article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
metaplastic breast cancer (mbc) is a rare malignancy characterized by the histologic presence of two or more cellular types, commonly a mixture of epithelial and mesenchymal components [16 ]. mbc represents 0.251% of breast cancers diagnosed annually [1, 7, 8 ]. due to its relative rarity and heterogeneous histologic presentation, the pathologic diagnosis of mbc is difficult. the world health organization (who) recognized mbc as a unique pathologic entity in 2000. since then, the incidence of mbc has risen, likely representing an increased recognition by pathologists [8, 9 ]. overall, greater than 70% of patients with mbc present with american joint committee on cancer (ajcc) stage ii or greater disease as compared to approximately 50% of patients with idc. compared to patients with idc, those with mbc have worse outcomes with 5-year survival rates ranging from 49% to 68% [1, 10, 11 ]. management of mbc has largely paralleled that of idc, despite growing evidence that mbc is a distinct entity that lies along the spectrum of basal - like breast cancers. this paper serves as a summation of current literature and approaches to the multimodality treatment of patients with mbc. the surgical treatment of mbc has largely paralleled that of idc. with the publication of nsabp b-06 trial results, the surgical approach to idc shifted from mastectomy to breast conservation therapy for appropriate patients. large tumors (5 cm) are a relative contraindication to breast conservation therapy and even less extensive tumors may preclude breast conservation in smaller - breasted patients. these guidelines are particularly important for mbc patients, as they typically present with larger tumors compared to their idc counterparts [8, 13 ]. as one might expect, relative to those with idc, a higher percentage of patients with mbc receive mastectomy rather than lumpectomy [8, 14 ]. despite the larger tumor size at presentation tseng and martinez found no difference in overall or disease - specific survival whether mbc patients were treated with mastectomy or lumpectomy, even after controlling for known prognostic factors. similarly, dave. found no difference in overall or disease - free survival between patients with mbc undergoing either modified radical mastectomy or breast conservation therapy. lymph node staging of patients with mbc is evolving, reflective of the changes in approach to axillary staging of patients with idc. however, sentinel lymph node biopsy (slnb) has largely replaced alnd due to lower associated morbidity with similar accuracy in the detection of regional metastasis. prior to the american college of surgeons oncology group (acosog) z0011 trial, all patients with a positive slnb subsequently went on to receive a completion alnd. however, based on the results of this trial, completion alnd may not be indicated in a select group of women with early stage breast cancers undergoing lumpectomy and subsequent whole breast radiation. therefore, data regarding the sensitivity and specificity of sentinel lymph node biopsy among mbc patients are unknown, as are data regarding the need for completion alnd for patients with sentinel lymph node metastasis. several studies have demonstrated lower rates of axillary lymph node involvement among patients with mbc relative to idc [8, 13 ]. pezzi. also demonstrated axillary lymph node metastases in 22% of those with mbc versus 34% of those with idc and further noted that nodal positivity was more common among the carcinosarcoma variant. despite this, beatty. demonstrated that slnb and alnd are used equally in patients with mbc relative to women with idc. showed that women with locally advanced mbc (i.e., primary tumors > 5 cm and/or four or more metastatic axillary nodes) who underwent postmastectomy radiation therapy had improved survival relative to those not receiving such radiation. because completion alnd is often the only way to document 4 lymph node metastases and because patients undergoing mastectomy were not included in the acosog z0011 trial, it would be prudent to recommend completion alnd for mbc patients undergoing mastectomy if they have documented sentinel lymph node metastasis. there are little data that standard breast cancer chemotherapy regimens utilized for idc are effective for women with mbc. compared to stage - matched women with idc, nevertheless, 33%86% of mbc patients receive chemotherapy and are, in fact, twice as likely to receive chemotherapy as similarly matched patients with idc [8, 11, 19 ]. single institution retrospective studies and genomic a report from the mayo clinic detailed 27 patients treated at their center over 20 years in which 33% received chemotherapy. ten different regimens were used, resulting in one partial response. this resistance to chemotherapies is likely a product of the complex genetic and nongenetic mechanisms within mbc that result in phenotypically diverse subclones and intratumoral heterogeneity. hormonal therapy is just as ineffective as chemotherapy, and generally has no role in the management of patients with mbc. there is a high incidence of hormone receptor negativity as well as lower her-2/neu overexpression in mbc. mbcs are often classified along the spectrum of basal - type breast cancers of which 7585% are triple negative (estrogen receptor, progesterone receptor, and her-2/neu overexpression negative) [21, 22 ]. patients with triple - negative mbc have poor 3-year disease - free survival compared to a similar group of triple - negative idc patients receiving identical chemotherapy regimens. variations in histologic types may partially account for the observed resistance to standard idc chemotherapeutic regimens as well as poorer survival. a study by tseng. included tumors with heterogeneous histologic diagnoses representing histologic subtypes including metaplastic carcinoma not otherwise specified, carcinosarcoma, malignant myoepithelioma, adenosquamous carcinoma, epithelial - myoepithelial, and adenocarcinoma with squamous / cartilaginous / and spindle cell metaplasia. [26 ], who subcategorized mbc into five types : matrix producing, spindle like, squamous with ductal origin, metaplastic with osteoclastic giant cells, and carcinosarcoma. in the analysis by tseng., carcinosarcoma was associated with both poorer overall survival (hr 1.52, ci 1.132.04, p = 0.005) and disease - specific survival (hr 1.63, ci 1.162.31, p = 0.005) in multivariate analysis. these findings likely reflect biological differences between the nonepithelial sarcomatous elements found in carcinosarcoma as compared to the nonepithelial components of the other histological variants. recent studies have investigated receptors that may potentially serve as novel targets for chemotherapy regimens. leibl and moinfar examined 20 different mbc samples (8 heterogeneous elements, 7 spindle cell, 4 carcinosarcoma, and 1 matrix - producing) with immunohistochemical staining for the four members of the egfr / her family. they found that 14 of the 20 samples were positive for her-1 whereas only 1 sample was positive for her-2, an inverse finding to that of idc. this would suggest that targeted protein kinase inhibitors such as gefitinib might be effective for some patients with mbc. likewise, other novel strategies have emerged to target the nonepithelial component of mbc tumors. one such strategy is the use of ifosfamide and etoposide for carcinosarcoma variants of mbc. hennessy., in an evaluation of sarcomatoid mbc patients treated at a single institution, reported no recurrence in the 3 patients that received doxorubicin and ifosfamide treatment. information regarding the role of adjuvant radiation therapy (rt) for the treatment of mbc is sparse [15, 25 ]. in a series of 43 patients with mbc, dave. total radiation consisted of 5066 gy with use of tangential fields and additional anteroposterior supraclavicular fields when regional nodes were treated. analysis utilizing the seer database suggested that adjuvant radiation improved both overall and disease - specific survival for all patients undergoing treatment for mbc, regardless of the type of operation performed (lumpectomy versus mastectomy). patients receiving rt demonstrated 36% and 26% decreases in death from any cause and breast - related mortality, respectively. results of multivariate analyses excluding patients with metastatic disease paralleled these findings, demonstrating 38% and 34% decreases in death from any cause and breast - related mortality, respectively. this is in accordance with a meta - analysis demonstrating that for prevention of local recurrences will improve overall and disease - specific survival. setting, rt is recommended to patients with four or more metastatic axillary nodes, large (5 cm) primary tumors and chest wall invasion [2729 ]. tseng. described mastectomy patients who had received rt demonstrating a 33% decreased risk of death from any cause. subgroup analysis of high and normal risk patients undergoing mastectomy demonstrated that specifically, patients undergoing mastectomy with tumors 5 cm or four or more metastatic axillary lymph nodes derived a 47% and 42% decreased risk of death from all - cause and breast - related mortality, respectively. patients undergoing mastectomy with tumors 5 cm and less than 4 metastatic axillary lymph nodes, however, derived no benefit from rt. this data would suggest that rt should be considered as a component of multimodality therapy for mbc patients undergoing mastectomy with these advanced features. due to its rarity and heterogeneity, there is no standard therapy for all patients with mbc. surgical treatment and axillary staging parallel that of idc with breast conservation therapy being appropriate for a select group of patients. traditional chemo- and hormonal therapies for idc are ineffective against mbc and often associated with poorer survival, while histology specific novel chemotherapeutic strategies may offer a survival advantage. targeted therapies based on individualized gene profiling, while promising for the future, are not commonly utilized. finally, adjuvant radiation, regardless of the type of surgery, clinical trials comparing standard therapies for idc in patients with mbc are needed, but are unlikely to be accomplished due to the rarity of the disease. | metaplastic breast cancer (mbc) is a malignancy characterized by the histologic presence of two or more cellular types, commonly a mixture of epithelial and mesenchymal components. mbc is rare relative to invasive ductal carcinoma (idc), representing less than 1% of all breast cancers. other than a lower rate of lymph node metastases, mbc tumors display poorer prognostic features relative to idc. due to its low incidence and pathological variability, the ideal treatment paradigm for mbc is unknown. because of its rarity, mbc has been treated as a variant of idc. despite similar treatment regimens, however, patients with mbc have worse outcomes. recent research is focused on biological differences between mbc and idc and potential novel targets for chemotherapeutic agents. this paper serves as a summation of current literature on approaches to the multidisciplinary treatment of patients with mbc. |
worldwide, tumours account for the majority of cases of large bowel obstruction with diverticular disease and volvulus accounting for the remainder. volvulus commonly affects the sigmoid, caecum and transverse colon in the decreasing order of frequency with caecal volvulus accounting for < 1% of causes of large bowel obstruction. additionally, the bascule subtype accounts for < 10% of cases presenting with caecal volvulus. we present the case of a 58-year - old patient who presented with symptoms of intestinal obstruction and had characteristic radiological findings of a caecal volvulus a 58-year - old female with a past medical history of a large intrathoracic hiatus hernia presented to her general practitioner and was subsequently referred to our surgical department with symptoms of sudden onset severe epigastric pain associated with vomiting and abdominal distension. her abdomen was generally tender, maximally in the epigastric region, although she was not peritonitic. the admission erect chest radiograph showed a large hiatus hernia and an elevated right hemidiaphragm with a large loop of distended bowel (fig. 1). subsequent computed tomography (ct) scan demonstrated an almost completely intrathoracic stomach with a degree of volvulus, and the liver medially displaced by a loop of large bowel felt to be caecum (fig. 2). since the patient remained otherwise well, bidirectional endoscopy was performed, and given that a volvulus point could not be identified and the ileocaecal junction was not identified, contrast studies were requested (figs 35) which demonstrated an incomplete obstruction caused by a volved caecum rotated anteriorly and cephalad. figure 1:erect chest radiograph, showing a large hiatus hernia and large loop of bowel elevating the right hemidiaphragm. figure 2:ct coronal section demonstrating caecum medially displacing the liver and causing an upward pressure on the right hemidiaphragm. figure 3:a large bowel contrast study showing the flow of contrast from the collapsed transverse colon into the dilated, upwardly displaced caecum. figure 4:coronal section of contrast - enhanced ct demonstrating contrast filling upwardly displaced caecum. figure 5:axial section of contrast - enhanced ct demonstrating whirl sign at the point of volvulus. erect chest radiograph, showing a large hiatus hernia and large loop of bowel elevating the right hemidiaphragm. ct coronal section demonstrating caecum medially displacing the liver and causing an upward pressure on the right hemidiaphragm. a large bowel contrast study showing the flow of contrast from the collapsed transverse colon into the dilated, upwardly displaced caecum after the contrast study partial resolution of symptoms occurred but given the development of free fluid in her contrast ct scan, the decision was taken to manage her surgically. a midline laparotomy was performed, with the finding of a freely mobile, grossly distended caecum flipped anteriorly over the ascending colon as demonstrated on her ct scan (fig. 6). additionally, there was no evidence of a gastric volvulus (suggesting partial twisting) and since her stomach was completely intra - abdominal, there was no need to address her hiatus hernia at that point in time. the patient was admitted to the high dependency unit post - operatively, made a good recovery and was discharged home within a week of surgery. caecal volvulus accounts for 1% of all causes of large bowel obstruction [1, 2 ]. the mechanism of caecal volvulus has been well documented and can be explained by the presence of an excessively mobile caecum or incomplete fixation of the ascending colon to the retroperitoneum during embryogenesis. additionally, caecal volvulus can be described as organoaxial (true caecal or caecocolic volvulus) or mesenteroaxial (caecal bascule). the latter describes the folding of the caecum anteriorly over the ascending colon and accounts for 10% of all caecal volvulus, while the former describes the twisting of the terminal ileum, caecum and ascending colon. interestingly, our patient had an incidental finding of a gastric volvulus on imaging, the aetiology most likely related to her large hiatus hernia, a known risk factor for gastric volvulus. the embryological theory as highlighted above for volvuli affecting the large bowel may also be applicable to the stomach. a review of 561 patients with caecal volvulus found that they commonly presented with symptoms of bowel obstruction abdominal pain, abdominal distension, constipation, nausea and vomiting. physical findings included abdominal distension, hyperperistalsis, peritoneal signs, abdominal mass and absent bowel sounds. it is reasonable to assume that patients with the bascule subtype may have intermittent subacute obstruction due to the flopping of the caecum back into its anatomical position. additionally, this subtype is less likely to strangulate as the mesentery is not frequently twisted when compared with the organoaxial subtype. risk factors commonly described for caecal volvulus include previous abdominal surgery, high fibre intake, chronic constipation and distal obstruction [57 ].. found that ct findings of whirl, ileocaecal twist, transition points, x marks the spot and split wall have high specificity for caecal volvulus. additionally, they found that the absence of distal colonic decompression made the diagnosis of caecal volvulus unlikely. diagnostic confusion may exist between sigmoid and caecal volvulus ; however, the location of the mesenteric twist (ct whirl sign) is highly accurate in distinguishing the two. swirling strands of soft tissue attenuation within a background of fat attenuation and gives the appearance of a hurricane on a map. barium enema has been historically used to confirm the presence of a volvulus, assess the distal colon and may also have a therapeutic effect. factors such as patient co - morbidities and the viability of the bowel should be taken into account when managing caecal volvulus. the authors agree that right hemicolectomy is associated with the lowest recurrence and complication rates compared with detorsion alone, detorsion and caecopexy and caecostomy. additional options when faced with non - viable bowel and where primary anastomosis is not suitable include ileostomy and mucus fistula. minimally invasive procedures may play a role in the management of patients without perforation or gangrenous bowel and provides a reasonable treatment option for this condition. | caecal volvulus is a rare cause of intestinal obstruction, with the bascule subtype accounting for < 10% of all cases of caecal volvulus. it is associated with significant morbidity and mortality if left undiagnosed. we present the case of a 58-year - old female who presented to our surgical department with symptoms of intestinal obstruction. she had various radiological investigations, which supported the diagnosis of a caecal volvulus of the bascule subtype. she was subsequently managed surgically and had a right hemicolectomy and ileocolic anastomosis. her recovery was uneventful and she was discharged within 1 week of having her operation. fortunately, caecal volvulus of the bascule subtype is rarely encountered ; however, clinicians need to be aware of its presentation and subsequent management options so that clinical outcomes are improved. |
budd - chiari syndrome (bcs) is a hepatic venous outflow obstruction at any level from the small hepatic veins to the junction of the inferior vena cava (ivc) and the right atrium. thrombosis of the hepatic veins is the most common cause of bcs in western countries, whereas membranous obstruction of the ivc or the hepatic veins is more common in eastern countries.12 patients with hepatic vein occlusion may present with symptoms and signs of portal hypertension, including ascites, hepatomegaly, splenomegaly, and progressive liver dysfunction.3 as most of the significant symptoms and signs in patients with bcs are associated with portal hypertension, treatment is usually intended to relieve portal hypertension. the anatomy of the hepatic veins is complex and distorted during progression of bcs ; thus, it is not practical to surgically reconstruct the veins. portal diversion treatment, such as side - to - side portocaval, mesocaval, and mesoatrial shunts, have been used, but these surgical methods are also associated with many serious complications. along with advances in radiological intervention technology, recanalization of occluded major hepatic veins or the ivc facilitates hepatic venous outflow drainage ; thus, hepatic congestion is relieved and portal pressure decreases, which is beneficial for recovery of liver function.45 endovascular stenting is currently accepted as an alternative effective treatment for bcs when liver transplantation (lt) is unavailable. we herein present a case of successful endovascular treatment performed in a patient with gradually deteriorating bcs. a 46-year - old woman was followed up for 10 years after a bcs diagnosis (fig. she was referred to us for lt due to progressive liver cirrhosis and deteriorated liver function. as a liver donor was unavailable, the patient underwent endovascular stenting of the ivc for palliation. an abdominal computed tomography (ct) scan showed hepatomegaly and ascites, and gastrointestinal endoscopy revealed esophageal varices. three main hepatic veins were thrombosed with complete occlusion of the suprahepatic ivc ; thus, hepatic venous blood flow was draining into the inferior right hepatic vein through the intrahepatic collaterals and passing through the subcutaneous venous collaterals (fig. she was placed on the lt waiting list due to progressive liver cirrhosis and deteriorating liver function, but there was little possibility of deceased organ allocation considering the preserved status of liver function, and no living donor was available. a septoplasty needle was passed through the occluded ivc into the internal jugular vein and femoral vein using a snare wire. severe elastic recoil (> 90%) was observed after balloon dilatation ; thus, a 2880-mm stent was inserted across the occluded area, and repeat double ballooning was performed. 3). she began to lose body weight 1 day after stenting, and the edema disappeared within the first week. a follow - up ct scan showed that the stented ivc was fully patent (fig. 4a), but intrahepatic collateral flow was draining through the right inferior hepatic vein with spontaneous closure of subcutaneous collateral veins (fig. anticoagulation (warfarin) and anti - platelet therapy (aspirin) was started 4 days after stenting to minimize the risk of thrombotic occlusion of the ivc stent. she was doing well at the 6-month follow - up visit, with nearly normal liver function (total bilirubin, 0.9 mg / dl and platelet count, 77,000/mm) and marked resolution of subcutaneous venous engorgement. one is hepatic vein thrombosis, which is often associated with various coagulation defects and disorders.67 the other is membranous obstruction of hepatic veins or the ivc.6 this latter cause is more common in eastern countries and may be congenital in origin. endovascular treatment is the main therapeutic choice with advances in interventional technology.48 a transjugular intrahepatic portosystemic shunt (tips) is currently the most common intervention for patients with bcs in western countries because obstruction of the hepatic veins is usually extensive.89 a tips often effectively relieves portal pressure in patients with liver cirrhosis as well as those with bcs, but its indication is limited, particularly in patients with advanced liver cirrhosis. balloon dilatation or stent insertion can be attempted to recanalize the hepatic venous outflow pathways, when the lumen of a hepatic vein or the ivc is partially maintained. it is important to pass the occluded area successfully when performing an endovascular intervention because this area may already be completely obliterated. in this present case, the ivc segment around the drainage for the main hepatic vein was completely occluded ; thus, a rendezvous technique was applied after passing from internal jugular vein access and capturing the wire from femoral vein access. interventional treatment is a safe and effective way to treat bcs.10 hepatic venous pressure can drop 25 - 50% after successful endovascular stenting in patients with bcs, and the 5-year survival rate in patients with mild disease and preserved liver function can be as high as 100%. survival rates for patients with progressing bcs are about 85% (65 - 100%) at 1 year and 77% (53 - 100%) at 5 years.1112 the common complications of endovascular treatment for bcs include hepatic encephalopathy, bleeding into the abdominal cavity or biliary tract bleeding, and hepatic artery injury, among others. the reported overall incidence of complications is < 3%, and mortality rate is about 1%.13 the incidences of restenosis after balloon expansion and stenting of hepatic veins are 10 - 20% and 10%, respectively.11 as the ivc and major hepatic veins are high - flow medium - velocity vessels, anticoagulation therapy is not indicated when using a wire - wall stent. newly formed endothelium will cover the thrombogenic surface of the stent material within 2 - 3 weeks. the primary reason why we administered anticoagulant and antiplatelet agents was due to the risk of restenosis because mechanical factors are the most critical for thrombogenesis based on hemodynamics principles. collaterals commonly develop in patients with bcs, and these collaterals play an important role in the clinical manifestation of bcs. the rationale of " early diagnosis and early treatment " is not suitable for all patients with bcs. satisfactory survival can be achieved in patients who are completely compensated by rich collaterals without invasive treatment. nevertheless, a beneficial treatment procedure should be performed if the patient 's conditions worsens at follow - up visits.14 in conclusion, endovascular stenting appears to be an effective treatment to alleviate portal pressure and prevent bcs - associated complications ; thus, endovascular stenting should be considered before marked stenosis or complete occlusion occurs in patients with bcs. | endovascular stenting is accepted as an effective treatment for patients with budd - chiari syndrome (bcs). we herein present a case of successful endovascular treatment. a 46-year - old woman, who was followed up for 10 years after a diagnosis of bcs, showed progression progressive of liver cirrhosis and deterioration deteriorated of liver function. three main hepatic veins were thrombosed with complete occlusion of the suprahepatic of the inferior vena cava (ivc) ; thus, hepatic venous blood flow was draining into the inferior right hepatic veins through the intrahepatic collaterals and passed passing through the subcutaneous venous collaterals. she underwent endovascular stenting of the ivc for palliation. a septoplasty needle was passed through the occluded ivc through into the internal jugular vein access and then to access the femoral vein using a snare wire. severe elastic recoiling was observed after balloon dilatation ; thus, a 2880 mm stenting was done inserted across the occlusion, and repeat double ballooning was performed. the final venogram shows showed restored ivc inflow. the patient began to lose body weight 1 day after stenting, and edema disappeared within 1 week. she is was doing well at the 6 month follow - up visit with nearly normal liver function and marked resolution of cutaneous venous engorgement. in conclusion, endovascular stenting appeared to be an effective treatment to alleviate portal pressure and to prevent bcs - associated complications ; thus, endovascular stenting should be considered before marked hepatic vein stenosis or complete occlusion occurs in patients with bcs. |
recent studies have revealed an association between lower pre - dialysis serum sodium levels and increased all - cause and cardiovascular mortality in haemodialysis (hd) patients [1, 2 ]. in these studies, hyponatraemia was also associated with low serum albumin, low body mass index and high interdialytic weight gain. protein energy wasting and malnutrition are common in patients with chronic kidney disease stage 5. it has been found to be present in 3040% of patients and has been associated with increased cardiovascular mortality and in particular sudden cardiac death in dialysis patients. nutritional status is best assessed using a combination of measures on a regular basis as recommended by national guidelines. upper arm anthropometry measurements, handgrip strength (hgs) and subjective global assessment (sga) are clinically useful measures of nutritional status and better surrogates of malnutrition and protein energy wasting compared with body mass index in maintenance hd patients as they are independent of hydration status. though protein energy malnutrition and hyponatraemia are both related to low - grade systemic inflammation, the association between them has not been investigated. the aim of our study was to investigate the relationship between serum na levels and protein energy wasting as measured by upper arm anthropometry, hgs and sga in a cohort of hd patients. we studied 182 hd patients treated across dialysis units affiliated with st george 's healthcare nhs trust and had a nutritional assessment completed (sga, mac, tsf, hgs) in 2010 and/or 2011. all subjects received 4-h bicarbonate - based dialysis treatment thrice weekly according to the local protocols and national guidelines and had been established with hd for 6 months. it comprises six assessments, three based on body weight change, food intake and gastrointestinal symptoms, and three based on physical assessments looking at muscle mass, subcutaneous fat and presence of oedema. an overall subjective score is given for each patient (between 1 and 7 : score 12 = severe malnutrition, 35 = mild to moderate malnutrition and 67 = normal nutritional state to mild malnutrition). a single mid - upper arm circumference (mac) the lateral part of the upper arm was marked at the midpoint between the acromion process and the end of the humerus. the tricep skinfold thickness was measured by pinching the fold of skin and subcutaneous tissue (without underlying muscle) formed over the tricep muscle with the thumb and index finger at the mid - point of the upper arm. the mid - arm muscle circumference (mamc) was derived from mac and tsf as follows : mamc (cm) = mac (cm) 3.14 tsf (cm). techniques used for these two measurements were carried out according to bishop. as recommended by the british dietetic association. the subjects were instructed to apply as much handgrip pressure as possible using the non - fistula hand. sga and anthropometry measurements were taken by the same dietitian. to test the standardization and reliability of the anthropometric measurements fair to good accuracy for arm circumference and skinfold measurements and this was achieved. idwg was defined as the difference between the pre - dialytic weight and weight at the end of the previous dialysis session. weight and blood pressure data were averaged from three consecutive dialysis session starting from the beginning of the week closest to the anthropometric measurements. pre - dialysis serum sodium values from routine monthly laboratory measurements were averaged for 6 months prior to the measurement. serum c - reactive protein (crp) and serum albumin were measured from the closest to the anthropometric measurements pre - dialysis routine bloods. patients on antidiabetic medications or with fasting plasma glucose 7.0 mmol / l and/or a1c 6.5% (48 mmol / mol) were classified as diabetics. the t - test (two sided, independent) was used for comparison of numerical means and chi - square test was used for comparison of categorical values ; p 136.2 meq / lp - valueserum na (meq / l)134.1 1.8137.7 1.2n / afemales (% of n)48320.023age68.5 12.964.5 15.20.046diabetes (% of n)35.928.60.300mamc (cm)23.50 3.1624.58 3.710.048handgrip strength(kg)21.7 13.628.0 (kg)71.8 14.075.0 16.30.220pre - hd sbp147.2 44142.3 20.70.367post - hd sbp139.2 33.5135.3 24.20.437pre - hd dbp67.9 13.469.6 11.10.427post - hd dbp63.3 16.265 12.40.335idwg (kg)2.0 1.21.64 2.00.022idwg%2.88 1.692.21 1.190.007albumin (g / l)31.65 4.7332.25 3.910.022crp (mg / l)24.06 45.5120.34 36.940.576data are expressed as means sd for numerical values.dbp, diastolic blood pressure ; hd, haemodialysis ; idwg, interdialytic weight gain ; idwg%, idwg / dry weight, kg (kilograms) ; mac, mid - arm circumference (cm) ; mamc, mid - arm muscle circumference, mac (cm) 3.14 tsf (cm) ; n, number of subjects ; sga, subjective global assessment ; n / a, not applicable ; sbp, systolic blood pressure ; tsf, triceps skinfold thickness (cm). comparison between clinical and anthropometric parameters according to serum na ; dichotomized data according to mean pre - dialysis serum na (136.2 meq / l) data are expressed as means sd for numerical values. dbp, diastolic blood pressure ; hd, haemodialysis ; idwg, interdialytic weight gain ; idwg%, idwg / dry weight, kg (kilograms) ; mac, mid - arm circumference (cm) ; mamc, mid - arm muscle circumference, mac (cm) 3.14 tsf (cm) ; n, number of subjects ; sga, subjective global assessment ; n / a, not applicable ; sbp, systolic blood pressure ; tsf, triceps skinfold thickness (cm). pre - dialysis serum na correlated positively with mamc, handgrip and sga (pearson correlation r = 0.165, p = 0.031, r = 0.237, p = 0.022 and r = 0.195, p = 0.011, respectively) but did not correlate with crp or serum albumin. scatterplots of correlations between pre - dialysis serum na and mamc and pre - dialysis serum na and handgrip strength are shown in figure 1. after controlling for crp, the correlation persisted for sga (r= 0.272, p = 0.045) but not for mamc and handgrip. after controlling for age, sex and the presence of diabetes mellitus the correlation persisted for sga (r = 0.315, p = 0.015) but not for mamc and handgrip. fig. 1.scatter diagram showing the relationship between pre - dialysis serum na (meq / l) and mid - arm muscle circumference (mamc) (a, left panel) and between pre - dialysis serum na (meq / l) and handgrip strength (kg) (b, right panel). 2.scatter diagram showing the relationship between pre - dialysis serum albumin (g / l) and mid - arm muscle circumference (mamc) (cm). plotted regression line with its 95% confidence intervals. scatter diagram showing the relationship between pre - dialysis serum na (meq / l) and mid - arm muscle circumference (mamc) (a, left panel) and between pre - dialysis serum na (meq / l) and handgrip strength (kg) (b, right panel). scatter diagram showing the relationship between pre - dialysis serum albumin (g / l) and mid - arm muscle circumference (mamc) (cm). plotted regression line with its 95% confidence intervals. serum albumin correlated positively with mamc (figure 2), handgrip and sga (r= 0.254, p = 0.001, r= 0.283, p = 0.010 and r= 0.0194, p = 0.016, respectively) and inversely with crp (r= 0.363, p = 0.000). this study demonstrates a positive association between low serum sodium and decreased lean body mass. we also showed that there is an inverse relationship between serum sodium and interdialytic weight gains. different possible mechanisms can explain the observed association between hyponatraemia and muscle wasting in dialysis patients. inflammation is a potential common pathogenetic pathway for the development of protein energy wasting and hyponatraemia. inflammatory signalling in the hypothalamus has been suggested to mediate wasting in chronic diseases associated with low grade inflammation. on the other hand hyponatraemia is a common finding in inflammation ; an interaction between interleukin-6 and vasopressin - induced antidiuresis has been suggested as the underlying mechanism based on animal experimental data. however, it should be highlighted that this mechanism can not explain inflammatory hyponatraemia in hd patients as they are largely anuric and antiduresis can not induce hyponatraemia. homeostasis of serum sodium in dialysis patients is primarily regulated by the mechanism of thirst. a potential simultaneous inflammatory activation of the hypothalamic receptors that control thirst can be assumed as a cause of hyponatraemia in these patients. however, elucidating the potential link between inflammation and hyponatraemia in dialysis patients is challenging as many additional factors may affect the serum sodium levels. our observations were limited to a small cohort of patients and although serum albumin was lower in the group of patients with lower sodium levels, the difference in crp levels did not reach statistical significance and we did not find a direct correlation between na and crp or albumin in the total study population. angiotensin ii receptors type 1 are expressed in skeletal muscle and regulate its function, whereas elevated angiotensin ii levels have been implicated in skeletal muscle atrophy. on the other hand the primary role of thirst in achieving na homeostasis in hd patients is clinically important. although compliance with a strict low - salt diet and reduced interdialytic fluid intake is of paramount importance in hd patients, a dysregulation of na homeostasis may pose a challenge in achieving targets in a subgroup of malnourished and inflamed patients, or even lead to iatrogenic large interdialytic weight gain due to the large gradient between serum and dialysate na. large interdialytic weight gain is not a uniform phenomenon and can represent two opposite ends of the spectrum of inflammation malnutrition syndrome : cachectic inflamed subjects with associated hyponatraemia on one side and well - nourished patients with high - salt intake between dialysis treatments patients. this heterogeneity associated with large interdialytic weight gain explains the discrepancy between studies examining the relationship between idwg and nutritional status [1820 ]. pre - dialysis serum sodium can help differentiate between these two different groups of patients and identify the subgroup of patients where dietary changes are more likely to be effective. the emerging role of serum sodium in mortality and interdialytic weight gains has added one more level uncertainty to the relationship between interdialytic weight gain and mortality. it has been suggested that large interdialytic weight gain has a causal role in increasing cardiovascular mortality due to the resulting cardiovascular stress with a mechanism similar to heart failure but recent studies have shown that the association between idwg and cardiovascular mortality does not persist after adjusting for pre - dialysis serum na while reducing the idwg by decreasing the sodium in the dialysate has not been proven effective in improving the outcomes and has even been associated with increased risk of adverse outcomes in retrospective epidemiological studies. however, to our knowledge, there are no prospective controlled data assessing the value of adjusting the na dialysate to minimize idwg in hyponatraemic patients. large idwg may represent an epihenomenon of an underlying inflammatory condition that manifests amongst others with hypothalamic inflammation, protein energy wasting and hyponatraemia. our study was not prospectively controlled and our sample was not sufficient to investigate the relationship between serum sodium and inflammation. in addition our analysis was limited to routinely collected laboratory parameters and we did not measure more sensitive markers of inflammation. secondly, not all of our patients underwent a nutritional assessment (patients not giving consent, patients unstable or due to language barrier) and within the assessed patients we did not have sga and handgrip data for every patient. hgs measurements may not be possible for other reasons affecting the dexterity of the hand needed for the movement other than forearm muscle strength such as hand arthritis and neuropathic pain. patients with poor compliance to medical treatment are more likely to decline nutritional assessment and this may introduce selection bias in the analysed population. finally, we used anthropometric data but did not perform bioelectrical impedance analysis and dual energy x - ray absorptiometry which are considered more accurate methods for the determination of body composition. our study was not prospectively controlled and our sample was not sufficient to investigate the relationship between serum sodium and inflammation. in addition our analysis was limited to routinely collected laboratory parameters and we did not measure more sensitive markers of inflammation. secondly, not all of our patients underwent a nutritional assessment (patients not giving consent, patients unstable or due to language barrier) and within the assessed patients we did not have sga and handgrip data for every patient. hgs measurements may not be possible for other reasons affecting the dexterity of the hand needed for the movement other than forearm muscle strength such as hand arthritis and neuropathic pain. patients with poor compliance to medical treatment are more likely to decline nutritional assessment and this may introduce selection bias in the analysed population. finally, we used anthropometric data but did not perform bioelectrical impedance analysis and dual energy x - ray absorptiometry which are considered more accurate methods for the determination of body composition. this is the first study to our knowledge to associate serum sodium with practical, broadly used and well - validated anthropometric measures of lean body mass. | backgroundlow serum sodium (na) has been associated with decreased body mass index and increased cardiovascular mortality in haemodialysis (hd) patients. we examined the relationship between serum na and selected nutritional parameters of protein energy wasting that are not affected from the hydration status in a cohort of hd patients.methodstriceps skinfold thickness (tsf), mid - arm circumference (mac), mid - arm muscle circumference (mamc), handgrip strength (hgs) and subjective global assessment (sga) were assessed in maintenance hd patients using standard techniques. mamc was calculated with the formula mamc (cm) = mac (cm) 3.142 tsf cm. pre - dialysis serum na values from routine monthly laboratory measurements were averaged for the last 6 months prior to the nutritional assessment.resultsaltogether 172 patients with anthropometric data were included in the final analysis. mean age was 66 14, females 62 (36%) and diabetics 48 (28.9%). patients with pre - dialysis serum na below the mean value (136.2 meq / l) had lower mamc, hgs, sga scores and albumin levels (23.50 3.16 cm versus 24.58 3.71 cm, p = 0.048 ; 21.7 13.6 kg versus 28.0 12.4 kg, p = 0.030 ; 5.1 1.2 versus 5.7 1.0, p = 0.012 and 31.65 4.73 mg / l versus 32.25 3.91 mg / l, p = 0.022, respectively) and higher interdialytic weight gains. pre - dialysis serum na correlated positively with mamc, handgrip and sga (pearson 's correlation r = 0.165, p = 0.031, r = 0.237, p = 0.022 and r = 0.195, p = 0.011, respectively).conclusionthis study demonstrates that low serum sodium is associated with protein energy wasting and increased interdialytic weight gain in hd patients. |
elearning is concerned with the learning activities, resource access, communication, and assessment undertaken in an online environment. this type of learning environment normally uses a range of information and communication technologies (icts) accessible via computer or mobile devices. the purpose of this study was to explore the attitudes of health professional educators (hpes) toward their use of ict, in general, and within their educational practice, in particular. ict, within this paper, refers to the technologies used in elearning, hpes are health care practitioners who undertake the role of teacher for their professional peers, students in preregistration courses, or patients. hpes facilitate learning for practice, from practice, and in practice within clinical, community, professional organization, or higher education contexts. a key role of hpes, in facilitating learning and professional development, is their modeling of good professional practice1 including using ict.2,3 systematic reviews of research literature on elearning and web - based learning in health professional education reveal a focus on the strategies and tools of elearning used by hpes and learning outcomes achieved through elearning.4,5 button recent review of the literature of elearning and ict in nursing education identified issues relevant to elearning for nursing educators. these issues, however, emphasized knowledge or skill development, rather than attitudes, which were of concern to educators, such as the time for elearning resource development and facilitation and the need for elearning ict skills training. studies that address the affective areas of elearning in health professional education tend to focus on participants attitudes to ict711 or their satisfaction with the elearning experience.12,13 childs conducted a systematic review of the health professional education literature to identify the barriers and solutions to elearning for health professionals and students. the findings of this review identified institutional, management, learner, and hpe issues. the attitudinal issues of hpes to elearning included resistance to change, poor motivation, fear, anxiety, and low confidence with computers. confidence in being able to successfully complete learning tasks has an important role in learner achievement.15 we might expect, therefore, that hpes learning to use ict within elearning will also depend on their sense of confidence with ict. coopers16 study found that intrinsic motivation and satisfaction with elearning were the primary incentives for educators in higher education. this internal source of motivation suggests that an internal locus of control supports hpes confidence in learning to use ict within elearning. in this sense, locus of control refers to the extent to which people believe that they are in control of events that occur in their environment.17 people with an internal locus of control are more likely to believe that their own actions can affect environmental events, including their learning achievement.18 conversely, people with an external locus of control are more likely to feel acted upon or controlled by their environment. wishart and ward19 found that a feeling of being in control of ict, rather than being controlled by it, was linked with nursing students being less fearful of the technology. this suggests that the role of locus on control in an elearning environment may also apply to hpes who grapple with their motivation and confidence with elearning ict. the influence of educator attitudes toward the use of ict in elearning on learner satisfaction with elearning is demonstrated by previous studies.2023 this signifies the important role that hpes play in enabling opportunities for learner development, through elearning, of thinking skills and self - efficacy with ict that are transferable to professional practice settings.24,25 the relationship between attitudes and behaviors has long been recognized as complex.26 nevertheless, encouraging hpes to adopt the desired behaviors of using ict in their educational practice requires that they develop their intention to act in the desired way.7 this intention to act is influenced by the attitudes toward the use of ict in elearning practice that hpes develop. therefore, hpes attitudes to ict for educational practice might be influenced by their exposure to, and expected use of, ict in their professional contexts with different ict requirements, such as educational or clinical contexts.27 accordingly, we sought information to identify factors and their degree of influence, which may contribute to hpe attitudes toward to ict in elearning. this study was conducted at a major metropolitan australian university that has a diverse range of undergraduate and postgraduate health professional disciplinary degrees. health professional education, a major postgraduate degree stream, enrolled hpes from a variety of health disciplines. the postgraduate health professional education course consisted of four mandatory subjects, two of which were delivered using online learning with a suite of elective subjects. each subject equated to approximately 120 hours of learning, and the mandatory subjects were conducted within the same year prior to the elective components. the content of each subject offered via elearning was related to health professional education pedagogy (clinical teaching and supervision and simulation - based learning for hpes) with an emphasis on the incorporation of ict into health professional education. students enrolled in these subjects were required to complete a range of online learning activities and assignments which necessitated substantial engagement with ict. these elearning activities included viewing online videos and documents, sharing ideas by communicating in discussion forums, creating blended media online presentations, and submitting written assignments online. students were encouraged to use a range of ict devices including computers, smart phones, and tablets to get access to and complete the elearning activities. in this way, all students enrolled in these two subjects were exposed to learning about health professional education within ict - rich elearning environments. prior to undertaking the study, we determined the sample size on the assumption that the study would provide 80% power with a type one error of 5%, an attrition rate of 5%, and 5% for the adjustment for covariates. all participants were enrolled at different stages of their degrees ; however, all had completed at least two subjects which were conducted in face - to - face modality prior to undertaking the subject via elearning. we only included participants without prior elearning exposure during their studies to ascertain the effect of elearning with the subjects. if participants completed both online subjects, data were analyzed only from the first subject studied by the participants. due to incomplete surveys and students withdrawing from the subject, n=52 participants completed the study (table 1). ethical approval was granted by the human research ethics committee of the university, and all participants consented to the study prior to the commencement of the subjects. participants completed a questionnaire related to ict attitudes, experiences, and knowledge and confidence with ict. participants were required to complete the prequestionnaires within the first 2 weeks of the semester and the postquestionnaires within 2 weeks of subject completion. the information technology attitude scales for health (itash)28 was developed previously to ascertain health professionals attitudes toward ict. the questionnaire was validated in 151 health professionals, but none were identified as hpes. it consists of three subscales, efficiency of care (a) ; education, training, and development (b) ; and the control scale (c), which show robust reliability (cronbach s alpha scores : 0.88, 0.70, 0.77 for the three subscales, respectively) and construct validity established previously.28 the efficiency of care subscale explored health professionals attitudes to ict improving health care while the education, training, and development subscale related to the amount and quality of ict education and training the health professional received ; and the control subscale was indicative of the health professionals sense of control over ict. the control subscale addressed the extent to which hpes felt that they were in control of their own ability to use ict. the subscales were contextualized for the hpe and the health professional education domain (table 2). all descriptive statistics were reported as means, standard deviations, and ranges, where applicable. cronbach s alphas were calculated to quantify internal consistency, with scores 0.7 considered satisfactory.29 when considering the entire data set, the pre-, postsubject itash subscale aggregated scores (efficiency of care [a ] ; education, training, and development [b ] ; and control scale [c ]) were analyzed using paired student s t - tests. as this study was exploratory, we sought to determine if relationships between the independent variables (age groups, health professional discipline, hours of ict usage, and time) and the dependent variables (change in itash subscales and self - reported confidence) existed. this was based on previous research, which has shown age and discipline to impact on health professionals attitudes to ict.11,30,31 student t - tests were used to determine the effect of age (0.05). the cronbach s alpha for the itash subscales a, b, and c were 0.7, 0.7, and 0.8, respectively, indicating that the scale had strong internal consistency (table 2). generally, desktop or laptop computers were the most prevalent, with over 75% of participants regularly using a smartphone. participants reported significant increases in overall confidence during the online subject (p0.05) (table 3). however, itash control (c) subscale, indicative of the participant s sense of ict control, significantly declined during the subject, suggesting that despite an increase in overall ict confidence, the participants did not feel that they were in control of ict when related to health professional education (p=0.002). there were no statistical differences between the independent variable of age groups and different health disciplines and the dependent variables (itash subscale change and self - reported overall confidence ; p>0.05). there were significant negative correlations between the amount of time engaged with ict devices and itash control (c) subscale and positive correlations for self - reported overall confidence (p=0.002 and p=0.001, respectively) (table 4). the main findings from the study reveal that hpes do not feel in control of ict educational capacity despite reporting an increase in confidence in ict usage. first, health care professionals are increasingly required to engage in ict within health care settings, and hpes need to be confident and in control in their ict usage to support their educational endeavors. this study demonstrates that when hpes engage in elearning related to health professional pedagogy, they feel less in control. second, confidence per se does not assist with improving attitudes to ict, especially as related to usage and value of ict for elearning. the improvement in hpes confidence in using ict as a result of their learning experience is consistent with research into the effects of training on ict user confidence.32,33 the concurrent decrease in the sense of user control of ict suggests that hpes confidence in using ict for their own learning may not necessarily result in the integration of ict into their pedagogical practices. attitudes toward learning to use ict, in general, and attitudes toward using ict within health professional education practice appear to be distinct issues. further research is required to shed light on how both of these attitudinal areas may need to be addressed in the preparation of hpes. this study found that there were no significant differences in attitudes between age groups or between health care discipline groups. this contrasts with others exploring the attitudes of health care professionals to ict.11,30,31 this may be because different health care disciplines may have different needs in their use of ict for professional health care practice.34 health professional roles, therefore, direct how ict is used to perform those roles. in contrast, the educational roles of planning, resource development, implementation, and facilitation of learning, assessment of learning, and program evaluation are common to all educational environments, regardless of the health care discipline. consequently, there is likely to be less difference in attitudes toward ict for educational purposes across hpes from different disciplines. we found that the time spent engaging with ict devices was related to ict confidence and a decrease in user control. the ownership and confidence in using ict devices of the participants in this study were similar to previous research,35 demonstrating that our cohort was representative of health professionals (figure 1). increased confidence in using ict appears to be a logical consequence of the more time they spent using ict devices. however, ict device engagement was negatively correlated with hpes sense of control of ict in general, not just with ict devices. this suggests that exposing hpes to more ict devices may not be sufficient for hpes to improve their sense of control over ict. instead, hpes may need to develop a better general understanding of ict and explore fewer devices in depth, particularly in terms of their use for learning and teaching. this is also recommended by skiba.3 developing a better general understanding of ict for elearning may improve their sense of control of ict for elearning. the hpe as expert self - concept may be undermined by a low sense of ict control. this suggests that a sense of ict control may be related to individual intrinsic properties rather than discipline - specific engagement. the hpes in this study experienced the use of ict to learn content related to the design and practice of clinical teaching and supervision and clinical simulation, including embedding ict into their elearning practices. the difference in confidence with using ict and the sense of user control of ict as a result of the learning experience suggests that hpes may not have been able to manage the cognitive load36 required by the content and learning experience. consequently, hpes may have responded by adopting a multifaceted approach to learning,37 implementing a deeper approach to learning of subject content and a more surface approach to the elearning use of ict. further research is required to explore the relationships between cognitive load, approach to learning, and attitudes to ict adopted by hpes within similar ict - embedded elearning environments. in this way, hpes may have experience in incorporating ict into their educational repertoire and improve their sense of ict control. metacognition is a significant component of the cognitive load requirements for hpes engaged in the elearning environments within this study.38 thinking about how their own ict - embedded elearning experience assisted them to develop the declarative and procedural knowledge39 of the subject content may enable hpes to synthesize better their knowledge and attitudes toward the use of ict within health care professional education. to date, exploration of the relationships between metacognitive ability and attitudinal development of hpes in relation to the use of ict in health care professional education has not been examined and warrants further study. the distribution of different health professional disciplines, however, may have had an impact on the findings despite the numerical distribution of disciplines indicative of clinical environments. participants in this study were hpes enrolled in subjects concerned with educational practice relevant to health care professional education. this may have an impact on the external validity of the current findings to hpes in nonstudent roles. we undertook a power analysis and determined sample size prior to the study. the distribution of different health professional disciplines, however, may have had an impact on the findings despite the numerical distribution of disciplines indicative of clinical environments. participants in this study were hpes enrolled in subjects concerned with educational practice relevant to health care professional education. this may have an impact on the external validity of the current findings to hpes in nonstudent roles. this study shows that hpes attitudes to ict for elearning are improved in terms of their confidence with ict, but not their sense of control, when exposed to an elearning environment specifically designed to address ict - embedded pedagogy for learning about health care professional educational issues. further research is needed to investigate issues, such as cognitive load and metacognition, which may have an impact on hpes sense of control in their use of ict in their educator roles. | backgroundthe use of information and communication technology (ict) in health professional education is increasing rapidly. health professional educators need to be responsive to health professionals information and communication technological needs ; however, there is a paucity of information about educators attitudes to, and capabilities with, ict.methodsfifty-two health professional educators, enrolled in health professional education postgraduate studies, participated in an online subject with specific elearning components requiring the use of ict. they completed a pre- and postquestionnaire pertaining to ict attitudes, confidence, and usage.resultsparticipants reported significant increases in overall ict confidence during the subject despite it being high at baseline (mean : 7.0 out of 10 ; p=0.02). even with increased ict confidence, there were decreases in the participants sense of ict control when related to health professional education (p=0.002) ; whereas, the amount of time participants engaged with ict devices was negatively correlated with the sense of ict control (p=0.002). the effect of age and health discipline on ict attitudes and confidence was not significant (p>0.05).conclusionthis study reports that health professional educators have perceptual deficits toward ict. the impact of elearning increased confidence in ict but caused a reduction in participants sense of control of ict. health professional educators require more ict training and support to facilitate better ict integration in health professional education settings. |
highly charged (trivalent and tetravalent) metal ions are of great interest in both supramolecular, biomolecular, and rare - earth chemistry. some of these serve as the coordination center that performs structural, catalytic, or electron - transfer functions, while others are well - known biotoxins. for example, iron sulfur clusters have biochemical functions involving the respiration and photosynthesis processes. lanthanide series elements have attracted significant attention due to their specific electromagnetic and optical characteristics. their complexes serve as luminescent probes because of their large stokes shifts and emission lifetimes. the actinide series elements, such as th, u, and pu, are well known for their radioactivity. all of these can form highly charged metal ions, which pose a major challenge to computational modeling. indeed, effective and accurate modeling of these ions will give insight into separation and recycling process aimed at reducing their harmfulness to the environment. there are several theoretical methods to model metal ions : quantum mechanics (qm), molecular mechanics (mm), and the hybrid qm / mm method. classical force fields, which use an analytical function to represent the relationship between the energy and configuration of a system, have a significant speed advantage over the quantum - based methods. it is the state - of - the - art tool to study systems at the molecular level when combined with molecular dynamics or monte carlo methods. for metal ions, there are several widely used models including the bonded model, nonbonded model, and cationic dummy model. the bonded model represents the interaction between the ion and its surrounding residues via the bond, angle, torsion, coulombic, and van der waals (vdw) terms. because of the harmonic approximation used in the bonded model, it does not simulate the processes involving chemical bond formation and dissociation. the nonbonded model usually places an integer charge on the metal ion and only uses the coulombic and vdw terms to represent the intermolecular interactions between the metal ion and surrounding particles. this simplification can result in a notable underestimation for modeling systems with strong covalent bonds. the dummy cationic model places the charge between the metal ions and the ligating atoms to mimic the covalent bond. besides the models previously discussed, there are also some polarizable force fields that have been developed for metal ions in recent years. even though more accurate models exist, the 12 - 6 lennard - jones nonbonded model is widely used due to its simple form, computational efficiency, and excellent transferability characteristics. however, in previous research, we found that the 12 - 6 lennard - jones (lj) nonbonded model could not reproduce several experimental properties across a series of divalent metal ions due to the neglect of the ion - induced dipole interaction. for the divalent metal ions, on average, there is a 50 kcal / mol underestimation for the hydration free energy (hfe) if we want to reproduce the experimental ion oxygen distance (iod) values, while there is 0.27 reduction for the iod values if we reproduce the experimental hfe values. in light of this, we proposed a 12 - 6 - 4 lj - type nonbonded model to account for the charge - induced dipole interaction. after picking suitable parameters, it was demonstrated that it was possible to reproduce the experimental hfe, iod, and coordination number (cn) values simultaneously for a series of divalent metal ions. furthermore, it was shown the new nonbonded model was readily transferable to mixed systems such as salt solutions and nucleic acid systems. in the present work, we have estimated the 12 - 6 lj parameters for 24 highly charged metal ions (18 m(iii) ions and 6 m(iv) ions) for three widely used water models (tip3p, spc / e, and tip4pew), respectively. this illustrated that the 12 - 6 lj nonbonded model has a much larger underestimation of the ion water interactions for the highly charged ions than for the mono and dications. we next parametrized the 12 - 6 - 4 lj - type nonbonded model for the 24 highly charged metal ions for the same three water models. in general, these parameters simultaneously reproduce both the experimental hfe, iod, and cn values with good accuracy. this work opens up new opportunities to simulate m(iii) and m(iv) ions in aqueous solution using classical models. stable trajectories were obtained with the metal binding site being well - conserved, further supporting the excellent transferability of these parameters. in present work, we employed the nonbonded model in the amber force field1 in eq 1, the uij(rij) is the nonbonded interaction potential between atoms i and j at distance rij. herein e represents the charge of the proton, while qi and qj are the partial charge of atoms i and j. the partial charge of metal ions is always treated as an integer number in the nonbonded model. the vdw interaction part uses a 12 - 6 lennard - jones (lj) potential, in which there are two parameters (ij and rmin, ij) that need to be determined. using the geometric combining rule, the well depth of the lj potential is2 for the rmin, ij parameters, there are two widely used combining rules3and4 equation 3 is employed in the amber and charmm force fields, while eq 4 is used in the opls force field. in the present work, we employed the lorentz berthelot combining rules, which is the union of eqs 2 (lorentz combining rule) and 3 (berthelot combining rule). for the 12 - 6 - 4 lj - type potential, we employed the following expression5 an r term was added to describe the ion - induced dipole interaction, which can not be overlooked for highly charged systems. the parametrization work concentrated on the determination of the rmin, i, i for the different metal ions, and the c4 term between the metal ion and oxygen atoms of the different water models. in the present work, we have determined the parameters for three widely used water models (tip3p, spc / e, and tip4pew) independently. previous work demonstrated that it is necessary to design different parameters for these water models due to their different geometries, charge distributions, and vdw parameters. the thermodynamic integration (ti) method was used to simulate the hfe values. ti calculates the free - energy change between two different states of a system. an initial - state / final - state mixing potential was used during the simulation, in which v0 and v1 represent the potential of the initial and final state, respectively, while governs the mixing between the two states. k determines whether the mixing is linear or of higher order (k = 1 is linear).6 the ion solvation process is modeled as transfer of an isolated metal ion from the gas to liquid phase. in the present work, we employed the thermodynamic cycle depicted in figure 1. to avoid the end - point catastrophe, we employed the linear scaling soft - core ti method to obtain the gvdw term.7 in eq 7, rij is the distance between the dummy atom and the surrounding particles, while is the distance at which the two particles vdw interaction is equal to zero. here the is the well depth and is a constant set to 0.5. problem is largely avoided because there is limited energy penalty induced between the dummy atom and proximal particles when the vdw potential of the dummy atom is turned on.89 as seen from eq 8, the free - energy of each process is obtained via the integration of the derivative of the potential with respect to. herein we employed gaussian quadrature (eq 9) to evaluate the integral in an efficient way. as illustrated in figure 1, we obtained the hfe values based on the free - energy changes associated with four processes : gvdw, gele+pol, gele+pol, and gvdw. herein the hfe value is computed using hfe = 1/2 (gvdw + gele+pol (gele+pol gvdw)). the gele+pol and gele+pol are gele and gele respectively, when the 12 - 6 nonbonded model is employed. at first, a dummy atom was placed in the center of a cubic water box (with size 32 32 32) with the closest water molecule 1.5 away from it. there are in total 722 water molecules in the tip3p or spc / e water boxes, while there are 732 water molecules in the tip4pew water box. afterward 1000 steps of steepest descent minimization were performed, followed by 1000 steps conjugate gradient minimization. then, a 500 ps heating procedure was performed to heat the system from 0 to 300 k in the nvt ensemble. next, we equilibrated the system for 500 ps at 300 k and 1 atm using the npt ensemble. the final snapshot from the equilibration simulation was used as the initial structure for the calculation of gvdw. to balance accuracy and speed, we used the four - window linear soft - core scaling process to obtain the gvdw value with values of 0.1127, 0.5, 0.88729, and 0.98, respectively. the simulation of last window was used to further equilibrate the system but was not used in the free - energy evaluation. the final snapshot was used to initiate the determination of gele+pol. for the gele+pol calculation process, a nine - window linear scaling scheme was utilized with values of 0, 0.2544, 0.12923, 0.29707, 0.5, 0.70292, 0.87076, 0.97455, and 1, respectively. afterward, the gele+pol calculation process was carried out in a similar manner. in these simulations, the first and last windows (equal to 0 and 1) are not used in the final free - energy calculation but to further equilibrate the system. finally, the gvdw simulation procedure was carried out using a three - window linear soft - core scaling process in which was set at 0.1127, 0.5, and 0.88729, respectively. for the determination of gvdw and gvdw, each window was simulated for 300 ps, with the last 200 ps used for data collection. the gele+pol and gele+pol simulations covered 200 ps, with the last 150 ps used for data collection in each window. all ti simulations were performed in the npt ensemble. we have employed two different methods to evaluate the uncertainty of the simulated hfe values in the present work. the first method (set 1) divided each sampling segment (gvdw, gele+pol, gele+pol, and gvdw) into two even portions and estimated the uncertainties for the vdw and electrostatic plus polarization free - energy determinations. for example, we have 200 ps of sampling for each window for the determination of gvdw and gvdw. we used the first 100 ps of sampling to calculate the gvdw - part 1 and gvdw - part 1 values, while we used the later 100 ps of sampling to obtain the gvdw - part 2 and gvdw - part 2. then, we assessed the uncertainty of the vdw free - energy determination by calculating the standard deviation based on these four values. the uncertainty of the electrostatic plus polarization free - energy determination was obtained in a similar manner with each fragment using 75 ps of sampling. subsequently, we obtain the total uncertainty in the hfe value by adding the uncertainties of the vdw and electrostatic plus polarization free - energy determinations. the second method (set 2) uses eq 10, in which the a is the autocorrelation time of observable a while (ac) is the standard deviation of a. t is the sampling time of the simulation and a is the final uncertainty of the observable a. the final hfe values given in the spreadsheets given in the si are depicted as a. again, the uncertainty of the vdw and electrostatic plus polarization free - energy determinations were evaluated separately, and the final uncertainty was treated as their sum. herein we used a a value equal to 500 fs for the vdw free - energy determinations, while we used 250 fs for the electrostatic plus polarization scaling part. we obtained these values based on test simulations, and they are consistent with previous work.10 the set 1 approach yields uncertainties in the range of 0.17.5 kcal / mol with an average of 1.2 kcal / mol, while set 2 gives uncertainties in the range of 1.1 to 2.0 kcal / mol with an average of 1.4 kcal / mol. on the basis of these analyses, we estimate that the hfe uncertainty is in the 2.0 kcal / mol range, which is quite small given the magnitude of hfes we are computing. a metal ion (with an integer + 3 or + 4 partial charge) was solvated in the center of a cubic water box (with the same size as described in the hfe simulation part). then, 1000 steps of steepest descent and 1000 steps of conjugated gradient minimization were carried out to relax the initial structure. simulation was performed in the nvt ensemble that took the system from 0 to 300 k. next, 500 ps of equilibration, followed by 2 ns of sampling were performed at 300 k and 1 atm. snapshots were stored every 0.5 ps (every 500 steps for 4000 snapshots in total) for the subsequent iod and cn analysis. the radial distribution function (rdf) of the ion and water oxygen atom was then calculated based on the average volume of the entire trajectory in the range of 05.0 with a grid resolution of 0.01. the first quadratic fit was performed using the points within 0.1 of the first peak of rdf. in this way the second quadratic fitting was done based on the points within 0.1 of the apex obtained from the first fitting. in total, 21 points were used for each fit. the maximum given by the second fitting was treated as the final iod value to two decimal places. the cn value was obtained by integrating from the origin to the first minimum of the rdf. the amber 12 suite of programs was used to perform the simulations, while the amber tools suite of programs was utilized to carry out the data analysis. the particle mesh ewald (pme) method and periodic boundary condition (pbc) were employed throughout. the time - step was 1 fs, while the cutoff was set to 10. for the temperature control, the langevin algorithm was utilized with a collision frequency equal to 5.0 ps. the isotropic pressure algorithm was used to control the pressure. the pressure relaxation time was set to 10 and 1 ps in the ti and standard md simulations, respectively. the hfe values for all m(iii) and m(iv) ions investigated were taken from marcus. it is one of the most complete databases regarding the thermodynamic properties of ions. the iod and cn values for m(iii) ions were taken from marcus review, while the iod and cn values for the m(iv) ions were taken from a number of sources. the experimental effective ionic radii were obtained from shannon. on the basis of the iod values and effective ionic radii, we estimated the effective radii of the coordinated water and display the data in table 1. some highly charged ions that readily hydrolyze water such as as, sn, and pb ions were not considered in the present work. referenced from marcus. referenced or calculated from marcus. from ankudinov one is for rmin/2 from 0.9 to 2.3 with 0.1 intervals without the c4 term (namely using the 12 - 6 lj nonbonded model), while the other is for the same rmin/2 value sets with a constant c4 term equal to 500 kcal / mol. the values are obtained for each rmin/2 value based on the noble gas curve (ngc), which was previously developed. the hfe, iod, and cn values for each parameter point are collected in tables si.1 and si.2 in the supporting information (si). these data points might be useful to those who want to parametrize the 12 - 6 lj or 12 - 6 - 4 lj - type nonbonded model with different target values from the present work. on the basis of the quadratic fitting of the data points from the parameter scans without the c4 term (see the si), we estimated the hfe and iod parameter sets. the two parameter sets are shown in tables 2 and 3, while the estimated absolute and percent errors are shown in table si.3. similar to our parametrization of divalent metal ions using the 12 - 6 lj nonbonded model, the rmin/2 parameters in the hfe parameter set are in excellent agreement with the vdw radii calculated using the quantum - mechanical scaling principle (qmsp) method. for the al, y, and la ions, the estimated rmin/2 values in the estimated hfe parameter set for the tip3p water model are 0.981, 1.454, and 1.628 respectively. the calculated vdw radii are 1.046, 1.481, and 1.642, respectively, based on the qmsp method. there is only a 6.2, 1.8, and 0.9% difference between these two sets of values. moreover, the estimated rmin/2 values used in the 12 - 6 lj parameter sets could be used as the vdw radii for resp charge - fitting procedures. for example, in the work of kuznetsov., they used 1.4 as the vdw radius for the resp charge fitting for both the fe and fe ions, while for the iod parameter set the fe radius was determined to be 1.409 in our previous research. herein, the iod parameter sets for the fe ion estimated the radius as 1.386, 1.386, and 1.375 for the tip3p, spc / e, and tip4pew water models, respectively. combining the data with previous work on m(ii) metal ions, we summarized the absolute and percent errors for the 12 - 6 lj nonbonded model for m(ii), m(iii), and m(iv) ions in tables 4 and 5. these results, taken as a whole, show that the underestimation of the 12 - 6 lj nonbonded model increases dramatically as the charge on the metal ion increases. for example, for the tip3p water model, the average absolute error goes from 50 kcal / mol for m(ii) ions to 80 kcal / mol for m(iii) and 240 kcal / mol for m(iv) ions for the iod parameter set, while the average absolute error of the iod values for the hfe parameter set increases from 0.27 for m(ii) ions to 0.29 for m(iii) ions and 0.58 for m(iv) ions. for some of the monovalent ions, it is possible to reproduce both the experimental hfe and iod values at the same time ; this underestimation of the 12 - 6 lj nonbonded model is pretty small and can almost be neglected. because there are significant errors associated with the 12 - 6 lj nonbonded model for highly charged ions, we did not carry out further refinement work on the estimated 12 - 6 lj parameters because the resultant parameters would be of limited usefulness. after initial parameter selection and subsequent fine - tuning, the final 12 - 6 - 4 parameters were determined. the final optimized 12 - 6 - 4 parameters are given in table 6 while the simulated hfe, iod, and cn values are shown in table si.4. these parameters reproduce the experimental hfe values by 1 kcal / mol and the iod values by 0.01 for the m(iii) ions, while they reproduce the hfe values by 2 kcal / mol and the iod values by 0.01 for the m(iv) ions. just as in the 12 - 6 - 4 parameter sets for divalent metal ions, the rmin/2 terms are similar between the three water models, while the c4 term for tip4pew water is generally larger than for the other two water models for the same metal ion. this may due to the smaller dipole of the tip4pew water model (2.32 d) relative to the tip3p (2.35 d) and spc / e (2.35 d) water models. figure 2 shows the accuracy comparison between the 12 - 6 - 4 parameter set and the 12 - 6 parameter sets for divalent, trivalent, and tetravalent metal ions. we can see that there is significant improvement in the accuracy using the 12 - 6 - 4 parameter set, which is able to reproduce the experimental hfe and iod values simultaneously. while for the 12 - 6 lj nonbonded model, if you want to reproduce the experimental hfe values, the error in the simulated iod values would increase along with the formal charge of the metal ions. vice versa, if you simulate the iod values using the 12 - 6 lj nonbonded model, the error of the calculated hfe would increase markedly with an increase in the oxidation state of the metal ion in question. (a) hfe errors for the 12 - 6 iod and 12 - 6 - 4 parameter sets for m(ii), m(iii), and m(iv) metal ions. (b) iod errors for the 12 - 6 hfe and 12 - 6 - 4 parameter sets for the m(ii), m(iii), and m(iv) metal ions. these metal ions have much stronger ion water interactions than the ln ions. they form a stable octahedral structure with water molecules in the first solvation shell. data in table 1 indicate that the average effective radius of the first solvation shell water is 1.35 for the first several metal ions, which is consistent with strong interactions between the coordinated water molecules and these metal ions. these values are close to previously proposed coordinated water radius (1.34). the corresponding average values are 1.49 and 1.46 for the ln and the m(iv) metal ions, respectively, which implies a smaller electronic cloud overlap between the metal ion center and each of the coordinated water molecules. al, in, and tl are group iv ions. for the c4 parameters derived herein, we obtained a sequence of tl > al > in. the al ion is the smallest m(iii) ion, resulting in a relatively larger c4 term due to its strong covalent interaction with coordinated water molecules. tl has two oxidation states, + 1 and + 3, and the hfe values of the tl and k are almost the same in marcus hfe set. the reduced electric potential of m(iii) + 3e = m is 1.67, 0.3382, and + 0.72 ev for al, in, and tl, respectively. it readily obtains electrons from its surroundings, which may be the reason for a strong charge - transfer effect between the tl ion and the surrounding water molecules. the 12 - 6 - 4 parameters of in and tl ions gave an excellent prediction for the hfe and iod values but overestimated the cn value (8 instead of 6), and this is mainly due to the lack of a correction for the water water interactions in the first solvation shell during the simulations. water interactions were parametrized to reproduce the pure liquid water properties in the original parameter design. however, the first solvation shell water molecules of the highly charged metal ions should more strongly repel one another due to their bigger charge separations. this effect is smaller for m(i) and m(ii) metal ions, but it dramatically increases for the highly charged ions. meanwhile, this kind of effect may decrease in protein systems due to the preorganization of the metal ion binding sites. fe has a larger c4 term than al, the smallest m(iii) ion, which suggests that fe has a stronger interaction with its surrounding water molecules. this is consistent with quantum - mechanical charge - field molecular dynamics (qmcf - md) simulations, which shows that the force constant between the ion and the oxygen of first solvation shell water molecules (kion - o) is 198 n / m for fe compared with 185 n / m for al. the fe ion has an average 1.85e charge (from a mulliken analysis) in the qmcf simulation, while al ion has a corresponding value of 2.5 e, which implies that there is a stronger charge - transfer effect for the fe ion and its surrounding water molecules than for the al ion. also, as previously discussed, this may be due to the underestimation of the interactions between the first solvation water molecules. while this effect is operative in aqueous solution, it will likely be less of an issue in protein systems (see discussion below). the + 3 oxidation state is the typical oxidation state of the ln elements, with the exception that eu and ce could also be observed. this is because eu has a half - filled 4f orbital while ce has the same electronic configuration as xe. the interaction of the ln ions with surrounding water molecules would be expected to have more ionic character than the m(iii) ions previously discussed. for example, the c4 terms between the ln ions and water molecules are between 152 and 282 kcal / mol, which is smaller than the 258456 kcal / mol range seen for the other + 3 metal ions previously discussed. previous simulations found that the kion - o values are much smaller for the ln ions ; for example, la, ce, lu, and er have kion - o values 110 n / m, while the values for the al and fe ions are 185 and 203 n / m, respectively. the ln ions have effective ionic radii in the range of 0.86 to 1.03 and iod values in the range of 2.34 to 2.55. these values are similar to that of the ca ion (whose effective ionic radius and iod value is 1.00 and 2.46, respectively). therefore, they have been used as probes to investigate the role of ca ions in biological systems. from table 6, we observe that the la and gd ions have the smallest c4 terms among the ln ions. this may be because they have either totally empty or half - filled 4f orbitals, making them more likely to form isolated ions, which reduces the covalent character of their bonds with coordinated water molecules. the effective ion radius decreases monotonically with an increase in the metal ions atomic number due to the poor shielding of the 4f electrons toward 5s and 5p orbitals. a similar tendency can also be seen for the hfe and iod values along the series. previous work reached the conclusion that the lighter ln ions (la to nd) prefer a cn of 9 and the heavier ions (gd to tb) prefer a cn of 8, while the middle ions such as sm and eu have cn between these two values. it was proposed that the former ln ions have a tricapped trigonal prism structure, which then shifts to a distorted bicapped trigonal prism structure for the heavier elements as one of the two capping water molecules leaves the first solvation shell. generally speaking, there is a good agreement between the 12 - 6 - 4 parameters for the hfe, iod, and cn values with experiment, with the exception that some of the cn values were slightly overestimated. the final parameters gave a cn in the range of 9 to 10 for ln ions rather than the range of 8 to 9 reported in the literature. as previously discussed, this may be due to the fact that there is no water water interaction correction term in the present parametrization process. moreover, the cn values given by marcus (as shown in table 1) likely also vary under different experimental conditions (counterions used solute concentration, etc.). among all ions, al, y, and la have the same electron configurations as the noble gas atoms ne, kr, and xe, respectively. using the tip3p water model as an example, we can see their c4 values decrease from 399 to 216 and 152 kcal / mol, respectively. there are only a few m(iv) ions that exist in aqueous solution, while the others are readily hydrolyzed into polynuclear complexes in water. the cn values of these metal ions are greater than 8, with some of them being 10 according to experiment. previous work found that pu(iv), th(iv), and u(iv) could strongly bind to transferrin, an iron - transport protein. hence, the parameters developed herein might facilitate theoretical research on the biotoxicity of these m(iv) ions. the zr and hf are in the ivb group. even though hf has a larger atomic number than zr, due to the lanthanide contraction effect, it has a smaller effective radius, smaller iod, smaller hfe, and a bigger c4 term than zr. in contrast, ce and th are in the same group where the larger atomic number (th) has the bigger ionic radius, bigger hfe, and smaller c4 terms. this may be because they share the same electronic structure as xe and rn, respectively. besides these ions, zr is another m(iv) ion that has a noble gas atom s electronic structure (the same as kr). there is also a single trend for the c4 terms of zr, ce, and th ions for each specific water model. for instance, the c4 terms for the tip3p water model are 761, 706, and 512 kcal / mol, respectively. th, u, and pu are in the an series and are the largest elements investigated in the present work. canaval. investigated th in aqueous solutions using the qmcf - md method. they found a stable nine - coordinate complex, and even the third layer of water molecules has a bigger mean residence time than that of pure water, implying they are stabilized by the highly charged th ion. u fluoresces due to the electron transition between the 6d5f and 5f electronic configurations. the u ion has the largest c4 term of all of the m(iv) metal ions investigated. frick. investigated the u ion in aqueous solution using the qmcf - md method, and the cn value was characterized as 9, while the average charge of u was predicted to be + 2.68 from mulliken population analyses. simulated the pu, pu, puo2, and puo2 ions in water solution using the car parrinello molecular dynamics method. they predicted that the pka value for the first hydrolysis step for the pu, pu, puo2, and puo2 ions is 6.65, 0.17, 9.51, and 5.70, respectively, showing a general tendency that the larger the charge of the metal center, the lower the pka value of the first hydrolysis reaction. hf, zr, and pu have relatively smaller iod values among the tetravalent ions, where they all have experimental cns of 8. ce was determined to have an experimental cn of 9, while u and th have cns between 9 and 11. proposed that counterions also play a key role in the first solvation shell structure, while the 9-, 10-, or 11-coordinated th have very small energy differences and are in a dynamic equilibration. the simulated hfe and iod values of the 12 - 6 - 4 parameter set are in excellent agreement with the experiment. the simulated cn values of most of the m(iv) ions are 10, with hf having a cn 8 for the tip4pew and spc / e water models. herein, the tip3p model always predicted a larger cn value than the other two water models, which may be because it has a smaller c12 term (582.0 10 kcal / mol) than that of the spc / e (629.4 10 kcal / mol) and tip4pew (656.1 10 kcal / mol) models. later, we analyze several redox pairs to explore the consistency of the c4 parameters we determined with respect to the behavior of these pairs in aqueous solution. we also calculated the relative hfe between each redox pair for the tip3p water model (see below). the divalent metal ions 12 - 6 - 4 parameters are from previous work. a nine - windows ti simulation (50 ps of equilibration and 150 ps of sampling for each window) was performed forward and backward, respectively, to obtain the final results. for example, the simulated relative hfes of fe / fe, cr / cr, and ce / ce ion pairs were 580.2, 516.9, and 698.2 kcal / mol, while the experimental values are 579.6, 516.2, and 697.6 kcal / mol, respectively. the experimental iod values shrink 0.08 from 2.11 of fe to 2.03 of fe ion. n / m for fe, which is almost twice as strong as that of fe (93 n / m), while the effective charges (from a mulliken population analysis) for the fe ion are in the range of 1.25 to 1.45 (with an average of 1.36), and for the fe ion it is in the range of 1.70 to 1.95 (with an average of 1.85). fe / fe redox pairs exist broadly in biologically related system such as the fe s proteins and heme structures. moreover, fe / fe redox pairs play fundamental roles in many electron - transfer processes. we have determined the 12 - 6 - 4 parameters for fe ion with three different water models in previous work. for the tip3p water model, the final optimized parameters were rmin/2 = 1.457, = 0.02710805 kcal / mol, and c4 = 163 kcal / mol. from the 12 - 6 - 4 parameters determined for the fe ion herein, we find that the rmin/2 decreases slightly as the outer shell electron number decreases, while the c4 term increases by 2.5 times relative to fe. this is consistent with a ratio between the c4 terms for a trivalent and divalent ion of [3/2 ] = 2.25, which is derived from the original ion - induced dipole equation (eq 11 in a prior publication). the cr and cr ions have [ar]3d and [ar]3d electronic structures, respectively, where the cr(h2o)6 complex has a strong jahn teller effect while the cr(h2o)6 molecule has a standard octahedral configuration. the iod values decreases from 2.08 to 1.96 for the cr and cr ions. using the tip3p water model as a representative example, we observe that the rmin/2 parameter decreases from 1.431 to1.405, while the c4 term increases from 137 to 258 kcal / mol for the cr and cr ions (the cr parameters are reported in reference (18)). ce is the most stable state because it shares the same electronic configuration with xe. just like the two oxidation pairs previously discussed we find that the rmin/2 value decreases while the c4 term increases significantly with increasing charge. for example, for the parameters determined for the tip3p water model, the rmin/2 decreased 0.03, while the c4 term increased by 480 kcal / mol. pdb entry 4bv1 was used to obtain the starting coordinates for this modeling exercise. it is a protein tetramer with each monomer having a metal site containing an fe ion. the structure has been determined by using x - ray crystallography to a resolution of 1.90. the tetramer structure is shown in figure 3, while chain c with its metal site is shown in figure 4. the metal site contains four histidine groups, one cysteine group, and one water molecule. by treating chain c as the initial structure, we performed three simulations with different parameter sets (the hfe, iod, and 12 - 6 - 4 parameter sets). for the 12 - 6 - 4 parameter set, the c4 terms between the fe ion and atom types other than water oxygen were evaluated using eq 11. details of the simulation procedures and the polarizability of each atom type are given in the si.11 a total of 10 ns of sampling was performed during the simulation, and snapshots were stored after each 500 fs. the hfe parameter set prefers a smaller cn (of 4), and the metal ion moves out from the binding pocket, while stable metal complex structures were obtained for the simulations using the iod and 12 - 6 - 4 parameter sets. an rmsd analysis was performed over the heavy atoms of the backbone and the metal site for the simulations by treating the initial structure (experimental structure) as reference. the rmsd of the heavy backbone atoms fluctuated around 1.2, while the rmsd of the metal site was 0.5. these values illustrate that the metal binding site is stable during the course of the simulations. we have also performed an rmsf analysis of the backbone heavy atoms for each residue together with the oxygen atom in the metal site binding water. it can be seen that the metal site residues : residue his10 (residue number 11), his 35 (residue number 36), his 41 (residue number 42), cys 97 (residue number 98), and his 100 (residue number 101), all have relatively small rmsf values (0.5). the metal site binding water (residue number 115, is not shown in the figure since the protein ends at residue number 112) has a rmsf of 0.6 for both the simulations with the iod and the 12 - 6 - 4 parameter sets. these results further validated that the metal ion site is stable over the course of the simulations. water molecules are not shown in the figure, the ferric ion is shown as a sliver sphere. chain c in pdb entry 4bv1 (left) and a close up of the metal site in chain c (right). the ferric ion is represented as a silver sphere, and it is coordinated by one cys, four his, and one water molecule. rmsd of heavy atoms of backbone (left) and the metal site (right, including the binding water molecule) for simulations with iod and 12 - 6 - 4 parameter sets using the initial structure (experimental structure) as reference. rmsf of heavy atoms of the protein residues in the simulations using iod and 12 - 6 - 4 parameter sets. in this work, we have estimated the 12 - 6 lj parameters and determined the 12 - 6 - 4 lj - type parameters for 24 highly charged metal ions (18 m(iii) ions and 6 m(iv) ions) with three water models (tip3p, spc / e and tip4pew) based on a parameter scanning protocol. we have shown that with the increasing charge of the metal ions there is a notable decrease in the accuracy of the 12 - 6 lj nonbonded model. using tip3p as an example, the average underestimation of the hfe values increases from 50 kcal / mol for m(ii) ions to 80 kcal / mol for m(iii) ions and to 240 kcal / mol for m(iv) ions when trying to reproduce the experimental iod values. the average underestimation of the iod values increases from 0.27 to 0.29 and 0.58 for the m(ii), m(iii), and m(iv) ions, respectively, when trying to reproduce the experimental hfe values. the 12 - 6 - 4 lj - type nonbonded model, which we previously described, addresses this problem in a consistent manner. it improves the accuracy of the 12 - 6 lj nonbonded model remarkably with just a slight increase in computational cost. this parameter set, derived in this work, reproduced several experimental values (hfe, iod, and cn) with good accuracy. they reproduce the hfe within 1 kcal / mol for the m(iii) ions and 2 kcal / mol for m(iv) ions while reproducing the experimental iod values to within 0.01. moreover, excellent quantitative and qualitative agreement with previous experimental and computational work supports the validity of the 12 - 6 - 4 lj - type nonbonded model. testing in a protein system also revealed good transferability of the parameters determined herein. | highly charged metal ions act as catalytic centers and structural elements in a broad range of chemical complexes. the nonbonded model for metal ions is extensively used in molecular simulations due to its simple form, computational speed, and transferability. we have proposed and parametrized a 12 - 6 - 4 lj (lennard - jones)-type nonbonded model for divalent metal ions in previous work, which showed a marked improvement over the 12 - 6 lj nonbonded model. in the present study, by treating the experimental hydration free energies and ion oxygen distances of the first solvation shell as targets for our parametrization, we evaluated 12 - 6 lj parameters for 18 m(iii) and 6 m(iv) metal ions for three widely used water models (tip3p, spc / e, and tip4pew). as expected, the interaction energy underestimation of the 12 - 6 lj nonbonded model increases dramatically for the highly charged metal ions. we then parametrized the 12 - 6 - 4 lj - type nonbonded model for these metal ions with the three water models. the final parameters reproduced the target values with good accuracy, which is consistent with our previous experience using this potential. finally, tests were performed on a protein system, and the obtained results validate the transferability of these nonbonded model parameters. |
entropy is a key property to understand a wide variety of physical, chemical, and biochemical phenomena. however, the estimation of absolute entropies and entropy differences from computer simulations is a long - standing problem and one of the current challenges in computational chemistry. the calculation of reliable absolute entropies from molecular dynamics (md) simulations is intrinsically difficult because the absolute entropy is a measure of the overall extent of phase space (ps) accessible to a molecular system. however, absolute single - molecule entropies can be estimated based on an analytical approximation to the configurational probability distribution corresponding to the ps accessed by a simulated system.(2) the underlying theory, assumptions, approximations, and alternative practical implementations have been recently reviewed. the relationship among quasi - harmonic (qh), essential - mode, and normal - mode analyses has also been investigated.(11) for an extensive review of the subject, not limited to the qh approach, see also refs (11) and (1619) and references therein. the difference between the true entropy of a simulated system and its qh estimate arises from (i) anharmonicities (i.e., non - gaussian behavior) in the probability distributions along individual qh modes and (ii) correlations among the probability distributions associated with different qh modes (beyond the pairwise linear correlations accounted for). these effects are neglected in standard qh analysis and (nearly) always lead to a negative entropy contribution.(11) a method to correct for both artifacts was recently described.(11) point ii is of particular relevance when trying to estimate entropy differences between two conformational states of a molecular system because error cancellation can not be guaranteed a priori. by taking into account correlation effects of increasing order, entropy estimates based on corrected qh analysis aim at capturing the entropy corresponding to the entire ps sampled (see figure 1 in ref (11)). thus, this approach is not limited to systems sampling single qh basins and allows capturing conformational transitions. the qh entropy upper - bound sqm, o (eq 10 with eq 12 ; empty bars) and the improved entropy estimate s (eq 20 ; hatched areas) are displayed scaled by the number n of system particles. the relative (%) values of the cumulative correction term fclcrc (eq 21 ; bar labels) are reported as a measure of the importance of the deviation from the qh approximation. from left to right : two -peptides in methanol at high temperature (f, folded ; u, unfolded ; a, all ; t, 298 instead of 340 k),(11) the 11 glucose - based disaccharides (w, free in water),(28) dipalmitoylphosphatidylcholine, dppc (i, inserted in a hydrated bilayer),(24) the cavity and its gating loop of the w191 g mutant of cytochrome c peroxidase (k, bound to a k ion with closed gating loop ; b, bound to 2-amino-5-methylthiazole with closed gating loop ; o, bound to a k ion with open gating loop),(20) the h - ras lipopetide anchor,(27) and the cc-peptide (this study). for the disaccharides,(28) corresponding mean entropy values are displayed (a vertical bar represents the range of values). see supporting information for details. in the present article, we expand the previous study in ref (11). a general formulation is proposed to account for correction terms of increasing order, and its practical implementation and limitations are discussed. we review previous studies employing this novel approach on an array of (bio)molecular systems providing a solid basis for its application and demonstrating the importance of these correction terms in the evaluation of absolute entropy and entropy differences. using microsecond md simulation of a test system, we analyze the convergence properties of the absolute single - molecule entropy and of the correction terms used to estimate it. the results emphasize that sufficient ps sampling is required for a reliable estimation of entropic contributions because convergence of both the qh upper bound and the required correction terms should be achieved. qh analysis aims to account for motions in the overall extent of ps accessible to a molecular system at thermodynamic equilibrium. it relies on approximating the configurational probability distribution as a multivariate gaussian, the momenta of which can be estimated, e.g., from molecular dynamics (md) or monte carlo simulations. more precisely, for a given choice of generalized coordinate system q (of dimension m = 3n, n being the number of atoms), its input quantity is the covariance matrix cq characterizing the atom - positional fluctuations (and their correlations) around an average configuration q. assuming a canonical ensemble and fluctuations resulting from an underlying harmonic potential of the form where is an effective hessian matrix and qo an effective equilibrium configuration, it follows that(11) note that the corresponding harmonic model only strictly produces the correct average configuration q and covariance matrix cq for generalized coordinate systems where the mass - metric tensor aq is configuration independent.(11) in this study, we only consider the specific case of single - molecule entropy (i.e., the entropy of individual distinguishable atoms in a covalently bound molecule) based on md simulation trajectories. as detailed elsewhere,(21)single - molecule entropy differs from molecular entropy in that the former estimate only accounts for intermolecular correlation in terms of the effect of the solvent on the single - molecule dynamics. in practice, the qh analysis of an md trajectory involves the following steps.(11) first, the average configuration q and the covariance matrix cq in the chosen coordinate system are evaluated as the equilibrium configuration qo and hessian matrix of the effective underlying harmonic model are then defined according to eq 2. second, the (symmetric) metric - tensor - weighted covariance matrix is diagonalized where vq is a m m - dimensional (orthogonal) matrix the columns of which represent the m components of the eigenvectors { q, m| m = 1,..., m } (called qh modes) of the metric - tensor - weighted covariance matrix and fq is a diagonal matrix containing the corresponding eigenvalues. these eigenvalues are related to the associated angular frequencies of the underlying effective harmonic model as (see eqs 2 and 4) the sum of the eigenvalues in fq is equal to the total mean - square metric - tensor - weighted fluctuation of the system, i.e. so that the eigenvalues can be interpreted as contributions of individual qh modes to this quantity (a larger value indicating a larger contribution to the total fluctuation of the molecule). third, the simulated trajectory is projected onto the qh modes, i.e., one considers the transformed coordinates bq defined as these so - called qh coordinates satisfy the properties(11) because fq is diagonal, eq 8 enforces that the individual components { bq, m| m = 1,..., m } of the qh coordinates bq are pairwise linearly uncorrelated, which, however, does not imply the absence of higher order (i.e., pairwise supralinear and higher order) correlations. we previously motivated the choice of a cartesian vs internal coordinate system.(11) if a cartesian coordinate system r is employed (after removal of the overall translational and rotational motion from the sampled trajectory(22)), the mass - metric tensor ar is identical to the mass matrix m (thus configuration independent, so that eq 2 is exactly satisfied). in this case, the qh analysis relies on the diagonalization of the mass - weighted cartesian covariance matrix, i.e. in place of aq cq aq in eq 4. in the absence of geometric constraints, if nc geometrical constraints are present in the system (e.g., bond - length constraints), these will map to an identical number of zero eigenvalues (see appendix a in ref (23) for a derivation in the mathematically similar context of essential - mode analysis). thus, the number of qh modes with nonzero eigenvalues is m = 3n nc 6, where m = 3n. when using a generalized coordinate system excluding overall translation and rotation variables, one has m = m = 3n nc 6. note that the qh coordinates have units of mass length.(11) single - molecule entropies can be obtained as follows.(11) in terms of qh coordinates, the configurational probability distribution associated with the effective harmonic model of eq 2 corresponds to that of m independent harmonic oscillators. assuming a canonical ensemble and a configuration - independent mass - weighted metric tensor, this leads to(11) where s() is the canonical entropy of a one - dimensional harmonic oscillator with angular frequency. the classical expression scl, o() and the quantum - mechanical expression sqm, o() for this quantity are and where = h(2) is the reduced planck s constant, leading to eq 10 to corresponding total estimates scl, o and sqm, o, respectively. in practice, even if the underlying trajectory was generated at the classical level, the qh entropy must be evaluated using the quantum - mechanical oscillator formula because in the high - frequency limit the classical entropy of a one - dimensional harmonic oscillator diverges to the unphysical limit of rather than to the physical limit of zero. however, the qh entropy estimate sqm, o is not the absolute configurational entropy of a single molecule but an upper bound for this quantity due to the presence of qh mode anharmonicities and correlations not accounted for in the effective harmonic model of eq 2. corresponding correction terms can be formulated exactly at the classical level using an approach previously described(11) and briefly summarized below. in the canonical ensemble, assuming a configuration - independent mass - metric tensor, the exact classical single - molecule entropy reads(11) where p(bq) is the probability distribution in the m - dimensional space of the qh coordinates bq (eq 7). this expression can be compared with the approximate (classical) qh estimate scl, o based on eqs 10 and 11, i.e. a series of increasingly accurate estimates { scl, k| k= 0, 1,..., m } may now be formulated as where c denotes a combination of k qh modes, c(k, m) = [(m k)!k!]m ! for k > 0 along with c(0,m) = 0 represents the total number of possible combinations c of k modes among the m qh modes and p(bq) is the k - dimensional probability distribution in the subspace of the qh coordinates bq within bq that are involved in a combination c. the derivation of this equation is given in the appendix in the supporting information. it is easily verified that scl, k=0 = scl, o (eq 14, i.e., the uncorrected classical qh entropy) and scl, k = m = scl (eq 13, i.e., the exact classical entropy). substituting the classical estimate scl, o by the corresponding quantum - mechanical estimate sqm, o (eqs 10 with 12) into eq 15 and introducing successive correction terms defined as leads to a (classically) corrected qh entropy estimate the successive correction terms of eq 17 involve integrals over the probability distributions p(bq) in eq 15 with increasing dimensionality k. note that these terms are all individually negative (or vanishing). the first correction term scl,1 involves one - dimensional (1d) integrals and accounts for anharmonicities in the individual qh modes. the second correction term scl,2 involves two - dimensional (2d) integrals and accounts for pairwise (supralinear) correlations between the qh modes. for simplicity, these two terms will be renamed sclah and sclpc, respectively, to match the notation used in other studies. the following higher order correction terms account for correlations among qh modes beyond the pairwise ones. although the classical qh entropy estimate scl, o usually represents a poor approximation to its quantum - mechanical counterpart sqm, o, the evaluation of the correction terms at the classical level remains accurate because anharmonicities and correlations principally affect the low - frequency qh modes for which the classical approximation holds.(11) the successive correction terms in the series of eq 17 are increasingly difficult to evaluate because both (i) the number of terms c(k, m) involved in the evaluation of scl, k and (ii) the sparseness in the required multiple - mode probability distributions p(bq) increase exponentially with k. for this reason, their evaluation is restricted in practice to the first two terms and implies an intrinsic uncertainty on the final estimate compared to the true single - molecule entropy (i.e., persisting in the limit of infinite sampling). however, note that, in a different context, alternative approximate formulations to estimate terms of increasing order mutual information have been proposed and seem to suggest that the first two correction terms in eq 17 are indeed dominant. following from eqs 16 and 17, the expressions for the first two correction terms are and leading to the corrected absolute single - molecule entropy estimate the relative magnitudes fclcrc, fclah, and fclpc of the correction terms sclcrc, sclah, and sclpc with respect to the qh entropy upper - bound sqm, o (expressed in percent), i.e. may then serve as a measure for the importance of the aforementioned corrections. in practice, the 1d and 2d integrals involved in eqs 18 and 19 are evaluated numerically in the form of sums over corresponding histograms. it is reasonable to choose the bin width along a given qh mode in proportion to the width (first moment) of the probability distribution along this mode with proportionality factors 1 and 2 for 1d and 2d integrals, respectively. however, 1 and 2 values must be selected carefully in order to keep both finite - sampling and binning errors to a minimum, i.e., to ensure the independence of the results on these two parameters.(11) for this reason, we monitored the dependence of such numerical integrals on the width of histogram bins for increasing periods of time, as described in section. note, finally, that the absolute single - molecule entropies so far discussed exclude roto - translational contributions. in principle, a translational entropy contribution can be included using the quantum - mechanical expression of the sackurtetrode equation for a specified standard state of the pressure (molecule in the gas phase) or of the concentration (molecule in solution). similarly, the rotational entropy contribution could be included using the appropriate quantum - mechanical expression (e.g., rigid - rotor approximation, based on the average inertia tensor of the molecule). however, these two contributions are likely to be highly coupled with each other and with s, i.e., they are not strictly additive, and their rigorous treatment is therefore still challenging. a recent study reported on relatively small effects of motional correlation on changes of reorientational entropy using selected qh modes from a 1.5 ns simulation of the ubiquitin protein.(35) in the present article, single - molecule configurational entropies refer to entropies excluding roto - translational effects. a 1.1 s long md simulation of the cc peptide (ch3-co - s - i - r - e - l - e - a - r - i - r - e - l - e - l - r - i - coo) at 300 k was performed with the amber 9 software,(36) the amber 99sb parameter set,(37) and the compatible tip3p water model.(38) the simulation was initialized from the -helical configuration based on a x - ray model structure of the cc coiled coil (pdb i d 1s9z).(39) trajectory snapshots were saved every 10 ps for analysis. the simulation setup and trajectory analyses are detailed elsewhere.(40) backbone atom - positional root - mean - square deviations (rmsd) from the initial folded structure and radius of gyration (rgyr) were calculated using all c atoms. independent qh analyses were performed for 22 increasingly long segments of the simulation (differing in length by 50 ns) by calculation of the solute all - atom mass - weighted covariance matrix dr (eq 9) in cartesian coordinates after least - squares fit superposition(22) of all configurations onto the initial structure to eliminate overall translation and rotation and diagonalization (eq 4 with aq1/2 cq aq1/2 = dr). a total of 534 (m = 3 297 351 6) modes associated with nonvanishing eigenvalues were considered. after determination of the qh modes (columns of the matrix vr in eq 4 ; sorted in order of decreasing eigenvalues, i.e., increasing m frequency in eq 5), the trajectory was projected in this basis set to obtain the time series of the corresponding qh coordinates br (eq 7). this first part of the analysis was performed using the s_correction program as implemented in the gromos++ module of the gromos05 software(41) for biomolecular simulation. the qh entropy upper bound, sqm, o (eq 10 with eq 12), the corrections for mode anharmonicity, sclah (eq 18), and pairwise supralinear mode correlation, sclpc (eq 19), their sum, sclcrc (eq 20), the improved absolute single - molecule entropy, s (eq 20), the relative terms fclcrc, fclah, and fclpc (eq 21), and the sum of the eigenvalues, tr[fr ] (eq 6), were then calculated for each of the 22 trajectory segments. note that this analysis is computationally intensive because, as discussed in section, each of the 22 sclah values requires the estimation of 534 1d integrals, while each of the 22 sclpc values requires the estimation of 142 311 2d integrals (eq 15). in addition, for each of these integrals the optimized proportionality factors 1 and 2 were determined based on multiple integral calculations for an accurate numerical integration (see section). as an indication of the actual computational cost, using an intel xeon x5450 3.0 ghz, dedicated software, and the above procedure, each 1d or 2d integral can be estimated with an average cpu time of 0.07 or 0.21 s, respectively, from 50 ns trajectory windows. overall, the analyses presented in this work require a cpu time that sums up to 6 months. the key findings of previous studies concerning the uncorrected qh upper bound, sqm, o (eq 10 with eq 12), the improved absolute single - molecule entropy s (eq 20), and the relative magnitude of the cumulative correction term fclcrc (eq 21) are summarized graphically in figure 1. these results span systems with different chemical nature : 2 -peptides in methanol,(11) the 11 disaccharides of gluscose in water,(28) the dipalmitoylphosphatidylcholine (dppc) lipid in a hydrated bilayer,(24) the w191 g mutant cavity and its gating loop within cytochrome c peroxidase in water,(20) the h - ras lipopetide anchor in water or inserted into a model lipid membrane,(27) and the cc-peptide in water (this study). in some cases, the qh analysis was also performed separately for different chemical environments or conformational states of the molecule, which permits estimating relative entropies, thereby quantifying the impact of the correction terms on the thermodynamic process of interest. these processes include reversible peptide folding (ref (11) and this study), conformational changes in carbohydrates(28) and lipids,(24) lipopeptide insertion in a model membrane bilayer,(27) ligand binding to a protein cavity,(20) and protein - loop gating.(20) the results presented in figure 1 are scaled by the number, n, of atoms to allow for a comparison among molecules of varying size (the raw data is available as supporting information, table s1). some clear qualitative trends are evident, although a direct comparison among these studies is not possible due to the different md time scales and physicochemical conditions. in all systems the cumulative correction term sclcrc (eq 20) is generally sizable, demonstrating an overall large deviation from a qh behavior as evaluated up to the pairwise supralinear level. the corresponding relative magnitudes, fclcrc, display values from 9% to 73% of the qh upper - bound value sqm, o (figure 1). in detail, these important cumulative terms result from the sum of correction terms for mode anharmonicity (sclah ; eq 18) that are always relatively small (up to 3% of the upper - bound value sqm, o) and for pairwise supralinear mode correlation (sclpc ; eq 19) that are always dominant. the latter correction term has a magnitude that depends on the physical nature of the molecular motional correlation experienced by the molecular system in a given thermodynamic state. the largest relative corrections, fclcrc, are expected and found for intrinsically more ordered systems (figure 1). this can be explained by considering that restricted flexibility is typically promoted by inter- and/or intramolecular interactions, simultaneously inducing increased motional correlation. for example, the ligand - bound state of the w191 g protein cavity(20) displays the largest fclcrc value (73%), i.e., the thermodynamic ensemble involving the largest motional correlations and lowest entropy content among those studied. on the other end of the spectrum and in line with this qualitative picture, the smallest fclcrc values were reported for the dppc lipid in a bilayer (9%),(24) i.e., the ensemble characterized by the highest molecular flexibility and thus the lowest motional correlations. interestingly, the 11 disaccharides of glucose in water(28) display high variability and always large fclcrc values (4572%). this behavior can be explained considering that these molecules involve a reduced number of degrees of freedom overall and the linkage between rather stiff glucose rings is the torsion defining major conformational changes. these qualitative trends are also in agreement with the observation that entropy is the measure of ps sampling for a molecular system. the qh upper bound, sqm, o, and the improved absolute single - molecule entropy, s, are estimated based on the ps that has been accessed during a md simulation of finite time scale, i.e., only a fraction of the ps accessible to the system. these time scales ranged from 50 ns (w191 g mutant(20) showing the lowest entropy) to 25.6 s (concatenated trajectory of the dppc lipid,(24) showing the largest entropy). however, this hampers a quantitative comparison of sqm, o, s, and sclcrc values among previous studies. prompted by these observations, the dependence of these quantities on the extent of accessed ps was assessed on the microsecond time scale for a peptide test system. the cc peptide in water was chosen as a test system to investigate entropy convergence properties because of its small size and broad ps accessibility. figure 2a shows the time series of the backbone atom - positional root - mean - square deviation (rmsd) from the folded structure and of the backbone radius of gyration (rgyr) along a 1.1 s of md simulation. the peptide undergoes several reversible folding / unfolding events and samples a variety of unfolded configurations and compact folds.(40) cc peptide dynamics on the microseconds time scale and entropy convergence. (a) the backbone atom - positional root - mean - square deviation (rmsd ; black) from the initial helical fold and of the backbone radius of gyration (rgyr ; gray) are shown along the time, t. the cartoon representations highlight example configurations (oriented with the ch3co terminus down). (b) build - up curves of the qh entropy upper bound sqm, o (eqs 10 with 12 ; dashed line) and of the improved absolute single - molecule entropy s (eq 20 ; solid line). convergence of (c) the cumulative correction term sclcrc (eq 20) and its contribution to the free energy tsclcrc, (d) its relative value fclcrc (eq 21), and (e) the sum of the eigenvalues tr[fr ] (eq 6). the probability distributions p(br, m) of the transformed qh coordinates br (eq 7) along selected qh modes (m = 1, 2, 6, 10, 50, and 500) are shown in figure 3a. the actual distributions become increasingly narrow and similar to the gaussian functions for higher m indices, i.e., the corresponding qh modes become increasingly stiff and harmonic. however, the distributions along the lowest frequency modes (e.g., figure 3a, m = 1 or 2) differ significantly from gaussian functions and evidently result from the superposition of multiple off - center gaussian - like distributions. a similar observation was previously reported in the context of two -peptides in methanol for which two main subensembles of folded and unfolded configurations could be disentangled based on the lowest frequency modes (figures 35 in ref (11)). in the present case, the most pronounced peaks for the cc peptide arise from folded configurations (see figure 3a, m = 1 and 2, leftmost peak). the actual distributions (gray line) are displayed together with the corresponding gaussians, i.e., po, m(br, m) = (2fr, m)e br, m the time dependence of these results was investigated as summarized in figure 3b for the two coordinates br with lowest frequencies, i.e., those contributing the most to the total mean - square metric - tensor - weighted fluctuation of the system (eq 6). the corresponding distributions vary significantly with the extent of ps sampling, as revealed by averaging over the first 0.2, 0.4, and 0.8 s periods, or over the entire 1.1 s ensemble (cf. figure 3b vs figure 3a for m = 1 and 2). increasing the simulation time results into broader distributions due to the larger extent of ps sampled. the intensity of the leftmost peak, corresponding to the contribution of the folded configurations, clearly reduces along the simulation initialized from the cc helical fold and evolving through a broad range of heterogeneous configurations (figure 1a). the data indicate that convergence of the probability distributions associated with the low - frequency qh coordinates in br requires sampling times longer than 1 s, considering that such differences persist when comparing results from the first 800 ns period with the whole 1.1 s simulation. the entropy convergence for the cc peptide in water as a function of sampling time is illustrated in figure 2b. the upper - bound curve obtained by application of the uncorrected qh formula (sqm, o ; eq 10 with eq 12) is compared to the build - up curve of the improved absolute single - molecule entropy (s ; eq 20). interestingly, the qh upper bound reaches convergence noticeably faster than the improved absolute single - molecule entropy. in detail, 0.3 or 0.7 s is needed to sample 90% or 99% of the final sqm, o estimate of 6922 j k mol, while larger sampling times of 0.5 or 1.0 s are needed to sample 90% or 99% of the final s estimate of 5916 j k mol (see also supporting information, table s2). these results clearly demonstrate that the convergence of the sqm, o upper bound does not imply the convergence of the absolute single - molecule entropy, s. in fact, the first quantity relies on the convergence of linear motional correlations only (following from the definition of linearly independent qh modes in eq 7 with eq 8). instead, as described below, the second quantity requires in addition the convergence of supralinear motional correlations. for this reason, s seems to represent a better indicator of convergence (compared to sqm, o) for the absolute single - molecule entropy. the convergence behavior of the cumulative correction term, sclcrc (eq 20), was also monitored (figure 2c). this entropy term describes the overall deviation from the qh model due to mode anharmonicity (sclah, eq 18 ; 4 j k mol after 1.1 s) and correlation (sclpc, eq 19 ; 1002 j k mol after 1.1 s) effects, associated with all unique combinations of modes m and n. its convergence behavior can be used as well as a measure of uncertainty on the entropy estimate. for comparison with previous studies (figure 1), the time evolution of the corresponding relative contribution fclcrc (eq 21) to the uncorrected sqm, o estimate (eq 10 with eq 12) is also displayed (figure 2d). in all studies, the dominant part of this correction arises from qh pairwise (supralinear) mode correlations (fclah values are 1 s), consistent with the observation that the cc peptide steadily explores new configurations. in line with previous studies, the entropic contribution of anharmonicity is small while the pairwise (supralinear) correlation correction to the entropy is large. the deviation from the quasi - harmonic assumption affects more significantly conformational states dominated by high motional correlation. using microsecond molecular dynamics simulation of a peptide test system we show that limited phase - space sampling results in an overestimation of correlation effects, and we discuss its implications for entropy estimation. this study demonstrates that the convergence of the quasi - harmonic upper - bound entropy with simulation time does not imply the convergence of the system absolute single - molecule entropy. as a consequence, our study also suggests that the convergence of the absolute single - molecule entropy rather than that of the quasi - harmonic upper bound should be preferably monitored. because the cumulative correction term accounting for both mode anharmonicity and pairwise (supralinear) correlation effects converges slowly and monotonically decreases, previous studies based on shorter time scales may have, in some cases, partly overestimated this correction term, thus leading to underestimated absolute entropy estimates. overall, the present study emphasizes the need of sufficient phase - space sampling to estimate entropic contributions from computer simulations. ideally, only thermodynamic ensembles at equilibrium should be considered to this end, i.e., full phase - space sampling obtained from simulations on time scales of several microseconds. in practice, we suggest that enhanced sampling techniques and/or concatenated copies of independent simulation trajectories will be useful tools to alleviate these problems in the future if properly combined with the correction terms used herein.(28) this strategy will open the possibility to include as well correlation effects of higher order than the pairwise (supralinear) explicitly considered in this study. a bright future opens for the estimation of accurate thermodynamic properties for biomolecular systems using chemical theory and computation. | the convergence properties of the absolute single - molecule configurational entropy and the correction terms used to estimate it are investigated using microsecond molecular dynamics simulation of a peptide test system and an improved methodology. the results are compared with previous applications for systems of diverse chemical nature. it is shown that (i) the effect of anharmonicity is small, (ii) the effect of pairwise correlation is typically large, and (iii) the latter affects to a larger extent the entropy estimate of thermodynamic states characterized by a higher motional correlation. the causes of such deviations from a quasi - harmonic behavior are explained. this improved approach provides entropies also for molecular systems undergoing conformational transitions and characterized by highly frustrated energy surfaces, thus not limited to systems sampling a single quasi - harmonic basin. overall, this study emphasizes the need for extensive phase - space sampling in order to obtain a reliable estimation of entropic contributions. |
various causes of intractable hiccups have been reported ; however, to the best of our knowledge, there are no previous reports of either intractable hiccups due to esophageal candidiasis in an immunocompetent adult or improvement following antifungal therapy. an esophagogastroduodenos - copy revealed several white deposits throughout the esophagus and extensive white deposits in the midesophageal diverticulum. a mucosal culture showed candidiasis, which was suspected to be the cause of the intractable hiccups. therefore, we concluded that esophageal diverticular candidiasis was the cause of his intractable hiccups. physicians should consider esophageal candidiasis as one of the differential diagnoses for intractable hiccups, even in immunocompetent adults. hiccups result from brief and intense inspiratory bursts in the diaphragm and inspiratory intercostal muscles, with reciprocal inhibition of the expiratory intercostal muscles. after diaphragmatic contraction, glottic closure occurs immediately, minimizing the ventilatory effect and generating the characteristic sound and sense of discomfort.1 hiccups are usually transient, but some patients occasionally experience intractable hiccups. although the causes vary, there are only a few case reports of intractable hiccups associated with esophageal candidiasis, all of which occurred in patients with aids.2 here, we report an extremely rare case of intractable hiccups caused by esophageal candidiasis in an immunocompetent adult. an 87-year - old man presented to our hospital with intractable hiccups. in the last 2 years, he had twice experienced hiccups that persisted for several days and improved with the following symptomatic treatment from his primary physician : esomeprazole, metoclopramide, dimethicone, and prokinetic chinese herbal medicine (i.e., rikkunshito and daikenchuto). although this was his third episode of hiccups, he had not experienced them in the previous year. the patient described repetitive waxing and waning hiccup cycles lasting 3 days, with 47 days of relief. he took a chinese herbal medicine with antispasmodic qualities, shakuyakukanzoto, which he received from his primary physician, and the symptoms resolved at first. however, 3 months later, the hiccups lasted for an entire day and did not improve with symptomatic treatment ; therefore, he was referred to our hospital. he did not exhibit dysphagia, chest pain, chest discomfort, nausea, or headache. the patient reported frequent use of esomeprazole for hiccups and chronic use of amlodipine and bisoprolol for hypertension. his temperature, other vital signs, and the findings from a physical examination of the chest and abdomen were normal. his laboratory parameters were normal, with no evidence of an immunocompromised status, such as diabetes mellitus or aids (table 1). cranial magnetic resonance imaging revealed chronic lacunar infarcts ; cerebral tumor or ventricle enlargement was not observed. chest computed tomography showed a midesophageal diverticulum projecting rightward at the tracheal bifurcation (figure 1). the midesophageal diverticulum was localized on the right wall approximately 30 cm distal to the incisors (figure 2). white residue was observed at the diverticulum margin and was flushed out easily. in the diverticulum, extensive white deposits were observed. the deposits in the diverticulum were biopsied. his - topathological examination (hematoxylin and eosin staining) showed significant inflammatory cell infiltration and acantholytic finely fragmented squamous epithelial cells (figure 3a), grocott staining showed yeast and fungal filaments (figure 3b), and mucosal culture revealed candida albicans. the patient was prescribed 200 mg fluconazole once daily for 14 days, and the hiccups decreased markedly in frequency. after 2 weeks of treatment, the residue and white deposits were absent from the entire esophagus and diverticulum in the egd views. written informed consent was obtained from the patient for publication of this case report and any accompanying images. the local ethics committee of hyogo prefectural kaibara hospital judged that the ethical review of this case was unnecessary. virtually everyone experiences self - limiting, transient hiccups that last for several minutes or more. last longer than 1 month.3 in our case, the patient had been experiencing intractable hiccups for 3 months. however, the intractable hiccups stopped after the esophageal candidiasis had been treated successfully with oral fluconazole, which is an antifungal agent that is recommended as a first - line treatment for candidiasis by the japanese society for medical mycology and the european society of clinical microbiology and infectious diseases.4,5 therefore, we concluded that his intractable hic - cups were caused by esophageal candidiasis. although the mechanism underlying hiccups is unclear, it is thought that stimulation of the afferent portion of the hiccup reflex arc comprising the phrenic nerve, vagus nerve, and sympathetic chain is transmitted through central nervous system connections, such as the phrenic nerve nuclei, medullary reticular formation, and hypothalamus, and finally reaches the efferent component that is composed of the anterior scalene muscles, external intercostal muscles, glottis, and diaphragm.3 transient hiccups are caused by gastric distension, sudden temperature change, alcohol ingestion, excessive smoking, and psychogenic factors.6 the causes of persistent or intractable hiccups vary appreciably and include irritation of the vagus nerve (e.g., pharyngitis, pneumonia, aortic aneurysm, and pancreatitis), central nervous system abnormalities (e.g., intracranial neoplasms, hydrocephalus, and meningitis), toxic - metabolic disease (e.g., uremia, diabetes mellitus, and electrolyte imbalance), diaphragmatic irritation (e.g., myocardial infarction, hepatosplenomegaly, and subphrenic abscess), drug intake (e.g., alpha methyldopa, short - acting barbiturates, and dexamethasone), infections (e.g. typhoid fever, influenza, and tuberculosis), general anesthesia, postoperative complications, and psychogenic or idiopathic variables.6 esophagitis can cause persistent or intractable hiccups because of irritation of the thoracic branches of the vagus nerve ; however, to the best of our knowledge, there are only a few other case reports of intractable hiccups associated with esophageal candidiasis.2 furthermore, the present report appears to be the first to describe a case of intractable hiccups caused by esophageal candidiasis in an immunocompetent adult. in our case, we suspect that inflammation of the esophagus stimulated the afferent portion of the hiccup reflex arc. the presence of inflammatory cell infiltration in the biopsied specimen suggests that inflammation of the esophagus might have contributed to the hiccups. the symptoms of esophageal candidiasis are dysphagia, odynophagia, nausea, vomiting, retrosternal pain, and gastrointestinal bleeding, although some patients are asymptomatic.79 because hiccups are atypical symptoms in esophageal candidiasis, they might be related to the esophageal diverticulum and the white residue, which was observed at the diverticulum margin. however, it is difficult to imagine that the esophageal diverticulum caused the intractable hiccups by itself because the diverticulum remained, even after the hiccups improved. furthermore, because the white residue was flushed out easily, it is unlikely that it had irritated the vagus nerve and caused intractable hiccups of several months duration. esophageal candidiasis usually occurs in immunocompromised hosts, although sometimes it is present in immunocompetent adults. other risk factors for esophageal candidiasis are acid - suppression therapy (e.g., proton pump inhibitors or histamine-2 receptor blockers), elderly age, use of antibiotics, malignancy, diabetes mellitus, chronic renal failure, use of corticosteroids (systemic or inhalant), and use of another immunosuppressive agent.911 our patient had some of these risk factors (i.e., elderly age and use of proton pump inhibitors). furthermore, he had esophageal diverticulum. although, we do not think that esophageal diverticulum itself caused the intractable hiccups, it may have become a hotbed of candidiasis. perhaps consequently, he had esophageal candidiasis in spite of his immunocompetent status. clinicians should consider esophageal candidiasis as one of the differential diagnoses when treating a patient with intractable hiccups, especially if that patient is an elderly adult who is using acid - suppressing therapy or has existing esophageal diverticulum. | introductionvarious causes of intractable hiccups have been reported ; however, to the best of our knowledge, there are no previous reports of either intractable hiccups due to esophageal candidiasis in an immunocompetent adult or improvement following antifungal therapy.case presentationan 87-year - old man presented with intractable hiccups. although the patient was immunocompetent, he used proton pump inhibitors. an esophagogastroduodenos - copy revealed several white deposits throughout the esophagus and extensive white deposits in the midesophageal diverticulum. a mucosal culture showed candidiasis, which was suspected to be the cause of the intractable hiccups. after oral fluconazole had been prescribed, the candidiasis resolved and the hiccups improved. therefore, we concluded that esophageal diverticular candidiasis was the cause of his intractable hiccups.conclusionphysicians should consider esophageal candidiasis as one of the differential diagnoses for intractable hiccups, even in immunocompetent adults. |
natural killer / t - cell (nk / t - cell) lymphoma is a rare fast - growing lymphoma arising from the lining of the nose or upper airway. a 26-year - old young female presented with nasal obstruction, bloody discharge and swelling of the nasal skin and right lower eyelid. biopsy from the soft tissue seen in the nasal cavity revealed nk / t - cell lymphoma (nasal type). patient was referred to a whole body 18 fluoride (18f)-fluoro - deoxy glucose (fdg) positron emission tomography - computed tomography (pet - ct). 18f - fdg pet - ct performed showed intense fdg uptake in heterogeneously enhancing soft tissue in the right nasal cavity with extension into the skin of the cheek and right lower eyelid [figure 1 : a - maximum - intensity projection, b - axial ct, c - fused pet - ct ]. intense fdg uptake was also noted in enhancing soft tissue bilateral adrenal masses [d - axial ct ; e - fused pet - ct ] indicating disease involvement. a diagnosis of bilateral adrenal involvement by nk / t - cell lymphoma was made. 18 fluoride - fluoro - deoxy glucose positron emission tomography - computed tomography (18f - fdg pet - ct) performed showed intense fdg uptake in heterogeneously enhancing soft tissue in the right nasal cavity with extension into the skin of the cheek and right lower eye lid (a - maximum - intensity projection, b - axial ct, c - fused pet - ct). intense fdg uptake was also noted in enhancing soft tissue bilateral adrenal masses (d - axial ct ; e - fused pet - ct) indicating disease involvement morphologically, mature nk cells are large granular lymphoid cells, they are negative for surface cd3 but characteristically express cytoplasmic cd3 epsilon (), cd56, and cytotoxic molecules. there are two main categories of nk cell - derived neoplasms, namely, aggressive nk cell leukemia and extranodal nk / t - cell lymphoma, nasal type. nk / t - cell lymphoma of the nasal type accounts for 710% of all non - hodgkin lymphomas in asia and latin america, but only 1% of that amongst caucasians. the leukemic counterpart of nk / t - cell lymphoma, aggressive nk - cell leukemia is an uncommon disease. clinically, it is useful to classify nk / t - cell malignancies into two categories, namely, nasal nk - cell lymphomas, and nonnasal or extranasal nk / t - cell lymphomas, depending on the site of the lesions. nasal nk / t - cell lymphomas occur in the nose and the upper aerodigestive tract. bone marrow involvement occurs in < 10% of patients, and distant metastasis is unusual. extranasal or nonnasal nk / t - cell lymphomas occur outside the typical nasal region, and the common primary sites involved include the skin, gastrointestinal tract, salivary glands, spleen, and testis. unusual sites of involvement such as the muscle, the adrenal gland, and the female genital tract (ovaries and uterus) have been reported. occult nasal involvement should be ruled out with panendoscopy and multiple random biopsies in patients presenting with extranasal nk / t - cell lymphoma. disseminated nodal nhl can involve the adrenals in up to 25% of the cases. however, primary adrenal lymphoma is extremely rare with majority of the cases being b cell type. natural killer - cell lymphomas are fdg - avid and pet - ct offers more accurate definition of the extent of involvement by distinguishing lymphoma involvement from inflammatory masses. 18-fdg pet - ct is increasingly used both at diagnosis and for monitoring of response to therapy. pet changes the staging in up to 21% of the patients and alters the planned management strategy in 44% of the patients. pet parameters such as total lesion glycolysis, in addition to the international prognostic index, is useful in predicting prognosis of these patients. for the stage, i / ii nasal nk / t - cell lymphomas, radiotherapy is an important modality of treatment. recent evidence indicates radiation therapy alone is insufficient, and chemotherapy is also needed in these patients. nonnasal nk cell lymphomas tend to have advanced or disseminated disease at presentation, and the role of radiotherapy is often limited. for the stage iii / iv nasal nk / t - cell lymphomas, extranasal nk / t - cell lymphomas and aggressive nk - cell lymphoma / leukemia, chemotherapy is the primary treatment. l - asparaginase - containing regimens have shown promise as the tumor cells lack l - asparagine synthetase and are susceptible to l - asparaginase, which depletes l - asparagines in nk lymphoma cells. | natural killer / t - cell (nk / t - cell) lymphoma is a rare condition, which presents as necrotic, granulomatous lesions involving the nose and the upper respiratory tract. the condition usually has an aggressive clinical course. the predominant subtype of nk / t - cell lymphoma noted in asian population is the nasal type. we describe a case of biopsy - proven nk / t - cell lymphoma with bilateral adrenal involvement. adrenal involvement by lymphoma is usually of b - cell type and occurs in disseminated disease and often unilateral. bilateral adrenal involvement by t - cell lymphoma is extremely rare. |
eumycetoma is a chronic, relentlessly progressive, granulomatous subcutaneous disease caused by a true fungus. it commonly occurs in the extremities, the foot being the most common site of involvement. cranial involvement has only rarely been reported[24 ] and is often due to direct extension from the paranasal sinuses. recently, characteristic mri findings of the dot - in - circle sign and a conglomeration of multiple extremely hypointense dots have been reported in pedal eumycetoma.[58 ] we describe these characteristic findings on an mri of the brain in a case of cranial eumycetoma (ce) that was caused by direct inoculation of the organism madurella grisea. a 35-year - old man presented with complaints of seizures for 1 year, slowly increasing left parietal swelling for 6 months, and sudden - onset weakness of the right upper and lower limbs and inability to speak for 6 days. he had been diagnosed elsewhere as cranial tuberculosis on the basis of imaging findings and had been on regular antituberculous treatment and steroids for the last 1 year. there was no significant premorbid illness apart from history of trauma to the scalp on the left side. on examination, the patient had a glasgow coma scale (gcs) score of 10/15, papilledema, and right facial palsy. there was a small, tender, focal scalp swelling in the left parietal region. mri of the brain done elsewhere 1 year ago showed a left parasagittal, homogeneously enhancing, dural - based mass with surrounding edema, involving the underlying cerebral cortex. ct scan [figure 1 ] done in our institution at the time of presentation showed an intensely enhancing mass, with features of osteomyelitis in the adjacent parietal bone. contrast enhanced ct scan of the brain shows an intensely enhancing mass (arrow) in the left frontal lobe with adjacent edema the patient underwent biopsy of the lesion via a left parietal flap. it was firm and yellowish, with multiple blackish granules within ; it was also stuck to the calvarium. histology [figure 2 ] revealed fibrocollagenous connective tissue containing multiple microabscesses, with the central cavitary spaces containing several pigmented grains composed of hyphal mats. the abscess walls displayed granulomatous reaction, with dense infiltrates of histiocytes, foreign body photomicrograph shows a microabscess containing pigmented grains (arrows) surrounded by an inflammatory reaction, including foreign body giant cells (h and e, 90) postoperatively, there was some improvement in speech and right upper and lower limb power. repeat mri after 1 year [figures 3 and 4 ] revealed an iso- to hypointense mass and surrounding edema in the left frontal region on t2w and fluid - attenuated inversion recovery (flair) images. dots representing fungal grains and the dot - in - circle sign was present. when compared to the previous imaging findings, there was a slight decrease in the size of the mass and the surrounding edema. currently, he is doing well clinically. his epilepsy is mostly controlled and he has grade 3 - 4 power in the limbs. axial flair (a) and t2w (b) mri images show a conglomeration of multiple extremely hypointense dots (arrows) within an iso- to hypointense mass in the left parasagittal frontal lobe, involving the motor cortex coronal t2w mri image (a) shows an iso- to hypointense left parasagittal frontal lobe mass (black arrow), with altered marrow signal (white arrow) in the overlying parietal bone. magnified coronal t2w mri images (b, c) show a few hypointense dots (open arrows) within the hyperintense granulomas (white stars) separated by hypointense walls (white arrows), giving the dot - in - circle sign. diffusion - weighted mri image (d) shows small hyperintense areas (arrow) of restricted diffusion, probably representing microabscesses. the recently described characteristic dot - in - circle mri sign in pedal eumycetoma represents a t2-hyperintense granuloma, with central hypointense dots of fungal grains separated by hypointense fibrous walls.[58 ] a conglomeration of multiple hypointense dots of fungal grains against the background of inflammatory granulomas was also seen. the grains were identified as hypointense dots on both t1w and t2w images and their mri signal was attributed to the magnetic - susceptibility effects of the paramagnetic elements of the grains. the present case also showed the typical conglomeration of multiple extremely hypointense dots within the mass, correlating histopathologically with multiple fungal grains. a few of the hypointense dots within the hyperintense granuloma were seen separated by hypointense walls, giving rise to the characteristic dot - in - circle sign on t2w images and probably correlating histopathologically with central fungal grains surrounded by dense granulomatous inflammation and fibrocollagenous tissue. we also noted a few small areas of restricted diffusion on dwi, probably reflecting microabscesses [figure 4d ]. an isointense to hypointense mass on t1w and t2w images, with or without peripheral extremely hypointense areas and central necrosis, has been described in ce. ce may be mistaken for other dural - based masses, such as meningioma or tuberculomas, even in endemic regions. both meningiomas and tuberculomas can present with a similar iso- to hypointense dural - based mass on t1w and t2w images, but the characteristic mri findings of ce would not be present. culture of the organism is considered the gold standard for confirming the diagnosis of eumycetoma. however, this takes a long time and false positive results can occur due to contamination of the sample. the characteristic mri findings can help make an early noninvasive diagnosis of ce and allow differentiation from other dural - based hypointense lesions. | cranial eumycetoma (ce) due to direct inoculation of madurella grisea into the scalp is extremely rare. we describe a case of ce caused by direct inoculation of m. grisea with the characteristic mri findings of the dot - in - circle sign and a conglomeration of multiple, extremely hypointense dots. |
orthodontic forces generate cellular and molecular responses, resulting in tooth movement. a difference in the expression pattern of bone modeling markers and histological changes is reasonable assuming that molecular changes in the compression zone are different than those in the tension zone of the periodontal ligament (pdl) and that these changes may depend on the magnitude and duration of orthodontic force. the biological response in pdl and bone has been interpreted as an aseptic inflam matory process mediated by prostaglandins and cytokines.1 osteoprotegerin (opg) and the ligand receptor activator of nfkb (rankl) have an important role in orthodontic tooth movement.2 the key - signaling pathway of rank rankl opg explains how the osteoblast lineage regulates the differentiation and activity of osteoclasts in physiologic and pathologic conditions and also in orthodontic movement.3 opg is a decoy receptor produced by osteoblasts that inhibits terminal stages of osteoclast differentiation, suppresses activation of matrix osteoclasts, and competes with rank for rankl binding, accelerating osteoclast apoptosis.4 opg and rankl interact with interleukin (il)-1, il-1, tumor necrosis factor (tnf), tnf, bone morphogenetic protein 2, and prostaglandin e2 (pge2) in bone modeling5 ; however, it has been proposed that tnf and il-1 regulate osteoclast differentiation and function through a mechanism independent of the rankl rank interaction.6 in orthodontic tooth movement, opg gene transfer inhibits rankl - mediated osteoclastogenesis, preventing experimental tooth movement.7 the rankl is a member of the membrane - associated tnf ligand family, expressed by mesenchymal cells of osteo - blast lineage and activated t cells (soluble rankl) in a state of skeletal inflammation.8 rankl expression is stimulated in osteoblast cells by most of the factors that are known to stimulate osteoclast formation and activity and is a downstream regulator of osteoclast formation and activation.9 rankl has an important role in osteoclastogenesis when it binds to the rank receptor in osteoclasts lineage cells, stimulating them to assume the osteoclast phenotype through interaction with multiple hormones and cytokines.10 rankl has been associated with pdl fibroblasts, osteoblasts, and osteocytes during orthodontic tooth movement.11 in vitro, pdl cells exposed to compressive forces express rankl.12 nishijima.13 showed an increased concentration of rankl in gingival crevicular fluid during orthodontic tooth movement, and in human pdl (hpdl) cells exposed to compression force, in a time- and force magnitude - dependent manner. additionally, it has been shown that local rankl gene transfer to the periodontal tissue accelerates orthodontic tooth movement12 and is expressed early in the compression side of teeth being moved orthodontically.14 to our knowledge, no published study has compared the expression and concentrations of opg and rankl in hpdl loaded with orthodontic forces of different magnitude. therefore, the aim of the present study was to investigate the differential expression and concentration of the rankl and opg in the hpdl with orthodontic force. this study was conducted according to a protocol reviewed by the ethics committee of the dentistry faculty at the pontificia universidad javeriana. thirty - two subjects ranging in age from 15 to 25 years who required premolar extraction as part of their standard orthodontic care were enrolled in the study. each subject exhibited good general health, healthy periodontal tissues, and was without caries in the premolars selected for extraction. patients were excluded if they had taken any medications for up to 4 months before the study or if they had a metabolic pathology or syndrome. using a split mouth experimental design, the maxillary right first premolar of each subject was treated as the experimental group and the maxillary left first premolar was utilized as a control. edgewise brackets were placed in both arches ; however, teeth in the control group were not bracketed. after obtaining informed consent from the subjects, the maxillary right first premolar of each subject the force applied to the premolars in each group was measured using dontrix (dentspaly). the experimental teeth were moved to the buccal with appliances designed specifically for this study (fig. both maxillary first premolars were extracted as indicated for treatment. immediately after tooth extraction, the pdl was recovered from the middle zone of the pressure side (labial) and the middle zone of the tension side (palatal) of each experimental tooth with a curette (hu - friedy). a portion of each pdl sample was stored in phosphate - buffered saline (pbs) at 70 c for protein determination by elisa, and a portion was stored in rnalater stabilization solution (ambion / life technologies) at 70 c for quantitative reverse transcription polymerase chain reaction (qrt - pcr) analysis. the pdl tissues in pbs were mechanically disaggregated and homogenized by ultrasonic processor s-2028 - 130 (isc bioexpress). then, 250 l of acetic acid was added and boiled in water bath for 10 minutes. the disaggregated tissue was centrifuged at 3,500 rpm for 45 minutes in ags-6kr centrifuge (beckman). the suspensions was incubated for 2 hours and centrifuged at 5,000 rpm for 1 hour. the presence of protein was verified by sodium dodecyl sulfate polyacrylamide gel electrophoresis, and protein concentration was determined by fluorescence spectroscopy (quibt). total protein of 10 g / ml was used with the elisa kits for opg and rankl (r&d systems) according to the manufacturer s instructions. all samples and standards were assayed twice and reported as concentration (g / ml). the sequences of the genes opg, rankl, and -actin were obtained from national centre for biotechnology information, nih, with accession numbers nm_002546.3, nm_003701.3, and nm_001101.3, respectively. all tissues were digested with 20 mg / ml proteinase k (invitrogen) for 1 hour at 55 c, rna was then extracted from the samples using trizol reagent (invitrogen/life technologies) according to the manufacturer s instructions. rna was suspended in 30 l diethylpyrocarbonate (depc) water and quantified with nanodrop1000 spectophotometry. complementary dna (cdna) was synthesized using superscript iii first - strand synthesis supermix and oligo(dt)20 (invitrogen) according to the manufacturer s instructions. qrt - pcr was performed using the sybrgreen i master (roche) for the target genes opg and rankl and for the -actin housekeeping gene. the final concentrations were 1 master mix, 20 nm primer, and 50 ng cdna. the negative controls used were a mixture of pcr reagents and depc water without rna and without reverse transcriptase. the standard pcr conditions were 95 c (10 minutes, one cycle), and then 40 cycles of 95 c (10 seconds), 63 c for -actin, 62 c for opg, 58 c for rankl (10 seconds), and an extension step, 72 c (15 seconds). the melting curve conditions were 95 c for 5 seconds, 65 c for 1 minute, and 40 c for 10 seconds (lightcycler 480 system ; roche). relative genetic expression of target gene was calculated using 2 formula with normalization of housekeeping gene -actin. to identify possible differences in the rankl / opg mrna expression and rankl / opg levels between controls, tension, and compression samples, an analysis of variance test was performed as the gaussian distribution of the data was normal. for all the tests performed, values of p 0.05). as the opg and rankl proteins are regulators of extracellular matrix and bone metabolism, the presence of both proteins in pressure and tension sides of hpdl under orthodontic forces was evaluated. the elisa test results showed that rankl protein level was significantly greater in the pressure sides with 7 oz (p 0.05). as the opg and rankl proteins are regulators of extracellular matrix and bone metabolism, the presence of both proteins in pressure and tension sides of hpdl under orthodontic forces was evaluated. the elisa test results showed that rankl protein level was significantly greater in the pressure sides with 7 oz (p < 0.0001) and with 4 oz of force when compared with tension sides in the experimental group and with the control group. therefore, rankl protein levels in compression sides in the experimental teeth were higher than those in the tension side and control teeth in all groups (p < 0.0001). in contrast, there were no statistically significant differences in opg level on comparing force magnitudes (p = 0.07) and on comparing pressure and tension sides in the experimental teeth with those in the control teeth (p = 0.83). the protein concentrations of opg ranged from 85 to 165 g / ml (fig. although the concept of tension and pressure sides of a tooth generated by orthodontic forces simplifies the biological response in the pdl and bone, differential expression of bone modeling marker has been observed in vivo according to the pattern of tooth displacement.15 the tension side has been characterized by an increase in osteoblast number and pressure side by osteoclasts and bone resorption. the present study showed an increased protein concentration of rankl in compressed hpdl cells in a force magnitude - dependent manner (rankl was increased in pressure side loaded with 7 oz of force). this finding was reported previously in hpdl in vitro,11,16 in hpdl in vivo,17 in compressed cells of human crevicular fluid,1821 in loaded miniscrew in humans,22 and in rat pdl.2023 these findings support the role of rankl in osteoclastogenesis mediated by pdl cells subjected to compressive forces. in contrast, the expression of rankl showed statistically significant difference (p < 0.0001) in tension and pressure sides loaded with 4 oz force compared with control group (unloaded teeth). these finding were reported previously in human17 and mice24 and were explained based on the expression of rankl in osteoblasts, fibroblasts, and osteoclasts in resorption lacunae. then, the number of osteoblasts present in the tension side loaded with light force (4 oz) could be higher than those present in the tension side loaded with 7 oz force showing a similar expression of rankl in the side with more osteoblasts (tension, 4 oz) and in the pressure side. although increased rankl has been demonstrated in loaded hpdl and crevicular fluid in vivo, and in loaded fibroblasts and osteoblasts in vitro, the effect of force magnitude in the response of rankl is not yet clear. nettelhoff.25 compared the response of hpdl fibroblasts and osteoblasts after the application of compressive force at two different strengths in vitro (2 and 4 cn / mm) over 12 hours and reported the highest mrna expression of rankl after 2 cn / mm of compressive force in hpdl fibroblasts and osteoblast, but mrna expression of rankl did not increase when the magnitude of compressive force was increase to 4 cn / mm. nishijima.13 retracted experimental canines using an elastomeric chain that delivered an initial force of 250 g for 1, 24, and 168 hours and applied compression force of different magnitudes (0.5, 1.0, 2.0, or 3.0 g / cm) to culture hpdl. they reported the highest concentration of rankl after 24 hours in vivo with 2 g / cm in vitro. in our study, we demonstrated an increase in rankl when orthodontic force augmented but we did not know whether the expression of rankl is also time dependent. therefore, further studies are necessary to confirm whether the response of rankl in compressed hpdl cells is time and force magnitude dependent. in contrast, our study did not demonstrate an effect on opg expression secondary to orthodontic force since the presence and expression of opg were similar in all groups (experimental and control). some studies demonstrated a significant decrease in opg in compressed cells,26,27 and an increase in opg in the tension sides in a time- and force magnitude - dependent manner.18,19,28 however, other studies did not find differences in the amount of opg around the loaded and unloaded miniscrew implants after different times of application force21 and in opg expression in human primary cementoblasts under compression forces in vitro compared with control group.29 the biological function of opg in the opg / rank / rankl system is the inhibition of osteoclast function and the acceleration of osteoclast apoptosis.30 similar amount of opg in tension, compression, and unloaded zones could suggest that the number of osteoclasts in pressure side should be maintained to get adequate bone remodeling after application of orthodontic forces. the increased ratio of rankl / opg in teeth loaded with orthodontic forces has been showed in several investigations.31 it seem that teeth in young people move faster than in older people because rankl / opg ratio measured by elisas is higher in young people.32 however, in our study the significance of ratio was a con sequence of the increase in the mean concentration of rankl, no for decrease in opg concentration. the increased expression of rankl is regulated by inflammatory chemokines such as pge2,33 mcp-1, mip-1a, sdf-1 and rantes,17 and trail.34 further, two major signaling pathways could regulate the osteoblasts : opg / rank / rankl and wnt/-catenin35 ; and the activation of osteoclasts could occur through the atpp2xr7/il-1 inflammation modulation pathway36,37 or through the opg / rank / rankl network. further studies comparing different age groups, magnitudes, and duration of orthodontic forces should be performed to clarify the exact role of rankl and opg in orthodontic movement. although the literature about the exact role of opg / rank / rankl system revealed high heterogeneity in the study design, it is clear that orthodontic forces activate this system and release inflammatory bone resorptive mediators such as il-1 and tnf-. tnf, il-1, and il-6 can act directly on osteoclasts independent of rankl.38 however, osteotropic hormones and cytokines regulate the concentration of opg, rankl, glucocorticoids, and inflammatory cytokines (il-1, il-4, il-6, il-11, il-17, and tnf-) stimulating osteoclastogenesis by induction of rankl expression.39 using animal models, local opg gene transfer has been used to inhibit relapse after orthodontic movement,12,40 and local rankl gene transfer has been used to accelerate orthodontic tooth movement in rats.7 these findings demonstrate the therapeutic potential of rankl and opg protein and highlight the importance of the research in this topic for orthodontics and the importance to study the role of opg and rankl in orthodontic movement. the knowledge of the role of opg / rank / rankl and atp / p2xr7/il-1 in orthodontic response could be use in the biomarkers for orthodontic treatment41 and will allow the design of medications or other interventions to affect the rate of tooth movement and the root resorption concurrent with orthodontics. rankl expression and concentration are increased in compression side as a consequence of application of orthodontic force. this finding suggests that rankl contributes to bone modeling in response to the initial placement of orthodontic force. further studies are necessary to clarify the role of rankl and opg in human orthodontic movement. | objectivethe objective of this study is to investigate the expression and concentration of ligand receptor activator of nfkb (rankl) and osteoprotegerin (opg) in human periodontal ligament (hpdl) with orthodontic forces of different magnitudes.methodsright premolars in 32 patients were loaded with 4 oz or 7 oz of orthodontic force for 7 days. left first premolars were not loaded. after 7 days, premolars were extracted for treatment as indicated. opg and rankl mrna expressions were measured by quantitative reverse transcription polymerase chain reaction (qrt - pcr), and elisa was used to assess opg and rankl protein concentration in compression and tension sides of pdl. data were subjected to analysis of variance and tukey tests.resultsthere was statistically significant difference in rankl concentration on comparing control teeth with tension and compression sides of the experimental teeth (p < 0.0001). the expression of mrna rankl was increased in the tension and compression sides with 4 oz (p < 0.0001). opg did not show statistically significant association with any group. changes in rankl / opg protein ratio in experimental and control groups showed statistically significant difference (p < 0.0001).conclusionsrankl protein levels are elevated in hpdl loaded with orthodontic forces, suggesting that rankl protein contributes to bone modeling in response to the initial placement of orthodontic force. |
according to the diagnostic and statistical manual of mental disorders, developmental coordination disorder (dcd) refers to those children whose acquisition and execution of motor skills is substantially below their age and opportunities for learning. the coordination problems are expressed in slow and inaccurate performance of motor skills, including activities of daily life, sports, and leisure activities. dcd is sometimes called a motor learning deficit, as these children have difficulties learning to perform all kinds of motor skills in daily life which their typically developing (td) peers seem to acquire almost effortlessly. td children learn motor skills either implicitly or explicitly by observing and imitating other children and adults or by trial and error. important in motor learning is the inherent ability of td children to monitor their own performance, to detect possible errors, and to identify possible sources of these errors. in addition to the ability to detect and correct errors, the amount of practice with a particular skill, or time - on - task, is an important determinant of improved motor skill in children. for instance, in infants, the amount of experience in locomotion is regarded as the most important determinant of improvements in walking skill. an important question in dcd is whether the motor learning deficit is merely a matter of lack of sufficient practice. put another way, if we give children with dcd sufficient opportunities to practice motor skills, will their motor problems gradually disappear ? although dcd is characterized by deficits in skill acquisition, remarkably little research has been done in this domain. the few studies that have attempted to study questions relating to deficient or inefficient learning in children with dcd are inconsistent in outcome. it is reported that the children with dcd are delayed in reaching the level of automaticity. an important new part in the description of the dsm 5 criteria is that the child with dcd should have had enough opportunities for learning. recent theory also acknowledges that contextual factors may play a large role in mediating developmental outcomes and should be taken into consideration early on. to date, no intervention studies are known, which tested if children with dcd only need more time and opportunity to practice in order to reach an appropriate level of performance in motor tasks compared to their td peers. if that were the case, then specific intervention would not be necessary, but rather providing the child more exercise time with enriched affordances by the home and school environment should suffice. based on these findings, there is a clear need for rigorous intervention studies using different motor learning paradigms, ranging from simply giving enough opportunity to practice to tailored client - focused interventions. ideally, these studies should involve not only valid and reliable test outcome measures but also pre- and post - fmri measurements to look at task - related changes in the brain. the icf defines participation as the involvement of a person in a life situation. in the case of motor activities, it encompasses involvement in activities of daily living (adl) or in sports and leisure time motor activities. participation refers not only to the amount of time a child engages in motor activities but also to the perceived ability to perform well and the motivation to perform an activity. several studies suggest that children with dcd have an activity deficit, as they participate less in adl and in both organized and non - organized physical activities [7, 8 ]. organized activities include both school - related activities and activities outside school, such as participating in organized sports. non - organized activities include activities performed during leisure time at home or during recess at school. for instance, observation of the amount of motor activity during recess at school showed that children with dcd were most often onlookers, observing the active play of other children. but also during organized activities such as physical education classes at school, children with dcd engaged more often in off - task behaviors, such as going to the toilet, than on - task behaviors. it is obvious that activity limitations experienced by children with dcd will influence participation in sports or activities in which these fundamental movements are required. several other reasons have been put forward for their reduced participation, such as avoidance of failure experiences. their lower scores in scales measuring perceived physical competence demonstrate that at a certain age these children are well aware of their lack of competence in motor skills [12, 13 ]. the vicious circle that develops out of avoidance of participation in motor activities is obvious : reduced participation leads to diminished opportunities to practice motor skills, which may result in less opportunity to improve motor skill performance. as a consequence, children with dcd not only become less physically fit but are also found to experience more loneliness as they participate less in social play and sports [14 ]. all these factors together may contribute to the development of internalizing symptoms as anxiety and depression in children with dcd [14, 15 ]. however, reduced participation is not the only explanation for the motor skill deficits of children with dcd. in a recent, yet unpublished study, this questionnaire consists of three scales ; parents rate for 23 adl items how well children are able to perform the activities, whether it took longer to learn the activities, and how often children participate in these activities. according to the parents, children with dcd however, in the majority of those tasks (17 out of 23), they were rated to participate as often as their peers. these adl included dressing, writing, hopping in squares, and brushing teeth, tasks often mentioned as difficult to perform for a child with dcd. although we subscribe the necessity of participation or time - on - task for learning a motor skill, the results of the aforementioned study highlight that mere participation may not be enough to improve the level motor skill learning in children with dcd. other factors may also play a role, such as learning from doing and the problem - solving skills of a child. in order to improve performance, it is necessary that children with dcd develop the right problem - solving skills, such as the ability to identify and correct errors. to this end, it is also important that they possess accurate understanding about the requirements of a motor task [16 ]. several studies have demonstrated that this understanding is often lacking in dcd [17, 18 ]. consequently, they often focus on less relevant aspects or incorrect causes of an incorrect motor activity when they try to identify possible causes for their incorrect task performance, for instance by referring to lack of luck as a cause for failure or by stating that the target is too far away when in fact they threw the ball too soft. in general, children with dcd were found to less often plan, monitor, and evaluate their performance. this is in line with a recent study ; hyland and polatajko reported that children with dcd were able to recognize that their motor performance was not adequate, but they failed to identify the cause of their performance deficit. for that reason, sangster and whitebread concluded that intervention should also incorporate the development of problem - solving abilities in children with dcd to enable them to improve their motor skills [16 ]. otherwise, impaired cognitive - motor function may limit their ability to benefit from the interactions with the environment and compromise their psychosocial development. thus, supportive, enabling environments should create opportunities for motor skill development and promote emotional engagement in physical activity. so we may conclude that treatment of dcd may not just be a matter of offering opportunities to practice motor skills but also of creating an environment in which children can engage in the (physical) activity and learn to detect and correct their motor performance. in the next paragraph over the past 40 years, several treatment methods have been developed, which can be divided roughly into two categories : process - oriented treatment approaches and task - oriented treatment approaches. the main assumption of process - oriented or deficit - oriented approaches is that a deficit in a body structure or sensory process is responsible for the motor skill problems of children with dcd. the aim of treatment is to remediate this deficit, which will result in improved motor task performance. one of the most well - known examples of a process - oriented approach is sensory integration therapy. however, despite its popularity, results of a recent review and meta - analysis of the efficacy of interventions (published between 1995 and 2011) showed that the effect size of process - oriented intervention is weak (0.12) [23 ]. the results of this study are in line with those of a comparable meta - analysis summarizing the efficacy of interventions investigated in studies published between 1983 and 1993. due to the limited availability of methodologically sound studies, the application of process - oriented approaches (like sensory integration therapy) was not recommended in the recent recommendations of the european academy of childhood disabilities (eacd) on the definition, diagnosis, and intervention of dcd [25 ] and not recommended in a policy statement of the american academy of pediatrics. task - oriented approaches focus on teaching those motor tasks that are difficult for a child with dcd, and are designed to improve functional outcomes. for each task, task performance is analyzed in order to identify aspects of the task that are difficult for a child. recent examples of task - oriented interventions are neuromotor task training (ntt) [2729 ] and the cognitive orientation to daily occupational performance (co - op) [30, 31 ]. ntt is based upon motor learning theory and the ecological approach [23, 29 ]. the first step is the identification of those tasks and activities related to participation, which are of greatest concern to the child and his family these are the target of treatment. by using motor teaching strategies, therapists guide children through the different phases of motor skill learning by gradually increasing task demands. task constraints refer to aspects of the task that restrain a motor activity, such as when a child can not catch a ball that is thrown with too much force or can not close a shirt with very small buttons. environmental constraints refer to aspects of the environment that impede performance, for instance when a child tries to cycle when the wind blows too hard or when people are watching. these task and environmental constraints are manipulated in intervention sessions to provide the opportunity to practice and improve the deficient motor skills. in the early phase of learning, providing simple verbal instruction as to the intended outcome of the skill may be adequate to stimulate practice. next, the child is provided with augmented feedback (information about their performance from the therapist or other external sources) so that they can improve performance on subsequent practice attempts. techniques such as guided discovery (ask and not tell) are applied to promote efficient learning, to ensure development of the skill, to influence the child s motivation to persist with practice, and to encourage the child to reflect on their performance to promote problem - solving skills. co - op is a child - centered approach based upon cognitive behavior modification theories, in particular the verbal self - instruction strategy developed by meichenbaum. it focuses on the acquisition of self - chosen occupational skills. during a co - op intervention, a child learns this self - instruction strategy, which enables the child to identify why the performance was not successful and to invent and execute plans to correct their performance (the goal - plan - do - check strategy). both ntt and co - op proved to be effective task - oriented intervention approaches for children with dcd according to the results of the meta - analysis by smits - engelsman. the common factor in both approaches seems to be the development of meta - cognitive skills during intervention, such as the ability to identify and correct performance problems. in a recent study, hyland and polatajko demonstrated that children with dcd learned to improve the ability to self - monitor their performance and to identify and correct errors during a co - op intervention. children not only analyzed their performance more often but were also better able to analyze what was going wrong, for instance when a child fails to write straight and comes up with the solution that a ruler is needed to improve performance. according to the authors, this effect was prompted by providing augmented feedback by the therapist and by using guided discovery, i.e., by asking questions about the performance. these results are in line with those of a study concerning ntt investigating the association of the application of teaching principles with treatment effectiveness. in particular, those teaching principles that enhanced problem - solving abilities proved to be effective, such as asking questions about the children s task performance and sharing knowledge about how to improve task performance. so, we may conclude that it is not only the increased time to practice motor skills that lies behind the effectiveness of task - oriented approaches but also the development of meta - cognitive problem - solving skills, which the child can draw on to learn other skills. since the publication of the meta - analysis of the effectiveness of intervention approaches, a new development can be noticed in intervention studies, i.e., the application of serious games. as mentioned before, time - on target is an important ingredient of treatment success. practicing motor skills during intervention sessions is often not enough to increase motor skill performance. in order to increase treatment effectiveness and to promote transfer of what has been learned to daily life, however, children with dcd are often not inclined to engage in physical activities at home. according to a study of kwan., boys with probable dcd reported not enjoying physical activities, and they did not feel that they were able to practice regularly. as a consequence, their motivation to become physically active is low. as mentioned before, both motivation and the perceived ability to perform well are important moderators of participation. the lack of enjoyment and motivation prompted clinicians to consider options that might encourage a more positive attitude towards physical activities. children will be more inclined to practice the activities if they are enjoyable and if they experience success. therefore, the need for enjoyment and the need to experience success should be important ingredients of intervention options. a serious game is the application of an interactive game that can be used for purposes other than mere entertainment, such as rehabilitation. children in general like to play games, as they are fun and motivating, as often some kind of reward is offered when they perform well. application of serious games as part of an intervention session or as exercises at home may motivate the children to practice more often and as such may increase the number of hours children with dcd are physically active. several commercially available games have been developed that can encourage children and adults to be physically active, such as the nintendo wii fit training, the kinect, and the eyetoy for playstation. recently, four studies have been conducted to investigate the effectiveness of these games as (part of) an intervention for children with dcd. in a small pilot study, hammond. investigated the effectiveness of a wii fit intervention on motor proficiency and on emotional and behavioral problems of children with dcd. two groups of children were included : a group of ten children with dcd who played nine wii fit games focusing on coordination and balance and a group of eight children who practiced motor skills in groups 1 h per week. each intervention session lasted 10 min and took place three times a week for a month. motor abilities were measured with the bruininks - oseretsky test (bot-2), and emotional and behavioral problems were measured with the strengths and difficulties questionnaire (sdq) filled out by parents. significant improvements in motor skills were seen after wii fit intervention, not only in skills measuring balance but also fine motor precision and visuo - motor integration, although less pronounced. however, the improvements in motor skills were not maintained after a period of 2.5 months without wii fit intervention. nevertheless, the results of this study are encouraging, as they provide evidence of the immediate effectiveness of a wii fit training, its popularity with the children, and its positive effect on their motivation to practice. in another pilot study, the effectiveness of the playstation 2 eyetoy game on motor skills and aspects of physical fitness was explored for 46-year - old children with dcd. nine children referred to physical therapy suspected of dcd were included who played the eyetoy games for 60 min once a week over 10 weeks. several eyetoy games were played, such as volleyball, bowling, and boot camp, requiring accurate upper - extremity movements that involve motor planning, balance, and eye - hand coordination. effects of intervention were assessed with the movement assessment battery-2 (mabc2), the developmental coordination disorder questionnaire (dcdq), the walking and talking test, and the 6-min walk test (6mwt). like the earlier study, children s overall performance on the mabc2 improved after intervention, particularly balance skills. an improvement in daily motor activities was also reported by the parents of the children. walking speed and walking distance the lack of effect of intervention on walking endurance may be due to the fact that walking endurance was only practiced in two of the games. an interesting part of this study is that from the fifth intervention session onwards, games were introduced in which children had to play against their parents. both children and parents enjoyed playing together, and the children exerted more effort when playing with their parents. although the evidence is scarce, the results of several studies confirm that virtual reality games enhance the motivation to engage in practice. players were found to perform better in a rehabilitation setting when they played in competition. in general, one of the major advantages of virtual reality games is the opportunity to vary task and environmental constraints : the games offer enriched environments, and children can practice functional movements repeatedly (time - on - task) under different task constraints. investigated the effect of the wii fit balancing games on the balance skills of 14 children with probable dcd and balance problems. children practiced the wii balancing games for 30 min, three times a week for 6 weeks. eighteen wii balancing games were available, and children were free to choose the games they wanted to play to increase variability of practice. a second group of 14 children with probable dcd and balance problems was included to serve as a no - treatment control group. performance was assessed pre - post with the movement assessment battery for children (mabc2), the wii fit ski slalom test (which was not practiced), and three subtests of the bot-2 (balance, running speed and agility, and bilateral coordination). after intervention, a positive effect on balance skills was found, as measured with the balance test of the mabc2 and the bot-2 scales running speed and agility and bilateral coordination. the effects of the wii intervention were largely task specific, as only those skills improved that were close to the balance tasks trained. the effects of a wii fit training have also been compared to those of ntt. the group receiving ntt consisted of 27 children with dcd and were treated in groups of five to eight children, two times a week for 4560 min over 9 weeks. a second group of 19 children with dcd underwent wii fit training for 6 weeks, three times a week for 30 min. these children practiced various games, such as cycling, skiing, soccer, and skateboarding games as well as five games incorporating arm movements. effects of treatment were assessed with the mabc2, the functional strength measure (fsm), a hand - held dynometer (hdd), the muscle power sprint test (mpst), and the 20 metre shuttle run test (20msrt). although both groups improved on the mabc2, only for the ntt group was this statistically significant. interestingly, the effects of ntt also transferred to tasks not practiced, such as tasks measuring manual dexterity. previous studies on the effectiveness of ntt also demonstrated transfer effects to untreated skills, such as handwriting skills and balance. isometric strength did not improve for either the ntt or wii fit group, but anaerobic performance did, for both groups. taken together, these results suggest that application of serious games such as the wii fit might be useful for children with dcd with low cardiorespiratory fitness. the authors conclude that the results of their study support the application of both ntt and wii training for children with dcd, but the results of ntt were superior. the results regarding the effectiveness of the application of serious games in intervention in these four studies are promising. an important difference between serious gaming and regular physical or occupational therapy is that children learn to perform motor skills more implicitly during serious gaming, as no formal instruction is part of the training. the increase in performance after playing serious games demonstrates that children with dcd are able to learn implicitly. these findings are in line with those of other clinical groups, such as children with cp who benefit from implicit motor learning. possible elements that induce the effects of playing serious games are the multiple repetition of tasks, variability of practice, and the provision of augmented feedback about their performance. it is well known from literature about motor learning that these elements enhance the acquisition of motor skills. in addition, children often practice serious games on their own and not with other children. playing on their own has the advantage that they do not have to be afraid of failing in front of other children. when children with dcd can practice on their own, and when the games are fun to play, they will be more motivated to engage in physical activities. on the other hand, playing against children with the same level of disabilities in a therapy setting can enhance their motivation and research findings demonstrate that children perform better in competition. despite the effectiveness of serious games, the results of ferguson. demonstrate that practicing serious games is effective, but not as effective as a regular task - oriented intervention, such as ntt. as only one study has compared the effectiveness of ntt with those of serious gaming, definite conclusions can not yet be drawn. however, the results of ferguson. an important difference between serious gaming and regular intervention is that learning is more explicit in regular intervention, as therapists provide feedback, but also teach problem - solving skills, such as the goal - plan - do - check strategy in co - op, and engage children in guided discovery during both co - op and ntt. as mentioned before, children with dcd lack these meta - cognitive problem - solving skills, and teaching these skills seems to be an effective element of regular intervention. the superior effectiveness of regular intervention in comparison to serious gaming may be due to the development of these problem - solving skills during regular intervention. however, serious gaming can be an important complementary intervention, which may enlarge the effectiveness of regular intervention. however, for some children with dcd, participation is affected not only by poor motor learning but also by contextual barriers such as the attitudes and support of others, and self - efficacy beliefs, all of which should be taken into account to prevent an activity disorder. the results of studies evaluating the effectiveness of intervention demonstrate that without any kind of intervention, most children with dcd generally do not improve their motor skills to normal standards. so far, specific task - oriented intervention methods, such as co - op and ntt, have proven to be most effective. as well, merely offering the children the opportunity to practice motor skills, for instance by playing serious games, can lead to improved motor performance, but to a lesser extent than task - oriented intervention. what we learn from the success of serious games is the importance of success experiences and practice in a safe environment. whether serious games can be enlisted to produce sustained effects is an issue for future investigation. whatever the intervention, explicit motor teaching with an emphasis on developing meta - cognitive problem - solving skills seems to be a necessary ingredient for children with dcd. furthermore, influencing contextual factors to create circumstances where the children can be active and keep practicing have to be part of the overall approach. important factors may be to create a support system, which encourages children to stay active over time. for instance, informing parents about the necessity may help them to support their children to practice regularly. to date, only a few studies evaluating the effectiveness of intervention for children with dcd have been conducted, and more research specifically on the best way to deliver the intervention is necessary to come to more definite conclusions. questions that need to be addressed are how implicit and explicit learning can best be combined in intervention and in which stage of motor learning they may be effective. also, the long - term effects of serious gaming have yet to be established. so far, we know little about the transfer of the effects of gaming to daily life motor performance. and it is important to investigate whether children continue to practice once the intervention has come to an end. | developmental coordination disorder (dcd) is often called a motor learning deficit. the question addressed in this paper is whether improvement of motor skills is just a matter of mere practice. without any kind of intervention, children with dcd do not improve their motor skills generally, whereas they do improve after task - oriented intervention. merely offering children the opportunity to practice motor skills, for instance by playing active video games, did lead to improved motor performance according to recent research findings, but to a lesser extent than task - oriented intervention. we argue that children with dcd lack the required motor problem - solving skills necessary to further improve their performance. explicit motor teaching with an emphasis on developing these problem - solving skills is a necessary ingredient of intervention in dcd, leveraging the effectiveness of intervention above that of mere practicing. |
the process of immunomodulation is of utmost importance for sustaining the immune homeostasis in the organism, and detailed knowledge about the precise mechanisms of this process can bring about a better and more efficient therapy of the autoimmune diseases. regulation of the immune response is accomplished by a number of cell subtypes and secreted factors as a lot of attention in the last years is focused on the role of the mesenchymal stem cells (mscs) [13 ]. it has been established that mscs inhibit the proliferation of t and b cells, the production of h2o2 from neutrophils, the secretion of immunoglobulins, t and nk cytotoxicity as well as the differentiation and maturation of monocytes into dendritic cells. also, the immunosuppression caused by the mscs affects the secretion of cytokines which is biased to th2 dominance with secretion of il-10 and il-4 while the secretion of ifn and tnf is suppressed [37 ]. the precise mechanisms of the mscs immunosuppressive effect have not been clarified yet. specific roles of secreted factors such as ido, il-6, tgf, lif, inos, pge2, hla - g [3, 58 ] have been assigned, and the role of direct cell - to - cell contact between the mscs and the targeted cells is discussed [9, 10 ]. however, besides data about the direct inhibitory effects of mscs, there are data published on some indirect inhibitory effects which are mediated through influencing other immunoregulatory cells. previous studies in our laboratory have demonstrated that mscs inhibit the differentiation of monocytes to dendritic cells and down - regulate the expression of molecules related with the antigen presentation and the expression of ccl-3 and ccl-4. these experiments showed that the effect of mscs isolated from adipose tissue (at - mscs) is stronger in comparison to mscs isolated from human bone marrow (bm - mscs). some indirect immunosuppressive effects of mscs seem to be due to their influence on the classical immunoregulatory cd4+foxp3 + cells generally referred to as tregs. the last decade witnessed some significant development of the idea for the t regulatory cells. along with the th3 cells secreting tgf and tr1 secreting il-10 [12, 13 ] a role was established for cd4+cd25 + t lymphocytes which exert immune suppression via ctla-4, tgf, and/or il-10 [1417 ]. later on an intracellular transcription factor foxp3 was identified as a more precise marker for the t regulatory subpopulations [1820 ]. it has been established that about 2% of cd4 + cells express foxp3, and it is related to the differentiation of tregs and exerts direct functional immune suppression [13, 17, 21 ]. recently, the role of cd25 molecule as a marker for suppressive subpopulations has raised some doubts. it is clear that the lack of surface expression of cd127 more accurately correlates with foxp3, and this can be found even in cd25 negative cells [18, 22, 23 ]. even more in patients with systemic lupus erythematosus (sle) both cd4+cd25+foxp3 + and cd4+cd25foxp3 + cells with expressed immunosuppressive properties have been identified [24, 25 ]. the molecular mechanisms of immunosuppression exerted by cd4+foxp3 + cells have not been identified but it is quite obvious that these mechanisms include the secretion of tgf and/or il-10 [12, 1719 ]. some published data seem to show that under the influence of mscs the number of the cd4+foxp3 + cells is increased, and these cells produce the immunosuppressive cytokine il-10, and thus mscs exert indirect immunosuppressive effect [2, 7, 9, 10, 26 ]. the aim of the present study is to analyze the effect of conditioned medium of at - mscs on the expression of foxp3 molecule and the secretion of cytokines by a homogeneously purified subpopulation of cd4 + t lymphocytes. additionally the factors secreted from the at - mscs are analyzed with the view of their putative effect on the changes in the cd4 + t lymphocyte populations. samples of peripheral blood were collected by venepuncture from 12 healthy volunteers, and 12 samples of human adipose tissues were collected during hip surgery. in both cases the samples were taken after a signed informed consent from the donors according to the regulations in this country. mesenchymal stem cells from adipose tissue were isolated, cultured, and phenotyped following strictly the generally accepted laboratory protocols and most of all the protocol developed in our laboratory. after forming a monolayer the at - mscs were detached after treatment with trypsin edta (1 : 250) (paa, austria) and seeded in 6-well plate (passage 1) at concentration 35 10 cell / well in dmem medium supplement with 10% foetal bovine serum and antibiotics (paa, austria). the cells were cultured until reaching 80% confluency as the culture medium was changed every 48 hours. after the last change of the medium, the 80% confluent cells were further cultured for 48 hours, and the medium designated as thus the conditioned at - msc medium contained dmem, fbs, and any factors secreted by the nonactivated at - mscs. this procedure was strictly followed in 12 independent experiments performed with t cell isolated and purified from 12 individual donors and 12 different samples of conditioned medium obtained as described above. pbmcs (peripheral blood monocytic cells) were isolated from peripheral blood by density gradient centrifugation (ficoll - paque plus, ge healthcare). the isolated cells were used for purification of cd4 + t lymphocytes using magnetic separation with macs kits (miltenyi biotec, bergisch - gladbach, germany). initially, cd14 + monocytes were discarded from pbmcs by positive selection with anti - cd14-microbeads and the flow through fraction was collected. cd4 + cells were enriched from the resulting cd14 cell fraction using anti - cd4-microbeads and the enriched cd4 + cell fraction was further characterized by flow cytometry mostly with regard to the expression of cd3/cd4 markers. the isolated t helpers (th) were cultured for 48 hours in conditioned medium from at - mscs at the first passage cultured for 48 hours. control t helper cells were cultured in dmem low glucose medium supplemented with 10% fetal bovine serum (paa, austria). th cells were seeded at concentration 5 10 cells / well into 24-well plates (paa, austria). homogeneity of the purified t helper populations was proved using monoclonal antibodies anti - human cd3 fitc and anti - human cd4 pe. anti - human cd4 fitc, anti - human hla - dr pe, and anti - human cd69 pe antibodies were used to assess the surface expression of the activation markers by cd4 + t lymphocytes cultured in at - mscs conditioned medium as well as the control t helper cultures. identification of t helper cells expressing surface cd25 and intracellular foxp3 was performed using cd4 percp - cy 5.5, anti - human cd25 fitc, anti - human foxp3 pe and foxp3 buffer set following the standard procedure recommended by the producer company. all the antibodies and the machines (facscalibur) used were purchased from becton dickinson, ca, usa. supernatants from th lymphocytes cultured with at - mscs conditioned medium or from control th cell cultures as well as samples of at - mscs conditioned medium were tested for the presence of il-2, ifn, il-10, and tgfb by human instant elisa (bender medsystems, austria) following strictly the manufacturer 's instructions. analysis of the cytokines in the at - mscs culture supernatants was performed using the human cytokine array panel a array kit (r&d systems, mn, usa) which can detect 36 different cytokines, chemokines, and growth factors (c5a, cd40l, g - csf, gm - csf, gro, i-309, sicam-1, ifn, il-1, il-1, il-1ra, il-2, il-4, il-5, il-6, il-8, il-10, il-12 p70, il-13, il-16, il-17, il-17e, il-23, il-27, il-32, ip-10, i - tac, mcp-1, mif, mip-1, mip-1, serpin e1, rantes, sdf-1, tnf, trem-1). with the aim to assess any signs of apoptosis of the cd4 + t cells cultured in at - mscs conditioned medium or cd4 + control cells the proteome profiler human apoptosis kit (r&d systems, mn, usa) was used as this test is capable to establish the intracellular expression of bad, bax, bcl-2, bcl - x, pro - caspase-3, cleaved caspase-3, catalase, clap-1, clap-2, claspin, clusterin, cytochrome c, trail r1/dr4, trair r1/dr5, fadd, fas / tnfsf6, hif-1, ho-1/hmox1/hps32, ho-2/hmox2, hsp27, hsp60, hsp70, htra2/omi, livin, pon2, p21/cip1/cdnk1a, p27kip1, phospho - p53(s15), phospho - p53(s46), phospho - p53(s392), phospho - rad17(s635), smac / diablo, survivin, tnf ri / tnfrsf1a, xiap. the programs cellquest and winmdi 2.9 were used for analysis of the flow cytometry data. image j program (nih, bethesda, md, usa) was used for analysis of the results from the human cytokine array panel a array kit and proteome profiler human apoptosis kit. the procedure followed in our experiments leads to isolation of a very homogeneous population of cd3+cd4 + t helper lymphocytes (figures 1(a) and 1(b)). cultivation of these cells in at - mscs conditioned medium did not cause any alterations in the expression of the activation markers cd69 and hla - dr (data not shown). however, cultures of th cells in conditioned medium caused an increase of the numbers of cd4 + t lymphocytes expressing foxp3 (figure 1(d)) as compared to the same parameter in control cells (figure 1(c)). this effect was found for both t helpers positive for the surface expression of cd25 and for t helpers negative for cd25 and was recorded in all samples tested from individual donors (table 1). so, it is obvious that some secreted factors present in at - mscs conditioned medium induce a specific upregulation of the transcription factor foxp3 which defines the treg subpopulation regardless of the expression of cd25. the search of secreted cytokines revealed the presence of tgf in very low concentrations in both cd4 + t cells cultured in at - mscs conditioned medium and control cd4 + t medium samples in all cases tested (figure 2(a)). no statistically significant differences were found for the concentrations of ifn or il-2 in experimental or control samples in each experiment with donor lymphocytes (figures 2(b) and 2(c)). in contrast to these findings statistically significant higher concentration of il-10 was detected in supernatants from cd4 + t cells cultured in at - mscs conditioned medium in comparison to the control supernatants (figure 2(d)). this increased secretion of il-10 was recorded in all cases of th cells cultured in at - mscs conditioned medium. it should be pointed out that the at - mscs conditioned medium itself did not contain any il-10, and this gives us ground to conclude that the increased concentration of this cytokine by t helpers cultured in at - mscs conditioned medium is due to its secretion by activated th lymphocytes. one of the possible ways for mscs to alter the t helper cells is the influence of the process of apoptosis, and in order to check this possibility the presence and changes of the intracellular proapoptotic or antiapoptotic factors were assayed in the same experimental design. however, no significant differences were found between th cells cultured in at - mscs medium and the control cells (data not shown). repeated testing of the at - mscs conditioned medium showed that it contained several chemokines with known effect on t helper cells and just a single cytokine with proven immunoregulatory effect. the chemokines were gro, rantes, serpin e, il-8, and sdf-1 and from the cytokines the il-6 was found to be with quite high concentration in the at - mscs conditioned medium. these chemokines and il-6 were found in negligible concentrations in control culture medium which point to their secretion by at - mscs (figure 3). the results obtained showed that when homogeneous population of cd4 + t lymphocytes was cultured in at - mscs conditioned medium, the percentage of the t helpers expressing foxp3 is increased as both cd25 + and cd25 cell subpopulations were affected. the role of the cd4+cd25+foxp3 + cells as the major immunosuppressive factor has been known for a rather long time. it has been described that these cells can originate directly from the thymus and are designated as natural (ntregs) or can differentiate under the influence of cytokines in the periphery and are called induced (itregs) [13, 19, 27 ]. the major cytokines responsible for inducing the differentiation of itregs are most probably il-2 and tgf. we could not detect these cytokines in the at - mscs conditioned medium, but judging on the increased percentage of cd4+cd25+foxp3 + it can be speculated that other cytokines may be involved in this process as discussed in the following. further on, our results revealed that under the influence of at - mscs conditioned medium, the percentages of the recently described subpopulation cd4+cd25foxp3 + increase as well. these cells were found to be increased in sle patients and were considered to be progenitors of cd25 + cells. different opinions are discussed in the specialized literature as some authors expressed some doubts whether this subpopulation is immunoregulatory by itself, but the prevailing opinion is independently to the expression of cd25, the foxp3 by itself exert functional suppression [13, 17, 21, 29 ]. based on this assumption the regulatory cells are more often designated as cd4+foxp3 + [18, 19 ]. it is commonly accepted that the cd4+foxp3 + cells express their immunosuppressive effects through the secretion of tgf and/or il-10 [12, 15, 17, 18 ]. in our studies we did not record an increased secretion of tgf by cd4 + t lymphocytes cultured in at - mscs medium. it is quite possible that under experimental design used in our experiments this cytokine is being expressed as membrane - bound form at the surface of the cd4 + t lymphocytes as such a mechanism has been described for cd4+foxp3 + cells and still is able to express its suppressive effect [14, 19 ]. however, statistically significant increase was found for il-10 secreted by cd4 + t lymphocytes cultured in at - mscs conditioned medium. the secretion of il-10 by cd4+foxp3 + cells is considered to be one of the most important mechanisms via which this cell subpopulation exerts the immunosuppressive function [30, 31, 31 ]. il-10 is an anti - inflammatory cytokine which inhibits the secretion of proinflammatory cytokines by the macrophages and dendritic cells. it inhibits the activities of th17 and the differentiation of blood monocytes into dendritic cells [11, 30 ]. one of the most significant immunoregulatory effects is the induction of tolerance in dendritic cells by inhibition of molecules which are crucial for antigenic presentation such as the b7 complex. moreover, il-10 directly inhibits the cd28 expression on th surface, and this molecule is the specific ligand for the b7 complex. our previous results have shown that at - mscs upregulate the secretion of il-10 by monocytic dendritic cells. however, under the experimental conditions described it can not be claimed that the cd4+foxp3 + cells are the only source of the il-10, but having in mind the increased number of these cells it is quite possible that there is a causative link between the increased numbers of cd4+foxp3 + cells and the increased concentrations of il-10 in the culture medium. it can be further speculated that under the influence of the at - mscs conditioned medium the number of cd4+foxp3 + cells secreting il-10 increases, and this could lead to an inhibition of the costimulatory molecule expression on the surface of the dendritic cells and t helpers which is the most important condition for inducing anergy in the t helper cells. therefore, together with the other mechanisms for immune suppression the at - mscs realize an indirect immune suppression by influencing other immunomodulatory cells such as dendritic cells and cd4+foxp3 + lymphocytes (figure 4). at - mscs this cytokine inhibits the expression of key molecules of antigen presentation, and this process leads to anergy of the t lymphocytes. it can be speculated that il-6 secreted by at - mscs is one of the key elements responsible for this effect. it is known that in parallel to its anti - inflammatory effect the il-10 has proapoptotic effect on dendritic cells as shown in a previous paper. the present studies did not find any changes with regard to the expression of the intracellular pro- or antiapoptotic factors in cd4 + t lymphocytes cultured in the presence of at - mscs conditioned medium. it has been reported that the mscs in general realize their immunomodulatory functions either through direct contact between the cells or through secretion of cytokines. as mentioned above at - mscs conditioned medium was used in our experiments which means that the observed effects are due to the presence of secreted factors in the medium. chemokines such as gro, rantes, serpin e, il-8, and sdf-1 which influence the chemotaxis of the t lymphocytes were shown to be present in the conditioned medium samples. so, it can be assumed that the process of immunosuppression realized by the at - mscs would be initiated with recruiting the t lymphocytes as the first step of the process. several types of secretory factors secreted by mscs have been reported in the literature which can influence the formation of cd4+foxp3 + cells, and these include ido, tgf, inos, pge2, hla - g5, i-309, il-10, il-6 [69, 31 ]. in our experiments the presence of il-6 solely was recorded in samples of at - mscs conditioned medium although we searched for tgf, i-309, and il-10, too. a probable explanation of this fact would be the assumption that mscs secrete a number of cytokines after being stimulated by other cytokines. thus, after stimulation with ifn the mscs secrete i-309 which on its side induces the formation of tregs while the direct contact and il-10 secretion have a key role in induction of the secretion of hla - g5 which would have the same effect. our results show that such an induction is not needed for the secretion of il-6 by at - mscs. the generally accepted views for il-6 hold that it is a proinflammatory cytokine which has a role in inhibition of the tregs and stimulation of the th17 immune response [18, 32 ]. however other data would suppose that the function of il-6 should be reassessed because of its reported immunosuppressive activity. il-6 causes increased secretion of il-10 and can exert antiapoptotic activity [7, 33 ]. it has been reported that mscs secrete high levels of il-6, and this secretion correlates directly with inhibition of the t cells, inhibition of the differentiation of the dendritic cells, and inhibition of the secretion of proinflammatory cytokines as well. similarly, the il-6 increases the secretion of other immunosuppressive factors such as inos and pge2 by mscs acting by an autocrine mechanism and also directly causes an increase of the numbers of newly described cd8+foxp3 + immunoregulatory cells [29, 36 ]. the numerous activities of the il-6 mentioned give ground to discuss its role as an anti - inflammatory cytokine. in agreement with the above cited data and our own results it can be speculated that under the influence of the il-6 secreted by nonstimulated at - mscs the number of il-10 secreting cd4+foxp3 + cells increases, and thus at - mscs realize an indirect immunosuppressive effect via the tregs. really it should not be claimed that the il-6 is the only one cytokine in this process since most of the factors modulating cd4+foxp3 + cell functions have not been tested in our experiments. most probably the cytokine induction of mscs to secrete immunosuppressive factors as well as the direct cell - to - cell contacts with the subsequent secretion of hla - g5 would be of high importance. previous results from our laboratory have shown the presence of hla - g5 in the cytoplasm of at - mscs as the effect of this molecule with regard to the tregs cells has been described in several papers [1, 57 ]. in conclusion, the results obtained show that under the influence of factors secreted by at - mscs the numbers of cd4+foxp3 + lymphocytes are increased and the secretion of il-10 is upregulated in purified cd4 + t cell population. it can be supposed that the presence of il-6 is very important for this process. similar effects of mscs on the foxp3 + cells and secretion of il-10 have been described in other papers [2, 69 ] but bone - marrow - derived mscs and umbilical cord - derived mscs have been used, and they were cocultured with heterogeneous cell mixture of pbmcs. original features in our experiments are the use of at - mscs conditioned medium and a homogeneous population of cd4 + t lymphocytes. under these conditions there is no direct cell - to - cell contact which might activate the at - mscs by other cell types, and the native or passive secretion of cytokines by at - mscs and their effects on the purified t helper cells were observed. | mesenchymal stem cells (mscs) are a new and promising tool for therapy of autoimmune disorders. in recent years their possibility to take part in the modulation of the immune response is discussed. the exact mechanisms for immunoregulation realized by mscs are not clear yet, but interactions with other immunoregulatory cells may be involved in this process. the investigation of the influence of mscs on the expression of foxp3 and cytokine secretion by t helper cells was the aim of this study. t helper cells were isolated from pbmcs by magnetic separation and mscs were isolated from human adipose tissue, and cd4 + t cells were cultured with conditional medium of mscs. the methods which were used include flow cytometry, elisa, and human proteome profiler kits. the results demonstrated that secretory factors in mscs conditional medium lead to increased expression of foxp3 and increased secretion of il-10 by t helpers. the obtained results give us opportunity to discuss the interaction between two kinds of immunoregulatory cells : mscs and foxp3 + t helpers. we suppose that this interaction leads to increased number of immunosuppressive helpers which secrete il-10. mscs provide some of their immunosuppressive functions acting on t regulatory cells, and we believe that il-6 secreted by mscs is involved in this process. |
two classes of proteins play important roles in dna segregation : topoisomerases and structural maintenance of chromosome (smc) complexes. dna replication introduces positive (+) supercoiling ahead of the replication fork, and rotation of the forks leads to interlinking of the two sister chromosomes, generating (pre)catenanes behind the replisomes throughout the chromosome. in escherichia coli, 225,000 catalytic events by the type ii topoisomerases dna gyrase and topoisomerase iv (topoiv) are required for each generation to unlink the 4.6-mb chromosome. dna gyrase acts preferentially ahead of the replication fork to remove (+) supercoiling (koster., 2010, vos., 2011). topoiv removes the majority of links behind the replication forks (joshi., 2013, wang., 2008), whereas the type i topoisomerase topoiii is able to remove links in single - stranded dna regions (koster., 2010, vos., 2011) and ftsk - dependent xercd recombination at dif is able to remove catenation links in ter (grainge., 2007). heterotetrameric topoiv consists of dimers of parc (the dna binding and catalytic subunit) and pare (the regulatory atpase). it changes dna topology by introducing a double - stranded break in dna and passing a second duplex segment of dna through the break before resealing it. topoiv acts on topologically different substrates including (+) and negative () supercoiled dna and knotted and catenated dna (koster. its essential cellular role is in decatenation of newly replicated dna (joshi., 2013, wang., 2008). the mechanism of how topoiv recognizes and discriminates its substrates and which substrate is preferred in vivo is not fully understood (lee. 2013a). a second class of proteins, smc complexes, play an equally important role in faithful dna segregation (hirano, 2006). despite sharing little primary amino acid sequence homology with other smc complexes, the e. coli complex mukbef retains much of the distinctive smc architecture (nolivos and sherratt, 2014, woo., 2009), forming dimers joined at a hinge domain located at one end of an 50-nm - long intramolecular coiled coil with an atpase head domain at the other end of the coiled coil. inactivation of the mukb protein or either of the two accessory proteins, muke and mukf, results in abnormal chromosome organization and segregation (danilova., 2007, the mukb dimerization hinge has been shown to physically interact in vitro with parc, which stimulates topoiv - mediated relaxation of () supercoils (hayama and marians, 2010, li., 2010). an enrichment of parc / e molecules in the vicinity of ori - associated mukbef clusters was observed in widefield imaging (nicolas., 2014). here, we used super - resolution microscopy to characterize the behavior of single molecules of topoiv in live e. coli. moreover, by perturbing the action of topoiv molecules using genetics, an inhibitor, and overexpression of competing protein domains, we are able to provide mechanistic insight into the function of topoiv and its interaction with mukbef clusters. using photoactivated - localization microscopy (palm) combined with single - particle tracking (manley., 2008), we show that 60 molecules of topoiv were present at any time, although sufficient parc and pare subunits were present for 105 topoiv molecules. impairing the interaction between functional topoiv and mukbef, by overexpressing a competing but non - functional parc c - terminal domain, resulted in an 2-fold reduction in the number of immobile topoiv molecules, consistent with the interaction between topoiv and mukbef directing the location and catalytic action of topoiv molecules toward ori - associated mukbef clusters. we identified two populations of immobile topoiv molecules ; we propose that one with a dwell time of 1.8 s identifies catalytically active molecules, while the other, with a dwell time of 3070 ms, identifies molecules bound to mukbef clusters. wide - field, palm, and 3d - structured illumination microscopy (3d - sim) (allen., 2014) demonstrated that mukbef clusters were enriched along the long axis of the cell. furthermore, we found that the mukb - parc interaction, although not essential for topoiv function, is crucial for timely segregation of newly replicated ori dna. impairing this interaction caused delayed segregation of newly replicated sister oris, consistent with the mukbef - parc interaction enhancing decatenation of newly replicated dna. to characterize the copy number and behavior of topoiv heterotetramers in live e. coli cells, we labeled the parc or pare subunits by replacing the endogenous genes with functional c - terminal fusions to the photoactivable fluorophore, pamcherry. the fusions were fully functional in in vivo assays (supplemental experimental procedures ; figure s1a ; table s3). linking consecutive localizations into trajectories allowed us to follow the movement of individual parc / e molecules at 15-ms intervals until photobleaching (figure 1a) (manley., 2008, uphoff., 2013). 289 34 photoactivatable molecules of parc and 210 46 photoactivatable molecules of pare, normalized to a 2.5-m - long cell, were counted. since the photactivation efficiency of pamcherry was determined to be 50% in vivo, the actual copy numbers are likely to be approximately two times higher than these values (supplemental experimental procedures). to measure the mobility of parc / e, we calculated an apparent diffusion coefficient (d) for each molecule from the one - step mean squared displacement (msd) of its trajectory using d = msd/(4 t), where t is the frame time of 15 ms. the different diffusing populations, which could not be described by a single diffusing species (figure s1b), were defined by fitting an analytical expression to the distribution of experimental d values (stracy., 2015). we first established the mean d of immobile molecules. based on a localization error of 40 nm, we estimated mean d of immobile molecules to be 0.1 ms. this was confirmed by fitting to the distribution d values for the previously characterized protein dna polymerase 1 (where the immobile population was clearly resolvable), showing that dimm = 0.11 0.01 ms (uphoff., 2013, the parc d distribution fitted well to a two - species model (figure 1b) : an immobile population (36% 1% ; constrained at dimm = 0.11 ms) and a second, unconstrained d distribution, corresponding to a slowly diffusing population (64% 1% ; dslow = 0.35 0.01 ms). molecules in the slow - diffusing population had a lower mobility than expected for free 3d diffusion, consistent with them undergoing transient interactions with dna, which parc does (corbett., 2005). the spatial distribution of slowly diffusing parc molecules showed that they were associated with the nucleoid, consistent with them being transiently associated with dna (figures s1 g and s3a). in contrast, we propose that the immobile parc molecules are relatively stably bound to dna or dna - bound proteins. the pare d distribution showed a third population of molecules with higher mobility in addition to the two populations similar to those observed for parc. 2013), we propose that the fast - diffusing molecules represent free pare subunits, whereas the immobile and slow - diffusing molecules were in topoiv heterotetramers. to test this, we imaged pare - pamcherry molecules in cells in which unlabeled pare was overexpressed, outcompeting labeled pare in topoiv heterotetramers. consistent with our hypothesis, 90% of pare - pamcherry molecules now diffused rapidly and were uniformly distributed throughout the cell, showing no bias toward the nucleoid region (figures s1f and s1 g). fitting a three - species model to this data (with dimm and dslow constrained) established that dfast = 0.94 0.02 ms. conversely, imaging pare - pamcherry molecules in a strain overexpressing unlabeled parc showed that the dfast population is completely lost (figure s1h), confirming that pare molecules in the dimm and dslow states are complexed with parc in topoiv heterotetramers. the three - species model for the pare data, with constrained dimm, dslow, and dfast values, showed that 32% 1% were immobile, 24% 1% were slow diffusing, and 44% 1% were fast diffusing (figure 1c). as the copy - number estimates showed that there is no excess pare in the cell, the 44% of uncomplexed, fast - diffusing pare molecules must reflect a steady - state level of topoiv heterotetramer formation and dissociation, with 56% of pare subunits being present in 60 topoiv heterotetramers. therefore, the 60 topoiv molecules present at any time form from a pool of parc and e molecules sufficient for 105 topoiv heterotetramers. by using the estimated copy numbers and the 1.1 m volume of cells 2.5 m long, we estimated the in vivo dissociation constant of topoiv heterotetramers to be 0.5 m (supplemental experimental procedures). since parc interacts with the mukb dimerization hinge in vitro (hayama and marians, 2010, li., 2010, vos., 2013b) and shows an enrichment near mukbef clusters in vivo (nicolas., 2014), we tested whether a fraction of the immobile parc and pare molecules result from their binding to immobile mukbef clusters on dna. fitting a two - species model (with the dimm and dslow populations established previously) to the distribution of d values for parc molecules in mukb or mukb cells ; mukb is unable to bind atp and form ori - associated mukbef clusters (badrinarayanan., 2012), showed a 50% reduction in the immobile fraction of parc / pare consistent with these molecules being immobile as a consequence of their interaction with ori - associated mukbef clusters (figure 2a ; figures s2a and s2b). using a clustering algorithm to define parc clusters containing 25 localizations, we showed that parc formed a median of one cluster per cell and deletion of mukb removed most parc clustering (figure 2a). this was confirmed by the radial distribution analysis of all parc localizations that showed a strongly clustered distribution, which was reduced 4-fold in mukb cells (figure s2c). since mukb and mukb cells have disorganized chromosomes (danilova., 2007), we also considered whether the reduction in the fraction of immobile parc / e molecules in these cells was instead a consequence of global chromosome changes. to distinguish these possibilities, we impaired the topoiv - mukb interaction by overexpressing an unlabeled parc c - terminal domain (parc - ctd), which binds mukb (vos., 2013b), thereby outcompeting topoiv binding. overexpression of parc - ctd did not significantly affect growth rate, cell length, or formation of anucleate cells (table s3), consistent with unperturbed chromosome organization. flow cytometry profiles showed a small increase in cells with multiple chromosomes (figure s1a). under these conditions, the immobile fraction of parc was reduced to the level in mukb cells (figure 2a, bottom), and clustering of parc was lost, consistent with approximately half of immobile parc molecules being dependent on a direct interaction with immobile mukbef clusters. to demonstrate that parc clusters spatially associate with mukbef clusters, we imaged parc - pamcherry and mukb - mypet in the same cells. calculating the radial distribution function of parc palm localizations with respect to the centroid of each mukbef focus showed that parc is enriched near mukbef foci, which moved very little during the observation period (figure 2b ; figure s2d), with 20% of parc localizations within 200 nm of mukbef centroids. this result is consistent with the 16% of parc molecules that were immobile due to a direct interaction with mukb, as judged by the reduction in the fraction of immobile molecules in mukb cells (figure 2a). we noticed that while parc clusters were nearly always in close proximity to a mukbef focus, not all mukbef foci were associated with a parc cluster, a trend also evident in intensity projections from epifluorescent imaging (figure s3e). imaging mukb - pamcherry with palm showed that, despite having a similar copy number (195 57 copies / cell ; figure s2f), mukbef formed approximately twice as many clusters per cell as parc (figure s2 g), thereby indicating an additional level of regulation governing the mukb - parc interaction. by using the fraction of immobile topoiv molecules dependent on mukb (figures 1b, 1c, and 2a) and, independently, the fraction of parc localizations close to mukb in the radial distribution analysis (figure 2b), we estimated that 15 topoiv molecules were associated with mukbef clusters at any given time and determined the in vivo dissociation constant of mukb - parc complexes to be 2 m (supplemental experimental procedures), consistent with in vitro measurements (li., 2010). to understand further how mukbef clusters direct the organization of immobile parc molecules within the nucleoid, we determined the probability density of parc molecules across the short cell axis. we segmented cell outlines from the bright - field images and determined the intracellular location of the tracks. we then established a d threshold (0.16 ms), which preserved the ratio of immobile (36%) to mobile (64%) molecules, established from fitting, to classify each individual parc track as immobile or mobile. the analysis showed that immobile parc molecules were preferentially located along the long axis of the cell (figure s3a). similar intracellular positioning was observed for immobile mukb - pamcherry molecules, with an even stronger bias of immobile molecules along the long cell axis (figure s3a, right). we found a similar pattern of mukbef cluster enrichment on the long cell axis when we analyzed the distribution of mukbef foci in epifluorescence images (figure s3b). in mukb cells, immobile parc molecules showed a lower probability of locating to the cell long axis, consistent with mukbef clusters recruiting parc molecules to the long cell axis (figure s3a, middle). when we co - imaged mukb - mypet and dapi - stained dna with 3d structured illumination microscopy, we also observed mukbef clusters located along the long cell axis, close to regions of high nucleoid density (figure s3c ; movie s1 ; supplemental experimental procedures). to dissect topoiv binding events, we analyzed long trajectories of ten or more localizations and sorted molecules into three categories : mobile molecules that remained above the d threshold for the observation period, immobile molecules that remained below the d threshold over the observation period, and molecules that exhibited transitions between these states (figure 3a). this analysis detected similar fractions of immobile molecules as determined from fits to the d distributions (compare figure 3b with figure 1b). in addition, a fraction of the molecules underwent transitions, consistent with topoiv molecules being in a dynamic equilibrium between bound and mobile states (figure 3a, right). in time - lapse experiments, using 15-ms exposures followed by 35-ms delays, we observed a reduction in the population of parc molecules that remained immobile over the course of the trajectory from 35% to 14% (figure 3b). molecules in the immobile category in the time - lapse experiments (bound for ten or more localizations with a 50-ms frame time) must remain bound for 0.5 s, compared to 0.15 s for the immobile molecules in normal 15-ms frame - time experiments (bound for ten or more localizations). the observed reduction in the fraction of immobile molecules shows that 21% of the binding events in muk cells lasted for 0.5 s. in contrast, when we performed the same analysis in mukb cells or in cells overexpressing parc - ctd, the fraction of immobile molecules remained unchanged in normal and time - lapse palm experiments (figure 3b). this shows that in wild - type cells, a population of mukb - dependent transiently immobile (0.5 s) topoiv molecules is present alongside molecules immobile for 0.5 s. because the underlying binding times are exponentially distributed, they can not be extracted intuitively from experiments. we therefore used markov chain monte carlo simulations to gain a better estimate of the durations of the short - lived mukb - dependent binding events. molecule trajectories were simulated undergoing brownian motion inside a confined cell volume (bakshi., 2013, persson., 2013, uphoff., 2013). molecules were in one of two diffusive states : dfree and dimm, with transitions allowed between each state. the free diffusion, dfree, of topoiv heterotetramers was calculated based on the free diffusion of pare (dfast), correcting for their relative sizes (supplemental experimental procedures). molecule trajectories were simulated to generate localizations at either 15-ms intervals or 15-ms intervals with 35-ms delays to match normal and time - lapse experiments, respectively. the simulated localizations were analyzed with the same tracking and categorizing algorithm as used for the experimental data. we simulated interconverting molecules with different exponentially distributed binding durations from 0.1 ms to 150 ms (keeping the fraction in each state equal). plotting the change in the fraction of molecules categorized as bound in time - lapse simulations compared to normal simulations showed that a binding duration of 3070 ms for mukb - dependent topoiv transient binding events recapitulated the experimentally observed decrease (figure 3c ; figure s4d). furthermore, simulations with a binding time exposure time showed that a transient (1 ms) dna binding explains well the lower - than - expected mobility of slowly diffusing parc molecules (figure s4c). finally, we characterized the molecules that remained immobile over the time - lapse experiment observation time (binding time 0.5 s). because our ability to observe complete events was limited by photobleaching, we increased the observation time by using low excitation intensities, sparse photoactivation, and long (0.5 s) exposure times, when mobile molecules are motion blurred, whereas immobile molecules appear as point sources, producing a diffraction - limited spot (elf., 2007, stracy., immobile molecules could therefore be distinguished by the width of the elliptical gaussian fits to the fluorescent spot. we used thresholds established with pol1 (with clearly resolvable immobile molecules) of < 160 nm short axis width and < 200 nm long axis width to identify immobile molecules (uphoff. the probability of observing a particular on - time is the product of the underlying binding - time probability and the bleaching probability. the bleaching - time distributions were measured independently with the same acquisition and excitation conditions using mukb - pamcherry, which binds dna in clusters with a dwell time longer (50 s) than the photobleaching lifetime (badrinarayanan., 2012). we measured parc on - times at 0.5 s, 0.75 s, and 1 s exposure times and corrected for photobleaching (uphoff., 2013). we found the mean binding time to be 1.8 0.4 s (table s4). in conclusion, we have shown that immobile topoiv molecules display two different bound states : a 30- to 70-ms mukbef binding - dependent state and 1.8-s binding events, which we propose identify topoiv molecules undergoing a single catalytic cycle, since such a binding time is of the same order as measurements of a single topoiv catalytic cycle in vitro (crisona., 2000, neuman., 2009, stone., 2003). based on analysis in vitro of processive bursts on (+) supercoiled dna, they were expected to last tens of seconds (crisona., 2000, stone., 2003). to determine if the topoiv - mukb interaction directs topoiv catalytic activity close to mukbef clusters, we treated cells carrying a norfloxacin - resistant gyrase gene with norfloxacin, which blocks the topoiv catalytic cycle, resulting in parc molecules covalently bound to dna (khodursky., 1995) we observed a 2-fold increase in the fraction of immobile parc / e molecules after 10-min norfloxacin treatment (figure 4a ; figure s5a), showing that most topoiv molecules had performed catalysis during this period ; however, we can not exclude the possibility that norfloxacin captures a fraction of nonproductive catalytic events that do not result in topological changes. longer incubation with norfloxacin did not increase the fraction of immobile molecules, showing that at 10 min, we had reached saturation and did therefore not have a quantitative measure of catalytic rate ; shorter exposure times were not experimentally tractable. this result agrees with the fact that mukb cells can decatenate and segregate their chromosomes (danilova. but it does not address the question of whether the mukb - parc interaction stimulates decatenation globally. the enrichment of parc molecules close to mukbef clusters, as judged by radial distribution analysis, was retained after norfloxacin treatment (figure 4b), showing that a fraction of topoiv molecules underwent catalysis close to mukbef clusters. after norfloxacin treatment of wild - type cells, we observed a modest increase in the number of topoiv clusters per cell, whereas mukb cells showed a similar cluster distribution to wild - type cells (figure 4a). these data indicate that topoiv molecules undergo catalysis in defined clusters, some of which are close to mukbef clusters. when we analyzed the distribution of catalytically active topoiv molecules across the short cell axis, we found that the previous bias toward the cell center was lost, presumably because the additional clusters were not associated with mukbef clusters (figure s5c). mukbef clusters were retained after norfloxacin, and parc colocalized with them (figure s5b). in the absence of mukbef clusters, covalently linked dna - parc molecules were less likely to be located close to the long cell axis, similar to the situation in steady - state cells (compare figure s5c curve with figure s3a middle curve). taken together, the results indicate that mukbef clusters direct the catalytic activity of some topoiv molecules to the cell long axis, whereas mukbef - independent catalysis occurs throughout the nucleoid. in these analyses, we can not exclude the possibility that covalently bound topoiv reshapes the chromosome and thereby influences the spatial distribution of topoiv. nevertheless, the spatial distribution of mukbef clusters was retained, suggestive of normal chromosome organization being maintained. furthermore, we note that topoiv - targeted strand breaks introduced by norfloxacin did not lead to chromosome fragmentation (hsu., 2006). to address whether topoiv catalysis occurs in cells lacking (pre)catenanes, we analyzed cells from a steady - state population that had not initiated dna replication, as assessed by a lack of mypet - dnan foci. the reduction in the immobile fraction of parc from 36% 1% to 21% 2% in these cells, when compared to the whole population (figure 4c), indicated that almost half of immobile topoiv molecules were dependent on replication. the replication - independent molecules showed a similar cluster distribution to that in steady - state cells (figure s5d), consistent with a large fraction of them being bound to mukbef clusters. norfloxacin treatment gave a similar proportion of immobile topoiv molecules as in steady - state cells, showing that topoiv catalysis occurs in the absence of (pre)catenanes, but not addressing its frequency (figure s5e). we conclude that even though the essential function of topoiv is in decatenation, its catalytic action is not restricted to (pre)catenanes. to test whether the interaction between parc and ori - associated mukbef clusters influenced decatenation of newly replicated ori - sisters, we used two assays to assess the time of ori separation after replication, and we analyzed how this changed after impairment of the parc - mukbef interaction. these assays have been validated previously and have shown that the time of locus separation is regulated by the activity / availability of topoiv, indicating that decatenation by topoiv directs the time of chromosome segregation (joshi., 2013, wang., 2008). in time - lapse experiments, we measured the time of ori1 locus separation after replication initiation, marked by the appearance of a fluorescent mypet - dnan focus (figure 5a). the ori1 locus replicates < 30 s after initiation at oric, and a sufficient amount of mypet - dnan loads at the forks to visualize it within < 2 min of initiation (moolman., 2014). cells in which the mukbef - parc interaction is normal had stably segregated 50% of the newly replicated ori1 loci by 17 min after the appearance of mypet - dnan. in contrast, cells in which the mukbef - parc interaction was impaired by parc - ctd overexpression showed a 12 min increase in the time required for 50% of cells to exhibit ori1-segregation (figures 5b and 5c). we also compared the fraction of cells containing one or more ori1 foci in snapshots of steady - state populations (figure 5d). we observed a decrease in the fraction of cells containing two ori1 foci when the parc - mukbef interaction was impaired, consistent with delayed ori1 decatenation. taken together, these results provide strong support for a mechanism in which the mukb - topoiv interaction plays a role in timely decatenation of newly replicated ori1 dna. the in vivo single - molecule approach exploited here provides a comprehensive understanding of the formation and behavior of topoiv molecules in their native unperturbed environment inside living cells. we observed a dynamic equilibrium between free and complexed parc / e subunits, independently of replication, with 60 potentially functional topoiv heterotetramers at birth. the observation that only 60% of subunits are in heterotetramers at any given time raises the possibility that more functional enzymes can be assembled if required. by combining in vivo super - resolution techniques with genetics, inhibitors, and overexpression of competing proteins, we have gained a molecular understanding of the interaction between topoiv and mukb and demonstrated the important functional significance of this interaction for dna segregation. we are confident that the c - terminal fusions of parc and pare are fully functional, that the fluorescent protein domains themselves are not influencing the localization and diffusional properties of the fusion proteins and therefore that the observed behavior reflects the true properties of topoiv subunits (supplemental experimental procedures). we infer that individual topoiv molecules undergo multiple attempts to bind dna productively before undergoing catalysis. this is reflected in the slow diffusion of parc / topoiv molecules, which simulations have indicated may result from transient (1 ms) interactions with dna (figure 1b ; figure s4c). we infer that this transient binding probably does not identify molecules undergoing catalysis, since a single topoiv catalytic cycle was measured to be 1 s in single - molecule and ensemble experiments in vitro (crisona., 2000, neuman., 2009, stone., 2003) our analysis is consistent with other data (lee., 2013, stone., 2003, vos., 2013a) that has led to the proposal that prior to catalysis, topoiv must first capture the g - dna segment that is to be cleaved and then capture a t - segment that is transported through the cleaved g - segment. the transient dna binding we observed likely represents an initial interaction with dna proceeding g - segment capture or g - segment capture itself. assuming that long binding events, lasting 1.8 s (tcatalysis, figure 3d), represent catalytically active molecules and that 14% (fcatalysis) of all molecules display this behavior (figure 3b), we calculated the mean time for a given topoiv molecule to locate and productively bind to its substrate, tsearch, using fcatalysis = tcatalysis/(tcatalysis + tsearch) (uphoff., 2013). we calculated that (tsearch + tcatalysis) = 13 s. therefore, for 11 s, topoiv molecules will diffuse slowly, presumably undergoing multiple transient interaction with dna, before initiating a catalytic cycle. () supercoils are relaxed distributively in vitro, whereas (+) supercoils are relaxed processively (crisona., 2000, stone., 2003) given that processive events would be predicted to last tens of seconds, the inferred topoiv catalytic cycle of 1.8 s, derived from the long exposure analysis, suggests that topoiv predominantly acts distributively rather than processively in vivo. this is consistent with rh () supercoils and rh replicative catenanes being the preferred targets for topoiv. our results provide a deeper understanding of the relative activity of topoiv on (pre)catenanes behind replication forks and in maintaining global supercoiling homeostasis. topoiv - mediated decatenation behind the fork is essential, and topoiv inactivation prevents decatenation and segregation of newly replicated sister loci without affecting replication or transcription (wang., 2008). dna gyrase is thought to be largely responsible for removal of lh (+) supercoils ahead of replication forks and the transcription machinery (vos., 2011). our results showing a reduction of immobile topoiv molecules in non - replicating cells, and a failure to detect processive relaxation of (+) supercoils in vivo, are consistent with most topoiv activity being directed to decatenation of newly replicated dna. consistent with this, covalent linking of topoiv to dna with norfloxacin does not block chromosomal or plasmid replication (khodursky and cozzarelli, 1998, khodursky.,, topoiv could support replication at 30% of the wild - type rate (khodursky., 2000), indicating that topoiv may act ahead of the fork, although it could be that in the absence of gyrase accumulation of the (+) supercoiling ahead of the fork is converted intro precatenanes by replisome rotation, thereby allowing limited fork progression as a consequence of topoiv - mediated decatenation. the presence of a similar proportion of topoiv heterotetramers in cells of all ages (figures s5f s5h) and catalytically active topoiv molecules in cells that have not initiated replication, along with the demonstration that topoiv availability controls decatenation at ori (figure 5) (joshi., 2013, wang., 2008, nicolas., 2014), shows that topoiv activity is not directed exclusively to replication termination and is inconsistent with the hypothesis that active topoiv molecules form only at replication termination as a consequence of replisome disassembly (espeli., our data lead us to propose that direct interaction between parc and mukb leads to a fraction of topoiv molecules being bound to mukbef clusters for 3070 ms, unless they undergo catalysis, in which case we propose that they will remain bound for 1.8 s. the mukbef cluster - parc interaction is important for timely segregation of newly replicated sister oris, consistent with the observation that topoiv availability determines ori1 locus separation time (wang., 2008). furthermore, ablation of topoiv activity, prevents ori segregation and its reinstatement leads to resumed ori segregation (nicolas. these observations strongly suggest that measurements of ori segregation time define decatenation efficiency. in the experiments here, we have demonstrated an 12-min delay in ori1 segregation if the parc - mukb interaction is impaired, consistent with topoiv being less active in decatenation without this interaction. we propose the topoiv interaction with mukbef clusters may favor ori decatenation partly because of an increased local concentration of topoiv and partly because of enhanced catalysis. because the mukb - parc interaction stimulates relaxation of rh () supercoils in vitro, we would also expect this interaction to stimulate decatenation because of the identical chirality of replicative catenanes and negative supercoils (nicolas., 2014). although in vitro experiments designed to test whether the topoiv - mukb interaction stimulated decatenation showed little or no stimulation (hayama., 2013, hayama and marians, 2010, li., 2010), the substrates used were different from those used in the supercoil relaxation experiments. we propose, given our in vivo results and the identical chirality of replicative catenanes and () supercoils, that the topoiv - mukbef interaction will stimulate decatenation. since the mukbef clusters are relatively stably associated with dna (badrinarayanan., 2012), their interaction with topoiv may facilitate binding of the g- and/or t - segment by topoiv. alternatively, this interaction might affect topoiv substrate specificity. since decatenation of newly replicated oris only occurs during a short period of the cell cycle, we wonder also whether the mukbef cluster - topoiv interaction may stimulate () supercoil relaxation in the region of the origin and thereby act to prevent premature ori firing, which requires that ori is highly negatively supercoiled (donczew., 2014). consistent with this, we note that mukbef clusters tended to move away from ori prior to replication initiation (nicolas., 2014) and that in cells in which the topoiv - mukb interaction is perturbed, we observed some replication initiation asynchrony (figure s1a). we propose that the coordination of type ii topoisomerase activity by an smc complex revealed here is not limited to e. coli. other studies have implicated functional interactions between eukaryotic smcs and their topoiv counterpart, topoii (baxter, 2015, baxter and aragn, 2012). for example, condensin was shown to facilitate decatenation of yeast minichromosomes (charbin., 2014). the sequential and coordinated action of topoiv and mukbef in the successive steps of decatenation and chromosome segregation revealed here provides a platform for future mechanistic studies that will reveal whether smc complexes provide dna - protein substrates that provide selectivity for topoisomerase action and precisely how topoisomerase action is coordinated with smc functions in chromosome processing. single colonies were inoculated into m9 glycerol (0.2%) and grown overnight at 37c to a600 0.40.6, then diluted into fresh m9 and grown to a600 0.1. cells were centrifuged and immobilized on agarose pads between two glass coverslips (0.17 mm thick, heated to 500c for 1 hr to remove any fluorescent background particles). we prepared 1% agarose pads by mixing low - fluorescence 2% agarose (bio - rad) in dh2o 1:1 with 2 growth medium. for details, see supplemental experimental procedures. live cell single - molecule - tracking palm used a custom - built total internal reflection fluorescence microscope. bright - field cell images were recorded with an led source and condenser (asi imaging). palm single - molecule - tracking analysis used custom - written matlab software (mathworks). we distinguished bound and diffusing proteins by calculating an apparent diffusion coefficient d = msd/(4 t) from the mean - squared displacement (msd) for each track with four steps. note that d is an apparent diffusion coefficient because of cell confinement and motion blurring (stracy., 2014). palm movies to measure long - duration binding events were recorded at low continuous 561-nm excitation intensities using long exposure times (uphoff., 2013). at these exposure times, mobile parc - pamcherry molecules are motion blurred over a large fraction of the cell, whereas immobile parc - pamcherry molecules still appear as point sources, producing a diffraction limited spot. the probability of observing a particular on - time is the product of the underlying binding - time probability and the bleaching probability. the bleaching - time distributions were measured independently using mukb - pamcherry, which binds dna in one to three large clusters per cell with a dwell time of 50 s (badrinarayanan., 2012), with the same acquisition and excitation conditions. on - time and bleaching - time distributions were fitted with single - exponential functions to extract exponential - time constants ton and tbleach, and the binding - time constant was calculated by tbound = ton tbleach / (tbleach ton). molecules were simulated undergoing brownian motion confined within a volume corresponding to the average size of cells imaged in experiments. the localization in each 15-ms frame determined from averaging the simulated molecule positions over 100 subframes and adding gaussian distributed localization error. the list of simulated localizations, with their corresponding frame number, could then be analyzed in exactly the same way as the experimental data. sister ori1 cohesion time in the strain kg52 containing plasmid pz68 (overproducing a parc ctd domain) was assessed in a 5-min time - lapse analysis. a laco array was inserted 16 kb counterclockwise of oric (ori1) ; laci - mcherry was expressed from the chromosomal leub locus, regulated by the lac promoter (wang., 2008). a chromosomally encoded mypet - dnan fusion protein was used as a marker for the replisome (moolman., 2014, reyes - lamothe., 2010). cells were growing exponentially in minimal medium supplemented with glycerol, at 37c (generation time 100 min). ctd overproduction was induced by addition of l - arabinose (final concentration, 0.2%) 3 hr prior to the experiment. as a control, the strain with the empty plasmid pbad24 (guzman., 1995) was used. | summarythe type ii topoisomerase topoiv, which has an essential role in escherichia coli chromosome decatenation, interacts with mukbef, an smc (structural maintenance of chromosomes) complex that acts in chromosome segregation. we have characterized the intracellular dynamics of individual topoiv molecules and the consequences of their interaction with mukbef clusters by using photoactivated - localization microscopy. we show that 15 topoiv molecules per cell are associated with mukbef clusters that are preferentially localized to the replication origin region (ori), close to the long axis of the cell. a replication - dependent increase in the fraction of immobile molecules, together with a proposed catalytic cycle of 1.8 s, is consistent with the majority of active topoiv molecules catalyzing decatenation, with a minority maintaining steady - state dna supercoiling. finally, we show that the mukb - parc interaction is crucial for timely decatenation and segregation of newly replicated ori dna. |
dermatophytes are the most common organisms infecting keratinized structures such as skin, hair, and nails, and their ability to degrade keratin is believed to be a major virulence factor. a correlation between keratinolytic activity and pathogenesis has been proposed because dermatophytes secrete a battery of endo- and exo - proteases during infection that degrade keratinized structures into oligopeptides and free amino acids for use as nutrients. it is likely that proteases with optimal activity at both acidic and alkaline phs are important virulence factors in dermatophytes, and that their regulation during infection is crucial. in the early stages, and in response to the acidic ph of human skin, the pathogen de - represses the synthesis of non - specific keratinases and proteases that have optimal activity at acidic ph. they act on skin proteins, producing peptides that are hydrolyzed into amino acids, which are then used by the fungus as sources of carbon, nitrogen, and sulfur. the metabolism of some amino acids promotes the alkalinization of the host microenvironment, making it suitable for the action of keratinases with optimal activity at alkaline ph. the dermatophyte trichophyton rubrum rapidly responds to ph changes by modulating the expression of genes, allowing the use of skin proteins over a wide ph range, thereby enabling the development of infection and persistence of the dermatophyte in host tissues moreover, inactivation of the pacc gene, a component of the ph signalling pathway in t. rubrum, reduces the activity of secreted keratinases, indicating that the pacc gene is somehow involved in the regulation of keratinolytic activity, and consequently in the virulence and pathogenicity of this organism. protein secretion from a eukaryotic cell requires movement through the endoplasmic reticulum (er) and the golgi apparatus. in the course of trafficking, the secreted proteins undergo glycosylation, which is the major post - translational molecular event [814 ]. in secreted proteins, the glycosyl groups are usually attached to either an amide group (n - glycosylation) or a hydroxyl residue (o - glycosylation), which are mainly found on serine and threonine residues. during glycosylation, the oligosaccharide glcnac2man9glc3 is transferred to an asn residue within the sequence asn - xser / thr by an oligosaccharyltransferase), where x represents any amino acid except proline. the main pathway utilizes sugar nucleotides and is located in the golgi apparatus. in yeasts, o - mannosylation begins in the er lumen and, like n - glycosylation, it requires dolichol phosphate - activated sugar residues. the initial reaction is catalyzed by proteins from the evolutionarily conserved mannosyltransferase (pmt) family. proteins secreted from yeast cells are usually heavily n- and/or o - glycosylated. in proteins that are glycosylated at both sites, it is not known whether n - glycosylation precedes o - mannosylation, or vice versa. it is also unknown whether the o - mannosylation that takes place in the er prevents n - glycosylation ; however, there is some evidence for the opposite situation. altered glycosylation may affect the stability and half - life of proteins, thus changing their activities or affinities towards substrates. delineating the mechanisms underlying fungal adaptability to ambient variation is fundamental to an understanding of the mechanisms of pathogenicity and resistance to inhibitors in pathogenic organisms. this work was aimed at investigating the expression of genes encoding dolichyl - p - man : man(5)glcnac(2)-pp - dolichyl mannosyltransferase and an o - mannosyltransferase (referred to as the n - man and o - man genes, respectively) in the dermatophyte t. rubrum in response to nutrients, ambient ph, and disruption of the pacc gene. our findings revealed a relationship between the expression of these two mannosyltransferase genes and the pacc gene in response to ambient ph and carbon source. t. rubrum clinical isolate h6 (atcc mya-3108) and a pacc-1 mutant that carries a disrupted pacc gene, which were used throughout this study, were selected as previously described. the h6 and pacc-1 strains were cultivated on sabouraud glucose agar for 15 days at 28 c, and pacc-1 cultures were supplemented with 450 g / ml hygromycin. mycelia were collected with a sterile spatula, vortexed in saline solution [0.9% (w / v) nacl ] with 0.01% (v / v) tween, filtered through fiberglass to remove mycelial debris, and then centrifuged to recover the conidia. then, 10 conidia were transferred to 50 ml of sabouraud broth, and germination was carried out at 28 c for 72 h on an orbital shaker at 180 rpm (control). after incubation, the final ph of the culture medium was measured with a ph meter, and the resulting mycelia were harvested by filtration through sterilized whatman paper (whatman international, maidstone, uk), washed with sterilized water, and transferred to minimal medium (mm) at ph 5.0 or ph 8.0, which was, in some cases (as indicated), buffered with 50 mm sodium citrate or 50 mm tris hcl, respectively. mm was supplemented with glucose (50 mm) or glucose plus glycine (50 mm each) and sodium nitrate (70 mm). all cultures were incubated at 28 c for 3, 6, and 24 h with agitation. mycelia obtained from each culture were harvested by filtration, and total rna was extracted from approximately 100 mg of frozen mycelium using trizol reagent, and treated with rnase - free dnase i (invitrogen, carlsbad, ca), following the manufacturer 's instructions. one microgram of dnase - treated rna was reverse transcribed into cdna using the high capacity cdna reverse transcription kit (applied biosystems, foster city, ca) according to the manufacturer 's instructions. the cdna from 3 independent biological experiments was quantified spectrophotometrically, and stored at 80 c until pcr amplification. for quantitative real - time pcr analyses, the genes encoding dolichyl - p - man : man(5)glcnac(2)-pp - dolichyl mannosyltransferase (n - man, terg_06338 ; genbank : xm_003233297) and o - mannosyltransferase (o - man, terg_06465 ; genbank : xm_003233430) were amplified from cdna using the following primers (53) : taaacgacagtggtatgccg (n - manfwd) and tgtagcctgttgggttctct (n - manrev) ; ccatgggacgtgtatactc (o - manfwd) and cgtcatcatagcaacattcag (o - manrev). reactions were performed in three independent experiments using sybr green pcr master mix (applied biosystems, foster city, ca), in the stepone plus real - time pcr system. a 12.5-l reaction was set up using 50 ng of cdna and 300 nm of each primer, and the pcr cycle was as follows : 95 c for 10 min, followed by 40 cycles of 95 c for 15 s and 60 c for 1 min. melting curve analyses were performed after each cycling to exclude primer dimers and nonspecific pcr products. relative transcript quantities were calculated using the ct method using the experimental condition that yielded the lowest ct value (n - man, non - buffered h6 cultures in keratin, 6 h incubation). the t. rubrum -actin (terg_06637) and -tubulin (terg_07904) genes, which were used as endogenous reference genes, were amplified using the following oligonucleotides (sequence 53) : aacgccatcatgaagtgt (actinfwd) and tccttctgcatacggtcaga (actinrev) ; ccgtatgatggccacttt (tubulinfwd) and ctgacctgggaaacgaagac (tubulinrev). data normalization and analyses were performed using the genex 5 multid analyses ab (www.multid.se). to confirm the identity of the genes analyzed in this work, as well as the endogenous reference genes, the pcr products were sequenced and analyzed by alignment with sequences retrieved from the broad institute dermatophyte comparative database (http://www.broadinstitute.org/annotation/genome/dermatophyte_comparative/multihome.html). t. rubrum clinical isolate h6 (atcc mya-3108) and a pacc-1 mutant that carries a disrupted pacc gene, which were used throughout this study, were selected as previously described. the h6 and pacc-1 strains were cultivated on sabouraud glucose agar for 15 days at 28 c, and pacc-1 cultures were supplemented with 450 g / ml hygromycin. mycelia were collected with a sterile spatula, vortexed in saline solution [0.9% (w / v) nacl ] with 0.01% (v / v) tween, filtered through fiberglass to remove mycelial debris, and then centrifuged to recover the conidia. then, 10 conidia were transferred to 50 ml of sabouraud broth, and germination was carried out at 28 c for 72 h on an orbital shaker at 180 rpm (control). after incubation, the final ph of the culture medium was measured with a ph meter, and the resulting mycelia were harvested by filtration through sterilized whatman paper (whatman international, maidstone, uk), washed with sterilized water, and transferred to minimal medium (mm) at ph 5.0 or ph 8.0, which was, in some cases (as indicated), buffered with 50 mm sodium citrate or 50 mm tris hcl, respectively. mm was supplemented with glucose (50 mm) or glucose plus glycine (50 mm each) and sodium nitrate (70 mm). all cultures were incubated at 28 c for 3, 6, and 24 h with agitation. mycelia obtained from each culture were harvested by filtration, and total rna was extracted from approximately 100 mg of frozen mycelium using trizol reagent, and treated with rnase - free dnase i (invitrogen, carlsbad, ca), following the manufacturer 's instructions. one microgram of dnase - treated rna was reverse transcribed into cdna using the high capacity cdna reverse transcription kit (applied biosystems, foster city, ca) according to the manufacturer 's instructions. the cdna from 3 independent biological experiments was quantified spectrophotometrically, and stored at 80 c until pcr amplification. for quantitative real - time pcr analyses, the genes encoding dolichyl - p - man : man(5)glcnac(2)-pp - dolichyl mannosyltransferase (n - man, terg_06338 ; genbank : xm_003233297) and o - mannosyltransferase (o - man, terg_06465 ; genbank : xm_003233430) were amplified from cdna using the following primers (53) : taaacgacagtggtatgccg (n - manfwd) and tgtagcctgttgggttctct (n - manrev) ; ccatgggacgtgtatactc (o - manfwd) and cgtcatcatagcaacattcag (o - manrev). reactions were performed in three independent experiments using sybr green pcr master mix (applied biosystems, foster city, ca), in the stepone plus real - time pcr system. a 12.5-l reaction was set up using 50 ng of cdna and 300 nm of each primer, and the pcr cycle was as follows : 95 c for 10 min, followed by 40 cycles of 95 c for 15 s and 60 c for 1 min. melting curve analyses were performed after each cycling to exclude primer dimers and nonspecific pcr products. relative transcript quantities were calculated using the ct method using the experimental condition that yielded the lowest ct value (n - man, non - buffered h6 cultures in keratin, 6 h incubation). the t. rubrum -actin (terg_06637) and -tubulin (terg_07904) genes, which were used as endogenous reference genes, were amplified using the following oligonucleotides (sequence 53) : aacgccatcatgaagtgt (actinfwd) and tccttctgcatacggtcaga (actinrev) ; ccgtatgatggccacttt (tubulinfwd) and ctgacctgggaaacgaagac (tubulinrev). data normalization and analyses were performed using the genex 5 multid analyses ab (www.multid.se). to confirm the identity of the genes analyzed in this work, as well as the endogenous reference genes, the pcr products were sequenced and analyzed by alignment with sequences retrieved from the broad institute dermatophyte comparative database (http://www.broadinstitute.org/annotation/genome/dermatophyte_comparative/multihome.html). in vitro growth of the dermatophyte t. rubrum is dependent on the initial culture ph, with apparent optimal growth at ph 4.05.0, irrespective of carbon source (glucose, glycine, or protein). the initial ph of the t. rubrum cultures increased from 5.0 to a ph that ranged from 8.3 to 8.9 after 7296 h of incubation in glycine or keratin. this effect was not observed when the fungus was cultivated with glucose as the carbon source, and the ph was maintained at approximately 5.0. hydrolysis of keratin and other proteins releases amino acids, such as glycine, whose metabolism leads to the secretion of ammonia, thereby shifting the ph of the culture from acidic to alkaline. therefore, the metabolism of both glycine and keratin at ph 5.0 were alkalinizing events, even though the culture ph was still acidic after 24 h of incubation in glycine or keratin (fig. disruption of the pacc gene in t. rubrum neither affects this ph shift (fig. however, a marked decrease in the conidiation on sabouraud solid medium and in the secretion of keratinolytic activity by the pacc-1 mutant, which correlated with its reduced capacity to infect human nails in vitro, were observed as compared to the control strain. no ambient ph changes were observed when the fungus was cultured in buffered media (data not shown). t. rubrum grows poorly in culture medium with a starting ph of 8.0, even though the culture becomes acidified after incubation with glucose as a carbon source (fig. 1). growth in glycine or keratin dropped the ph of the culture to approximately 7 after the first 36 h of incubation, which increased to approximately ph 7.5 after 24 h of incubation (fig. an attractive hypothesis is that t. rubrum senses the alkaline environment and then acidifies the culture medium to an ambient ph at which its growth is stimulated. metabolism of glycine or keratin leads to the secretion of ammonia, which shifts the culture ph to alkaline ph values. therefore, to better understand the transcription of both the o - man and n - man genes during the first 24 h of incubation, when the ph of the medium was still acidic in non - buffered cultures (fig. 1), we estimated the expression of both genes by qrt - pcr in different culture conditions. transcription of the o - man and n - man genes in both the h6 and pacc-1 mutant strains was affected differently by the carbon source, the culture ph, and the time of incubation (fig. o - man was preferentially transcribed in both buffered and non - buffered keratin cultures, whereas n - man was apparently preferentially transcribed in non - buffered glucose cultures. the expression of n - man decreased as incubation time increased at ph 5.0, but the expression decreased more consistently in buffered glucose cultures (fig. disruption of the pacc gene decreased transcription of o - man in both glucose and keratin at ph 5.0 ; however, o - man expression was enhanced in glucose plus glycine. interestingly, the transcription of n - man in keratin cultures was enhanced in the pacc-1 mutant at ph 5.0. therefore, at acidic ph, transcription of the o - man and n - man genes was positively and negatively affected, respectively, by the pacc gene in keratine cultures (fig. 2). moreover, transcription of the o - man and n - man genes in buffered cultures indicated that the o - man gene was preferentially transcribed at acidic ph in the presence of keratin compared to glucose or glucose plus glycine as the carbon sources, whereas transcription of the n - man gene was almost the same in both acidic and alkaline ph in the presence of keratin, and these properties were affected by disruption of the pacc gene (fig. it is also worth noting that while the disruption of the pacc gene resulted in changed transcription of the o - man gene in the different conditions at ph 5.0, it also resulted in the opposite changes for growth in glucose and glucose plus glycine at ph 8.0. thus, our results suggest that the product of the pacc gene negatively affect both the transcription of the n - man gene in keratin at ph 5.0 and the o - man gene at ph 8.0 in the presence of different nutrients (fig. 2) i.e., the pacc gene is functional irrespective of the culture conditions assayed. it has been well documented that the dermatophyte t. rubrum, as well as other filamentous fungi, acidifies the culture medium and represses the secretion of proteases during growth in glucose as the sole carbon source. moreover, during growth in glycine or keratin, the culture medium is alkalinized ; however, this change is dependent on the initial ph of the culture, with an apparent optimum at ph 4.05.0. interestingly, glycine utilization is apparently not repressed by glucose, because alkalinization of the culture medium occurs with glucose and glycine as carbon sources. however, it is worth noting that during the first 24 h of cultivation, the ph of the medium is still acidic (fig. 1), implying that the metabolism of glycine or keratin, an alkalinizing event, occurs during the first 24 h of cultivation, exclusively in an acidic environment. in the model fungi neurospora crassa and aspergillus nidulans, one of the metabolic responses to the ph of the culture medium is the ph - dependent glycosylation of secreted enzymes [3437 ]. for example, the level of glycosylation of the pho-2 alkaline phosphatase synthesized by n. crassa at alkaline ph differs from that synthesized at acidic ph, which is approximately 13% and 21% for the pho-2 enzyme purified from mycelium grown at ph 5.4 and 7.8, respectively. the loss of enzymatic activity observed for the pi - repressible alkaline phosphatase secreted at acidic ph is probably because the glycosylation of this enzyme is lower than that secreted at alkaline ph. we have also provided evidence that glycosylation of secreted enzymes, as documented for the pi - repressible phosphatases in n. crassa and a. nidulans, is pacc - dependent. in t. rubrum, disruption of the pacc gene, as in the pacc-1 mutant strain, resulted in decreased growth on human nails and decreased secretion of keratinolytic proteases in liquid medium when supplemented with keratin, which suggests that the keratinases secreted by t. rubrum are somehow regulated by the pacc protein. pacc might be involved in the glycosylation of these keratinases through transcriptional modulation of o- and n - linked mannosyltransferases, a hypothesis supported by the results described here. transcriptional profiling of both the o - man and n - man genes revealed a high level of complexity, because transcription of these genes was affected by nutrients, culture ph, and the functioning of the pacc gene. disruption of the pacc gene increased the expression of n - man at ph 5.0 in keratin cultures. moreover, if o - mannosylation precedes n - glycosylation in t. rubrum, as demonstrated in yeast, this physiological effect is dependent on the function of the pacc gene at acidic ph. in conclusion, the genes encoding the o- and n - mannosyltransferases had different expression profiles, and the o - man gene was preferentially expressed at acidic ph when t. rubrum was grown on medium containing keratin. the balance between n - man and o - man expression levels in cultures at acidic ph may be under the control of the pacc transcription factor (in response to different carbon sources). therefore, the product of the pacc gene of t. rubrum is functional at acidic ph. moreover, transcription of the n - man and o - man genes might be required at different culture phs for the glycosylation of transported proteins, according to the stage of infection, which suggests a possible role in cell adhesion and activation of signalling pathways regulating the production of enzymes that enable nutrient uptake for fungal development and maintenance in the host [3941 ]. | in fungi, ambient ph sensing involves the activation of the pal / pacc signalling pathway. in the dermatophyte trichophyton rubrum, ph - dependent secretion of keratinases, which are major virulence determinants, is affected by disruption of the pacc gene. here, the transcription profiling of the genes coding for n- and o - linked mannosyltransferases, enzymes involved in protein glycosylation, was evaluated in t. rubrum in response to disruption of the pacc gene and growth in keratin, glucose, and glucose plus glycine. we show that transcription of these mannosyltransferase genes is affected by nutrients at acidic ph and by pacc. |
glucometers, which employ the glucose dehydrogenase pyrroloquinoline quinone (gdh - pqq) are known to produce falsely high recordings of capillary glucose in the presence of interfering substances like maltose and galactose. the food and drug administration (fda) did recommend that these meters should not be used in hospital settings. following this public health notification gdh - pqq glucometers have been supplanted by glucometers using mutant variant of quinoprotein glucose dehydrogenase (mutq - gdh) chemistry which is a maltose independent advanced chemistry. we report a child who had falsely high capillary glucose values with a mutq - gdh glucometer. the child was later proven to have galactosemia and the falsely high capillary glucose was due to a cross reaction with galactose. a 2-month - old male child was admitted to our hospital for jaundice and failure to thrive. admission arterial blood gas was suggestive of compensated metabolic acidosis with a high anion gap. random capillary glucose was performed, which revealed a value of 310 mg / dl [table 1 ]. lab results of the patient on the first day of hospitalization subsequent readings taken every hour for the next 6 h were above 250 mg / dl. capillary glucose testing was performed using accu - check performa (roche diagnostics, mannheim, germany) glucometer. in view of suspected diabetic ketoacidosis, an endocrinology consultation was sought and hydration and insulin infusion were considered. however, the corresponding random venous plasma glucose was 67 mg / dl (performed using glucose oxidase method) and there was an absence of glucosuria. hence, it was decided to withhold insulin infusion and potentially fatal hypoglycemia was avoided. in view of a possible cross reaction of high galactose with the glucometer, which employs a mutq - gdh chemistry further testing a quantitative test for galactose-1-phosphate uridyl transferase in whole blood showed a value of 3.85 u / g hb (normal range 11 - 41.0 u / g hb). quantitative test for galactose 1-phosphate in red blood cell was 1.8 mg / dl (normal range 0 - 1 mg / dl). a liver biopsy revealed macrovesicular steatosis with bile duct proliferation and a fibrosis score of 4/6 [figure 1 ]. liver biopsy showing macrovesicular steatosis (white arrow) and bileduct proliferation (black arrow) the child was started on a galactose free formula. he showed steady improvement with resolution of jaundice and weighed 4.0 kg on repeat examination 1 month later. galactosemia is a rare condition with a prevalence of 1 in 60,000 live births among caucasians. diagnosis of galactosemia is usually made by a new born screening test in western countries. in india, a prospective screening study for galactosemia in 18,000 newborns in india identified a single case of galactosemia with an estimated prevalence of 1:10,300. point of care testing devices like glucometers are increasingly being used in hospital care settings. hence, it is important that the practicing clinician is aware of the technical deficiencies associated with these devices. pre - analytical errors include damage to the test strip or incomplete deposition of reagent on the test strip. analytical errors deal with the technique of testing and includes insufficient or excessive blood loading, miscoding, calibration errors and those arising from contamination. operator dependent errors can be divided into two, namely those involving glucometers using glucose oxidase chemistry and those involving gdh - pqq chemistry. hypertriglyceridemia, hyperuricemia, hypoxia and acetaminophen can interfere with glucometers using the glucose oxidase chemistry. diet or medication containing excessive galactose, maltose, xylose and vitamin c can interfere with glucose dehydrogenase (gdh) biosensor. a previous analysis of the food and drug administration 's (fda) manufacturer and user facility device experience (maude) data base for gdh - pqq glucometer has listed two cases of severe hypoglycemia (non - fatal) in children with galactosemia and these events happened despite warnings by both manufacturers and regulatory authorities. to our knowledge, this is the first clinical case report of a falsely high glucose reading due to high galactose in a proven case of galactosemia with a glucometer using the mutq - gdh chemistry (a modified gdh - pqq chemistry). the package insert of the glucometer cautions that galactose levels greater than 15 mg / dl (0.83 mmol / l) can cause overestimation of glucose values. according to a previous biochemical study galactose levels more than 39 mg / dl (2.2 mmol / l) had significant interference with the glucometer test strips and can produce a falsely high reading. in developing countries where there is no new born screening for galactosemia a sick infant with high galactose levels is at risk for developing iatrogenic hypoglycemia. based on our experience, we suggest precautionary measures to prevent a medical misadventure. all stakeholders including doctors, nurses, diabetic educators and caregivers of galactosemia patients should be made aware of the pitfalls of mutq - gdh - pqq chemistry based glucometers. | we report a 2-month - old child with galactosemia and falsely high glucose readings with a glucometer using mutant variant of quinoprotein glucose dehydrogenase (mutq - gdh) chemistry. potentially fatal hypoglycemia could have been induced in the child if insulin infusion had been initiated as per glycemic management protocol. even though, the product information with the glucometer carries warning regarding interference by high galactose levels, the awareness regarding this interaction is generally poor in many practice settings. although, false readings have been reported with glucose dehydrogenase pyrroloquinoline quinone (gdh - pqq) glucometers, to our knowledge this is the first case report of a falsely high glucose reading due to high galactose in a proven case of galactosemia with a glucometer using the mutq - gdh chemistry (a modified gdh - pqq chemistry). our experience has prompted us to write this case report and we suggest avoiding these glucometers in neonates and infants when a metabolic disease is suspected. |
approximately 2 billion people have latent infection, 8 million would develop active tuberculosis annually, and 2 - 3 million would die due to tuberculosis. with this resurgence, cases with extrapulmonary tuberculosis approximately 10 - 11% of extrapulmonary tuberculosis involves joints and bones, which is approximately 13% of all tuberculosis cases. collagens are major structural proteins of the extracellular matrix, joints, and bones and their correct structure is crucial for the proper functioning of locomotor apparatus. both tuberculosis per se and its chemotherapy with antitubercular drugs could cause pronounced changes in collagen 's contents and structure [1, 2 ]. investigation of these changes is very important for improving first - line antitubercular therapy and minimization of its adverse effects. previously we have demonstrated putative changes in rat bone and skin type i collagens amino acid contents with using different doses of pyrazinamide [2, 3 ]. type ii collagen has been classically recognized as the major collagenous component of cartilage. the aim of present study was to investigate potential effect of pyrazinamide on male rats cartilage type ii collagen amino acid composition. extraction of proteoglycans was carried out by 100 ml 2 m mgcl2, 0.05 m tris (ph 7.6) during 3 days. collagen was extracted by 100 ml 0.1 m acetic acid (ph 2.5) with pepsin. pepsin (20 mg / g of tissue) was added into this solution and mixtures were left for 3 days in refrigerator at 4c. after that for pepsin inactivation ph in each mixture was neutralized by addition of powdered crystalline tris (to ph 7.6). fractionation of pure type ii collagens was carried out by growing concentrations of nacl according to method. protein fraction from pellet which was formed at 4.4 m nacl concentration contained type ii collagen. fractions were separated by centrifugation (65000 g, 60 min, at 4c). obtained pellets were recrystallized (3 times) by dialysis (against 15% kcl in 0.02 m nahpo4 at 4c) and centrifugation (65000 g, 60 min, at 4c). collagen fractions were hydrolyzed : 24 h, 6 n hcl, 105c. their amino acid compositions were analyzed by ion exchange chromatography on the amino acid analyzer aaa-881 (czech republic). in statistical processing of experimental data mean of corresponding parameter (for each animal) was used as independent variable. the obtained data were calculated by one - way analysis of variance (anova). changes in male rat cartilage type ii collagen amino acid contents induced by pyrazinamide were profound as compared to control (table 1). statistically significant changes were registered in cartilage collagen with pyrazinamide administration at dose 1000 mg / kg for 6 amino acids and at dose 2000 mg / kg for 6 amino acids. cartilage type ii collagen of male rats with pyrazinamide at dose 1000 mg / kg contains lower contents of alanine (12.3%) and isoleucine (37.8%) simultaneously with higher contents of serine (+ 46.5%), glutamic acid (+ 31.0%), and leucine (+ 46.6%). collagen of rats with pyrazinamide at dose 2000 mg / kg contains lower contents of arginine (25.9%) and alanine (31.7%) simultaneously with higher contents of serine (+ 65.6%), valine (+ 32.7%), and leucine (+ 40.6%). for the majority of amino acids our experiments demonstrated presence of qualitative changes in male rats ' cartilage type ii collagens with pyrazinamide (in comparison with norm) (table 1). with pyrazinamide administration possibly could be formed cartilage type ii collagen molecules with changed surface charge (changes in number of arginine, serine, and glutamic acid residues), rigidity (changes in quantity of alanine, valine, isoleucine residues), number of specific loci responsible for cell adhesion, interaction with chaperons, and procollagen processing to collagen (changes in arginine residues) [814 ]. such collagen molecules changes could hence affect the properties of connective tissues, mineralisation processes, and calcium metabolism. comparative analysis of present results with our previous data on skin and bone type i collagens demonstrated analogous character of changes in regard to contents of serine, glutamic acid, alanine, valine, and leucine residues [2, 3 ]. this could be the evidence of existence some general mechanisms of pyrazinamide effects on collagen 's contents and structure. moreover, having compared these data with our previous experiments, we found out analogous character of these changes in regard to changes of free serine, glutamic acid, alanine, valine, and leucine contents in liver, kidney, lung and spleen pools with different doses of pyrazinamide. thus adverse effects of pyrazinamide (this widely used antitubercular drug) are much more serious and more profound than it was considered earlier. among this pyrazinamide treatment could cause qualitative changes in nucleic acid molecules, change their length, and structure. we can suppose that such changes could be caused by pyrazinamide via its influence on nucleic acids (coding information for this proteins synthesis) as it was mentioned previously [2, 9, 10 ]. in our previous experiments we demonstrated epigenetic changes induced by pyrazinamide treatment, pyrazinamide - mediated alterations in male rats dna fragmentation processes, bone type i collagen amino acid composition, spermatogenesis indices, reproductive capability, and posterity antenatal and postnatal development. besides these, on changes in collagen metabolism and structure pathologic changes in amino acid metabolism could also be affected. and at last, due to collagen genes polymorphism [1114 ], collagen structures contain in norm 4 different -chains of the same type in different concentrations. pathology changed concentrations in which these 4 different -chains of the same type of collagen are present in connective tissue structures. possibly pyrazinamide - caused disturbances in amino acid compositions in our experiments could be a result of such changes in transcription rates of genes coding different -chains from the same type collagen superfamily as it was previously demonstrated for other pathology. | introduction. current therapeutic regimens with first - line antitubercular agents are associated to a high rate of adverse effects which could cause pronounced changes in collagen 's contents and structure. investigation of these changes is very important for optimization of antitubercular therapy and minimization of treatment - caused harm. the aim of present paper was to investigate potential effect of pyrazinamide on male rats ' cartilage type ii collagen amino acid composition. materials and methods. wistar albino male rats (160200 g b.w.) were divided into three groups : i received pyrazinamide per os at a dose of 1000 mg / kg b.w./day ; ii at a dose of 2000 mg / kg b.w./day, in both groups it was given for 60 days ; iii control. after 60 days of the experiment, rats of the experimental (groups i and ii) and control groups were sacrificed and the amino acids contents of male rat cartilage type ii collagens were determined using amino acid analyzer. results and discussion. the study of pyrazinamide effects (administered in different doses) on rat cartilage type ii collagen amino acid contents demonstrated presence of dose - dependent pyrazinamide - mediated quantitative and qualitative changes in these rat extracellular matrix proteins in comparison with control. |
the obesity epidemic currently facing the developed world [1, 2 ] is increasing the number of people affected by preventable causes of disability. this epidemic has an impact on the field of rehabilitation as interventions need to be adapted for people with obesity and new approaches need to be developed for people with disability resulting primarily from obesity. [4, 5 ], one physiological issue in the obese that is affected is the respiratory system. some of the affected respiratory physiology includes altered static lung volumes, lower arterial oxygen pressure (pao2), increased alveolar - to - arterial oxygen pressure difference (aado2) at rest, reduced respiratory system compliance with increased elastic loading of the inspiratory muscles, increased work and oxygen cost of breathing, and increased respiratory resistance compared to normal - weight individuals. nonetheless, obesity can affect almost all aspects of function and extend to impacting on quality of life (qol) and health related quality of life (hrql). the term weight - related quality of life (wrql) is emerging to express the effect of excess weight on an individual 's ability to live a fulfilling life. body mass index (bmi) explains only about one - third of the variance of wrql [7, 8 ]. few nonmodifiable factors such as gender [9, 10 ], race [8, 9 ], and age [10, 11 ] have been associated with wrql. pain is known to have a strong impact on wrql [12, 13 ]. other potentially modifiable predictors include depression, arthritis, and gastroesophageal reflux along with weight - related stigma, but these factors are only a partial representation of the determinants of wrql. data also indicate that obese individuals with binge - eating disorder are strongly related to a poorer hrql, whether these measures are evaluated in those without surgery or postbariatric surgery. however, it is not certain if binge - eating disorder independently affects wrql. modifiable factors such as cardiorespiratory fitness confers some hrql benefits in the obese. measures of body size have been implicated with respiratory functions including pao2 [1921 ]. in earlier work on this same group of subjects, we showed that among people with morbid obesity, a high waist - to - hip ratio was associated with poorer arterial blood - gas status. on average, pao2 decreases by 5 mmhg and aado2 increases by 5 mmhg as waist - to - hip ratio increases by 0.1 units [20, 21 ]. gender plays a role in arterial blood - gas status, but that is only because the waist - to - hip ratio is different between males and females. a recent review has shown that every 5 to 6 kg reduction in weight increases pao2 by 1 and decreases aado2 by 1 mmhg. waist circumference has also been associated with exercise capacity and bmi has been associated with functional walking capacity as measured by the 6-minute walk test (6mwt) (pearson 's r = 0.71 ; p = 0.002). the demonstration that obese women have poorer walking capacities than normal - weight persons and that weight reduction improved walking speed and maximum oxygen uptake (vo2max) supports a direct link between weight and mobility. this relationship is likely mediated through respiratory function as research has shown a strong relationship between respiratory function and walking capacity (r = 0.5 to 0.8 between vo2max and 6mwt). walking capacity and vo2max 6mwt correlated well (spearman 's rho : 0.39 to 0.49 ; p < 0.01) with the physical function domain of the medical outcome study short - form health survey (sf-36) [18, 28 ], which is a well - established generic measure of hrql. the fact that obese people report decrements up to 30% in most domains of the sf-36 relative to general population norms [14, 29, 30 ] suggests that through some direct and/or indirect mechanisms, obesity impacts hrql. to do justice to the complexity of the relationships underlying wrql requires a strong theoretical framework for estimating direct and indirect effects of these multiple constructs. in this study, this model proposes a linear relationship between biological and physiological factors, symptoms status, functional status, general health perception, and quality of life. in addition, characteristics of the individual and of the environment are included as mediating variables. the aim of this study was to contribute evidence to support a framework for understanding the impact of obesity on quality of life, considering a wide number of potential determinants. morbidly obese persons scheduled for laparoscopic gastric bypass were recruited at the mcgill university health center (muhc), montreal, canada. kg / m, (2) a medical contraindication to exercise testing (acute myocardial infarction, cardiac arrhythmia, or use of pacemaker) ; (3) respiratory, renal, or hepatic failure ; (4) metastatic disease ; (5) cognitive impairment. arterial blood gasesarterial blood gases were obtained from radial artery cannulation and sampled after 5 minutes of rest, with the participants sitting upright on a chair. arterial blood - gases were corrected for changes in arterial blood temperature and measured directly via an abl725 blood gas analyzer (radiometer, copenhagen, denmark). arterial blood gases were obtained from radial artery cannulation and sampled after 5 minutes of rest, with the participants sitting upright on a chair. arterial blood - gases were corrected for changes in arterial blood temperature and measured directly via an abl725 blood gas analyzer (radiometer, copenhagen, denmark). aerobic capacity testa test to determine peak oxygen uptake (vo2peak) was performed on an electrically braked cycle ergometer (velotron dynafit pro, racermate inc., the vo2peak test commenced at 5 w and increased by 1 w every 2 to 6 seconds (10 to 30 watts every minute) until volitional exhaustion. the difference in the incremental increase in power output was to make sure all individuals fatigued within 8 to 12 minutes. vo2 was measured with a metabolic cart (model vmax 229lv, sensorsmedics, yorba linda, ca) using the breath - by - breath option. the mean of the highest three consecutive vo2 values (averaged over 20-second intervals) was defined as the vo2peak. a test to determine peak oxygen uptake (vo2peak) was performed on an electrically braked cycle ergometer (velotron dynafit pro, racermate inc., the vo2peak test commenced at 5 w and increased by 1 w every 2 to 6 seconds (10 to 30 watts every minute) until volitional exhaustion. the difference in the incremental increase in power output was to make sure all individuals fatigued within 8 to 12 minutes. vo2 was measured with a metabolic cart (model vmax 229lv, sensorsmedics, yorba linda, ca) using the breath - by - breath option. the mean of the highest three consecutive vo2 values (averaged over 20-second intervals) was defined as the vo2peak. 6 mwt is the distance an individual can walk in 6-minutes ; it reflects the capacity of an individual to perform daily activities.. predicted values for age and gender were estimated using the formula from gibbons.. the sf-36 is a 36-item survey that includes eight domains measuring physical functioning, role limitations due to physical health problems, bodily pain, general health perceptions, vitality, social functioning, role limitations due to emotional problems, and mental health. a physical and mental component summary (pcs and mcs) can be derived from these items. the summary scales are standardized with a mean of 50 and a standard deviation of ten. the sf-36 is a reliable measure with good internal consistency and good test - retest reliability. the iwqol - lite is a self - reported questionnaire designed to assess the impact of obesity on quality of life. it is comprised of 31 items grouped into five dimensions : physical functioning, self - esteem, sexual life, public distress, and work. the measure has excellent psychometric properties with good internal consistency (ranging from 0.90 to 0.96), good test - retest reliability (0.83 to 0.94), is sensitive to weight change [38, 39 ], and its scale structure is supported by confirmatory factor analysis. to facilitate interpretation of values for the iwqol - lite, the scoring has been reversed and transformed according to the following formula : (1)transformed score= [(maximum theoretical scoreactual score)test score range ] 100. the score is considered as a continuous variable in the analysis. a model of wrql the relationships between variables representing the different components within the wilson - cleary model were estimated with linear regressions. the statistical significance and the consistency with the literature in the direction of the coefficients were examined. path analysis allows the simultaneous estimation of all relationships between the variables in a single model rather than a series of models. it estimates the effect of each variable on the subsequent one, controlling for prior variables. a variable can be a dependent variable in one relationship and an independent variable in another. the several related relationships between biological, physiological, functional factors, and wrql were modeled. we included variables that have been shown to have a significant impact on quality of life among people with obesity in previous studies. the extent to which the data was consistent with the model was then tested with the maximum likelihood estimate method (ml). the full information maximum likelihood (fiml) estimation was used to impute data that were considered missing randomly. the latter is the recommended method as it yields consistent and efficient estimates. to evaluate the fit of the model as a whole, few goodness - of - fit tests were used following the recommendations of hu and bentler and schermelleh - engel.. the goodness of fit tests assessed how the model accounts for the observed correlations or covariances. first, we used the chi - square test statistic, which should be close to zero. as the chi - square test is highly dependent on sample size, other measures of fit were also used. the root mean square error of approximation (rmsea) is a measure of approximate fit in the population and is concerned with the discrepancy due to approximation. in addition, a 90% confidence interval (ci) enabled an assessment of the precision of rmsea estimate. the lower boundary (left side) of the ci should contain zero for exact fit. another goodness - of - fit measure used was the standardized root mean square residual (srmr), which is an overall fit measure based on residuals. a rule of thumb is that srmr should be less than 0.05 for good fit. the comparative fit index (cfi) and the tucker - lewis index (tli) are based on model comparisons. for both indexes, values greater than 0.97 indicate a good fit relative to the independent model. because the tli is not normed functional walking capacity (6mwt) was approximately 60% of age - predicted value. aerobic capacity (ml / kg / min) was below the 20th percentile. their hrql scores, indicate impairment with the sf-36 physical component being more impacted than the mental component (pcs = 34 ; norm 52, mcs = 44 ; norm 51). the sample had an average value of 46 out of 100 on the iwqol - lite. on the iwqol - lite, which has been transformed to have 100 indicating excellent quality of life, women reported much lower values than men, reaching statistical significance for overall quality of life, and for the dimensions of public distress and self - esteem. 4% of the data was missing with 6 out of 42 participants having 1 or more missing values. the wrql model consisted of the linear effect of waist circumference on pao2 at rest, pao2 at rest on 6mwt, 6mwt on pcs, pcs on iwqol - lite, and mcs on iwqol - lite. the relationships between each individual components of the wrql model were statistically significant except for the effect of pao2 at rest on 6mwt (p = 0.0546). waist circumference was a predictor of pao2 at rest, pao2 at rest was a predictor of walking capacity, which in turn predicted pcs. the first model estimated the effect of waist circumference on pao2 at rest, the second model estimated the effect of waist circumference and pao2 at rest on 6mwt, the third estimated the effect of waist circumference, pao2 at rest, and 6mwt on pcs, and finally the fourth estimated the effect of all these factors together on iwqol. tables 3 and 5 show the results of the multiple linear regression models, which were similar to those obtained from the univariate regression. the total variance of iwqol - lite explained by the model with waist circumference, pao2 at rest, 6mwt, pcs, and mcs was 28%. these results show the limitations of regression as there is only one outcome variable and the predictors must act independently in order to have an effect. numerous regressions need to be estimated to assess the relationship between several variables. in the multivariable model, each variable is adjusted for the effects of the others and hence their effects on other variables are not estimable. a path coefficient () represents the relative effect of each factor on subsequent factors, after controlling for all other prior and simultaneous effects. the path analysis supported the findings of the linear regression, all coefficients were statistically significant. the results of the path analysis are represented in figure 1. according to the path analysis, as waist circumference increased, pao2 at rest decreased (= 0.234 ; p = 0.0118). as pao2 at rest increased, the distance walked in 6-minutes increased (= 2.585 ; p = 0.0414). the 6mwt had a positive effect on physical functioning (= 0.051 ; p = 0.0008), which in turn was related to better quality of life (= 1.148 ; p = < 0.0001). mental health was also associated with better iwqol (= 0.872 ; p = 0.0052). the total effect of waist circumference on iwqol - lite was 0.035 [(0.234) (2.585) (0.051) (1.148) ]. the summary statistics suggested excellent fit of the data (= 4.963, 9 df, p = 0.838 ; rmsea estimate = 0.000, rmsea 90% confidence interval = 0.0000.101 srmr = 0.065 ; cfi = 1.000 ; tli = 1.225). the model explained 13% of the variance in pao2, 22% of pcs, 9% of 6mwt, and 38% of iwqol - lite. about 6% of americans are morbidly obese and a large proportion have impaired wrql. given the impact of obesity, the development of a framework for understanding and measuring the quality of life of people with obesity is essential. understanding the determinants of wrql could enable us to develop targeted biopsychosocial intervention to improve the quality of life of obese people. the interventions would then serve as a catalyst for engaging in behaviours which impact on both weight and on quality of life. hrql measures focus mainly on functioning, and fail to consider that people with chronic disease, such as obesity, may have adapted by finding alternative ways to have a satisfactory life. some authors argue that we are really measuring perceived health and not hrql with our present measures. that is, to assess hrql adequately, the measures would have to incorporate the values and meanings an individual places on a given function. once the determinants of wrql have been identified, they can be integrated in the measures of wrql, which could improve their psychometric properties, and render them more reflective of patients ' values rather than solely of their functioning. the statistical significance of the relationships between the components of the model of wrql was demonstrated with linear regression. path analysis is the optimal approach to test a model as it evaluates an entire hypothesized multivariate model. it allows for the estimation of the direct effect of a variable on another, as well as the indirect effect of a variable on another through an intervening variable. the measures of body size were all highly correlated, but the model with waist size had the best fit. based on correlations and regression models, waist - to - hip ratio has been found to predict pao2, and an increase of waist - to - hip ratio is associated with lower resting pao2 [20, 21 ]. pcs and mcs from the sf-36 can be considered as indicators of perceived health status, the capacity to exercise should theoretically impact an individual 's perceived health status. both sf-36 and iwqol - lite are hrql measures : one is generic while the other is obesity specific. the determination of the minimum sample size required in path analysis is complex. unlike in a linear regression, where the sample size depends on the ratio of subjects to variables, in a path analysis it depends on the number of parameters to be estimated. the model estimated is simple consisting of six variables and 5 paths (sample size of 42 for 13 free parameters). the variables are normally distributed, and there were no convergence problems or improper solutions, such as negative variance estimates or heywood cases. there may be other valid alternative models, and some relationships may have been excluded from the model by lack of power, but the relationships included are undeniably significant. in addition, a path analysis (sometimes called causal modeling) tests theoretical propositions about cause and effect without manipulating variables. in this study the propositions are supported by this method of decomposing correlations but the result does not prove that the causal assumptions are correct. therefore the results should be considered as preliminary and need to be cross - validated in other samples. the model explained 38% of the variance of iwqol - lite, which may appear small but can be expected considering the complexity of wrql and the limited spectrum of variables available on this sample. the use of latent variable representing many observed indicators may help to explain more variance in future studies. other variables such as weight history, readiness for change, and physical activity habits would be interesting to examine. furthermore, the presence of binge - eating disorder was not evaluated, which could have affected the results. finally, the analysis is based on the wilson - cleary model which proposes linear relationships between variables. this linear model may not be optimal to capture the network of factors around wrql. in conclusion, waist circumference, pao2, functional walking capacity, and mental health were predictors of wrql. | obesity and its relation to quality of life are multifaceted. the purpose of this paper was to contribute evidence to support a framework for understanding the impact of obesity on quality of life in 42 morbidly obese subjects considering a wide number of potential determinants. a model of weight - related quality of life (wrql) was developed based on the wilson - cleary model, considering subjects ' weight characteristics, arterial oxygen pressure (pao2), walking capacity (6-minute walk test, 6mwt), health - related quality of life (hrql ; physical and mental component summaries of the sf-36 pcs / mcs), and wrql. the model of wrql was tested with linear regressions and a path analysis, which showed that as pao2 at rest increased 6mwt increased. 6mwt was positively associated with the pcs, which in turn was positively related to wrql along with the mcs. the model showed good fit and explained 38% of the variance in wrql. |
rotational atherectomy (ra) is an irreplaceable modality for heavily calcified lesions in current percutaneous coronary intervention (pci). since incomplete stent expansion is a well - known predisposing factor for further instent restenosis and thrombosis, lesion preparation using ra prior to stent deployment in balloon heavily calcified undilatable lesion is mandatory. however, some complications may be encountered during ra procedure, including slow or no reflow, coronary spasm, distal embolization, coronary dissection, coronary perforation, fracture of the guide wire (gw), or the drive shaft and entrapment of burr. among these complications, it occurs more frequently in off - label use and usually needs surgical removal. here we report a case series of burr entrapment and discuss the mechanism and management of this complication. case 1 was a 60-year - old lady with lupus nephritis complicated with end stage renal disease under regular hemodialysis for decades. rotablation for the heavily calcified left anterior decending artery (lad) (figure 1a) was performed by 1.5 mm rotablator burr initially and followed by another 1.75 mm one. during the pecking motion of the 1.75 mm burr at 160,000 r / min, it was suddenly stuck at the distal lad and could not be activated even after intracoronary nitroglycerin injection (figure 1b). a hydrophilic fielder fc wire (asahi intech, japan) and a stiff conquest wire (asahi intech, japan) were tried to pass the entrapped burr for dilation of the segment that entrapped it, but both failed. the burr was re - activated after increased the speed up to 180,000 r / min and could be advanced distally followed by successful retrieval. case 2 was a 65-year - old gentleman with type 2 diabetes and dyslipidemia, who was admitted for pci because of unstable angina. heavily calcified from proximal to distal lad was revealed by both angiography and intravascular ultrasound. rotablation using a 1.5 mm burr was performed at a speed of 180,000 r / min. the burr was entrapped at the distal lad during a long run of more than 10 s (figure 2). the stuck burr was retrieved by pulling vigorously on the guiding catheter (gc), gw and rotablator burr simultaneously. however, it resulted in a spiral dissection and acute closure at the distal lad, which was successfully rescued by re - wiring and stenting. case 3 was a 69-year - old woman who was admitted due to stable angina. ra was performed using a 1.5 mm burr, which was entrapped after passing the angulated segment during the first run (figure 3). despite all efforts, the burr could not be retrieved successfully and the patient was sent for emergent surgery to retrieve the burr. case 4 was a 74-year - old male with left main (lm) bifurcation disease and received bypass surgery years ago. pci for the lm bifurcation and calcified lad lesions was performed because all the bypass grafts were occluded. a conquest wire was passed distally followed by 2.5 mm balloon inflation at the stenotic lesion to retrieve the entrapped burr successfully (figure 4). after stenting for the lad, the lm bifurcation was successfully treated by simultaneous kissing stenting. heavily calcified lad and left circumflex artery (lcx) were found and a 1.25 mm burr was employed first for the lcx lesion. during the pecking motion of rotablation, the burr was suddenly trapped at middle lcx and could not be retrieved (figure 5). the entrapped burr was removed by manual traction of the burr and guide wire, which resulted in injury and acute closure at the ostium of lcx. intra - aortic balloon pump was inserted for hemodynamic support and antegrade flow of lcx was restored by successful re - wiring and stenting. the burr is olive - shaped and has diamond coating at its distal surface for antegrade ablation, but the proximal part was smooth without diamonds, which prohibits backward ablation. if a burr was advanced beyond a tight calcified lesion or embedded in a long, angulated and heavily calcified lesion, it can be entrapped. first, a small burr can be advanced beyond a heavily calcified plaque before sufficient ablation, especially when the burr is pushed firmly at high rotational speed. during high speed rotation, meanwhile, the coefficient of friction during motion is less than that at rest, which may facilitate the burr to pass the calcified lesion easily without debulking a significant amount of calcified tissue. in this situation this phenomenon was named kokesi after the japanese doll by kaneda. second, the burr can be entrapped within a severely calcified long lesion, especially angulated and concomitant coronary spasm. when a large burr was pushing vigorously against such lesion without sufficient pecking motion, the rotational speed may decrease significantly and this type of entrapment may occur. an emergent open surgery would be the most reliable and always the last option for removing the entrapped burr, just as the case 3 we reported. however, surgical removal is invasive, time consuming and usually not immediately available, especially for hemodynamic unstable cases. before sending the patient to surgery, several non - surgical techniques, to relief spasm and facilitate antegrade coronary flow, intracoronary nitroglycerin and/or verapamil injection are also suggested.,, the simplest method to retrieve the entrapped burr is pulling back the rotablator system manually. in some cases, as the case 2 and 5 of our series, the stuck burr can be withdrawal successfully by manual traction with on - dynaglide or off - dynaglide rotation but the vessel may perforate and proximal segment may be injured. extreme force on the burr and burr shaft may also result in shaft fracture. disengaged the gc from vessel ositum and sending another gw deep into aorta may prevent vessel injury by avoid deep seating of gc during traction. in some cases, set the rotablation speed up to 200,000 r / min and try to advance the burr into the distal lumen may successfully withdrawal the burr while spinning, just as our case 1. second, if simple manual traction failed, passing a second gw beyond the entrapped burr followed by balloon dilatation for the calcified lesion proximal to it may create a crack between the burr and vessel wall to retrieve it.,,, the lesion surrounding the entrapped burr is always heavily calcified and usually need a hydrophilic - coated wire to pass it and sometimes stiffer wire such as conquest wire may be needed to pass the adjacent hard plaque,, as the case 4 of our series. however, the profile of the rotablation drive shaft sheath is 4.3 fr, which may prohibit introducing of a balloon catheter (mostly 3 fr in diameter) into the gc if it is a 6 or 7 fr one. in this situation, introducing another gc via another vascular access may be needed for the second gw and balloon., alternatively, the gc may be exchanged to a 8 fr one after cutting off the burr and sheath near the advancer.,, sakura. demonstrated a novel idea to remove the drive shaft sheath after cut off the system near the advancer. after retracting the sheath and leaving the transected uncoupled burr, a second gw and balloon catheter can easily pass through the gc even it is a 6 fr one. third, a snare was reported to remove an entrapped burr successfully by parsan. the rotablation system was cut at the hub as described above, which allowed direct access of the snare to the burr shaft. after encircled the burr shaft by the snare and the noose tightened immediately proximal to the entrapped burr, the burr was successful withdrawal by simultaneously retracting on the snare and the gc. applying the traction force locally to the entrapped burr is a more controlled manner and may reduce the risk of proximal vascular trauma. fourth, using a child catheter was also reported to retrieve the stuck burr either by over - the - wire 5fr 120-cm straight gc (heartrail st01, terumo, japan) or monorail 5 fr guideliner (vascular solutions, minnesota, usa) gc. after cut off the drive shaft and sheath near the advancer, the child catheter can be inserted through the remaining rotablation system to the entrapped burr. by simultaneous traction on the burr shaft and counter - traction on the child catheter, the catheter tip can act as a wedge between the burr and the surrounding plaque, which may exert a larger and more direct pulling force to retrieve the burr. furthermore, the child catheter may protect the proximal vessel on coronary tree and facilitate following interventional procedures after successful removal of the burr by taking advantage of the child - in - mother technique. the burr entrapment can usually be avoided by gentle pecking motion and short runs of rotablation (< 15 s). when a smaller burr was employed, more slowly advancement to ablate the plaque of proximal lesion sufficiently was recommended, and too high a burr speed should also be avoided to prevent kokesi phenomenon. it was also suggested that the speed of rotation per minute should not be drop more than 10% during burr advance to avoid a too large amount of debris being produced within a short time, which may not occur if push gently. if the burr was push aggressively, it may become stalled and embedded in the calcified lesion ; especially when the lesion is long, heavily calcified, low elastic and high angulated., continuous high pressure flushing of nitroglycerin and verapamil can also avoid severe vessel spasm and slow / no reflow. furthermore, using a stiffer wire to straighten the narrowing to lessen resistance was also been proposed. a stiffer gw dose not always produce an unfavorable bias but sometimes makes favorable bias which may help a sufficient ablation of angulated heavily calcified lesion. since the burr was diamond - coated only at the distal part, some entrapped burrs may be successful retrieved if the proximal part was also coated by its manufacturer. burr entrapment is a rare but serious complication during ra and often necessitates open surgery to retrieve the trapped burr. the mechanisms for such complication include kokesi phemonenon or insufficient pecking motion for long, heavily calcified and angulated lesion. several bailout techniques other than surgery have been proposed to retrieve the stuck burr such as simple manual traction, passing another gw followed by balloon inflation to release the trap, using a snare immediate proximal to the burr for forceful local traction or a child catheter to facilitate the successful retrieval. a stiffer wire may be used to straighten the lesion to lessen the resistance unless unfavorable wire bias was observed. interventional cardiologists using rotablator should be familiar with these tips and tricks to avoid and rescue this complication. | entrapment of the burr within calcified lesion is an uncommon, but serious complication during rotational atherectomy and usually needs surgical retrieval. we report a case series of this complication and also review the possible mechanisms, such as kokesi phenomenon or insufficient pecking motion with decreased rotational speed. we also review the potential techniques ever proposed to rescue this complication percutaneously, including simple manual traction, balloon dilation to release the trap, snaring the burr as distal as possible for forceful local traction and wedging the burr with a child catheter to facilitate retrieval. gentle pecking motion of the burr for sufficient ablation and shortening the run less than 15 s may avoid such complications. interventional cardiologists using the rotablator should be familiar with the tips and tricks to avoid and rescue this complication. |
one challenge in primary care in germany is the treatment of older patients who consult their general practitioners (gps) with multiple health and associated everyday problems [13 ]. shared decision making (sdm) is a particular communication strategy in the doctor - patient dialogue with medical decisions being taken jointly by the doctor and the patient. this concept involves the doctor ascertaining the needs of the patient, providing the patient with information and explaining the various preferred methods of treatment. in this way the personal values and preferences of the patient can be taken into account [46 ]. the approach is seen as a key element in patient - centered care and the favoured model of decision making [79 ]. patient centeredness contributes to better patient knowledge and more realistic patient expectations about the course of the disease, more active patient participation in the treatment process, and fewer decisional conflicts. for the doctor, actively inquiring after the patient perspective during the consultation has lead to a decrease in questionable prescribing of antibiotics. nevertheless, patient - centered care has been studied more often in doctors caring for healthier patients. numerous studies demonstrate that most patients, if they were asked, would like to play an active role in health care decisions. however, it has also been shown that patient behaviour in actual decision making situations does, in fact, diverge from the ideal formulated by the patient. this is especially the case for older people, who tend to have a lower preference to participate in such decisions than younger people. according to a european study, it is not so much actively participating in the decision making that is important for older patients but rather the desire for a trusting relationship with the doctor, a patient - centred approach (e.g., the interest of the doctor, a trustworthy and supportive manner), and receiving information. the study emphasises that the desire for involvement is heterogeneous in the group of over 70 years old and that this can change over time and during the course of illness. this means that, in practice, it is necessary to find a flexible approach in which the doctor caters to the individual needs of older patients. the aim of this study is to develop a theoretical model of the perceptions and experiences of older patients with regard to sharing health care decisions with their gps in context of their relationship. we therefore conducted and analyzed semistructured interviews with older general practice patients that led to a classification grid in which the patients ' preferred level of participation and their reported actual behaviour in decision - making situations are presented. the qualitative data was obtained in the first part of the research project prefcheck : preferences in treatment planning for older patients the study was approved by the ethics committee of the hannover medical school (no. 5069). nine general practices in the area of hannover (city of hannover / southern regions) participated in the study. while four gps were recruited through professional contacts of the authors, the others were respondents to cover letters with information leaflets sent to a random selection of 30 gps (50% female) with their own practice. statistical sampling was used to select the participants, who were women and men in the age groups < 80 years old or 80 years old. each patient who visited the practice from 10 am during the recruitment week and met the inclusion criteria (aged at least 70 years) exclusion criteria were history of severe cognitive impairment, legal incapacity, inadequate knowledge of german or inadequate language competence, profound hearing loss, currently participating in another clinical study, not reachable by telephone, and categorised as nursing care level ii or iii (no independent living possible). participating patients were informed about the aims of the study, signed a written permission, and agreed to provide sociodemographic data. the patients underwent a geriatric assessment (step) in the general practitioner 's surgery. the geriatric assessment is a multidimensional, multidisciplinary diagnostic instrument designed to collect data on the health and everyday problems of older patients. two days afterwards, the participants were asked from a member of the research staff on the basis of their assessment results about their view on the health problems (not part of this analysis) and about participation preferences and any experiences they had related to these. a structured guide formed the basis of the qualitative interviews and included questions on the patients ' preferred level of participation and the patients ' actual experiences in this respect in the context of their own medical history. the first part of the interviews entailed the presentation of general fictitious decision making scenarios (see box 1), which were developed from experience prior to this project in interviews with very old people. the scenarios were designed to take in different areas of health care decision making : purely medical decisions and also health - related decisions in everyday life. the presentation of the scenario always led to the question : who is to decide what should be done ? this initiated a discussion with the interviewees on their reasons and opinions concerning this. to facilitate a better understanding of the decision making scenarios, which were kept rather general, the personal assessment results provided good illustrations in the course of the interview. in the next part of the interview, the patients were asked to give an account of their experiences in participating in decision making. the key question was : has there ever been a difference of opinion between you and your doctor as regards the choice of medical treatment ? the recorded interviews were transcribed (simple transcription) and analysed using the analysis programme atlas.ti. samples of the entire interviews were checked against the transcripts for accuracy. a two - stage procedure that integrated a qualitative content analysis and a type construction scheme was chosen for the analysis, which was independently carried out by two research associates together with a four - member research team. firstly, a qualitative content analysis was conducted in order to reduce and compress the volume of data within the context of the research question. for this purpose, all the sections of the interviews referring to the fictitious decision - making scenarios and to other reported experiences were extracted and used for an analysis covering all the patients. this entailed identifying the particular categories relating to decision - making, autonomy and self - determination, and dealing with differences in opinion and summarising these in a table. an overview of the categories, subcategories, and codes can be found in table 1. a multistage model of empirically grounded type construction was used to process the reorganised material. this approach attempts to construct ideal types. for this purpose, first, relevant dimensions and manifestations for comparison are developed. the cases are then grouped and analysed for their empirical regularities in order, finally, to obtain typical cases. these ideal types represent a notional, one - dimensional enhancement of specific typical elements that, although they are gained from real contexts, can not be found in real people to this extent [24, 25 ]. to develop a typology from the patient interviews, the participation preferences expressed by each interviewee were set in relation to his reported (i.e., actual) behaviour in the dealings with doctors. these two dimensions (decision - making preference, adherence to doctor 's advice) resulted from the information on decision - making preferences in the fictitious scenarios as well as from the situations described by the patients in which there was a difference in opinion between the patient and the doctor. the next two dimensions, trust in doctors, and desire for information, were identified as the central themes in the analysis of the material across all patients and were used in the typology classification because of the frequency of their occurrence in all the interviews (see table 2). in the next step, the interview of each patient was reexamined in the light of the grid that had been developed. each relevant section of the interview material, which had earlier been sorted into tabular form, was matched to the appropriate manifestation of the four dimensions. an individual combination of the various manifestations of the dimensions was thus obtained for each interviewed patient. clusters of interviewed patients could then be identified, on the basis of which (ideal) patient types were characterised in a final step. the two dimensions decision - making preference and adherence to doctor 's advice were chosen as the main categories for this in a coordinate system to represent the different types on the x - axis and the y - axis. these two dimensions were defined as the main group categories since they allowed the elderly patients ' preference for participation in decision making to be related to their reported actual behaviour. the two other dimensions, trust in doctors and desire for information, served the purpose of describing the respective patient types more precisely. finally, all patient interviews were revisited to extract information about experienced doctor - patient relationships to explore connections with the respective decision - making type. in the nine general practices, 48 patients were approached, 34 (71%) of whom were included in the study and interviewed. the average duration of the interviews was 27 minutes (range : 1150 minutes). the level of education was classified according to the recommendations of the robert koch institute. the first part of the following presentation of the results refers to the patients ' preferred participation in decision making and is arranged according to the various fictitious decision - making scenarios of the semistructured interviews ; the second part introduces the patient types that were developed. in the case of different treatment options for an illness most patients assumed that the doctor would make the decisions in the fictitious decision - making scenarios : if the decisions are important, then he makes them alone anyway [the doctor ] i do n't think anyone would decide this, i have to decide it for myself (female, 79 years old). at the same time it was also clear that it was necessary to have been informed calmly, comprehensively, and in an understandable way by the doctor before a decision : she [the doctor ] should give me a good explanation of what the alternatives are regardless of the decision - making preference, a relationship of trust often longstanding with the doctor was important for many of the interviewed patients : if a further examination was needed (e.g., an x - ray examination), the patients were unanimous in saying that this must be decided by the doctor. it was noticeable that most of the elderly patients could not imagine having a say in this matter. well, i ca n't make the decision, i do n't even know if it 's needed that urgently, do i ? and if the doctor says we have to check that or that has to be observed, we need to x - ray, the reason given for the doctor having to make this decision was the status of the doctor as the expert and the patient as the layman, who lacked the necessary expertise to make such decisions. it is precisely because the doctor should make the decisions that the patient consults him. also in the case of taking new medication, it is the doctor, as the expert, who should make the decisions. a patient (female, 87 years old) made such a comment : no, in that sense i 'm a layperson. so i have no idea what is good for me, and there are really so many medicines on the market, how should i decide what 's right for me ? that 's what i really have to leave up to the doctor / so i really do need to have enough trust to leave it up to the doctor. some patients suggested that, if there were problems with the intake of medication, the doctor would definitely be consulted again in order to receive further information : yes, of course, sure i would grab the patient information leaflet and look up what it is. and then if i had any difficulties or questions, i () say : this and that and that, explain it to me once again a different picture arises when the fictitious decision concerns modifications to one 's own home (e.g., mounting of grab rails). in the world of everyday matters affecting the patient, the interviewed patients almost exclusively wanted to make the decision alone : most of the participants considered the rearrangement of their living environment to be a topic that did not fall within the scope of primary care. almost all patients wanted to make up their own mind in this decision - making scenario as well, even if they were forced into this decision by complex constraints. on the topic of using nursing care services, patients frequently expressed their reluctance to move into an old people 's home : so go into an old people 's home now, i 'm not at all keen on that () (male, 80 years old). this manifested itself specifically in the fear of not being able to cope with everyday life alone : yes, i 'd like to stay in my flat as long as possible the interviewees mentioned their concerns about losing their independence and thus not being able to make decisions themselves. one patient (female, 79 years old) : i () always need help and it would be very important, very, very important for me that i could manage to live without any help. it was striking that, for a number of participants, the word nursing care triggered an association with the old people 's home or the loss of autonomy and generated fears. when considering all of the interviews together, differences could be found between the responses to the fictitious situations and the accounts of decision - making situations experienced in the patients ' own medical history. this will be illustrated with one case example. in the fictitious decision - making scenarios (different treatment options, taking an x - ray, intake of new medication, and utilisation of nursing care services), it was the opinion of the patient (female, 81 years old) that the doctor should make the decision : i 'd like to say, also the doctor. () no, i do n't understand much about it anyway. later, in the course of the interview, the same patient reported on a real experience in which she acted against the doctor 's advice : if i do n't have any pain, i do n't need any painkiller either ! ' thus the patient had not verbalized her resistance and confronted the doctor at the time he prescribed the medication but rather decided not to comply. in summary, on being asked about their behaviour in the fictitious who is to decide what should be done ? situations, participants more frequently stated that the doctor should make the health care decisions ; in account of comparable, specifically experienced situations, however, they describe the opposite. thus, in some cases, older patients act more self - determinedly than they describe in hypothetical situations or than they would imagine themselves to. therefore, in the next step, the two aspects ideal and concrete behaviour will be used for a more precise characterisation of patient types. it became apparent that different patient types evolved not only because of the personal attitude towards participation but also in response to the relationship experienced in consultations and particularly in decision - making situations.. any doctor can recommend something and i listen to it and / but the last decision is on my side. i phoned him (and i was allowed to phone him anytime) to say : doctor, i just wanted to thank you. and this with a homeopathic remedy. trust evolved as a response to a good doctor - patient relationship, and it helped patients to be more relaxed with decisions and led to better adherence. the patients often pointed out how doctors contribute to a good relationship : provide time, listen, pay attention and be open (patients 7 and 12), explain and give information (patients 14, 42, and 45), be truthful (patients 11, 14, and 32), be reassuring (patient 46), be a long - standing companion and share experiences (patients 13, 27, 28, and 45), know the patient through and through (patients 27, 28, 32, and 45), and be at eye level (patient 33). personal attitude : i make the decision as a basic principle. any doctor can recommend something and i listen to it and / but the last decision is on my side. i phoned him (and i was allowed to phone him anytime) to say : doctor, i just wanted to thank you. and this with a homeopathic remedy. hence it needs to be taken into account that the patient typology on decision making is often based on the two aspects, which are patients ' personal attitudes and the context, in particular the experienced relationship with the doctor. on the basis of the different dimensions (self - determined decision making, adherence, trust, desire for information), eight different ideal types could be found with different degrees of preferences in the decision - making process : preference for patient led decisions (three types), for doctor led decisions (three types), and for decisions with variable participation (two types), (see figure 1). three ideal patient types can be defined for patients who would like to make the health care decisions themselves (figure 1). committed self - determined. patient 26 reported that rheumatism had been misdiagnosed by a specialist. for 14 years he took compromising medications. that i am very self - confident with the doctor and do n't believe everything that they tell me. the committed self - determined are the first type : those who assert their own decisions even against the doctor. at the same time, they actively inform themselves and discuss the matter critically with the doctors. mrs f. [the doctor ] described a tablet for blood sugar (). but then [i ] have had dizziness, [i ] measured the blood pressure () and it was low. these patients make the decisions themselves and also act against the doctor 's advice in his absence. patient 42 talked about her change of antihypertensive medication and admitted that she did not understand the doctor 's explanations. i only agreed with him because i think he is the one who should know (). although these patients would also like to make their own decisions, they act cooperatively within the therapy most of the time and follow the doctor 's advice. patients in this group tend to feel that they are in a relationship of dependency on the doctor. patients who, in part, would like to make the health care decisions themselves and, in part, want a decision from the doctor are divided into the two subgroups distrustful and moderate adapted. patient 13 recalled an incidence with a bleeding nipple. after some tests her gynaecologist wanted to wait. she went for a second opinion and later returned postoperatively. when asked about shared decision making type is characterised by the fact that there is no consistent decision - making preference. the patient also actively opposes the medical advice and does not place trust in the doctor. what 's important is, when the doctor says that needs to be done, then it is done (). it is me and of course the doctor, who decide. patient 9 (female, 73 years old). decisions are taken partly by the doctor and partly by the patients in this group, too. the patients invariably act cooperatively and follow the doctor 's advice in the course of the therapy. they want information from the doctor, but there is no active discussion or questioning of this information on the part of the patient. the following three ideal types of patients are of the opinion that the doctors should make the decisions. patient 39 reflected on his information - seeking behaviour in connection with a prostate operation : this is my deficiency that i do not want to know () what should i speak to them about, they wo n't do it differently anyway. the doctors must be trusted (relationship of dependency) and at the same time they actively oppose the doctor 's advice.. uncertain doctor trusting. () and then i try it, whether i tolerate it or not. and although instructions from the doctor are not actively opposed, the patients describe situations in which, in his absence, they acted against the doctor 's advice. it was possible to gather the various reasons for patients acting against the doctor 's advice in his absence from the interview material. among these were that the doctor did not consider patients ' objections, patients wanted to have more self - determination but could not assert themselves against the doctor, or patients did not dare to ask follow - up questions, for example, concerning problems with the therapy or concerns about possible side effects of the medication. () i would rely on the doctor on what he says take this or that [tablet ]. most of the patients interviewed belong to the groups in which the doctor alone should make the medical decisions. no further information is desired by the patient and the doctor 's instructions are followed. in this study, patients were interviewed about their participation preferences in fictitious decision - making scenarios and their experiences in actual decision - making situations with their doctors. overall, the results reinforce that, when asked about their preference for involvement, the group of older patients differs (cf. however, the results suggest that in tendency older patients are more likely to remain passive and let the doctor make the decisions. this tallies with an american study in which a typology is also developed (flynn., 2006) and which comes to the conclusion that with increasing age patients tend to leave medical decisions to the doctor. there the authors distinguish between autonomous patients and patients who would rather delegate the decision - making to the doctor. a similar classification into passive and active patient behaviour in decision - making situations is found in scheibler. similarly, in our study it was also noticeable that, for example, the current attitudes of the patient group (resigned) distrustful, in particular, have been strongly influenced by previous negative experience. on the other hand, experiences of a good doctor - patient relationship facilitated a convinced doctor - trusting attitude. our results clearly demonstrate that the desire for involvement in the decision - making process depends on the matter to be decided. in their typology of shared decision making, the research team classifies decision - making situations according to the criteria risk (between low and high risk) and certainty (between one realistic choice and between more alternatives). our older patients show a lower involvement in medical decisions as compared to health - related everyday life decisions, which they tend to not share. older patients ' desire for self - determination in their own everyday lives is great. a decision by the doctor that affects issues at home is connected to the risk of losing autonomy (cf. it also seems unexpected since, according to patient opinion, the responsibility for such a decision lies on the patient. our results reinforce those of an american study which show that a forced involvement of the patient in disease - related decisions by the doctor can even lead to resistance on the part of the patient. our patient typology targets older patients and further differentiates existing typologies that represent all age groups. beyond the distinction between active and passive patient types, our typology includes elements, such as adherence, trust, and information - seeking behaviour. the two latter elements (trust in medicine and desire for information) have also been identified by marstedt. to describe four patient types (indifferent, doctor - trusting, doctor critical and cotherapist). using the developed classification grid in our study, we have found eight different patient types in relation to decision - making preferences and actual health care participation of older patients. this typology shows heterogeneity of preferences and behaviour not only with regard to involvement in health decisions but also with respect to the actual agreement or opposition to doctors ' recommendations and patient adherence. desire for information and degree of trust are found to relate to patient 's practiced autonomy. it seems that little trust in doctors motivates patients to seek information outside the doctor - patient relationship and encourages opposition to medical advice. a doctor - trusting relationship seems to meet patients ' information needs already and enhances adherence. the interviewed patients ' understanding of the concept of trust does, however, vary. some of the patients state that they see themselves in a relationship of dependency on the doctor and have no alternative but to trust him, whereas others will happily and willingly trust their doctors (cf. however, this study serves as a pilot into a differentiated (ideal-) patient typology. statements concerning the frequency of these patient types in the elderly population can not be made on the basis of the results of our study. time as an important factor in the often longitudinal decision - making processes has not been explored sufficiently here. we are also aware that patient centeredness has no universally accepted definition, and we deal with a lack of conceptual clarity for this term [32, 33 ]. it is not always obvious to doctors which type of patient they have in front of them at any particular time. we found that a motive can be either distrust in the context of bad experiences with doctors ' decisions or a personal attitude independent of the specific doctor - patient relationship. secondly, the less self - determined patients tend to rely on doctors making health - related decisions. whereas a trusting doctor - patient relationship satisfies patients ' wishes for information and leads to adherence, nonadherence, and opposition accompany distrust. our patients determined a relationship as positive, if they received personal attention and adequate information, truthfulness, empathy, and if they were able to look back at difficult situations that have been mastered together. giving adequate information is of particular value not only for the doctor - patient relationship but also for decision - making situations [34, 35 ]. in practice information needs to be offered in such a way that patients can properly assess it and weigh it up. social and structural factors need to be taken into account : for instance, the social background of the patient, the amount of time available for the consultation, access to further information, and, finally, ancillary services (cf. 36). three barriers relevant to shared decision making were observed in this group of older patients : one is the patients ' dependent trust in authority that inhibits to speak out if they are of a different opinion to the doctor. the second one is the assumption that for some older patients there is only a right decision and a wrong decision weighing up and discussing different options represent a pattern of behaviour with which these older patients seem to be unfamiliar. finally, pending decisions in everyday life are not easily raised by the patient for fear of losing autonomy. our typology may facilitate the doctor to share decisions with older patients in ensuring that information is sufficiently provided and emotional support is established within a trusting relationship to the degree depending on the patient 's preferences. it is apparent that, for one or more of the reasons mentioned previously, older patients sometimes neither desire nor regard shared decision making as possible. in this case, the doctor should be prepared to assess barriers, to reiterate information regarding alternatives, and to respect patient decisions even if the alternatives seem more promising. this open - minded process enhances a trusting relationship, a requirement for such patient - centered care (see [36, 37 ]). successful communication continues to be the key to the realisation of a good doctor - patient relationship and to the design of medical care in line with patient needs [8, 14, 38 ]. it is necessary to encourage (older) patients to openly express their needs and wishes themselves and to support this. | background. this qualitative study aims to gain insight into the perceptions and experiences of older patients with regard to sharing health care decisions with their general practitioners. patients and methods. thirty - four general practice patients (70 years) were asked about their preferences and experiences concerning shared decision making with their doctors using qualitative semistructured interviews. all interviews were analysed according to principles of content analysis. the resulting categories were then arranged into a classification grid to develop a typology of preferences for participating in decision - making processes. results. older patients generally preferred to make decisions concerning everyday life rather than medical decisions, which they preferred to leave to their doctors. we characterised eight different patient types based on four interdependent positions (self - determination, adherence, information seeking, and trust). experiences of a good doctor - patient relationship were associated with trust, reliance on the doctor for information and decision making, and adherence. conclusion. owing to the varied patient decision - making types, it is not easy for doctors to anticipate the desired level of patient involvement. however, the decision matter and the self - determination of patients provide good starting points in preparing the ground for shared decision making. a good relationship with the doctor facilitates satisfying decision - making experiences. |
recent interest to semiconductor quantum dots (qds) is conditioned by new physical properties of these zero - dimensional objects, which are conditioned by size - quantization (sq) effect of the charge carriers (ccs) [1 - 3 ]. such new structures were obtained by means of interrupted growth of qds within semiconductor media. development of new growth technologies, in particular such as stranski - krastanov epitaxial method, made possible development of qds having various shapes and dimensions. it is known that energy spectrum of ccs of a qd is fully quantized and similar to the energy spectra of atoms, in view of that the qds are often called artificial atoms. most of the research in this area is focused on studies of the spherical qds. however during last years the ellipsoidal, pyramidal, cylindrical and lens - shaped qds are also undergoing theoretical and experimental investigations [5 - 10 ]. due to presence of strong sq effect in the mentioned objects the physical characteristics of ccs in such systems strongly depend on the geometrical shapes of qds. even slight variation of the shapes significantly affects the cc spectrum. in other words, qd geometric shapes and dimensions may serve as useful tools for cc energy spectrum and other characteristic parameters variation inside a qd for various practical applications in systems comprised of qd ensembles. monitored shaping during the process of growth makes possible simulation and development of samples with desired physical parameters. another powerful factor affecting the cc energy spectrum shaping inside qd is the confinement potential of the qd the semiconductor nanostructures based on gaas / ga1xalxas - type systems are objects of intensive recent investigations due to wide band gap and availability of well elaborated growth techniques of various systems incorporating such materials. as a result of natural diffusion process during the growth of qds, the correspondently forming confinement potential is such that can be easily approximated in most cases by a parabolic potential. also note, that for this approximation the kohn theorem is well generalized, this proves that such approximation is correct, the experimental verification is provided in ref.. however, the effective parabolic potential may origin due to peculiarity of the qds shape., the rotational ellipsoids, or spheroids, in contrary to spheres, are known to be described by two parameters (short and large half - axes instead of radius). in addition to that the external electric and magnetic fields causing quantization are alternative tools of control of the energy spectrum of qds cc. the strong external fields, at certain values of their intensities, may have the same, or even stronger sq effect on the energy spectrum than the quantum dot s shape variation. note, that the magnetic field affects the cc motion only in transversal direction, in difference to the electrical field. therefore two fields directed in parallel open possibility for a broad manipulation of the cc characteristics inside semiconductor sq systems. in particular in paper the quantum effect of the magnetic field inside the of the strongly prolate qd is investigated. the effect of electrical field on the cc energy spectrum inside the mentioned system has been considered in paper. however, the combined effect of unidirectional electric and magnetic fields is not considered yet. analysis of the optical absorption spectra of various semiconductor structures represents a powerful tool for obtaining numerous characteristics of these structures, namely : forbidden gap widths, effective masses of electrons and holes, their mobility, dielectric features, etc. many papers study these spectra by experiments and analysis, both in massive and sq semiconductor structures (see e.g. [16 - 18 ]). indeed, presence of new sq energy levels makes possible to realize new inter - band transitions widening the scope of applications of devices based on such systems. meanwhile existence of the external quantizing fields often results in restructuring of the energy levels, as well as creation of new selection rules during the process of the light absorption. therefore electronic states and direct inter - band light absorption are considered below for strongly oblate ellipsoidal quantum dots (soeqd) and strongly prolate ellipsoidal quantum dots (speqd) at presence of unidirectional electric and magnetic fields ; the problem is considered for strong sq regime. let us to consider an impenetrable soeqd located in unidirectional electric and magnetic fields (see fig. the potential energy of a charged particle (electron, or hole) in such structure has the following form:(1) where a1 and c1 are the short and long semiaxes of speqd, respectively. (b) strongly prolate ellipsoidal quantum dot as is known, in the strong sq regime, the energy of coulomb interaction between electron and hole can be considered much smaller than the energy created by the soeqd walls. in the framework of such approximation thus, the problem is reduced to analytical determination of the energy separate expressions for electron and hole (as for non - interacting particles). the quantum dot shape indicates that particle motion along the z - axis takes place faster than in the normal direction, this also allows to utilize adiabatic approximation. the system hamiltonian under these conditions has the following form:(2) in which is the particle momentum operator, is the vector potential of the magnetic field, is the electrical field intensity, is the radius - vector, s is the light velocity in vacuum, and e is the magnitude of electron charge. assuming the calibration of vector potential in cylindrical coordinates to have a form, one can express the system hamiltonian as(3) which may be represented as a sum of two hamiltonians of fasth1 and slowh2 subsystems in dimensionless variables:(4) with assumed notations : where is the effective mass of electron, is effective rydberg energy, is the effective bohr radius of electron, and is the dielectric permeability. the homogenous electrical and magnetic fields are given by relations and here we assume the wave function (wf) to have the following form:(7) following the above - mentioned adiabatic approximation, when the coordinaterof the slow subsystem is fixed, the particle motion is localized in one - dimensional potential well having effective width, wherea = a1/abandc = c1/ab. the schrdinger equation for the fast subsystem will acquire the following form:(8) after a number of simple transformations and numerical simulation, for the close - to - bottom energy levels of the spectrum (when the particle is predominantly localized in the regionr a) one can obtain the following power series expression with high degree of accuracy:(9) where n and n parameters depend on the value of the electrical field. the relation (9) represents an effective potential which is incorporated in the slow system schrdinger equation(10) thus by solving the eq. 10), we shall obtain the ultimate energy relation for the charged particle (electron, hole)(11) where n = 2nr + |m|,nr and m are the radial and magnetic quantum numbers, respectively. now let us to consider an impenetrable speqd located in the unidirectional electric and magnetic fields (see fig. for this case the potential energy of the charged particle (electron, or hole) will have the form (1) under the conditiona1c1, wherea1andc1are the short and long semiaxes of speqd, respectively. as in the soeqd case, in the strong sq regime we neglect the coulomb interaction between the electron and hole. 1b makes possible the particle motion in the radial plane to be faster than along the z - axis, which also allows to use adiabatic approximation just like in the soeqd case. here 5and6, for the speqd case we have(12)(13) the homogenous electrical and magnetic fields are represented as and just as is in the previous case, while the vector potential is. for this case we assume the wf to have a structure(14) following the above - mentioned adiabatic approximation, when thezcoordinate of the slow subsystem is fixed, the particle motion is localized in two - dimensional potential well having effective width the schrdinger equation for the fast subsystem has the form(15) after number of transformations we shall obtain the following energy expression 1(z) for the fast sub - system(16) while n1 and n2 are some numbers depending on the magnetic field intensity. the expression (16) 18gives the final energy expression for the charged particle (electron, hole)(19) another notable issue of the problem is the direct inter - band absorption of the light by soeqd in the strong sq regime. in other words, the relationc { ab, ab } holds, whereabis the effective bohr radius of electron (or hole). hole, when e h, eand hare the effective masses of electron and hole, respectively. the absorption coefficient is given by the expression (20) where v and v are sets of quantum numbers (qn) corresponding to the electron and heavy hole, eg is the forbidden gap width in the bulk semiconductor, is the incident light frequency and a is a quantity proportional to the square of matrix element in decomposition over bloch functions. numerical calculations were made for the qd fromgaas, with parameters : e = 0.067me, e = 0,12h, er = 5.275 mev, ab = 104, eg = 1.43 ev. finally, for the quantitykand for the absorption edge (ae) we have obtained:(21)(22) where, while and are certain integral quantities. let us now to consider the selection rules in this case. in the absence of the fields, the transitions between the levels with qnn = n,n = n andm = m are allowed. when the external fields are present the transitions are possible in all cases of magnetic quantization in the radial direction, between the levels with magnetic qnsm = m. under weak magnetic quantization, whenah a1, where is magnetic length, transitions are allowed between the levels with radial qnsnr = nr, and thus between the oscillatory qnsn = n. in the case whenaha1, the selection rules among the oscillatory qns are cancelled, which is a result of competition between size and magnetic quantization. a magnetic field of extremely high - intensity, for whichah a1, restores the selection rules between the oscillatory qns. it should be also noted that the selection rules in the direction of electrical field are becoming obsolete. consider now a direct inter - band light absorption inside speqds in the strong sq regime. in this particular case for thekand ae we obtained the following expressions(23)(24) respectively ; where, while, where and are certain integral quantities. at absence of the fields at the speqd case, the transitions between the qnsn = n,nr = nr, andm = m are allowed. the application of the external fields to the speqd the following alternations from the previous case can be indicated. when the magnetic quantization is either weak or moderate, i.e. whenah a1oraha1(herea1is the short half - axis), the selection rules in the radial direction are becoming completely obsolete. as a result of this, meanwhile, transitions between the magnetic qns remain unchanged : m = m. note that in the hypothetical case of extremely strong magnetic field (whenah a1) the selection rules for transitions between the oscillatory qns are completely restoring. let us to consider an impenetrable soeqd located in unidirectional electric and magnetic fields (see fig. the potential energy of a charged particle (electron, or hole) in such structure has the following form:(1) where a1 and c1 are the short and long semiaxes of speqd, respectively. (b) strongly prolate ellipsoidal quantum dot as is known, in the strong sq regime, the energy of coulomb interaction between electron and hole can be considered much smaller than the energy created by the soeqd walls. in the framework of such approximation thus, the problem is reduced to analytical determination of the energy separate expressions for electron and hole (as for non - interacting particles). the quantum dot shape indicates that particle motion along the z - axis takes place faster than in the normal direction, this also allows to utilize adiabatic approximation. the system hamiltonian under these conditions has the following form:(2) in which is the particle momentum operator, is the vector potential of the magnetic field, is the electrical field intensity, is the radius - vector, s is the light velocity in vacuum, and e is the magnitude of electron charge. assuming the calibration of vector potential in cylindrical coordinates to have a form, one can express the system hamiltonian as(3) which may be represented as a sum of two hamiltonians of fasth1 and slowh2 subsystems in dimensionless variables:(4) with assumed notations : where is the effective mass of electron, is effective rydberg energy, is the effective bohr radius of electron, and is the dielectric permeability. the homogenous electrical and magnetic fields are given by relations and here we assume the wave function (wf) to have the following form:(7) following the above - mentioned adiabatic approximation, when the coordinaterof the slow subsystem is fixed, the particle motion is localized in one - dimensional potential well having effective width, wherea = a1/abandc = c1/ab. the schrdinger equation for the fast subsystem will acquire the following form:(8) after a number of simple transformations and numerical simulation, for the close - to - bottom energy levels of the spectrum (when the particle is predominantly localized in the regionr a) one can obtain the following power series expression with high degree of accuracy:(9) where n and n parameters depend on the value of the electrical field. the relation (9) represents an effective potential which is incorporated in the slow system schrdinger equation(10) thus by solving the eq. 10), we shall obtain the ultimate energy relation for the charged particle (electron, hole)(11) where n = 2nr + |m|,nr and m are the radial and magnetic quantum numbers, respectively. now let us to consider an impenetrable speqd located in the unidirectional electric and magnetic fields (see fig. for this case the potential energy of the charged particle (electron, or hole) will have the form (1) under the conditiona1c1, wherea1andc1are the short and long semiaxes of speqd, respectively. as in the soeqd case, in the strong sq regime we neglect the coulomb interaction between the electron and hole. 1b makes possible the particle motion in the radial plane to be faster than along the z - axis, which also allows to use adiabatic approximation just like in the soeqd case. here 5and6, for the speqd case we have(12)(13) the homogenous electrical and magnetic fields are represented as and just as is in the previous case, while the vector potential is. for this case we assume the wf to have a structure(14) following the above - mentioned adiabatic approximation, when thezcoordinate of the slow subsystem is fixed, the particle motion is localized in two - dimensional potential well having effective width the schrdinger equation for the fast subsystem has the form(15) after number of transformations we shall obtain the following energy expression 1(z) for the fast sub - system(16) while n1 and n2 are some numbers depending on the magnetic field intensity. the expression (16) is an effective potential being incorporated in the schrdinger equation for the slow another notable issue of the problem is the direct inter - band absorption of the light by soeqd in the strong sq regime. in other words, the relationc { ab, ab } holds, whereabis the effective bohr radius of electron (or hole). we consider the case of a heavy hole, when e h, eand hare the effective masses of electron and hole, respectively. the absorption coefficient is given by the expression (20) where v and v are sets of quantum numbers (qn) corresponding to the electron and heavy hole, eg is the forbidden gap width in the bulk semiconductor, is the incident light frequency and a is a quantity proportional to the square of matrix element in decomposition over bloch functions. numerical calculations were made for the qd fromgaas, with parameters : e = 0.067me, e = 0,12h, er = 5.275 mev, ab = 104, eg = 1.43 ev. finally, for the quantitykand for the absorption edge (ae) we have obtained:(21)(22) where, while and are certain integral quantities. let us now to consider the selection rules in this case. in the absence of the fields, the transitions between the levels with qnn = n,n = n andm = m are allowed. when the external fields are present the transitions are possible in all cases of magnetic quantization in the radial direction, between the levels with magnetic qnsm = m. under weak magnetic quantization, whenah a1, where is magnetic length, transitions are allowed between the levels with radial qnsnr = nr, and thus between the oscillatory qnsn = n. in the case whenaha1, the selection rules among the oscillatory qns are cancelled, which is a result of competition between size and magnetic quantization. a magnetic field of extremely high - intensity, for whichah a1, restores the selection rules between the oscillatory qns. it should be also noted that the selection rules in the direction of electrical field are becoming obsolete. consider now a direct inter - band light absorption inside speqds in the strong sq regime. in this particular case for thekand ae we obtained the following expressions(23)(24) respectively ; where, while, where and are certain integral quantities. at absence of the fields at the speqd case, the transitions between the qnsn = n,nr = nr, andm = m are allowed. the application of the external fields to the speqd the following alternations from the previous case can be indicated. when the magnetic quantization is either weak or moderate, i.e. whenah a1oraha1(herea1is the short half - axis), the selection rules in the radial direction are becoming completely obsolete. as a result of this, meanwhile, transitions between the magnetic qns remain unchanged : m = m. note that in the hypothetical case of extremely strong magnetic field (whenah a1) the selection rules for transitions between the oscillatory qns are completely restoring. as one can infer from the obtained results, the cc energy spectrum both of soeqds and speqds is equidistant. more correctly, each level of the fast subsystem has a family of equidistant slow subsystem levels positioned thereupon. the obtained result is valid only for the levels close to the well bottom (or having low qn values), due to the assumed adiabatic approximation. however, the transition frequency between the equidistant levels when the fields are present is usually higher. for example, in the absence of fields, when half - axes of soeqd are a1 = 2.5abc1 = 0.5ab, the transition frequency for the first equidistant family is obtained equal to which falls into the ir part of spectrum. with the same half - axes, but in the presence of fields h = 10 t, f = 500 v / cm the transition frequency is almost one - and - half times higher :. the only exception is speqd with h = 0, f 0. in that case all equidistant levels are shifted for the same value depending on the intensity of the electrical field. the inter - level distance remains the same as in the absence of electrical field (shifted oscillator). figures 2 and 3 illustrate the dependence of cc energy spectrum families inside soeqd on intensities respectively of electrical and magnetic fields, under fixed lengths of half - axes. 2 that the first family of the cc energy spectrum falls with growth of the electric field intensity, while the second family grows and then reduces. this behavior was called anomalous stark effect by the authors of ref.. they explained such field dependence of energy levels by behavior of the particle probability density ||. however, no such anomaly is revealed under correct definition of the stark effect. in other words, the dependence of the inter - level distance on the electrical field intensity has monotonously growing character. dependence of the first two equidistant cc energy spectrum families inside soeqd on the electrical field intensity, under fixed values of magnetic field intensity and half - axes lengths : h = 100 t, c1 = 0.5ab, a1 = 2.5ab dependence of the first equidistant family of cc energy spectrum inside soeqd on the magnetic field intensity, under fixed values of electrical field intensity and half - axes lengths : f = 1000 v / cm, c1 = 0.5ab, a1 = 2.5ab as one can see from the fig. 3, all levels of the cc energy spectrum family are growing when the magnetic field intensity is increased. this is conditioned by growth of the magnetic quantization contribution into the cc energy increase. inter level distance is increased with magnetic field intensity while the levels are remaining equidistant. figures 4 and 5 show the dependence of ae inside soeqd on the intensities of electrical and magnetic fields, respectively, when the lengths of soeqd half - axis are fixed. 4 that ae value is shifted towards longer wavelengths when the electrical field intensity is growing. this fact is explained by a change of the quantum - well bottom caused by the external electrical field. as a result of this phenomenon, the energy of electron is reduced, while the energy of hole increases, which in turn reduces the forbidden gap width. presence of the magnetic field increases the energy of the both particles, independently of the charge sign. otherwise, the ae shift is due to magnetic quantization effect (blue shift). absorption edge dependence on the electrical field intensity, at different values of the magnetic field inside soeqd having fixed half - axis lengths :, c1 = 0.5ab and a1 = 2.5ab absorption edge dependence on the magnetic field intensity, at different values of the electrical field inside soeqd having fixed half - axis lengths :, c1 = 0.5ab and a1 = 2.5ab figure 6 illustrates the three - dimensional view of the ground state energy for a cc inside the speqd as a function of electrical and magnetic field intensities under fixed lengths of half - axis. one can see that the effects of the electrical and magnetic fields are different : increase of the magnetic field intensity increases the particle energy, while increase of the electrical field intensity reduces the particle energy. the first phenomenon is explained by a growth of the magnetic quantization contribution into cc energy increase, while the second by a change of potential well bottom, or competition of sq and electrical fields effect on cc. ground state energy dependence of cc inside speqd as a function of electrical and magnetic field intensities, under fixed values of half - axis : a1 = 0.3ab and c1 = 2ab similar dependence of ae on the electrical and magnetic fields in soeqd is illustrated in fig. the behavior of this dependence can be explained similarly as in the case of speqd. absorption edge dependence on the electrical and magnetic field intensities inside speqd, under fixed values of half - axis : a1 = 0.3ab and c1 = 2ab so far we have studied the absorption of a system consisting of semiconductor qds having identical dimensions. for comparison of the obtained results with experimental data, one has to take into account the random character of speqd and soeqd dimensions (or half - axis) obtained during the qd technological growth process. so, for making the comparison the absorption coefficient should be multiplied by concentration of qds. then, instead of the distinct absorption lines we will obtain a series of fuzzy maximums as a result of the size dispersion by semiaxis. for illustration of the size dispersion by the semiaxis we used two experimentally observable models. in the first model we used the lifshits - slezov distribution function : (25) where is some average value of the semiaxis. in the second model the gaussian distribution function is used (see e.g.): (26) figure 8 illustrates the dependence of the absorption coefficient k on the frequency of incident light, for the ensemble of soeqds in the absence of external fields. note that in the model of gaussian dots distribution, a single distinctly explicit maximum of absorption is observed. when the light frequency is increasing, the second slightly notable maximum is traced. further increase of the incident light frequency results in decrease of the absorption coefficient. when the lifshits - slezov model is realized during a device growth, a number of distinctly explicit absorption maximums as a function of incident light frequency is observed. note that weakly expressed oscillations on the first peak are seen in the second case, which are due to inter - band transitions of the first equidistant family (see additional graphical insertion in fig.. absorption coefficient dependence on the incident light frequency, for the ensemble of soeqds having two different distribution functions ellipsoidal qds, especially soeqds or speqds, have various commercial applications, in particular in large two - dimensional focal plane arrays in the mid- and far infrared (m&fir) region, having important applications in the fields of pollution detection, thermal imaging object location and remote sensing as well as ir imaging of astronomical objects (see e.g. us patent # 6541788). this research has been performed in the framework of the armenian state research program semiconductor nanoelectronics. the authors express their gratitude to the rector of russian - armenian university, prof. | in framework of the adiabatic approximation the energy states of electron as well as direct light absorption are investigated in strongly oblate and strongly prolate ellipsoidal quantum dots (qds) at presence of electric and magnetic fields. analytical expressions for particle energy spectrum are obtained. the dependence of energy levels configuration on qd geometrical parameters and field intensities is analytically obtained. the energy levels of electrons are shown to be equidistant both for strongly oblate and prolate qds. the effect of the external fields on direct light absorption of a qd was investigated. the dependence of the absorption edge on geometrical parameters of qds and intensities of the electric and magnetic fields is obtained. selection rules are obtained at presence as well as absence of external electric and magnetic fields. in particular, it is shown that the presence of the electric field cancels the quantum numbers selection rules at the field direction, whereas in radial direction the selection rules are preserved. perspectives of practical applications for device manufacturing based on ellipsoidal quantum dots are outlined. |
new methods and strategies for the direct functionalization of c h bonds are beginning to reshape the fabric of retrosynthetic analysis, impacting the synthesis of natural products, medicines, and even materials1. the oxidation of allylic systems has played a prominent role in this context as possibly the most widely applied c h functionalization due to the utility of enones and allylic alcohols as versatile intermediates, along with their prevalence in natural and unnatural materials2. allylic oxidations have been featured in hundreds of syntheses, including some natural product syntheses regarded as classics3. despite many attempts to improve the efficiency and practicality of this powerful transformation, the vast majority of conditions still employ highly toxic reagents (based around toxic elements such as chromium, selenium, etc.) or expensive catalysts (palladium, rhodium, etc.)2. these requirements are highly problematic in industrial settings ; currently, no scalable and sustainable solution to allylic oxidation exists. as such, this oxidation strategy is rarely embraced for large - scale synthetic applications, limiting the adoption of this important retrosynthetic strategy by industrial scientists. in this manuscript, we describe an electrochemical solution to this problem that exhibits broad substrate scope, operational simplicity, and high chemoselectivity. this method employs inexpensive and readily available materials, representing the first example of a scalable allylic c h oxidation (demonstrated on 100 grams), finally opening the door for the adoption of this c h oxidation strategy in large - scale industrial settings without significant environmental impact. |
|
breast cancer has become a major focus of worldwide attention due to the increase in incidence over the past decades. in brazil, it is an important public health problem, being the most common neoplasm among women and the leading cause of death from cancer in this population group. in 2014, 57,120 new cases were estimated representing a rate of 56.09 cases per 100,000 women. in brazil, the issue of breast cancer is compounded by the frequency of diagnoses at more advanced stages of the disease. on average, 60% of cases are diagnosed at stages iii and iv, leading to more aggressive and mutilating surgeries, increasing the incidence of complications arising from oncological treatment [2, 3 ]. lymphoedema is a major complication of treatment for breast cancer, reaching, in our population, about 30% of women after five years of postoperative follow - up. several approaches to the treatment of lymphoedema have been reported in the literature [5, 6 ]. among conservative treatments, complex physical therapy (cpt) has emerged as the best approach to control the volume of lymphoedema of the upper limb [714 ]. the first phase of treatment aims for the maximum reduction in limb volume and is part of this treatment : skin care, manual lymph drainage (mld), exercises, and compression bandaging. immediately after this phase, the maintenance phase (second phase) starts, consisting of adaptation of compression garments, exercise, and self - massage, with the goal of preserving and optimising the results obtained in the initial phase [1013 ]. the therapeutic response to any treatment provided depends not only on the physiological actions of the treatment but also on the cultural, social, psychological, and physical conditions of each patient. one of these components, which may influence the therapeutic response, is the quality of life. according to the world health organization (who) quality of life is defined as individuals perception of their position in life in the context of culture, value systems in which they live in relation to their goals, expectations, standards, and concerns. for patients with breast cancer, quality of life assessment will approach the way they experience changes caused by the disease as well as the positive or negative influence that the treatment will have on their lives [1623 ]. in this context, this study aims to evaluate qol as a predictor of treatment response in women undergoing cpt in the treatment of upper limb lymphoedema after axillary lymphadenectomy. a randomised clinical trial was conducted in women with secondary treatment of breast cancer lymphoedema. 57 women referred for unilateral axillary dissection, with a difference between the upper limbs greater than three centimeters in circumference at one point at least, who were not undergoing chemotherapy or adjuvant radiotherapy and showed no heart disease or systemic decompensated hypertension, were included. women were excluded if they had surgery less than six months previously, were diagnosed with preoperative lymphoedema, showed signs of inflammation in the swollen limb, had a history of allergic reaction to the material used for compression bandaging, had active locoregional or distant disease, or had been undergoing treatment for lymphoedema with compression bandaging for the last three months. for the treatment of lymphoedema, all patients underwent complex physical therapy (skin care, compression bandaging, exercises, and home orientations), with or without manual lymphatic drainage. the main outcome (therapeutic response) was considered to be the percentage reduction in excess limb volume between the beginning and the end of treatment (end of compressive bandaging, occurring in about 4 weeks), calculated by (iv fv / iv)100, with iv being the initial volume and fv the final volume. the measures for each point which were used were v = h (c + cc + c)/(12), in which v is the volume of the limb segment, c and c are the circumferences at each end, and h is the distance between the circumferences (c). descriptive variables were collected, such as age, body mass index (bmi), time to onset postoperative lymphoedema, excess volume in the segment, duration of chronic lymphoedema, and the number of infections in the limb with lymphoedema. as the main predictor variable, the mean score of quality of life was considered, measured at study entry. quality of life was assessed by the eortc qlq - c30 and br23, both validated by the brazilian population. qlq - c30 is a multidimensional questionnaire designed to assess the psychological and social functioning of patients with cancer. it is made up of 30 questions that assess five functional scales (physical, functional, cognitive, emotional, and social role), three symptom scales (fatigue, pain, nausea, and vomiting), and quality of life scales and overall health. qlq - br23 intends to specifically evaluate the effects of treatment in patients with breast cancer. the functional scale is divided into ranges of body image, sexual function, sexual satisfaction, and future perspective. the second level consists of the subscales : adverse effects of systemic therapy, breast symptoms, and arm symptoms. qlq - c30 and br23 have a scale ranging from 0 to 100, in which 0 is the worst health status and 100 the best of health, except for the symptom scales in which higher scores represent more symptoms and worse quality of life. for statistical analysis, the descriptive analysis of the study population was performed by using measures of central tendency and dispersion. to evaluate the changes in excess volume before and after treatment, we performed the wilcoxon signed - rank test, considered statistically significant at p 40% excess volume) and the average duration of lymphoedema was 73 months. therefore, our population has more advanced and greater chronicity compared to previous lymphoedema studies. the use of quality of life assessments in breast cancer patients has an important role as a risk for complications, treatment outcome, and prognosis [19, 22, 23, 26 ]. with regard to quality of life before physiotherapy, when assessed by the eortc qlq c-30 instrument, the average for overall quality of life was 40.2. in the functional domain, worse scales for quality of life were in emotional function (mean 54.82) and cognitive function (mean 63.43). on the scale of symptoms, worse quality of life scores were reported for pain (mean 65.7) and fatigue (mean 68.4). when assessing the quality of life by br 23 module, a low score was observed in the domain of future perspective (47 points) and arm symptoms (53 points). in a study performed by gurdal., using the eortc qlq c-30 instrument and also evaluating before treatment for lymphoedema, the population showed a better mean score of overall quality of life (58.2 and 64.8, depending on the group treatment). in the domain of functionality, the physical and social functions were the most affected and the symptoms of pain and fatigue had the worst score. the difference in the functionality of our patients may reflect cultural issues, especially those related to body image. physical symptoms associated with lymphoedema include decreased strength and range of motion of the upper limb, fatigue, and pain. these symptoms, associated with the appearance of lymphoedema, can lead to negative self - image, especially in relation to body image, which also affects social and sexual relationships. emotional well - being is also altered, and these women experience greater stress, anxiety, sadness, anger, frustration, and guilt in relation to their situation. regarding the response to lymphoedema treatment, several clinical trials and observational studies which have performed cpt report a statistically significant decrease in limb volume before and after treatment [1114, 2830 ]. in our population, the average reduction in excess volume was 282 ml, with 15% reduction (p < 0.001). the best result was observed in a randomised clinical trial of 77 women treated with compression bandaging, exercises, and mld group. a reduction rate of 36% and 56% was reported (according to treatment group). this difference in treatment response can be explained by the protocols established in each service. in our population, as it is within a public hospital with great demand for lymphoedema treatment, patients were treated twice a week, using compression bandaging throughout the period, which may explain the worse therapeutic response. in this study, we found no association between quality of life at the beginning of treatment and the therapeutic response of the cpt in any studied domain. this study has some limitations, among which we can highlight the sample size which may have influenced the lack of association between the therapeutic response and the quality of life symptoms subscale in the arm symptoms subscale (p = 0.099). in other scales evaluated, it is unlikely that an increase in the sample size would change the result. as strengths, we highlight the homogeneity of women and little possibility of selection and classification bias, since the data were collected from patients from a single institution in reference to the treatment of breast cancer, which gives adequate internal validity of the study. however, generalization of the results (external validity) should be viewed with caution. studies in other populations with different treatment and sociodemographic conditions could be conducted to better understand the influence of quality of life as a predictor of therapeutic response of lymphoedema. in conclusion, this study included 57 women with advanced and chronic lymphoedema in early treatment with cpt. domain scores of quality of life observed at inclusion of the study had worse scores for emotional function and better scores for social function. in symptom scales, overall quality of life scores were low. when evaluating the quality of life by br 23 module, a low score was observed in the field of future perspective and arm symptoms. after treatment, absolute reduction of excess volume between the upper extremities of 282 ml was observed, representing a reduction of 15%. no association was observed between the domains of quality of life and therapeutic response to treatment of lymphoedema. | purpose. to assess the quality of life (qol) as a predictor of volume reduction in women undergoing complex physical therapy (cpt) for lymphoedema following breast cancer. methods. clinical trial in 57 women undergoing cpt. results. at baseline, in measuring quality of life for the eortc qlq - c30 questionnaire subscale of functionality, the worst scores for emotional function (55 points) and better social function (89 points) were observed. the symptom scales showed the worst pain averaged (66 points). the overall quality of life showed a low score (40 points). in the br 23 module, low scores were observed in the field of future perspective (47 points). after treatment of lymphoedema, absolute reduction of excess volume between the upper limbs of 282 ml was observed, representing a reduction of 15%. no association was observed between the domains of quality of life and response to treatment of lymphoedema. conclusion. this study included 57 women with advanced and chronic lymphoedema in early treatment with cpt and low scores for quality of life. the lymphoedema therapeutic response was not influenced by the qol at the beginning of treatment. |
high circulating calcitonin levels are associated with medullary thyroid carcinoma. however, several other neuroendocrine tumors (nets) can also release calcitonin, including pheochromocytomas, neuromas and lung, breast, prostate, and colorectal carcinomas. calcitonin - secreting pancreatic endocrine tumors (ctspets) have been described as extremely rare. we report 2 consecutive cases of ctspets found during the evaluation of patients with hypercalcitoninemia and thyroid nodules. these cases highlight the risk of underestimating calcitonin as a tumor marker for pancreatic net. written informed consent was obtained from both patients for the publication of this manuscript and accompanying images. a 53-year - old caucasian man was referred to our department for an elevated serum calcitonin level (253 pg / ml, reference range 010) discovered during an evaluation of thyroid nodules. the patient was asymptomatic and was not taking any medication ; his family history included only lung cancer, in his father. color doppler ultrasound (cdus) revealed 2 non - homogeneous thyroid nodules of 0.6 and 1.8 cm, with a medium elastography pattern (3b and 2 respectively). fine needle aspiration cytology (fnac) suggested benign hyperplastic nodules (thy 2, british thyroid association, bta - rcp 2007) ; calcitonin measurement in fine needle wash - out of both thyroid nodules was negative (1.24 and 1.68 pg / ml respectively). serum electrolytes, pthi, 24-h urinary metanephrines (144 mcg/24 h < 345) and vanillylmandelic acid (vma = 8.0 mg/24 h < 13.6) were normal. hypercalcitoninemia was confirmed in 2 further samples (388 and 443 pg / ml). net markers were normal : neuron - specific enolase (nse) (5 ng / ml < 10), gastrin (50 pg / ml < 120), chromogranin a - cga (44 ng / ml < 90), cea (1.5 ng / ml < 5), vip (12 pmol / l < 30), 5ht+5htp (4.0 mg/24 h < 5), psa (0.65 ng / ml < 2.3), and 24-h urinary 5hiaa (3.0 mg/24 h < 6). abdominal computed tomography showed a pancreatic nodule (1.8 cm) with moderate enhancement during arterial phase, confirmed on magnetic resonance imaging (figure 1a) as suggestive of net. an integrated nuclear medicine approach was undertaken (a.b.) : f - dopa pet / ct (figure 1b - lower panel) revealed mild pancreatic metabolization while f - fdg pet / ct (figure 1b - upper panel) and octreoscan + spect / ct were negative. mri, f - fdg pet / ct imaging, and immunostaining for calcitonin in case 1. a, mri scan shows a solid 18-mm lesion in the pancreatic tail (arrows), which appears hypointense on t1 and slightly hyperintense on t2. contrast - enhanced sequences show hypervascularity in arterial phase with persistent enhancement in the subsequent phases. b, f - fdg pet / ct (in the upper part of the panel) and f - dopa pet / tc (in the lower part of the panel) both show no significant metabolic activity in the pancreatic lesion. the patient underwent a distal pancreatectomy (p.c.) that confirmed a well - differentiated net (2.3 cm, g1, proliferation index 2%) which was positive for calcitonin, ncam, cga, synaptophysin, nse immunostaining (figure 1c) and negative for insulin, glucagon, gastrin, somatostatin, and serotonin. calcitonin gradually normalized after surgery (figure 2) ; prolonged follow - up (24 months) showed repeatedly normal calcitonin levels, confirming disease eradication. genetic testing for men1 (exons 2,3,4,5,6,7,8,9,10) and ret (exons 10,11,13,14,15,16) mutations associated with ctspets were negative. time course of postsurgical calcitonin normalization (solid : case 1 ; open : case 2). a 78-year - old caucasian woman with a 5-month history of vague abdominal discomfort and constipation complained of a recent onset gastric pain and underwent a liver us, which found 2 suspect non - homogeneous lesions (1.6 and 0.6 cm) in liver segment vii. before admission she had an abdominal computed tomography scan, which revealed a nodule (4.0 cm) in the pancreatic tail, and a f - fdg pet / ct scan, that was negative. 010), confirmed in 2 subsequent measurements (122 and 218 pg / ml), with normal nse (4 ng / ml < 10), gastrin (64 pg / ml < 120), cga (75 ng / ml < 90), cea (1.79 ng / ml < 5), vip (20 pmol / l < 30), 5ht+5htp (4.0 mg/24 h < 5), and 24-h urinary 5hiaa (4.0 mg/24 h < 6). thyroid hormones and antibodies were normal. thyroid cdus confirmed 2 hypoechoic nodules (1.2 and 1.7 cm) with a medium (3a) elastography pattern. fnac showed benign hyperplastic nodules (thy 2) with unremarkable calcitonin levels in needle wash - out. serum electrolytes, pthi, and 24-h urinary metanephrines (53.0 mcg/24 h) and vma (6.0 mg/24 the patient underwent us - guided biopsy of the hepatic lesion that was consistent with metastasis from a well - differentiated net (panckae1/ae3 +, ck8/18 +, ck7-, ck20-, synaptophysin+, nse+/-, cga-/+, heppar1-, alfafp-, ttf1-, cdx2-, calcitonin- ; ki67 staining < 3%). histopathology revealed a well - differentiated 5.0-cm pancreatic net with angioinvasion (g1, proliferation index 2%), with immunostaining positive for calcitonin, ncam, cga, synaptophysin and nse and negative for glucagon, gastrin, insulin, somatostatin, and serotonin. calcitonin levels normalized rapidly post - surgery (+ 24 h = 101 pg / ml ; + 48 h = 3.62 pg / ml ; + 21 days = 1.31 pg / ml) (figure 2). the patient is currently doing well and is followed up regularly in the outpatient clinic. a 53-year - old caucasian man was referred to our department for an elevated serum calcitonin level (253 pg / ml, reference range 010) discovered during an evaluation of thyroid nodules. the patient was asymptomatic and was not taking any medication ; his family history included only lung cancer, in his father. color doppler ultrasound (cdus) revealed 2 non - homogeneous thyroid nodules of 0.6 and 1.8 cm, with a medium elastography pattern (3b and 2 respectively). fine needle aspiration cytology (fnac) suggested benign hyperplastic nodules (thy 2, british thyroid association, bta - rcp 2007) ; calcitonin measurement in fine needle wash - out of both thyroid nodules was negative (1.24 and 1.68 pg / ml respectively). serum electrolytes, pthi, 24-h urinary metanephrines (144 mcg/24 h < 345) and vanillylmandelic acid (vma = 8.0 mg/24 h < 13.6) were normal. hypercalcitoninemia was confirmed in 2 further samples (388 and 443 pg / ml). net markers were normal : neuron - specific enolase (nse) (5 ng / ml < 10), gastrin (50 pg / ml < 120), chromogranin a - cga (44 ng / ml < 90), cea (1.5 ng / ml < 5), vip (12 pmol / l < 30), 5ht+5htp (4.0 mg/24 h < 5), psa (0.65 ng / ml < 2.3), and 24-h urinary 5hiaa (3.0 mg/24 h < 6). abdominal computed tomography showed a pancreatic nodule (1.8 cm) with moderate enhancement during arterial phase, confirmed on magnetic resonance imaging (figure 1a) as suggestive of net. an integrated nuclear medicine approach was undertaken (a.b.) : f - dopa pet / ct (figure 1b - lower panel) revealed mild pancreatic metabolization while f - fdg pet / ct (figure 1b - upper panel) and octreoscan + spect / ct were negative. mri, f - fdg pet / ct imaging, and immunostaining for calcitonin in case 1. a, mri scan shows a solid 18-mm lesion in the pancreatic tail (arrows), which appears hypointense on t1 and slightly hyperintense on t2. contrast - enhanced sequences show hypervascularity in arterial phase with persistent enhancement in the subsequent phases. b, f - fdg pet / ct (in the upper part of the panel) and f - dopa pet / tc (in the lower part of the panel) both show no significant metabolic activity in the pancreatic lesion. the patient underwent a distal pancreatectomy (p.c.) that confirmed a well - differentiated net (2.3 cm, g1, proliferation index 2%) which was positive for calcitonin, ncam, cga, synaptophysin, nse immunostaining (figure 1c) and negative for insulin, glucagon, gastrin, somatostatin, and serotonin. calcitonin gradually normalized after surgery (figure 2) ; prolonged follow - up (24 months) showed repeatedly normal calcitonin levels, confirming disease eradication. genetic testing for men1 (exons 2,3,4,5,6,7,8,9,10) and ret (exons 10,11,13,14,15,16) mutations associated with ctspets were negative. time course of postsurgical calcitonin normalization (solid : case 1 ; open : case 2). a 78-year - old caucasian woman with a 5-month history of vague abdominal discomfort and constipation complained of a recent onset gastric pain and underwent a liver us, which found 2 suspect non - homogeneous lesions (1.6 and 0.6 cm) in liver segment vii. before admission she had an abdominal computed tomography scan, which revealed a nodule (4.0 cm) in the pancreatic tail, and a f - fdg pet / ct scan, that was negative. 010), confirmed in 2 subsequent measurements (122 and 218 pg / ml), with normal nse (4 ng / ml < 10), gastrin (64 pg / ml < 120), cga (75 ng / ml < 90), cea (1.79 ng / ml < 5), vip (20 pmol / l < 30), 5ht+5htp (4.0 mg/24 h < 5), and 24-h urinary 5hiaa (4.0 mg/24 h < 6). thyroid hormones and antibodies were normal. thyroid cdus confirmed 2 hypoechoic nodules (1.2 and 1.7 cm) with a medium (3a) elastography pattern. fnac showed benign hyperplastic nodules (thy 2) with unremarkable calcitonin levels in needle wash - out. serum electrolytes, pthi, and 24-h urinary metanephrines (53.0 mcg/24 h) and vma (6.0 mg/24 h) were normal. the patient underwent us - guided biopsy of the hepatic lesion that was consistent with metastasis from a well - differentiated net (panckae1/ae3 +, ck8/18 +, ck7-, ck20-, synaptophysin+, nse+/-, cga-/+, heppar1-, alfafp-, ttf1-, cdx2-, calcitonin- ; ki67 staining < 3%). histopathology revealed a well - differentiated 5.0-cm pancreatic net with angioinvasion (g1, proliferation index 2%), with immunostaining positive for calcitonin, ncam, cga, synaptophysin and nse and negative for glucagon, gastrin, insulin, somatostatin, and serotonin. calcitonin levels normalized rapidly post - surgery (+ 24 h = 101 pg / ml ; + 48 h = 3.62 pg / ml ; + 21 days = 1.31 pg / ml) (figure 2). the patient is currently doing well and is followed up regularly in the outpatient clinic. the discovery of 2 cases of ctspets within 11 months in our center suggests that extrathyroid calcitonin secretion by net could be more common than generally thought. the absence of specific symptoms (except for a vague abdominal discomfort) is problematic for both identification of the source and post - operative monitoring. several extrathyroidal tumors can produce ectopic calcitonin, including pheochromocytomas, pancreatic nets, adrenocortical carcinomas, nets of esophagus, acute leukemia, lung cancers, cervical tumors, prostatic carcinomas, breast cancers, renal carcinomas, gastrointestinal tract tumors. in all these tumors, the anatomic localization, rapid growth, and frequent cosecretion of other hormones (including acth, gastrin, catecholamines, and somatostatin) drive the clinical presentation and allow rapid localization of the source. symptoms of pancreatic net can include diarrhea, which has been associated with cosecretion of somatostatin or the histological nature of the tumor. however, neither of our patients complained of diarrhea. in contrast, isolated ectopic calcitonin secretion has not been associated with a specific clinical picture and can remain silent, meaning patients are unlikely to seek medical help. the lack of emphasis on differential diagnosis leads to general unawareness of ctspets and some cases probably remain undiagnosed. case 1 suggests that elevated calcitonin levels should be investigated with care even in the presence of thyroid nodules, and especially when the nodules have few suspicious features ; the pancreas should be screened first. in fact, if not promptly diagnosed, ctspets can metastasize, as in case 2. calcitonin measurement should be included in the work - up of any neuroendocrine pancreatic lesion, with or without metastases, even if metastases can lose secretory activity, probably as they dedifferentiate (case 2). herein, we showed 2 cases with positive immunostaining for calcitonin in pets in which serum calcitonin decay (24 h, 48 h, and 21 days) was helpful in postsurgical surveillance. nuclear medicine imaging supported the diagnosis and the combined morphological / functional imaging provided by hybrid pet / ct scan offered the best guide for surgery. in both cases, the absence of glucose metabolism in the pancreatic lesions supported the diagnosis of biologically nonaggressive ctspets. in case 1, the lack of f - dopa fixation in the thyroid strengthened the suspicion of an extrathyroid calcitonin secretion, already suggested by the negative calcitonin measurement in fnac needle wash. of note was that the pancreatic nodule failed to metabolize f - dopa consistently, with low aromatic amino acid decarboxylase activity (false negative). octreoscan was negative, suggesting low or negative sstr-2 expression ; unfortunately the more sensitive gallium - dotatoc - pet scan was not performed. the negative genetic tests suggest the sporadic nature of these pancreatic lesions. in conclusion, when calcitonin levels are elevated and thyroid examination is not clearly suggestive of medullary thyroid carcinoma or c - cell hyperplasia, general screening of extrathyroidal calcitonin secretion is recommended. ctspet should be suspected in the differential diagnosis, especially in view of the lack of specific symptoms, that may further delay diagnosis. routine serum calcitonin measurement may be a highly sensitive adjunct to identify a subset of ctsnets, and calcitonin monitoring may enable early detection and postoperative surveillance. | abstractcalcitonin is the hallmark of medullary thyroid carcinoma. however, extrathyroidal neuroendocrine tumors can also release calcitonin.we report 2 cases of calcitonin - secreting pancreatic tumors found in asymptomatic patients with thyroid nodules referred to our center within 11 months.case 1 : a man initially referred for thyroid nodule characterization was found to have hypercalcitoninemia (> 200 pg / ml) during non - neoplastic fine - needle aspiration.case 2 : a woman evaluated for liver metastasis was found to have hypercalcitoninemia and multinodular goiter.our research emphasizes that marked hypercalcitoninemia in the presence of thyroid nodules is not necessarily due to medullary thyroid carcinoma ; awareness of this could avoid unnecessary thyroidectomy. the lack of specific symptoms related to hypercalcitoninemia may be the reason that the prevalence of calcitonin - secreting pancreatic tumors is underestimated. |
myxomas are the most common type of cardiac tumors, and approximately 75% of these tumors originate in the left atrium and 15% to 20% in the right atrium, with only less than 10% arising from the right and left ventricles. however, the incidence of myxomas in the great vein is extremely rare, and a thorough review of the literature demonstrates only one case in the inferior vena cava (ivc), one case in the femoral vein, and one case in the superior vena cava (svc). most patients present clinically with one or more of a triad of emboli, intracardiac obstruction, and constitutional manifestation ; furthermore, a small myxoma has no symptoms. a 24-year - old man presented with moderate shortness of breath of two months duration, which was intermittent and unrelated to exercise or rest. physical examination showed normal vital signs, blood pressure of 110/80 mm hg, and pulse rate of 75 beats per minutes and regular. there were no abnormal physical findings such as jugular venous distention, rales, and edema. there was a holosystolic murmur (grade 2/6) over the right parasternal area with radiation to the left. laboratory findings of note were a hematocrit value of 43% and an erythrocyte sedimentation rate of 12. chest x - ray revealed no abnormalities, and the electrocardiogram demonstrated a normal sinus rhythm with normal voltage waves. the patient underwent two - dimensional echocardiography, which demonstrated a 4 5 5 cm atrial mass attached by a long stalk to the svc. during atrial systole, the mass moved into the tricuspid annulus, resulting in an apparent obstruction. based on these findings, a right atrium tumor was diagnosed and the patient underwent surgery. the venous return was accomplished by svc - ivc cannulation, and the aorta was cross - clamped with cardioplegic arrest. core cooling to 32 c, aortic occlusion, and cold cardioplegic arrest provided exposure to the tumor through an extended right atriotomy to the svc. the right atrium was opened, and a cluster of grape - shaped, glistening, white masses of leathery consistency (as reported by devig) was noted within it. the mass was not attached to the right atrial wall and had a long stalk, which was emerging from the svc orifice (figures 1 - 3). cavotomy was performed at the site where the stalk was palpable ; and under tension and stretching of the stalk, the point of origin was determined to be in the proximal part of the svc wall. decision was made to extirpate the stalk base under caudal traction. with the aid of this maneuver, the tumor base was excised from the svc wall and the small defect in the svc was repaired. the patient was weaned off cardiopulmonary bypass uneventfully, and his postoperative course was unremarkable. pathologic examination of the tumor revealed a 57 cm firm, cluster tumor, and histological examination revealed a benign myxoma. myxomas were reported for the first time in 1845 by king and then by goldberg in 1952. diagnostic methods for myxomas include chest radiography (pulmonary hypertension, atrial enlargement), two - dimensional transthoracic echocardiography (tte), transesophageal echocardiography (tee), and angiography, as well as some other noninvasive modalities such as computed tomography and magnetic resonance imaging. tee is helpful for the precise localization of a tumor and its point of attachment as well as obstruction of cardiac valves. the indication for selective angiography in patients with myxomas remains for the detection of coronary artery disease if the patients are more than 40 years old. rath and demorise utilized this imaging method for the detection of coronary artery embolus and myocardial infarction in patients with myxomas. cardiac tumors are exceedingly rare, with the incidence ranging between 0.001% and 0.03% of the autopsied specimens. approximately, 75% of primary cardiac tumors are benign, and myxomas are the most frequent type of benign intracardiac tumors with an incidence ranging from 83% to 92%. a literature search revealed only 5 previously reported cases of myxomas arising from the femoral vein, ivc (two cases), eustachian valve, and svc. another instance of a lesion arising from the svc was reported by teixido. bontolotti and associates reported a patient with unusual findings of a right atrial myxoma arising from the supra hepatic segment of the ivc ; the tumor was excised under core cooling and cardioplegic arrest with a short period of low - flow cardiopulmonary bypass. along the same lines, devig and colleagues described a young man who underwent an excision of a right atrial myxoma located at the junction of the right atrial wall and the anterosuperior aspect of the ivc. chiming in with the previous findings, cujec and associates reported a 21-year - old man with a right atrial myxoma arising from the eustachian valve that prolapsed to the ivc, causing the budd - chiari syndrome, and elmusa. reported the excision of a right atrial myxoma from the supra hepatic segment of the ivc. were the first to report the case of a young man diagnosed with a testicular germ cell tumor with pulmonary metastasis : there was a large vegetative mass arising from the svc and extending through the right atrium. right atrial myxomas may present with embolic obstructive or constitutional signs and symptoms like syncopal attack, exertional dyspnea, and chest discomfort due to a transient occlusion of the tricuspid by a thrombus or a fragment of the tumor tissue. the most characteristic finding is an ejection - type systolic murmur in the pulmonary area that often varies from day to day or with positional change. be that as it may, the absence of symptoms, with the exception of dyspnea, in our patient was remarkable insofar as other patients with right atrial myxomas are reported to complain of vague constitutional symptoms such as malaise, low - grade fever, weakness, and unexplained weight loss. laboratory examinations typically reveal microcytic anemia in addition to an elevation in the erythrocyte sedimentation rate. once the diagnosis of a cardiac myxoma is established, a prompt excision is essential to prevent complications. in our patient, the myxoma was attached to the medial wall of the svc and the stalk of the tumor was clearly visualized by the tee. patients with complex and familial myxomas are characterized by younger age, atypical location, multiple tumor sites, and high incidence of recurrent tumors. painstaking surgical management and postoperative follow - up are, therefore, of vital importance in this group of patients. as this case report clearly shows, rare and bizarre variations in the origin of myxomas may occur and they can not be discovered preoperatively unless an index of suspicion is maintained. | myxomas are the most common benign cardiac tumors. myxomas are more common in the left heart chamber than the right side chamber. an extracardiac origin presenting as a right atrial mass is very rare. we present a case of myxoma originating in the superior vena cava (svc) in a 24-year - old man, who underwent surgical resection. preoperative two - dimensional echocardiography demonstrated a mass in the right atrium. intraoperatively, the tumor was found to have originated from the svc orifice. the tumor was excised from the svc by opening the one - third proximal portion of the svc. pathological examination revealed a myxoma, and one - year follow - up showed no evidence of the recurrence of any tumors in the svc. |
anemia has been shown to be the most frequent hematological abnormality in hiv - infected patients globally [1, 2 ]. even among those initiating antiretroviral therapy (art), anemia has been demonstrated to be a strong risk factor for disease progression and subsequent death [15 ] independent of cd4 count and viral load. in a large european cohort study, the presence of severe anemia at art initiation was associated with a 13-fold increased risk of death. in sub - saharan africa, which has the largest burden of hiv in the world, anemia is common as patients are more likely to be malnourished, have advanced immunosuppression, and have higher rates of comorbidities (especially tuberculosis and malaria) than those in high - income countries [6, 7 ]. despite the public health importance of anemia, prospective data from sub - saharan africa on its impact are limited. recent reports suggest that hemoglobin levels improve with art [2, 3, 8 ] ; however, few studies have documented the evolution of hemoglobin levels among patients on art in resource - limited settings, and whether the effects on hemoglobin levels vary by art regimen. given the number of patients on art in this region, understanding the role of anemia in hiv treatment is critical to developing strategies to improve survival and reduce morbidity on art. the major cause of anemia is impaired erythropoiesis resulting from the release of inflammatory cytokines and decreased production of hematopoietic growth factors, coupled with malabsorption and impaired recycling of iron [9, 10 ]. additionally, there are multiple other causes of anemia, which include nutritional deficiencies (iron, cobalamine, or folate deficiency), malignant bone marrow infiltration, bone marrow infection, and hemolysis [1114 ]. among patients initiating antiretroviral therapy, the use of zidovudine containing regimens has been associated with the incidence of anemia, and bone marrow toxicity has been postulated [2, 9, 10 ]. amongst patients in an urban hiv clinic in uganda, these findings suggested that baseline severe anemia should not be used as a criterion for avoiding the use of zidovudine in patients initiating art in resource - limited settings [15, 16 ]. in this prospective cohort study conducted in johannesburg, south africa, we set out to determine the prevalence, incidence, and predictors of anemia among patients initiating first line art. we also sought to explore whether the degree of immunosuppression at art initiation or the initiating art regimen (zidovudine versus other) impacted the magnitude of hemoglobin increase while on treatment. the themba lethu clinic is one of the largest hiv care and treatment clinics in south africa with over 22,000 patients initiated onto art since 2004. we included art nave, nonpregnant hiv - infected patients 18 years of age, initiated on standard first - line art at themba lethu from april 2004 to august 2009 with documented hemoglobin measurements. at themba lethu, art is provided according to the south african department of health guidelines. all patients are scheduled to have a full blood count at art initiation, four months after initiation, and then every six months thereafter. the laboratory data are captured onto a longitudinal patient management electronic record. with the full blood count measurements, whilst clinicians read the results, only hemoglobin values if initiated onto a zidovudine (azt) containing regimen, a full blood count is done at initiation, monthly for the first three months on treatment, and then every six months thereafter. only patients with a contraindication to stavudine (d4 t) at art initiation would be given azt in place of d4 t (i.e., pregnant women or patients receiving tuberculosis treatment). during the study period from april 2004 to august 2009, the 2004 south africa national department of health hiv treatment guidelines were in force. for all patients, person - time accrued from art initiation until the date of the begining of (1) incident anemia ; (2) last clinic visit ; (3) loss to follow - up ; (4) death ; (5) transfer ; or (6) completion of 24 months of follow - up. loss to follow - up was defined as 4 months since last clinic visit. at themba lethu, mortality is ascertained via family or hospital report, active tracing, and linkage with the south african national vital registration infrastructure initiative. we used the national institutes of health division of aids definitions for grading the severity of adult and paediatric adverse events to define anemia. incident anemia was defined as new - onset anemia during the 24 month follow - up period among patients who were not anemic at initiation of art. we calculated the prevalence and incidence of anemia at art initiation and during follow - up, respectively. prevalence ratios (pr) and 95% confidence intervals (95% ci) for the association of baseline characteristics with prevalent anemia were estimated using modified poisson regression. cox proportional hazards models were used to evaluate the association between incident anemia and baseline (defined as 90 days before to 7 days after art initiation) characteristics such as hemoglobin, cd4 count, body mass index (bmi), and who stage. we further examined overall changes in hemoglobin levels on treatment by stratifying results by cd4 count and art regimen (azt versus non - azt containing regimen) at treatment initiation. use of themba lethu clinic data was approved by the human research ethics committee (medical) of the university of witwatersrand, and approval for analysis of anonymized data was approved by the boston university institutional review board. between april 2004 and august 2009, 10,369 patients fulfilled the inclusion criteria. among these, 102 (1%) did not have hemoglobin measurements, and 8 patients had abnormally high hemoglobin levels (> 30 g / dl) at art initiation leaving 10,259 patients for analysis. excluded patients were largely similar in demographic and clinical characteristics from those who were included in analyses. the majority of patients were females (68%), with a median age of 36 years (iqr 3143) and initiated on stavudine - lamivudine - efavirenz (89.4%) (table 1). the cohort was immunosuppressed at art initiation, with a median cd4 count of 82 cells / ml (iqr 30151), 45.7% with who stage iii / iv, and 19.9% with a tuberculosis diagnosis. overall prevalence of anemia at art initiation was 25.8% (95% ci : 25.0%26.7%). in multivariable analysis, females (pr : 1.77 ; 95% ci : 1.641.90) and younger patients (1835 versus > 55 ; pr : 1.59 ; 95% ci : 1.192.11) were more likely to be anemic at art initiation (table 2), while patients initiated onto azt - based regimens (versus d4t - based) were less likely to be anaemic (pr : 0.56 ; 95% ci : 0.420.75) at the start of treatment. only 3.1% (n = 322) of the patients were initiated on to azt - based regimens. of note, among these 322 patients initiated onto azt - based regimens, 47 patients corresponding to 14.6% already had hemoglobin levels of less than 10 g / dl at baseline. additionally, we found that those with a who iii / iv versus i / ii (pr : 1.96 ; 95% ci : 1.812.12), patients with a low cd4 count (200 cells / ml ; pr : 1.48, 95% ci : 1.281.73), and those with tuberculosis at initiation (pr : 1.14, 95% ci 1.061.22) were more likely to have anemia at art initiation. the incidence rate for anemia among these patients was 3.1/1000 person - years (py). incidence of anemia was the highest in the first 3 months after art initiation at a rate of 34.7/1000 py and decreased to 16.7/1000 py between 3 and 6 months on treatment. this incidence was then fairly stable over the remaining 18 months of follow - up, between 7.7 and 8.4/1000 py. in adjusted analyses (table 1) female gender (adjusted hazards ratio (ahr) : 1.78 ; 95% ci : 1.452.19), lower bmi (ahr : 1.70 ; 95% ci : 1.352.14), who iii / iv (ahr : 1.24 ; 95% ci : 1.021.51), and lower cd4 count (200 cells / ml, ahr : 1.72 ; 95% ci : 1.182.52) were associated with increased incident anemia over the follow - up period. we found that azt use was associated with over twice the rate of developing anemia during follow - up (ahr : 2.19 ; 95% ci : 1.503.20). in a sensitivity analysis to decrease measurement error our hazard ratios were similar though the association between azt and incident anemia was slightly attenuated, from 2.19 to 1.88 (95% ci : 1.173.03). among the 10,259 patients initiating art, hemoglobin increased over 24 months on art (figure 1). between 0 and 3 months on art, mean hemoglobin was 11.2 g / dl but increased to 13.6 g / dl between 21 and 24 months. regardless of cd4 at art initiation, hemoglobin levels increased over time. between 06 months on art, the magnitude of hemoglobin increase was linearly related to cd4 count. however, between 6 and 24 months on art, hemoglobin levels showed a sustained overall increase, the magnitude of which was similar regardless of baseline cd4 count. at art initiation, patients on azt containing regimens had higher mean hemoglobin (mean 12.0 g / dl, sd 2.0) compared to those initiated onto regimens without azt (mean 11.4 g / dl, sd 2.2). from 6 and 24 months on art, mean hemoglobin increased for both regimen categories. for patients on azt containing regimens, mean hemoglobin increased from 12.3 g / dl to 13.3 g / dl, and for patients on regimens without azt, mean hemoglobin increased from 12.6 g / dl at initiation to 13.4 g / dl by 24 months. this is a study of patients under routine public - sector hiv care in johannesburg, south africa, over a quarter of patients presented at treatment initiation with anemia (hb < 10 g / dl). this is slightly higher than previous estimate of 18% of prevalence of anemia among hiv - infected patients in southern africa but in line with estimates for other regions of africa (between 24% and 37%). we estimate the incidence of anemia at 3.1/1000 person - years and found it to be the highest in the first 6 months after art initiation. since hemoglobin measurements are simple and inexpensive, monitoring hemoglobin levels over the first 6 months on art among patients at high risk may allow for improved detection of hiv - related anemia. it may also lead to detection of related underlying comorbid illnesses manifesting as anemia associated with poor treatment outcomes [15 ]. beyond 6 months, our data shows a lower incidence of anemia in support of current recommendations to measure hemoglobin levels every 6 months and if clinically indicated during this time. in our data, incident anemia was associated with female gender, lower bmi, advanced who stage, and lower cd4 count. the association of anemia with lower bmi is likely to reflect malnutrition, as a number of nutritional deficiencies contribute to anemia. the increased risk in anemia among patients with immunosuppression is in agreement with previous published reports [16, 2124 ]. studies have shown that azt can inhibit bone marrow activity, resulting in decreased production of blood cells and platelets ; previous research has demonstrated its association with incident anemia [16, 22, 23, 25, 26 ]. the present study also showed that over 24 months of follow - up, hemoglobin increased for patients initiating art, similar to findings from resource - rich environments [2, 3 ]. this increase in hemoglobin was seen regardless of art regimen (both azt- and d4t - based regimens). this observation is in contrast to a meta - analysis of six clinical trials conducted in high - income settings that reported decreases in hemoglobin levels during 48 weeks of follow - up among patients initiating azt containing regimens. however, in a cohort of hiv - infected patients accessing art from a rural hospital in tanzania, the majority of patients who were anemic at the time of art initiation had significant hemoglobin increase over the initial 12 months of art, and in this study, zidovudine - containing initial regimen was an independent predictor of persistent anemia. this pattern of improving hemoglobin level despite initiating an azt - containing regimen is also similar to observations in some south african and ugandan cohorts. our study has several strengths including large number of clinical events owing to the relatively large sample size. we did not collect comprehensive information of clinical conditions that may be possible underlying causes of anemia, resulting in unmeasured confounding of the risk factors for prevalent and incident anemia. additionally, loss to follow - up may have led to selection bias, as outcome can not be determined in patients lost or those who have died. in conclusion, we observed a high prevalence of anemia among hiv - infected patients initiating first - line art in johannesburg, south africa. over 24 months of follow - up, incidence of anemia was the highest in the first 6 months after art initiation, but, overall, during follow - up, this remained low. our results further support findings that art improves hemoglobin and this is seen regardless of regimen type (azt containing versus non - azt containing) and the degree of immunosuppression. hemoglobin measurement is an inexpensive marker for hiv disease progression and should be measured more frequently in patients at risk for anemia in the first 6 months after initiation of art. our study suggests that art improves hemoglobin levels regardless of magnitude of immunosuppression and art initiating regimen. | among those with hiv, anemia is a strong risk factor for disease progression and death independent of cd4 count and viral load. understanding the role of anemia in hiv treatment is critical to developing strategies to reduce morbidity and mortality. we conducted a prospective analysis among 10,259 hiv - infected adults initiating first - line art between april 2004 and august 2009 in johannesburg, south africa. the prevalence of anemia at art initiation was 25.8%. mean hemoglobin increased independent of baseline cd4. females, lower bmi, who stage iii / iv, lower cd4 count, and zidovudine use were associated with increased risk of developing anemia during follow - up. after initiation of art, hemoglobin improved, regardless of regimen type and the degree of immunosuppression. between 0 and 6 months on art, the magnitude of hemoglobin increase was linearly related to cd4 count. however, between 6 and 24 months on art, hemoglobin levels showed a sustained overall increase, the magnitude of which was similar regardless of baseline cd4 level. this increase in hemoglobin was seen even among patients on zidovudine containing regimens. since low hemoglobin is an established adverse prognostic marker, prompt identification of anemia may result in improved morbidity and mortality of patients initiating art. |
clinically significant unexpected antibodies are capable of causing hemolytic transfusion reactions secondary to accelerated destruction of a significant proportion of transfused red blood cells (1). therefore, screening for unexpected antibodies should be part of all pretransfusion testing, with antibody identification in the event of a positive result. in the 1990s, the microcolumn gel technique was introduced for screening and identification of such unexpected antibodies (2). this method is not only easy to perform and economical of time but also easy to standardize and read, so it has become the most common technique in the blood bank laboratories of many countries (3). the two principal techniques for unexpected antibody screening and identification are the indirect antiglobulin and enzyme methods. the most frequently used method is the indirect antiglobulin with gel (liss / coombs), and the microcolumn assay technique using the liss / coombs gel test is the most popular for this purpose in korea (4 - 6). in recent years, the enzyme gel method (nacl / enzyme) has been added for antibody identification in a few hospitals in korea due to its higher and exact identification rate (7). however, the nacl / enzyme method is used only for antibody identification, so some unexpected antibodies could be missed in screening step. at present, there has been no study in korea of antibody screening and identification using these two methods. the purpose of the present study was to compare the results of the liss / coombs and nacl / enzyme methods for screening and identifying unexpected antibodies and to evaluate the clinical usefulness of simultaneous testing by these two methods. from may 2005 to april 2006, unexpected antibody screening was performed on 15,014 samples using the liss / coombs and nacl / enzyme gel tests. when unexpected antibodies were detected by either test, those antibodies were identified using both methods. a 50 l sample of 0.8% screening or identification cell reagent and 25 l of patient serum were added to the microtube of each gel card. after 15 min ' incubation at 37, the card was centrifuged for 10 min, and the reactions for agglutination were examined macroscopically on an illuminated view box. all tests were carried out using the diamed - id micro typing system (diamed ag, cressier, morat, switzerland). for the liss / coombs screening method, the liss / coombs card and two test reagents id - diacell i - ii (diamed ag) were used. for the nacl / enzyme screening method, the nacl / enzyme card and three test reagents diacell i - ii - iii p (papainized) (diamed ag, i d) were used. when unexpected antibodies were detected by either test, those antibodies were identified using both methods. for the liss / coombs identification test, the liss / coombs card and id - panel test reagent (diamed ag) were used. for the nacl / enzyme identification test, the nacl / enzyme card and the id - panel p test reagent (diamed ag) were used. an antibody screening result was defined as positive if one or both of the cell reagents agglutinated with the patient 's serum in the liss / coombs test, and if one or more of the three cell reagents agglutinated with the patient 's serum in the nacl / enzyme test. for antibody identification, we interpreted each method as positive if one or more of the 11 cell reagents agglutinated. when only one antibody was identified in the serum, we interpreted it as " identified " if all reactions in the 11 wells were consistent with the manufacturer 's identification table and as " unidentified " if the reactions in some wells were discordant with the table. when two or more antibodies were present, we interpreted them as " identified " if all antibodies were identified exactly with each method, as " partially identified " if at least one antibody was identified exactly with each method, and as " unidentified " if none of them was identified exactly. if no agglutination reactions occurred in any of the 11 wells, we interpreted the result as " negative ". from may 2005 to april 2006, unexpected antibody screening was performed on 15,014 samples using the liss / coombs and nacl / enzyme gel tests. when unexpected antibodies were detected by either test, those antibodies were identified using both methods. a 50 l sample of 0.8% screening or identification cell reagent and 25 l of patient serum were added to the microtube of each gel card. after 15 min ' incubation at 37, the card was centrifuged for 10 min, and the reactions for agglutination were examined macroscopically on an illuminated view box. all tests were carried out using the diamed - id micro typing system (diamed ag, cressier, morat, switzerland). for the liss / coombs screening method, the liss / coombs card and two test reagents id - diacell i - ii (diamed ag) were used. for the nacl / enzyme screening method, the nacl / enzyme card and three test reagents diacell i - ii - iii p (papainized) (diamed ag, i d) were used. when unexpected antibodies were detected by either test, those antibodies were identified using both methods. for the liss / coombs identification test, the liss / coombs card and id - panel test reagent (diamed ag) were used. for the nacl / enzyme identification test, the nacl / enzyme card and the id - panel p test reagent (diamed ag) were used. an antibody screening result was defined as positive if one or both of the cell reagents agglutinated with the patient 's serum in the liss / coombs test, and if one or more of the three cell reagents agglutinated with the patient 's serum in the nacl / enzyme test. for antibody identification, we interpreted each method as positive if one or more of the 11 cell reagents agglutinated. when only one antibody was identified in the serum, we interpreted it as " identified " if all reactions in the 11 wells were consistent with the manufacturer 's identification table and as " unidentified " if the reactions in some wells were discordant with the table. when two or more antibodies were present, we interpreted them as " identified " if all antibodies were identified exactly with each method, as " partially identified " if at least one antibody was identified exactly with each method, and as " unidentified " if none of them was identified exactly. if no agglutination reactions occurred in any of the 11 wells, we interpreted the result as " negative ". unexpected antibodies were detected by at least one method in 234 of the 15,014 serum samples, including 25 autoantibody - containing samples (1.56%). the positive screening rates of the liss / coombs, nacl / enzyme, and combined tests for unexpected alloantibodies were 0.48% (n=72), 1.29% (n=194), and 1.39% (n=209), respectively (table 1). the positive rate of the combined methods was about threefold that of the liss / coombs method only, and highly discrepant results were seen between these methods. only 57 (27.3%) of the total 209 alloantibody cases were positive by both methods, whereas 137 (65.6%) and 15 (7.2%) were positive only by the nacl / enzyme and the liss / coombs method, respectively. among the 57 samples showing positive in both screening tests, on the other hand, 11 samples were positive only by the nacl / enzyme identification test, and these antibodies were anti - e (n=5), anti - lea (n=3), anti - c+e (n=1), anti - e (n=1), and anti - e+lea (n=1) (table 2). one sample was negative in both identification tests. among the 15 samples having positive results only by the liss / coombs screening test, 7 samples were positive for the liss / coombs identification test only, 1 for the nacl / enzyme test only, and 2 for both tests. among the 137 samples having positive results only by the nacl / enzyme screening method, 102 samples were positive for the nacl / enzyme identification test only. the 61 samples were finally identified as anti - c (n=3), anti - c (n=1), anti - c+k (n=1), anti - e (n=25), anti - e+c (n=2), anti - lea (n=27), and anti - leb (n=2). but other 41 samples were " unidentified " in the nacl / enzyme identification test. ten samples showed positive results in the liss / coombs method as well as the nacl / enzyme method, and these were finally identified as anti - d (n=1), anti - e (n=1), anti - e+c (n=1), or anti - lea (n=4), with 3 being unidentified. according to the final identifications, anti - rhesus antibodies were the most common, and 78 antibodies were identified. these antibodies were exactly " identified " in 20 cases and " partially identified " in 12 cases by the liss / coombs method and were exactly " identified " in 72 cases and " partially identified " in 6 cases by the nacl / enzyme method (table 3). of the 40 anti - lewis antibodies, all were identified by the nacl / enzyme method. in the liss / coombs method the anti - fya, anti - fyb, and anti - xga antibodies were identified only by the liss / coombs method. previously, screening for unexpected antibodies was performed with an indirect antiglobulin test or an enzyme test using a conventional tube method. however, the recently introduced gel test has proved to be more sensitive and has many advantages (8, 9). the use of liss has increased the number of antibodies detected, and clinically important antibodies have been found in increasing numbers. in addition, the gel method is rapid, and interpretation of the results is easy. therefore, the gel test gained widespread usage throughout the world, including korea. in this study, we compared the results of the liss / coombs and nacl / enzyme tests using the gel method for screening and identifying unexpected antibodies and evaluated the clinical usefulness of simultaneous testing by two methods. of the 15,014 patient samples tested, 0.48% had a positive reaction with the liss / coombs screening method. this rate is similar to that in previous reports from korea (4 - 6). the positive rate of antibody screening increased to 1.29% with the nacl / enzyme method and to 1.39% using these two tests together. this result indicates that the nacl / enzyme method is sensitive in detecting unexpected antibody, especially rh antibodies. among the 137 samples showing positive results in nacl / enzyme screening only, 102 samples were also positive only with the nacl / enzyme identification method and 10 were positive with both the liss / coombs and the nacl / enzyme identification. anti - rh (n=35), anti - le (n=33), and unidentified antibodies (n=44) accounted for nacl / enzyme screening - only antibodies. twenty - five samples showed negative results in both the liss / coombs and nacl / enzyme identification methods. the decision about the clinical significance of nacl / enzyme screening - only positive results is difficult, and we should be careful in interpretation. in a few previous reports, the authors stated that the enzyme method revealed a high proportion of nonspecific reactions with uncertain clinical value, and " enzyme - only " antibodies lack clinical significance, so the method is not employed routinely by many laboratories (10, 11). in our study, the unidentified antibodies (44/137) and negative results (25/137) in identification also accounted for a high proportion among the nacl / enzyme screening - only positive results. these are considered nonspecific reactions, clinically insignificant, or both, although we could not evaluate individual patient data for clinical significance. however, we can not completely accept the opinion that all nacl / enzyme screening - only positive results are insignificant. a few reports about antibody screening in pregnant women showed different results that enzyme - enhanced methods often detect low concentrations of anti - rh antibodies not found by other methods (12, 13). in addition, there are some cases of acute hemolytic transfusion reaction (14) or delayed transfusion reactions (11, 15) caused by " enzyme - only " antibodies. we found additional evidence supporting the importance of the enzyme method for antibody screening in this study. among the 137 samples that were nacl / enzyme - only positive these antibodies were identified as anti - d (n=1), anti - e (n=1), anti - e+c (n=1), and anti - lea (n=4), with three unidentified results in the nacl / enzyme identification. however, these samples were only weakly reactive in liss / coombs identification, and most of them remained unidentified with the liss / coombs method. these antibodies have a chance of being missed in screening if only liss / coombs methods were used in antibody screening. thus, the liss / coombs method for screening could fail to detect some significant unexpected antibodies. for antibody identification, there are significant differences between the liss / coombs and nacl / enzyme methods (table 3). some samples showed positive in the liss / coombs screening were positive only in the nacl / enzyme identification. and, it has the advantage of discriminating antibodies when mixed antibodies were present. in addition, 11 samples were positive only in the nacl / enzyme identification, although these were positive in both screening methods. however, the anti - fya and anti - xga antibodies were found on screening and were identified only by the liss / coombs method. therefore, nacl / enzyme method should be used together with liss / coombs method. in the present study, the nacl / enzyme method showed about threefold higher detection rates, especially of rh antibodies in screening, and higher exact identification rates and discrimination power for mixed antibodies. in conclusion, simultaneous liss / coombs and nacl / enzyme testing is useful for antibody screening and identification because the nacl / enzyme method can detect and identify many significant antibodies that would be overlooked if only the liss / coombs method was used, although a high proportion of antibodies found in nacl / enzyme screening are insignificant and reflect nonspecific reactions. | we evaluated the clinical usefulness of simultaneous liss / coombs and nacl / enzyme testing using the gel method for screening and identification of unexpected antibodies in 15,014 samples. when unexpected antibodies were detected by either screening test, those antibodies were identified using both the liss / coombs and the nacl / enzyme gel test. the positive screening rates of the liss / coombs, nacl / enzyme, and combined tests (excluding 25 autoantibody cases) were 0.48%, 1.29%, and 1.39%, respectively. among the 57 samples positive by both screening methods, the antibodies in 19.3% could be identified only by the nacl / enzyme method. among the 137 samples positive only by nacl / enzyme screening, 74.5% showed positive results in antibody identification only by the nacl / enzyme test, although 7.3% were also positive in the liss / coombs test. the nacl / enzyme method thus showed about threefold higher detection rates than the liss / coombs method, especially in screening for rh antibodies, and higher exact identification rates and discriminatory power for identifying mixed antibodies. addition of the nacl / enzyme method to routine laboratory procedures may detect and identify considerable numbers of significant antibodies that might be missed if only the liss / coombs method is used. |
cyclin - dependent kinase inhibitors have the potential to induce cell cycle arrest and apoptosis in cancer cells. roscovitine, a potent and selective inhibitor of cdk2 and cdc2, has demonstrated selective inhibition of cdk enzymes over related kinases. it has been reported that roscovitine does cause not only cell cycle arrest, but also apoptosis in cancer cells [2, 3 ]. in in vitro study, it has been shown that roscovitine has cytotoxic activity against a lot of human tumor cells, as well as in tumor xenograft models [4, 5 ]. roscovitine is currently undergoing phase ii clinical trials as a treatment for nonsmall cell lung cancer and nasopharyngeal cancer [6, 7 ]. in this study, we investigated whether roscovitine could inhibit the tumor growth and exhibit cytotoxicity in cervical carcinoma cell lines : c33a, hce-1, hela, and siha. in addition, we are interested in elucidating the biochemistry of apoptosis of roscovitine on these cell lines. our data showed that roscovitine can inhibit tumor cell proliferation in dose- and time - dependent manner in cervical carcinoma cells. roscovitine can induce cell cycle arrest and apoptosis in 4 cervical cells but showed selective sensitivity. we estimated that cervical carcinoma cells responded differently to roscovitine because of differences in apoptotic and genetic background. these results also suggest that roscovitine may be a selective and effective chemotherapeutic agent against cervical carcinoma. c33a, hce-1, hela, and siha cell lines were purchased from the institute of basic medical sciences chinese academy of medical sciences and shanghai sanqiang analysis company. dulbecco 's modified eagle medium (dmem), fetal bovine serum (fbs), and trypsin were purchased from hyclone laboratories inc. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl - tetrazolium bromide (mtt) and acridine orange were purchased from amresco company (usa). protease inhibitor cocktail (1%, cat no : 539134) was purchased from merck (usa). a 10 mmol / l roscovitine stock solution of the compound was prepared in dmso and diluted to a different concentration. four cervical carcinoma cells (c33a, hce-1, hela, and siha) were maintained in rpmi-1640 media containing 10% fetal bovine serum, 2 mmol / l l - glutamine, 100 u / ml penicillin, and 100 g / ml streptomycin. c33a, hce-1, hela, and siha cells (5 10/well) were grown in 24-well plates and treated with roscovitine (030 mol / l) or dmso (0.3%, final concentration) for 48 and 72 h. attached cells were released by trypsin and combined with nonadherent cells. after 0, 2, 4, 6, 12, 24, and 72 h, 20 mol / l of roscovitine was added into the wells. cell number and cell viability were determined using haemocytometer and trypan blue dye exclusion test. c33a, hce-1, hela, and siha cells were seeded into 96-well plates and incubated overnight at 37c. roscovitine was added to cells (in 5 replicates) and incubated for 72 h at 37c. 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (mtt) was made up as a stock of 2 mg / ml in cell media and filter sterilized. media were removed from cells, and mtt solution was then added at 50 l per well and incubated in the dark at 37c for 4 h. mtt solution was removed, and mtt dye was solubilised with 50 l / well of dmso with agitation. measure the absorbance at 562 nm and then determine the ic50 (concentration of roscovitine which inhibits cell growth by 50%). cervical carcinoma cells in logarithmic phase of 5 10/ml were incubated into 6-well cell culture plate and were cultured at 37c in an incubator with 5% co2 for 24 h. with the culture medium removed, the volume of 2 ml containing 20 mol / l roscovitine was added into each well. the cells were cultured at 37c in an incubator with 5% co2 for 0, 6, 12, 24, 48, and 72 h, respectively, collected, respectively, and then centrifuged at 2000 g for 5 min.. the media binding reagent with 10 l of annexinv - fitc was added. the cells were incubated in darkness for 15 min and centrifuged at 3000 g for 5 min, and then the supernatant was removed. atp is a sign of cell viability, and it exists in all living cells with metabolism. the luciferase and d - luciferin contained in the atp lite kit react with atp to produce fluorescence. the reaction formula is as follows:(1)atp+d - luciferin+o2oxyluciferin+amp+ppi+co2+light fluorescence intensity was measured by perckinelmer 2030 multilabel reader. 100 l cells suspension were seeded at 3 10/ml in 96-well culture plate. after 24 h, the cells were added with 100 l culture medium containing roscovitine 10, 20, 30, 40, 50, and 60 mol / l, respectively. the blank group was added with media, and the control group was added with 0.5% dmso. each group had 5 repeats. the cells of c33a and hela were cultured for 48 h. temperatures of atp lite buffer, cell lysis solution, and lyophilized substrate solution were balanced to room temperature (rt). atp lite buffer with the volume of 5 ml was added into the lyophilized substrate solution. cell lysis solution with the volume of 50 l was added into each well. the mixture was vibrated at 1000 g for 5 min by microvibration to dissolve the cells and to stabilize atp. the prepared matrix solution with the volume of 50 l the mixture was vibrated at 1000 g for 5 min and was protected from light for 10 min to measure its fluorescence intensity. the concentration of c33a and hela cells in logarithmic phase was diluted to around 5 10/ml. 2 ml of the c33a and hela cell suspension was placed into 6-well culture plate and covered by the cover slips. the cells were cultured at 37c in an incubator with 5% co2 for 24 h. then the culture medium was removed. 20 mol / l roscovitine was added into each well, respectively, with the group of 0.3% dmso as the control group. the cover slip with growing cells was selected, washed with pbs for 3 times to remove serum, fixed with 95% ethanol for 15 min, treated by 1% acetic acid for 30 s, then stained by 2 10 mol / l acridine orange for 3060 s, processed by 1 mol / l cacl2 for 30120 s, and washed by pbs for 3 times. a slide dropped with 200 l glycerol was covered lightly, as the excess liquid was sucked by filter paper. the picture was taken by confocal microscope at the excitation wavelength of 488 nm and the emission wavelength of 561 nm.. a p value of < 0.05 was considered statistically significant, and p value of < 0.01 was considered very significant. the growth of cells was inhibited in dose - dependent manner after exposure to roscovitine for 48 h and 72 h ranging from 0 to 30 mol / l (figure 1). the antiproliferation effect of roscovitine was evaluated by measuring the growth rates and treated with 20 mol / l roscovitine. treatment with roscovitine caused a time - dependent inhibition of cell growth in accordance with the cell viability assay during 72 h as compared with control (figure 2). the ic50 values of c33a, hce-1, hela, and siha cells were 22.09 3.29, 21.21 1.96, 13.79 3.30, and 16.88 7.39 mol / l, respectively, as shown in figure 3. we analyzed the cell cycle profiles of growing cervical cell lines exposed to 20 mol / l roscovitine. in c33a, hce-1, and siha cell lines, the sub - g1 dna content was remarkable and apparently increased during 2448 h, indicating that apoptosis occurred (figure 4). in hela cell lines, we found that the sub - g1 dna content occurred great increase within 12 h. the results indicated that roscovitine induced apoptosis in four cervical carcinoma cells, and hela is the most sensitive to roscovitine. to understand the reason of the cancer cells exhibiting different sensitivity to roscovitine, the most sensitive hela cells and the most resistant c33a cells were used as the representatives to do the atp lite and morphological study. with atp assay, it was confirmed that roscovitine significantly inhibited the growth of both c33a and hela cells. the intracellular atpase activity decreased significantly as the concentration of roscovitine increased, as shown in figure 5. the inhibition effect of roscovitine in hela cells is higher than that in c33a cell lines in a dose - dependent manner. the c33a and hela cells stained with acridine orange fluorescence were observed by confocal microscopy. their nuclei presented homogeneous fluorescence of green light while in the apoptotic cells, due to the chromatin pyknosis or the broken fragments of unequal size, the apoptotic body was formed. they were stained with acridine orange and presented the deep and dense fluorescence or the granular fluorescence of green. c33a and hela cells treated with roscovitine were taken pictures at 0, 24 h, the apoptosis feature was demonstrated clearly, as shown in figure 6. the results indicated that the cells treated with roscovitine showed cell membrane blister, cell shrinkage, and apoptosis. those indicated that roscovitine induced apoptosis in both two cell lines, and hela cells were more sensitive to roscovitine. roscovitine, an olomoucine - related purine analogue derived from 6-dmap and isopentenyladenine that competes with atp for its binding site on cdks, has been developed as a cdk inhibitor [8, 9 ]. roscovitine treatment induced not only cell cycle arrest, but also apoptosis in various type cell lines [4, 10, 11 ]. in this study, we showed for the first time that the novel cdk inhibitor roscovitine inhibits cervical tumor cell proliferation in dose- and time - dependent manner and induced apoptosis rapidly in vitro in cervical carcinoma cells by a mechanism that involved apoptosis. we found that roscovitine exhibited selective cytotoxicity towards cervical cells, and the cells showed different morphologic and apoptotic changes at the same concentration. this observation was confirmed by flow cytometry and indicating the apoptotic mechanism of roscovitine. published paper using roscovitine on head and neck squamous carcinoma cells also showed two possible results [1214 ]. the results suggest that cervical carcinoma cells may respond differently to roscovitine because of the mechanism and relationship of apoptosis and cell cycle arresting. from our study, roscovitine can inhibit tumor cell proliferation in dose - dependent and time - dependent manner and exhibited difference cytotoxicity in different cervical cell lines. as such, roscovitine will be a selective and effective chemosensitivity drug for cervical carcinoma therapy. | the antitumor activity of roscovitine was tested in four cervical carcinoma cells : c33a, hce-1, hela, and siha. the effects of roscovitine on atp lite assay, cell cycle, and apoptosis were assessed. the sub - g1 dna content occurred great increasing, and this indicates that apoptosis was induced quickly in hela cells, but slowly in the other cells. the morphological observation results showed that roscovitine induced apoptosis and cell death in the cervical carcinoma cells. results revealed that roscovitine exhibited selective cytotoxicity towards 4 cervical carcinoma cells, and the cells showed different morphologic and apoptotic changes at the same concentration. it was estimated that cervical carcinoma cells responded differently to roscovitine because of differences in apoptotic and genetic background in different cervical carcinoma cells. this study suggested that roscovitine had the potential to be a chemotherapeutic agent against cervical carcinoma. |
modern man is chronically exposed to lead in the biosphere at levels several orders of magnitude higher than the natural level that once existed. there is much concern about the possible adverse effects of this population - wide, low - level lead exposure, particularly on the developing organism, wherein the central nervous system may be one primary target. we have developed in oculo test systems, which permit temporal and spatial discrimination of possible effects of lead and other potential neurotoxic agents in the environment on the developing central nervous system as well as on different types of peripheral nerves in the adult. in one experimental protocol, defined areas of the fetal rat brain are grafted to the anterior chamber of the eye of adult rat recipients that are exposed to lead. such grafts will become vascularized from the host iris and continue developing in oculo. thus, grafted brain tissue and host brain will share circulation and therefore be exposed to similar amounts of lead. studies of cerebellar grafts revealed that, although there was a normal gross cytological development in the presence of lead, there was a marked and permanent impairment of spontaneous discharge rates of the grafted purkinje neurons as observed with electrophysiological techniques long after cessation of lead treatment. the host purkinje neurons were not affected. a similar, although less dramatic, impairment of cerebellar function could be subsequently demonstrated in intact animals when newborn rats were given lead during the first 20 days of life and studied as adults.(abstract truncated at 250 words)imagesfigure 1.figure 5. afigure 5. b |
|
dendritic spines are small protrusions that serve as a postsynaptic site for the 90% of the excitatory synapses in the cns. different kinds of dendritic spines were described based on their shape and their actin content in adult rat brains. mushroom dendritic spines have stalks with a clear head differentiation, stubby spines are thick and have no neck, and thin spines are characterized as long and without neck. mushroom dendritic spines have a rich actin cytoskeleton network [1, 2 ], which is highly regulated by proteins that either stabilize the actin monomer (g - actin), such as thymosin or profiling, arp2/3, rho - gtpase kinase contractin, or prevent polymerization and convert several polymers into small fragments of actin such as cofilin and gelsolin. several functions have been suggested for dendritic spines as they have been implicated in the mechanism of synaptic plasticity, learning and memory [47 ], and protein translocation. functional decline of dendritic spines is a consequence of synaptic loss in neurodegenerative disease and brain insults. furthermore, processes such as loss of dendritic spines, dendritic pruning, and loss of synaptic proteins precede neuronal death in many neurodegenerative disorders [1012 ]. moreover, activation and impaired function of the ubiquitin - proteasome pathway is thought to contribute to a number of neurodegenerative disorders. therefore, spine pathologies may be involved in different brain insults including hypoxia ischemia [1417 ]. perinatal asphyxia (pa) is a serious clinical complication with high mortality and morbidity. following pa, approximately 45% of newborn die and 25% have permanent neurological deficits including cerebral palsy, mental retardation and developmental delay, learning disabilities, visual and hearing problems, and different issues in school readiness [1924 ]. in previous works, we have observed several alterations in striatum and hippocampal areas after pa, such as high level of ubiquitinization in dendritic spines, reactive gliosis, alterations in dendritic microtubular organization, and modification in cytoskeleton organization [17, 25, 26 ]. given that numerous reports support the idea that dendritic spines are the main site damaged during brain ischemia [25, 27 ], we aimed to investigate whether dendritic spine changes are a spread feature induced by pa. for this purpose, we studied dendritic spine modifications in the stratum radiatum of ca1 hippocampal area. all procedures involving animals were approved by the institutional animal care and use committee at the university of buenos aires (school of medicine) and conducted according to the principles of the guide for the care and use of laboratory animals (nih publications no. sprague - dawley female rats in the fifteenth day of pregnancy were placed in individual cages and maintained on a 12 : 12 h light / dark cycle in a controlled temperature (21 2c) and humidity (65 5%) environment. the animals had access to food (purina chow) and tap water ad libitum. one group of animals (n = 10) was used as surrogate mothers, another group (n = 10) was assigned to pa procedures. eosin - phalloidin and phalloidin - alexa were purchased from invitrogen (carlsbad, ca). secondary antibodies against mouse were obtained from jackson immunoresearch laboratories (west grove, pa). paraformaldehyde, em grade glutaraldehyde, sodium cacodylate, and durcopan acm resin were obtained from electron microscopy sciences (fort washington, pa) ; special welled tissue culture plates were obtained from mattek (ashland, ma). ten full - term pregnant rats on gestational day 22 were anesthetized, rapidly decapitated, and the uterus horns were isolated through an abdominal incision and placed in a water bath at 37c for 19 min (subsevere pa : n = 10 full - term pregnant rats) [25, 26, 2931 ]. we have used 19 min as the maximum time of pa because more than 20 minutes result in a survival rate lower than 3%. following asphyxia, the uterus horns were rapidly opened, the pups were removed, the amniotic fluid was cleaned, and the pups were stimulated to breathe by performing tactile stimulation with pieces of medical wipes for a few minutes until regular breathing was established. the umbilical cords were ligated, and the animals were left to recover for 1 hour under a heating lamp. when their physiological conditions improved, they were given to surrogate mothers who had delivered normally within the past 24 hours. the different groups of pups were marked and mixed with the surrogate mothers ' normal litters (control animals (ctl) that were left undisturbed). briefly, an intracardiac perfusion was performed with normal rat ringer 's at 35c followed by fixative under deep anaesthesia (containing 50 mg / kg ketamine, 1 mg / kg rhompun and 5 mg / kg acetopromazine in sterile saline). for light microscopy analysis, rats were perfused with 4% formaldehyde (freshly made from paraformaldehyde) in 0.1 m phosphate buffer, ph 7.2. the brain was removed and fixed for 2 additional hours in the same solution at 4c. then, sections were embedded in durcupan acm resin. after removing the brain from the skull, it was postfixed in the same fixative during 2 h. coronal or sagital sections (5080 m) were made with a vibratome (leica). some of these sections were stained with cresyl violet according to the procedures described in capani.. vibratome sections were washed with 50 mm glycine - pbs containing 0.5% cold water fish gelatin to block nonspecific binding. following 30 min of washing, the sections were incubated on a shaker, in a solution of 0.05% of eosin phalloidin-0.5% cold - water fish gelatin/50 mm glycine - pbs for 2 h at 4c. for light microscopic studies, phalloidin conjugated to alexa was also used because of its superior fluorescent quantum yield compared to eosin. as a negative control, tissue sections stained with eosin - phalloidin were mounted on glass - welled tissue culture dishes (mat tek corp) pretreated with polyethylenimine. the slices were fixed again for 25 min with 2% glutaraldehyde in 0.1 m cacodylate buffer, rinsed in buffer for several minutes, and placed in 50 mm glycine and potassium cyanide in cacodylate buffer for an additional 5 min to reduce nonspecific staining. photooxidation was performed on the zeiss axiovert described above, equipped with a 75-w xenon arc light source. the samples were immersed in a solution of 2.8 mm diaminobenzidine in 0.1 m sodium cacodylate at 4c bubbled with pure o2, final ph 7.4, and then irradiated under conventional epifluorescence using a xenon lamp. after 68 min, a brownish reaction product began to appear in place of the fluorescence. following photooxidation, tissue sections were rinsed in 0.1 m sodium cacodylate several times and incubated for 30 min with 1% osmium tetroxide in 0.1 m sodium cacodylate, ph 7.2. after several washes in double - distilled h2o, the sections were dehydrated in an ascending ethanol series, flat - embedded in durcopan acm resin, and polymerized for 24 h at 60c. serial thin sections (80100 nm) were cut with reichert ultracut e ultramicrotome using glass knives and examined using a jeol 100cx electron microscope at 80100 kev. one set of thin sections was poststained with a combination of uranyl acetate and lead citrate. for e - pta staining, sections were dehydrated in an ascending series of ethanol to 100% and stained for 1 h with 1% pta stained prepared by dissolving 0.1 g of pta in 10 ml of 100% ethanol and adding four drops of 95% ethanol. the volume fraction of immunoreactive material for phalloidin was estimated using the point - counting method of weibel and a grid delimiting 5000 m in the hippocampus. percentage of reactive area was estimated using image j program (image j 1.41, nih, usa). for electron microscopy analysis sampling, all of the synapses that have the characteristic of mushrooms dendritic spines (head larger than the neck) were used in this study since mushrooms dendritic spines are the unique f - actin positive spines. random fields of neuropil containing at least one synapse were photographed at 10000x magnification and analyzed at a total magnification of 30000x. ca1 hippocampal specimens were selected for quantitative analyses based on the quality of e - pta staining and the degree of ultrastructural preservation, as determined from conventionally stained material from the same animals. samples were analyzed from controls (n = 4) and 19 min pa animals (n = 8). tissue sections were cut at thickness of 100 nm and examined and photographed at 80 kev at a magnification of 8300x with a zeiss 109 electron microscope. for each animal, five micrographs were obtained from hippocampus. as described above, each negative was digitized into a pc computer. using nih image 1.6, psds were first manually outlined, and then the maximal thickness, minimum thickness, length, and total area of each psd were determined. all synapses in which the postsynaptic density, intracleft line, and presynaptic grid were clearly visible were chosen for analysis. the selection criterion resulted in the analysis of between 30 and 50 psds per animal for each hippocampus. for analysis all of the synapses that have the characteristic of mushrooms type dendritic spines (head larger than the neck) were used in this study since mushrooms spines are the unique f - actin positive spines. random fields of neuropil containing at least one synapse were photographed at 10000x magnification and analyzed at a total magnification of 30000x. biochemical fractionation was performed as described previously by saraceno. using the whole dorsal hippocampus (ctl, n = 6 ; pa n = 6). dounce homogenates (h) of the pellets in ice cold tevp buffer (10 mm tris - hcl, ph 7.4, 5 mm naf, 1 mm na3vo4, 1 mm edta, and 1 mm egta, 1.25 g / ml pepstatin a, 10 g / ml leupeptin, 2.5 g / ml aproptionin, 0.5 mm pmsf) containing 320 mm sucrose were centrifuged at 1000 g to remove nuclei and large debris (p1). the supernatant (s1) was centrifuged at 10.000 g for 10 min to obtain a crude synaptosomal fraction (p2) and subsequently was lysed hypoosmotically and centrifuged at 45.000 g for 90 min to obtain a pellet of the synaptosomal membrane fraction (lp1). after each centrifugation, the resulting pellet was rinsed briefly with ice cold tevp buffer before subsequent fractioning to avoid possible crossover contamination. western blot analysis was carried out using lp1 fractions separated on 10% sds - page. samples containing 50 g of protein from each group were applied to each lane. after electrophoresis, proteins were transferred to polyvinylidene difluoride (pvdf) membrane as described previously [3638 ]. the membranes were incubated with a primary antibody anti--actin (sigma, 1 : 1000) overnight at 4c. then, after appropriate washing procedures, they were incubated with horseradish peroxidase - conjugated anti - mouse secondary antibody for 2 hours at room temperature. the films were scanned, and the optical density of protein bands was quantified using gel pro analyzer software 3.1.00.00 (media cybernetics, usa). we used glyceraldehyde-3-phosphate dehydrogenase (gapdh) as load controls [17, 3941 ]. statistical analyses were performed using the graphpad prism 5.03 for windows statistical package (graphpad software, inc, san diego, ca, usa). the study of nuclear morphology by cresyl violet staining showed that pa animals present clear nuclear condensation 4 months after injury respect to ctl animals in the stratum radiatum ca1 hippocampal area sections (figure 1). statistical analyses showed alterations in pyramidal neurons of hippocampal ca1 area, showing an abundance of pyknotic nuclei in asphyctic animals as compared to control animals (table 1). then, we employed neuronal nuclei (neun) immunolabeling to determine the nature of the cells presenting condensed nuclei (figure 1). statistical analyses showed no significant difference in the number of neun+ nuclei in the ca1 hippocampal area of asphyctic animals respect to controls. when we analyzed the cellular distribution of neun labeling, it was determinate that asphyctic animals showed a significant increase in the number of abnormal neun+ nuclei and a significant decrease in the number of normal neun+ nuclei in the ca1 hippocampal area compared with ctl group (table 1). to determine the morphology of these cells morphological analyses showed that most cells presenting condensed nuclei evidence dark cytoplasm with rare vacuoles and compaction, a hypertrophic nucleolus, a nucleus with a festoon shape, and a twisted nuclear envelope, corresponding to neurons in degeneration [25, 32, 42, 43 ] (figure 1). osmium - lead - citrated staining showed no obvious alterations in the stratum radiatum ca1 hippocampal area sections from 4-month - old ctl and pa rats (figure 2). presynaptic terminals, presynaptic vesicles, and ultrastructural organization of psd were intact (figure 2). on the other hand, e - pta immunostaining showed clear alterations in synapses of rats subjected to pa (figure 3). following pa, the thickness of psd increased as compared to controls (figure 3). there was also a general increment in the amount of e - pta - stained material in psd of pa animals compared to controls. t student analyses for the area and length of the psd and for the minimum and maximum thickness of the psd were significant (p < 0.05). post hoc tests revealed that the means of psd area was significantly bigger as compared to the ctl group (p < 0.01) (table 2). these inconsistencies between the osmium and e - pta staining may be attributable to the fact that general heavy metal staining obscures the synaptic modifications occurring in post asphyctic tissue. in addition, it is possible that e - pta stains different components in the psd than osmium - uranium - lead methods. it has been known that psds stained with e - pta are shorter and probably wider than those stained with the osmium - heavy metal method. e - pta preferentially stains protein(s) rich in basic amino acid residues, including lysine, arginine, and histidine, such as collagen or histones. in contrast, conventional heavy metal staining stains a wide type of lipids and cytoskeletal and cytoplasmic elements. since both markers stain different components, this might explain why e - pta staining is more effective to detect the psds alterations than heavy metal - stained sections. consistent with other studies in different models of ischemia [27, 33, 43 ] and using this long - term pa model, we did not observe any alterations in the subcellular organization of hippocampus material stained with osmium - heavy metals. however, we observed a marked increase in e - pta - stained material in subsevere pa. although not too much data is available about the mechanism of cell death during pa [25, 30 ], these findings suggest that the increased in the thickness could be related with the degradation of abnormal proteins probably before neurons trigger death mechanisms. thus, we hypothesize that some early signals triggered in psds could induce late neuronal alterations in post asphyctic hippocampal tissue. since we and others demonstrated that e - pta - stained aggregates could be composed of abnormal protein [25, 33, 46 ], we performed immunoelectron microscopy following the procedures previously described by capani. in order to detect ubiquitin (figure 4). we observed ubiquitinated synaptic proteins after 19 min of pa in the stratum radiatum ca1 hippocampal area sections, while negative controls, in which the primary antibody was omitted, did not show immunolabeling (data not shown). taking these results into account, we could suggest that aggregates of ubi - proteins are present in psds of asphyctic animals, as it was observed in some neurodegenerative diseases. even though data about cell death mechanisms during pa are scarce [25, 30 ], these findings suggest that psd thickening could be related to degradation of abnormal proteins, probably before cell death mechanisms are triggered in neurons. consistent with this view, persistent ubiquitination was found in the psd of hippocampal neurons [46, 48 ] after transient cerebral ischemia, which suggests that increased ubi - protein conjugates might produce protein damage. in addition, damage in protein can be produced by the increment in ros production and calpain activation as consequence of a rise in ca levels after hypoxic - ischemic insult [1, 49, 50 ]. on the other hand, while other heat shock proteins reversibly attach to denatured proteins and help to refold or reassemble them, ubiquitin - conjugated proteins are degraded by 26 s proteasome. pa insult activates the ubiquitin pathway, which might affect neuronal survival by damaged protein accumulation. since neurons do not have the capacity to remove it, ubi - protein accumulation leads neurons to death. brain hypoxia - ischemia triggers an early increment of glutamate in the extracellular space at synaptic level. high levels of glutamate produce a cascade of events in dendritic spines that lead to cell death [25, 31, 33, 43, 48, 5255 ]. since structure and function of dendritic spines are dynamically regulated by different cellular pathways acting on the actin cytoskeleton, we used light and electron microscopic techniques that had previously been used in our laboratory [1, 56 ] and others [4, 8 ] to study f - actin modifications induced by pa. by confocal microscope analyses, we observed dendritic spines represented by punctate staining using phalloidin - alexa. pa animals showed a decrease in punctate staining respect to ctl group (figure 5 top) (p < 0.01). is mostly concentrated in mushroom dendritic spines, this decrement is tightly related with the f - actin contained in the dendritic spines. when we analyzed different dendritic spine populations, we observed that only the number of mushroom dendritic spines, the only f - actin - positive spines in control animals, showed a significant decrease after 19 min of pa (p < 0.05) (figure 5 bottom). in contrast, synapses did not show any sign of evident degeneration in asphyxic rats. isolated synaptosome (lp1) fractions were analyzed by immunoblotting using anti--actin antibody and quantified (figures 5 and 6). statistical analysis showed no significant differences in mean optical densities of f - actin bands (p = n.s.) from pa and control group. however, pa animals showed a decrease in amount of -actin with respect to ctl animals (p = 0,058). both in vivo and in vitro studies showed high concentration of -actin in dendritic spines are involved in the organization of the synapses in adult brains [5760 ]. although we observed a reduction of the number of spines f - actin positive in pa animals, the maintenance of -actin concentration observed in synaptosomal fraction may represent the cytoskeletal support of a stable dendritic spines structure that maintains, thus, the potential morphological plasticity in circumstances where adaptive changes in synaptic connectivity are adequate. consistent with this point of view, disruption of receptor - scaffold proteins as nmdar - psd 95, which depends on actin polymerization interactions, can prevent cell death after ischemia. several studies using different models of neuronal cell death have demonstrated that endogenous gelsolin 's antiapoptotic properties correlated to its dynamic actions in the cytoskeleton. gelsolin - null neurons have higher rates of cell death and a rapid and sustained elevation of ca levels following glucose / oxygen deprivation, as well as augmented cytosolic ca levels in nerve terminals following in vitro depolarization. furthermore, the increment in histone acetylation induces upregulation of gelsolin, dramatically reducing the levels of actin filaments and cell death following cerebral ischemia in mice. has shown that actin depolymerization prevents neuronal death, we hypothesize that the decrease in -actin in synaptosomal fraction could also be related with cell death observed after pa insult, as this process is connected with an abnormal ubi - protein increment. in addition, our group has previously observed learning ; reference and working spatial memory impairments in the morris water maze in 3-months - old rat, subjected to acute asphyxia immediately after birth, using the hypoxic - ischemia model described in the present manuscript. it is well known that the performance in these spatial tests is disrupted after hippocampal damage. therefore, synaptic modifications observed in asphyctic animals could be related with behavioral deficits previously described by our group. these findings suggest that excessive protein ubiquitination in hippocampal psd, 4 months after a subsevere pa insult, seems to be related to the increment in protein accumulation in this area. in spite of this increment, we observed a decrease in -actin which suggests that pa is damaging the actin cytoskeleton. moreover, the amount of -actin in pa animals is correlated with the decrement in the number of mushroom - shaped dendritic spines. although further studies will be necessary to determine the role of ubi - protein accumulation in psd, we could speculate that psd alterations might be involved in the generation of an aberrant biochemical pathway leading to long - term modifications in the brain of pa animals, as we described in a previous paper. in agreement with this point of view, alzheimer 's disease has a deleterious action on the actin cytoskeleton linked with psd, leading to dendritic spine dysfunction and synaptic degeneration. | perinatal asphyxia (pa) affects the synaptic function and morphological organization. in previous works, we have shown neuronal and synaptic changes in rat neostriatum subjected to hypoxia leading to long - term ubi - protein accumulation. since f - actin is highly concentrated in dendritic spines, modifications in its organization could be related with alterations induced by hypoxia in the central nervous system (cns). in the present study, we investigate the effects of pa on the actin cytoskeleton of hippocampal postsynaptic densities (psd) in 4-month - old rats. psd showed an increment in their thickness and in the level of ubiquitination. correlative fluorescence - electron microscopy photooxidation showed a decrease in the number of f - actin - stained spines in hippocampal excitatory synapses subjected to pa. although western blot analysis also showed a slight decrease in -actin in psd in pa animals, the difference was not significant. taken together, this data suggests that long - term actin cytoskeleton might have role in psd alterations which would be a spread phenomenon induced by pa. |
the ovary itself is a highly vascularized organ but vascular tumors of the female genital tract, especially those arising in the ovary, are very rare, not exceeding 60. these neoplasms have been reported in different ages ranging from infancy to 81 years.though most of these lesions are small and detected only incidentally during an operation or autopsy, a few of them can be large and present with abdominal pain and ascites. the aim of this article is to emphasize on a rare occurrence with its clinicopathological features and differential diagnoses in view of the recent literature. a 22 year - old woman presented with an acute onset of lower abdominal pain of 2 days duration. on bimanual pelvic examination, a right adnexal mass was palpated. ultrasonography revealed a right ovarian solid mass measuring 4.5 cm 3.8 cm 3 cm with a low - resistant vascular flow pattern on doppler examination. an adnexal mass, identified on ultra - sound, was explored through a lower midline incision which revealed a solid hemorrhagic mass in the right ovary. macroscopically, the outer surface of the mass was smooth and glistening with a grayish white to purplish tint. 1) due to multioculated cystic spaces filled with frank blood. microscopically, most of the ovary was replaced by numerous dilated thin walled vascular channels, of variable size and configuration (fig. thrombi were noted but there was no necrosis. a follicle cyst and a corpus luteum were also present. the diagnosis of primary ovarian haemangioma, a benign vascular tumor was made. immunohistochemistry, revealed cd 31 & cd 34 positivity of the cells lining the lumina, confirming their vascular nature (fig. haemangiomas are benign vascular tumors arising from failure in vascular formation, particularly in the canalizing process, forming abnormal vascular channels. the difference between these two types relate to the size of the blood vessels formed. vascular tumors of the female genital tract, especially those of the ovary, are very rare. cyclic changes in the female genital organs during the reproductive period and the asymptomatic nature and small size of the neoplasm have been attributed to explain its rarity of occurrence. although the exact number of ovarian haemangiomas is disputed, the number of well documented cases seems to be 50 or more but does not exceed 60. large lesions tend to present clinically as adnexal mass, frequently associated with lower abdominal pain, nausea and vomiting, due to torsion or abdominal distension because of the mass itself. only a few of the ovarian haemangiomas have been reported to be associated with massive ascites and elevated serum ca-125 levels clinically mimicking an ovarian carcinoma. preoperative doppler examination of such a lesion may show a low - resistant vascular flow pattern, supporting malignant neoplasia of the ovary. pseudo - meigs syndrome, stromal luteinization, stromal hyperplasia, and thrombocytopenia have also been reported as complications of ovarian haemangioma. the decreased platelet count is regarded as one of the manifestations of kasabach and merritt syndrome, particularly in bilateral cases associated with diffuse abdominopelvic haemangiomatosis. coexistence of non - ovarian neoplasms such as endometrial carcinoma, cervical carcinoma, rectosigmoid carcinoma, and tubal carcinoma has also been reported. although the etiology remains unknown, these lesions have been considered either hamartomatous malformations or true neoplasms in which pregnancy, other hormonal effects, or infection have been implicated as factors, enhancing the growth. it has been suggested that the hyperestrogenism caused by pre - existing stromal luteinization of ovaries may stimulate the development of an ovarian haemangioma due to the growth stimulatory effects of estrogens on vessels and expression of estrogen receptors by haemangiomas. according to another hypothesis, the presence of an expansile ovarian hemangioma induces stromal luteinization by mass effect. these luteinized stromal cells produce androgens, which are subsequently converted to estrogens in adipose tissue, potentially causing unopposed estrogenic stimulation to the endometrium which may present as postmenopausal or dysfunctional uterine bleeding, aching breasts, advanced male type hair loss, and elevated androgen and estradiol levels. macroscopically, ovarian haemangiomas are usually small with size ranging from 5 mm to 24 cm in its greatest diameter. although they may be encountered in any part of the ovary, the medulla and hilum appear to be the most common sites. histologically, they demonstrate either a cavernous, capillary, or mixed type with the cavernous type predominating, as in the present case, in contrast to haemangiomas in other parts of the body. microscopically, they are composed of dilated, blood - filled, generally thin - walled vessels ranging from small to large size, lined by a single layer of flattened endothelial cells. the vessels may be haphazardly located or display a roughly lobular arrangement in a variable amount of connective tissue stroma in which inflammation, hemorrhage and hemosiderin deposits, can be detected. extensive punctate calcification in cavernous haemangioma was reported by kim.the present tumor was devoid of calcification probably because of early presentation and surgery. sometimes both preoperative findings and intra - operative structures can be confusing. thus to avoid unnecessary radical surgery for a benign neoplasm, haemangioma should be kept in mind as a differential diagnosis of an ovarian mass before surgery. while the clinical differential diagnoses of ovarian haemangiomas include tubo - ovarian mass, twisted ovarian cyst, and chocolate cyst, the main pathological differential diagnoses are those of vascular proliferations, lymphangioma, and monodermal teratoma composed of a prominent vascular component. haemangioma in the ovary must be differentiated from proliferations of dilated blood vessels of the ovarian hilar region. to define the lesion as a true hemangioma, a mass of vascular channels with minimal amounts of stroma should form a reasonably circumscribed lesion distinct from the remainder of the ovary. one of the main characteristics of these vessels is that they may be calcified or have thickened walls and narrowed lumina due to medial deposition of a hyaline, amyloid - like material. lymphangioma, which was considered in the differential diagnosis of this case because of a similar morphological appearance, was excluded due to the absence of pale eosinophilic homogeneous material within the vascular channels. one of the controversial issues regarding the differential diagnosis involves distinguishing a monodermalteratoma having an angiomatous component from a pure haemangioma. although vascular elements are not generally a component of ovarian teratomas, bilateral ovarian teratomas with a large hemangiomatosis component have been reported in which the lesions were distinguished from a pure hemangioma by the presence of a focus of respiratory epithelium. haemangiomas of the ovary are very rare neoplasms with a wide age range and incidental discovery during operation or autopsy. the risk of kasabach and merritt coagulopathy has to be considered in larger tumors, thus necessitating correct diagnosis and definitive surgical treatment. there is no conflict of interest related to the work among the authors in this study.\ the source of funding was institutional funds of drs tribedi & roy diagnostics laboratory, kolkata. written informed consent was obtained from the patient for publication of this case report and accompanying images. bm, ss ; arq & sr performed the histological examination and prepared the manuscript. arq & sr have supervised all the work and final correction of the manuscript done by them. | introductionhaemangioma of ovary is a rare tumour.presentation of casewe report an ovarian haemangioma which presented as an acute abdomen due to an adnexal mass.discussionwe report an ovarian haemangioma which presented as an acute abdomen due to an adnexal mass. haemangiomas have been reported in other organs but ovarian haemangioma is a rare tumor, usually asymptomatic and presenting as an incidental finding. large lesions tend to present clinically with pain. a few cases have been described in the literature.conclusionconsidering their rare occurrence such tumors are a diagnostic challenge. |
pneumoconiosis is a chronic pulmonary disease caused by the accumulation of small (0.5- to 5-um) dusts in the lungs, which leads to inflammation and fibrosis in the air sacs. the function of the lungs worsens with the disease progress, and the patients show dyspnea, coughing, sputum, and chest pains. in particular, coal workers pneumoconiosis has a higher risk of complications than normal pneumoconiosis, and the patients have dyspnea when the symptoms are severe. its onset date is about 10 yr after the first exposure to coal dust, and as such, more than 50% of the patients are over 60 yr old (korean occupational safety and health agency, 2011). the decreased activities due to decreased breathing function weaken the respiratory muscles and worsen dyspnea (bauer., 2007 ; sirajuddin and kanne, 2009).the patients feel anxious about experiencing shortage of breath while engaging in physical activities, which limits their daily activities (leidy and haase, 1996). the rehabilitation program for patients with respiratory disease aims to decrease the symptoms, increase the patients participation in daily as well as mental and social activities, and to eventually improve the quality of life of patients with chronic respiratory disease (kim and kang, 2006). in this study, the previous studies on respiratory rehabilitation programs (han, 2003 ; kim and kang, 2006 ; no., 2009) various rehabilitation programs developed from many studies have been applied, but a standardized exercise program for chronic lung disease patients has yet to be established. the most important part of respiratory rehabilitation is aerobic exercise (kim, 2003), and the typical aerobic exercise is walking. walking is a systemic exercise, and most daily activities involve walking. as such, it is considered a suitable exercise for elderly people. the american thoracic society (ats, 1995) reported that the ultimate goal of the nursing and treatment of chronic lung disease is to help patients actively lead the management of their own health to prevent complications, minimize symptoms, and maintain their body functions at the optimal levels for carrying out daily activities under the given circumstances. the six - minute walking test is suggested as a useful test for evaluating the treatment efficacy by assessing the pulmonary function and exercise ability of patients with pulmonary disease (ats, 2002). the test involves the measurement of the walking distance covered by a patient for a certain period of time, with an adjustable walking speed. as the test involves a similar amount of exercise during daily activities, it can directly reflect the lung functions and exercise abilities of patients while carrying out daily activities. it does not require special equipment and is simple, safe, and has high reproducibility (stark., 1982). the six - minute walking test was reported to have higher sensitivity in measuring the symptoms of dyspnea in chronic obstructive pulmonary disease (copd) than the lung function test or arterial blood gas analysis (lee., 1992). based on the investigators clinical experience in the pulmonology department, it was found that the patients with chronic pulmonary diseases such as pneumoconiosis feel financially burdened by the respiratory rehabilitation program due to their long - term hospitalization for treatment, and also have difficulty applying the respiratory rehabilitation and exercise program to their daily activities. as the respiratory rehabilitation and exercise program for chronic pulmonary disease patients needs to be applied for a long time for long - term efficacy, the patients should be able to easily perform the exercise without assistance from trained staff or the use of special equipment in a comfortable environment. this study was conducted to prove the efficacy of the six - minute walking exercise on dyspnea and the ability to perform daily activities through a six - minute walking test that subjectively evaluates dyspnea and exercise ability with self - adjusting exercise intensity based on the patient s physical ability. also, it aimed to investigate the nursing intervention for patients with pneumoconiosis through walking exercise by motivating patients to exercise and by improving their confidence. the design of this study was a time series with a non - equivalent control group quasi - experimental design to analyze the efficacy of six - minute walking on dyspnea and daily activity performance in patients with pneumoconiosis. the study subjects were over-60-year - old male pneumoconiosis w hospital (in gyeonggi - do) inpatients from september 30 to december 6, 2013. the detailed inclusion / exclusion criteria are as follows : patients who understood the purpose of this study and who agreed to participate in it ; with pneumoconiosis and were considered eligible to perform the program based on the investigator s judgment ; whose medications for pneumoconiosis or hypertension had not changed for the last one month ; without severe heart disease, cerebrovascular disease, cancer, orthopedic, or neuro - psychological disease ; and who had not done regular exercise for the last one month. the sample size of this study was determined to be 39 subjects for each group based on the gpower 3.0 program (faul., 2007), with a 0.5 effect size, 0.7 statistical power, and 0.05 significance level. forty subjects were originally enrolled for each group (40 for the experimental group and 40 for the control group, for a total of 80), but one subject in the experimental group was withdrawn from the study due to hospital discharge, and one subject in the control group was withdrawn due to symptom aggravation. as such, 39 subjects in each group were able to complete the study. to prevent the subjects from each group from sharing information with those in the other group, the subjects were hospitalized in different wards, and the subjects in the experimental group were given an explanation about the study results. a six - minute walking exercise is an exercise using a six - minute walking test. the six - minute walking test is described in the ats guideline (2002) as involving walking on 30-meter hospital floors where every 3 meters are marked. the walking is self - paced, and the patients are allowed to take a break as required. the subjects wait at the starting line and are asked to walk the 30-meter distance back and forth at their fastest speed, starting with the signal. for the subjective evaluation of dyspnea in this study, the anxiety about dyspnea during the exercise was scored on a scale of 1 (no anxiety) to 5 (very severe anxiety). the higher the score was, the greater the anxiety about dyspnea during the exercise. the degree of dyspnea after the exercise was scored on a scale of 0 (no shortness of breath) to 10 (severe shortness of breath) using a 12-level modified borg scale (borg, 1982). the shortness of breath for the last two weeks was evaluated by the subject using the borg scale dyspnea index, and the higher score was, the more severe the dyspnea. the pulmonary function, which involves pulmonary expansion, was used in this study as an objective indicator of the disease severity as a volume / time relationship using the pulmonary volume, functional capacity, and resistance in the trachea. a trained examiner used a pulmonary test device (vmax-22+v62j, sensormedics, usa) to measure the fev1% prediction (pred.) and fev1/fvc%, of the pulmonary function indicators. was considered mild or stage i ; 3549%, stage ii ; and 34% or less, stage iii. for the activities of daily living (adl), the modified chronic respiratory disease questionnaire (guyatt., 1987) formulated by han (2003), consisting of 23 questions, was used for this study. each question in the questionnaire was scored on a scale of 1 (can not be performed) to 5 (not difficult to perform). the higher the score was, the more the subject could independently perform the daily activity. approval for this study was obtained from the institutional review board (irb) of g university hospital (gbirb2013 - 161) and from the medical team, physicians, nursing department, and head nurse of the wards in w hospital, and support for the study was obtained from the nurse team in the wards. two nurses in the ward were trained about the purpose of the study method before the data collection and were involved in the data collection, along with the investigator. the investigator visited the patients rooms in person to explain the study purpose and necessity as well as the confidentiality of the patients information, and a signed informed - consent form was obtained from each subject. the data that were required to be collected before the test were obtained by the investigator a day before the walking test. the questionnaire was explained to the subjects, and the anxiety about the breathing difficulties that occurred during the exercise, the symptoms and severity of the dyspnea for the last two weeks, and the daily activities were evaluated by the subjects themselves. the experimental group was trained about the preparation exercise before the test, the six - minute walking exercise, and the finishing - up exercise. the subjects in the experimental group underwent pulse and blood pressure measurement before the walking exercise. if a subject showed any abnormal finding in the measurement, they were controlled before the exercise. to minimize the effect of the activities undertaken prior to the test, the subjects were asked to rest for more than 10 min before the test. for the preparation exercise, free gymnastics, stretching, and light walking were freely performed for five minutes, and six - minute walking exercise was likewise performed. for the finishing exercise, two sets of pursed - lip breathing (10 times per set) were carried out to regulate the breathing, and then free gymnastics, stretching, and walking slowly were freely performed for five minutes. the preparation to the finishing - up exercises took about 20 min. the experimental group was asked to perform the exercise series once a day (at around the same time) three times a week for 10 weeks. the distance of the six - minute walking exercise was recorded in the log - book. the post - investigation data were collected from the experimental and control groups 10 weeks after the initiation of the experiment. the experimental group was advised about the six - minute walking method and was informed of the study results after 10 weeks. the general characteristics of the subjects were presented as frequency, percentage, mean, and standard deviation. the homogeneity of the general characteristics of the experimental and control groups was analyzed using a -test and an independent t - test (table 1), and the homogeneity of the subjective dyspnea (anxiety about breathing difficulties, mbs), adl, and pulmonary function test (pft) of the experimental and control groups was analyzed using an independent t - test (table 2). the differences in subjective dyspnea, adl, and pft between the experimental and control groups were also analyzed using an independent t - test. the design of this study was a time series with a non - equivalent control group quasi - experimental design to analyze the efficacy of six - minute walking on dyspnea and daily activity performance in patients with pneumoconiosis. the study subjects were over-60-year - old male pneumoconiosis w hospital (in gyeonggi - do) inpatients from september 30 to december 6, 2013. the detailed inclusion / exclusion criteria are as follows : patients who understood the purpose of this study and who agreed to participate in it ; with pneumoconiosis and were considered eligible to perform the program based on the investigator s judgment ; whose medications for pneumoconiosis or hypertension had not changed for the last one month ; without severe heart disease, cerebrovascular disease, cancer, orthopedic, or neuro - psychological disease ; and who had not done regular exercise for the last one month. the sample size of this study was determined to be 39 subjects for each group based on the gpower 3.0 program (faul., 2007), with a 0.5 effect size, 0.7 statistical power, and 0.05 significance level. forty subjects were originally enrolled for each group (40 for the experimental group and 40 for the control group, for a total of 80), but one subject in the experimental group was withdrawn from the study due to hospital discharge, and one subject in the control group was withdrawn due to symptom aggravation. as such, 39 subjects in each group were able to complete the study. to prevent the subjects from each group from sharing information with those in the other group, the subjects were hospitalized in different wards, and the subjects in the experimental group were given an explanation about the study results. a six - minute walking exercise is an exercise using a six - minute walking test. the six - minute walking test is described in the ats guideline (2002) as involving walking on 30-meter hospital floors where every 3 meters are marked. the walking is self - paced, and the patients are allowed to take a break as required. the subjects wait at the starting line and are asked to walk the 30-meter distance back and forth at their fastest speed, starting with the signal. for the subjective evaluation of dyspnea in this study, the anxiety about dyspnea during the exercise was scored on a scale of 1 (no anxiety) to 5 (very severe anxiety). the higher the score was, the greater the anxiety about dyspnea during the exercise. the degree of dyspnea after the exercise was scored on a scale of 0 (no shortness of breath) to 10 (severe shortness of breath) using a 12-level modified borg scale (borg, 1982). the shortness of breath for the last two weeks was evaluated by the subject using the borg scale dyspnea index, and the higher score was, the more severe the dyspnea. the pulmonary function, which involves pulmonary expansion, was used in this study as an objective indicator of the disease severity as a volume / time relationship using the pulmonary volume, functional capacity, and resistance in the trachea. a trained examiner used a pulmonary test device (vmax-22+v62j, sensormedics, usa) to measure the fev1% prediction (pred.) and fev1/fvc%, of the pulmonary function indicators. was considered mild or stage i ; 3549%, stage ii ; and 34% or less, stage iii. for the activities of daily living (adl), the modified chronic respiratory disease questionnaire (guyatt., 1987) formulated by han (2003), consisting of 23 questions, was used for this study. each question in the questionnaire was scored on a scale of 1 (can not be performed) to 5 (not difficult to perform). the higher the score was, the more the subject could independently perform the daily activity. approval for this study was obtained from the institutional review board (irb) of g university hospital (gbirb2013 - 161) and from the medical team, physicians, nursing department, and head nurse of the wards in w hospital, and support for the study was obtained from the nurse team in the wards. two nurses in the ward were trained about the purpose of the study method before the data collection and were involved in the data collection, along with the investigator. the investigator visited the patients rooms in person to explain the study purpose and necessity as well as the confidentiality of the patients information, and a signed informed - consent form was obtained from each subject. the data that were required to be collected before the test were obtained by the investigator a day before the walking test. the questionnaire was explained to the subjects, and the anxiety about the breathing difficulties that occurred during the exercise, the symptoms and severity of the dyspnea for the last two weeks, and the daily activities were evaluated by the subjects themselves. the experimental group was trained about the preparation exercise before the test, the six - minute walking exercise, and the finishing - up exercise. the subjects in the experimental group underwent pulse and blood pressure measurement before the walking exercise. if a subject showed any abnormal finding in the measurement, they were controlled before the exercise. to minimize the effect of the activities undertaken prior to the test, the subjects were asked to rest for more than 10 min before the test. for the preparation exercise, free gymnastics, stretching, and light walking were freely performed for five minutes, and six - minute walking exercise was likewise performed. for the finishing exercise, two sets of pursed - lip breathing (10 times per set) were carried out to regulate the breathing, and then free gymnastics, stretching, and walking slowly were freely performed for five minutes. the preparation to the finishing - up exercises took about 20 min. the experimental group was asked to perform the exercise series once a day (at around the same time) three times a week for 10 weeks. the distance of the six - minute walking exercise was recorded in the log - book. the post - investigation data were collected from the experimental and control groups 10 weeks after the initiation of the experiment. the experimental group was advised about the six - minute walking method and was informed of the study results after 10 weeks. the general characteristics of the subjects were presented as frequency, percentage, mean, and standard deviation. the homogeneity of the general characteristics of the experimental and control groups was analyzed using a -test and an independent t - test (table 1), and the homogeneity of the subjective dyspnea (anxiety about breathing difficulties, mbs), adl, and pulmonary function test (pft) of the experimental and control groups was analyzed using an independent t - test (table 2). the differences in subjective dyspnea, adl, and pft between the experimental and control groups were also analyzed using an independent t - test. the difference in the change in the score of anxiety about breathing difficulties during exercise between the experimental group, which performed the six - minute walking exercise, and the control group, which did not perform the six - minute walking exercise, was analyzed. the score of the experimental group decreased from 2.89 to 2.69 while that of the control group increased from 2.92 to 3.15, which were statistically significant differences (p<0.05) (table 3). with regard to the difference in the change in the mbs between the experimental and control groups, the score of the experimental group decreased from 3.05 to 2.54 while that of the control group decreased from 2.87 to 2.82, showing a statistically significant difference (p<0.05) (table 3). as for the difference in the change in the pulmonary function test results between the experimental and control groups, which - was analyzed using the forced expiratory volume for 1-second prediction (fev1% pred.), the forced vital capacity of prediction (fvc% pred.), and the fev1% pred,, the ratio between fvc and fev1, the fev1% pred. result showed an increase from 65.79 to 68.69% in the experimental group and from 65.51 to 65.77% in the control group, which were not statistically significantly differences (t=0.05, p=0.958) (table 3). the ratio between the fvc and fev1 (fvc / fev1) results showed increases from 81.33 to 83.77% in the experimental group and from 80.15 to 81.18% in the control group, with a statistically insignificant difference (table 3). for the difference in the change in adl between the experimental and control groups, the analysis results showed increases from 61.46 to 64.49 in the experimental group and from 61.46 to 61.51 in the control group, showing a statistically significant difference (p<0.05) (table 3). the ultimate goal of the nursing and treatment of patients with chronic pulmonary disease is to help the patients actively manage their health to minimize the symptoms, prevent complications, and maintain their functions for daily activities under the given circumstances. the copd patients in all stages can increase their functions for physical activities through the exercise program, can attain partial respiratory rehabilitation, and can relieve their symptoms, including dyspnea and fatigue, but a standardized program has yet to be established. as such, the efficacy of six - minute walking exercise on dyspnea and adl were investigated in this study, and the results are as follows. the anxiety about breathing difficulties during the exercise significantly decreased in the subjects who performed the six - minute walking exercise. oh (2003) also reported that the psychological symptoms, such as insecurity and anxiety, showed significant improvement compared to the physical symptoms in patients with copd after two weeks of respiratory rehabilitation, which is in agreement with the results of this study. the subjects of this study were elderly patients with pneumoconiosis and who were isolated from their family and from the society due to their long - term hospitalization. as such, the training and support from the nurses for the walking exercise seemed to help decrease their anxiety about breathing difficulties during the exercise. also, the continuous walking exercise, three times a week for 10 weeks, was considered helpful in building up their confidence about exercise, which eventually led to a decrease in their anxiety about dyspnea. oh (2003) reported that the physical symptoms experienced by most copd patients are dyspnea, fatigue, and sleep disturbance, and that their psychological symptoms included insecurity, lethargy / despair, and anxiety. the previous studies (kim and kang, 2006) emphasized the importance of psychological intervention for relieving dyspnea. leidy and haase (1996) reported that copd patients have anxiety about breathing difficulties when carrying out physical activities, which limits their daily activities. as such, reliving anxieties through respiratory rehabilitation programs such as an exercise program is considered very important as it affects the quality of life associated with adl in patients with pneumoconiosis. the mbs of the subjects who performed a six - minute exercise significantly decreased compared to that of the subjects who did not perform such exercise. this result is in agreement with the results of the previous studies (han, 2003 ; kim, 2001), which reported improved dyspnea after the application of an exercise program as a part of the respiratory rehabilitation program for copd patients. american college of chest physicians / american association of cardiovascular and pulmonary rehabilitation (accp / aacvpr, 1997) also reported that a respiratory rehabilitation program significantly improved dyspnea during exercise and daily activities, and that training with exercise helped more in maintaining the efficacy of decreased dyspnea. the previous studies used different tools, however, to measure the patients dyspnea. as such, further studies using an assessment tool that includes comprehensive symptoms such as other respiratory symptoms apart from dyspnea, adl, sleep, and confidence, such as the copd assessment test (cat) dose, are being considered to be performed in the future. the six - minute walking exercise did not affect the subjects fev1% pred. and fev1/fvc% as such results did not show a significant difference. this result is in agreement with the results of the previous studies (haave., 2008 ;) that investigated the change in the pulmonary function after aerobic and cardio exercises in copd patients and reported no change in the fev1% pred. and fev1/fvc% results. (2005) reported that the pulmonary function is not a good indicator for dyspnea as no significant relationship between the dyspnea and pulmonary function results was found in their study. results after exercise. the poor results of their studies were attributed to the short study period (between 4 and 24 weeks) and to the non - consistent exercise types, including aerobic and upper / lower - limb cardio exercises, because it is difficult to recover the pulmonary function that has degenerated for a long time within a few weeks or months. jang and kim (2006) recommended consistent exercise as it can slow down the progression of pulmonary function degeneration and can bring about positive effects even if the exercise can not bring the function back to normal. the subjects who performed the six - minute walking exercise showed significant improvements in adl compared to those who did not perform the exercise. this result is in agreement with that of the study conducted by han (2003), which reported improved adl after the implementation of the respiratory rehabilitation program, and with the study conducted by chen. (2011), which reported a higher activities - of - daily - living score after one year of exercise in serious copd patients. as such (1996) reported that decreased adl is associated with dyspnea or fatigue in copd patients, and suggested that the use of an intervention for dyspnea can effectively improve adl. (2009) on adl based on the subject s symptoms reported that the patients who experienced severer dyspnea showed more decreased adl, which explains the correlation between dyspnea and adl. this study also showed that walking exercise decreased the index of dyspnea and increased adl, which proved that walking exercise can be easily performed anytime during the conduct of daily activities by pneumoconiosis patients. also, it was confirmed that the six - minute walking test has a significant meaning as a test method for nursing and exercise intervention in chronic pulmonary disease patients. as such, this study confirmed that the six - minute walking exercise can decrease the anxiety about breathing difficulties during the exercise, can lower the dyspnea index after the exercise, and can improve adl in pneumoconiosis patients. the six - minute walking exercise is expected to be used as a nursing intervention for the respiratory rehabilitation of pneumoconiosis patients. this study was conducted to investigate the effect of the six - minute walking exercise through the six - minute walking test on subjective dyspnea and adl in pneumoconiosis patients aged 60 years or more, and to provide basic data for nursing intervention for such patients. the study results showed that the six - minute walking exercise decreased the pneumoconiosis patient subjects anxiety about breathing difficulties during the exercise and lowered the dyspnea index after the exercise, which eventually improved adl in the subjects. as such, this six - minute walking exercise was considered an easily applicable exercise with a minimum cost for respiratory rehabilitation, and was regarded as capable of reducing the burden of exercise on the patients as it involves a similar amount of exercise as the daily activities, thus motivating the patients and improving their confidence about exercise. the six - minute walking exercise is expected to be used as a nursing intervention for the respiratory rehabilitation of pneumoconiosis patients. | the purpose of this study was to examine the effects of walking exercise through a 6-min walking test on subjective dyspnea, pulmonary function test, arterial blood gas analysis, and activities of daily living to provide base data for the nursing intervention of pneumoconiosis patients. the subjects were pneumoconiosis patients men aged over 60. this quasi - experimental study was designed with a non - equivalent control group pre- and post - test design, and the study period was september to december 2013. of the pneumoconiosis inpatient subjects, 39 were assigned to the experimental group and the 39 to the control group. only the experimental group was subjected to a 6-min walking test three times a week for 10 weeks. subjective dyspnea was measured based on anxiety about dyspnea during and after the exercise. fev1% prediction and fev1/fvc% were used to measure the pulmonary function. the arterial blood gas was measured based on the ph, pao2, paco2, and activities of daily living. the data were analyzed through an 2 and t - test. the study results showed that the 6-min walking test reduced the anxiety about dyspnea of the pneumoconiosis patients during the exercise, moderated the dyspnea index after the performance of the activities, and improved the patients ability to perform activities of daily living. thus, walking exercise seems to be an effective nursing intervention to maintain the respiratory rehabilitation outcomes by minimizing the pneumoconiosis patients burden. |
newtonian ideas helped us to understand solid matter and moving objects found in the earth 's gravitational field. einstein, however, through his renowned equation e = mc, determined that energy and matter are dual expressions of the same universal substance (1). a slowly vibrating substance is referred to as physical matter, whereas the subatomic (which vibrates at or above the speed of light) is subtle matter or pure light energy. light is electromagnetic radiation, which is the fluctuation of electric and magnetic fields in nature. more simply, light is energy, and the phenomenon of color is a product of the interaction of energy and matter. the wavelength, frequency and quantity of energy of every colorful ray are fixed for each color ; that is, a specific wavelength, a certain frequency and a particular amount of energy in that wave have been denominated as a distinct color. the human eye is sensitive to electromagnetic radiation only at wavelengths roughly between 380 and 780 nm. visible light can be broken down into numerous electromagnetic frequencies, and frequency relates to a color of the rainbow : red, orange, yellow, green, blue, indigo, violet and all the vibrations thereof. newtonian concepts, limited to the observable, have also been applied by contemporary medicine, which is premised on the idea that the total picture becomes predictable by understanding and regulating the various material parts. that is, when a part of the body malfunctions, it is removed or replaced in a similar way to how we handle machinery.. simply stated, contemporary medicine examines the symptoms and influences or suppresses them, but it does not involve itself with a real source diseased life energies. einstein 's approach deals with the human body not as an assemblage of chemical parts but as a total, complete system operating in harmony with the electromagnetic / energy system of the universe. the key to understanding chromotherapy / vibrational healing lies not in the newtonian mechanistic approach but in rerouting energy fields that form complex relationships with other fields such as those surrounding the physical / cellular substance and others relating to more non - physical energies (1). the human body, according to the doctrine of chromotherapy, is basically composed of colors. the body comes into existence from colors, the body is stimulated by colors and colors are responsible for the correct working of various systems that function in the body. all organs and limbs of the body have their own distinct color (3). all organs, cells and atoms exist as energy, and each form has its frequency or vibrational energy. each of our organs and energy centers vibrates and harmonizes with the frequencies of these colors. when various parts of the body deviate from these expected normal vibrations, one can assume that the body is either diseased or at least not functioning properly. the vibratory rates inherent in the vibrational technique (chromotherapy) are such that they balance the diseased energy pattern found in the body. for in every organ there is an energetic level at which the organ functions best. any departure from that vibratory rate results in pathology, whereas restoring the appropriate energy levels to the physical organs results in a healed body (1). chromotherapy is a narrow band in the cosmic electromagnetic energy spectrum, known to humankind as the visible color spectrum. it is composed of reds, greens, blues and their combined derivatives, producing the perceivable colors that fall between the ultraviolet and the infrared ranges of energy or vibrations. these visual colors with their unique wavelength and oscillations, when combined with a light source and selectively applied to impaired organs or life systems, provide the necessary healing energy required by the body. colors generate electrical impulses and magnetic currents or fields of energy that are prime activators of the biochemical and hormonal processes in the human body, the stimulants or sedatives necessary to balance the entire system and its organs (fig. phototherapy (light therapy) was practiced in ancient egypt, greece, china and india. people of that era were certainly unaware of the scientific facts of colors as medicine, but they certainly had faith in healing with colors. they used primary colors (i.e. red, blue and yellow) for healing as they were unaware of the mixing up of two colors. the science seems to have been silent at those times. according to ancient egyptian mythology, the art of chromotherapy was discovered by the god thoth. in the hermetic traditions, the ancient egyptians and greeks used colored minerals, stones, crystals, salves and dyes as remedies and painted treatment sanctuaries in various shades of colors (6). the ancient ayurvedic physician charaka, who lived in the sixth century bc, recommended sunlight to treat a variety of diseases (7). in ancient greece the greeks were unaware of biological changes in the body as a result of color treatment ; nevertheless, they had blind faith in the healing properties of colors. it is also interesting to know that they used both forms of treatment with colors : direct exposure to sunlight and indirect healing. in the indirect method, they used such materials as stones, dyes, ointments and plasters as the medium. what was missing in their medicinal use of color was water as a medium for the absorption of color, which later proved to be the best remedy for removing toxins from the body. he made clear the vital importance of color in both diagnosis and treatment. according to avicenna, color is an observable symptom of disease. he also developed a chart that related color to temperature and physical condition of the body. he used color treatment with the view that red moved the blood, blue or white cooled it and yellow reduced muscular pain and inflammation (6). he discussed the properties of colors for healing and was the first to establish that the wrong color suggested for therapy would certainly elicit no response in specific diseases. for example, he observed that a person with a nosebleed should not gaze at things of a brilliant red color and should not be exposed to red light because this would stimulate the sanguineous humor, whereas blue would soothe it and reduce blood flow. this seems to be the practical understanding at the time, but we do not find discrete values of frequencies or energies associated with these colors. 19th century ideas and practices pleasanton (1876) used only blue and stated that blue was the first remedy in case of injuries, burns or aches. he reported his findings on the effects of color in plants, animals and humans. he claimed that the quality yield and the size of grapes could significantly increase if they were grown in a greenhouse made with alternating blue and transparent panes of glass (8). he also cured certain diseases and increased fertility as well as the rate of physical maturation in animals by exposing them to blue light. the same methodology employing the color blue was adopted by hassan (1999), who found it to be very useful as a first - line treatment for injuries as well as for burns. since, pleasanton 's work lacked scientific proof and evidence, no established rules were presented before the scientific societies, leading to a great gap between his work and the development of color / vibrational healing on scientific grounds. if work could be carried out even now on his great ideas, especially in agricultural development and in animals, researchers could make new discoveries. most areas that seem to have been ignored in the past were emphasized by edwin babbitt. he identified the color red as a stimulant, notably of blood and to a lesser extent the nerves ; yellow and orange as nerve stimulants ; blue and violet as soothing to all systems and as having anti - inflammatory properties. accordingly, babbitt prescribed red for paralysis, physical exhaustion and chronic rheumatism ; yellow as a laxative, emetic and purgative and for bronchial difficulties ; blue for inflammatory conditions, sciatica, meningitis, nervous instability, headache, irritability and sunstroke. he also stated that all vital organs have direct connection with the skin through arteries, blood vessels and capillaries, and colour rays can affect the entire blood stream through circulation and elimination of toxins (9). babbitt also developed various devices, including a special cabinet called a thermolume, in which colored glass and natural light were used to produce colored light and a chrome disk a funnel - shaped device fitted with a special color filter he discussed in detail the effects of the reflection, absorption, transmission and polarization of light. different patients were presented in his book who had been treated using color healing devices created by him. babbitt also established the relationship between color and minerals, which he used as an addition to treatment with colored light, and he developed elixirs by irradiating water with sunlight filtered through colored lenses. potentized water retained the energy of the vital element within the particular color filter used and had remarkable healing power (7). his invention of different devices such as a special cabinet that used natural light to produce colored light by splitting it into seven colors, used for the focalization of light onto some particular area, worked quite effectively for healing wounds and stopping bleeding, headaches, etc. the actual energy to which he referred in potentized water was not calculated by any means. he did not explain the energy change in water, its quantum states and how different kinds of vibrations affect water in different manners. he did not explain about the potency of potentized water, but incredible for that time was is his correlation of magnetism with chromotherapy. his work on color healing, for the first time in history, proved to be comprehensive in taking both a physiological and a psychological approach. any chromotherapist even nowadays can benefit from his work as he discussed appropriate colors for diseases in detail that in a way does not contradict to the facts newly established under the influence of science. 20th century scientific emergence ghadiali (1927) discovered the scientific principles that explain why and how different color rays have various therapeutic effects on the body. his spectro - chrome encyclopaedia, is considered to be the first published book to explain the complete doctrine of chromotherapy. the rules explained in this book could be proved using any kind of modern techniques. he discovered that there is a unique color or energy vibration that either sedates or stimulates the stream of energy through a specific organ, causing a natural biochemical reaction. by knowing the action of different colors upon the different organs and systems of the body, one can apply the appropriate color that will balance the action of any organ or system that has become abnormal in its functioning or condition. the aim of the science of color healing is to cure disease by restoring normal balance of color energies of the body (11). ghadiali established that particular areas of the body respond to particular colors ; these areas are similar to what the ancients called chakras. according to klotsche, the chakras are areas of highly concentrated energy that are connected to various locations mainly along the spinal cord. these energy fields are related to the major organs in the body (1). the concept of chakras is essentially an east indian concept, which ghadiali presented as the source of energies. the colour bands of spectrograms are produced when a chemical element undergoes a process of combustion or vaporization that accelerates the motion of its atoms. the specific band of colours and dark lines emitted when a certain element is heated, are known as fraunhauafer lines. this procedure is commonly used to identify the chemical composition of a substance (with a photospectrometer) (11). contrary to accepted scientific theory, which assumes that each element is a unit, ghadiali concluded that the chemical elements are colour compounds. his results can be proved by any of the sophisticated equipment of modern science. a specific disease thus constitutes a specific imbalance of colour waves and by implication, chemical imbalance. ghadiali found that by treating the body with a particular color vibration, one could effectively reintroduce the appropriate biochemical elements into the body ; he referred to this as color chemistry, certainly a new field of study. his results as published in the first decade of the twentieth century were advocated by klotsche (1) in colour medicine : color medicine not only can heal the diseased frequency of the body but also can introduce actual chemical elements / vibration into the body in a non - toxic form. during the nineteenth century as medicine came under the umbrella of science, it focused too much on the material physical body, ignoring the mind. with the advances in physical medicine and treatments such as surgery and antiseptic, interest in healing with colors declined. colour ray frequency changes in atmosphere arising from the sunspots really affect the flocculation index of human blood albumin resulting in changes of menstrual cycles. takkata came up with experimental results on direct exposure to sunlight. he did not mention anything about material aids for providing a color deficient to the human body. ott described takkata 's experiment in part iii of his series colour and light : their effect on plants, animals and people, published in 1987, and described how color rays from sunspots would alter a person 's flocculation index. it can be received through the skin or the eyes, which, in turn, has been found to stimulate the internal glands (10). ott 's work seems to be a continuation of takkata 's efforts ; both have worked on the effects of light on blood, but ott also described the different methods of chromotherapy. it is not clear in his work what parameters he has adopted to verify the effect of sunlight on skin. the same effect was also described in babbitt 's work, which is more informative and explanatory. it is very interesting that no chromopath has contradicted another 's specific color treatment suggested for a specific disease. he noted that different lights affect different enzymatic reactions for healing purposes (10). this was the first time that the effect of chromotherapy was tested at the dna level. as ghadiadi, klotsche correlated colors with chakras : each chakra energizes and sustains certain organs. the balance of the seven chakras activates healing by transmitting energy to the electromagnetic field around the body (1). ' the body has seven major energy centres known as chakras, each centres is responsive to a different colour. chakra located at the sites of the major endocrine glands, corresponds to particular states of consciousness, personality types and endocrine secretions. approaches to chromotherapy for new researchers, klotsche discussed some useful points about chromotherapy as he practiced it, and he found it to be a complete therapeutic system for 123 major illnesses. he used single colors and also combinations of two or more colors for therapy and different techniques, namely, direct exposure and hydrochromopathy. he correlated the concepts of color healing with einstein 's mass energy relationship, which seems quite accurate in terms of the concept of an energy field around the human body. his work seems to be an extension of ghadiali 's concept, but it proved to be more accurate. he emphasized the pros of chromotherapy that it is safe, simple, economical and highly effective but still his work lacks scientific proof on hydrochromopathy, which according to him was the best means of toxin elimination. we find no scientific calculations in his study ; no spectroscopy has been conducted in this context. the work of mester resembles that of azeemi and gives a clear picture of the effects of colors on the human body, whether applied directly to the skin or absorbed in such materials as water, oil and milk and then given to the patient. this could affect patients with hereditary diseases such as hypertension, thalassemia and diabetes. this work needs more research and a series of experiments should be carried out with certain biophysical applications. azeemi discussed in detail the causes of diseases and suggested appropriate colors, which are very easy to understand and to use. the complete methodology of chromotherapy as described by him is extremely useful and effective ; undoubtedly, a new area of research has evolved with the publication of his book. his work is remarkable in the sense that he compiled all the concepts of chromopathy established so far. chromotherapists of the past emphasized one thing and left others unattended. some have emphasized direct exposure of the affected and diseased area to light. it is evident that all these methods focused only on the material aspect of chromotherapy, but hassan produced a detailed study covering different aspects of chromotherapy, including the material aspect of healing as well as the electromagnetic transfer of color characteristics. hassan (3) measured the production of a 32 su (sparkle units) charge in chromotized water due to the absorption of rays, but any theoretical explanation is missing. this was the first time in the history of chromotherapy that this kind of work had been done, but surprisingly hassan did not proceed further to the spectroscopy of charged water. he compared chromotherapy with all other therapeutic systems developed so far, with an in - depth explanation of the complete doctrine of chromotherapy (vibrational healing). he states : every therapeutic system has its own doctrine or to say own point of view about the reasons and causes of diseases. according to the theory of chromalux, an electric charge is produced due to the influence of the vibrations of cosmic and colourful rays upon the brain cells. this electric charge takes the form of a current emitted where various cells collide with another. this collision results in formation of incalculable colourful vibrations, which can be termed as thought.the cervical vertebrae is the main passage for the current that starts from the brain ; if this bone fractures, the flow of current suffers a set back resulting in damage of the brain tissues (3). he elaborated the technique of choosing the right color for specific diseases and explained the theory of the basic colors used for therapy and the combinations of different shades. hassan 's work stresses that a patient 's history should be keenly observed before suggesting any color. an electric charge is produced due to the influence of the vibrations of cosmic and colourful rays upon the brain cells. this electric charge takes the form of a current emitted where various cells collide with another. this collision results in formation of incalculable colourful vibrations, which can be termed as thought. the cervical vertebrae is the main passage for the current that starts from the brain ; if this bone fractures, the flow of current suffers a set back resulting in damage of the brain tissues (3). color psychology and medicine for research techniques and impressive quantitative data, the world of color psychology and medicine is indebted to the recent efforts of gerard (1970). probably for the first time, he tested the reactions of the entire organism, using advanced and modern techniques with colored light beamed onto the skin of the subject. profiting from the experience of other scientists and the use of an electroencephalogram, he evolved new approaches and discovered a number of significant facts (12). physiologically, affective responses of subjects revealed that warm colors were useful in arousing those troubled with reactive depression or neurasthenia. anxious subjects were actually calmed by these cooler colors, from the viewpoint of clinical psychology. this is an important finding in gerard 's work, as it reveals that cool colors can be effective as a tranquilizer in cases of tension and anxiety. exposure to warm colors increased respiratory movements, frequency of eye blinks, cortical activation and palmar conductance (arousal of the autonomic nervous system). cool colors showed opposite effects by acting as a relaxant and tranquilizer for anxious individuals, lowering blood pressure, providing relief from tension, alleviating of muscle spasms and reducing eye blink frequency. just as warm colors showed a consistently pronounced pattern of stimulation, cool colors showed a consistent pattern of relaxation. to summarize gerard 's research and testing, his scientific data showed that all colors affect all human both psychologically and physiologically in a specific manner. in his view, this body or energy glow is responsible for keeping our body healthy. the same fact is described by azeemi in his book color therapy thus : it is a wrong concept that our physical body is itself everything, but instead the electromagnetic glow (aura) around the body gives us the energy and transfers health or diseases to the physical body (2). these concepts received support from russian scientists who worked in collaboration with an indian researcher, shah, using kirlian technology. they took pictures of the electromagnetic energy glow around the human body and discovered that actual disease appears first in the aura and is then transferred to our physical body and can be detected 68 months prior to appearance in our physical body. thus, they have established the fact that chromotherapy can be a preventive treatment (13). in support of this theory, thelma moss (14) noted : all seemingly solid objects in our world including our bodies are made up of the electromagnetic energy, the more dense the energy the more solid the object is. this fact also demonstrates an idea of einstein 's quoted by shah in his article divine healing, that if we are the objects with mass m and we expose ourselves to a very powerful and high intensity electromagnetic field, and then we will gradually be transformed from matter into energy. in the form of energy, if we obtain a superior level of consciousness then we will be able to direct the flow of energy and we will not be restricted by the limited dimensions of space - time. therefore in this condition we can surpass the boundary of time to return back into the past or to travel in the future. in addition to the fact that we are an energy source that possesses conscious wisdom, we have the capability to transform ourselves back to the physical form (13). if we are the objects with mass m and we expose ourselves to a very powerful and high intensity electromagnetic field, and then we will gradually be transformed from matter into energy. in the form of energy, if we obtain a superior level of consciousness then we will be able to direct the flow of energy and we will not be restricted by the limited dimensions of space - time. therefore in this condition we can surpass the boundary of time to return back into the past or to travel in the future. in addition to the fact that we are an energy source that possesses conscious wisdom, we have the capability to transform ourselves back to the physical form (13). after einstein 's statement, a new door could be opened to justify the electromagnetic body around the physical body, as posited by klotsche in colour medicine and that only einstein could demonstrate to the materialistic or mechanized newton - bound world of the west through his mathematical energy formula e = mc. according to einstein energy and matter are interchangeable and interconvertible. klotsche explains this phenomenon thus : we know that the vibratory rate of a substance determines its density or its forms as matter. when we recognize the vibratory patterns in the universe, i.e. the energy ranges or fields found on the cosmic electromagnetic scale, we will then be able to open the doors to the tremendous healing powers found in the subtle energy octaves of the cosmos. the visible light spectrum with its beneficial frequencies for the human body provides the preventing tool for healing. chromotherapy provides colors to the electromagnetic body or the aura (energy field) around the body, which in turn transfers energy to the physical body. we know that the vibratory rate of a substance determines its density or its forms as matter. when we recognize the vibratory patterns in the universe, i.e. the energy ranges or fields found on the cosmic electromagnetic scale, we will then be able to open the doors to the tremendous healing powers found in the subtle energy octaves of the cosmos. the visible light spectrum with its beneficial frequencies for the human body provides the preventing tool for healing. ghadiali agreed that beaming a color or colors onto the skin acts as a form of feeding color to the body. patterson of stellar research corporation explains that light is the closest thing to pure energy that we can identify. colour as pure vibrational energy is the rational therapy for maintaining health and overcoming disease (15). when applied to the human body, light will provide all deficient energies since every color is associated with a quantity of energy. a concept from physics confirms the idea of chromotherapists that colors provide energies. there have appeared no contradictions among any of the theories about chromotherapy presented, but still there are some areas of study which were not focused on in the past, including the study of the electromagnetic radiation glow around the human body and its quantization. colors have a profound effect on us at all levels physical, mental and emotional. if our energy levels are blocked or depleted, then our body can not function properly, and this in turn can lead to a variety of problems at different levels (16). this concept is also supported by klotsche, who stated : these interrelating systems of subtle forces recharge or rechannel energy into diseased areas where it is blocked or deficient, for disease is nothing more than a restriction of energy flow. as we know energy or vibrational flow along the path of least resistance and through the extra energy associate with the use of vibrational healing, the appropriate energies seek out the needed areas, freeing blocked energy where it is most required. the interaction between the dense physical energy of the body and the subtle energy, which controls many of the body functions or activities, is the key to understanding relationship between energy and matter (1). these interrelating systems of subtle forces recharge or rechannel energy into diseased areas where it is blocked or deficient, for disease is nothing more than a restriction of energy flow. as we know energy or vibrational flow along the path of least resistance and through the extra energy associate with the use of vibrational healing, the appropriate energies seek out the needed areas, freeing blocked energy where it is most required. the interaction between the dense physical energy of the body and the subtle energy, which controls many of the body functions or activities, is the key to understanding relationship between energy and matter (1). this energy body can also be proved through photography, as described by perry in scientific documentation of chromotherapy : in 1939, kirlian discovered that if an object on a photographic plate is subjected to a high voltage electric field, an image is created on the plate. this image is said to be the physical manifestation of the electromagnetic radiation around the body (aura), which allegedly surrounds every living thing (17). qalander (18) explained unrevealed facts about the human body and its energy glow in his work. this idea has also been used by shah and russian medical staff for treating patients. this discovery led to a new area of research ; unfortunately, scientists even today have not yet explored the relationship between the basic science of electromagnetic energy around the body (aura) and chromotherapy. these explanations are based on strictly physical functions and ignore the bioelectric energy field, which has been demonstrated or photographed with kirlian devices (1). that electromagnetic energy can be moved through our auras into the physical body by light frequencies, using color medicine, can also be explained thus : all living things are moist ; the moisture is transferred from the subject to the emulsion to the electric charge pattern on the films, causing a kirlian image to appear (14). this undoubtedly helps us understand how disease is cured according to the doctrine of chromopathy, but the area that should be emphasized is the quantum state of electromagnetic radiance around every living body. phototherapy (light therapy) was practiced in ancient egypt, greece, china and india. people of that era were certainly unaware of the scientific facts of colors as medicine, but they certainly had faith in healing with colors. they used primary colors (i.e. red, blue and yellow) for healing as they were unaware of the mixing up of two colors. the science seems to have been silent at those times. according to ancient egyptian mythology, the art of chromotherapy was discovered by the god thoth. in the hermetic traditions, the ancient egyptians and greeks used colored minerals, stones, crystals, salves and dyes as remedies and painted treatment sanctuaries in various shades of colors (6). the ancient ayurvedic physician charaka, who lived in the sixth century bc, recommended sunlight to treat a variety of diseases (7). in ancient greece the greeks were unaware of biological changes in the body as a result of color treatment ; nevertheless, they had blind faith in the healing properties of colors. it is also interesting to know that they used both forms of treatment with colors : direct exposure to sunlight and indirect healing. in the indirect method, they used such materials as stones, dyes, ointments and plasters as the medium. what was missing in their medicinal use of color was water as a medium for the absorption of color, which later proved to be the best remedy for removing toxins from the body. he made clear the vital importance of color in both diagnosis and treatment. according to avicenna, color is an observable symptom of disease. he also developed a chart that related color to temperature and physical condition of the body. he used color treatment with the view that red moved the blood, blue or white cooled it and yellow reduced muscular pain and inflammation (6). he discussed the properties of colors for healing and was the first to establish that the wrong color suggested for therapy would certainly elicit no response in specific diseases. for example, he observed that a person with a nosebleed should not gaze at things of a brilliant red color and should not be exposed to red light because this would stimulate the sanguineous humor, whereas blue would soothe it and reduce blood flow. this seems to be the practical understanding at the time, but we do not find discrete values of frequencies or energies associated with these colors. 19th century ideas and practices pleasanton (1876) used only blue and stated that blue was the first remedy in case of injuries, burns or aches. he reported his findings on the effects of color in plants, animals and humans. he claimed that the quality yield and the size of grapes could significantly increase if they were grown in a greenhouse made with alternating blue and transparent panes of glass (8). he also cured certain diseases and increased fertility as well as the rate of physical maturation in animals by exposing them to blue light. the same methodology employing the color blue was adopted by hassan (1999), who found it to be very useful as a first - line treatment for injuries as well as for burns. since, pleasanton 's work lacked scientific proof and evidence, no established rules were presented before the scientific societies, leading to a great gap between his work and the development of color / vibrational healing on scientific grounds. if work could be carried out even now on his great ideas, especially in agricultural development and in animals, researchers could make new discoveries. most areas that seem to have been ignored in the past were emphasized by edwin babbitt. he identified the color red as a stimulant, notably of blood and to a lesser extent the nerves ; yellow and orange as nerve stimulants ; blue and violet as soothing to all systems and as having anti - inflammatory properties. accordingly, babbitt prescribed red for paralysis, physical exhaustion and chronic rheumatism ; yellow as a laxative, emetic and purgative and for bronchial difficulties ; blue for inflammatory conditions, sciatica, meningitis, nervous instability, headache, irritability and sunstroke. he also stated that all vital organs have direct connection with the skin through arteries, blood vessels and capillaries, and colour rays can affect the entire blood stream through circulation and elimination of toxins (9). babbitt also developed various devices, including a special cabinet called a thermolume, in which colored glass and natural light were used to produce colored light and a chrome disk a funnel - shaped device fitted with a special color filter he discussed in detail the effects of the reflection, absorption, transmission and polarization of light. different patients were presented in his book who had been treated using color healing devices created by him. babbitt also established the relationship between color and minerals, which he used as an addition to treatment with colored light, and he developed elixirs by irradiating water with sunlight filtered through colored lenses. potentized water retained the energy of the vital element within the particular color filter used and had remarkable healing power (7). his invention of different devices such as a special cabinet that used natural light to produce colored light by splitting it into seven colors, used for the focalization of light onto some particular area, worked quite effectively for healing wounds and stopping bleeding, headaches, etc. the actual energy to which he referred in potentized water was not calculated by any means. he did not explain the energy change in water, its quantum states and how different kinds of vibrations affect water in different manners. he did not explain about the potency of potentized water, but incredible for that time was is his correlation of magnetism with chromotherapy. his work on color healing, for the first time in history, proved to be comprehensive in taking both a physiological and a psychological approach. any chromotherapist even nowadays can benefit from his work as he discussed appropriate colors for diseases in detail that in a way does not contradict to the facts newly established under the influence of science. 20th century scientific emergence ghadiali (1927) discovered the scientific principles that explain why and how different color rays have various therapeutic effects on the body. his spectro - chrome encyclopaedia, is considered to be the first published book to explain the complete doctrine of chromotherapy. the rules explained in this book could be proved using any kind of modern techniques. he discovered that there is a unique color or energy vibration that either sedates or stimulates the stream of energy through a specific organ, causing a natural biochemical reaction. by knowing the action of different colors upon the different organs and systems of the body, one can apply the appropriate color that will balance the action of any organ or system that has become abnormal in its functioning or condition. the aim of the science of color healing is to cure disease by restoring normal balance of color energies of the body (11). ghadiali established that particular areas of the body respond to particular colors ; these areas are similar to what the ancients called chakras. according to klotsche, the chakras are areas of highly concentrated energy that are connected to various locations mainly along the spinal cord. these energy fields are related to the major organs in the body (1). the concept of chakras is essentially an east indian concept, which ghadiali presented as the source of energies. the colour bands of spectrograms are produced when a chemical element undergoes a process of combustion or vaporization that accelerates the motion of its atoms. the specific band of colours and dark lines emitted when a certain element is heated, are known as fraunhauafer lines. this procedure is commonly used to identify the chemical composition of a substance (with a photospectrometer) (11). contrary to accepted scientific theory, which assumes that each element is a unit, ghadiali concluded that the chemical elements are colour compounds. his results can be proved by any of the sophisticated equipment of modern science. a specific disease thus constitutes a specific imbalance of colour waves and by implication, chemical imbalance. ghadiali found that by treating the body with a particular color vibration, one could effectively reintroduce the appropriate biochemical elements into the body ; he referred to this as color chemistry, certainly a new field of study. his results as published in the first decade of the twentieth century were advocated by klotsche (1) in colour medicine : color medicine not only can heal the diseased frequency of the body but also can introduce actual chemical elements / vibration into the body in a non - toxic form. during the nineteenth century as medicine came under the umbrella of science, it focused too much on the material physical body, ignoring the mind. with the advances in physical medicine and treatments such as surgery and antiseptic, interest in healing with colors declined. colour ray frequency changes in atmosphere arising from the sunspots really affect the flocculation index of human blood albumin resulting in changes of menstrual cycles. takkata came up with experimental results on direct exposure to sunlight. he did not mention anything about material aids for providing a color deficient to the human body. ott described takkata 's experiment in part iii of his series colour and light : their effect on plants, animals and people, published in 1987, and described how color rays from sunspots would alter a person 's flocculation index. it can be received through the skin or the eyes, which, in turn, has been found to stimulate the internal glands (10). ott 's work seems to be a continuation of takkata 's efforts ; both have worked on the effects of light on blood, but ott also described the different methods of chromotherapy. it is not clear in his work what parameters he has adopted to verify the effect of sunlight on skin. the same effect was also described in babbitt 's work, which is more informative and explanatory. it is very interesting that no chromopath has contradicted another 's specific color treatment suggested for a specific disease. he noted that different lights affect different enzymatic reactions for healing purposes (10). this was the first time that the effect of chromotherapy was tested at the dna level. as ghadiadi, klotsche correlated colors with chakras : each chakra energizes and sustains certain organs. the balance of the seven chakras activates healing by transmitting energy to the electromagnetic field around the body (1). ' the body has seven major energy centres known as chakras, each centres is responsive to a different colour. chakra located at the sites of the major endocrine glands, corresponds to particular states of consciousness, personality types and endocrine secretions. approaches to chromotherapy for new researchers, klotsche discussed some useful points about chromotherapy as he practiced it, and he found it to be a complete therapeutic system for 123 major illnesses. he used single colors and also combinations of two or more colors for therapy and different techniques, namely, direct exposure and hydrochromopathy. he correlated the concepts of color healing with einstein 's mass energy relationship, which seems quite accurate in terms of the concept of an energy field around the human body. his work seems to be an extension of ghadiali 's concept, but it proved to be more accurate. he emphasized the pros of chromotherapy that it is safe, simple, economical and highly effective but still his work lacks scientific proof on hydrochromopathy, which according to him was the best means of toxin elimination. we find no scientific calculations in his study ; no spectroscopy has been conducted in this context. the work of mester resembles that of azeemi and gives a clear picture of the effects of colors on the human body, whether applied directly to the skin or absorbed in such materials as water, oil and milk and then given to the patient. this could affect patients with hereditary diseases such as hypertension, thalassemia and diabetes. this work needs more research and a series of experiments should be carried out with certain biophysical applications. azeemi discussed in detail the causes of diseases and suggested appropriate colors, which are very easy to understand and to use. the complete methodology of chromotherapy as described by him is extremely useful and effective ; undoubtedly, a new area of research has evolved with the publication of his book. his work is remarkable in the sense that he compiled all the concepts of chromopathy established so far. chromotherapists of the past emphasized one thing and left others unattended. some have emphasized direct exposure of the affected and diseased area to light. it is evident that all these methods focused only on the material aspect of chromotherapy, but hassan produced a detailed study covering different aspects of chromotherapy, including the material aspect of healing as well as the electromagnetic transfer of color characteristics. hassan (3) measured the production of a 32 su (sparkle units) charge in chromotized water due to the absorption of rays, but any theoretical explanation is missing. this was the first time in the history of chromotherapy that this kind of work had been done, but surprisingly hassan did not proceed further to the spectroscopy of charged water. he compared chromotherapy with all other therapeutic systems developed so far, with an in - depth explanation of the complete doctrine of chromotherapy (vibrational healing). he states : every therapeutic system has its own doctrine or to say own point of view about the reasons and causes of diseases. according to the theory of chromalux, an electric charge is produced due to the influence of the vibrations of cosmic and colourful rays upon the brain cells. this electric charge takes the form of a current emitted where various cells collide with another. this collision results in formation of incalculable colourful vibrations, which can be termed as thought.the cervical vertebrae is the main passage for the current that starts from the brain ; if this bone fractures, the flow of current suffers a set back resulting in damage of the brain tissues (3). he elaborated the technique of choosing the right color for specific diseases and explained the theory of the basic colors used for therapy and the combinations of different shades. hassan 's work stresses that a patient 's history should be keenly observed before suggesting any color. an electric charge is produced due to the influence of the vibrations of cosmic and colourful rays upon the brain cells. this electric charge takes the form of a current emitted where various cells collide with another. this collision results in formation of incalculable colourful vibrations, which can be termed as thought. the cervical vertebrae is the main passage for the current that starts from the brain ; if this bone fractures, the flow of current suffers a set back resulting in damage of the brain tissues (3). color psychology and medicine for research techniques and impressive quantitative data, the world of color psychology and medicine is indebted to the recent efforts of gerard (1970). probably for the first time, he tested the reactions of the entire organism, using advanced and modern techniques with colored light beamed onto the skin of the subject. profiting from the experience of other scientists and the use of an electroencephalogram, he evolved new approaches and discovered a number of significant facts (12). physiologically, affective responses of subjects revealed that warm colors were useful in arousing those troubled with reactive depression or neurasthenia. anxious subjects were actually calmed by these cooler colors, from the viewpoint of clinical psychology. this is an important finding in gerard 's work, as it reveals that cool colors can be effective as a tranquilizer in cases of tension and anxiety. exposure to warm colors increased respiratory movements, frequency of eye blinks, cortical activation and palmar conductance (arousal of the autonomic nervous system). cool colors showed opposite effects by acting as a relaxant and tranquilizer for anxious individuals, lowering blood pressure, providing relief from tension, alleviating of muscle spasms and reducing eye blink frequency. just as warm colors showed a consistently pronounced pattern of stimulation, cool colors showed a consistent pattern of relaxation. to summarize gerard 's research and testing, his scientific data showed that all colors affect all human both psychologically and physiologically in a specific manner. hassan related the human body to the electromagnetic energy glow surrounding every creature. in his view, this body or energy glow is responsible for keeping our body healthy. the same fact is described by azeemi in his book color therapy thus : it is a wrong concept that our physical body is itself everything, but instead the electromagnetic glow (aura) around the body gives us the energy and transfers health or diseases to the physical body (2). these concepts received support from russian scientists who worked in collaboration with an indian researcher, shah, using kirlian technology. they took pictures of the electromagnetic energy glow around the human body and discovered that actual disease appears first in the aura and is then transferred to our physical body and can be detected 68 months prior to appearance in our physical body. thus, they have established the fact that chromotherapy can be a preventive treatment (13). in support of this theory, thelma moss (14) noted : all seemingly solid objects in our world including our bodies are made up of the electromagnetic energy, the more dense the energy the more solid the object is. this fact also demonstrates an idea of einstein 's quoted by shah in his article divine healing, that if we are the objects with mass m and we expose ourselves to a very powerful and high intensity electromagnetic field, and then we will gradually be transformed from matter into energy. in the form of energy, if we obtain a superior level of consciousness then we will be able to direct the flow of energy and we will not be restricted by the limited dimensions of space - time. therefore in this condition we can surpass the boundary of time to return back into the past or to travel in the future. in addition to the fact that we are an energy source that possesses conscious wisdom, we have the capability to transform ourselves back to the physical form (13). if we are the objects with mass m and we expose ourselves to a very powerful and high intensity electromagnetic field, and then we will gradually be transformed from matter into energy. in the form of energy, if we obtain a superior level of consciousness then we will be able to direct the flow of energy and we will not be restricted by the limited dimensions of space - time. therefore in this condition we can surpass the boundary of time to return back into the past or to travel in the future. in addition to the fact that we are an energy source that possesses conscious wisdom, we have the capability to transform ourselves back to the physical form (13). after einstein 's statement, a new door could be opened to justify the electromagnetic body around the physical body, as posited by klotsche in colour medicine and that only einstein could demonstrate to the materialistic or mechanized newton - bound world of the west through his mathematical energy formula e = mc. according to einstein energy and matter klotsche explains this phenomenon thus : we know that the vibratory rate of a substance determines its density or its forms as matter. when we recognize the vibratory patterns in the universe, i.e. the energy ranges or fields found on the cosmic electromagnetic scale, we will then be able to open the doors to the tremendous healing powers found in the subtle energy octaves of the cosmos. the visible light spectrum with its beneficial frequencies for the human body provides the preventing tool for healing. chromotherapy provides colors to the electromagnetic body or the aura (energy field) around the body, which in turn transfers energy to the physical body. this makes chromotherapy the most effective among various therapies. we know that the vibratory rate of a substance determines its density or its forms as matter. when we recognize the vibratory patterns in the universe, i.e. the energy ranges or fields found on the cosmic electromagnetic scale, we will then be able to open the doors to the tremendous healing powers found in the subtle energy octaves of the cosmos. the visible light spectrum with its beneficial frequencies for the human body provides the preventing tool for healing. every color, each with its own frequency, is a form of energy (12). ghadiali agreed that beaming a color or colors onto the skin acts as a form of feeding color to the body. patterson of stellar research corporation explains that light is the closest thing to pure energy that we can identify. colour as pure vibrational energy is the rational therapy for maintaining health and overcoming disease (15). when applied to the human body, light will provide all deficient energies since every color is associated with a quantity of energy. a concept from physics confirms the idea of chromotherapists that colors provide energies. there have appeared no contradictions among any of the theories about chromotherapy presented, but still there are some areas of study which were not focused on in the past, including the study of the electromagnetic radiation glow around the human body and its quantization. colors have a profound effect on us at all levels physical, mental and emotional. if our energy levels are blocked or depleted, then our body can not function properly, and this in turn can lead to a variety of problems at different levels (16). this concept is also supported by klotsche, who stated : these interrelating systems of subtle forces recharge or rechannel energy into diseased areas where it is blocked or deficient, for disease is nothing more than a restriction of energy flow. as we know energy or vibrational flow along the path of least resistance and through the extra energy associate with the use of vibrational healing, the appropriate energies seek out the needed areas, freeing blocked energy where it is most required. the interaction between the dense physical energy of the body and the subtle energy, which controls many of the body functions or activities, is the key to understanding relationship between energy and matter (1). these interrelating systems of subtle forces recharge or rechannel energy into diseased areas where it is blocked or deficient, for disease is nothing more than a restriction of energy flow. as we know energy or vibrational flow along the path of least resistance and through the extra energy associate with the use of vibrational healing, the appropriate energies seek out the needed areas, freeing blocked energy where it is most required. the interaction between the dense physical energy of the body and the subtle energy, which controls many of the body functions or activities, is the key to understanding relationship between energy and matter (1). this energy body can also be proved through photography, as described by perry in scientific documentation of chromotherapy : in 1939, kirlian discovered that if an object on a photographic plate is subjected to a high voltage electric field, an image is created on the plate. this image is said to be the physical manifestation of the electromagnetic radiation around the body (aura), which allegedly surrounds every living thing (17). qalander (18) explained unrevealed facts about the human body and its energy glow in his work. this idea has also been used by shah and russian medical staff for treating patients. this discovery led to a new area of research ; unfortunately, scientists even today have not yet explored the relationship between the basic science of electromagnetic energy around the body (aura) and chromotherapy. these explanations are based on strictly physical functions and ignore the bioelectric energy field, which has been demonstrated or photographed with kirlian devices (1). that electromagnetic energy can be moved through our auras into the physical body by light frequencies, using color medicine, can also be explained thus : all living things are moist ; the moisture is transferred from the subject to the emulsion to the electric charge pattern on the films, causing a kirlian image to appear (14). this undoubtedly helps us understand how disease is cured according to the doctrine of chromopathy, but the area that should be emphasized is the quantum state of electromagnetic radiance around every living body. variation in influences of light during the 1950s, studies suggested that neonatal jaundice, a potentially fatal condition found in two - thirds of premature babies, could be successfully treated by exposure to sunlight. this was confirmed in the 1960s, and white light replaced high - risk blood transfusions in the treatment of this condition. blue light was later found to be more effective and less hazardous than full - spectrum light (the most common form of treatment for neonatal jaundice). comparison of blue light with turquoise for treatment of neonatal jaundice was carried out by ebbesen (19). bright white full - spectrum light is also now being used in the treatment of cancers, sad (seasonal affective disorder, so - called winter depression), anorexia, bulimia nervosa, insomnia, jetlag, shift working, alcohol and drug dependency, and to reduce overall levels of medication. schauss worked on the tranquilizing effect of colors and found that color reduces aggressive behavior and violence (20). the blue light found to be successful in the treatment of neonatal jaundice has also been shown to be effective in the treatment of rheumatoid arthritis, as emphasized by pleasanton in his work. in studies by mcdonald, most of those exposed to blue light for variable periods of up to 15 min experienced a significant degree of pain relief. it was concluded that the pain reduction was directly related both to the blue light and to the length of exposure to it. blue light is also used in healing injured tissue and preventing scar tissue, as well as for burns and lung conditions (2). in 1990, scientists reported to the annual conference of the american association for the advancement of science on the successful use of blue light in the treatment of a wide variety of psychological problems, including addictions, eating disorders and depression. at the other end of the color spectrum, red light has been shown to be effective in the treatment of cancer and constipation and in healing wounds. as a result, color is becoming widely accepted as a therapeutic tool with various medical applications. a new technique that has been developed over the past two decades as a result of pioneering research is photodynamic therapy (pdt). this is based on the discovery that certain intravenously injected photosensitive chemicals not only accumulate in cancer cells but also selectively identify these cells under ultraviolet light. these photosensitive chemicals then exclusively destroy the cancer cells when activated by red light, whose longer wavelength allows it to penetrate tissue more deeply than other colors. thomas dougherty, who developed pdt, reports that in a worldwide experiment more than 3000 people with a wide variety of malignant tumors have been successfully treated using this technique (21). chromotherapy is now used to improve the performance of athletes ; whereas red light appears to help athletes who need short, quick bursts of energy, blue light assists in performances requiring a steadier energy output. by comparison pink holding cells are now widely used to reduce violent and aggressive behavior among prisoners, and some sources have reported a reduction of muscle strength in inmates within 2.7 s. it appears that when in pink surroundings people can never become aggressive despite their desire, because the color saps their energy. in contrast, yellow should be avoided in such contexts because it is highly stimulating. gimbel (22) suggested a possible relationship between violent street crime and sodium yellow street lighting. color, brain and the effects of light research in russia during the 1960s showed that one in six experimental subjects could recognize color with their fingertips after only 2030 min training, and blind people developed this sensitivity even more quickly. understanding of these effects has come about only as a result of research into the hormones melatonin and serotonin, both of which are produced by the pineal gland in the brain. melatonin is known to be the crucial chemical pathway by which animals respond to light and synchronize their bodily functioning with diurnal and seasonal variations. serotonin is a very important neurotransmitter in the brain, whose action has been linked with mental disturbances such as schizophrenia and hallucinogenic states. serotonin, a stimulant, is produced during daylight whereas the output of melatonin which is linked with sleep its main site of action appears to be the hypothalamus, the part of the brain involved in mediating the effects of various hormones and in regulating emotions. however, changes in the output of melatonin in response to light influence every cell of the body, notably the reproductive processes, which are sensitive to such variations. high levels of melatonin have been found in women with ovulation problems and anorexia nervosa (a characteristic feature of which is amenorrhea, or absence of periods), in men with low sperm count and in people suffering from sad, which usually occurs during winter. research also confirmed that certain parts of the brain are not only light sensitive but actually respond differently to different wavelengths ; it is now believed that different wavelengths (colors) of radiation interact differently with the endocrine system to stimulate or reduce hormone production (22). this work has given a new dimension to chromotherapy : the use of colors in psychological disorders. sad has become a very common problem nowadays, in england in particular, where the sun does not shine for up to 1 or 2 weeks, so that no light enters into the body. as a consequence, psychological diseases manifest, mainly in the form of depressions, which, according to chromopathy studies, are curable without any use of tranquilizers. a detailed study of chromotherapy, with patients exposed to sunlight through color filters, was produced by jacob. takkata was the first researcher to attempt to find a relationship between blood and sunlight. of course, sunlight is a perfect blend of seven colors ; different colors are responsible for the release of different kinds of hormones, which keeps us healthy. jacob stated in his work that light is responsible for turning on the brain and the body. when even a single photon of light enters the eye, it lights up the entire brain. this light triggers the hypothalamus, which regulates all life - sustaining bodily functions, the autonomic nervous system, endocrine system, and the pituitary (the body 's master gland). it also sends a message, by way of light, to the pineal organ, which is responsible for releasing one of our most important hormones, melatonin. the release of melatonin is directly related to light, darkness, colors, and the earth 's electromagnetic field. it turns on each cell 's internal activities, allowing them to harmonize with each other and nature. the pineal gland is believed to be responsible for our feeling of oneness with the universe and sets the stage for the relationship between our inner being and the environment. if that relationship is harmonious, we are healthy, happy, and feel a sense of well - being. an imbalance in this relationship makes itself known in the form of disorders or disease in our physical, mental or emotional states. the pineal is our light meter, and receives information from the heavens above, to give us that sense of oneness with the universe, and from the earth 's electromagnetic field below to keep us grounded. a perfect balance is necessary to maintain our health and to keep us in harmony with the environment (22). when even a single photon of light enters the eye, it lights up the entire brain. this light triggers the hypothalamus, which regulates all life - sustaining bodily functions, the autonomic nervous system, endocrine system, and the pituitary (the body 's master gland). it also sends a message, by way of light, to the pineal organ, which is responsible for releasing one of our most important hormones, melatonin. the release of melatonin is directly related to light, darkness, colors, and the earth 's electromagnetic field. it turns on each cell 's internal activities, allowing them to harmonize with each other and nature. the pineal gland is believed to be responsible for our feeling of oneness with the universe and sets the stage for the relationship between our inner being and the environment. if that relationship is harmonious, we are healthy, happy, and feel a sense of well - being. an imbalance in this relationship makes itself known in the form of disorders or disease in our physical, mental or emotional states. the pineal is our light meter, and receives information from the heavens above, to give us that sense of oneness with the universe, and from the earth 's electromagnetic field below to keep us grounded. a perfect balance is necessary to maintain our health and to keep us in harmony with the environment (22). color medicine is one of these neglected items. the common feature of every remedial and curative system of treatment, whether it is ayurveda, allopathy, acupuncture, unani, homeopathy, biochemic, magnetotherapy, physiotherapy, radiotherapy, aromatherapy, reflexology or chromotherapy, is to somehow apply vibrations of one kind or another in such a manner that the body can be put back on the health track. most systems induce vibrations indirectly, but there are a few in which the vibrations are used directly upon the body, and chromotherapy is one of them. no controversies were found among the theories presented, in research work conducted in any area of the world. there are other quantum states such as charm, beauty, flavor, tenderness, etc. these quantum states are linked with each other via glucons and form intermediatory energy fields known as quarks, if condensed, produce bosons, a fifth state of matter. the medium used in chromotherapy has never been explored in depth ; for example, water, the main medium used in chromotherapy, has never been studied quantitatively in any of the research conducted in the context of chromotherapy. the literature exhibits a severe lack of scientific work pertaining to quantum physical states and optical mathematics. we found no study of quantum states and the electromagnetic glow around the human body. conductivity measurements of the chromotized water used in hydrochromopathy have not been emphasized by any researcher. energy - related measurements could be helpful in potentizing or chromotizing the liquid medium used for treatment. relationships ought to be established between charged water, its energy states and its effect on the human body. the quantum mechanical dipole moment as a result of absorption of different colors, we conjecture, produces charge quantization phenomena. chromotherapy as a system of treatment can benefit people because of its harmony with nature. everything that exists in this world is a combination of different colors (2). in every creation of god, one color or another is dominant ; as stated by azeemi : by using clay, a clay pot is repaired and piece of cloth mends a doll made of cloth, the plastic is used to repair the articles of plastic, then why light and colours can not be used for the human health care which is the origin of man 's creation. the holy scriptures say that existence of man is based upon various types of lights and colours. then why a human being can not be treated with colours (2).walker once said : you realize you are part of the hologram of life, surrounded by an aura or energy field that radiates distinct colour and vibrations. the aura fingertips your soul and reflects your goodness, wellness, mental stability, maturity, emotional / inner turmoil or peaceful fulfilment. more of each of these qualities, peace, wellness, stability, maturity and fulfilment may become your ever present precious possession by the application of colour 's power in our daily living (23). by using clay, a clay pot is repaired and piece of cloth mends a doll made of cloth, the plastic is used to repair the articles of plastic, then why light and colours can not be used for the human health care which is the origin of man 's creation. the holy scriptures say that existence of man is based upon various types of lights and colours. you realize you are part of the hologram of life, surrounded by an aura or energy field that radiates distinct colour and vibrations. the aura fingertips your soul and reflects your goodness, wellness, mental stability, maturity, emotional / inner turmoil or peaceful fulfilment. more of each of these qualities, peace, wellness, stability, maturity and fulfilment may become your ever present precious possession by the application of colour 's power in our daily living (23). | chromotherapy is a method of treatment that uses the visible spectrum (colors) of electromagnetic radiation to cure diseases. it is a centuries - old concept used successfully over the years to cure various diseases. we have undertaken a critical analysis of chromotherapy and documented its scientific evolution to date. a few researchers have tried to discover the underlying scientific principles, but without quantitative study. sufficient published material can be found about the subject that provides a complete system of treatment focused on the treatment methodologies and healing characteristics of colors. a number of studies have elaborated the relationship between the human body and colors. we also show the possibility of carrying out diverse research into chromotherapy that is pertinent to deciphering the quantum mechanical dipole moment of water molecules. the quantum mechanical dipole moment as a result of the absorption of different colors, we conjecture, produces charge quantization phenomena. this review illustrates that the development of science in the field of electromagnetic radiation / energy can be very helpful in discovering new dimensions of this old theory. |
in 2002, paulhus and williams1 described the personality construct of the dark triad (dt), and since then, dt has been attracting increasing attention.2 dt consists of three dimensions : machiavellianism (a manipulative, self - centered, immoral, and calculative attitude), narcissism (exaggerated self - love, dominant, self - aggrandized, egocentric), and psychopathy (lack of empathy, adventurousness, low anxiety, cold - blooded). machiavellianism refers to a personality trait associated with taking advantage and being self - centered, immoral, and calculating,3 with frequent and extreme use of deception and manipulation.1,4 while machiavellian individuals present themselves as charming and attractive personalities to impress their peers,4 they might remain hypocritical, superficial, and manipulative.3 further, machiavellianism did correlate with low agreeableness and conscientiousness in the big five model.1 a machiavellianistic behavior is closely related to self - interest and personal gain.5 narcissism is characterized by views of megalomania, exaggerated self - love, dominance, superiority, self - centeredness, self - aggrandizement, and egocentric attitude.1 in interpersonal relationships, narcissist people behave in an exploitative and egocentric way and try to take advantage of others to satisfy their admiration.6 further, narcissism is negatively correlated with agreeableness and positively associated with the extraversion and openness to experience factors of the big five model.7 lastly, psychopathy is associated with a tendency to be highly impulsive, adventurous, and cold - blooded and have little empathy and low anxiety.1 similar to machiavellianism and narcissism, psychopathy is associated with low empathy.8 whereas the personality constructs of machiavellianism, narcissism, and psychopathy had already been acknowledged within various areas of psychology and psychiatry,9,10 they were examined separately and in isolation from one another.11 only with paulhus and williams1 did these three dimensions integrate into an overall construct. these authors also introduced the term dark to highlight the rather problematic and socially controversial set of mental attitudes and behaviors reflected in a shared use of antagonistic, dishonest, and egocentric interpersonal styles.1,9,10,1214 since then, research has identified associations between higher dt scores and increased sexual desire as well as rather impersonal, masochistic, and harder sexual behavior,15 lower intimacy in personal relationships,16 and poorer skills in managing and coping with money.17 further, people scoring high on dt traits both report and display overt schadenfreude / gloating;18 view others personalities as being less positive, desirable, or reliable;19 show and express more mating rivalry (backbiting, manipulation, lying);20 are more prone to aggressive, risky, illegal, racist, and impulsive behavior;21,22 report being evening rather than morning or intermediate chronotypes;23 and are less intrinsically motivated to religious observance.24 lastly, recent research has shown that men scoring high on dt traits spent more time in editing selfies posted on social network sites.25 on the other hand, (ie, men scoring high in dt traits) as physically and sexually attractive.26 additionally, and most importantly, people scoring high on dt traits seem to be more mentally tough.27 mental toughness (mt) is a psychological construct related to positive stress management and a relatively new area of academic research.28 it involves a cognitive strength variable that is known to be associated with good performance both in elite sport29 and, more recently, in nonelite sport.30,31 indeed, in previous studies,3032 we employed the mental toughness questionnaire48 (mtq48)33 and showed in several samples of adolescents and young adults, who were nonelite athletes, that 1) the construct of mt was associated with higher levels of physical activity (pa) among nonelite athletes,3032 2) mt was associated with greater stress resilience,3032 3) mt remained relatively stable over time,31 4) mt was associated with higher pa levels,30,32 5) relative to men, women reported lower mt, and 6) higher mt was associated with both better subjective34 and objective sleep.35 these findings suggested, therefore, that mt is related to successful stress management, psychological well - being, superior sleep quality, and higher levels of pa. in conclusion, we note that mt is associated with a broad range of positive behaviors, including a straightforward, highly motivated strategy to achieve goals, along with a strong belief in oneself and one s own ability, and with greater pa. although in previous studies mt has been associated with success in sport3639 and psychological well - being, some researchers have also identified potentially dysfunctional outcomes.37,4044 (these dysfunctional outcomes are also called the dark side of mental toughness, though dark is misleading : here, costs, disadvantages, expenses, exaggerations, or downside.) more specifically, athletes with high mt seemed to be at a greater risk of ignoring medical advice and disregarding rehabilitation. for example, coulter suggested that mentally tough athletes may be overconfident or too committed to the pursuit of winning that they fail to recognize or accept medical advice about minor injuries, rendering them at a higher risk of major injury than players with less self - belief.4345 from these studies we deduce that mentally tough athletes might be particularly committed to their aims while disregarding the costs and side effects as people scoring high in machiavellianism often do. accordingly, one aim of the present study was to explore the possible relation between mt and dt traits. while most research related to the dark side of mental toughness has been conducted with elite athletes, to our knowledge, to date only one study has considered the relation between dt and mt in a nonelite sport population. onley investigated the association between dt and mt among healthy adults and observed significant positive associations between mt and narcissism and negative associations between mt and psychopathy and machiavellianism. further, onley claimed a common genetic basis to dt and mt. in the light of onley s findings, we investigated whether the association between dt and mt could be replicated. further, given the association between mt and pa, we asked whether dt might also be related to pa, and whether there are differences between sexes given that women typically have lower mt scores than men30,32 and lower pa levels.46 accordingly, the following three hypotheses were formulated. first, following onley,27 we anticipated that dt traits and mt would be correlated. second, following gerber,30,32 we expected that dt traits, mt and pa would be positively interrelated. third, again following gerber,30,32 we expected lower mt and pa scores among women than among men, and we expected that men would score higher on dt traits.21,4749 we believe that the present study has the potential to add to the current knowledge on dt and mt in an important way : it is possible that the pattern of results will help explain why, for example, athletes can be successful, ruthless, and selfish at the same time. accordingly, the pattern of results might help clarify why nonathletes might also be mentally tough and concomitantly socially ruthless. the sample consisted of 341 iranian adults (age : m=29.0 years ; sd = 6.58 ; range : 1837 years, 51.6% women ; mean age of women participants : m=28.89, sd = 5.45 ; mean age of men participants : m=29.23, sd = 7.45 ; t(339)=0.34, p>0.65, d=0.05) who volunteered to take part in an online survey. all participants who joined the survey had a unique ip address. to recruit participants, the study was posted electronically on facebook and other local social media networks (cloob and irexpert). data collection was done via the internet, which is a both timely and reliable way to gather data (refer brand for an overview). commercially available the software is an easily applied tool for the creation of internet - based studies. the software provider guarantees that all data are stored on a server that is not accessible to any third party. the user of the software receives the raw data related to the questionnaires but not to the ip address of the participants. moreover, to avoid repeat participation, the software is designed to block recruitment of subjects whose ip addresses have already been used. participants were informed about the purpose of the study and about the voluntary basis of their participation. they were also assured of the confidentiality of their responses, and written informed consent was obtained on the first page of the questionnaire. moreover, participants could discontinue or withdraw from the study without giving any further explanation. to improve compliance, participants could take part in a prize draw, although to do so they needed to provide an email address. the study was approved by the review board of the allamehtabatabai university, faculty of educational sciences and psychology, tehran, iran, and the entire study was conducted in accordance with the ethical standards laid down in the declaration of helsinki. participants completed a series of standardized questionnaires as follows : machiavellianism was measured with the 20-item mach - iv.51 participants were asked how much they agreed (1= strongly disagree ; 5= strongly agree) with statements such as : never tell anyone the real reason you did something unless it is useful to do so ; or the best way to handle people is to tell them what they want to hear. responses were averaged to create a machiavellianism index, with higher mean scores reflecting stronger machiavellianism (cronbach s = 0.85). narcissism was assessed with the 40-item narcissistic personality inventory.52 for each item, participants were asked to rate how much they agreed (1= strongly disagree ; 5= strongly agree) with the statements that applied to them (eg, everybody likes to hear my stories ; and i am an extraordinary person.). the items were summed to obtain a narcissism index (cronbach s = 0.92). subclinical psychopathy was assessed by the 40-item self - report psychopathy scale - iii.53 participants rated how much they agreed (1= strongly disagree ; 5= strongly agree) with statements such as i almost never feel guilty or responses across items were averaged to create an overall index of psychopathy (cronbach s = 0.88), with higher scores indicating greater psychopathy. in addition to examining the dt traits separately, we also created a composite measure of the overall dt. as recommended by jonason,54 we first standardized (z - scored) overall scores for each measure, and then averaged all three scores to create a composite dt index. a principal component factor analysis showed that all three measures loaded well (> 0.52) on a single factor that accounted for 52.11% of the variance (eigen value > 1.56). in this study, we used the 18-item short form of the mtq48,33 which measures total mt. previous studies have reported high correlations between the short and long forms of mtq.33 evidence has also been provided for the factorial validity of mtq48 in previous studies.31,55 mtq instruments generally have high test retest reliability as well as high internal consistency and are moderately associated with other psychological constructs such as optimism and self - efficacy.31,33,56,57 sample items are i generally cope well with any problems that occur or however bad things are, i usually feel they will work out positively in the end. items on the mtq18 were anchored on a 5-point likert scale from 1 (= strongly disagree) to 5 (= strongly agree), with higher scores reflecting greater mt. responses across items were summed to obtain an overall mt index (cronbach s = 0.84). to obtain information on pa, the short version of the international physical activity questionnaire (ipaq) was used. this questionnaire was developed by a working group initiated by the world health organization and the centers for disease control and prevention. results from 12 countries demonstrate that the ipaq has comparable reliability and validity to other self - reported measures of pa.58 the short (self - administered, seven - item), last - week version of the ipaq was administered, asking about the time spent being physically active over the last 7 days. minutes of sitting, walking, as well as moderate - intensity (walking not included) and vigorous - intensity activities were computed for the past week. the ipaq questionnaires (short and long versions), including definitions of moderate and vigorous activity, are available at www.ipaq.ki.se. the age range was 19 years ; therefore, we performed a series of correlational correlations between age and the dt, mt, and pa. first, a series of pearson s correlations was computed to calculate the associations between dt traits, mt, and pa. next, a series of student s t - tests was performed to calculate differences in dt traits, mt, and pa in both sexes. the level of significance was set at 0.05, though we also computed effect sizes (cohen s d), with d0.65, d=0.05) who volunteered to take part in an online survey. all participants who joined the survey had a unique ip address. to recruit participants, the study was posted electronically on facebook and other local social media networks (cloob and irexpert). data collection was done via the internet, which is a both timely and reliable way to gather data (refer brand for an overview). commercially available the software is an easily applied tool for the creation of internet - based studies. the software provider guarantees that all data are stored on a server that is not accessible to any third party. the user of the software receives the raw data related to the questionnaires but not to the ip address of the participants. moreover, to avoid repeat participation, the software is designed to block recruitment of subjects whose ip addresses have already been used. participants were informed about the purpose of the study and about the voluntary basis of their participation. they were also assured of the confidentiality of their responses, and written informed consent was obtained on the first page of the questionnaire. moreover, participants could discontinue or withdraw from the study without giving any further explanation. to improve compliance, participants could take part in a prize draw, although to do so they needed to provide an email address. the study was approved by the review board of the allamehtabatabai university, faculty of educational sciences and psychology, tehran, iran, and the entire study was conducted in accordance with the ethical standards laid down in the declaration of helsinki. participants completed a series of standardized questionnaires as follows : machiavellianism was measured with the 20-item mach - iv.51 participants were asked how much they agreed (1= strongly disagree ; 5= strongly agree) with statements such as : never tell anyone the real reason you did something unless it is useful to do so ; or the best way to handle people is to tell them what they want to hear. responses were averaged to create a machiavellianism index, with higher mean scores reflecting stronger machiavellianism (cronbach s = 0.85). narcissism was assessed with the 40-item narcissistic personality inventory.52 for each item, participants were asked to rate how much they agreed (1= strongly disagree ; 5= strongly agree) with the statements that applied to them (eg, everybody likes to hear my stories ; and i am an extraordinary person.). the items were summed to obtain a narcissism index (cronbach s = 0.92). subclinical psychopathy was assessed by the 40-item self - report psychopathy scale - iii.53 participants rated how much they agreed (1= strongly disagree ; 5= strongly agree) with statements such as i almost never feel guilty or responses across items were averaged to create an overall index of psychopathy (cronbach s = 0.88), with higher scores indicating greater psychopathy. in addition to examining the dt traits separately, we also created a composite measure of the overall dt. as recommended by jonason,54 we first standardized (z - scored) overall scores for each measure, and then averaged all three scores to create a composite dt index. a principal component factor analysis showed that all three measures loaded well (> 0.52) on a single factor that accounted for 52.11% of the variance (eigen value > 1.56). in this study, we used the 18-item short form of the mtq48,33 which measures total mt. previous studies have reported high correlations between the short and long forms of mtq.33 evidence has also been provided for the factorial validity of mtq48 in previous studies.31,55 mtq instruments generally have high test retest reliability as well as high internal consistency and are moderately associated with other psychological constructs such as optimism and self - efficacy.31,33,56,57 sample items are i generally cope well with any problems that occur or however bad things are, i usually feel they will work out positively in the end. items on the mtq18 were anchored on a 5-point likert scale from 1 (= strongly disagree) to 5 (= strongly agree), with higher scores reflecting greater mt. responses across items were summed to obtain an overall mt index (cronbach s = 0.84). to obtain information on pa, the short version of the international physical activity questionnaire (ipaq) was used. this questionnaire was developed by a working group initiated by the world health organization and the centers for disease control and prevention. results from 12 countries demonstrate that the ipaq has comparable reliability and validity to other self - reported measures of pa.58 the short (self - administered, seven - item), last - week version of the ipaq was administered, asking about the time spent being physically active over the last 7 days. minutes of sitting, walking, as well as moderate - intensity (walking not included) and vigorous - intensity activities were computed for the past week. the ipaq questionnaires (short and long versions), including definitions of moderate and vigorous activity, are available at www.ipaq.ki.se. machiavellianism was measured with the 20-item mach - iv.51 participants were asked how much they agreed (1= strongly disagree ; 5= strongly agree) with statements such as : never tell anyone the real reason you did something unless it is useful to do so ; or the best way to handle people is to tell them what they want to hear. responses were averaged to create a machiavellianism index, with higher mean scores reflecting stronger machiavellianism (cronbach s = 0.85). narcissism was assessed with the 40-item narcissistic personality inventory.52 for each item, participants were asked to rate how much they agreed (1= strongly disagree ; 5= strongly agree) with the statements that applied to them (eg, everybody likes to hear my stories ; and i am an extraordinary person.). the items were summed to obtain a narcissism index (cronbach s = 0.92). subclinical psychopathy was assessed by the 40-item self - report psychopathy scale - iii.53 participants rated how much they agreed (1= strongly disagree ; 5= strongly agree) with statements such as i almost never feel guilty or responses across items were averaged to create an overall index of psychopathy (cronbach s = 0.88), with higher scores indicating greater psychopathy. in addition to examining the dt traits separately, we also created a composite measure of the overall dt. as recommended by jonason,54 we first standardized (z - scored) overall scores for each measure, and then averaged all three scores to create a composite dt index. a principal component factor analysis showed that all three measures loaded well (> 0.52) on a single factor that accounted for 52.11% of the variance (eigen value > 1.56). in this study, we used the 18-item short form of the mtq48,33 which measures total mt. previous studies have reported high correlations between the short and long forms of mtq.33 evidence has also been provided for the factorial validity of mtq48 in previous studies.31,55 mtq instruments generally have high test retest reliability as well as high internal consistency and are moderately associated with other psychological constructs such as optimism and self - efficacy.31,33,56,57 sample items are i generally cope well with any problems that occur or however bad things are, i usually feel they will work out positively in the end. items on the mtq18 were anchored on a 5-point likert scale from 1 (= strongly disagree) to 5 (= strongly agree), with higher scores reflecting greater mt. responses across items were summed to obtain an overall mt index (cronbach s = 0.84). to obtain information on pa, the short version of the international physical activity questionnaire (ipaq) was used. this questionnaire was developed by a working group initiated by the world health organization and the centers for disease control and prevention. results from 12 countries demonstrate that the ipaq has comparable reliability and validity to other self - reported measures of pa.58 the short (self - administered, seven - item), last - week version of the ipaq was administered, asking about the time spent being physically active over the last 7 days. minutes of sitting, walking, as well as moderate - intensity (walking not included) and vigorous - intensity activities were computed for the past week. the ipaq questionnaires (short and long versions), including definitions of moderate and vigorous activity, are available at www.ipaq.ki.se. the age range was 19 years ; therefore, we performed a series of correlational correlations between age and the dt, mt, and pa. first, a series of pearson s correlations was computed to calculate the associations between dt traits, mt, and pa. next, a series of student s t - tests was performed to calculate differences in dt traits, mt, and pa in both sexes. the level of significance was set at 0.05, though we also computed effect sizes (cohen s d), with d<0.49 indicating small effect sizes (s), 0.50<d<0.79 indicating medium effect sizes (m), and d0.80 indicating large effect sizes (l). statistical analyses were performed with spss 20.0 (ibm corporation, armonk ny, usa) for apple mac. the age range was 19 years ; therefore, we performed a series of correlational correlations between age and the dt, mt, and pa. first, a series of pearson s correlations was computed to calculate the associations between dt traits, mt, and pa. next, a series of student s t - tests was performed to calculate differences in dt traits, mt, and pa in both sexes. the level of significance was set at 0.05, though we also computed effect sizes (cohen s d), with d<0.49 indicating small effect sizes (s), 0.50<d<0.79 indicating medium effect sizes (m), and d0.80 indicating large effect sizes (l). statistical analyses were performed with spss 20.0 (ibm corporation, armonk ny, usa) for apple mac. all descriptive and correlational statistics of dt traits, mt, and pa are reported in table 1. machiavellianism, narcissism, psychopathy, and overall dt traits were all positively and significantly associated with mt. further, higher machiavellianism, narcissism, dt overall score, and mt were associated with higher pa (vigorous) scores, and pa (walking) was positively and significantly associated with psychopathy. table 2 reports all descriptive and inferential statistics for dt traits, mt, and pa, comparing men and women participants. no significant mean differences were found for machiavellianism, narcissism, mt, or pa (vigorous and moderate pa, and walking). all descriptive and correlational statistics of dt traits, mt, and pa are reported in table 1. machiavellianism, narcissism, psychopathy, and overall dt traits were all positively and significantly associated with mt. further, higher machiavellianism, narcissism, dt overall score, and mt were associated with higher pa (vigorous) scores, and pa (walking) was positively and significantly associated with psychopathy. table 2 reports all descriptive and inferential statistics for dt traits, mt, and pa, comparing men and women participants. no significant mean differences were found for machiavellianism, narcissism, mt, or pa (vigorous and moderate pa, and walking). the key findings of the present study were that overall dt and specific dt traits were associated with mt and pa in a sample of young iranian adults. the present results add to the current knowledge in an important way in that we were able to show an association between dt traits, mt, and pa among participants in a non - western country. our first hypothesis was that there would be an association between dt and mt, and this was confirmed. thus, we were able to replicate the findings reported by onley.27 however, in contrast to their27 findings, we were also able to show that mt was consistently and positively associated with all facets of dt. given that the data available to us can not clarify why we found robust associations between dt and mt, when onley s findings27 did not, we offer the following suggestion : by definition, mentally tough individuals feel committed to their aims and goals (commitment),33 while feeling committed to own goals is also characteristic of those scoring high on machiavellianism : 5. indeed, machiavellianism is closely related to self - interest, personal gain, and achievement of own aims.1,5,9 in this view, toughness might be considered one of the proximal, downstream factors that enable those high on the dt to be successful in pursuing their goals that are often offensive to people. accordingly, we may assume that mentally tough individuals trying to achieve their aims could disregard others needs as those scoring high on psychopathy tend to do. mentally tough individuals report having high confidence in their abilities ; likewise, those with higher narcissism scores have confidence in their abilities (though others may not share their opinion of themselves). our second hypothesis was that both dt and mt would be associated with pa, and the pattern of results confirmed this. therefore, we hold that the present results add to the current literature in an important way : dt and vigorous, but not moderate, pa are associated. we also note that both in the present study and in previous studies30,46 only vigorous pa appears to be robustly associated with psychological traits such as dt and mt. from the present study, we do not have any direct evidence as to why vigorous but not moderate pa should be associated with dt, and previous explanations for this remain somewhat unsatisfactory.30,46 the following may be a more plausible explanation : vigorous exercising demands planning, organization, engagement, renouncing easier and more reward - oriented activities, as well as resistance to pain, time pressures, and, for example, health concerns. accordingly, we might expect that strongly goal - oriented and self - confident59 individuals are physically vigorously active. another possibility is that both mt traits and dt traits are acquired in the course of long - term, regular, and vigorous training in sports with possibly a more competitive character. accordingly, mt and dt traits may have emerged over time among those participants in the present study who practiced more exercise in childhood and adolescence. in this regard, brand showed that a relation was already apparent between mt and vigorous, but not low to moderate, pa in preadolescents and adolescents. our third hypothesis was that women would have lower dt, mt, and pa scores than men ; this was partially confirmed because higher dt traits scores were observed in men compared to women participants, while no differences were observed as regards subjective pa. higher dt scores were expected in men compared to women participants, and the reason might be the higher intrasexual competition, as also the fact that economically more successful men attain higher in social dominance, which, again, has a favorable impact on short - term mating. accordingly, the present pattern of results only partially mirrors the findings reported by gerber,32 and others.21,47,49,54 despite the intriguing findings, several limitations warn against overgeneralization. experts rating and objective data would enhance the validity of the present pattern of results. this holds particularly true for two main aspects : pa and personality traits on axis ii of the diagnostic and statistical manual of mental disorders fifth edition (dsm-5).60 as regards pa, future studies might assess it via activity trackers, for example, of the kind available on smart phones, or using commercially available actigraphs. as regards personality traits on the axis ii of the dsm-5,60 again, experts ratings would shed more light on the participants possible personality of psychopathology. this is critical, as data were gathered via an online survey, which by definition precludes both direct contact with the participants and expert assessment. in this view, as with any kind of online research, data might be biased. and accordingly, second, only participants willing and able to complete the online survey took part in the study and accordingly a systematic sample bias can not be entirely ruled out. in this regard, third, the present pattern of results might have emerged as a result of further latent and unassessed factors, which might have biased two or more dimensions in the same direction. this comment holds particularly true as regards sleep - altering psychological processes such as stress, social interaction, anxiety, and impulsivity. fourth, figueredo proposed a multisample structural equation model to gain further insight into the latent factors of the dt, whereas we focused on a more basic statistical approach. among a sample of young adults, higher scores on dt traits were associated with greater mt and higher vigorous pt. further, apart from overall dt score and psychopathy, no differences were observed between the sexes. | objectivethe dark triad (dt) describes a set of three closely related personality traits : machiavellianism, narcissism, and psychopathy. mental toughness (mt) refers to a psychological construct combining confidence, commitment, control, and challenge. high mt is related to greater physical activity (pa) and, relative to men, women have lower mt scores. the aims of the present study were 1) to investigate the association between dt, mt, and pa, and 2) to compare the dt, mt, and pa scores of men and women.methodsa total of 341 adults (m=29 years ; 51.6% women ; range : 1837 years) took part in the study. participants completed a series of questionnaires assessing dt, mt, and pa.resultsmachiavellianism, narcissism, and psychopathy were all significantly associated with higher mt scores (rs = 0.45, 0.50, and 0.20, respectively). dt traits and mt were associated with more vigorous pa. compared to men, women participants had lower scores for dt traits (overall score and psychopathy), while no differences were found for mt or pa in both sexes.conclusiondt traits, high mt, and vigorous pa are interrelated. this pattern of results might explain why, for instance, successful professional athletes can at the same time be tough and ruthless. |
common sites of breast cancer metastases include regional lymph nodes, bones, liver, lungs and brain. metastatic breast and lung cancers are the most common non - traumatic causes of brachial plexopathy, after radiation induced fibrosis. because one of the major lymphatic drainage of the breast is through the apex of the axilla, it is not uncommon for metastatic breast cancer to invade the brachial plexus. a 56-year - old woman diagnosed with infiltrating ductal carcinoma of the left breast had undergone left modified radical mastectomy followed by radiotherapy and adjuvant chemotherapy. she presented to her oncologist with left para sternal chest wall recurrence with restriction of movement of the left upper limb. the patient was referred for 18f - fdg pet / ct to evaluate the extent of recurrent / metastatic disease. whole - body contrast enhanced pet / ct was acquired 1 hour following the intravenous injection of 296 mbq of 18f - fdg on pet ct discovery 600, with 16 slice ct scanner. the scan showed ill - defined heterogeneously enhancing hypermetabolic soft tissue along left brachial plexus [figure 1 ] with intra - spinal extension through neural foramina at c5-c6 and c6-c7 levels on the left side [figure 2 ] along with few ill -defined intra - spinal enhancing lesions at d4-d5, d7-d8 and d8-d9 levels [figure 3 ] and heterogeneously enhancing extra - axial lesion in left c - p angle region [figure 4 ]. the scan also showed heterogeneously enhancing ill - defined soft tissue lesion in subcutaneous plane in left para - sternal region in anterior chest wall at 1st intercostal space [figure 5 ] along with soft tissue in antero - superior mediastinum extending along left proximal common carotid artery [figure 6 ]. maximum intensity projection (mip) and coronal 18f - fdg pet - ct images show linear extension of tracer activity from superomedial aspect (supra / infraclavicular) to lateral aspect of the left axilla. ill - defined heterogeneously enhancing hypermetabolic soft tissue along left brachial plexus with intra - spinal extension through neural foramina at c5-c6 and c6-c7 levels on left side. fdg avid heterogeneously enhancing extra - axial lesion in left c - p angle region. fdg avid heterogeneously enhancing ill - defined soft tissue lesion in subcutaneous plane in left para - sternal region in anterior chest wall at 1st intercostal space. fdg avid soft tissue in antero - superior mediastinum extending along left proximal common carotid artery. the two major causes of brachial plexopathy in breast cancer patients are metastatic invasion of and radiation damage to the plexus. it is difficult to image because of complicated anatomy of the plexus and its immediate anatomical relationship to blood and lymphatic vessels. computerized tomography scanning has been used to assess the brachial plexus but it has several limitations. the neurovascular bundle of the axillary artery and brachial plexus may appear as a single structure when the administration of contrast medium is poorly timed. in a series of 46 patients with proven metastatic plexopathy a ahmad also had either normal ct or the appearance of minimal thickening of the brachial plexus in 6 cases out of the total 11 cases in their study. its superiority to ct scanning relates to its ability to differentiate more accurately nerves from surrounding vessels and soft tissues. review of the literature suggests that there is no doubt that mri can delineate both the normal and abnormal anatomy of the brachial plexus in more detail than ct scan. some studies have shown that tumor recurrence has a higher signal intensity than radiation fibrosis on t2-weighted images, although other authors have reported increased t2 signal in both metastatic and radiation plexopathy patients. fdg - pet is a useful imaging technique to study the brachial plexus in breast cancer patients and that it may be useful to monitor treatment efficacy as well. the current data is insufficient to suggest unequivocally that fdg - pet may be useful in distinguishing neoplastic from radiation plexopathy. maximum intensity projection (mip) and coronal 18f - fdg pet / ct images show linear extension of tracer activity from superomedial aspect (supra / infraclavicular) to lateral aspect of the axilla closely related to the subclavian / axillary vessels. dual time point imaging may have some role in this scenario and further work in this area may be proved useful. | we report a case of a 56-year - old woman diagnosed with infiltrating ductal carcinoma of the left breast, who had undergone left modified radical mastectomy followed by radiotherapy and adjuvant chemotherapy. fdg pet - ct showed metastatic brachial plexopathy with intra - spinal and extra - axial brain metastasis. metastatic brachial plexopathy along with brain and spinal metastasis is a rare condition with very less incidence. the scan also showed left para - sternal anterior chest wall recurrence with antero - superior mediastinal metastasis. 18fdg - pet scanning is a useful tool in evaluation of patients with suspected metastatic plexopathy. it may also be useful in distinguishing between radiation - induced and metastatic plexopathy. typical pattern of fdg uptake and dual time point imaging may increase specificity and require further evaluation. |
acute migratory polyarthritis, then known as acute articular rheumatism was the first manifestation described simultaneously in 1605, in france from guilleaume de baillou and in england by thomas sydenham. the following year he described the disorder of movement (st vitus dance) that is now called sydenham s chorea. the clinical manifestations of rheumatic fever were described in the latter half of 17 century. the full clinical syndrome was appreciated only near the end of the 19 century. in 1944 thomas duckett jones proposed a set of guidelines for the diagnosis of rheumatic fever, now known as the jones criterions.(1, 2, 3, 4). rheumatic fever is now considered an acute non - suppurative inflammatory disease that follows group a strepotococcical infection of the throat (5, 6). at the beginning of the 21st century, and 400 years after the first description, it has remained the most common cause of acquired heart disease in underdevelopment countries, in children and young adults. it has continued to be a major public health problem worldwide, but particularly in developing countries. in 1990, the world health organization estimated that 12 million people are affected, with more than 400 000 deaths occurring annually and with hundreds of thousands more, mainly children, left disabled. although the incidence has declined significantly in developed countries, rheumatic fever is relatively uncommon in north america and in the most european countries but is still often in some balkans countries, including kosovo too. the consequences of acute rheumatic fever remain significant : approximately 80 % of patients have cardiac involvement with clinical and subclinical carditis during their acute episode and 35 % go on to develop moderate or severe rheumatic heart disease. rheumatic heart disease result in considerable expanses to the health system and personal cost to patients whose career choices, quality of life ; medical and surgical treatment and fertility are adversely affected. rheumatic mitral stenosis is common in such children and adults, many times without a history of rheumatic fever in previous period (6, 7, 8). kosovo is the youngest country in the world, with youngest population in the europe, where 50 % of citizens are younger than 25 years. in the same time kosovo was the most underdevelopment when it was a part of yugoslavia, with a very low level of social and health care services. all of these issues have led to an increase in the incidence of rheumatic fever in that period in kosovo. (3, 8, 9) the role of echocardiography in the diagnosis of acute rheumatic carditis was established over the last 20 years. the world health organization recommends screening for rheumatic fever and rheumatic carditis in all affected children and in high risk population. the recent availability of compact portable echocardiography has led to the growing use of technology for rheumatic heart disease screening in a number of low - income countries where it is shown to detect significantly more rheumatic heart disease than laboratory analysis and cardiac auscultation. recent data showed that in those low - incoming countries the prevalence of rheumatic heart disease varying from 75 per 100,000 children in urban population in south auckland, 21.5 per 1000 in cambodia and 42.6 per 1000 in tonga (8, 9, 10). echocardiography detects clinically inaudible yet hemodynamically significant valve lesions, and can exclude pathology in those with an innocent cardiac murmur. after the war in kosovo we established guidelines for echocardiography screening for all children with or suspected for / or with rheumatic fever in order to confirm or exclude the presence of carditis and heart lesions. based on the high incidence of rheumatic fever in kosova and the high number of patients with rheumatic heart disease, despite the improvement in prevention and treatment, our objective was to present all children admitted and treated from rheumatic fever in the pediatric clinic in prishtina, during the period 1998 2010 and to describe the clinical manifestations and heart lesions, as diagnosed by echocardiography. between january 1988 and december 2010, at division of cardiology and rheumatology 609 patients were admitted with diagnosis of acute rheumatic fever. patients were divided in two groups : group i include patients admitted from january 1988 to december1998 and, group ii, included patients admitted from january 1999 to december 2010. criteria for separation were war during the 1999 and, input of the echocardiography as a method for diagnosis and assessment heart lesions. our study was based on the examination of medical records of 388 patients treated from group i, and on the medical records and echocardiograms of 221 patients from group ii. a single pediatric cardiologist executed echocardiograms and every patient underwent three or more examinations, with a mean interval of 15 days. most of the patients have been under and streptococcical prevention, 364 children (93.8%) from first group and 211 (95%) from second group. none of the patients was receiving cardiovascular medications at the time of the echocardiographic examinations. before the examination, weight and stature were recorded and the body surface area was calculated by the dubois and dubois formula. also, blood pressure was measured and 12-lead electrocardiogram record was obtained. all the echocardiograms were performed at rest, without sedation, and included the m- and two - dimensional modes, besides doppler examination with color - flow mapping. the ultrasound systems used were : acuson aspen advanced, acuson sequoia 256 and hewlett packard 2000 sonos. the diastolic and systolic diameters were measured using m - mode in the parasternal short axis view. systolic function and dimensions of the left ventricle were obtained and the ejection fraction was obtained by the teichholtz method, and values equal to or above 55% were considered normal. the severity of mitral and aortic regurgitation, and mitral and aortic stenosis were determined by color - flow doppler evaluation and reported according to the recommendations of the american society of echocardiography. gain settings were optimized by the sonographers as the large variation in body habitus precluded the use of standardized settings. valve leaflet morphology was assessed in parasternal long and short - axis views. when indicated, echocardiophic measurements were interpreted according to the body surface area. from total number of 609 children included in our study, 388 (63.7%) belong to the group i, with nearly equal frequency in males and females (311 male or 51% and 298 female or 49%), aged 5 to 17 years, with a median 11 years. all patients were white, 238 (61.3%) were from rural environments and 150 (38.7%) from urban communities. all children underwent careful clinical examination specifically evaluating for manifestations of rheumatic fever e.g. migratory polyarthritis, chorea minor, carditis, rash, cardiomegaly on a chest radiograph and av - block on the electrocardiogram. data from table 1 shows decreasing number of patients in the end of 80 and, increasing of the number in the beginning of last decade, with peak of incidence in 1993. data of patients from group i, based on the jones criterions ch.minorchorea minor, n.subcut. erythema marginatum in both groups incidence of the carditis and other jones criterions are equal and, basing on the clinical findings (ecg, x - ray chest and especially cardiological findings of the murmurs) in the group i and, echocardiographic findings in the group ii we think that the lesion are as well equal (in group i, 62% has a systolic murmur while in group ii, 61.53% had mitral regurgitation). children who had developed systolic and diastolic murmur in comparison with children who has a three dominate jones criterions. diastolic murmur, card / ch.m carditis / chorea minor manifested jones criterions in patients treated in period 1999 2010. erythema marginatum, the important murmurs in children with acute rheumatic fever and presented carditis are the apical holosystolic murmur of mitral incompetence, the early decrescendo murmur of aortic incompetence and mid - diastolic murmur at the apex (the carey - coombs murmur). most frequent is the soft mitral regurgitant murmur and, this may be pansistolic, or it may peak during late systole. the intensity and (11, 12) in our study in acute stadium of rheumatic fever, 75% of children with carditis and, 1% with chorea minor manifested systolic murmur. the advent of echocardiography has paved the way for a clearer understanding of the pathophysological findings observed in the hearts of patients with rheumatic fever. results from this diagnostic modality have shown that as many as three - fifths of patients without clinical evidence of carditis had significant findings of mitral valvar prolapse, annular dilation, chamber enlargement and multiple valvar regurgitation (13, 14). echocardiography as a method for evaluation of cardiac problems (congenital anomalies and lesion of rheumatic fever) in our division started improving from september 1999. in our study, we noted that from 221 patients with acute rheumatic fever, 198 or 89.59 % manifested echocardiographic parameters of carditis. diagnosis was based in the value of dimensions of the left ventricle and value of fractional shortening or the ejection fraction using teichholz method of calculation. all children with carditis manifested fs fewer than 028. in 28 patients, with signs of heart failure we measured fs from 016 to 021, where 7 of them died, in acute period. carditis is the most common serious manifestation of the acute rheumatic process, since it is the only one that causes death during the acute attack or produces residual disability and late mortality. carditis is seen in up to half of patients with rheumatic fever and it is the usual cause of admission to hospital (15, 16, 17). in both our groups incidence of carditis is equal and much higher than other statistical data : in 348 children (89.6 %) out of 388 in group i and 198 (89.5%) out of 221 children in group ii. in the other side, basing in the still low level of social and health care, it is rule in our institution for hospitalization all patients with rheumatic fever, where in our study polyarthritis and chorea minor were more often manifestations for hospitalization. tricuspid insufficiency rheumatic carditis is a pancarditis and cardiac failure is usually the result of the associated myocarditis. (18) in our study 21 patients (6.0%) out of 348 with carditis from group i, manifested in admission clinical signs of heart failure, while 38 (19.1%) out 198 from group ii. 4 patients from group i and 3 from group ii died during the first 10 days of hospitalization, with signs of congestive heart failure. 2 children from group ii developed several lesion on the mitral valve with high level of insufficiency and, in the inability for surgical correction, died with signs of heart failure and pulmonary edema. the classic findings of rheumatic mitral stenosis involve thickening and fusion of the mitral valve commissural edges and chordae. this result in characteristic abnormalities of the mitral leaflet opening motion and due to commissural fusion, the leaflets open with a doming motion. the degree of chordal thickening and mitral valve commissural fusion is highly variable. in rheumatic heart disease, appearance.(19, 20, 21) initially, this results in reduction of the orifice and conversion of the mitral leaflet - chordal apparatus from a tubular channel to a tunnel shaped orifice. but all these changes we can register in later stages of the disease. there is a continuum between upper limit of physiological and pathological regurgitations, usually graded by a cardiologist.(22, 23, 24) in our study, in the acute stage of the disease, echocardiographic signs of mitral stenosis manifested 29 patient or 13 %. many of these had borderline 1 - 2 centimeters mitral regurgitant jets but did not meet defined pathological doppler criteria. mitral regurgitation (mr) is a commonly encountered morphologic and hemodynamic lesion in patients with rheumatic fever. in our study for complete hemodynamic evaluation of mr we used the full range of echocardiographic techniques, especially color doppler imaging which was the primary echocardiographic tool for detection and quantification of mr. in the determination of the severity of mr we used continual wave and color doppler imaging. we used the average value of three measurements, indexing the regurgitation jet area to left trial size. from 132 of our patients with mr, 28 had trivial, 62 had medium and 42 had severe mr. the absence of universally accepted diagnostic criteria for rheumatic heart disease, in particular the morphological features, presents challenges for clinicians involved with rheumatic heart disease screening and diagnosis. there is some agreement that both morphological features and pathological grade regurgitation need to be present for echocardiographic diagnosis of rheumatic heart disease, but our analysis supports the use of more stringent doppler criteria than were used in earlier studies. ref) further studies to achieve international standardization are required (9, 25, 26). the most common cause of acquired aortic valve disease in children and adults in underdevelopment countries is rheumatic fever. only 3 patients were presented with trivial aortic stenosis. the tricuspid valve is rarely included in rheumatic fever and can be manifested as stensosis or regurgitation. we presented only data of patients which have been treated in our institution, but real number could be much higher, basing in the fact that albanian community boycotted new health institutions organized by serbians. after next four years (1992 - 1994) thousands albanians migrated in the west europe and started supporting their families in kosova. despite of decreasing incidence in the next four years, presented statistical data showed that rheumatic fever remains still the highest in europe. in this period we still did nt have echo machine to perform echocardiography and, this was the reason why we did nt have evaluation of heart lesion and, exact data of type and level of disability of the valves. the tendency of increasing the indecency is present in period 1999 - 2001, despite of them that we do nt have real data during the 1999, where war was in kosova. this can be disserted as a consequence of the war, migration of the population from and to the kosovo, destroyed of the infrastructure and poor health care service. there are several technical factors that must be accounted for determining anatomic orifice size from this approach. we used two - dimensional echocardiography to visualize the actual restrictive orifice of the stenotic mitral valve and its limiting orifice. we also used doppler echocardiography to determine the transvalvular gradient from left atrium to the left ventricle, using the continuous wave doppler and color doppler. in our study it was one of the most important factors in determining severity of mitral stenosis and relation - ship to the patient s functional status. despite results of economic development and increasing level of social and health services kosova still remains one of the most underdevelopment countries in europe, where chronic diseases e.g., cystic fibrosis, seasonal enterocolits, tuberculosis and rheumatic heart disease overload the public health system and contribute to the high morbidity and mortality in these disease states. the number of the affected children with rheumatic fever remains still high, especially during the last war, while, more of them as a consequence left disable of heart lesion. in last decade we started applied echocardiography as a diagnostic method in evaluation and assessment of the carditis and heart lesion. in 1995 veasy, proposed that doppler evidences for mitral and aortic regurgitations be included as one of the minor manifestations in the revised jones criterions provided that rigid echocardiographic rules are employed (6, 8, 10). analysis of current data on the use of echocardiography has made narulla and colleagues move one step further and in 1999 they concluded that the echocardiography and doppler imaging may have a place as a major criterion in the jones s criterions. implementation of this modification to the jones criterions may not be practicable at this point in developing countries unless prospective well - controlled studies are done that demonstrate distinctly superior treatment and prognostic value of detecting carditis in this manner (25, 26). in developing countries exit opportunity for this proposes but, basing on the recent published data and on our experience and results we support this propose. | background : acute rheumatic fever and its sequels, rheumatic heart diseases, remain major unsolved preventable health problems in kosovo population, particularly among the disadvantages indigenous albanian and egyptians people. in kosovo, despite of performing secondary prophylaxis with benzathine penicillin, acute rheumatic fever hospitalization rates have remained essentially unchanged for the last 20 years. the role of echocardiography in the diagnosis of acute rheumatic carditis was established over the last 20 years.aims:in this study we aimed to determine the prevalence of rheumatic heart disease in children from kosovo population with first attack of acute rheumatic fever. also, we presented that echocardiography examination detects a greater prevalence of rheumatic heart disease than other diagnostic procedures. we aimed to compare the sensitivity and specificity of cardiac auscultation, ecg record, lab analysis to echocardiography and to determine the feasibility of specific age in this setting.methods:to optimize accurate diagnosis of rheumatic fever and rheumatic heart disease, we utilized two group models. in the first group of 388 children, hospitalized and treated before 1999, diagnosis of rheumatic fever was decided basing on the clinical and laboratory findings whereas in second group (221 children treated from1999 to 2010) clinical and lab diagnosis were amplified also on the detection by echocardiography.conclusion:in second group, using echocardiography as a method of diagnosis and assessment children with rheumatic fever, we found high rates of undetected rheumatic heart disease in this high - risk group population. echocardiographic examination of children with rheumatic fever for rheumatic heart disease may over diagnose rheumatic heart disease unless congenital mitral valve anomalies and physiological regurgitation are excluded. |
ghana and other countries in sub - saharan africa (ssa) are experiencing an epidemic of cardiovascular diseases propelled by rapidly increasing rates of hypertension. a reciprocal or bidirectional relationship has been postulated for hypertension and end - stage chronic kidney disease (esckd). hypertension is a key pathogenic factor linked to deterioration of kidney function, whilst the most common forms of secondary hypertension are attributable to chronic kidney disease [46 ]. according to commodore - mensah., hypertension is the leading cause of renal failure in ghana, whilst owiredu. estimated a 20-fold higher increased risk of death through cardiovascular complications among chronic kidney disease (ckd) patients than any other cause in the general population. the upsurge in chronic noncommunicable diseases has been attributed to modifiable lifestyle practices characterized by sedentary lifestyle and a resultant obesity [913 ]. evidence that hypertension is related to increases in body fat is well established in the literature [1422 ]. epidemiological studies of the impact of obesity on outcome in chronic kidney disease (ckd) remain conflicting, with several well - designed studies even suggesting a survival advantage for obese end - stage renal disease (esrd) patients [2325 ]. this study sought to compare the association between different modifiable lifestyle practices, adiposity indices, renal function parameters, and hypertension as well as the predictive implications for levels of these parameters in target cardiac organ damage among an urban ghanaian hypertensive population. a hospital - based case - control study was conducted between november 2012 and september 2013. one hundred and eighty (108) nondiabetic hypertensive patients were attending clinic at the komfo anokye teaching hospital (kath) and the precise specialist clinic, all in kumasi, ghana, and sixty - one (61) age - matched normotensive controls were from the kumasi metropolis. the study participants were recruited from a population of adult individuals between the ages of 22 and 87 years. criteria for the case group were patients diagnosed with hypertension who were not suffering from diabetes and were of consent age. the control group were normotensive age - matched healthy individuals with no past history of diabetes, cardiac, renal, and hepatic dysfunction, or dyslipidaemia, living in the kumasi metropolis, who consented to participate in this study. self - reported structured questionnaire was administered to determine duration of hypertension and treatment status, smoking status, alcohol intake, educational level, physical activity levels, occupation, the usage of nonprescribed orthodox and herbal medications, family history of hypertension, current and past symptoms of cerebrovascular disease, and peripheral vascular and coronary heart diseases. blood pressure (bp) and pulse rate measurements were done using the omron m5-i digital fully automatic blood pressure monitor (omron healthcare europe bv wegalaan 57 nl-2132 jd hoofddorp). after participants had sat quietly for at least ten minutes, three measurements were taken at one - minute intervals on the right arm in a seated position, with arm supported at heart level and feet flat on the floor using an appropriate sized cuff. hypertension was diagnosed when the mean of the second and third blood pressure (bp) measurements was equal or above 140/90 mmhg or when participants reported use of antihypertensive medication which was verified from their hospital files [27, 28 ]. anthropometric measurements included height to the nearest millimeter without shoes and weight to the nearest 0.1 kg in light clothing. subjects were weighed on a bathroom scale (zhongshan camry electronic co. ltd., guangdong, china) and their height was measured with a seca stadiometer with the participant standing erect with back straight, heels together, and feet slightly apart at a 60-degree angle. waist circumference (to the nearest centimeter) was measured with a gulick ii spring - loaded measuring tape (gay mills, wi) midway between the inferior angles of the ribs and the suprailiac crests. the hip circumference was measured as the maximal circumference over the hip circumference (hc) at the level of the widest diameter around the gluteal protuberance in centimeters. body mass index (bmi) was calculated by dividing weight (kg) by height squared (m). the waist - to - hip ratio (whr) was calculated by dividing the waist circumference (cm) by the hip circumference (cm). waist - to - height ratio was calculated by dividing the waist circumference (cm) by the height circumference (cm). other calculated adiposity indices were as follows:(1)conicity index (ci) : (1)ci = waist circumference m0.109weight kg / height m(2)abdominal volume index (avi) : (2)avi=2waist c cm2 + 0.7waist c cmhip c cm21000(3)body adiposity index (bai) : (3)bai = hip circumference cmheight m1.518. conicity index (ci) : (1)ci = waist circumference m0.109weight kg / height m abdominal volume index (avi) : (2)avi=2waist c cm2 + 0.7waist c cmhip c cm21000 body adiposity index (bai) : (3)bai = hip circumference cmheight m1.518. venous blood samples were collected after an overnight fast (1216 hours) between 7 am and 10 am. about 5 ml of venous blood was drawn from the antecubital vein of which four ml was dispensed into vacutainer plain tubes and one ml was dispensed into fluoride oxalate tubes. after centrifugation at 500 g for 15 minutes, the serum and plasma were stored at 80c until assayed. parameters that were determined include fasting blood glucose (fbg) to exclude participants with diabetes, urea, creatinine, uric acid, potassium, sodium, and chloride. the methods adopted for the determination of the urea, creatinine, and uric acid were predetermined by the reagent manufacturer (dialab gmbh, iz - n sd, hondastrasse, a-2351 wiener neudorf, austria). ion selective electrode (ise) method was used to assay electrolytes (avl 9180 electrolyte analyzer, roche diagnostics, switzerland, http://www.roche.com/index.htm) at the komfo anokye teaching hospital in kumasi. all other biochemical analytical investigations were carried out at the kumasi centre for collaborative research in tropical medicine (kccr) located at the kwame nkrumah university of science and technology, kumasi. detailed history, physical examination, chest x - ray, 12-lead resting electrocardiogram (ecg), and transthoracic echocardiogram (echo) were done. estimate glomerular filtration rate (gfr) was calculated from serum creatinine according to cockcroft - gault cg equation as follows:(cg)egfr=140ageweight72serum creatinine 0.85 if female. (4v - mdrd)egfr=186scr1.154age0.2031.2120.742 if female.the egfr results from the various renal function equations were used to stratify the study population into five categories corresponding to the five stages of ckd in the k / doqi ckd classification. chronic kidney disease was classified as egfr < 60 ml / min/1.73 m (stages 3, 4 and 5 ; see table 5). heart failure was diagnosed, using the modified framingham criteria for diagnosis of heart failure. major criteria included paroxysmal nocturnal dyspnea, raised jugular venous pressure, cardiomegaly, basal crepitation, s3 gallop, and acute pulmonary oedema. minor criteria included tachycardia, orthopnea, exertional dyspnea, nocturnal cough, hepatomegaly, and diuretic use. heart failure was diagnosed if the participant had two major and one minor or one major and two minor criteria. other complications of hypertension included cardiomegaly (without heart failure), stroke or transient ischaemic attack, and chronic kidney disease. continuous variables were expressed as their mean sem, whereas categorical variables were presented as count and proportion. comparisons of the general characteristics of the hypertensive group against the normotensive group were performed using unpaired t - tests, chi square () tests, or fisher exact tests where appropriate. analysis of variance (anova) and bonferroni post hoc test were used to compare more than two means, whilst a post hoc linear contrast test was used for trend analysis of continuous variables., chicago, usa (http://www.spss.com) version 20.00) and graphpad prism version 6.00 graphpad software, san diego, california, usa (http://www.graphpad.com/), for windows were used for statistical analysis where appropriate. two hundred and forty - one (241) adult ghanaians were recruited for the study. the sociodemographic characteristics of the participants, as shown in table 2, involved 61 (25.3%) normotensives and 180 (74.7%) hypertensives, of which 40 patients representing 16.6% of the study population were newly diagnosed hypertensives who were not on any hypertensive drugs and were classified as drug - naive. significantly self - reported alcohol intake and smoking were both found to be more prevalent among the hypertensives, peaking in each case in the drug - naive group. no significant differences were recorded in the rest of the sociodemographic parameters assessed between the three different groups of participants evaluated in this study (see table 2). among all the parameters evaluated as shown in table 3, no statistically significant variation was recorded between the newly diagnosed hypertensives and their counterparts on treatment. higher anthropometric indices were recorded among both hypertension groups compared with the normotensives ; however, in the case of body mass index (bmi) and waist - to - hip ratio (whr) the difference was not statistically significant. the hypertensives presented with significantly higher mean serum biochemical indices of renal dysfunction and electrolytes levels than their normotensive counterparts. the average concentration of microalbumin excreted in the urine as well as the glomerular filtration rate estimated by both 4v - mdrd and cg equations was comparable among the treatment - nave hypertensives and the normotensives (see table 3). among the general study population after adjusting for age and gender, positive additive changes in waist - to - height ratio (whtr) as well as both the abdominal body frame factors (waist circumference (wc) ; hip circumference (hc)), the abdominal body region volumetric models for central obesity (conicity index (ci) ; abdominal volume index (avi)) and body fat deposition (body adiposity index (bai)) were associated with corresponding incremental changes in the haemodynamic measures (hypertension), the serum biochemical kidney profile measures, and renal insufficiency (decreasing egfr). among the hypertensive subpopulation, positive association was observed between the anthropometric measures and the serum biochemical kidney profile (k, na, cl, urea, creatinine, and ua) as well as renal insufficiency. with the exception of pulse, no significant correlation was observed between the anthropometric measures and the haemodynamic measures among the hypertensive subpopulation. among both the general study population and the hypertension subgroup increasing levels of serum potassium, urea, creatinine, and uric acid significant association between the haemodynamic measures and the serum biochemical kidney profile was more profound in the general study population than the hypertension subgroup (see table 4). among the total population of 241 participants, 13.3% presented with chronic kidney disease (ckd) when assessed by the four - variable modification of diet in renal disease 4v - mdrd equation. all patients presenting with ckd belong to the hypertension group. with the exception of one study participant who was observed to be in stage four by the cockcroft - gault cg equation, all ckd patients observed were in the third stage (see table 5). among the hypertensive patients who were newly diagnosed and thus treatment - nave and those who were on therapy irrespective of the equation used in assessing glomerular filtration rate, the group on therapy recorded a greater percentage of end - stage chronic kidney disease (ckd) than their nave counterparts ; however, with the exception of the chronic kidney disease epidemiology collaboration (ckd - epi) equation (see figure 1(a)), this difference was not statistically significant (see figures 1(a) and 1(c)). with the exception of the cockcroft - gault cg equation (see figure 1(e)), significant gender differences in the incidence of ckd were observed. using the ckd - epi equation, 22.6% of hypertensive females presented with ckd compared to 14.9% of hypertensive males (see figure 1(d)). twenty - one and seven percent (21.7%) of females compared to 12.2% of males presented with ckd as per the four - variable modification of diet in renal disease 4v - mdrd equation (see figure 1(f)). irrespective of the equation used in estimating the glomerular filtration rate (gfr), self - reported nonalcoholics presented with significantly higher percentage of chronic kidney disease (ckd) than the alcoholics (23.6% versus 16.7% ; 30.6% versus 16.7% ; and 20.8% versus 15.7) for chronic kidney disease epidemiology collaboration (ckd - epi), cockcroft - gault cg, and four - variable modification of diet in renal disease 4v - mdrd equations, respectively. from figure 2(d), significantly higher percentage of smokers (37.9%) were observed with ckd, compared to their counterparts who did not smoke (15.9%), a similar outcome was observed with the use of 4v - mdrd where (37.9%) of smokers presented with ckd compared to (13.9%) of nonsmokers (see figure 2). almost all participants presenting with chronic kidney disease (ckd) clustered at the upper quartiles (3rd and 4th) of systolic blood pressure. the exception included 10% of ckd subjects who clustered at the lower quartiles (7.5% and 2.5% for 1st and 2nd quartiles, resp.) of systolic blood pressure when cockcroft - gault cg equation was used to estimate the glomerular filtration rate. percentage cluster distribution by ckd was observed to be significantly tilted toward the upper quartiles of diastolic blood pressure. though not statistically significant, the majority of ckd participants clustered in the third and fourth quartiles of pulse, irrespective of the renal function equation used. the majority of participants presenting with microalbuminuria clustered in the upper quartiles of the haemodynamic parameters evaluated (see figure 3). the prevalence of microalbuminuria among the alcoholic subjects was 32.4% compared to 27.8% among the nonalcoholics. study participants who smoked recorded a higher percentage of microalbuminuria compared to nonsmokers and also a higher number of smokers were found to cluster at increasing levels of microalbuminuria compared to nonsmokers. patients using herbal medicine had higher microalbuminuria (32.7%) than those who were not using herbal medications (27.6%). even though higher microalbuminuria was observed among the physically active group, severity of microalbuminuria was more profound in their nonactive counterparts (see figure 4). in general, significant additive linear relationship was observed for all serum renal biochemical parameters assayed with progressive quartile increment of haemodynamic indices. the exception was observed with the average levels of uric acid among the diastolic quartile cluster distribution, where no significant linearity was observed. irrespective of the renal function equation used in the estimation of the glomerular filtration rate among the study population, participants presenting with cardiac abnormalities (left ventricular hypertrophy - electrocardiograph, left ventricular hypertrophy - echocardiograph, and cardiomegaly - x - ray) recorded significant prevalence of chronic kidney disease compared to their counterparts who were without the specific abnormal heart condition (see table 6). put the calculated incidence of renal insufficiency (egfr < 60 ml / min/1.73 m ; stages 3, 4, and 5) among different hypertensive populations in accra ghana at 4.1% and 27.8%, respectively. the estimates of hypertensive kidney target organ damage burden for the present study (17.80%22.22%) compared to the earlier records in the previous studies but were higher than the former and lower than the latter. the difference in ckd burden for the hypertensive cohort was perhaps due to differences in study population characteristics ; thus, the work of addo. involved a population survey whilst that of osafo. and the present study were hospital - based studies. again the fact that the study of osafo. included 14.7% of subjects with preexisting diabetes mellitus whereas the present study involved only nondiabetic hypertensives may account for the higher ckd incidence recorded in the previous report. adu in an editorial in the ghana medical journal estimated the prevalence of hypertension in the african population at 10% and posited that hypertension accounts for 38.8% of the aetiology of ckd and is possibly the leading cause of target kidney organ damage among this population. the incidence of ckd was higher among the hypertensive study participants on treatment than the treatment - nave group. the increased duration of chronic diseases like hypertension has usually been linked with deterioration of sequelae and survival. also the institution of drug therapy in the management of hypertension is usually associated with advancing disease state and this may account for the higher target kidney organ damage observed among the hypertensives on treatment. gender differences in health vary according to differential vulnerabilities in males and females, which may be as a result of biological or sociodemographic differences [38, 39 ]. in the case of chronic kidney disease among hypertensives, vulnerability seems to be more tilted toward the female gender than the male gender [4, 40 ]. this finding is in agreement with observations made in this study (see figure 1). wang. have suggested that the stronger association between obesity and chronic kidney disease in women than in men could account for this phenomenon. in ghana, obesity is reported to be significantly higher among females than in males [13, 41 ]. among hypertensives, obesity was found to be significantly higher (p = 0.0337) among females (57.5%) compared to the males (40.5%). the raging debate of alcohol consumption as a modifiable lifestyle trait influencing both hypertension and kidney outcomes in the scientific literature has become even more intense in recent times because of the great importance it confers due to the seemingly large numbers of the population any prognostic outcome may affect. in the current study, self - reported alcohol consumption was recorded among more than half of the study population (130 (53.9%)) with a significantly higher presence among the hypertensives than the normotensives (see table 1). deleterious association of alcohol consumption with hypertension is available in the ghanaian literature [10, 42, 43 ]. plausible mechanisms elucidated for such adverse effects include stimulation of corticosteroid, catecholamine, vasopressin production, and drug interaction causing resistance to drug therapy and direct pressor effect due to alcohol induced arteriolar vasoconstriction [4446 ]. the findings of the current study are consistent with those of renaud. and reynolds. both of whom reported an inverse association between alcohol consumption and chronic kidney disease among hypertensives (see figure 2). however, due to our inability to determine the threshold dose level of alcohol intake among the study population, drawing inferences for causality of alcohol dose response was not possible [46, 49 ]. it is therefore appropriate to concur with reynolds. who called for caution in the interpretation of similar results, since epidemiologically a suggested j- or u - shaped relationship exists between alcohol consumption and coronary heart diseases. thus, the apparent benefits of moderate drinking on kidney and coronary heart disease mortality are offset at higher drinking levels by increasing risk of death from other types of heart diseases (cardiomyopathy, arrhythmia, etc.), neurological disorders, cancer, liver cirrhosis, and traffic accidents [46, 50 ]. despite the recent report from the hunt study suggesting smoking is not a major determinant of adverse blood pressure and other component cardiovascular disease risk factors and the report from the population - based malm - diet - and - cancer - cohort which found that the associated risk of cardiovascular disease and cardiovascular disease mortality conferred by genetic variation on chromosome 9p21 may be attenuated by smoking, there is consensus on the association of smoking with adverse cardiovascular and renal outcome [5359 ]. in the present study, self - reported smoking was 13.3% among the total study population and significantly higher among the hypertensives compared to normotensives (16.1% versus 4.9%). in agreement with the findings of adverse renal events associated with cigarette smoking among various study populations [53, 6063 ], current smoking status was associated with chronic kidney disease among hypertensives (see figure 2). plausible mechanisms of smoking attributed renal injury include increased blood pressure and heart rate ; altered diurnal blood pressure rhythm ; increased sympathetic nerve activity ; nicotine induced mesangial cell proliferation and increased production of fibronectin ; arteriosclerosis of renal and intrarenal arteries and arterioles ; growth factor activation (angiotensin ii, endothelin-1, and tgf-1) ; oxidative stress ; impaired lipoprotein and glycosaminoglycan metabolism ; tubulotoxicity ; direct endothelial cell toxicity ; increased aggregation of platelet ; modulation of immune mechanisms ; vasopressin - mediated antidiuresis and insulin resistance [4, 64 ]. excess weight gain is a major risk factor for essential hypertension and end - stage renal disease (esrd) [65, 66 ]. in the present study, higher anthropometric indices were recorded among the hypertensive groups compared to the normotensives and, after adjusting for age and gender, positive additive changes in anthropometric indices were associated with corresponding incremental changes in the haemodynamic measurements (hypertension), the serum kidney profile estimates, and renal insufficiency (decreasing egfr). according to the guyton hypothesis, sustained hypertension can occur only when there is a derangement of pressure natriuresis [6, 67, 68 ]. obesity related resetting of the kidney - fluid apparatus to a hypertensive level is consistent with the model of hypertension by volume overload. documented pathogenic mechanisms include enhanced sympathetic nervous system activity, increased activity of the systemic renin - angiotensin system, low atrial natriuretic peptide levels, and physical compression of the kidneys by fat deposits within and around the kidneys, coupled with increased abdominal pressure due to accumulation of excess visceral fat, all of which can cause sodium retention [65, 7072 ]. this enhanced sodium avidity shifts the pressure natriuresis curve to the right, thereby necessitating higher arterial pressure to excrete the day 's salt intake and maintain sodium balance and volume homeostasis [67, 73 ]. there is an accumulating body of clinical and experimental data implicating obesity as an important causative factor in renal disease [7476 ]. the compensatory mechanisms to maintain sodium balance in obesity in the long term lead to increased systemic arterial pressure, creating a haemodynamic burden on the kidneys which causes glomerular injury. deposition of extracellular matrix throughout the renal medulla and the ducts of bellini compresses the renal parenchyma toward the pole of the kidney resulting in the formation of round - shaped, enlarged kidneys in obese subjects. high blood pressure is a key pathogenic factor that contributes to the deterioration of kidney function. conversely, chronic kidney disease (ckd) is the most common form of secondary hypertension, thus making the kidney both a cause and a victim of hypertension. in the current study, chronic kidney disease was observed only among the participants presenting with hypertension, irrespective of the predictive equation used in estimating the glomerular filtration rate. the association between hypertension and ckd was also evident as percentage cluster distribution of participants presenting with chronic kidney disease predominantly segregated with the upper quartiles (3rd and 4th quartiles) of the haemodynamic indices (sbp, dbp, and pulse ; see figure 3). the strength of association was found to be more pronounced with systolic blood pressure rather than diastolic blood pressure, posing a greater risk for cardiovascular events and kidney disease progression. serum elevation of kidney excretory products like electrolytes and metabolites of purine and amino acid catabolism (uric acid and urea) in hypertensives has traditionally been attributed to decreased glomerular filtration rate (gfr) as a result of the effect of hypertension on renal function. a reduction in renal blood flow as a consequence of increasing renal vascular resistance leads to decreased distal tubular flow rate which leads to increased reabsorption and decreased excretion [68, 79, 80 ]. significantly higher levels of serum electrolytes as well as urea and uric acid were observed among the hypertensive subgroup compared to their normotensive counterparts (see table 2). the assertion that serum kidney excretory products are only secondary to residual confounding factors that have a pathogenically inert relationship with hypertension and renal disease is giving way. serum kidney excretory products are now viewed as pathophysiologically active independent attribution factors for the cause and progression of hypertension and renal disease [8185 ]. linear additive relationship was observed for all serum electrolytes as well as urea and uric acid with progressive quartile increment of haemodynamic indices measured in this study. after adjusting for age and gender in the present study, surfeit urea and uric acid were significantly associated with renal insufficiency (see table 3). often considered a beneficial antioxidant, recent epidemiologic and experimental studies have demonstrated that hyperuricaemia is a major and an independent risk factor for the development of renal disease, hypertension, and adverse cardiovascular outcome [79, 83, 84, 86, 87 ]. possible adverse effects of uric acid on the vasculature have been linked to increased chemokine and cytokine expression, induction of renal vasoconstriction mediated by endothelial dysfunction, activation of the renin - angiotensin system, and stimulation of oxidative stress in vascular smooth muscle cell (vsmc) proliferation, mediated by the mitogen - activated protein (map) kinase pathway and increased vascular c - reactive protein (crp) expression. in this urban population, chronic kidney disease was associated with hypertension and cardiac abnormalities. modifiable lifestyle practices (smoking and alcoholism) increased the risk of hypertension, whilst smoking increased kidney target organ damage among hypertensives. | the surge in prevalence of chronic noncommunicable diseases like hypertension and chronic kidney disease has been linked with modifiable lifestyle practices and increased body fat. this study sought to compare the association between different modifiable lifestyle practices, adiposity indices, renal function parameters, and hypertension as well as the predictive implications for levels of these parameters in target cardiac organ damage among an urban ghanaian hypertensive population. using a hospital - based case - control study design, 241 ghanaian indigenes from the kumasi metropolis were recruited for this study. the case group was made up of 180 hypertensives and 61 normotensives served as controls. in addition to sociodemographic data, standard haemodynamic, anthropometric, renal function, and cardiac organ damage assessments were done. the prevalence of chronic kidney disease (ckd) ranged from 13.3% to 16.6% depending on the equation used in estimating the glomerular filtration rate (egfr). percentage cluster distribution by chronic kidney disease was observed to be significantly tilted toward the upper quartiles (3rd and 4th) of the haemodynamic parameters measured. chronic kidney disease was significantly higher among self - reported smokers and alcoholic hypertensives. in this urban population, adiposity was associated with hypertension and renal insufficiency. chronic kidney disease was associated with hypertension and cardiac abnormalities. |
fatigue, best defined as difficulty in initiating or sustaining voluntary activities, is a common symptom of various illnesses and even occurs in healthy individuals [24 ]. in japan, in contrast, long - term fatigue (chronic fatigue) is sometimes irreversible, and the compensation mechanisms that are useful in reducing acute fatigue are ineffective. thus, to avoid chronic fatigue, it is important to develop effective strategies to recover from and avoid accumulation of acute fatigue. positive effects of hot - water bathing in micro - bubbles on recovery from mental fatigue have been reported. in addition, a warm - water footbath can relieve fatigue, probably because the footbath promotes circulation and removes metabolites such as radical oxygen species, resulting in relief of fatigue. however, it is often difficult to spend a great deal of time under these warm conditions. using heating apparatuses such as a stove, we can easily spend long periods exposed to a warm environment in the cold seasons, which may help in the recovery from mental fatigue. in particular, a pellet stove, which burns compressed wood or biomass pellets, is ecological and generally believed to increase core temperature effectively though its far infrared ray effect. hypothermia has been shown to decrease cerebral blood flow, and cold conditions lead to deterioration of autoregulation of cerebral blood flow. thus, the pellet stove might increase core temperature resulting in the promotion of the recovery of the inactivated cerebral blood flow caused by mental fatigue. since mental fatigue impairs our daily activities, it is of great value to develop effective methods to promote recovery from mental fatigue. the aim of this study was to test the effects of a pellet stove on recovery from mental fatigue using recently established fatigue - inducing and evaluation methods. after a mental fatigue - inducing task, participants moved to a room equipped with or without a pellet stove. we measured mental task performance, various subjective sensations, and autonomic nervous system activities immediately before and after a recovery session from mental fatigue to evaluate the fatigue - recovering effects of spending timing in a room equipped with a pellet stove. sixteen healthy volunteers (28.47.2 years of age [meansd ]) ; seven females and nine males ] were enrolled in this randomized, placebo - controlled, crossover experiment (control and pellet stove conditions). current smokers, individuals having history of medical illness, taking chronic medication, or supplemental vitamins were excluded. the study protocol was approved by the ethics committee of osaka city university, and all the participants provided written informed consent for participation in the study. this study was performed between march 16, 2010, and march 24, 2010. after enrollment, participants were randomly assigned to two groups in a single - blinded, crossover fashion to perform fatigue - inducing and recovery sessions. as a fatigue - inducing mental task, they performed a 2-back test for 30 min, and as fatigue - evaluating mental tasks, they performed advanced trail making tests (atmts) for 20 min just before and after the fatigue - inducing session. they were asked to rate their levels of fatigue, healing, comfort, and warmth on a visual analogue scale (vas) from 0 (minimum) to 100 (maximum) to evaluate their subjective mental state before and after the fatigue - inducing task. participants also underwent accelerated plethysmography (apg) before and after the fatigue - inducing task. then they moved to a recovery room. during the recovery session, they sat on a floor quietly for 30 min in a room equipped with either a pellet stove (modanro ; kondo tekko co., ltd., nagano, japan) (pellet stove condition) or a monitor on which a pellet stove was displayed (control condition). after the recovery session, they were again subjected to the evaluation of atmts, vas, and apg. the study was conducted in a quiet temperature- and humidity - controlled environment, and the temperature and humidity were similar between the pellet and control stove conditions. for 1 day before each visit, participants refrained from intense mental and physical activity, consumed a normal diet and beverages, and maintained normal sleeping hours. as a fatigue - inducing task, participants performed a 2-back test for 30 min. either of four types of letters was continually presented on a display of a personal computer every 3 sec. participants had to judge whether the target letter presented at the center of the screen was the same as the one that had appeared two presentations before. if it was, they were to click the right mouse button with their right middle finger ; if it was not, they were to click the left mouse button. they were instructed to perform the task trials as quickly and as correctly as possible. correct response or error was continually presented on the display of the personal computer. as fatigue - evaluation tasks, participants performed atmts for 20 min. during these tests, circles numbered from 1 to 25 were randomly located on the display of a personal computer, and participants were required to click these circles in sequence using a computer mouse, starting with circle number 1. when they clicked the 25 target, the atmt was considered completed. in atmt task a, when they clicked a target circle, it remained at the same position, but the color of the circle changed from black to yellow. in atmt task b, when they clicked the first target circle, it disappeared, and circle number 26 appeared in a different position on the screen. subsequently, clicking, for example, circles 2, 3, and 4 resulted in these particular circles disappearing and the addition of circles 27, 28, and 29 on the screen, so that the number of circles seen on the screen was always 25. in atmt task c, when participants clicked the first target circle, it disappeared and circle number 26 appeared in a different position on the screen, and the positions of all other circles were changed at random. subsequently, clicking, for example, circles 2, 3, and 4 resulted in these particular circles disappearing and the addition of circles 27, 28, and 29 on the screen, so that the number of circles seen on the screen was always 25. they were instructed to perform these task trials as quickly and as correctly as possible., apg was performed using a pulsimeter (artett, u - medica, osaka, japan) with the sensor positioned on the tip of the ventral side of the index finger. photoplethysmography was used to measure changes in the absorption of light by hemoglobin, which is related to blood flow volume. the pulsimeter performed automatic analyses of the second derivative of the photoplethysmographic waveform, which is known as the apg waveform. the apg waveform consists of four waves in systole (a d) and one in diastole (e). sensor output of the pulsimeter was preprocessed by a second - order analog low - pass filter with 23 hz of cut off frequency. data were recorded (3.3 volts to 10 bits) using an analog - to - digital converter and real - time at a sampling rate of 1,000 samples per second. these digital data were processed with the 67 order, finite impulse - response filter using the hanning window. detected peak times were interpolated to sub - millisecond order. the resolution ability for the power spectrum was 0.001 hz. for the frequency analyses, the total power was calculated as the power within a frequency range of 00.4 hz, the low - frequency component power (lf) was calculated as the power within a frequency range of 0.040.15 hz, and the high - frequency component power (hf) was calculated as that within a frequency range of 0.150.4 hz. lf and hf were assessed in normalized units ; normalization was performed by dividing the absolute power of each component by the total variance and then multiplying by 100. the % hf is vagally mediated [1820 ], whereas % lf originates from a variety of sympathetic and vagal mechanisms. the paired t - test was used to evaluate the significance of differences between the control and pellet stove conditions. to control for intraindividual variability of baseline values before the recovery session, changes from values before the recovery session to those after the recovery session, were calculated. all p values were 2-tailed, and those less than 0.05 were considered statistically significant. statistical analyses were performed using spss 17.0j (spss inc, chicago, il, usa). sixteen healthy volunteers (28.47.2 years of age [meansd ]) ; seven females and nine males ] were enrolled in this randomized, placebo - controlled, crossover experiment (control and pellet stove conditions). current smokers, individuals having history of medical illness, taking chronic medication, or supplemental vitamins were excluded. the study protocol was approved by the ethics committee of osaka city university, and all the participants provided written informed consent for participation in the study. this study was performed between march 16, 2010, and march 24, 2010. after enrollment, participants were randomly assigned to two groups in a single - blinded, crossover fashion to perform fatigue - inducing and recovery sessions. as a fatigue - inducing mental task, they performed a 2-back test for 30 min, and as fatigue - evaluating mental tasks, they performed advanced trail making tests (atmts) for 20 min just before and after the fatigue - inducing session. they were asked to rate their levels of fatigue, healing, comfort, and warmth on a visual analogue scale (vas) from 0 (minimum) to 100 (maximum) to evaluate their subjective mental state before and after the fatigue - inducing task. participants also underwent accelerated plethysmography (apg) before and after the fatigue - inducing task., they sat on a floor quietly for 30 min in a room equipped with either a pellet stove (modanro ; kondo tekko co., ltd., nagano, japan) (pellet stove condition) or a monitor on which a pellet stove was displayed (control condition). after the recovery session, they were again subjected to the evaluation of atmts, vas, and apg. the study was conducted in a quiet temperature- and humidity - controlled environment, and the temperature and humidity were similar between the pellet and control stove conditions. for 1 day before each visit, participants refrained from intense mental and physical activity, consumed a normal diet and beverages, and maintained normal sleeping hours. as a fatigue - inducing task, participants performed a 2-back test for 30 min. either of four types of letters was continually presented on a display of a personal computer every 3 sec. participants had to judge whether the target letter presented at the center of the screen was the same as the one that had appeared two presentations before. if it was, they were to click the right mouse button with their right middle finger ; if it was not, they were to click the left mouse button. they were instructed to perform the task trials as quickly and as correctly as possible. correct response or error was continually presented on the display of the personal computer. as fatigue - evaluation tasks, participants performed atmts for 20 min. during these tests, circles numbered from 1 to 25 were randomly located on the display of a personal computer, and participants were required to click these circles in sequence using a computer mouse, starting with circle number 1. when they clicked the 25 target, the atmt was considered completed. in atmt task a, when they clicked a target circle, it remained at the same position, but the color of the circle changed from black to yellow. in atmt task b, when they clicked the first target circle, it disappeared, and circle number 26 appeared in a different position on the screen. subsequently, clicking, for example, circles 2, 3, and 4 resulted in these particular circles disappearing and the addition of circles 27, 28, and 29 on the screen, so that the number of circles seen on the screen was always 25. in atmt task c, when participants clicked the first target circle, it disappeared and circle number 26 appeared in a different position on the screen, and the positions of all other circles were changed at random. subsequently, clicking, for example, circles 2, 3, and 4 resulted in these particular circles disappearing and the addition of circles 27, 28, and 29 on the screen, so that the number of circles seen on the screen was always 25. they were instructed to perform these task trials as quickly and as correctly as possible., apg was performed using a pulsimeter (artett, u - medica, osaka, japan) with the sensor positioned on the tip of the ventral side of the index finger. photoplethysmography was used to measure changes in the absorption of light by hemoglobin, which is related to blood flow volume. the pulsimeter performed automatic analyses of the second derivative of the photoplethysmographic waveform, which is known as the apg waveform. the apg waveform consists of four waves in systole (a d) and one in diastole (e). sensor output of the pulsimeter was preprocessed by a second - order analog low - pass filter with 23 hz of cut off frequency. data were recorded (3.3 volts to 10 bits) using an analog - to - digital converter and real - time at a sampling rate of 1,000 samples per second. these digital data were processed with the 67 order, finite impulse - response filter using the hanning window. detected peak times were interpolated to sub - millisecond order. the resolution ability for the power spectrum was 0.001 hz. for the frequency analyses, the total power was calculated as the power within a frequency range of 00.4 hz, the low - frequency component power (lf) was calculated as the power within a frequency range of 0.040.15 hz, and the high - frequency component power (hf) was calculated as that within a frequency range of 0.150.4 hz. lf and hf were assessed in normalized units ; normalization was performed by dividing the absolute power of each component by the total variance and then multiplying by 100. the % hf is vagally mediated [1820 ], whereas % lf originates from a variety of sympathetic and vagal mechanisms. the paired t - test was used to evaluate the significance of differences between the control and pellet stove conditions. to control for intraindividual variability of baseline values before the recovery session, changes from values before the recovery session to those after the recovery session, were calculated. all p values were 2-tailed, and those less than 0.05 were considered statistically significant. statistical analyses were performed using spss 17.0j (spss inc, chicago, il, usa). subjective parameters before and after the fatigue - inducing sessions and after the recovery session are shown in table 1. vas scores for fatigue, healing, comfort, and warmth before and after the fatigue - inducing sessions did not differ significantly between the control and pellet stove conditions. after the recovery session, subjective scores for fatigue were significantly lower in the pellet stove condition compared with the control condition, and values for comfort and warmth were significantly higher than those in the control condition. changes of subjective scores for comfort and warmth in the pellet stove condition were significantly higher than those in the control condition and changes in values for healing trended toward significance (table 2). cognitive task parameters before and after the fatigue - inducing sessions and after the recovery session are shown in table 3, and changes of the performances of the cognitive tasks after the recovery session are shown in figure 1. although changes in total trial counts after the recovery session did not differ between the control and pellet stove conditions, changes in total error counts in the pellet stove condition were significantly lower than that in the control condition. apg parameters before and after the fatigue - inducing sessions and after the recovery session are shown in table 3, and changes of the apg parameters after the recovery session are shown in figure 2. changes in the sympathetic nerve activity after the recovery session in the pellet stove condition were significantly lower than those in the control condition ; and changes of parasympathetic nerve activity in the pellet stove condition were significantly higher than that in the control condition. we found that mental task performance after the recovery session in the pellet stove condition was better than that in the control condition. in addition, higher levels of subjective healing, comfort, and warmth, and lower sympathetic nerve activity and higherpara sympathetic nerve activity were seen in the pellet stove condition compared with the control condition. these results provide evidence that improved cognitive function, subjective mental states, and balance of the autonomic nervous system activities resulted from using a pellet stove during a period of recovery from mental fatigue. our results are consistent with the results of a previous report of hot - water bathing in micro - bubbles ; although temperature of the water was similar between the bathing in micro - bubbles and the normal bathing, subjective level of warmth was higher in the micro - bubble - bathing condition, and simultaneously this bathing condition showed positive effects on recovery from mental fatigue. previously, we showed that participants were fatigued by performing 30-min 2-back test trials through the evaluations of the task performance of atmts just before and after the mental fatigue - inducing session ; after the mental fatigue - inducing session, the total error counts of the cognitive tests increased. because the performance of the cognitive tasks is thought to require selective attention, the decreased total error counts after the recovery session in the pellet stove condition might be caused by an increase in the ability to maintain selective attention. the brain network, including the prefrontal cortex (pfc) and anterior cingulate cortex (acc), has been shown to play an important role in the regulation of autonomic nervous system activities. decreased parasympathetic activity and increased sympathetic activity are interpreted as a state of autonomic hypervigilance, and sympathoexcitatory subcortical circuits are normally under the inhibitory control of the pfc [2527 ]. because impaired selective attention assessed by increased error counts of the atmts was observed after the fatigue - inducing task, and the selective attention process activates the pfc and acc [3033 ], acute mental load might introduce temporary dysfunctions in the pfc and acc to cause decreased parasympathetic and increased sympathetic activities as well as inability to use selective attention. considering that the pellet stove condition showed an increased ability in participants to use selective attention and increased parasympathetic and decreased sympathetic activities, the pellet stove may be effective for recovery from mental fatigue through the activation of the pfc and acc. the mechanism by which the pellet stove was effective for the recovery from mental fatigue is not clear. however, subjective level of warmth was higher in the pellet stove condition although temperature of the rooms was similar between the pellet stove and the control condition. hypothermia has been shown to decrease cerebral blood flow, and cold conditions lead to deterioration of autoregulation of cerebral blood flow. thus, one possible mechanism for the effects seen in this study is that the pellet stove increased core temperature resulting in the promotion of the recovery of the inactivated cerebral blood flow and function in the pfc and acc. first, we conducted this study with a limited number of participants. to generalize our results, studies involving a larger number of participants are essential. further studies are necessary to clarify the mechanisms of the pellet stove to accelerate the recovery from mental fatigue. in conclusion, we demonstrated that the pellet stove was effective for recovery from mental fatigue. to avoid chronic fatigue, it is important to develop effective strategies to attenuate and recover from acute mental fatigue. use of a pellet stove might prevent unfavorable situations as a result of accumulated acute mental fatigue. | summarybackgroundexposure to a warm environment has been reported to be effective for recovery from mental fatigue. however, there have been no reports examining the effects of a pellet stove on recovery from mental fatigue. the purpose of this study was to examine the effects of a pellet stove on recovery from mental fatigue.material/methodsin this placebo - controlled, crossover experiment, 16 healthy volunteers were randomized into the pellet stove and control groups. after a 30-min fatigue - inducing mental task session, participants moved to a recovery room with (pellet stove condition) or without (control condition) a pellet stove to see the image of a pellet stove for 30 min.resultsafter the recovery session, the participants exposed to the pellet stove condition showed lower total error counts of a cognitive test, higher levels of subjective healing, comfort, and warmth, and sympathetic nerve activity and higher parasympathetic nerve activity as compared with the control condition.conclusionsthese results provide evidence that improved cognitive function, subjective mental states, and balance of the autonomic nervous activities result from using a pellet stove during the recovery session. hence, the pellet stove was effective for the recovery from mental fatigue. |
it demonstrates an elastotic degeneration of the collagen as a result of excessive ultraviolet exposure. majority of pterygium occurs in the nasal side, but it is not uncommon to encounter double - head pterygium in the pterygium belt pterygium can affect vision by causing tear film instability, inducing corneal astigmatism or blocking the visual axis. simple excision of pterygium leaving behind an area of bare sclera has a high recurrence rate ranging from 24 to 89%. therefore, there are many adopted methods to augment the long - term success of pterygium surgery. commonly used adjuvants in the literature include conjunctival autograft (cau), limbal - conjunctival autograft (lcau), mitomycin c (mmc), and amniotic membrane transplantation (amt). lcau was showed to be superior to mmc in pterygium surgery in a 10-year follow - up study of a randomized controlled trial published recently in the literature [8, 9 ]. comparison between cau and lcau reported similar success between the two methods in primary pterygium and a superior effectiveness of lcau in recurrent cases. the present study is a 12-year follow - up study comparing the long - term outcomes and complications of double - head pterygium surgery with cau to one head and mmc application to the opposite head of the same eye. this is a follow - up study of a comparative interventional trial, which was approved by the research ethics committees of the chinese university of hong kong and adhered to the tenets of the declaration of helsinki. in the original study, 39 eyes of 36 patients with double - head pterygium were randomized to receive cau to one head of the pterygium and mmc application by being defaulted to the opposite head. randomization was done by choosing between two sealed envelopes, labeled nasal pterygium with ca in one and nasal pterygium with mmc in another. the same surgeon (ey) performed all surgeries at hong kong eye hospital during the period of may 2000 to june 2001. in this follow - up study, patients in this cohort were invited back to the hospital for clinical examination in september to december 2013 to document the long - term outcomes and complications of the two adjuvants in pterygium surgery. clinical examination of the anterior segment and optic disc, intraocular pressure measurement and slit - lamp photography were performed. this follow - up study was approved by the institutional review board of the hospital authority. in the original study, pterygium size and morphology size of pterygium was measured from limbus to the head of pterygium and the longest diameter was taken. pterygium was graded into atrophic, intermediate, and fleshy according to the visualization of episcleral vessels underneath the pterygium body with clearly distinguished vessels seen in atrophic type and totally obscured view in fleshy type. intraoperative mmc (0.02%) was applied directly to the bare sclera using moist vitreous sponges for 5 minutes. the site of mmc application was irrigated thoroughly with at least 50 ml of balanced salt solution. the conjunctiva peripheral to the excised pterygium was then sutured to the episclera. on the pterygium head receiving cau, a free conjunctival graft was harvested from the superior region of the same eye with dimensions 1 mm larger than the recipient bed. the free graft was then secured to the recipient bed respecting its polarity with interrupted 8.0 polyglactin. postoperative treatment included a topical steroid (dexamethasone) and antibiotic (chloramphenicol) four times daily for 4 weeks. the first - year result of the original study was presented in a local scientific conference in hong kong without publication in the literature. in the current follow - up study, grade a represents the appearance of the operated site is not different from the normal appearance ; grade b represents some fine episcleral vessels in the excised area extend up to but not beyond the limbus and without fibrous tissue ; grade c represents additional fibrous tissue is in the excised area but does not invade the cornea ; grade d represents fibrovascular tissue invades the cornea and was defined as recurrence in this follow - up study. two independent assessors (rw and el), who were blinded to treatment each pterygium received, determined disease recurrence and conjunctival bed grading. a lesion was considered as recurrence if one assessor agreed on a disease relapse. as for the conjunctival bed status, the higher grading would be chosen if there was a discrepancy between grading scored by the two assessors. long - term complications related to cau or mmc involving the cornea and scleral bed are the secondary outcome measures of the study. information regarding recurrence and complications by the first postoperative year was traced from the medical records and record of the original study. statistical analysis was performed using pasw software version 18.0 (spss / ibm, inc., chi - square and mann - whitney u test were used to compare qualitative and quantitative variables, respectively, between groups. there were 39 eyes (78 pterygia) of 36 patients recruited in the original study. the mean follow - up period was 155 4 months (12.9 years). the response rate was 82.1% with 32 eyes (64 pterygia) completing this follow - up study. six patients (6 eyes) passed away before this follow - up study ; one patient (1 eye) was lost to contact. twenty - seven eyes of 25 patients were assessed in the clinic, while disease recurrence was determined from telephone interview in 4 patients (5 eyes) who were unable to attend the clinic. supplementary photographs were obtained from those 4 patients for determination of recurrence, but conjunctival bed grading was not performed in them. demographic and clinical data of patients who completed and defaulted the follow - up study was summarized in table 1. there was no significant difference in pterygium size (p = 0.412), morphology (p = 0.251), and type (p = 0.792) between the completed and defaulted patients apart from age, which was significantly older in the defaulted patients (p = 0.016). preoperative characteristics of the pterygium between the treatment groups in the current follow - up study were summarized in table 2. there was no significant difference in size (p = 0.403), morphology (p = 0.749), and type (p = 0.740) of the pterygium between the cau and mmc groups. thirteen nasal pterygia were treated with cau after excision, and 19 nasal pterygia were treated with mmc. moreover, there was no significant difference in size (p = 0.512), morphology (p = 0.414), and type (p = 0.740) between nasal and temporal pterygium. the cohen 's kappa coefficient, which is a statistical measure of interassessors agreement, was 0.81 signifying almost perfect agreement between the two assessors in the current study. recurrence of pterygium was noted in 1 case in the cau group (2.56%) and 6 cases in the mmc group (15.4%) one year after the operation. the difference in recurrence rate was statistically significant between the two treatment groups (p = 0.048). significant difference in recurrence rate was also noted between the two groups 12 years after the pterygium operation. there were 2 cases of recurrence in the cau group (6.25%), and 9 cases in the mmc group five recurrent cases were nasal pterygium, and 6 recurrent cases were located on the temporal side (p = 740). among the cases with recurrence observed, all but one were primary pterygium before the operation performed in the study (p = 0.434). it was excised and treated with mmc in the original study, but it recurred 3 months afterwards. all the recurrent cases did not undergo further pterygium operations and were managed conservatively according to the patients ' preference. grading of conjunctival bed was summarized in table 4. among the eyes with no disease recurrence on either side (38 pterygia in 19 eyes), conjunctival beds previously treated with mmc were graded higher than the beds covered with cau in the same eye (p = 0.024). eight eyes showed higher conjunctival bed grades after mmc treatment than that after cau treatment 12 years after the surgery. difference in conjunctival bed grades was not significant between sites (nasal or temporal) of pterygium (p = 0.333). diffuse punctate epithelial erosions were seen in 8 eyes (20.5%) and all resolved with topical lubricants. corneal dellen, conjunctival cyst, pyogenic granuloma, symblepharon, and subconjunctival fibrosis were not observed at sites previously covered with autograft and at the harvest site of cau. as for the mmc group, severe complications including scleral thinning and melting, corneal decompensation, and glaucoma were not detected in any patient attending the follow - up at 12 years after the double - head pterygium surgery. there are various techniques developed to minimize disease recurrence with cau and mmc the two most commonly adopted adjuvants. adjuvants including cau and mmc in pterygium surgery have been summarized in a recently published review article. cau has been shown to be an effective procedure, with recurrence rates ranging from 2% to 39% after primary pterygium excision [11, 1315 ]. on the contrary, mmc is an alkylating agent that prevents cellular activity by inhibiting dna synthesis. previous studies showed recurrence rates varying from 3% to 38% in primary pterygium when mmc was used intraoperatively [6, 1618 ]. however, the use of mmc may lead to severe ocular complications including scleral thinning and necrosis, corneal decompensation, and glaucoma [1922 ]. the current study had a high response rate with more than 80% of patients participating in the follow - up study. the double - head pterygium in each eye received cau on one side and mmc on the other as adjuncts, and the pairwise comparison of treatment effects in the same eye minimized interpersonal variability as a confounder. randomizing the treatment arm to either nasal or temporal pterygium also reduced confounding effect arising from the lesion site. although there was no difference in the preoperative characteristic of pterygium, such as the size, site, morphology, and type between the 2 study groups, the list of confounding variables is not exhaustive. it is important to note that direct comparison among different studies is difficult because there are variations in surgical techniques including extent of excision and application of mmc, follow - up duration, and definition of recurrence. the recurrence rate of pterygium after cau was significantly lower than that of mmc in the current study. several studies in the literature demonstrated a trend favoring cau over intraoperative mmc for prevention of pterygium recurrence [15, 16, 23 ]. similar findings were observed in a recently published randomized controlled study with 10-year follow - up, which showed a recurrent rate of 6.9% after lcau and 25.5% after mmc. by including the limbal epithelium in the conjunctival graft the 10-year recurrence rates after lcau and mmc reported by young. were similar to the 12-years recurrence rates after cau and mmc in our study. reports have shown that both lcau and cau were effective in preventing recurrence after pterygium excision, though lcau showed slight advantage over cau in recurrence rate in recurrent pterygium [10, 24 ]. the current study demonstrated a comparable success with cau in terms of long - term pterygium recurrence rate and the lack of complications such as corneal dellen, conjunctival cyst, pyogenic granuloma, symblepharon, and subconjunctival fibrosis. conjunctival bed grading was found to be significantly higher after mmc treatment when compared to that after cau. this finding was consistent with a higher recurrence rate after mmc treatment as shown in current study. although there was no long - term complication observed between the two adjuvants in this study, adjuvant mmc treatment after pterygium excision was shown to be inferior to cau in preventing recurrence. it is interested to see that there was an ongoing recurrence in the mmc group (3 eyes) after the first 1 year of pterygium excision, while all the recurrence took place within 1 year in the cau group. in a 10-year follow - up study by young., there was 1 recurrent case in the lcau group and 3 recurrent cases in the mmc group after the first postoperative year. on the contrary, koranyi. did not observe any recurrence after the 12 months visit in a 4-year comparative study between cau and mmc in primary pterygium surgery. survival curve analysis also showed that there was a 97% chance that there would be a recurrence within 1 year of pterygium removal. the ongoing recurrence observed could be the result of persistent ocular inflammation or irritation in the site previously managed with intraoperative mmc while leaving the bare sclera behind., we were not able to identify the exact time of pterygium recurrence during the extended follow - up period because all the patients were discharged from the original study (1 year) before they were invited back for the current follow - up study. nevertheless, majority of the recurrence cases occurred within the first postoperative year ; this may signify the need to monitor patient who underwent pterygium excision for at least a year before discharge. moreover, this study was also a noncomparative analysis of using cau and mmc in double - head pterygium surgery. in the current study, recurrence was found in 28% of our cases (9 of the 32 eyes). two eyes had recurrence over both heads, and 7 eyes had recurrence over either head treated with mmc previously. other options in double - head pterygium surgery included rotational cau, split - cau, sequential cau, mmc, and amt. all of these treatments aimed at preventing recurrence despite the larger conjunctival defects remained after removal of the two heads. a previous interventional cohort in our hospital involved combining rotational cau and cau. rotational cau was harvested from the larger pterygium and placed over the conjunctival defect of the smaller pterygium with 180-degree rotation. the defect of the larger pterygium was then covered with cau harvested from the superior bulbar conjunctiva. another way to cover the bare sclera was using split - cau. split - cau aimed at covering both conjunctival defects with a large cau divided from the superior bulbar conjunctiva. no recurrence was found in a retrospective evaluation of 7 eyes over a mean follow - up period of 18 months. however, adequate exposure may be difficult in small chinese eyes. by performing sequential cau to each head separately, a canadian group showed only 1 nasal recurrence (5.6%) after 2 years in a retrospective study of 9 eyes. this allowed cau to each head but avoiding extensive cau dissection. on the other hand, intraoperative mmc application was used solely after double - head pterygium excision in a case series of 13 eyes. in this case series, 1 eye (8.0%) had recurrence in a follow - up period of 3 years. similar recurrence rate (9.1%) was shown with amt after extensive conjunctival excision of 11 eyes observed for 1 year. although the results of our study appeared to be inferior to other studies in the literature, most studies were limited by the small sample size, short follow - up duration, and retrospective nature, making direct comparison difficult among them. this is understandable as the reported incidence of double - head pterygium was less than 3%, making case recruitment difficult. the current method we adopted for double - head pterygium surgery is combining cau with rotational cau or amt to cover the bare sclera. in conclusion, both cau and mmc were shown to be safe adjuvants in pterygium surgery. cau appeared to be a better choice with lower recurrence rate and better conjunctival appearance when compared to mmc. bare sclera pterygium excision in the presence of adjuvant mmc should not be performed given the significantly high rate of long - term recurrence. | purpose. the study aims to compare the long - term outcome of conjunctival autograft (cau) and mitomycin c (mmc) in double - head pterygium surgery. methods. this is a follow - up study of a comparative interventional trial. thirty - nine eyes of the 36 patients with double - head pterygium excision in the original study 12 years ago were recruited for clinical assessment. seven out of the 36 patients were lost. in the original study, each eye with double - head pterygium was randomized to have pterygium excision with cau on one head (temporal or nasal) and mmc on the other head. all patients were invited for clinical assessment for conjunctival bed status and the presence of pterygium recurrence in the current study. results. there was no significant difference between the size, morphology, and type of pterygium among the two treatment groups. the recurrence rate of cau group and mmc group 12 years after excision was 6.3% and 28.1%, respectively (p = 0.020). among eyes without recurrence, the conjunctival bed was graded higher in the mmc group than the cau group (p = 0.024). conclusion. the use of conjunctival autograft has a significantly lower long - term recurrence rate than mitomycin c in double - head pterygium surgery. |
a 25-year - old systemically healthy male patient presented with complaints of severe photophobia, redness, discharge, pain and severe swelling of the lids in the left eye, since two days. past history was significant for a boil on the lower eyelid, two days ago. on examination, the best - corrected visual acuity was 20/20 and 20/30, in the right and left eyes respectively. the left eye showed severe lid edema with scales on the skin and associated kerato - conjunctivitis [fig. photographic documentation of the anterior segment condition was impossible because of the severe photophobia. a conjunctival swab and a periorbital skin swab were sent for culture and sensitivity. the patient was seen by our infectious diseases expert and started on intravenous co - amoxiclav (augmentin, glaxosmithkline) 1 g twice daily, intravenous ceftriaxone (ceftriaxone sodium, sandoz, novartis) 1 g twice daily and oral metronidazole (flagyl, searle) 500 mg three times daily, pending sensitivity reports. topical loteprednol etabonate (0.5%) (alrex eye drops, bausch and lomb incorporated) every three hourly and ciprofloxacin (0.3%) (ciplox eye drops, cipla) six times a day were started, in the left eye. on follow - up two days later, the skin scabs had fallen off, revealing violaceous, sub - epidermal necrosis. the conjunctival inflammation had reduced and the corneal marginal infiltrates had almost disappeared [fig. the culture plates for corneal infiltrates showed negative growth and were discarded after three weeks. five days later, the skin lesions had healed and the conjunctivitis had resolved. intravenous antibiotics were stopped and the patient was started on oral co - amoxiclav (augmentin, glaxosmithkline), 625 mg thrice a day, for a week. on final follow - up a month later, periocular skin discoloration was the only sequalae noted [fig. 2 ]. infections in the periocular region occur post surgical procedures, post trauma, furunculosis or even without any antecedent cause.2 ideally, a combination of intensive parenteral antimicrobial therapy and prompt surgical debridement of necrotic tissue should be done. intravenous pooled immunoglobulin and heparinization may also have beneficial roles by neutralizing super - antigen activity and aiding antibiotic perfusion.4 necrotizing fasciitis is a clinical diagnosis. necrotizing fasciitis limited to the eyelids looks and behaves differently from nf affecting other parts of the body, due to the excellent blood supply in the eyelid area.3 mild cases, especially those restricted to the eyelids alone may respond to medical therapy. the increased blood supply allows for delayed debridement, because the local vasculature allows for better access of the systemic antibiotics to the infected area. the marginal zone of tissue surrounding the infected area has better local blood supply and hence a higher chance of avoiding necrosis.3 we report the case of a 25-year - old male patient who presented with periocular nf associated with kerato - conjunctivitis. the paucity of literature regarding this entity, in association with staphylococcus - induced periocular nf probably stems from an under - reporting bias. these infiltrates are usually the result of an immunological reaction with staphylococcal antigens but in cases with severe infection as in our patient, the infiltrates need to be cultured for an infectious etiology. the patient responded to conservative medical management with systemic antibiotics, topical antibiotics and topical steroids. we report this case to highlight the successful conservative management of periocular nf and the hitherto unreported anterior segment involvement. | we report a 25-year - old systemically healthy male who presented with periocular necrotizing fasciitis (nf) in the left eyelid. this was associated with the presence of immunologically mediated marginal kerato - conjunctivitis, in the same eye. this potentially dangerous lid infection and the associated ocular surface infection resolved successfully, with medical management. we report this case to highlight the successful conservative management of periocular nf and the hitherto unreported anterior segment involvement. |
metabotropic glutamate receptors, members of the g protein - coupled receptor superfamily, are widely distributed throughout the central nervous system (cns) on neuronal and glial cells. during the past two decades, a body of scientific evidence has accumulated indicating that metabotropic glutamate receptors play a substantial role in many cns diseases and psychiatric disorders [1, 2 ]. given their discrete localization within the human brain and thence the possibility of limiting off - target effect, metabotropic glutamate receptors subtype 5 (mglur5) have been proposed as an attractive novel therapeutic target worth investigating. in this context, negative allosteric modulation of mglur5 has been suggested for the treatment of mental disorders, such as anxiety disorders and depression, and more recently for treatment of alcohol and drug addiction [1, 2 ]. a number of mglur5 antagonists and selective nams have been identified in the last decade. selective mglur5-nams have been reported to possess higher potency, selectivity, and brain penetrance and demonstrate a better safety profile compared to mglur5 competitive antagonists. however, relevant mglur5-nam - related adverse effects including cognitive and memory impairments and psychotomimetic effects have also been reported [1, 3].the exact underlying mechanism and implication of mglur5 in the pathogenesis of these adverse effects remain to be verified. an overview of studies evaluating mglur5 in preclinical and clinical settings is provided in the review papers of gregory. and durand.. here we report our clinical and pharmacological experience with bidaily ascending oral doses of mglur5-nam administered to a cohort of 18 young healthy female volunteers. the medication used in this trial, a mglur5-nam, is a structurally novel lipophilic compound with a log p value of 4.7. in previous exploratory pharmacokinetic assessments of this medication (data not published), the following drug characteristics were obtained : time to maximum exposure (tmax) : 2 h, half - life (t1/2) : 7 h and plasma albumin binding : > 97%. a positive food effect on oral bioavailability particularly cmax was found. the test drug is a noninhibitor, noninducer substrate of cyp 2c, cyp 1a1, and cyp3a4. elimination of the parent drug and its metabolite occur mainly via the faecal route. in faeces, a cohort of 23 healthy nonsmoking female subjects aged between 18 and 37 years with a mean age of 24.2 years were recruited to participate in a phase i clinical trial to evaluate the potential pharmacokinetic interaction between a novel mglur5-nam, test drug, and a monophasic oral contraceptive (oc). the current report demonstrates a subanalysis of pooled data from 18 female subjects enrolled in a phase i drug - oc interaction clinical trial. the clinical trial protocol, related amendments, and informed consent including statement of willingness to participate in the clinical study (english and dutch) were reviewed (from legal, ethical, and medical points of view) and approved by the independent ethics committee, of the evaluation of ethics in biomedical research the medical history (as indicated by subjects own reports and confirmed by subjects general practitioners) including history of psychiatric diseases, alcohol and drug abuse, physical examinations, thorough laboratory investigations, and ecg assessments indicated the mental and physical healthy, drug nonaddiction states of all participants. no positive family history of mood disorders was obtained from any of the study participants. written informed consent was obtained from all 23 subjects before initiation of any study - related procedure. data obtained from five of the 23 consented subjects has not been included in the statistical analysis of this report. two subjects were prematurely removed on the second and third days after starting the study (during dose up - titration period), having demonstrated severe drug - induced hallucinations during the first and second dosing days. both subjects did not complete the study, and therefore, data required for statistical analysis were not collected / unavailable. one subject developed urinary tract infection and was removed from the study before receiving the study medication. one subject became pregnant (has had positive pregnancy test) at the end of the study. the statistical models were run with and without the data from this subject, only to check if the data of this subject would influence the outcome. although subject 's data were not considered clinically (see section 3) and/or statistically different from the other subjects, data were excluded from the report to avoid any pregnancy - induced pharmacodynamic or pharmacokinetic confounding effect. the test medication was administered orally (capsule formulation) in an escalating bidaily dose level design including an up - titration (dose - escalation) period of 3 days followed by a 9-day fixed - dose (steady state) period in which the same dose level of the test drug was orally administered twice a day (as 2 equal doses, 12 hours apart, between 08:00 and 08:30 and 20:00 and 20:30). no placebo was administered in this study. during the up - titration period and throughout the fixed - dose (steady state) period, with the exception of day 7, the morning dose was administered half an hour before breakfast. on day 7 of the steady state, the test drug was administered under fasting conditions. on all days of the clinical trial a standard meal prior to the first dosing and throughout the study, use of medications or consumption of food or drinks known to influence the cyp 450 enzyme activity, for example, grape fruit, was not allowed. blood samples (3 ml) were obtained from participating subjects, at different time points of the study, to assess drug concentrations. during the 3 up - titration days and on days 1 and 7 of the fixed - dose period, blood samples were obtained at the following time points : before morning dose (0 h), 2 hours after morning dose and 2 hours after evening dose. on day 7 of the fixed - dose period 2 additional blood samples were taken : one sample before evening dose (0 h) and one sample 4 hours after evening drug administration. on day 1 of the fixed - dose (steady state) period, the evening test drug concentration at 0 h was not assessed. on all other days of the fixed - dose period test drug serum concentration the test drug concentrations were determined in plasma by a validated liquid chromatography - mass spectrometry / mass spectrometry (lc - ms / ms) method with a lower limit of quantitation (lloq) of 2 ng / ml. throughout the study the subjects were closely monitored and queried about the occurrence of subjective complaints at regular intervals using nonleading questions. any subjective complaint or objective finding encountered during the study all reported or observed adverse events were assessed and evaluated by the principal investigator of the study. the most relevant cns adverse events encountered in this trial were insomnia, anxiety and emotional lability, cognitive impairment symptoms, and visual (pseudo) hallucination. the latter was defined according to the dsm iv criteria as a sensory perception without external stimulation of the relevant sensory organ. in this report visual (pseudo) hallucinations have been classified into simple hallucinations, characterised by absence of forms and are often photopsias such as flashes of light or colours and complex hallucinations, having specific forms that might include animals, objects, and humans [6, 7 ]. statistical analysis. we performed a post hoc analysis of the results obtained from 18 healthy young female volunteers with regard to the pk profile and the drug - related adverse reaction. a mixed model was used for comparison of morning and evening 2 h postdose concentrations for days 1 and 7 of the steady state. the amount of drug absorbed and remained in the circulation at 2 hours postmorning and -evening dosage on day 7 of the fixed - dose (steady state) period was calculated by subtracting ctrough (trough plasma drug concentration obtained just before dosing at 0 h) from cmax (concentration at 2 h after dose). an ancova was used to compare the difference between 2 h postdose and baseline trough (0 h) values obtained from morning and evening concentrations on day 7, with the baseline trough value as additional covariate. in both models the evening plasma concentrations obtained at 2 h and 4 h after dose on day 7 were compared using a paired t - test. all found p values are two - sided, and alpha = 0.05 has been used. no correction for multiple comparisons was done, as these post hoc results are considered explorative and the main aim is to identify hypotheses that should be subjected to further research. on the 3 up - titration days and on days 1 and 7 of the fixed - dose (steady state) period the mean plasma levels obtained 2 h after morning dose were consistently higher than those obtained 2 h after evening dose (figure 1). for both day 1 and day 7, 15 a comparison of the results from day 1 and day 7 showed an overall statistically significant difference between morning and evening concentrations (p < 0.0001), figures 2 and 3. this difference was also seen when each day was separately analyzed but was less pronounced for day 7 (p < 0.0001 for day 1 ; p = 0.002 for day 7), tables 1 and 2. based on the descriptive statistics, it was apparent that a difference existed between the morning and evening baseline values. this difference proved to be statistically significant (p = 0.0292) and was, therefore, included in the ancova model as an additional covariate. in the ancova for the day 7, difference in plasma concentrations between 2 h and 0 h, a statistically significant difference was found between morning and evening concentrations, table 2 (p = 0.0165). we also compared the evening test drug plasma concentrations obtained on day 7 at 2 h with those obtained at 4 h after dosage. the mean of concentrations obtained at 4 h after evening dose was 28% higher than that obtained 2 h after evening dosage (275 ng / ml versus 215 ng / ml). this difference was statistically significant (p = 0.0357). at the individual subject level, the 4 h postevening plasma concentrations were higher than those obtained at 2 h after dose in 14 out of the 18 subjects (78%) ; see figure 4. in terms of the adverse events (clinical pd effects), these ranged from mild episodes of headache, light headedness, and fatigue to symptoms of cognitive dysfunction, anxiety, insomnia, and (pseudo) hallucinations. twenty - three (23) visual (pseudo) hallucinatory episodes were reported in 11 out of 18 (61%) subjects, that is, not including 3 subjects who also demonstrated (pseudo) hallucination at some point during the trial : 2 prematurely withdrawn subjects with severe hallucination and one subject who became pregnant at the end of the study. the (pseudo) hallucinatory episodes were nocturnal in 9 out of the 11 subjects (82%), diurnal in one subject (9%), and combined diurnal - nocturnal in one subject (9%). in descriptive terms, simple (pseudo) hallucinatory episodes consisted mainly of flashes of light. the latter were reversible and not accompanied by migraine or associated with vision loss or other ophthalmic disorders. none of the subjects had a history or clinical symptoms or signs of any eye disease at screening, during the conduct of study or at the follow - up visit. the content of complex (pseudo) hallucinatory episodes included distorted baby faces, animal faces, spiders with yellow legs and red mosquitos, mythical figures, seeing people from the distant past (who were not physically present), and moving dolls. the encountered (pseudo) hallucinations were nocturnal complex in 8 subjects (recurrent in 1 subject) ; diurnal complex (1 episode) in one subject ; one nocturnal complex and 1 diurnal simple (pseudo) hallucinatory episode in one subject ; and 11 nocturnal (pseudo) hallucinatory episodes (4 complex and 7 simple) in one subject. in all of the hallucinatory subjects, visual (pseudo) hallucinations were of sudden onset, occurred 45 minutes to 5 hours and 20 minutes after dose, and lasted for 5 minutes to 12 h (table 3). it is also worth mentioning that, in 2 subjects (data not included in the analysis), the test drug was prematurely discontinued due to severe nocturnal combined visual complex and tactile (pseudo) hallucinatory episodes. one of these 2 subjects saw dust whirling from the ceiling and experienced electricity cable wiring on her body. the hallucination was so severe that the subject tried to protect her own belongings from the dust by covering them with clothing and thereafter started to clean the hallucinatory dust from her own arms and legs. this nocturnal hallucinatory episode persisted for 7 hours and was followed by emotional lability and severe impairment of cognitive functions (mental absence) that lasted for a further 6.5 hours. in the case of the other prematurely withdrawn subjects, the (pseudo) hallucinatory episode also contained 2 components, a visual and a tactile component. the subject saw purple, yellow, and green - colored flashes of light together with water drops and flowers. the tactile component consisted of the feeling that the bed was folding (up) around her body. this nocturnal combined visual and tactile hallucinatory episode lasted for almost 2 hours and was combined with anxiety. this was associated with intense concentration impairment and mental dullness which lasted for 14.5 continuous hours. as mentioned above, the data of one subject who became pregnant at the end of the study was not included in the analysis in order to avoid any pregnancy - induced confounding effect. this subject demonstrated one diurnal and 2 nocturnal episodes of complex (pseudo) visual hallucination. this hallucinatory episode was associated with restlessness and consisted of seeing images (described as movie scenes) from old job situations. the second episode, a nocturnal one, consisted of hypnagogic frightening images (as described by the subject) that occurred at the boundary between sleeping and waking. this episode started 4 hours and 50 minutes after the evening dose and continued for 1 hour and 50 minutes after the subject woke up from a sleep. the third (pseudo) visual hallucinatory episode started 3 hours and 55 minutes after the evening dose and lasted for 1 hour and 15 minutes. this was frightening for the subject and necessitated close medical supervision and assistance, by supervisory physician, to calm down the subject. noteworthy is that the ward on which the subject was admitted has no ceiling fan. nocturnal insomnia associated with significant secondary behavioural disorders including anxiety and emotional instability was observed in 13 out of the 18 participating subjects (72%). symptoms of cognitive dysfunction of sufficient severity to interfere with daily functioning were encountered in 11 of the 18 subjects (61%). the cognitive dysfunction symptoms experienced were impaired concentration in 8 subjects (duration range 0.513.75 h), mental dullness in 5 subjects (lasting from 3.75 to 72 h), slow reaction to sensory stimuli including delayed visual perception in 5 subjects (duration range 135 h), and difficulty expressing thoughts in 2 subjects (lasting for 1.5 and 45 h, resp.). in this post hoc analysis, we studied the morning and evening peak plasma concentrations (cmax) and the associated adverse events of a twice - daily oral administration of mglu5r - nam, a class of compounds suggested for the treatment of some psychiatric disorders such as anxiety and depression. the data demonstrated in this report raises 2 points of pharmacological as well as clinical interest. first, we observed intrasubject differences between morning and evening peak plasma concentrations (cmax) at 2 h after dosing of the test drug in 2 equal dose levels. in this respect, it is noteworthy to mention that some critical pharmacokinetic properties of medicinal drugs such as tmax, cmax and t1/2 are usually based on morning dose studies. extrapolation of these basic pk properties from a diurnal drug plasma concentration - time curve alone might underestimate the clinical relevance of drug chronopharmacokinetics. the reported data shows that the mean of 2 h postdose evening plasma concentrations obtained on day 1 and day 7 of the fixed - dose (steady state) period was, respectively, 45% (191/422 ng / ml) and 62% (215/344 ng / ml) of the corresponding morning mean concentration. on day 1, the morning dose was administered half an hour before breakfast, while, on day 7, the morning dose was administered under fasting conditions. a food effect on the test drug bioavailability could explain the difference between the morning concentrations on days 1 and 7. however, the difference between the morning and evening concentrations on day 7 more likely indicates the influence of endogenous intrasubject factors that control drug absorption and disposition (distribution and elimination by biotransformation and excretion). this assumption is supported by looking at the average difference between cmax and ctrough in the evening of day 7, which was found to be 55% of the corresponding average difference between cmax and ctrough in the morning (128.5/233.0 ng / ml). the apparent low evening cmax of this lipophilic drug might be explained by the impact of endogenous biological rhythm on factors controlling drug absorption and disposition. the impact of circadian rhythm on drug plasma therapeutic levels has been discussed in the reports of sukumaran and coworkers and erkekoglu and bayder. circadian rhythm induces an increase in evening gastric emptying time, intestinal hypomotility, low hepatic and gastrointestinal blood flow, and decreased expression of intestinal lipophilic drug transporters genes such as microsomal triglyceride transfer protein, apolipoproteins b, and apolipoprotein a4 [9, 10 ]. as mentioned above, approximately 41% of the test drug is eliminated unchanged in faeces. intestinal hypomotility leads to prolonged contact of the test drug with the gut epithelium, and therefore, an increase, rather than decrease, in the amount of drug absorbed would be expected. taken together, this suggests a delay in reaching evening peak plasma concentrations, which in turn might give a false conclusion of a low cmax value when assessed at the same postdose time point used for assessment of the morning tmax. the data demonstrated in this report strengthen this assumption. on day 7, the evening test drug concentrations taken at 4 h after dose were higher than those taken at 2 h after dose in 78% of participating subjects. also the mean of individual plasma concentrations obtained at 4 h after evening dose was 28% higher than that obtained 2 h after evening dose (275 ng / ml versus 215 mg / ml). given that, it might be conceivable to extrapolate the critical pk properties of lipophilic medicinal products (such as those used to treat cns diseases and psychiatric disorders) not only from diurnal drug plasma concentration - time curves but also from evening ones. considering evening / nocturnal pharmacokinetic studies in addition to the conventional morning pharmacokinetic studies might reveal drugs chronopharmacokinetics and allow a better understanding of human body - drug interaction. second, the rate of clinically relevant drug - induced neuropsychiatric adverse reactions, such as complex visual (pseudo) hallucinatory episodes and complicated insomnia was higher after evening dose. the exact underlying mechanism of this apparent discrepancies between prevailing plasma concentrations and cns effects is not clear. hysteresis caused by delayed secondary pharmacological effects of mglur5 inhibition such as diminished activation of n - methyl - d - aspartate receptors (nmdars) offers no likely explanation. this is because the drug was administered twice daily, meaning that, if delayed pharmacological effect is the cause, then the cns adverse effects would have been encountered with similar frequencies during the day and at night. a possible explanation is nocturnal exposure of the brain to a higher concentration of the test drug. circadian rhythm - related physiological variations in hepatic and extrahepatic drug cytochrome enzyme activity, hepatic blood flow (hbf), serum albumin levels, and cerebral blood flow (cbf) may play a role in this scenario. the test drug is metabolized by cyp 450 enzymes 2c, 1a1, and 3a4 which are present not only in the liver and gut, but also in the brain [1113 ]. a large number of cyp 450 enzymes including 2c, 1a1, and 3a4 are expressed by endothelial cells of human brain microvessels, blood brain barrier, and in approximately 75% of brain neurons. they are found concentrated near drug targets in specific regions [12, 13 ]. the levels of cyps in specific neurons may be comparable to, or even higher than, levels in hepatocytes. brain cyps might, therefore, exhibit a second pass effect and exert a relevant impact on local drug metabolism. the activity of these microsomal enzymes shows circadian rhythm that is controlled by the central body clock. the latter is regulated by light / dark phases and not by activity state. in this context, mrna expression of phase 1 detoxification enzyme system (microsomal cytochrome p450) and drug metabolism, via cytochrome p450 system, were reported to reach their peak during the day (active phase) when compared to night, resting phase [9, 10, 14 ]. with regard to hbf, lemmer and nold found significant circadian phase - dependent variation in estimated hbf in healthy subjects, being greatest at 08:00 am. given the fact that both cyp 450 activity and hbf are major determinant factors in the rate of clearance of lipophilic drugs, circadian rhythm - related changes in these factors could respectively lead to a morning increase and evening decrease in the rate of mglu5r - nam biotransformation to its inactive metabolite. regarding the circadian rhythm - induced alteration in serum albumin concentrations, touitou. reported that human plasma albumin concentrations drop to their lowest level during the night time and increase by day reaching a peak at around 08:00 am, shortly after waking (circadian amplitude 813%). although plasma albumin level has not been assessed in this study, circadian variation in plasma protein level might have influenced the ratio of test drug bound to unbound fraction (fu) in the plasma, causing nocturnal increase in plasma concentration of the mglur5-nam fu. lastly, it is widely agreed upon that cbf is lower in the morning shortly after awakening than in the afternoon or evening, nadir around 12:00 pm and a zenith at approximately midnight [17, 18 ]. taken all together, nocturnal decrease in drug biotransformation to inactive metabolite and increases in drug fu and cbf may have caused higher nocturnal mglur5-nam concentration in the brain. our results show three important pd effects which may have implications in the psychiatric clinical settings. these effects are insomnia (with secondary mood disturbances including anxiety and emotional instability), visual (pseudo) hallucination, and symptoms of cognitive dysfunction of sufficient severity to interfere with daily functioning. insomnia may be explained by a mglur5-induced indirect activation of the hypothalamus - pituitary - adrenal (h - p - a) axis. inhibition of mglur5 has been reported to induce decrease in inhibitory drive from gabaergic interneurons on hpa axis neurons [4, 21 ]. this ultimately leads to activation of the stress hormone axis with increased acth and cortisol release [4, 21 ], causing hyperarousal and insomnia [4, 22 ]. from a clinical point of view, treatment - induced activation of stress reaction and insomnia are crucial side effects that might have significant implication on psychiatric patients treated for anxiety disorder. although hyperarousal state and insomnia could explain some drug - induced visual hallucinations, the exact role of mglur5 in the pathogenesis of hallucinations remains to be clarified. another possible mechanism for the observed (pseudo) hallucination is n - methyl - d - aspartate receptors (nmdars) hypofunction. activation of nmdars was found to increase hippocampal gabaergic inhibitory transmission, while noncompetitive inhibition of nmdars induces cognitive impairment and psychotic symptoms such as hallucination. crosstalk with molecular and biochemical interactions between nmdars and mglur5 has been reported [24, 25 ]. symptoms of cognitive dysfunction were demonstrated by 61% of the subjects in this report ; 64% of these demonstrated visual (pseudo) hallucinations as well. in line with these findings, earlier reports indicated a relationship between mglur5 antagonists / nams and cognitive impairment both in humans and animals [1, 3 ]. a link between cognitive impairment and complex visual hallucination in some cns disease states regardless of the underling mechanism of mglu5r associated (pseudo) visual hallucinations and cognitive dysfunction, attention should be given to the emergence of such clinically significant cns adverse reactions in a mentally compromised psychiatric patient treated for depression or anxiety disorders. in summary, this report sheds light on two important clinicopharmacological points. firstly, critical pharmacokinetic properties of medicinal drugs such as tmax, cmax and t1/2 are commonly determined from morning dose studies only. extrapolation of basic pk properties from a diurnal plasma concentration - time curve may underestimate the clinical relevance of drug chronopharmacokinetics. we, therefore, suggest that clinical trials designed to evaluate critical pk characteristics of lipophilic medications targeting cns diseases / psychiatric disorders consider potential chronopharmacokinetics of drugs. this might necessitate conducting pk studies not only in the morning but also in the evening. secondly, cns lipophilic medicinal products may achieve higher nocturnal brain drug concentration (compared to diurnal one) possibly due to circadian rhythm - related physiological variations in major determinants of drug disposition. further investigations are needed to confirm this observation and to elucidate its exact underlying mechanisms including possible circadian variation in plasma levels of drug unbound fraction. | metabotropic glutamate receptor 5 (mglur5) negative allosteric modulators (nams) may play a role in some psychiatric disorders such as anxiety and depression. the pharmacokinetic profile and pharmacodynamics effects of mglur5-nams have been previously reported. we performed a post hoc analysis of pharmacological and clinical data obtained from 18 young healthy female subjects who received a mglur5-nam in the context of a phase i drug - drug interaction study between a mglur5 nam and a monophasic oral contraceptive. mglur5-nam was administered in an escalating bidaily dose level design. there was no interaction between the oc and mglur5-nam. higher morning mglur5-nam plasma concentrations were found compared to evening concentrations. most of the observed clinically significant neuropsychiatric adverse reactions occurred nocturnally and included visual (pseudo) hallucinations, insomnia accompanied by secondary behavioural disorders, and cognitive dysfunction symptoms of sufficient severity to interfere with daily functioning. circadian rhythm - related physiological variations in drug absorption and disposition may explain this pharmacokinetics - pharmacodynamics apparently disproportionate relationship. we suggest that clinical trials evaluating basic pharmacokinetic properties of psychiatric medications consider potential drug 's chronopharmacokinetics. this may assist with dose optimization and minimize serious neuropsychiatric adverse reactions in the vulnerable psychiatric patient. |
rhabdomyosarcoma (rms) is a malignant tumor of striated muscle origin and derives from primitive mesenchyme that retains its capacity for skeletal muscle differentiation. the combined use of chemoradiotherapy and surgery improves the survival rate significantly, namely up to 5 years. we report on a 42-year - old male patient who, without a significant clinical history, presented to the ent service complaining of nasal obstruction, exophthalmos, edema and ipsilateral facial congestion. ct and mri were performed. ct showed an aggressive, noncalcified, solid mass centered in the left nasoethmoidal region invading the left side of the frontal sinus, left maxillary sinus and the left orbit. t2-weighted mri showed a mildly hypointense, solid mass centered in the left nasoethmoidal region invading the left side of the frontal sinus. the tumor was also invading the left orbit with lateral displacement of the medial rectus muscle and globe (fig. 3). intracranial invasion and heterogeneous avid enhancement of the mass was seen in the postcontrast fat - saturated images (fig. 9), s-100, chromogenin and synaptophysin and negative for nse (neuron - specific enolase). the case was presented and discussed at the head and neck tumor board and a decision was made to initiate chemoradiation therapy consisting of 4 cycles of ifosfamide, doxoruvicine, vincristin and mesna. conventional radiotherapy treatment was started with a total dose of 63 gy, administered in 1.8-gy doses during 7 weeks (fig. rms is a malignant tumor with striated muscle differentiation deriving from primitive mesenchyme that retains its capacity for skeletal muscle differentiation. rms was first described in the english literature in 1937 and in 1992 in children as a tumor mainly composed of bundles of cells with myogenic differentiation by immunohistochemical and ultrastructural analysis. since then and until 2007, 21 cases have been described in the english literature. this sarcoma is one of the most common soft tissue sarcomas in newborns, children, and young adults. the annual incidence of rms in the usa is 4.6 per million in subjects under 20 years of age. rms may occur in all age groups but is more prevalent in the first and second decades of life, with a peak between 2 and 6 years of age, representing approximately 48% of all pediatric cancers. although head and neck tumors are rare in children, approximately 60% of all pediatric rms cases occur in the head and neck [9, 10, 11 ]. rms has different grades of striated muscle cell differentiation and it may occur in any part of the body. four different histopathological types have been described : embryonal, alveolar, pleomorphic and undifferentiated, with embryonal and alveolar being the two most common histopathological types described in childhood. the embryonal type represents 70% of all cases, is mainly seen in children under the age of 12 and carries the best prognosis. the alveolar type is more frequent in the extremities, affecting an older age group. it generally shows the chromosomal translocation t2:13 ; p3514, carrying a more ominous prognosis than the other types of rms. the pleomorphic variety is less frequent and occurs more often in an older population. approximately 40% of all newly diagnosed rms arise in head and neck structures including parameningeal sites (16% of all cases, and almost half of all head and neck cases), the orbit or eyelid (10% of all cases), and other nonorbit, nonparameningeal sites (10% of all cases). the parameningeal sites include the nose, nasopharynx, paranasal sinuses, middle ear, mastoid, infratemporal fossa and pterygopalatine fossa. rms of the temporal bone carries a poor prognosis due to its proximity to the brain and vital structures. jaffe. found a 2-year survival rate of 0% in a review of 20 cases from the literature. the nonorbital and nonparameningeal forms include the scalp, parotid gland, oropharynx, larynx and oral cavity. the tongue, palate and cheeks are the most common oral sites. of the 35% of all rms that occur in the head and neck, 1012% present in the oral cavity. rms can have a syndromic presentation such as their association with beckwith - wiedemann syndrome (10% of all cases). metastasis occurs by hematogenous or lymphatic spread, most commonly to the lungs, bones and brain. the prognosis is influenced by the anatomic location at the time of presentation, patient 's age, completeness of resection, extent of metastasic disease and tumor histology. the combined use of chemoradiotherapy and surgery has significantly improved the survival rate of head and neck rms to 5 years in the last 30 years. a study indicates that approximately 65% of the children diagnosed with rms survive with combined therapy. in the pediatric parameningeal rms cases, the treatment of choice is chemoradiotherapy, with surgery having a limited role due to the relative inaccessibility of the lesions and associated surgical morbidity. improved and innovative operative techniques of craniofacial surgical reconstruction have resulted in satisfactory functional and cosmetic results. in conclusion, rms is a rare head and neck tumor that occurs in the adult population and has a poor prognosis despite aggressive therapy. | abstractwe report a patient who presented to the ent service complaining of nasal obstruction, exophthalmos, edema and ipsilateral facial congestion. imaging studies revealed an aggressive noncalcified solid mass centered in the left nasoethmoidal region and heterogeneous avid enhancement following contrast media injection. subsequently, a biopsy confirmed the presence of solid alveolar rhabdomyosarcoma. the patient was treated with chemoradiation therapy for 7 weeks. due to the advanced stage of the disease, the patient was enrolled in a palliative care and pain control program. |
renal transplant candidates present immune dysregulation, caused by chronic uremia followed by renal replacement therapy. recently, uremia was reported to influence cytokine synthesis. while the immune response shift is well described in the literature, still it is not clear whether the pretransplant chronic inflammation affects posttransplant outcome. from routine blood tests crp (c - reactive protein) and albumin levels were shown not only to reflect the general immune response in uremic patients but also to predict kidney outcome [4, 5 ]. pretransplant cytokine profiles were also considered to exert a deleterious effect on graft function or survival, but the published data have been inconclusive [6, 7 ]. the aim of the study was to investigate whether pretransplant peripheral blood gene expression affects clinical outcome of renal allograft recipients. in a prospective study we analyzed a wide range of immune factors known to be related to inflammation (il-6, il-8, ngal, and tnf - alpha), apoptosis (fas, caspase 3, p53, and il-18), and lymphocyte t activation (ifn - gamma, il-2) as well as regulatory t cell (il-10, tgf - beta, and foxp3) function with the real - time pcr method. pretransplant cytokine gene expression linked to recipient- and donor - related factors was examined with further analysis of allograft function. the working hypothesis was the search for the novel predictive biomarkers connecting the recipients ' pretransplant immune and inflammatory status with transplant outcome. the study was carried out prospectively on 87 low risk consecutive renal transplant recipients (aged 1672 years, mean 47 years ; 34 females, 53 males) transplanted between 2006 and 2012 at wroclaw medical university. among them they remained on renal replacement therapy from 1 to 97 months (mean 25 18 months). the patients received organs from donors (81 deceased, 6 living) aged from 16 to 72 years. eighty - three recipients received their first graft, while for 4 of them it was the second transplant. immunosuppressive therapy consisted of corticosteroids with cyclosporine and mycophenolate mofetil / sodium in 35 cases, corticosteroids with tacrolimus and mycophenolate mofetil / sodium in 49 cases, corticosteroids with everolimus and tacrolimus in 1 case, and corticosteroids with sirolimus and cyclosporine in 2 cases. four recipients received induction therapy with anti - cd25 antibodies at the time of transplantation. pretransplant demographic and clinical data (age, gender, weight, height, comorbidity, and history of chronic kidney disease) were obtained from medical records from patients ' dialysis centers. posttransplant clinical data (renal function, immunosuppressive therapy, complications, and outcome) were collected from medical records of the transplant outpatient clinic of the department of nephrology and transplantation medicine in wroclaw, poland. estimated glomerular filtration rate (egfr) was calculated using the abbreviated modification of diet in renal disease study formula (mdrd). blood samples for routine laboratory tests assessing pretransplant inflammatory response as well as samples for gene expression were collected immediately before the transplant procedure and introduction of immunosuppressive therapy. the study was approved by the commission of bioethics at wroclaw medical university, and all aspects of the study were in accordance with the world medical association declaration of helsinki. before enrollment, each patient read an information sheet and provided fully informed consent. rna was isolated with a paxgene blood rna kit (preanalytics) and reversely transcribed with high capacity rna to cdna kit (applied biosystems). the peripheral blood gene expression of caspase-3 (casp3, hs00263337_m1), fas (fas, hs00236330_m1), p53 (tp53, hs00153349_m1), foxp3 (foxp3, hs00203958_m1), ifn - gamma (ifng, hs00174143_m1), interleukin-2 (il-2, hs00174114_m1), interleukin-6 (il-6, hs00174131_m1), interleukin-8 (il-8, hs00174103_m1), interleukin-10 (il-10, hs00174086_m1), interleukin-17 (il-17a, hs99999082_m1), interleukin-18 (il-18, hs00155517_m1), ngal (lcn2, hs00194353_m1), tgf - beta (tgfb1, hs99999918_m1), and tnf - alpha (tnf, hs00174128_m1) was assessed with real - time pcr on custom - designed low density arrays (taqman) with taqman pcr master mix. gapdh was chosen as the reference gene, and it was proved not to be related to transplant outcome (delayed graft function (dgf)/acute rejection occurrence (ar), serum creatinine, and gfr). each gene was tested in triplicate ; raw expression data were averaged and converted to ct, where ct = ctgene ctgapdh and ct is the cycle threshold value and defines the calculated cycle number, in which the fluorescence measured during pcr reaction increases over the preset threshold value. the expression data were analyzed separately for each of the genes in the subsequent manner. the samples with the highest quartile of ct values (which corresponds to the lowest expression level) were chosen as a reference group (ref) for data normalization. the expression data throughout the paper are presented as ct = mean ctref ctsample. statistical analysis was performed with the statistica v.12 statistical package (statsoft, poland). the numerical variables were tested for outliers and normality and presented as mean standard deviation or median + interquartile range. in case of normally distributed variables, if the normality assumption was not fulfilled, mann - whitney u - test and spearman correlation were used. for normally distributed continuous variables, their influence on the outcome was corrected by multiple regression for the other parameters shown significantly in univariate analysis. delayed graft function (defined as a need of hemodialysis in the first week after transplantation) was seen in 20 cases (23%). seventeen recipients (19%) experienced at least one biopsy - proven rejection episode within the first posttransplant year. recipients were followed up for 5 years after transplantation. during that time 5 recipients died (5.7%) and 11 lost their grafts (12%). severe cardiovascular complications occurred in 7 recipients (8%), serious infections with a need of hospitalization occurred in 10 cases (11%), 13 (15%) recipients suffered from cmv disease, and 18 recipients (21%) presented recurrent urinary tract infections. after 24 months of observation 36% of recipients presented excellent kidney function with gfr above 50 ml / min (mean gfr 60.3 5.4 ml / min). recipients and donors characteristics are included in table 1 and the clinical pretransplant recipient blood parameters are presented in table 2. all the parameters were analyzed in relation to graft short- and long - term outcome. the pretransplant blood parameters (crp, albumin, cholesterol, complete blood cell test, etc.) did not affect posttransplant outcome or acute rejection episodes. moreover, in our study group, we found no association of cold ischemia time or number of hla mismatches and graft function or survival. from the clinical parameters studied only donor age, recipient age, and recipient bmi proved to influence allograft outcome. both recipients ' and donors ' age were negatively correlated with immediate and short- and long - term allograft function at any time point studied. recipients ' age was associated with worse graft function from 14 days to 24 months (14-day gfr r = 0.33, p = 0.003 ; 1-month gfr r = 0.37, p = 0.001 ; 3-month gfr r = 0.31, p = 0.0 ; 6-month gfr r = 0.39, p = 0.001 ; 12-month gfr r = 0.33, p = 0.008 ; and 24-month gfr r = 0.35, p = 0.012). donor age was a strong risk factor for graft function deterioration from the beginning (14-day gfr r = 0.33, p = 0.004 ; 1-month gfr r = 0.41, p 50 ml / min 24 months after ktx). each of casp3, fas, and il-18 gene expression levels above cut - off proved to have around 70% sensitivity and at least 80% specificity for good long - term outcome prediction. we studied the immune background of renal transplant candidates just before the transplantation and its impact on the transplant outcome. we analyzed the expression of immune - related genes at the mrna level with real - time pcr methodology. we observed that th1 derived cytokines (il-2 and ifn - gamma) were significantly correlated with better short- and long - term allograft function. we also observed a positive correlation between pretransplant expression of three proapoptotic genes, casp3, fas, and il-18, with allograft function. both of the observations were not published before. in addition, it is possible to hypothesize that some level of th1 constitutive activation supports more active apoptosis which in turn is associated with secretion of anti - inflammatory, tolerogenic molecules as il-10 and tgf - beta. collectively, these observations could be interpretative as a credit for hypothesis that some basal immune system cell activation is needed to make them more sensitive to effective inhibition by immunosuppressive drugs. it was caused by abnormal function of regulatory t - cells, the depletion of dendritic cells, naive and central memory t cells and b cells, and impaired phagocytic function of polymorphonuclear cells and monocytes [1, 8, 9 ]. various studies have shown that pretransplant immune status of the recipient can influence transplant outcome, acute rejection episodes, delayed graft function, and kidney survival. it was noted that pretransplant humoral autoimmunity (cross matches, panel reactive antibodies) affected graft outcome. previously, we as well as other authors have reported that cellular alloimmunity measured by the elispot technique influenced the acute rejection rate and overall graft survival [11, 12 ]. in our population some studies observed that pretransplant blood cytokine pattern reflected immune infiltrates observed in kidney tissue during rejection. similarly to some previous reports, we observed that none of the pretransplant cytokine patterns was associated with ar. th1 cytokines (il-2, ifn - gamma) trigger an alloimmune response with activation of t cytotoxic lymphocytes, monocytes, and nk cells. pretransplant levels of anti - inflammatory cytokine tgf - beta tended to be lower among patients with acute rejection episodes, in contrast to upregulated th1-derived cytokines. pretransplant serum levels of another proinflammatory cytokine, il-6, were associated with an increased risk of acute rejection episodes and graft loss, and sil-6r was higher and tgf - beta was lower in patients exhibiting atn. unexpectedly, it was noted that pretransplant elevations of not only proinflammatory il-12, but also anti - inflammatory cytokine il-10, were both connected to acute rejection. in contrast there are few reports of no relationship of pretransplant cytokine levels with acute rejection incidence. chin. observed that pretransplant ifn - gamma levels did not predict acute rejection in a small retrospective study.. found no significant difference in serum concentration of il-2, il-10, il-4, and ifn - gamma on the day before transplantation between the group with acute rejection within the first months and rejection - free recipients. did not observe any influence of pretransplant levels of examined cytokines il-1, il-2, il-3, il-4, il-6, il-10, tnf - alpha, tgf - beta, and ifn - gamma on acute rejection or atn rate. among other conflicting reports we observed no correlation between immune factors ' gene expression and acute rejection. nevertheless in our study pretransplant gene expression of th1-derived cytokines (il-2 and ifng) significantly correlated with better posttransplant allograft function from the beginning up to 5 years. according to our knowledge, no previous papers have reported an association between pretransplant cytokine expression and kidney allograft function measured by gfr. th1-derived cytokines trigger an alloimmune response but also are easily suppressed by standard immunosuppressive drugs (calcineurin inhibitors act by inhibiting t cells through il-2 deprivation). furthermore, it is known that ifn - gamma inhibits synthesis of the potent rejection - maintaining cytokine il-17 and further inhibits th2 differentiation. this is a pathway of switching the alloresponse to a cellular rather than a humoral reaction. the humoral mechanism of rejection was recently described as more harmful and more difficult to manage than the cellular type. graft failure has been described rarely after t - cell - mediated rejection and commonly after antibody - mediated rejection. moreover, some authors have observed elevated levels of ifn - gamma in stable patients after renal transplantation compared to an acute rejection group [13, 19 ]. that mechanism can partially explain our observation that higher pretransplant ifn - gamma expression was linked to better short- and long - term allograft function. we observed for the first time in the literature a positive correlation between pretransplant expression of three proapoptotic genes : for caspase-3, fas, and il-18 (casp3, il-18, and fas), with allograft function expressed as egfr. that association was seen not only in the early posttransplant period, but also in the long - term observation up to 5 years. increased apoptosis of leukocytes was reported to be associated with increased proinflammatory activity in patients with chronic kidney disease. fas, which is an apoptosis triggering cytokine, increased significantly with the stage of chronic kidney disease, especially in patients treated with peritoneal dialysis. we did not find any published reports concerning expression of apoptosis - related genes in relation to further allograft function. in our study pretransplant expression of tp53, which belongs to the major apoptosis - inducing gene family, correlated negatively with wbc count. the discovered positive correlation between proapoptotic gene expression and graft function may be partially explained by increased apoptosis of neutrophils and lymphocytes, which are known to be involved in the graft injury. from the standard markers of inflammation, pretransplant crp was reported to be a risk factor for acute rejection episodes or not to influence graft function and survival among children or adults. in the present study we also found no influence of pretransplant crp levels on the rate of delayed graft function or acute rejection and allograft function. after transplantation the restoration of renal function reduces the intensity of chronic inflammation in allograft recipients. severe pretransplant hypoalbuminemia was reported to be an independent risk factor for delayed graft function or graft loss [4, 26 ]. in contrast, we did not find higher risk of posttransplant dgf, ar, or worse graft function in hypoalbuminemic recipients, possibly because the majority of our recipients presented pretransplant albumin levels within the normal range. we noted that the albumin level correlated significantly with il-10 gene expression in our patients. this is an expected finding because hypoalbuminemia was described as a potent factor augmenting chronic inflammation [2729 ]. in our study recipients ' pretransplant bmi contrary results were published on the association of a higher 1-year gfr with pretransplant obesity and lower early gfr in patients with bmi < 18.5 kg / m. more conflicting results on severe obesity and kidney allograft function were reported [31, 32 ]. found that recipient bmi correlated with the incidence of dgf and 1- and 5-year allograft function. we did not find recipients ' bmi to be a risk factor for acute rejection or dgf, probably because of low prevalence of obese and undernourished patients in our population (mean bmi was around 24 kg / m). among donor - related issues, age is one of the most important factors negatively influencing outcomes of kidney allografts. like other authors, we found a strong correlation between donor age and kidney function from the beginning up to 2 years. apart from nonspecific time - related injury, kidneys from older donors were proved to be associated with a more intense host immune response early after transplant (up to 1 month) reflected by significantly higher numbers of peripheral t and b cells, increased t - cell alloreactivity, and modified cytokine patterns in rats. allografts from older donors were reported to be more immunogenic than those from younger donors [36, 37 ]. in our study, donor age was an independent significant risk factor not only for delayed graft function but also for acute rejection, which is in agreement with previous reports. this deleterious influence was still noticeable despite the fact that the majority of our recipients (86%) received grafts from donors younger than 60 years. all the previously published results on the predictive value of pretransplant cytokine measurements were based on determination of cytokine blood concentration by elisa technique. our report for the first time assesses the cytokine gene expression in relation to posttransplant outcome. it was previously reported in a murine model that the ifn - gamma gene expression detected by real - time kinetic rt - pcr correlated very well with ifn - gamma protein secretion measured by elisa. examining serum levels of cytokines in kidney allograft recipients together with blood mrna expression did not find any significant differences in those two ways of assessment of cytokine production. the study was performed to investigate whether pretransplant peripheral blood immune gene expression affects clinical outcome of renal allograft. the lowered pretransplant th1-derived cytokine and apoptosis - related gene expressions were a hallmark of subsequent worse kidney function but not of acute rejection rate. the pretransplant ifng and casp3 and fas and il-18 genes expression in the recipients ' peripheral blood is the possible candidate for novel biomarker of short- and long - term allograft function. | renal transplant candidates present immune dysregulation, caused by chronic uremia. the aim of the study was to investigate whether pretransplant peripheral blood gene expression of immune factors affects clinical outcome of renal allograft recipients. methods. in a prospective study, we analyzed pretransplant peripheral blood gene expression in87 renal transplant candidates with real - time pcr on custom - designed low density arrays (taqman). results. immediate posttransplant graft function (14-day gfr) was influenced negatively by tgfb1 (p = 0.039) and positively by il-2 gene expression (p = 0.040). pretransplant blood mrna expression of apoptosis - related genes (casp3, fas, and il-18) and th1-derived cytokine gene ifng correlated positively with short- (6-month gfr casp3 : p = 0.027, fas : p = 0.021, and ifng : p = 0.029) and long - term graft function (24-month gfr casp3 : p = 0.003, fas : p = 0.033, il-18 : p = 0.044, and ifng : p = 0.04). conclusion. lowered pretransplant th1-derived cytokine and apoptosis - related gene expressions were a hallmark of subsequent worse kidney function but not of acute rejection rate. the pretransplant ifng and casp3 and fas and il-18 genes ' expression in the recipients ' peripheral blood is the possible candidate for novel biomarker of short- and long - term allograft function. |
inclusion criteria were that subjects 1) had type 1 diabetes for at least 1 year, 2) were between the ages of 21 and 70, 3) drove a minimum of 6,000 miles a year, and 4) either reported no driving mishaps (no collisions, citations, or automatic driving where they drove from point a to b with no recollection or someone else took over control of the vehicle due to hypoglycemia) in the past 12 months (history group) or reported at least two such mishaps in the past 12 months (+ history group). mmol / l) through insulin infusion and take frequent blood samples, we excluded subjects with hematocrit 5% atrial or ventricular ectopy, and pregnant females. four subjects prematurely discontinued testing : three had insufficient intravenous access for the hyperinsulinemic clamp procedure and one experienced lower extremity muscle twitching resulting from acute or chronic hypomagnesemia. the resulting sample of 38 participants had a mean age of 42.5 12 years (median 42 years, range 2166 years), disease duration of 21.6 9.4 years (median 20 years, range 152 years), and a1c of 7.4 0.8%. as illustrated in table 1, the + /history groups did not differ on any diabetes, hypoglycemia, or driving parameters other than + history subjects reported more episodes of severe hypoglycemia and driving mishaps in the previous 12 months. subjects ' descriptive characteristics data are means sd or % (n) unless otherwise indicated. diabetes control and complications trial criteria for severe hypoglycemia was used, i.e., episodes where individual was unable to treat himself or herself, either because he or she was stuporous, was unconscious, or had a seizure. mean rating on a scale where 1 is always, 2 is frequently, 3 is seldom, and 4 is never. after signing an institutional review board approved consent form, participants completed an outpatient screening evaluation including a medical history, physical examination, 12-lead electrocardiogram, and laboratory evaluation with a1c, complete blood count, and a comprehensive metabolic panel. for the 48 h before admission, subjects were instructed to avoid hypoglycemia by reducing total insulin by 10%, routinely testing blood glucose five times a day, and eating prophylactically 10 g of carbohydrates when blood glucose fell to 0 represents worse than average driving. to evaluate whether + history subjects differed from history subjects across euglycemia and hypoglycemia, two between (group) two within (conditions) repeated - measures ancovas were performed, with subject 's average blood glucose for that condition used as the covariate. approved consent form, participants completed an outpatient screening evaluation including a medical history, physical examination, 12-lead electrocardiogram, and laboratory evaluation with a1c, complete blood count, and a comprehensive metabolic panel. they were also introduced to and rehearsed using the simulator. for the 48 h before admission, subjects were instructed to avoid hypoglycemia by reducing total insulin by 10%, routinely testing blood glucose five times a day, and eating prophylactically 10 g of carbohydrates when blood glucose fell to 0 represents worse than average driving. to evaluate whether + history subjects differed from history subjects across euglycemia and hypoglycemia, two between (group) two within (conditions) repeated - measures ancovas were performed, with subject 's average blood glucose for that condition used as the covariate. + history subjects demonstrated a trend toward greater carbohydrate utilization (f = 3.064, p = 0.089,). + history subjects demonstrated 16.1% greater carbohydrate utilization to maintain euglycemia than history subjects. although + history subjects drove just as well as history subjects during euglycemia, they demonstrated a marked impairment in performance during progressive hypoglycemia (group condition f = 5.0, p = 0.03). as illustrated in fig. 2, + history subjects ' driving performance worsened almost 2.5 sds from euglycemia to hypoglycemia, whereas history subjects demonstrated no driving impairment, driving slightly (but not significantly) better during hypoglycemia. peak epinephrine released was greater during hypoglycemia than during the euglycemic condition (condition f = 57.35, p 5 mmol / l first, like most insulin clamp studies, these data represent a single observation in a laboratory setting. second, this study was partially based on driving a simulator, not an actual car with real - life traffic and driving demands / risks. third, this was a relatively small sample of only 38 adult drivers with type 1 diabetes. this small sample size may not have had sufficient power to identify small but potentially important differences between these two groups, such as differences in sex (history = 34% women as compared with 62% for + history group). finally, although this crossover design controlled for effects of antecedent hypoglycemia, an alternative design would have been to separate testing days by 2 weeks while rigorously avoiding hypoglycemia for 2 weeks before each testing. however, these limitations are offset by the fact that these a priori findings replicate previous post hoc analyses with an independent sample and different research staff but using similar methodologies and technologies (14). in addition, the simulator used in this study has been found to predict on - road driving behaviors (21) and predict future collisions (20). given the potential gravity of the consequences of hypoglycemia - related collisions (9), it would seem clinically prudent to use these findings as a guide when working with individuals who are at a higher risk for hypoglycemia while driving, despite these methodological limitations. | objectivecollisions are more common among drivers with type 1 diabetes than among their nondiabetic spouses. this increased risk appears to be attributable to a subgroup of drivers with type 1 diabetes. the hypothesis tested is that this vulnerable subgroup is more at risk for hypoglycemia and its disruptive effects on driving.research design and methodsthirty - eight drivers with type 1 diabetes, 16 with (+ history) and 22 without (history) a recent history of recurrent hypoglycemia - related driving mishaps, drove a virtual reality driving simulator and watched a videotape of someone driving a simulator for 30-min periods. driving and video testing occurred in a double - blind, randomized, crossover manner during euglycemia (5.5 mmol / l) and progressive hypoglycemia (3.92.5 mmol / l). examiners were blind to which subjects were + /history, whereas subjects were blind to their blood glucose levels and targets.resultsduring euglycemia, + history participants reported more autonomic and neuroglycopenic symptoms (p 0.01) and tended to require more dextrose infusion to maintain euglycemia with the same insulin infusion (p < 0.09). during progressive hypoglycemia, these subjects demonstrated less epinephrine release (p = 0.02) and greater driving impairments (p = 0.03).conclusionsfindings support the speculation that there is a subgroup of type 1 diabetic drivers more vulnerable to experiencing hypoglycemia - related driving mishaps. this increased vulnerability may be due to more symptom noise (more symptoms during euglycemia), making it harder to detect hypoglycemia while driving ; possibly greater carbohydrate utilization, rendering them more vulnerable to experiencing hypoglycemia ; less hormonal counterregulation, leading to more profound hypoglycemia ; and more neuroglycopenia, rendering them more vulnerable to impaired driving. |
ssc) is a chronic, multifactorial disease which was first described by goetz. the disease can run either a chronic or violent course which depends on the degree of internal organs dysfunction. literature data point out that small and large blood vessel disturbances and fibrosis development play a key role in connective tissue changes of immunological character. in healthy tissues angiogenesis does not take place because of equilibrium levels of proangiogenic and antiangiogenic factors. the following factors are known to trigger angiogenesis, that is, vascular endothelial growth factor (vegf), basic fibroblast growth factor (bfgf), and interleukin-18 (il-18) [5, 6, 7 ], whereas endostatin, tgf-, tnf-, interleukin-10 (il-10), as well as tissue inhibitor of metalloproteinases 1, 2, 3 (timp1, 2, 3) have antiangiogenic activity. literature data reporting inhibitory effects on angiogenesis exerted by monocytes and lymphocytes obtained from systemic sclerosis patients could further support the importance of angiogenesis disturbances in the development of systemic sclerosis [8, 9 ]. impairment of collagen i, collagen iii, collagen v, collagen vi, collagen vii synthesis in ssc leads to skin and internal organ fibrosis. recent research data underline the important role of proteases in extracellular matrix degradation, including collagen, in the course of this disease. it is worth pointing out that matrix metalloproteinases (mmps) belong to the group of proteases. mmps are synthesized and released by fibroblasts, monocytes, granulocytes, t lymphocytes, dendritic cells, macrophages, endothelial cells, microglia, epithelial cells, myocytes, and astrocytes. tissue inhibitors of proteinases (timps) are suggested to play a more important role in fibrosis development than proteolytic enzymes. what is more, timps are synthesized by the same cells as their proteolytic enzymes. they exert an inhibitory effect on metalloproteinases activation and further also on active forms of those enzymes. up till now, four timps have been described, out of which the role of three has been fairly well elucidated, that is, timp1, 2, and 3. homeostasis disturbances between mmps and their tissue inhibitors could be responsible for changes in extracellular matrix composition. heart involvement could be one of the most important prognostic factors in the course of ssc. heine, already in 1926, was the first scientist to describe heart disturbances in ssc. it should be noted that cardiovascular changes could develop at any stage of the disease. however, clinical symptoms have not been characteristic and manifest fairly late thus leading to late diagnosis and subsequent delay in proper treatment. the most common complaints reported by the patients with heart involvement are palpitations, dyspnoea, fatigability, and vague pain in the chest. myocardial ischaemia, resulting from coronary vessels spasms, observed in ssc patients may resemble peripheral raynaud 's phenomenon. in ssc patients, more often than in the general population, morphological changes of heart structures, specially of the mitral valve, are observed. employment of echocardiography, spiroergometry, perfusion scintigraphy of the myocardium, 24-hour heart rhythm monitoring allow to detect clinically silent changes [21, 22 ]. the aim of our study was to evaluate cardiovascular changes in ssc patients and assess serum levels of vegf, endostatin, and timp2 in those patients. the study involved 34 ssc patients, 26 women and 8 men, of age range 1669 years. in our group 15 patients presented diffuse form (dssc) (mean 45.4 12.5 years) and 19 limited ssc (lssc) (mean age 50.7 13.3 years). all the patients were diagnosed according to american college of reumatology (acr) criteria. because of the illness course, all dssc subjects were on disease - modifying drugs, that is, cyclophosphamide (50 mg daily), prednisone (1520 mg daily) or combination of both agents in the same doses as in monotherapies (treatment duration : 3168 months, mean : 27 48 months). patients from both subgroups were treated with nifedipine (10 mg daily) and vitamin e (400 mg daily) for at least 5 months. the degree of skin sclerosis was assessed using the total skin score (tss) according to kahaleh (066 points). functional evaluation of four internal organs and systems, that is, oesophagus, cardiovascular system, joint and bone system, and lungs was performed by oesophagal scintigraphy, 24-hour ecg monitoring (3-channel oxford medilog excel-2), doppler echocardiography (h - p 2500 apparatus), x - ray examination of feet and hand bone, x - ray chest examination, and dlco (diffusing capacity of the lung for carbon monoxide) (expressed in percentages of the predicted value ; pulmonary changes were diagnosed when dlco was below 80% of the predicted value). blood was collected in the morning into the pyrogen - free tubes and stored in 20c until further evaluated. vegf levels were measured in 33 patients (19 with lssc and 14 with dssc) and endostatin in 30 patients (16 with lssc and 14 with dssc). the control group consisted of 20 healthy persons (19 female, 1 male ; aged 2564 years, mean age : 46.3 13.2 years). timp2 serum levels were measured in 21 patients (9 with lssc and 12 with dssc) and 10 healthy persons (8 women and 2 men ; aged 2064 years, mean age : 47.2 12 years). vegf, endostatin, and timp2 serum levels were evaluated by enzyme immunoassay technique (elisa) (quantikine r & d systems inc, minneapolis minn ; oncogene research products, boston, mass ; amersham, pharmacia biotech, england, uk). detection sensitivity of the examined cytokines was 9.0 pg / ml for vegf, 1.953 ng / ml for endostatin, and 0.011 ng / ml for timp2. this timp-2 assay detects approximately 50% of recombinant human timp-2 when complexed with recombinant human active mmp-9 in a 1:1 molar ratio. greater than 2.5 ng / ml. antinuclear antibody titres were examined by indirect immunofluorescence test on hep-2 cells. all patients and individuals from the control group gave their informed consent to participate in our study according to the bioethic committee of medical university of lodz requirements. the obtained results were expressed as mean, maximum, minimum, and median values together with standard deviation (sd). mann - whitney, cochran - cox, and two independent sample tests were employed for comparison of mean or median values. correlations between serum levels of vegf, endostatin and heart involvement were evaluated by fisher precisely test with correlation coefficient q. a p value less than.05 was considered to be statistically significant. clinical characteristics of the patients are presented in table 1 we revealed disturbances in different internal organs, that is, oesophagus in 26/34 ssc patients (15 with lssc and 11 with dssc) ; lungs in 20/34 ssc patients (10 with lssc and 10 with dssc) ; heart in 15/34 ssc patients (8 with lssc and 7 with dssc) ; osteoarticular changes in 27/34 ssc patients (15 with lssc and 12 with dssc). cardiovascular changes were observed in 15 ssc patients (8 with lssc and 7 with dssc). they were of different character and developed as single events or coexisted with each other. mean heart rate in ssc patients was 81 11 in comparison to 71 9 observed in the control group. conduction disturbances were found in 3 patients, 6 presented heart rhythm disturbances, and other 6 presented episodes of ischaemia. statistically significantly lower values of 24-hour heart rhythm monitoring were observed in ssc patients in comparison to the control group. cardiographic examination did not reveal any impairment of systolic function of the left ventricle in any of the examined patients ; however 6 patients presented impairment of diastolic function of this ventricle. eight patients presented organic changes such as fibrosis of the mitral valve leaflets and/or aortic cusps ; however only in two patients the changes were of hemodynamic importance. it was demonstrated that mean levels of vegf were lower than those in the control group (194.0 196.8 pg / ml and 271.2 201.0 pg / ml, respectively at p >.05) ; endostatin were higher than those in the control group (113.6 60.7 ng / ml and 73.6 25.9 ng / ml, respectively at p.05) (table 1). using fisher test, we did not find any statistically significant correlation between serum levels of the examined parameters and cardiovascular changes (detailed data not presented). however, comparison of mean serum levels of vegf, endostatin, and timp2 in patients with heart involvement showed higher levels of endostatin than in the control group (p <.05) ; also such a tendency, however still statistically insignificant, was observed in the selected 14 ssc patients (sssc), in whom all 3 substances were assessed (table 2). it was also demonstrated that mean serum levels of endostatin and timp2 were statistically significantly higher in patients with heart changes than in the group of patients without such changes (p <.05) (table 3). antinuclear antibodies (ana) were found in 34 patients. in 19 patients with lssc the following ana were observed : anti - topoisomerase i (10 patients), u3rnp antibodies (1 patient), u1rnp antibodies (2 patients), anti - rna polimerase i antibodies (1 patient), and antinuclear antibodies of unidentifiable specificity (5 patients). in dssc patients the following antinuclear antibodies were identified : anti - scl 70 antibodies (10 patients, in two patients coexisted with anticentromere antibodies, aca, and in one patient coexisted with ku antibodies) and u3rnp (5 patients). coronary vessel changes and fibrosis of the myocardium are features of heart involvement in the course of systemic sclerosis. myocardial fibrosis usually develops in subendocardial layer and does not depend on blood supply, as in atherosclerosis. kucharz also revealed that ecg changes were observed in about 50% of systemic sclerosis patients. thickening of the left ventricular wall, asymmetrical hypertrophy of interventricular septum, cardiomegaly, and exudative changes in the pericardial sac have been described. rodnan was the first group who demonstrated that apart from vessel spasms, inflammatory changes and fibrosis of coronary vessel walls were important factors in myocardial ischaemia development. endostatin is found in blood, urine, and basement membranes of many organs but its activity has not been fully elucidated. however, it is known that endostatin specifically inhibits endothelial cell proliferation and migration stimulated by vegf. endostatin also vastly reduces inflow of endothelial cells to newly developed basal membrane of the blood vessels. in vitro, incubation of endostatin with endothelial cells leads to cell apoptosis. increased levels of endostatin were found in systemic sclerosis patients in comparison to the control group. our results demonstrated significantly increased serum endostatin levels in scleroderma patients when compared with the control group, too. collagen type xviii can be found in the basement membrane of skin blood vessels and internal organs involved in systemic sclerosis. other authors demonstrated increased endostatin serum levels only in a small group of patients ; however they did not find any correlation with clinical parameters. in ssc patients, especially with cardiovascular disturbances, timp2 and endostatin action could be dependent on tissue microenvironment. timp2 and endostatin may act synergistically exerting their antiangiogenic action via not yet fully elucidated pathways in ssc course. this action could be also triggered by the treatment methods employed and could further result from systemic response of the organism. however, despite not fully elucidated endostatin action, it could be assumed that this factor inhibits activation of proenzymatic metalloproteinase 2 form and catalytic actions of membrane metalloproteinases type 1 and type 2. thus, endostatin exerts a considerable effect on accumulation of extracellular matrix components and fibrosis development in the internal organs. our results point out statistically significantly increased endostatin levels in scleroderma patients presenting cardiovascular disturbances in comparison to the patients without such abnormalities. probably increased levels of this factor may also lead to inhibitory effect of angiogenesis in anoxied heart tissue. tissue inhibitor of metalloproteinase 2 is a protein of 21- kd molecular weight, released in a soluble form. this protein exerts an inhibitory effect on all active metalloproteinases forms and competes with them as regards regulation of the extracellular matrix amount. yazawa demonstrated statistically significantly increased serum levels of both timp1 and timp2 in ssc patients than in the control group. the current study results did not reveal statistically significant differences as for timp2 serum levels between ssc patients and the control group. however, our results demonstrated statistically significant differences of this protein level in the serum of lssc patients with / or without heart involvement. so, this observation could further support the importance of timp2 in the development of cardiovascular changes. excessive accumulation of collagen type i could lead to heart muscle fibrosis and restrictions in the systo - diastolic function of the heart ventricles. it can be further assumed that increased levels of timp2 may lead to angiogenesis inhibition, thus intensifying already triggered dysfunction of microcirculation. imbalance of heart extracellular matrix components and decreased number of capillaries could also lead to oxygen diffusion restrictions and myocyte hypoxia. structural changes of heart walls probably result from imbalance between production and destruction of extracellular matrix components, proliferation and migration of cells and their apoptosis and necrosis. heart fibroblasts take part in the above processes via production of growth factors and cytokines, which exert auto and paracrine action thus, it seems reasonable to conclude that the currently observed correlation between timp2 levels and heart dysfunction may be much more important in disturbances of extracellular matrix degradation than ecm excessive accumulation. the obtained results seem to confirm an important role of angiogenic and fibrotic factors in the course of systemic sclerosis, including development of cardiovascular disturbances. they also suggest that evaluation of endostatin and timp2 serum levels in ssc patients could be helpful in the assessment of the cardiovascular system. | fibrosis of oesophagus, lungs, heart, and kidney in the course of systemic sclerosis (ssc) may lead to dysfunction of the above organs or even patients death. recent studies point out the role of angiogenesis and fibrosis disturbances in the pathogenesis of ssc. heart fibrosis is one of the most important prognostic factors in ssc patients. so, the aim of our study was to examine cardiovascular dysfunction in ssc patients and its correlation with serum levels of vascular endothelial growth factor (vegf), endostatin, and tissue inhibitor of metalloproteinase 2 (timp2). the study group comprised 34 patients (19 with limited scleroderma (lssc) and 15 with diffuse scleroderma (dssc)). the control group consisted of 20 healthy persons, age and sex matched. internal organ involvement was assessed on the basis of specialist procedures. serum vegf, endostatin, and timp2 levels were evaluated by elisa. we found cardiovascular changes in 15 patients with ssc (8 with lssc and 7 with dssc). the observed symptoms were of different characters and also coexisted with each other. higher endostatin serum levels in all systemic sclerosis patients in comparison to the control group were demonstrated (p <.05). also higher serum levels of endostatin and timp2 were observed in patients with cardiovascular changes in comparison to the patients without such changes (p <.05). the obtained results support the notion that angiogenesis and fibrosis disturbances may play an important role in ssc. evaluation of endostatin and timp2 serum levels seems to be one of the noninvasive, helpful examinations of heart involvement in the course of systemic sclerosis. |
patients with growth hormone (gh) deficiency who have a history of abnormal birth injury such as breech delivery occasionally show an atrophic anterior lobe of the pituitary gland, the formation of an ectopic posterior lobe at the median eminence, and a thin or absent pituitary stalk on brain magnetic resonance imaging (mri) (1). gh insufficiency develops first, followed by insufficiencies of gonadotropins and thyroid stimulating hormone (tsh) during childhood, and finally adrenocorticotropic hormone (acth) insufficiency in later adulthood (2,3). successful pregnancy in hypopituitarism is rare, given its association with an increased risk of pregnancy complications, such as abortion, anemia, pregnancy - induced hypertension, placental abruption, premature birth, and postpartum hemorrhage, as reviewed by du. gh replacement therapy (ghrt) is not officially licensed for use during pregnancy because of the lack of sufficient safety data. pregnant patients receiving ghrt are often concerned about whether or not they should stop ghrt, and most physicians have reported making a decision on whether or not to continue ghrt in agreement with the patient 's wish (6). we herein describe the successful pregnancies and deliveries in a patient with evolving hypopituitarism due to pituitary stalk transection syndrome who partially continued gh, thyroid hormone, and glucocorticoid replacement therapy during pregnancy. a 31-year - old japanese woman visited our hospital because of adrenal insufficiency after her first delivery. she was born by breech delivery at 31 weeks ' gestation, weighing 1,040 g. at the age of 7 years, she presented with growth retardation and was diagnosed with gh deficiency using an insulin - induced hypoglycemia and arginine test. she did not visit our hospital for 5 years from age 15 until age 20 but returned to the department of obstetrics and gynecology because of primary amenorrhea. she succeeded in becoming pregnant after several inductions of ovulation and delivered a healthy male baby weighing 2,795 g, as described by fukuta. she received ghrt again 10 months after the first delivery from her primary care doctor (table 1). clinical course of hormonal data in a patient with evolving hypopituitarism at and after the first delivery. she was referred to the department of endocrinology and metabolism at our hospital by her primary care doctor because her laboratory tests showed adrenocortical insufficiency at 31 years of age. her free t4 was low despite levothyroxine replacement, and her adrenocortical function was diagnosed as mildly insufficient for the first time on the basis of her endocrinological data (table 2). a low dose of hydrocortisone (5 mg daily) was added to levothyroxine (50 g daily) and somatropin (0.45 mg daily). her ghrt was reduced to two - thirds of the pregestational dose (0.3 mg daily) at 8 weeks ' gestation and discontinued at 26 weeks ' gestation. thyroxine was increased to 75 g daily after 8 weeks ' gestation and 100 g daily after 26 weeks ' gestation, so that the serum free t4 levels remained 0.7 - 1.1 ng / dl during pregnancy. we carefully followed her with monthly measurements of the serum levels of gh, insulin - like growth factor (igf)-1, acth, cortisol, and thyroid hormone during her second pregnancy, as shown in figure. her gh levels rose gradually after the second trimester, but the igf-1 levels were maintained until delivery. she had remained normotensive, and neither proteinuria nor glycosuria was observed during her second pregnancy. under spontaneous labor, she delivered a male baby weighing 3,320 g at a gestation of 40 weeks and 1 day. her serum gh and igf-1 levels fell rapidly three days after delivery, and so the ghrt was restarted. the latest follow - up showed that her two children aged 5 and 2 were both mentally and physically healthy. changes in the serum levels of igf-1, gh, and cortisol, and in the plasma levels of acth during the second pregnancy and after delivery. an intact gh - igf1 axis is not always essential for normal fertility, but it has been claimed that gh deficiency leads to difficulties in conception and subfertility (8). the role of gh supplementation in the prevention of fertilization problems or early gestational complications in gh - deficient women (8 - 10) should to be clarified. the efficacy and safety of ghrt during pregnancy is also a matter of debate (9 - 12). during normal pregnancy, the pulsatile release of pituitary gh is progressively suppressed and replaced by a continuous secretion of placental gh. gh does not cross the placenta, and its effects on the fetus are probably indirect and mediated by maternal igf-1 production and actions on the substrate supply to the fetus (13). therefore, it is justifiable to continue ghrt in women with definite gh deficiency at least until sufficient production of placental gh is achieved (14). in the present case the proteinuria was observed at the late stage of third trimester in the first pregnancy but not in the second pregnancy, suggesting that proteinuria may not be an adverse effect of ghrt. very recently, vila. (6) reported the pregnancy outcomes in a large group of patients (173 women in 15 countries) with gh deficiency and hypopituitarism. three different ghrt regimens were adapted : 1) ghrt stopped before or as soon as the pregnancy was confirmed, 2) ghrt partially continued and stopped at the end of the second trimester, and 3) ghrt continued throughout the pregnancy. the different regimens did not seem to influence the percentages of live births (80.5% in women who continued ghrt and 80.4% in women who stopped ghrt completely). they concluded that pregnancy outcomes and pregnancy complications, such as gestational diabetes, pre - eclampsia and pregnancy - associated hypertension, were not related to the ghrt patterns, method of conception, or number of additional pituitary hormone deficiencies (6). we reported the successful pregnancies and deliveries in a patient with evolving hypopituitarism due to pituitary stalk transection syndrome who partially continued gh, thyroid hormone, and glucocorticoid replacement therapy during pregnancy. we hope this report encourages patients with hypopituitarism who wish to have a successful pregnancy and delivery, although the optimal management of hypopituitarism during pregnancy and delivery has not been determined yet. the clinical course of the present case was presented at the 87th annual meeting of the japan endocrine society in april, 2014. | we herein report a 31-year - old japanese woman with evolving hypopituitarism due to pituitary stalk transection syndrome. she had a history of short stature treated with growth hormone (gh) in childhood and had hypothyroidism and primary amenorrhea at 20 years old. levothyroxine replacement and recombinant follicle stimulating hormone - human chorionic gonadotropin (fsh - hcg) therapy for ovulation induction were started. gh replacement therapy (ghrt) was resumed when she was 26 years old. she developed mild adrenocortical insufficiency at 31 years old. she succeeded in becoming pregnant and delivered twice. ghrt was partially continued during pregnancy and stopped at the end of the second trimester without any complications. |
infectious diseases caused by flaviviruses are major concerns in the public health community, particularly those that are drug - resistant or resistant to antibody - mediated neutralization. however, the basic mechanism by which mutations in antigenic proteins lead to evasion of antibody neutralization is still unclear. in flaviviruses, the envelope protein domain iii (ed3) harbors many of the critical mutations that have been shown to reduce antibody neutralization. the ed3 forms a classic -sandwich fold that is conserved among flaviviruses (figure 1a, side view). e, and f g form a surface patch that is exposed to the solvent in the viral particle (figure 1a, top view). structural studies have shown that effective neutralizing monoclonal antibodies (mabs) recognize this surface patch with a high degree of shape complementarity. structural and sequence analysis of the ed3 from different flaviviruses. structural alignment of the ed3 from different flaviviruses : dengue virus types 1, 2, 3 and 4, denv-1 (pdb 3irc), denv-2 (pdb 1tg8), denv-3 (pdb 1uzg), and denv-4 (pdb 2h0p), respectively ; west nile virus, wnv (pdb 1s6n) ; st. louis encephalitis virus, slev (pdb 4fg0) ; omsk hemorrhagic fever, omsk (pdb 1z3r) ; yellow fever virus, yfv (pdb 2jqm) ; japanese encephalitis virus, jev (pdb 1pjw) ; tick - borne encephalitis, tbe (pdb 1svb). the rmsd (all atoms) among all ed3 structures is between 1 and 4. -strands are colored in yellow, random coils are colored in green, and a highly conserved hydrophobic core found in most flaviviruses is colored in gray. the loops de (cyan), bc (red), n - terminus (blue), and fg (pink) form a patch of residues that are exposed to the solvent in the context of the intact viral particle. the figures were rendered using pymol v. 0.97 (delano scientific llc, san carlos, ca). the sequence alignment shows the amino acids of each solvent - exposed loop and the conserved hydrophobic core. interestingly, within the large ed3mab interaction surface, a few specific mutations significantly decrease mab binding and reduce neutralization in vivo, depending largely on the type of side chain substitution. in the ed3 of west nile virus (wnv), the mutations t332k and t332 m reduced mab binding almost completely (> 80% reduction compared with wild - type). the mutation t332a partially reduced mab binding (50% reduction), whereas t332v had no effects in antibody binding. this broad spectrum of mutational effects on mab binding is also observed in the ed3s of other flaviviruses, such as mutations at positions s331 and d332 in japanese encephalitis virus (jev), a serologically close relative of wnv, or mutations at positions k305 and k307 in dengue virus type 2 (denv-2), a distant relative of wnv and jev. moreover, not only mutations within the interaction surface itself prevent mab binding and neutralization, but mutations can occur outside the binding site and influence antibody binding via long - range effects. these observations motivated us to address the following questions : what is the nature of epitopes ? antibody contact region reduce mab binding ? is there a network of interacting residues, wherein mutations perturb distantly positioned regions of the protein ? addressing these questions using high - resolution structures and antibody binding data is challenging and time - consuming, particularly for phylogenetically and serologically related viruses whose protein antigens typically share a high degree of structural and sequence similarity. the structures of the ed3 of various flaviviruses, shown in figure 1a, are very similar, making it difficult to identify specific features in each viral protein that may be associated with unique antigenicity. hence, an alternative approach is needed, and the ed3 of flaviviruses was adopted as a model system. based on increasing experimental evidence highlighting the importance of protein conformational fluctuations in biological function, we hypothesized that epitopes are intrinsically encoded in the thermodynamic properties of the conformational fluctuations of the ed3s. thus, even if the protein antigens look alike, their thermodynamic properties might differ significantly. to test our hypothesis, we investigated whether mab - resistant mutations affect the conformational fluctuations in the ed3s of two related but serologically distinct flaviviruses, wnv and denv-2. in this study, we used an algorithm that allowed us to explore the thermodynamic properties of correlated fluctuations in computer - generated protein ensembles. our results support a model of evasion of antibody - mediated neutralization that involves changes in the protein s conformational fluctuations and long - range interactions between mutation sites and epitopes. this study also reveals fundamental thermodynamic properties of residues residing in epitopes that may have general implications for other pathogens. to investigate the thermodynamic properties of protein fluctuations in the ed3s from wnv and denv-2, we used the corex algorithm. briefly, corex generates a native state ensemble from the target protein structure (pdb 1s6n for wnv and 1tg8 for denv-2) through the combined unfolding of adjacent groups of residues defined as folding units. folding units are treated as native - like or as unfolded peptides. within this ensemble, the free energy of each conformational state, gi, is calculated with a surface - area parametrization that has been validated experimentally. by rewriting gi as an equilibrium constant (ki) between the conformer i and the folded state (ki = exp[gi/(rt) ]), we define the probability (pi) of each conformer as1 in eq 1, q is the sum of all possible states in the ensemble (partition function). moreover, gi can be resolved into the energetic contributions from each residue in the protein : gi = jn = aagij, which allows the investigation of thermodynamic properties at the residue level. within the ed3 ensembles, we estimated the relative stability of each residue, gf, j, as the ratio of the probability that residue j is in the folded state (pf, j) to the probability that the same residue is in the unfolded state (pu, j):2 from eq 2, residues with high stability are mostly in the folded state in the ensemble, whereas residues with low stability are mostly in the unfolded state. we describe pairwise residue interactions in the ed3s as the thermodynamic coupling between two residues j and k. the first step to obtain a quantitative value of the thermodynamic coupling is to evaluate the effect of an energetic perturbation on residue k (= g) over the stability of residue j. this is accomplished by recasting eq 2 to consider the folding state of a second residue k. after rewriting eq 2, we evaluated the effect of g over the stability constant of residue j:3 in eq 3, the modified residue stability constant (gf, j) considers the probabilities of states where residues j and k are both folded (pf, j|f, k), both unfolded (pu, j|u, k), or one in each state (either pf, j|u, k or pu, j|f, k). thus, an energetic perturbation on residue k (= exp[g/(rt) ]) can have a stabilizing, a destabilizing, or no effect over residue j. this thermodynamic effect can be quantified by subtracting eq 3 from eq 2:4 importantly, this analysis does not require residues j and k to be in close proximity in the primary sequence or in the tertiary structure of the protein. thus, the value gf, j from eq 4 characterizes long - range effects of residue k over residue j. given that a long - range effect is not a bidirectional phenomenon per se, in this study we define thermodynamic coupling as a bidirectional long - range effect. in other words, thermodynamic coupling is the sum of the influence of a perturbation on residue j over residue k (gf, kpert, j) and the reciprocal effect, namely, the influence of a perturbation on residue k over residue j (gf, jpert, k):5 thermodynamic coupling between two residues can be manifested in three ways : positive (gj, k > 0), negative (gj, k gepitopewild - type or gepitopemutant < gepitopewild - type). the conserved effect of mutations in both ed3s suggests similar thermodynamic principles in the mechanism of evasion of antibody - mediated neutralization. (a) the correlation between thermodynamic coupling and binding energy to mabs follows a peaked function. the values for this figure were obtained by averaging the thermodynamic coupling of the residues in the ed3s that reside in the bc loop for wnv (red symbols) or in the fg loop for denv-2 (blue symbols). the black line is a fit of the response of a boltzmann equilibrium process (eq 7 in methods). (b) changes in the response of the boltzmann fit using decreasing cooperativity values (c = 6.5 in brown, c = 4.0 in green, c = 2.0 in dark brown, and c = 1 in orange). the simplest model that describes the peaked function shown in figure 6 is the response of a boltzmann (equilibrium) process between two thermodynamic states (eq 7 in methods). often in biophysics, a boltzmann process is described for folded / unfolded, bound / unbound, or active / inactive transitions in a protein. in this study, however, the boltzmann process represents a transition between low and high thermodynamic coupling states in the epitope of the ed3s. we interpret these thermodynamic coupling states as states of lower or higher fluctuations in the epitope relative to wild - type. by using eq 7 to fit the data in figure 6a, we determined the midpoint of the transition (xo = 2.3 kcal / mol) and a cooperativity factor, c, that describes the sharpness of the transition between the two states. we obtained a value of c = 6.5, which reflects a sharp transition between states. the high degree of cooperativity implies that mutations that generate small changes in the thermodynamic coupling of the epitope result in a large reduction in the binding energy to a mab. this is clearly seen in figure 6a wherein changes in the thermodynamic coupling of the epitope as small as 0.3 kcal / mol result in a 12 kcal / mol change in binding energy (equivalent to 10- and 100-fold decrease in mab binding affinity). to illustrate the biological relevance of a high degree of cooperativity characterizing the transition between thermodynamic coupling states, we systematically reduced c in eq 7 and recorded the changes in the shape of the peaked function observed in figure 6a. when we reduced the value of c from 6.5 to 1, the height of the peaked function was significantly reduced (figure 6b). this decrease in height implies that even if a mutation in ed3 generates a large change in the thermodynamic coupling of the epitope, the reduction in the mab binding affinity will be very small. we also observed that the peaked function broadens as the value of c decreases. this broadening effect indicates that a mutation in ed3 loses efficacy in reducing mab binding affinity even for large changes in thermodynamic coupling. in fact, for a change of 0.3 kcal / mol in the thermodynamic coupling and a c = 2, the reduction in mab binding affinity is only 25%. when c = 1, the expected change in mab binding affinity is negligible. a phenotype that evades neutralization in wnv and denv-2 is clearly observed when the mab binding affinity is reduced 10-fold or more relative to wt. in order to decrease the mab binding affinity 10-fold when c = 2, the change in thermodynamic coupling in the epitope needs to be as high as 1.52.0 kcal / mol. thermodynamic perturbations of 1.52.0 kcal / mol will likely lead to global protein unfolding and render the viral particle nonviable. our analysis is logical from a biological point of view because mutations that result in severe changes in the stability of the protein antigen will be selected against. instead, mutations that generate small changes in the thermodynamic coupling of residues in the epitope would be evolutionarily advantageous and provide the virus with an advantage over neutralizing antibodies without jeopardizing the structural integrity, fold, global stability of the protein antigen, or viability of the infectious virion. because of the fundamental thermodynamic nature of our analysis, we foresee that the strategy to generate resistance to antibody binding described here may be applicable to other pathogens. previous studies have proposed that epitopes are predominantly located in flexible regions of a protein antigen. our studies, however, provide a thermodynamic foundation for the role of protein flexibility in escape mutants. we found that resistant mutations increase or decrease the flexibility of the epitope by tuning up or down the degree of thermodynamic coupling between the site of mutation and the epitope. the modulation of thermodynamic coupling may occur via linear effects (mutations in the epitope) or by conformational effects (mutations in neighboring structures of the epitope). these long - range mutational effects probably originate in the redistribution of conformational states within the ensemble of the ed3s and not through a direct mechanical pathway that evokes a static view of proteins. we envision that long - range interactions between residues residing in the epitopes and other amino acids may provide additional mutation sites in the virus to increase antigenic variations that allow the virus to go undetected by the host immune system. altogether, the application of an ensemble - based description of protein fluctuations quantitatively explains the effect of mutations in evasion of antibody neutralization. ensemble - based descriptions of the equilibrium have been successfully used to describe the mechanism of allosteric regulation in other protein systems (i.e., dhfr and camp receptor protein). thus, changes in the subpopulations of the native state ensemble (due to mutation, ligand binding, or protein protein interactions) seem to be a general strategy that nature uses to regulate biological function, including escape from antibody binding. the parallel observations for wnv and denv-2 allowed us to establish a unified mechanism of antibody - mediated neutralization for these two viruses. this mechanism correlates subtle changes in the conformational fluctuations in the epitope (described as thermodynamic coupling) and large defects in antibody binding affinity. the consequence of such correlation is that the virus is efficiently undetected by neutralizing antibodies without global unfolding of the viral protein. viruses have evolved many strategies to survive neutralizing antibodies, including the disruption of interaction surfaces between the epitope and the antibody (steric hindrance). here, we describe the role of protein conformational fluctuations and how mutations inside or outside the epitope lead to evasion to antibody neutralization (figure 7).. a static view of the mechanism of antibody resistance involves steric hindrance of tight antibody antigen interactions due to mutations in the epitope (i.e., at position t332, green arrowhead). alternatively, but not exclusively, mutations in the viral epitope (red arrowhead) may lead to changes in the conformational dynamics of the protein antigen to prevent antibody binding. moreover, we found that mutations not located in the primary epitope (the bc loop in wnv) that are thermodynamically coupled can also lead to antibody neutralization resistance via conformational effects (black arrowhead). in this figure, antibody neutralization is a central component of the immune response against viruses, as antibodies reduce viral infectivity by preventing cell entry and tissue dissemination. a large effort is being invested in identifying epitopes in proteins from these and other flaviviruses. correctly identifying the epitopes is very important, since it will allow the development of new and efficient therapies (i.e., therapeutic antibodies), or the identification of target sites for small molecules to bind and inactivate viral proteins. without a priori information on the epitopes, our studies revealed a previously unidentified relationship between mutational susceptibility of the ensemble and epitope location. thus, an important and fundamental question arises : what is an epitope ? from a functional perspective, an epitope has been identified by mutations that decrease antibody - binding affinity and generate a neutralization - resistant phenotype in a virus. from a structural point of view, epitopes have been assigned as residues that are part of an interaction surface between the protein antigen and the antibody. in this study, we add a dimension to the identification of an epitope based on the fundamental thermodynamic property of correlated fluctuations in the protein ensemble. we propose that the combination of functional data, high - resolution structures, and thermodynamic information should allow a more accurate identification of the key residues responsible for the generation of evasion to antibody - mediated neutralization of viruses or other pathogens. | mutations in the epitopes of antigenic proteins can confer viral resistance to antibody - mediated neutralization. however, the fundamental properties that characterize epitope residues and how mutations affect antibody binding to alter virus susceptibility to neutralization remain largely unknown. to address these questions, we used an ensemble - based algorithm to characterize the effects of mutations on the thermodynamics of protein conformational fluctuations. we applied this method to the envelope protein domain iii (ed3) of two medically important flaviviruses : west nile and dengue 2. we determined an intimate relationship between the susceptibility of a residue to thermodynamic perturbations and epitope location. this relationship allows the successful identification of the primary epitopes in each ed3, despite their high sequence and structural similarity. mutations that allow the ed3 to evade detection by the antibody either increase or decrease conformational fluctuations of the epitopes through local effects or long - range interactions. spatially distant interactions originate in the redistribution of conformations of the ed3 ensembles, not through a mechanically connected array of contiguous amino acids. these results reconcile previous observations of evasion of neutralization by mutations at a distance from the epitopes. finally, we established a quantitative correlation between subtle changes in the conformational fluctuations of the epitope and large defects in antibody binding affinity. this correlation suggests that mutations that allow viral growth, while reducing neutralization, do not generate significant structural changes and underscores the importance of protein fluctuations and long - range interactions in the mechanism of antibody - mediated neutralization resistance. |
h - ns is an abundant global regulator of transcription and a determinant of nucleoid structure in many bacteria (1,2). this protein is primarily a repressor acting both as a selective silencer of specific genes or regions of the chromosome and also more locally in concert with other transcription factors within a regulatory region (3). genes under h - ns control in enteric bacteria are often responsive to abrupt environmental changes. such genes include those activated by enhanced osmolarity of the growth medium (exemplified by prov) and also genes associated with pathogenicity, notably shigella flexneri virf and the pathogenicity - associated islands in uropathogenic bacteria (49). h - ns binding to dna in vitro is facilitated by structural characteristics of dna (1) but by itself this mechanism may not provide sufficient selectivity for precise silencing. however, by combining recent findings we derive here an at - rich sequence motif for directing sequence - specific dna binding by h - ns. depending on their context such motifs can effect local repression or act more globally altering the packaging of dna thereby silencing the packaged genes. importantly, the proximity of these sites within putative silenced regions indicates how h - ns silencing can be nucleated and propagated over a substantial length of the bacterial chromosome. we conclude from an analysis of genes containing h - ns binding sites that a major role of h - ns, and also possibly its paralog, is to regulate functional systems as a whole rather than selectively targeting individual regulatory or structural genes. in addition to structurally determined dna binding (1), two recent findings suggest that h - ns binding can be highly sequence specific. first, two tight binding sites of identical sequence with a kd of 15 nm were identified in the escherichia coli prou operon (10). importantly, this sequence also directed tight h - ns binding when placed in a completely different sequence context, thus excluding any more extensive structure - specific recognition. second, the h - ns dna binding domain, in isolation, selectively footprinted particular sequences of varying extents within the regulatory regions of several h - ns sensitive genes (11). although both results are indicative of sequence - specific binding neither individually is sufficient to identify a consensus sequence. however, inspection of the footprinted sequences revealed that they all contained at least one section with high similarity to the high - affinity sites in prov. from the identified sequences a template motif was derived (table 1). because the derived motif depended on the assumption that high - affinity binding sites are related in sequence we used the motif to predict three potential h - ns binding sites in the fis promoter from positions 150 to + 1. these predicted sites, although imperfect fits to the derived motif, confirmed a footprinting analysis of this promoter (supplementary data) and thus provide a validation of the derived sequence template for h - ns binding in vitro (table 1). combining the sequences for all identified sites yields the 10 bp motif tcgataaatt (figure 1). the base composition, 78% at, is fully consistent with the documented preferred composition of h - ns targets in vivo (12). second, a centrally positioned t - a base step is found in all identified sites. this step would confer thermal instability and both axial and torsional flexibility on the binding sites (13). table 1.derivation of a dna binding motif template for h - nsgenesitefit(/10)prov 1tcgatatatt9prov 2tcgatatatt9gadacggataaatc7gadxtcgttaaaat9virftagattaagt7.5cspaccgattaatc7.5hnstccttacatt8orictgtatacttt6templatetcgttaaatta tfis 1gcgataatta7fis 2gcatttaaaa5.5fis 3gcgactaaaa5.5the prov sequences are taken from ref. (10) and the gada, gadx, virf, cspa, hns and oric sequences from ref. (11). figure 1.(a) logo representation of the experimentally determined h - ns binding motif derived from sequences in table 1. (b) logo representation of the predicted h - ns binding motif derived from identified occurrences in the set of differentially expressed genes responding to h - ns removal under different growth conditions. (c) average at content profiles of sequences from 300 to + 100 bp relative to the start of translation for sets of genes differentially expressed in hns cells but containing or lacking a predicted h - ns binding site. derivation of a dna binding motif template for h - ns the prov sequences are taken from ref. (10) and the gada, gadx, virf, cspa, hns and oric sequences from ref. (11). (a) logo representation of the experimentally determined h - ns binding motif derived from sequences in table 1. (b) logo representation of the predicted h - ns binding motif derived from identified occurrences in the set of differentially expressed genes responding to h - ns removal under different growth conditions. (c) average at content profiles of sequences from 300 to + 100 bp relative to the start of translation for sets of genes differentially expressed in hns cells but containing or lacking a predicted h - ns binding site. however, in vivo binding sites have been identified by h - ns - dna chip - on - chip experiments (12,1416). although such experiments do not provide the resolution of in vitro footprinting, they give valuable genome - scale information on locations where h - ns binds dna. we can therefore ask whether sequences related to the binding motif occur at or close to the identified segments. we found that of the top 99 highest scoring sites identified by grainger. (16) the motif occurred in 59 within 250 bp of the reported signal peak (supplementary data 1). as a control, we randomly picked 99 regions of 500 bp in length and asked what fraction contained a high - affinity h - ns binding site. this calculation was repeated 1000 times and revealed that the average number of expected binding sites was 39, with a standard deviation of 4.5 binding sites. therefore, our observation that 59 of the 99 high - confidence regions have a high - affinity h - ns binding site is statistically significant (z - score = 4.5 ; p - value 21 sds from what is expected by chance. in another independent control experiment, we first identified 1000 random 500 bp segments that had a predicted binding site and analyzed their at content. this investigation revealed that the average expected at content for random 500 bp segments that contained a motif was 52%. we therefore conclude that the sites identified by chip - on - chip are, on average, substantially enriched in at content but randomly selected sequences that may or may not contain a site are not. in the absence of other data, the binding of h - ns to a site in vivo, or even the presence of a site, is not necessarily indicative of a biologically relevant role. to assess the functionality of the h - ns binding motif, we asked whether its occurrence correlated with genes known to be regulated by h - ns in vivo. to test whether such a correlation exists, we scanned two sets of genes previously identified by microarray analysis to be derepressed in an e. coli strain lacking h - ns (17). since h - ns is only one component of a complex regulatory system which includes rpos and lrp as well as other dna binding proteins (1,18), derepression could be either a direct or an indirect consequence of h - ns removal and therefore not all genes identified by these screens are likely to be direct h - ns targets. the first set of scanned genes was initially compiled to include genes responding to h - ns removal under different growth conditions. we found that of the 57 genes scanned 33 (or 57.9%) contained one or more sequences related to the h - ns binding motif within a region spanning positions 300 to + 100 bp relative to the first nucleotide of the translation start site (see methods section). the positive hits included the genes ade, fimd, gada, hlye, ompf, osmc, prov (supplementary data 2), all of which have previously been independently shown to be regulated by h - ns. the second set of scanned genes were initially characterized as those which were differentially expressed in isogenic hns+ and hns strains on either reduction or increase of the natural superhelical density (17). in this set, we found that of the 211 genes scanned 98 (or 46.4%) registered as positive hits (supplementary data 3). these included several additional genes, including the hde locus and many genes involved in flagella formation, previously known to be under h - ns control. combining both sets 116 putative target genes were identified, 32 of which contained more than one copy of the motif. another question of interest was whether the genes containing the h - ns motif differ in base composition from those that do not. since the preferred in vivo targets of h - ns are generally at - rich (12), we compared the base composition of these two classes of genes for the region from 300 to + 100 bp relative to the translation start site (see methods section). we found that for the first set of scanned genes (expression change in the absence of h - ns) the at content of the genes containing the h - ns motif was, on average, consistently 10% above the average at content both of the genes apparently lacking the h - ns motif and also the average composition in this region for all e. coli genes (figure 1 ; p - value 21 sds from what is expected by chance. in another independent control experiment, we first identified 1000 random 500 bp segments that had a predicted binding site and analyzed their at content. this investigation revealed that the average expected at content for random 500 bp segments that contained a motif was 52%. we therefore conclude that the sites identified by chip - on - chip are, on average, substantially enriched in at content but randomly selected sequences that may or may not contain a site are not. in the absence of other data, the binding of h - ns to a site in vivo, or even the presence of a site, is not necessarily indicative of a biologically relevant role. to assess the functionality of the h - ns binding motif, we asked whether its occurrence correlated with genes known to be regulated by h - ns in vivo. to test whether such a correlation exists, we scanned two sets of genes previously identified by microarray analysis to be derepressed in an e. coli strain lacking h - ns (17). since h - ns is only one component of a complex regulatory system which includes rpos and lrp as well as other dna binding proteins (1,18), derepression could be either a direct or an indirect consequence of h - ns removal and therefore not all genes identified by these screens are likely to be direct h - ns targets. the first set of scanned genes was initially compiled to include genes responding to h - ns removal under different growth conditions. we found that of the 57 genes scanned 33 (or 57.9%) contained one or more sequences related to the h - ns binding motif within a region spanning positions 300 to + 100 bp relative to the first nucleotide of the translation start site (see methods section). the positive hits included the genes ade, fimd, gada, hlye, ompf, osmc, prov (supplementary data 2), all of which have previously been independently shown to be regulated by h - ns. the second set of scanned genes were initially characterized as those which were differentially expressed in isogenic hns+ and hns strains on either reduction or increase of the natural superhelical density (17). in this set, we found that of the 211 genes scanned 98 (or 46.4%) registered as positive hits (supplementary data 3). these included several additional genes, including the hde locus and many genes involved in flagella formation, previously known to be under h - ns control. combining both sets 116 putative target genes were identified, 32 of which contained more than one copy of the motif. another question of interest was whether the genes containing the h - ns motif differ in base composition from those that do not. since the preferred in vivo targets of h - ns are generally at - rich (12), we compared the base composition of these two classes of genes for the region from 300 to + 100 bp relative to the translation start site (see methods section). we found that for the first set of scanned genes (expression change in the absence of h - ns) the at content of the genes containing the h - ns motif was, on average, consistently 10% above the average at content both of the genes apparently lacking the h - ns motif and also the average composition in this region for all e. coli genes (figure 1 ; p - value < 10 ; wilcoxon signed - rank test). for the second set of scanned genes (initially assayed under conditions of hyper- and hypo - negative supercoiling), the same differential was observed between the genes containing the h - ns motif and the average composition in this region for all e. coli genes (p - value < 10). however, for this set the at content of the genes apparently lacking the h - ns motif was intermediate between those containing the h - ns motif and all e. coli genes (p - value < 10). by including the additional putative h - ns motifs identified in our sequence screen, we refined the logo for h - ns binding (figure 1) and observed little change from the input motif. again, the most highly conserved feature of the individual identified motifs was a centrally placed t - a base step. in the very few cases where this was absent it was replaced by c - a, the second most flexible base step (13). by their nature, microarray screens used to identify genes whose expression is hns sensitive would not necessarily reveal all genes under direct h - ns control. for example, one such well - characterized gene, bgl, remains uninduced under most laboratory conditions (19). we therefore scanned the genes compiled in the regulondb database (20) as well - characterized targets of h - ns. a total of 24 out of 39 (or 61.5%) contained sequences with a reasonable match to the binding site logo (figure 2a). we noted that the bgl regulatory region, in addition to containing sequences closely related to the template, also contained several similar sequences that fitted the template less closely. using the criterion that such secondary sequences should contain a run of at least six consecutive base - pairs and a t - a base step we identified 10 motifs of this type associated with the bgl regulatory elements (supplementary data). a similar pattern of multiple primary and secondary sequences was also observed in a number of other genes known to be sensitive to h - ns. these included eltab, flga / flgb, hdeab, htda, micf, spvr, virf and yghj (6,7,2123). figure 2.(a) analysis of known transcriptional regulatory network of h - ns from regulondb for occurrence of the binding motif template. the arrows indicate that one protein may directly affect the expression of another but do not indicate whether such regulation would be positive or negative. (a) analysis of known transcriptional regulatory network of h - ns from regulondb for occurrence of the binding motif template. genes containing a predicted strong h - ns binding site are underlined. the arrows indicate that one protein may directly affect the expression of another but do not indicate whether such regulation would be positive or negative. although the genes silenced by h - ns appear to contain multiple putative sites for h - ns binding, there are other genes for which h - ns appears to bind to more isolated sites. one such gene is nir (3) where h - ns binds to the upstream region in concert with fis and ihf to repress promoter activity. this region contains two potential h - ns binding sites (gggtatattg and ttgtataaat) correlating with the h - ns footprint. both contain the core of the consensus and the presence of two t - a steps indicates that the sequences are unlikely to confer coherent intrinsic curvature (24). since it is well established that h - ns regulates many genes correlated with enteric pathogenicity of e. coli and salmonella typhimurium ssp., we asked whether putative h - ns binding sites could be identified within plasmids such as po157 and r27 that confer pathogenicity and also within the pathogenicity - associated islands in the uropathogenic e. coli strain 536 (9). in all cases, we observed a substantial number of positive hits, respectively 19, 80 and 211 genes (figure 3). we note that particularly in the case of the pathogenicity - associated islands of strain 536 there is a strong tendency for the identified genes to be clustered. on average within the islands there although certain predicted sites can be associated with more than one gene (e.g. when transcription is divergent), the analysis also reveals that there are regions within all of the pathogenicity islands where the spacing between strong sites is 8 genes. table 2.average number of genes between identified h - ns binding motifs in the pathogenicity - associated islands in e. coli u536islandaverage number of genes between motifspai12.40pai22.40pai32.38pai42.71pai52.95avg2.57 figure 3.maps of occurrence of sequences with close matches to the binding motif template in selected regions of (a) e. coli k12, (b) uropathogenic e. coli 536 (c) plasmids po157 (top) and r27 (bottom). average number of genes between identified h - ns binding motifs in the pathogenicity - associated islands in e. coli u536 maps of occurrence of sequences with close matches to the binding motif template in selected regions of (a) e. coli k12, (b) uropathogenic e. coli 536 (c) plasmids po157 (top) and r27 (bottom). by combining dna footprinting data from different sources, we have identified a dna sequence that correlates with h - ns binding at specific locations in the e. coli genome. this sequence, or sequences closely related to it, is found in the regulatory regions of genes that are silenced by h - ns (e.g. bgl and prou) and also those (e.g. nir) in which h - ns acts in cooperation with other abundant dna - binding proteins. in the former class, but not in the latter, abundant at - rich sequences which fit less well to the consensus are interdigitated with the putative high - affinity binding sites. we suggest that this organization facilitates the spreading of bound h - ns around nucleating high - affinity sites and the consequent formation of a repressive higher - order structure that is responsible for silencing. we have validated the identified binding site by three procedures by showing that it occurs with high frequency in vivo at h - ns binding sites identified by a chip - on - chip protocol, by a search for its occurrence in genes shown to be differentially regulated in hns mutant strains and by direct comparison to reported characterized footprints. we have further shown that sequences closely related to the consensus are associated with genes implicated in pathogenicity. our search was restricted to a region spanning 300 to + 100 bp relative to the initiating atg of translated genes and would miss sites located outside this region. indeed, one of the high - affinity binding sites identified by bouffartigues. (10) is located at + 130 bp downstream of the translation start site. nevertheless, its identification within all the characterized regulatory regions analyzed (e.g. bgl, prov) implies that a high - affinity binding site or sites are characteristic of such regions. our screen also identified putative binding sites in adjacent genes (e.g. csgd and csge, fima and fimi), and genes separated by one other gene within the same operon (e.g. flgc, flge, flgg). the pattern of sites associated with adjacent genes was particularly apparent both in the r27 plasmid and the pathogenicity - associated islands of e. coli u536. our results are consistent with a silencing mechanism in which h - ns binds first to nucleating high - affinity sites (10,25), corresponding in principle to the logo identified here, and then polymerizes resulting eventually in the formation of a supercoiled interwound filament containing two dna duplexes joined by protein bridges, concomitantly constraining a dna loop (21,2629) (figure 4). this mode of binding also explains previous observations showing that h - ns binds preferentially to dna containing intrinsically curved regions since the dna in plectonemes is bent both within the interwindings and at the apical loops. the frequent location of nucleating sites associated with adjacent genes and also their repetition within operons would allow the filament to silence an extensive region. such a mechanism would be consistent with the silencing of pathogenicity - associated islands in enteropathogenic proteobacteria (9). similarly, the at - rich composition of regions adjacent to the sites we have identified could facilitate spreading of h - ns by interspersing high - affinity nucleating sites with lower affinity at - rich secondary sites. in support of this notion, in the po157 plasmid the higher at content of regions containing h - ns binding sites relative to those that do not, be a simple consequence of the composition of the site itself since there are extensive regions enriched in at close to the initiation codon that lack identified motifs (supplementary data 5). in addition, we have shown that the presence of a motif per se is not necessarily correlated with substantial at enrichment. at - enriched regions are thus extensive and may contain zero to several examples of the motif. we suggest that nucleation of dna binding of a structural component of a protein dna array, such as an h - ns - dna fiber, followed by spreading, may constitute a general mechanism for organizing chromatin both in bacteria and eukaryotes. initial nucleation of h - ns binding at high - affinity sites is following by spreading and condensation of h - ns on supercoiled dna to generate a silenced fiber. blue squares represent high - affinity h - ns binding sequences (nucleating sites) and green and yellow circles represent bound h - ns on nominal distal and proximal sides, respectively, of a promoter. initial nucleation of h - ns binding at high - affinity sites is following by spreading and condensation of h - ns on supercoiled dna to generate a silenced fiber. blue squares represent high - affinity h - ns binding sequences (nucleating sites) and green and yellow circles represent bound h - ns on nominal distal and proximal sides, respectively, of a promoter. the ability of h - ns both to bind locally and to silence longer regions of dna is similar to the dna - binding properties of another abundant global regulator, fis. both can bind with high specificity to individual sites and can also bind cooperatively to more extensive regions. these properties allow them to act both as transcription factors and as determinants of nucleoid structure. another feature of the occurrence of h - ns binding sites is that many genes within a particular regulatory system appear to be targeted. the h - ns binding motif is associated with not only the genes encoding the structural genes of flagella but also with the specific sigma factor (flia) and anti - sigma factor (flgm) genes for regulating flagella biosynthesis. in addition the h - ns binding motif is associated with papx, a gene encoded by the po157 plasmid that is a functional homolog of proteus mirabilis mrpj (30) and represses the flagellar regulon. in this example, the pattern is indicative of a primary global regulator that controls both positive and negative secondary regulators as well as their targets. to assess the biological relevance of this pattern, we compared the occurrence of the motif with the in vivo binding of h - ns to flagellar genes. peaks of binding detected by chip - on - chip are located near flgn, flia, flic (two separate ones), flid, flif and fliz (14). nearly all of these, with the exception of the second flic peak and flid, contain the h - ns binding motif. we conclude that there is a good correlation between the presence of the motif and in vivo binding for this set of genes and that this correlation is indicative of functionality. however, the effects of hns on the expression of the flagellar regulon are complex. in hns mutants, nevertheless, the flhdc master operon is repressed in vitro by h - ns and expression from its promoter is increased in an hns mutant (32). similarly an activator, hdfr, of the master operon, is also negatively regulated by h - ns in vivo (33) and its gene is associated with a putative h - ns binding site. these observations show that h - ns can repress certain individual transcriptons within the flagellar regulon, but the regulatory complexity is such that the outcome of h - ns removal is likely only predictable in the context of the complete control network. we suggest that h - ns acts as a system regulator that is involved in coordinating the expression of the flagellar regulon. another possible example of this mode of control by h - ns is the mxi - spa type iii secretion regulon (34). in this system, the activator virb displaces h - ns from repressed promoter sites but does not itself directly affect rna polymerase function (35). an additional aspect of regulation by h - ns is the interdependent regulation of h - ns and its paralogs. one of the genes identified in our screen was sfh, a paralog of h - ns encoded by the r27 virulence plasmid (21,36). the paralog has the same dna binding domain as h - ns and so is assumed to bind to the same dna sites. notably the regulatory regions of both the hns gene itself and that of its paralog stpa contain multiple sites with similarities to the h - ns binding site, although in neither case are there sites which correspond to the canonical sequence (supplementary data 12). we suggest that interactions between these different, but functionally related proteins serve to act homeostatically to maintain an appropriate overall total concentration of repressors in the cell. concomitantly, the interactions of h - ns paralog and fis with the regulatory regions of other genes encoding nucleoid - associated proteins (crp, hupa, hupb) would similarly act homeostatically to maintain nucleoid structure (figure 2b). the complete genome, predicted proteome and coding sequence locations for the e. coli strain k12 and the plasmids were obtained from ncbi genbank. the regions from 300 to + 100 bp relative to the translation start site were scanned for the presence of the binding motif using several publicly available programs such as mast, motifscanner and scanace. the program weblogo was used to automatically generate logos of the predicted binding sites. for the at content analysis, the genes were categorized into three classes : (i) those that were differentially expressed and predicted to have an h - ns binding site (direct targets), (ii) those that were differentially expressed but did not contain a predicted h - ns binding site (indirect targets) and (iii) those that were not differentially expressed (control set). in order to calculate the mean at content for each position within the sequences of each set. a window of 250 to + 250 bp relative to the signal center was analyzed for presence of the binding site motif. | the global transcriptional regulator h - ns selectively silences bacterial genes associated with pathogenicity and responses to environmental insults. although there is ample evidence that h - ns binds preferentially to dna containing curved regions, we show here that a major basis for this selectivity is the presence of a conserved sequence motif in h - ns target transcriptons. we further show that there is a strong tendency for the h - ns binding sites to be clustered, both within operons and in genes contained in the pathogenicity - associated islands. in accordance with previously published findings, we show that these motifs occur in at - rich regions of dna. on the basis of these observations, we propose that h - ns silences extensive regions of the bacterial chromosome by binding first to nucleating high - affinity sites and then spreading along at - rich dna. this spreading would be reinforced by the frequent occurrence of the motif in such regions. our findings suggest that such an organization enables the silencing of extensive regions of the genetic material, thereby providing a coherent framework that unifies studies on the h - ns protein and a concrete molecular basis for the genetic control of h - ns transcriptional silencing. |
endothelial cells (huvec passage 46 ; clonetics, walkersville, md) were grown to confluence, then stimulated with plasminogen activation inhibitor-1 (pai-1, 10 ng / ml ; american diagnostica inc., supernatant was collected 3 hours after stimulation and centrifuged (145 g, 8 minutes) to remove cell debris. the supernatant was subsequently ultracentrifuged (100,000 g, 6 minutes, 4 degrees) and pelleted. emps were re - suspended in phosphate buffered saline (pbs) and stored at 80c. flow cytometric analysis was used to characterize and quantify emps based on cd31- and annexin v - positivity occurring in a size gate less than 1 m. this size gate was set on forward versus side scatter using latex standard beads measuring 0.84 m (spherotech fp-0856 - 2). enumeration was completed against a known concentration of 7.6 m polystyrene beads placed within the sample (spherotech pps-4). the flow rate used for analysis was 12 l / min (figs. 1 and 2). 7.6 m latex beads are shown in gate p1 and allowed for enumeration of emps. within gate p2, events positive for annexin v (p3) and cd31 (p4) were enumerated against p1 to quantify emp levels. the same settings were used to quantify emps in perfusate samples. as a separate and confirmatory measure, transmission electron microscopy (tem). a 25-l drop of emp in solution was pipetted onto a formvar plastic coated grid (ted pella, inc.) and allowed to air dry for 1 hour. the microparticle grid was examined and photographed by tem with a jeol 100 cx microscope (fig. 3). emp size distribution as measured by tem (10,000magnification) accompanied by a representative micrograph. emps (30010) were introduced to an iv bag (model patient) containing 300 ml of 0.9 ns (model patient) and manually agitated for 3 minutes. the iv bag was connected to a primed cvvh circuit containing 170 ml of 0.9 ns and mixed (~65010 emp / ml final mixed perfusate concentration) as shown in fig., the perfusate was circulated through the cvvh filter (nxstage purema, 200 m pore size, 35 m wall thickness, rate 250 ml / hour) for a period of 70 minutes. 0.5 ml aliquots were removed for flow cytometric analysis at 510 minute intervals for 70 minutes of dialysis. emp levels were recorded and expressed as a fraction of starting concentration after mixing occurred. three runs were completed and the fraction of emps versus time was plotted with standard error of the mean (sem). at the end of 4 hours filtration,. a 300 ml iv bag of 0.9 ns served as the model patient and was spiked with emps. the circuit contained 170 ml 0.9 ns and ran counter - current against 1 l of 0.9 ns dialysate. after mixing, 0.5 ml aliquots were drawn from the patient for analysis as dialysis was completed via the filter. endothelial cells (huvec passage 46 ; clonetics, walkersville, md) were grown to confluence, then stimulated with plasminogen activation inhibitor-1 (pai-1, 10 ng / ml ; american diagnostica inc., supernatant was collected 3 hours after stimulation and centrifuged (145 g, 8 minutes) to remove cell debris. the supernatant was subsequently ultracentrifuged (100,000 g, 6 minutes, 4 degrees) and pelleted. emps were re - suspended in phosphate buffered saline (pbs) and stored at 80c. flow cytometric analysis was used to characterize and quantify emps based on cd31- and annexin v - positivity occurring in a size gate less than 1 m. this size gate was set on forward versus side scatter using latex standard beads measuring 0.84 m (spherotech fp-0856 - 2). enumeration was completed against a known concentration of 7.6 m polystyrene beads placed within the sample (spherotech pps-4). the flow rate used for analysis was 12 l / min (figs. 1 and 2). 7.6 m latex beads are shown in gate p1 and allowed for enumeration of emps. within gate p2, events positive for annexin v (p3) and cd31 (p4) were enumerated against p1 to quantify emp levels. the same settings were used to quantify emps in perfusate samples. as a separate and confirmatory measure, transmission electron microscopy (tem). a 25-l drop of emp in solution was pipetted onto a formvar plastic coated grid (ted pella, inc.) and allowed to air dry for 1 hour. the microparticle grid was examined and photographed by tem with a jeol 100 cx microscope (fig. 3). emp size distribution as measured by tem (10,000magnification) accompanied by a representative micrograph. emps (30010) were introduced to an iv bag (model patient) containing 300 ml of 0.9 ns (model patient) and manually agitated for 3 minutes. the iv bag was connected to a primed cvvh circuit containing 170 ml of 0.9 ns and mixed (~65010 emp / ml final mixed perfusate concentration) as shown in fig., the perfusate was circulated through the cvvh filter (nxstage purema, 200 m pore size, 35 m wall thickness, rate 250 ml / hour) for a period of 70 minutes. 0.5 ml aliquots were removed for flow cytometric analysis at 510 minute intervals for 70 minutes of dialysis. emp levels were recorded and expressed as a fraction of starting concentration after mixing occurred. three runs were completed and the fraction of emps versus time was plotted with standard error of the mean (sem). at the end of 4 hours filtration, a 300 ml iv bag of 0.9 ns served as the model patient and was spiked with emps. the circuit contained 170 ml 0.9 ns and ran counter - current against 1 l of 0.9 ns dialysate. after mixing, 0.5 ml aliquots were drawn from the patient for analysis as dialysis was completed via the filter. the decline in emp levels due to dialysis is rapid with 50% of clearance being seen in the first 30 minutes. within 40 minutes, the circulating emp levels were reduced to 29% of starting concentration and this level stayed relatively constant over the duration of the study. to determine the fate of the cleared emps, we measured emp levels in the dialysate. the dialysate contained 5.7% of the original emp concentration (~65010 emp / ml) at the end of 4 hours of uninterrupted dialysis. emps levels expressed as a fraction of initial concentration by time and averaged over 3 experiments. the data presented here demonstrate that counter - current dialysis using a standard clinical cvvh filter and under clinical conditions removes emps from a modelled patient 's circulation. given our previous evidence of emp - induced ali, these findings support the idea of cvvh as a meaningful therapeutic intervention in ali due to clearance of emps from the patient circulation. the experimental conditions achieve the same plasma level of emps as seen in human clinical disease (110 per ml). while this work demonstrates that a standard 200-m cvvh circuit and filter entraps emps, there are significant limitations to the model presented. the observed emp clearance is likely a saturable phenomenon, which would explain the relatively constant emp concentration from 40 to 70 minutes and low dialysate emp levels. the relative volume of human circulation (~5 l) to cvvh circuit (~200 ml) is much higher in the clinical condition as compared to our model (300 and 170 ml, respectively). while this would not affect a steady state of dialysis, a saturable filter emp - binding additionally, emps may continue to be generated in a patient and a non - saturable clearance method would be required to achieve a lower steady state emp concentration. convection and pressure gradient forces were not modelled, as these interventions require replacement fluid and this would confound emp measurement. however, if emp charge and size are amenable, forced hindered diffusion via the application of convective and pressure forces coupled with replacement by emp - free fluid would likely sustain clearance. in conjunction with particle trapping by the filter, the first order kinetics of emp clearance could be prolonged at a minimum. additionally, emp interactions in vivo with plasma oncotic elements (circulating cells, albumin, etc.) we do not feel that such elements have a major impact upon the steady state of emps in vivo, since characterized emps in human disease states using flow cytometry have identified the 0.510 per ml threshold injury value using flow cytometry of submicron events occurring in platelet - free plasma (54). thus, the absence of these elements in our model is representative of the steady state of unbound plasma emps present in human disease. the low dialysate emp level and plateauing circulation emp level beyond 40 minutes suggest that emp sequestration occurs within the cvvh filter or tubing and that this is a saturable phenomenon. frequent changing of the cvvh filter is a logical step that may overcome this limitation. additionally, more efficient and selective emps clearance can be realized by conjugating endothelium - specific antibodies to commercially available specialty cvvh filters (aethlon adapt). this approach would provide more selective binding sites and higher affinity for circulating emps. by combining a selective filter with convection and pressure gradients, emp clearance could likely be substantially prolonged. clinical data generally support the protective role of cvvh in ali management. a clinical randomized trial and several animal trials demonstrate that the achievement of negative fluid balance is associated with improved outcomes from ali (6265)(67,68). in addition to its salutary effects on emp levels, early cvvh may prevent or minimize volume overload that is commonly observed with the resuscitation phase of critical illness, particularly in persons suffering concomitant acute kidney injury (aki). thus, cvvh could be used as an effective tool targeting both the molecular machinery and iatrogenic components of ali. as a translatable next step, we plan to assay patients pre- and post - dialysis to observe emp concentration effects. ultimately, the application of dialysis to rodent models of emp - induced ali would examine efficacy in on - going diseases and emp thresholds associated with worse injuries. while the utility of ultrafiltration can be tested in an animal model, diffusion appears to be enough to remove emps due to their small size : standard dialysis alone was effective in this in vitro model. the authors have not received any funding or benefits from industry or elsewhere to conduct this study. | backgroundendothelium - derived microparticles (emps) are submicron vesicles released from the plasma membrane of endothelial cells in response to injury, apoptosis or activation. we have previously demonstrated emp - induced acute lung injury (ali) in animal models and endothelial barrier dysfunction in vitro. current treatment options for ali are limited and consist of supportive therapies. we hypothesize that standard clinical continuous venovenous hemofiltration (cvvh) reduces serum emp levels and may be adapted as a potential therapeutic intervention.materials and methodsemps were generated from plasminogen activation inhibitor-1 (pai-1)-stimulated human umbilical vein endothelial cells (huvecs). flow cytometric analysis was used to characterize emps as cd31- and annexin v - positive events in a submicron size gate. enumeration was completed against a known concentration of latex beads. ultimately, a concentration of ~650,000 emp / ml perfusate fluid (total 470 ml) was circulated through a standard cvvh filter (pore size 200 m, flow rate 250 ml / hr) for a period of 70 minutes. 0.5 ml aliquots were removed at 5- to 10-minute intervals for flow cytometric analysis. emp concentration in the dialysate was measured at the end of 4 hours to better understand the fate of emps.resultsa progressive decrease in circulating emp concentration was noted using standard cvvh at 250 ml / hr (a clinical standard rate) from a 470 ml volume modelling a patient 's circulation. a 50% reduction was noted within the first 30 minutes. emps entering the dialysate after 4 hours were 5.7% of the emp original concentration.conclusionthese data demonstrate that standard cvvh can remove emps from circulation in a circuit modelling a patient. an animal model of hemofiltration with induction of emp release is required to test the therapeutic potential of this finding and potential of application in early treatment of ali. |
aqueous dispersions of micrometer - sized droplets of thermotropic liquid crystals (lcs) provide versatile platforms for the design of stimuli - responsive soft matter systems. the responsiveness of these droplet - based lc systems to various types of stimuli results from the fine scale of energetics that controls the equilibrium ordering of lcs. specifically, past studies have established that the ordering of lcs within micrometer - sized droplets reflects contributions to the free energy that arise from orientation - dependent anchoring of the lc at the surfaces of the droplets, elastic strain of the lc associated with the accommodation of surface anchoring, and the formation of topological defects. recent studies, however, have also led to observations involving lc droplets in aqueous dispersions that reveal our understanding of factors controlling the ordering of lc droplets to be incomplete. in particular, existing theories of lc droplets can not account for (i) changes in the internal configurations of the lc droplets that occur with changes in droplet size, (ii) the effects of simple salts on the ordering of the lcs, or (iii) the partitioning of amphiphiles to the defects of lc droplets. in this paper, we seek to advance our understanding and ability to design aqueous dispersions of stimuli - responsive lc droplets by exploring the properties of lc droplets encapsulated (or caged) inside thin and porous polymeric membranes. our results reveal that the interactions of the lc droplets with the interfaces of the polymeric cages give rise to surfactant - triggered shape changes and resulting internal ordering transitions that are not seen in free lc droplets. of particular relevance to this article are recent studies that have investigated the ordering of spherical lc droplets encapsulated in capsules composed of polyelectrolyte multilayers (pems). in those studies, the spherical polymeric capsules were formed using noncovalent interactions (e.g., electrostatic interactions or hydrogen bonding), and the lcs were observed to fill the interiors of the capsules completely. the study reported in this article moves to investigate the ordering of lcs within multilayer capsules prepared by covalent reactions of branched polyethylenimine (pei) and poly(2-vinyl-4,4-dimethylazlactone) (pvdma). in contrast to capsules formed from pems, multilayer capsules formed using pei and pvdma have been found to fill only partially with lc, resulting in the formation of micrometer - sized lc droplets that are trapped or caged in aqueous solutions contained within the polymer capsule. these systems are a particularly interesting class of responsive soft matter, as the capsules can be designed to bind to the surfaces of mammalian cells, with the caged lc droplets undergoing changes in optical appearance upon exposure to cytotoxic analytes (thus providing the basis for sensors of local concentrations of toxic analytes near cells, etc.). the work reported here sought to provide insight into some of the observations reported above and explore further the properties of caged lc droplets in the presence of aqueous solutions of surfactants. first, we report on the origins of the partial filling of pei / pvdma capsules by the nematic lc e7. in this context, we describe the design of new amphiphilic polymeric capsules that were prepared to present a hydrophobic inner surface to the lc droplet (to promote filling) and a charged (cationic) outer surface to promote the dispersal of the capsules in water. we establish that the partial filling of the capsules by e7 is also observed with amphiphilic capsules and that it arises largely from the swelling of the capsules upon transfer into water from the bulk lc phase after filling of the capsules with lc. second, because the capsules are partially filled by lc (the remainder of the internal volume of the capsule is an aqueous solution), we explore changes in the shapes of the caged lc droplets that are driven by surfactant - induced changes in the wetting of the lc on the inner surfaces of the capsules. as detailed below, we observed the addition of surfactants to aqueous solutions of caged lc droplets to promote wetting and ordering transitions of a complexity not observed in free lc droplets, which may permit new designs of stimuli - responsive lc - droplet - based systems. the fabrication of hollow polymer microcapsules was performed according to a previously published procedure for the layer - by - layer (lbl) formation of covalently assembled polymeric capsules. on the basis of a past report, we used monodisperse silica microspheres with a diameter of 4.99 0.22 m as a template for the polymer microcapsules to produce lc droplets of a size that is sensitive to amphiphilic adsorbates. solutions of pei and pvdma (or pvdmafl labeled with 6-aminofluorescein to facilitate fluorescence - based imaging) (figure 1a) were prepared in acetone (20 mm with respect to the molecular weight of the polymer repeat unit). sio2 microparticles (100 l in plastic microcentrifuge tubes) were rinsed with 1 ml of acetone and centrifuged prior to the addition of polymer. in brief (see si and past reports for details), an initial layer of pei was adsorbed onto the silica microparticles through electrostatic interactions, and subsequent layers of pvdma (or pvdmafl) and pei were sequentially added, layer - by - layer, to build up a covalently cross - linked multilayer film. between the addition of each polymer layer, particles were rinsed three times by centrifugation (2 min at 1500 rpm) and resuspension in acetone. films fabricated using this method have been shown previously to contain residual azlactone groups, providing a reactive handle for postfabrication functionalization with other chemical functionalities. we selected two different structural motifs, shown in figure 1b ; further discussion is included below. after the fabrication of two pei / pvdma bilayers, the coated microparticles were rinsed with tetrahydrofuran (thf) and functionalized by adding 1 ml of decylamine (da, figure 1b) in thf (20 mm) for 1 h to install the hydrophobic functionality. these da - functionalized coated microparticles were then rinsed with thf three times and dispersed in acetone prior to resuming the fabrication of an additional 2.5 bilayers of pei and pvdma. finally, to functionalize these outer 2.5 bilayers with protonatable hydrophilic functional groups, the microparticles were washed with thf three times and then dispersed in 1 ml of 3-(dimethylamino)propylamine (dm) in thf (20 mm) for 1 h. polymer - coated silica microparticles were rinsed with thf three times by centrifugation and then suspended in a small volume of water (100 l) in preparation for aqueous etching. the silica core was removed from the polymer membrane by treatment with a commercially available buffered oxide etching (boe, 10:1) solution containing hydrofluoric acid (hf) ; see materials section in si. hf solutions and vapors are extremely poisonous and corrosive and may cause extreme burns that are not immediately painful. handle with extreme caution in a chemical fume hood, and use appropriate protective equipment (gloves, face / eye protection, laboratory coat, etc.), and neutralize waste appropriately.) the samples were incubated with 800 l of boe at room temperature for 510 min. the resulting hollow capsules were centrifuged (4500 rpm for 5 min) and rinsed five times in 1 ml of water. after the silica template was removed to obtain hollow polymeric microcapsules, the microcapsules were filled with lc following a previously reported protocol. in brief, the capsules were rinsed with ethanol twice, centrifuged to remove as much of the supernatant ethanol as possible, and suspended in a mixture of 5% ethanol and 95% e7. this mixture of ethanol and e7 forms an isotropic phase that can infiltrate the polymeric capsules. the ethanol was slowly evaporated from the sample by leaving the tube containing the sample uncapped on a shaker plate for 24 h, resulting in a nematic phase containing the capsules. the capsules were then extracted into an aqueous phase by removing excess e7 by centrifugation, contacting the sample with water, and shaking gently. this procedure resulted in the spontaneous transfer of capsules containing lc droplets to the aqueous phase. dispersions of either bare or coated microparticles, hollow capsules, and lc - containing capsules were placed on a coverslip and optically imaged in bright - field polarized light (crossed polarizers) using fluorescence modes with an olympus ix-71 inverted microscope (center valley, pa) with a 100 oil - immersion objective (with or without an additional 1.6 optical zoom) and equipped with a 100 w mercury lamp. for fluorescence - based imaging of capsules fabricated using pvdmafl, an olympus u - mnb2 fluorescence filter cube was used with a 470490 nm excitation filter and a 520 nm emission filter. a monochrome hamamatsu 1394 orca - er ccd camera (bridgewater, nj) was controlled with simplepci software (compix, inc. images were later analyzed using imagej software (nih, bethesda, md). for each sample, the bulk solution was imaged using polarized light microscopy to determine the ordering of lc droplets in capsules that were freely diffusing. however, since the diffusion quickly moved the capsules out of the plane of focus or the field of view, capsules could be imaged in all three imaging modes (bright field, crossed polarizers, and fluorescence) only after sedimentation onto the coverslip surface. in our experiments, we did not observe any orienting effect on the lc resulting from contact with the coverslip, as reported in a past study. (a) chemical structure of branched pei and pvdma used for the covalent layer - by - layer assembly of multilayer films. chemical functional groups : decylamine (denoted r1 or da) was used to functionalize the first two bilayers, and dimethylaminopropylamine (denoted r2 or dm) was used to functionalize the outer 2.5 bilayers (see text). in contrast to prior studies described in the introduction, the capsules used in this current investigation were prepared to have walls with hydrophobic functionality facing the interior of the capsule and hydrophilic functionality on the outer surface. this was accomplished by functionalizing the interior with decylamine (da) and the exterior with dimethylaminopropylamine (dm) such that the hydrophobic interior contacted the lc and the hydrophilic exterior surface contacted the bulk aqueous phase. (see figure 1 and the experimental section for details.) in the remainder of this article, we refer to these capsules as having an amphiphilic structure and by using the acronym dadm to identify the da and dm motifs decorating the interior and exterior walls of the capsules. in the interest of brevity, the confirmation of the successful synthesis of these dadm capsules is detailed in the supporting information (si). specifically, we present evidence of the incorporation of the da and dm into the capsule walls (figure s1) and show scanning electron micrographs of polymer - coated microparticles and hollow capsules (figure s2). measurements made using the scanning electron micrographs reveal the size of the dried, polymer - coated microparticles to be 4.9 0.2 m. after treatment with lc using methods that lead to the complete filling of pem - based capsules in past studies, we observed the dadm - functionalized pei / pvdma capsules used here to be only partially filled with lc (see figure 2f, middle row). specifically, we measured the average diameters of the dadm capsules and the lc droplets to be 6.7 0.3 and 4.9 0.5 m, respectively ; that is, the lc filled approximately 40% of the internal volume of the capsules. to provide insight into the reasons underlying partial filling, we imaged the film - coated microparticle precursors and the hollow capsules in each step of the synthesis (figure 2). the images in the middle row of figure 2 are bright - field micrographs, and images in the bottom row are fluorescence micrographs of fluorescein - labeled capsules that clearly define the sizes and shapes of the capsules. first, the dadm - coated silica microparticles in water were measured to have a diameter of 5.3 0.3 m (figure 2b), a value that is indistinguishable from the diameter measured for the bare silica microparticles in water (5.2 0.3 m as in figure 2a). second, after etching of the silica templates, we measured the diameter of the resulting hollow capsules to vary significantly depending upon the solvent in which they were suspended (figure 2c e). specifically, we measured capsule diameters to be 6.7 0.3 m in water, 5.6 0.3 m in 90% acetone/10% water, and 4.7 0.2 m in nematic e7. third, upon extraction of lc - containing dadm capsules into an aqueous phase, the capsule diameter was again measured to be 6.7 0.3 m (figure 2f), a value that is indistinguishable from that of empty capsules in water. overall, these observations reveal that the volume of the lc encapsulated within the polymeric shell is determined by the size of the capsule when it is present in the nematic lc (i.e., during filling ; compare panels e and f of figure 2). when lc - filled capsules are extracted into an aqueous phase, the capsules swell, thus resulting in capsules that are only partially filled. we emphasize that the volume of the lc droplets caged within the polymer capsules when dispersed in water is roughly equal to the interior volume of the capsules when they are dispersed in nematic lc during filling. the top row shows a cartoon of the sample composition, the middle row consists of bright - field images, and the bottom row contains the corresponding fluorescence microscopy images of (a) bare silica microparticles in water, (b) dadm - coated silica microparticles in water, (c) empty dadm capsules in water (after hf treatment and rinsing), (d) empty dadm capsules in a solution of 90% acetone and 10% water, (e) dadm capsules in nematic e7, and (f) dadm capsules partially filled with e7 in water. the average capsule size is noted below the fluorescence microscopy image, and the lc droplet size is also denoted below (f). bright - field and fluorescence microscopy images are not shown for all states, e.g., where the sample was not in focus or not fluorescent. (a, b) micrographs of the same group of capsules imaged with different locations of the focal plane such that in (a) the circular capsule on the right of the image was in focus and in (b) the crescent - shaped capsule in the center of the group was in focus. (c) micrograph of a separate region showing a group of capsules with more spherical than nonspherical capsules. finally, we comment that a fraction of capsules observed in nematic e7 (approximately one in six capsules prior to extraction into water) possessed nonspherical crescent shapes, consistent with a buckling instability in the capsule wall (figure 3). for these nonspherical capsules, we measured the long axis (i.e., the largest diameter that could be measured) to be 4.5 0.3 m, corresponding to a diameter similar to that of the spherical capsules (4.9 0.5 m), and the short axis (perpendicular to the long axis) was measured to be 2.3 0.6 m. this small subpopulation impacted the underfilling of the capsules with lc and contributed to heterogeneity in the size and shape of the capsules and droplets. we note that the majority of capsules that we observed to be nonspherical in the e7 phase returned to a spherical shape when transferred to the aqueous phase ; a very small percentage of capsules (approximately 2%) remained nonspherical in shape. figure 4a c shows representative caged lc droplets imaged in bright - field and polarized light modes as well as schematic illustrations of the ordering of the lc in the droplets. a number of features of the droplets imaged between crossed polarizers led us to conclude that the orientational ordering of the lc within these droplets corresponds to a so - called bipolar configuration. in this configuration, aqueous interface with two point defects at diametrically opposite poles, as depicted schematically in the right column of figure 4. in figure 4a, the key identifying features are the two dark spots on the left and right sides of the droplet, bright lobes above and below these spots, and a relatively dark center of the droplet, indicating that the lc in the center is aligned with either the polarizer or analyzer. the narrow dark spots correspond to point defects on the droplet surface known as boojums that define the poles and, thus, the symmetry axis of the bipolar nematic droplet. (the angle that this symmetry axis makes with the polarizer is indicated on the polarized light images.) typically, boojum defects can be seen in bright - field images as dark regions because they possess a local refractive index environment that is distinct from that of the rest of the lc droplet and thus scatter light. however, optical distortions resulting from the polymer capsule prevented us from identifying the boojums in many of our bright - field images. bright - field and polarized light micrographs of dadm capsules in water (left and center columns, crossed polarizers indicated by white arrows). corresponding schematic illustrations of the lc director profiles are shown in the right column. the angle that the axis of symmetry of the droplet makes with the polarizer is 0 in (a), 14 in (b), and 43 in (c). (d) two droplets with asymmetric shapes also exhibit signature features of bipolar ordering with arrows indicating the locations of boojum defects. figure 4b shows a droplet that has its symmetry axis, defined again by dark spots that correspond to the boojums, at an angle between the polarizer and analyzer. the rotation of the symmetry axis away from the polarizer / analyzer results in a birefringent texture within the droplet that is brighter than that shown in figure 4a. this has curved dark bands within the bright central region in a baseball - like pattern, a characteristic that is frequently used to identify bipolar droplets. figure 4c shows a bipolar lc droplet within a capsule aligned with its axis of symmetry at an angle of 43 from the polarizer and analyzer. in this image, we observed only one bright region next to each boojum, as the other lobe is more closely aligned with a polarizer. in summary, the observations reported above are consistent with a bipolar configuration of roughly spherical lc droplets within the capsules. while the majority of the caged lc droplets appeared to be spherical, we also observed a subpopulation of nonspherical, asymmetric droplets (approximately one in four droplets was asymmetric ; see discussion below for a further analysis of shape). figure 4d shows an example of two capsules that contain nonspherical lc droplets. in these images, it appears that the lc has partially wet the inner surface of the capsules, causing the droplets to distort to asymmetric lemonlike shapes. droplets that assumed this asymmetric shape, however, still exhibited birefringent textures that closely resembled those of the spherical droplets. we conclude that the lc ordering in these cases is a distorted bipolar configuration (figure 4d), with the two boojums located close to the contact line defined by the lc polymer interface. here, we also note that the shape of the polymeric capsules did not appear to be perturbed by partial wetting of the inner surface of the capsule by the lc. previous studies have shown that addition of surfactants to aqueous dispersions of lc droplets can trigger a bipolar - to - radial ordering transition within the droplets. inspired by these results, we investigated the response of lc droplets confined within dadm capsules to model anionic and cationic surfactants (sodium dodecyl sulfate (sds) and dodecyl trimethylammonium bromide (dtab)). the first section below describes lc wetting transitions within amphiphilic capsules induced by sds and dtab, and the second section describes changes in the internal ordering that occur in response to each of the two surfactants. we note that the highest concentrations of surfactant used in the experiments described below were less than the critical micelle concentrations to avoid the solubilization of the lc. bright - field (top row), polarized light (middle row, crossed polarizers), and fluorescence (bottom row) micrographs of representative regions showing lc ordering and wetting in partially filled capsules as a function of increasing sds concentration (indicated below each column). labels above each column indicate the internal ordering of the lc at each concentration. figure 5 shows the appearance of lc droplets within dadm capsules upon exposure to increasing concentrations of sds. an inspection of figure 5 reveals that the addition of sds caused a continuous decrease in the contact angle () of the lc on the inner surfaces of the capsules (see figure 6 for the definition of and values of measured from bright - field micrographs), resulting in a change in the shape of the lc droplet. figures 5 and 6, when combined, first reveal that low concentrations of sds (0.050.25 mm) caused the lc droplets to adopt a convex lens shape (130 10). at moderate sds concentrations (0.251 mm), we observed hemispherically shaped lc droplets (89 5), with approximately planar (low curvature or a large radius of curvature (rc), see discussion below) lc aqueous interfaces inside the capsules. we note that the shape (and internal ordering) of the lc droplets was not homogeneous within a sample ; for example, at 0.25 mm sds, we observed both lens - shaped droplets and nearly hemispherical droplets. (see also figure s3 for information regarding the distribution of for samples in water or at different surfactant concentrations.) lastly, at higher sds concentrations (0.510 mm), we observed a large population of droplets that adopted a concave lc aqueous interface within the capsules (30 for each data point). in contrast to the above - described influence of sds on the wetting of lc on capsule walls, we did not observe a substantial change in the shape or wetting of lc droplets in the presence of dtab (see figure 7 ; the average increased from 157 11 in water to 162 10 in 10 mm dtab ; see also the si for histograms of). in contrast to our results using sds, this result suggests that dtab permeates but does not adsorb to the wall of the capsule to an extent that it leads to measurable changes in the contact angle, likely because of the positive charge of the dimethylamine functional groups decorating the outer walls of the dadm capsules. bright - field (top row), polarized light (middle row, crossed polarizers), and fluorescence (bottom row) micrographs of representative regions showing lc ordering and wetting within partially filled capsules as a function of increasing dtab concentration (indicated below each column). labels above each column indicate the internal ordering of the lc at each concentration. concurrent with the surfactant - induced wetting transitions on the inner surfaces of the capsules, we observed the ordering of the lc within the droplets to change with the addition of sds and dtab (middle row of images in figures 5 and 7). as discussed above, the encapsulated lc droplets exhibited bipolar ordering in water (i.e., no surfactant, see figure 4). when dtab was added to an aqueous dispersion of encapsulated lc droplets, we observed very little change in the shapes of the droplets (figure 7), and the sequence of internal configurational states that we observed was similar to that of free lc droplets. the states observed include (i) saturn - ring disclination line - containing states (at 2.5 mm dtab), (ii) preradial configurations with a single point defect on the surface (from 2.5 to 5 mm), and (iii) radial configurations (from 5 to 10 mm). we note, in particular, that the appearance of the radial configuration is consistent with very weak interactions between the lc droplets and the inner surfaces of the capsules. past studies have noted that the contact of lc droplets with surfaces often pins the configurational state of lc droplets at high surfactant concentration in the preradial state. next, we characterized the ordering states of the lc within the lens- and hemispherical - shaped lc droplets (85127) that formed in the presence of sds. figure 8a d shows selected lc droplets in the presence of 0.25 mm sds (90). we interpret the optical appearance of these droplets to indicate that they possess ordering consistent with an axial or saturn - ring configuration in which the axis of symmetry of the lc ordering follows the axis of symmetry of the droplet shape. we note that this optical texture is observed for lens - shaped droplets in the presence of 0.05 mm sds (figure 5), and it is also observed in samples at higher concentrations of sds (up to 1.0 mm). as seen from a side view (figure 8c, d), this director profile exhibits a disclination line near the planar interface such that the profile resembles that of a saturn - ring configuration. (see figure s4 for images of bare e7 droplets with saturn - ring and radial configurations.) schematic director profiles (left column) with corresponding bright - field (middle column) and polarized light (right column, crossed polarizers indicated by white arrows) micrographs of (a) top, (b) tilted, and (c, d) side views (at different angles with respect to the polarizer / analyzer) of hemispherical lc droplets contained within dadm capsules in 0.25 mm sds. (e, f) side views at different angles of hemispherical lc droplets in 1 mm sds. (g, h) schematics show possible director configurations for inhomogeneous boundary conditions. additionally, the top view (figure 8a) of the hemispherical droplets has four white lobes surrounding a dark cross, consistent with the axial symmetry indicated in figure 8. as the sds concentration was increased, the lc droplets transitioned to an internal configuration that resembled a deformed radial droplet (figure 8e, f, 1 mm sds, see also the video in the si) with a point defect clearly visible in the bright - field and polarized light micrographs. we note that another possible director configuration that is consistent with the micrographs is shown in figure 8 g, as further discussed below. the key results of the study reported in this article relate to the response of caged lc droplets to surfactants. in contrast to free lc droplets, where sds and dtab trigger qualitatively similar configurational transitions and cause a minimal change in shape, we observed dadm - caged lc droplets to undergo wetting transitions in the presence of sds but not dtab. the change in droplet shape that accompanied the wetting transition resulted in differential effects of the two surfactants on the internal configurations of the lc within the droplets. we emphasize that this situation also differs from past reports that examined the anchoring of lcs confined to capillaries (diameter 10200 nm), microgrooves, silica pores, polymer - dispersed cavities, and so forth because the internal volumes of those structures were completely filled with lc. (thus, changes in shape were not observed ; see ref (34) for one exception.) below, we discuss in more detail the coupled wetting transitions and ordering transitions described in this article. to provide insight into the wetting transitions, we calculated the shapes of the caged droplets by solving the laplace equation under the assumption that gravity and the elasticity of the lc have a negligible influence on shape. the neglect of gravity is justified by an evaluation of the bond number, calculated as bo = gl/, where is the difference in densities of the fluid phases, g is the acceleration due to gravity, l is the characteristic length (for which we use the droplet radius), and is the interfacial tension. for our experimental system as noted above, we also neglect the effect of the elasticity of the lc on the shape of the lc droplets since the ratio of the elastic energy to the surface energy, given as k/v (where k is either the splay or bend elastic constant and k 10 n), is 10 for our experimental system. aqueous interface will have constant curvature within the caged lc droplets, as predicted by the laplace equation under the above - stated conditions. figure 9a shows the shapes of lc droplets on (i) planar surfaces and (ii) the curved interior surfaces of the microcapsules, both calculated as a function of [and by assuming that the capsules are rigid (see experimental observations above) and of constant size ]. for these calculations, we used a volume of lc that corresponded to 40% of the interior of the capsule volume (also consistent with the experiments reported in this article). to enable comparisons of the lc droplet behavior on a flat substrate and in a spherical cavity, figure 9b shows a plot of the interfacial area between the lc and polymer (i.e., the wall of the capsule or the surface of the flat substrate) and between the lc and aqueous phase, both as a function of. finally, figure 9c shows the radii of curvature of the lc aqueous interfaces, plotted as a function of for the two geometries. from figure 9a first, an inspection of figure 9b reveals that, within a spherical cavity defined by the polymer capsule, there exists a crossover at which the interfacial area between the lc and polymer capsule exceeds the interfacial area of the lc aqueous interface. for the lc volume and capsule size used in our calculations, this occurs at 130. in contrast, on a planar surface, the interfacial area between the droplet and supporting substrate is always less than the aqueous interface. we also note that, on a planar substrate, the areas of the two interfaces of the lc droplets approach each other only in the limit of 0. in this limit, a thin film of infinite area is predicted. in contrast, however, in a spherical cavity, a thin film of finite thickness (0.5 m thick, as shown in figure 9a) is formed on the interior surface of the capsule wall in the limit of 0. from this result, we conclude that the caging of droplets within capsules provides, in general, the basis of a versatile method for control of the relative interfacial areas of liquids that is not possible on flat surfaces. (a) calculated shapes for lc droplets of constant volume (using the average experimental volume) with varying contact angle for two geometries : (i) on a flat surface and (ii) within a spherical cavity equal in size to the dadm capsules in water. black lines represent the flat surface or spherical cavity, and blue lines represent the lc aqueous interface. axes are square, with the grid on the x axis marking 10 m (each droplet is plotted with centers 10 m apart), and contact angles are used to label the x axis. (b) graph of interfacial areas ; interfaces are indicated within the legend. (c) graph of the radius of curvature (rc) of the lc aqueous interface for each geometry. (d) shapes plotted for a constant contact angle of 90 for varying volumes of lc, denoted on the plot relative to v, the average volume measured experimentally. the second set of observations that we make from figure 9 relates to the radius of curvature (rc) of the lc interface. specifically, an examination of figure 9c reveals that the caging of lc droplets within capsules leads to radii of curvature of the lc interfaces that are strikingly different from those on planar substrates. in particular, as the contact angle of the lc with the capsule wall approaches 84, we calculate rc of the lc aqueous interface to diverge to positive or negative infinity. (see also experimental observations in figure 5.) in contrast, the rc of lc on a planar interface diverges only in the limit of 0. this fundamental difference in the behavior of rc is significant, as rc dictates the laplace pressure difference, = pin pout = 2/rc, across the interface of the droplet. thus, rc also affects the chemical potential of the lc inside a droplet, which is given by i(rc) = i() + 2vi / rc, where i() is the chemical potential of species i with a flat interface and vi is the molar volume of species i. in particular, we note that for all contact angles (figure 9c), the rc of the lc aqueous interface for lc contained within a spherical cavity is either negative (at < 84) or larger (84 < < 180) than that of the lc on a flat surface. this observation, when combined with the influence of the laplace pressure on the chemical potential of the lc, leads us to conclude that the chemical potential of caged lc is lower than that of an lc droplet on a flat surface. if two such droplets were present in a system, then we would predict that ostwald ripening would cause the growth of the encapsulated droplet at the expense of decreasing the size (and rc) of the droplet of the same volume on a flat surface. the effects of changes in droplet volume for caged lc droplets and lc droplets supported on flat surfaces are shown in figure 9d (for constant = 90). for caged droplets, an increase in volume leads to an increase in rc before turning negative. significantly, the chemical potential of the lc in the caged droplet decreases more rapidly with increasing volume as compared to droplets on flat surfaces. this observation leads us to predict that capsules containing droplets with rc < 0 will be stable with respect to both uncaged droplets as well as bulk lc. a second key result reported in this article is that the wetting transitions described above are coupled to changes in the internal ordering and topological defects of the lc. in order to discuss this coupling, two key concepts need to be introduced, namely, the topological charge of defects and the euler characteristic of closed surfaces. the topological charge (n) of a defect is related to the number of times the lc director rotates through all possible angles encountered on a surface that encompasses the defect. for example, in the case of a bipolar droplet, a topological charge of n = + 1/2 is assigned to each of the boojum defects by placing a hemispherical surface around the boojum and evaluating the director orientations. for the case of a radial droplet with a central point defect, the defect can be surrounded by a spherical surface that encounters all possible angles of the director, and it therefore has a topological charge of n = + 1. for droplets in transition states that connect the bipolar and radial configurations of spherical lc droplets and possess uniform boundary conditions (the tilt angle with respect to the surface normal is the same everywhere on the droplet surface), gauss s theorem requires the conservation of topological charge. for example, the transition state that comprises a saturn - ring disclination line located slightly inside the surface of the droplet must have a topological charge of + 1 (it can be encompassed by a spherical surface that encounters all orientations of the lc director). another commonly encountered transition state that lies between the bipolar and radial configurations is the preradial configuration with a topological charge of n = + 1. the above - described discussion addresses the well - studied case of configurational transitions in spherical droplets whereas the experiments reported in this article address the more complicated situation where changes in the shapes of the lc droplets accompany internal configurational transitions. to address this situation the euler characteristic of a sphere, and any surface that can smoothly be transformed into a sphere (e.g., a football and a bowl are both topologically equivalent to a sphere), is two. this result is useful because, for uniform boundary conditions, the sum of the topological charges (n) must be half of the euler characteristic of a closed surface. this leads us to conclude that the euler characteristic of the caged lc droplet shapes observed in our experiments is unaltered as compared to that of spherical droplets because all shapes observed for the caged lc droplets can be smoothly transformed into a sphere. thus, the wetting transitions reported in this article do not change the conservation of topological charge discussed in the context of past studies of free (spherical) droplets. specifically, for lc droplets exposed to sds (figures 5 and 8), the wetting transition results in multiple shapes (lenses, hemispheres, and concave hemispheres), all of which are smooth deformations of a spherical surface. thus, if the boundary conditions are uniform at all surfaces of the lc, then the internal configurations of the lc in the presence of sds will be topologically equivalent to bipolar, axial / saturn - ring, and radial configurations (schematics in figures 4 and 8a f). whether the anchoring of the lc at all surfaces of the caged droplets is uniform, however, remains to be established. it is possible that the caged lc droplets possess inhomogeneous anchoring, for example, due to differential adsorption of sds between the lc aqueous interface or the lc polymer interface (figure 8g, h). in this scenario, due to inhomogeneous anchoring, the relationship of the topological charge and the euler characteristic is changed from that discussed above. the topological charges, however, will still satisfy gauss s theorem and will be determined by the specific profile of the director at the surfaces of the lc droplets. in figure 8g, h, we present two possible director configurations in the caged lc droplets that are consistent with the nonuniform anchoring of the lc at its surfaces. in each case polymer interface, providing a net topological charge of + 1/2 (see above). as noted in the results section, the lc anchoring shown schematically in figure 8 g is consistent with the experimental observations shown in the micrographs in figure 8e, f. however, we do not observe birefringent textures that are consistent with the configuration in figure 8h. we end by noting that in the limit of 0 the complete wetting of lc on the inner surface of the capsule would lead to the formation of a shell of lc. this transition, although not yet observed in our experiments, leads to the creation of a new surface and thus the shell possesses an euler characteristic of + 4 (and thus a topological charge of + 2). for additional discussion of this geometry, we refer the reader to studies of lc shells created from double emulsions. in summary, the key advances reported in this article are two - fold. first, we provide insight into the physical processes that underlie the formation of caged lc droplets contained within cross - linked polymer multilayer capsules. we demonstrate that dadm capsules swell reversibly and that the extent of swelling correlates with the dielectric constant of the solvent. this result suggests principles by which the extent of filling of the capsules can be systematically varied in future studies. we emphasize that the partial filling of the capsules reported here underlies our observations of the lc wetting transitions. the second key advance involves surfactant - induced changes in both the wetting and ordering of caged lc droplets. whereas the effects of dtab and sds on the internal ordering of free lc droplets are similar, we reveal that the two surfactants trigger strikingly different wetting and configurational transitions when the lc droplets are caged within the polymeric capsules. specifically, the addition of anionic sds resulted in a progression of complex droplet shapes as the contact angle of the lc on the inner surfaces of the capsules decreased ; in contrast, no significant change in droplet shape was observed upon addition of cationic surfactant dtab. although additional measurements are needed to quantify the orientation of the lc at the surfaces of the complex shapes formed by the caged lc in the presence of the sds, under the assumption of uniform anchoring the various internal states of the droplets are topologically equivalent to axial and radial configurations (i.e., consistent with the conservation of topological charge). although topologically equivalent to free droplets, the contributions that surface anchoring, lc elasticity, and topological defects make to the free energy of caged lc droplets will differ from those of free droplets. as a result, caged lc droplets offer the promise of new and versatile sources for the design of lc - droplet - based responsive soft matter that can not be realized in dispersions of free droplets. we also note that the physics of caged lc droplets is conceptually similar to that of liquid - crystalline dna toroids confined in viral capsids. as such, caged lc droplets may offer the basis of a model system for understanding some aspects of dna packing in viruses. | we report a study of the wetting and ordering of thermotropic liquid crystal (lc) droplets that are trapped (or caged) within micrometer - sized cationic polymeric microcapsules dispersed in aqueous solutions of surfactants. when they were initially dispersed in water, we observed caged, nearly spherical droplets of e7, a nematic lc mixture, to occupy 40% of the interior volume of the polymeric capsules [diameter of 6.7 0.3 m, formed via covalent layer - by - layer assembly of branched polyethylenimine and poly(2-vinyl-4,4-dimethylazlactone) ] and to contact the interior surface of the capsule wall at an angle of 157 11. the internal ordering of lc within the droplets corresponded to the so - called bipolar configuration (distorted by contact with the capsule walls). while the effects of dodecyltrimethylammonium bromide (dtab) and sodium dodecyl sulfate (sds) on the internal ordering of free lc droplets are similar, we observed the two surfactants to trigger strikingly different wetting and configurational transitions when lc droplets were caged within polymeric capsules. specifically, upon addition of sds to the aqueous phase, we observed the contact angles () of caged lc on the interior surface of the capsule to decrease, resulting in a progression of complex droplet shapes, including lenses (130 10), hemispheres (89 5), and concave hemispheres (< 85). the wetting transitions induced by sds also resulted in changes in the internal ordering of the lc to yield states topologically equivalent to axial and radial configurations. although topologically equivalent to free droplets, the contributions that surface anchoring, lc elasticity, and topological defects make to the free energy of caged lc droplets differ from those of free droplets. overall, these results and others reported herein lead us to conclude that caged lc droplets offer a platform for new designs of lc - droplet - based responsive soft matter that can not be realized in dispersions of free droplets. |
isolated hemihyperplasia (ih, omim 23500) is most succinctly defined as asymmetric regional body overgrowth because of an underlying abnormality of cell proliferation in individuals without any other underlying diagnosis. there are no widely accepted criteria for defining ih as distinct from normal growth variation in children, and therefore the pragmatic case definition is that ih should be apparent from the end of the bed. the asymmetry can be due to differences in the growth of bone, soft tissue, or both. the diagnosis of ih should be made by a clinical geneticist experienced in the differentiation of ih from other causes of body asymmetry, including regional body undergrowth, seen for example with mild fibular hemimelia and hemiatrophy. known overgrowth syndromes, including beckwith - wiedemann syndrome (bws), proteus syndrome, neurofibromatosis type 1, mosaic trisomy 8, and disorders associated with vascular malformations including klippel - trenaunay syndrome and megalencephaly - cutis marmorata telangiectatica congenital, must be ruled out. the increased risk of embryonal tumors in individuals with ih is well documented in case reports and clearly substantiated by the only prospective study, which was reported by hoyme.1 in 1998. they followed 168 children with ih for 10 years and reported 10 tumors in 9 individuals. there were six wilms tumors (wts), one hepatoblastoma (hbl), two adrenal cell carcinomas, and one small bowel leiomyosarcoma, giving a tumor incidence of 5.9%. in a review of 134 tumors in ih patients, lapunzina2 noted that the types of tumors in ih patients are similar but not identical to those seen in bws. as in bws, the ih tumors were mostly embryonal, 94% occurred in the abdomen, and usually diagnosed before 10 years of age. the six extraabdominal tumors involved the brain, testes, lung, uterine cavity, and bone marrow. recognition that ih and bws have clinical overlap and similar tumor associations has led to the search for the same constitutional epigenotypes involving the gene cluster at 11p15.5 in ih patients, that are known to underlie bws. as of early 2008, a minority of ih patients have indeed been found to have one of the three most common epigenotypes found in bws, namely uniparental paternal disomy of 11p15 (upd), loss of maternal methylation of kcnq1ot1, and hypermethylation of maternal h19.38 shuman.8, in 2006, reported the largest single cohort of ih patients (51) studied for these molecular defects. they found that 40 (78%) had no identified abnormality but had six tumors, i.e., a tumor incidence of 15%. eight (16%) patients had upd of whom four developed tumors for a tumor incidence of 50%. three (6%) had loss of maternal methylation of kcnq1ot1 and none had tumors. the authors point out that because upd is always mosaic, it can be missed and therefore it is likely that a subset of patients without identified molecular defects may actually have upd. the authors also noted that of the four upd patients with tumors, two were conceived by assisted reproductive technologies, raising the question of whether assisted reproductive technology is a risk factor for ih because of upd and associated high tumor risk. niemitz.9, in 2005, reported the results of similar molecular studies on 15 ih children with wt, and noted that 12/15 (80%) had no identified abnormality, and all three of those with abnormalities had hypermethylation of maternal h19, two because of upd and one an isolated methylation defect only. these authors suggested that the methylation defect of h19 per se, with or without upd, confers a high tumor risk. overall, the preponderance of ih patients with or without tumors who have undergone epigenetic studies have no identified etiology. this is in contrast to bws, 70% of whom have an identified epigenetic or genetic etiology. therefore, current molecular techniques are not helpful in identifying the subset of ih patients with tumor risk and so all ih patients should be screened for tumors. similarly, data on tumor risk for specific molecular defects is too limited to be clinically useful at this time, although the studies noted above have reported high tumor risk with methylation of h19 with or without upd. the purpose of tumor surveillance in high - risk individuals is to facilitate identification of tumors at an early stage when treatment is most effective and least invasive. the most frequent tumors in children with ih are wt and hbl, but other tumors including neuroblastoma, adrenocortical tumors, and sarcomas occur. the vast majority of tumors occur in the abdomen and, given the ready availability and noninvasiveness of diagnostic ultrasound, abdominal ultrasound is the screening modality of choice for most tumors. beckwith in 1998 recommended abdominal ultrasound every 3 months until age 7 or 8 years for children with bws. these are the ages that 90% and 93%, respectively, of wt are diagnosed.10 he based his recommendation on the epidemiology and biology of wt (including rapid wt growth), benefits, risks, and cost of monitoring for wt in bws patients. data on the effectiveness of this protocol are somewhat limited for ih, as studies have been retrospective and most studied patients have had bws. one such study is that by choyke.11, who looked at whether screened patients with bws or ih who developed wt had less late - stage disease than those not screened. their results suggested strongly that ultrasound screening at intervals of 4 months or less reduced the proportion of late - stage wt. beckwith s original protocol has also been recommended by tan.12, in 2006, after a comprehensive review of the literature. all of the above authors have recognized the potential adverse effects of ultrasound screening, primarily false positive findings, some of which have led to invasive surgeries.11 tan. have also recommended that serum alpha - fetoprotein (afp) be measured every 3 months until age 4, by which time 90% of hbl will have developed. they cite a case report with this recommendation by clericuzio.13, of five children (three with bws and two with ih) with normal hepatic ultrasounds for whom rising serial afp measurements prompted additional imaging and ultimate diagnosis of early stage hbl. caution in interpretation of infant afp levels is necessary, given the high levels of afp at birth which fall rapidly to the normal adult level by 1012 months of age.14,15 lastly, one of the authors (c.l.c.) is an advocate of teaching parents the daily caretaker abdominal examination for young children with ih.16 on the basis of this author s personal experience, most parents are eager to take an active role in their child s care. those that are too anxious to do the exam are fully supported in not doing so. the benefits of this practice are anecdotal : one parent found a wt half - way through the 3 month screening interval (personal observation). as there is no evidence of an adverse effect of teaching parents the abdominal examination, it seems reasonable to offer this education as an option. | isolated hemihyperplasia, formerly termed isolated hemihypertrophy, is a congenital overgrowth disorder associated with an increased risk for embryonal tumors, mainly wilms tumor and hepatoblastoma. this practice guideline will set forth the diagnostic criteria and tumor screening recommendations for children with isolated hemihyperplasia, based on the best information available. there is clinical overlap between isolated hemihyperplasia with beckwith - wiedemann syndrome. the majority of beckwith - wiedemann syndrome patients have a molecular abnormality involving the imprinted cluster of genes at 11p15.5. in contrast, the preponderance of isolated hemihyperplasia patients studied have no identified etiology. tumors have developed in isolated hemihyperplasia patients with and without molecular abnormalities. for this reason, molecular diagnostics are not helpful in identifying the subset of isolated hemihyperplasia patients with tumor risk and all isolated hemihyperplasia patients should undergo tumor screening. |
reproductive applications of laparoscopy have broadened to include various diagnostic, reconstructive, and ablative operations. a major concern at laparoscopy remains intraabdominal adhesions, which may predispose a patient to access - related injury and can make the dissection of vital structures difficult, leading to increased complexity of the procedure. previous intraabdominal surgery has been reported as a relative contraindication to the laparoscopic surgery among infertile women, necessitating a different approach. we have observed concern from referring physicians regarding the safety of laparoscopy in infertile patients who previously underwent surgery, because of the risk of intraabdominal adhesions. furthermore, in our tertiary referral center practice, we have observed intraabdominal adhesions in patients with and without risk factors for adhesions at laparoscopy. successful reproductive procedures have been completed in the majority of these patients. to better understand the risk and incidence of intraabdominal adhesions at laparoscopy, we performed a retrospective cohort study to assess infertile patients with and without preoperative risk factors and who performed the reproductive laparoscopic procedures. all infertile patients who underwent laparoscopic reproductive surgical procedures from april 2000 to april 2006 were included in this retrospective cohort study. risk factors for intraabdominal adhesions were defined as previous abdominal surgery at the same anatomical site (including those with adnexal or uterine surgery) at a different site, or at the same and a different site, pelvic endometriosis (moderate to severe disease), inflammatory disorders of the gastrointestinal or genitourinary tracts, or a combination of these factors. for further specification, previous surgery was defined as any type of open abdominal, pelvic, or flank surgery with the potential to cause intraabdominal adhesions, including multiple laparotomies, abdominal myomectomy, cesarean delivery, abdominal wedge resection of the ovaries, adnexal surgery (including salpingectomy for ruptured ectopic pregnancy), abdominal repair of uterine perforation, abdominal operations for correction of double uterus, gastrointestinal procedures, vascular procedures, cholecystectomy, and appendectomy. inguinal procedures, superficial abdominal surgery or endoscopic gastrointestinal, gynecological, or urological procedures were not considered intraabdominal surgery. thus, unless patients had also undergone other procedures that qualified as intraabdominal, they were classified as having undergone no previous surgery. medical charts were reviewed to collect demographic data, identify preoperative risk factors for intraabdominal adhesions, and record surgical details. operative videotapes were reviewed in each case to determine the presence or absence and characterize the extent of abdominal wall adhesions when present. an adhesion was defined as bowel or omentum, or both, adherent to the abdominal wall that was laparoscopically visible in the operative field using a standard laparoscope with a 0-degree lens. the location of abdominal access was predetermined based on the disease site. generally, a veress needle and visiport technique (united states surgical corp., norwalk, connecticut) was achieved through the umbilicus in mid - line procedures and at the lateral border of the rectus muscle on the ipsilateral side of disease in adnexal surgery. adhesions were scored on a modification of the adhesion scale of the gynecologic operative laparoscopy group, including grade 1- thin and filmy adhesions, grade 2- opaque adhesions composed of more dense tissue, and grade 3- cohesive, thick tissue including intra - abdominal organs, such as small or large bowel. based on the amount of the operative field occupied by adhesions, as viewed from the end of the camera port, the extent of adhesions was considered minor (occupying less than 10%), moderate (occupying 10% to 25%), and severe (occupying greater than 25%) of the operative field. cases that initially involved attempted laparoscopic reproductive surgery and were converted to open surgery during the procedure were assessed at the time of conversion by inspecting the intraperitoneal cavity. data were analyzed using a commercially available statistical software package with p0.05, not significant). estimated adhesion severity in the 92 patients with adhesions was minor in 52%, moderate in 37%, and severe in 11%. adhesions involving large bowel adherent to the abdominal wall were found in 20 (22%) patients. combined small- and large - bowel adhesions were documented in 18 (20%) patients, which were grade 3 on the gynecologic operative laparoscopy group scoring scale. the remaining adhesions were omental, including grade 1 in 36 patients (39%) and grade 2 in 18 (20%). in 32 patients (35%), adhesions were estimated to be in the primary port placement field and in 60 (65%) were an estimated minimum of 5 cm from the primary port site. laparoscopic approaches are being increasingly used for a wide variety of complex reproductive procedures among infertile women. intraabdominal adhesions increase the risk of bowel injury during access with delayed detection of bowel injury significantly increasing the risk of a fatal outcome. the incidence of adhesions has been estimated to be almost 100% in patients with a history of previous surgery and 28% in those without earlier surgery in the general and gynecologic surgery populations. we evaluated experience with adhesions in an infertile population and used intraoperative video to define and better analyze the presence of intra - abdominal adhesions among this select patient group. in this cohort study, the incidence of intraabdominal adhesions in patients with and without risk factors was 64% and 47%, respectively. the adhesion incidence in group 2 was somewhat higher than reported values, which may have been related to underlying pathological conditions in these patients. when analyzing this small group of patients according to the risk factors for adhesions, the relative risk of adhesions was 1.34 (95% ci 0.89 to 2.01, p=0.18) in those with known risk factors. the broad ci and the p value indicate that no statistically significant increase for risk in adhesions occurred in either group, which supports our observations. however, a larger sample size may have resulted in a different outcome because repeating the relative risk calculation with twice the sample size yielded a statistically significant difference in the groups. the single access - related injury in this cohort occurred with veress needle and visiport technique use in a patient with no previous surgery and planned for bilateral ovarian drilling for pcos. the patient had marked adhesions of the mid descending colon to the anterior abdominal wall. unfortunately, this adhesion was not predicted preoperatively due to the absence of risk factors. a retrospective review demonstrated that abdominal ultrasound was not performed, whereas transvaginal sonography was done to confirm the diagnosis. we do not suggest abdominal ultrasound as a method of investigation to be done routinely in all of our cases ; however, some authors have reported the use of sonography to localize abdominal wall adhesions with excellent accuracy in high - risk individuals. although ultrasound may be considered in patients who have identified preoperative risk factors for adhesions to select a safe access site, routine ultrasound in all who have undergo laparoscopic reproductive surgery would likely not be cost effective. estimated blood loss was higher in group 2 (p<0.05), which may have been related to the specific surgery performed and complexity of the cases rather than the presence or absence of intraabdominal adhesion risk factors. included in group 2 were a larger number of cases of difficult laparoscopic resection of ovarian endometriomata, which tends to involve increased rates of blood loss and conversion to open surgery although this is not the usual case for endometriosis surgery, even in the most complicated cases, in experienced hands. in this cohort, preoperative risk factors for intraabdominal adhesions did not increase operative time, the rate of conversion to open surgery, or complications. the conversion rate was higher in patients with versus without adhesions independent of risk factor status. only 2 patients required conversion due to adhesions associated with a single bowel injury and difficult adhesiolysis that failed to progress, respectively. we do not consider risk factors for or the presence of intraabdominal adhesions to be contraindications to laparoscopic infertility surgery. some authors use the hasson technique of open laparoscopy because the safety of this technique has been validated in such cases, although we know that open access may not limit bowel injury. some studies have described a left upper quadrant access site with and without mini - laparoscopes to assess peri - umbilical adhesions before direct access is obtained through the umbilicus. the left upper quadrant mid clavicular line site or palmer 's point was the most commonly selected access site in these studies. successful access to the peritoneal cavity was attained in all cases. in our patients with intraabdominal adhesions, only 35% of the adhesions were located close to the primary port site, thus, predisposing to bowel injury at initial port placement. most of the remaining 65% of adhesions required adhesiolysis to complete the intended procedure, suggesting that these adhesions were significant. this study was limited by the relatively small number of patients, which may have influenced the relative risk ci and did not allow subgroup analysis for the different risk factors or for multiple coexisting risk factors. all patients had pelvic pathology, including 56 with documented adnexal adhesions related to previous surgery or endometriosis, or both. to our knowledge, the influence of the underlying pelvic pathology on intraabdominal adhesions is unknown, although we noted that 59% of patients with intraabdominal adhesions had coexisting adnexal pathology. because the natural history of formation of different intra - abdominal adhesions in relation to the presence or absence of preoperative risk factors could not be determined exactly, in our study no attempt was made to correlate the preoperative risk factors with the estimated adhesion severity seen at laparoscopy. a new study would need to be designed to assess which risk factors correlated with the presence of moderate and severe adhesions and which require the need to proceed to open surgery from the start. the results presented in this article may not be applicable in general gynecologic cases involving other underlying pathological conditions. rather, we analyzed the risk of intraabdominal adhesions in patients with and without preoperative risk factors. no difference existed in the risk of intraabdominal adhesions in this small group of patients with and without preoperative risk factors. preoperative risk factors for intraabdominal adhesions should not contraindicate the laparoscopic approach for reproductive infertility surgery. a prospective randomized study of veress versus hasson access techniques is required before any conclusions can be drawn regarding the best access. | objective : abdominal wall adhesions at laparoscopy may predispose infertile patients to access - related injuries and increase the complexity of the procedure. we have observed concern from referring physicians regarding the safety of surgical laparoscopy in infertile patients who previously underwent surgery because of the risk of abdominal adhesions. to assess the risk of intraabdominal adhesions at laparoscopy, a retrospective cohort study was performed.methods:all infertile patients who underwent a reproductive laparoscopic procedure in a 6-year period at our institution were included in this study. a chart review was performed to obtain demographic / surgical data and identify preoperative risk factors for intraabdominal adhesions. operative videotapes were reviewed to determine the presence and location of adhesions. standard statistical analyses were performed.results:during the study period, 254 infertile patients underwent reproductive surgical laparoscopy, and videotapes on 164 (65%) were available for review. a total of 88 patients (54%) were identified with preoperative risk factors for intraabdominal adhesions (group 1), while 76 (46%) had no risk factors (group 2). the relative risk of adhesions was 1.34 (95% ci, range 0.89 to 2.01, p=0.18) when risk factors were identified. there were no differences in the groups regarding patient age, operative time, access technique, conversion to open surgery, or complications. estimated blood loss was significantly higher in group 2, likely due to the predominance of laparoscopic surgery for ovarian endometriomata and complexity of the cases rather than the presence or absence of intraabdominal adhesion risk factors.conclusions:no difference existed in the risk of intra - abdominal adhesions in infertile patients with and without identifiable preoperative risk factors. preoperative risk factors for intraabdominal adhesions should not contraindicate the surgical laparoscopic approach for reproductive procedures. |
the primary goal of endodontic therapy is to make the root canal system devoid of micro - organisms. this can be achieved by thorough biomechanical preparation, along with effective debridement and disinfection protocols. the use of various intracanal irrigants and medicaments are essential to control microbial infections especially in the lateral and accessory canals, isthmus, and apical deltas. calcium hydroxide [ca(oh)2 ] is a commonly employed intracanal medicament in root canal therapy. its antibacterial activity is directly related to its ionic dissociation into calcium and hydroxyl ions;this high alkalinity inactivates bacterial enzymes. chlorhexidine (chx, n, n1-bis(4-chlorophenyl)-3,12-diimino-2, 4, 11, 13,tetraaza tetradecadediimidamide), a potent antibacterial and antiseptic agent is used extensively in the irrigation of root canal walls and also as a medicament during routine endodontic therapy. a mixture of ca(oh)2 and chx has been shown to possess better antimicrobial efficacy due to their synergistic effect than ca(oh)2 alone. in vitro studies the preparation of the ca(oh)2 and 0.2% chx mixture generates ros immediately after the mixture and also after 7 and 14 days. ros inhibits the growth of enterococcus feacalis by destruction of its cell wall and plasma membrane and plays an important role in the pathogenesis of pulpal and periodontal diseases. the high reactivity is mainly due to the presence of unpaired valence shell electrons. during normal metabolism of oxygen, ros is formed as a byproduct and plays an important role in cell signaling and homeostasis. however, during oxidative stress, ros levels increase intensely and result in significant damage to cell structures. these species are cytotoxic and have been implicated in the etiology of a wide array of human diseases. thus ros can kill bacteria but it also destroys the adjacent infected host tissues. to counteract the ros formation, antioxidants are necessary for the destruction of these free radicals (ros) by reacting with oxygen and thereby preventing the harmful effects caused by oxygen radicals. proanthocyanidin and lycopene are potent bioactive antioxidants naturally occurring in grape seed and tomato extracts, respectively and act as ros scavengers. they are antibacterial, antiallergic, and inhibit platelet aggregation and capillary permeability ; these effects contribute to the potent antioxidant ability. lycopene, a red pigment found in tomato - based products, is an acyclic form of beta - carotene. no study has been undertaken to comparatively analyze the role of grape seed and tomato extract in reducing ros formation. hence the objective of this study was to analyze ros formation when chx was mixed with ca(oh)2 and to evaluate the effect of proanthocyanidin and lycopene on ros formation when mixed with chx and ca(oh)2. the study also aims to evaluate the effect of these antioxidants on the antibacterial efficacy of ca(oh)2 and chx against e. feacalis. five grams of grape seed extract (gnc herbal plus, singapore) in the form of powder was collected from capsules and dissolved in 100 ml of distilled water to make 5% proanthocyanidin solution. five grams of tomato extract (parry nutraceuticals, india) in the form of powder was dissolved in 100 ml of distilled water to make 5% lycopene solution. group i : 2% chx gluconate, (asep - rc, steadman pharmaceuticals pvt ltd, thiruporur, tamilnadu), group ii was a mixture of 125 mg of ca(oh)2 with 1 ml of 2% chx gluconate solution. group iii comprised a mixture of 125 mg of ca(oh)2 with 1 ml of 2% chx solution and 1 ml of 5% proanthocyanidin solution and group iv, a mixture of 125 mg of ca(oh)2 with 1 ml of 2% chx gluconate solution and 1 ml of 5% lycopene solution. on mixing, groups ii, iii, and iv had a paste - like consistency. each of the sample groups was analyzed for ros formation using the mass spectrometer (jeol gc mate ii) immediately after preparation. the mass spectrometer was used in the electron impact ionization method with the ion source temperature held at 280c, detector volts of 70 ev, and a mass range of 50 to 500 amu (amu : atomic mass unit). all the groups were placed on the petri dishes inoculated with robertson 's cooked media and incubated at a temperature of 371c with muller hinton agar and were incubated for 24 hours. the agar was evenly distributed over the surfaces of the petri dishes (of 90 mm diameter) to a thickness of 5 mm. standard wells with a diameter of 4.0 mm were punched into the agar with the blunt end of a pasteur pipette. approximately 0.5 ml suspensions of e. feacalis were swabbed over the surface of the agar plates with a sterile applicator. the diameters of the inhibition zones around the materials were measured in mm using vernier caliper and divider after 24 hours. the results were tabulated and analyzed statistically using one - way anova and tukey - kramer multiple comparison tests. five grams of grape seed extract (gnc herbal plus, singapore) in the form of powder was collected from capsules and dissolved in 100 ml of distilled water to make 5% proanthocyanidin solution. five grams of tomato extract (parry nutraceuticals, india) in the form of powder was dissolved in 100 ml of distilled water to make 5% lycopene solution. group i : 2% chx gluconate, (asep - rc, steadman pharmaceuticals pvt ltd, thiruporur, tamilnadu), group ii was a mixture of 125 mg of ca(oh)2 with 1 ml of 2% chx gluconate solution. group iii comprised a mixture of 125 mg of ca(oh)2 with 1 ml of 2% chx solution and 1 ml of 5% proanthocyanidin solution and group iv, a mixture of 125 mg of ca(oh)2 with 1 ml of 2% chx gluconate solution and 1 ml of 5% lycopene solution. on mixing, groups ii, iii, and iv had a paste - like consistency. each of the sample groups was analyzed for ros formation using the mass spectrometer (jeol gc mate ii) immediately after preparation. the mass spectrometer was used in the electron impact ionization method with the ion source temperature held at 280c, detector volts of 70 ev, and a mass range of 50 to 500 amu (amu : atomic mass unit). all the groups were placed on the petri dishes inoculated with robertson 's cooked media and incubated at a temperature of 371c with muller hinton agar and were incubated for 24 hours. the agar was evenly distributed over the surfaces of the petri dishes (of 90 mm diameter) to a thickness of 5 mm. standard wells with a diameter of 4.0 mm were punched into the agar with the blunt end of a pasteur pipette. approximately 0.5 ml suspensions of e. feacalis were swabbed over the surface of the agar plates with a sterile applicator. the diameters of the inhibition zones around the materials were measured in mm using vernier caliper and divider after 24 hours. the results were tabulated and analyzed statistically using one - way anova and tukey - kramer multiple comparison tests. the graph that shows a peak value of 196.96 denotes ros. when comparing the graphs of group i [figure 1 ], group ii [figure 2 ] and group iii [figure 3 ], the group iv [figure 4 ] shows a drastic reduction in ros formation. reactive oxygen species formation in group i reactive oxygen species formation in group ii reactive oxygen species formation in group iii reactive oxygen species formation in group iv ros such as superoxide radical, hydrogen peroxide, singlet oxygen, and hydroxyl radical are small, short - lived, and highly reactive molecules formed by incomplete one - electron reduction of oxygen. they are cytotoxic and have been implicated in various diseases like diabetes and neurodegenerative diseases, and influence cellular processes such as proliferation, apoptosis, and senescence, responsible for cancer development. generally, harmful effects of ros on the cell most often include damage of dna, oxidation of polydesaturated fatty acids in lipids, oxidation of amino acids in proteins, and oxidative inactivation of specific enzymes by oxidation of cofactors. however, ros in lesser quantities are shown to be bactericidal and can enhance cell proliferative activity and information signaling. ros inactivate bacteria and their proteins and contribute to the microbicidal activity of phagocytes, regulation of signal transduction, and gene expression, and cause oxidative damage to nucleic acids, proteins, and lipids. waris and ahsan have reported that elevated levels of ros and downregulation of ros scavengers and antioxidant enzymes are associated with various human diseases including different types of cancer. in normal conditions, a dynamic equilibrium exists between ros activity and defense capacity of antioxidants. the shift in equilibrium in favor of ros activity results in oxidative stress. this might happen either due to an increase in ros production or a decrease in defense capacity of antioxidants. antioxidants are substances which considerably delay or inhibit oxidation of the oxidizable substrate at lower concentrations. proanthocyanidins, or condensed tannins, are oligomers and polymers of flavan-3-ols, found in the skin, stems, and seeds of grapes from which they are extracted into the must during vinification. many in vitro and in vivo studies have shown that proanthocyanidins possess potent antioxidant properties. grape seed extract was chosen for this study as it yields a 10% higher concentration of proanthocyanidins, with a greater degree of oxygen free radical - scavenging potential when compared to skins and stems of grapes. proanthocyanidin possesses anticariogenic property by inhibiting the glucan synthesis and the subsequent adhesion of streptococcus mutans on the structure of the tooth. moreover, grape seed extracts inhibit the growth of anaerobic bacteria, such as porphyromonas gingivalis and fusobacterium nucleatum, associated with periodontal diseases. lycopene, the red pigment of tomato, is a tetraterpene assembled from eight isoprene units composed entirely of carbon and hydrogen, containing 11 conjugated and two nonconjugated carbon carbon double bonds. various studies have shown that the consumption of a lycopene - rich diet reduces the incidence of cancers and heart diseases. lycopene exerts potent antifungal activity against candida albicans by causing significant damage to the cell membrane. lycopene, the main carotenoid in tomato products along with vitamin c and flavonoids, possesses the greatest quenching ability of singlet oxygen which accounts for its strong antioxidant and free radical - scavenging property. it protects cell membranes from lipid peroxidation by neutralizing hydroxyl radicals and stimulating antioxidative enzymes such as superoxide dismutase, glutathione peroxidase, and glutathione reductase. lycopene has the potential to quench singlet oxygen, scavenge free radicals of nitrogen dioxide (no2), thiyl (rs), and sulfonyl (rso2), which also contributes to its potent antioxidant activity. according to the results of this study, the peak value of 196.96 denotes ros formation. the peak of 195 m / z was probably originated by the production of reactive compounds (ros), as a result of the high concentration of hydroxyl ions (alkaline environment) in the presence of chx. the maximum production of ros was observed in group ii which is reflected in its higher peak value. when compared with group i (chx), group ii [ca(oh)2+chx ] shows a higher ros formation. this is probably due to the formation of hydroxyl ion which is the dissociation product of ca(oh)2 at an alkaline ph. group iv [lycopene+chx+ca(oh)2 ] and group iii [ca(oh)2+chx+proanthocyanidin ] show a significant decrease in ros when compared with group ii and group i. the reduction in ros is attributed to the inherent antioxidant properties found in group iv and group iii. between group iv and group iii, group iv shows a drastic reduction in ros formation in the graph when compared to group iii. the reduction in ros levels in group iii could be due to the fact that proanthocyanidins have specificity for hydroxyl free radicals and they possess multiple donor sites enabling them to trap superoxide radicals, and they also undergo redox reactions helping them to scavenge free radicals. lycopene, by virtue of its high number of conjugated double bonds, has the maximum oxygen - quenching ability. oxygen quenching by lycopene occurs via physical quenching, that is, the carotenoid remains intact and can undergo further cycles of single oxygen quenching. further, lycopene is an effective deactivator of electronically excited sensitizer molecules which are involved in the generation of radicals and singlet oxygen. the relatively low molecular weight of lycopene (536.87 g / mol) when compared with proanthocyanidin (592.54 g / mol) could be also a factor for decreased ros formation with lycopene. the antibacterial efficacy of the groups was evaluated to determine whether reduction in ros formation reduces the antibacterial potential of the extracts, as ros plays a major role in inactivation of bacterial proteins due to its bactericidal effect. the agar diffusion method was chosen as it is a preliminary and most widely used method for antibacterial assessment. the antibacterial efficacy as evident from table 1 is as follows : group iv > group iii > group ii > group i. group iv shows the maximum antibacterial efficacy with a zone of inhibition seen at 27 mm, whereas group i shows the least antibacterial efficacy with the zone of inhibition evident at 15 mm. group iii and group ii have zones of inhibition at 23 mm and 20 mm, respectively. no statistical difference was observed between groups i and ii, groups ii and iii, and groups iii and iv. hence it can be said that lycopene and proanthocyanidin by their inherent antibacterial properties, produce a greater zone of bacterial inhibition than the chx group and the ca(oh)2- chx mixture group. within the limitations of this study, it can be concluded that the combination of ca(oh)2 and chx generates excessive amount of ros which is detrimental to the host tissues. addition of natural antioxidants like lycopene and proanthocyanidin to the ca(oh)2-chx mixture increases the antibacterial efficacy of the ca(oh)2-chx mixture and also decreases damage to the host tissue by lowering ros formation. thus, lycopene or proanthocyanidin are effective additives to enhance the antibacterial efficacy and for the safer use of intracanal medicament. | aim : the objective of the study was to determine the neutralizing effect of proanthocyanidin (grape seed extract) and lycopene (tomato extract) on reactive oxygen species (ros) generated by the mixture when used as an intracanal medicament. the study also evaluated the effect of proanthocyanidin and lycopene on the antibacterial efficacy of a mixture of chlorhexidine (chx) and calcium hydroxide [ca(oh)2 ] against enterococcus feacalis.materials and methods : four sample groups were prepared as follows. group i : 2% chx gluconate (control group) and group ii : a mixture of 125 mg of ca(oh)2 with 2% chx gluconate solution. group iii was a mixture of 125 mg of ca(oh)2 with 1 ml of 2% chx gluconate solution and 1 ml of 5% proanthocyanidin solution and group iv, a mixture of 125 mg of ca(oh)2 with 1 ml of 2% chx gluconate solution and 1 ml of 5% lycopene solution. the groups were analyzed for ros formation using the mass spectrometer (jeol gc mate ii) immediately after preparation. the antibacterial property was evaluated by using agar diffusion method and the results were statistically analyzed using one - way analysis of variance (anova) and tukey - kramer multiple comparison tests.results:the peak value of 196.96 denotes ros formation. group ii shows a higher peak value than other groups. group iv shows a drastic reduction in the peak value. group iv shows a drastic reduction in ros formation when compared with group ii, group iii, and the control group. antibacterial efficacy was higher in group iv, followed by group iii, group ii, and group i.conclusion:lycopene and proanthocyanidin reduce the ros significantly by virtue of their antioxidant property. lycopene shows more antioxidant property when compared with proanthocyanidin. |
synthesis of new catalysts is critical for modern synthetic chemistry, but catalyst discovery is commonly based on time - consuming and frustrating trial - and - error protocols. to address this issue, many combinatorial approaches to accelerate the process have been developed.[1, 2 } however, combinatorial catalysis has been hampered by limited access to structurally diverse systems, in particular with bifunctional scaffolds. non - trivial synthetic operations are commonly required for their assembly, which renders the systems unsuitable for automated high - throughput synthesis. furthermore, a significant drawback of most combinatorial catalytic protocols is the requirement for all candidates to be purified, characterized, and evaluated individually, regardless of their activity. therefore, collective catalyst screening is highly desirable, although only a few pioneering reports have been described. in recent years, substantial effort has been invested into the design of modular and responsive catalysts, in which the activity can be controlled through secondary inputs. in particular, highly successful self - assembled supramolecular catalysts with tunable activity have been developed for transition - metal catalysis and organocatalysis, providing quick and facile routes to bifunctional catalyst scaffolds. elegant studies by the reek and breit groups, have also shown the potential for simplified screening of such systems by deconvolution methods. dynamic covalent chemistry (dcc) uses reversible covalent bonds to mimic the adaptive nature of supramolecular systems, while retaining the advantages of well - defined, stable covalent compounds. for example, dcc has been successfully used for ligand / receptor identification, molecular - interaction analysis, kinetic processes, biopolymers, and chemical reaction networks. due to the high interest in developing tunable catalysts and catalytic systems, we became interested in the possibility of creating such a dynamic catalyst and investigating its properties. there are furthermore no known bifunctional catalysts, in which the two functional parts are connected by a reversible covalent bond. the application of dcc for catalyst discovery has otherwise been a long - standing goal. early examples relied on adaptive host systems that re - equilibrate in the presence of a transition - state analogue (tsa), leading to amplification of the host that in theory best stabilizes the transition state. however, this leads to a need for design and synthesis of the tsa, and the screening process may result in a host that only binds the tsa without possessing any actual catalytic activity. because dynamic covalent chemistry is equipped with a developed framework for analysis of large mixtures, we imagined a possibility to directly find an optimal dynamic catalyst for a given reaction from a large adaptive system. herein, we have developed a method for the dynamic combinatorial synthesis of systems of bifunctional catalysts, followed by in situ identification of the optimal catalyst. baylis hillman (mbh) reaction, and a selective bifunctional catalyst with interesting properties was discovered. this method circumvents previous issues with dcc and catalysis by directly screening towards the actual chemical transformation in a kinetic manner. in bifunctional catalysis, two functional groups capable of activating substrates are mounted on one scaffold. it was hypothesized that if such a scaffold incorporated a reversible bond as shown in figure 1 a, a dynamic combinatorial system of potential bifunctional catalysts could be generated. by allowing the system to reach equilibrium, a predictable product distribution dictated only by the relative thermodynamic stability of the catalysts would be obtained. thus, dynamic deconvolution with selective component removal can be used to evaluate the effect of each component (figure 1 b). note that the thermodynamic nature of the key bond connection is essential for the accuracy of the deconvolution approach. performing the same deconvolution on mixtures, in which the bifunctional catalyst has been constructed under kinetic control such systems are highly vulnerable to kinetic traps, resulting in a risk of active catalysts being unexpressed in the mixture. for a dynamic system, as long as the building blocks utilized for constructing the catalysts are relatively uniform in terms of the dynamic covalent functional group, all possible linear combinations should be expressed in the system in predictable ratios. b) removal of a single - system component gives propagating effects, eliminating all possible linear combinations of the component. to utilize this dcc methodology for discovery of dynamic bifunctional catalysts the mbh reaction was chosen, because organocatalysis has proven to be highly successful for this transformation, and the importance of bifunctionality has been well investigated. furthermore, studies have found that optimal catalyst architectures were difficult to predict through rational design, which together with the often very long reaction times highlighted a need for rapid catalyst screening methods.[19b, e ] traditionally, mbh reactions utilizing,-unsaturated ketones as donors are also hard to control, with polymerization and side - reactions often diminishing the efficiency. accurate catalyst predictions for such a reaction would indicate that the dynamic screening methodology possessed a high level of generality. thus, a racemic catalyst system that incorporated a nucleophilic lewis base, an h - bond donor and a dynamic imine bond connecting the two components was designed as shown in scheme 1 a. acids and water render the imine bond labile, but removal of either component leads to a structurally robust linkage. this conditional reversibility is essential, because a dynamic catalyst should be able to equilibrate under one set of conditions and stay inert under another. as illustrated in scheme 1 b, the catalyst should activate both the enone and the aldehyde, and preorganize the substrates for conversion towards the mbh adduct. the initial strategy was to first form the imines, and then allow the dynamic system to reach equilibrium in situ using an equilibration catalyst. this approach was tested for the model system shown in scheme 2, using components a, b, 1, and 2 to form imines a1, a2, b1, and b2 quantitatively. herein, only component b2 fulfills the criteria for bifunctionality, because it possesses both a nucleophilic tertiary amine moiety and an h - bond donating thiourea group. model - system formation with indirect re - equilibration route (top) and direct condensation route (bottom). however, upon attempted re - equilibration by addition of catalytic amounts of water and widely used transimination catalysts, such as benzoic acid or sc(otf)3, it was noticed that the component distribution in the imine system did not change. control experiments confirmed that the system had in fact already reached equilibrium during condensation (see the supporting information). this result was surprising, because amines and aldehydes in the absence of acid are known to condensate irreversibly under kinetic control. it was thus hypothesized that the thiourea n h protons could act as general acid catalysts for the system and self - catalyze the system synthesis, in which it takes part. further control experiments indicated that thioureas are indeed able to induce equilibration of dynamic imine systems, as long as water and/or amines are still present in the mixture (see the supporting information). we also confirmed that transimination did not proceed at all in the absence of these species, which supports a hydrolysis / condensation mechanism for the re - equilibration. this effectively led to dynamic systems that were locked at equilibrium under dry conditions, because the water necessary for re - equilibration was continuously removed during the condensation phase. furthermore, it was also confirmed that thiourea structures were capable of catalyzing the exchange even in the absence of primary amines, indicating that aliphatic amine transimination catalysis was not the sole factor at play. to the best of our knowledge, this is the first report of h - bond - catalyzed transimination outside of biological systems. this finding greatly simplified our method, because the re - equilibration step shown in scheme 2 could be entirely omitted. furthermore, it added a further layer of complexity to this potential catalyst class, because these dynamic thiourea - imine catalysts are, in a sense, able to modify and catalyze their own formation. with equilibration conditions in hand, the system was next expanded to four aldehydes and four amines, as shown in scheme 3, to increase the chances of finding an active catalyst. aldehydes 2, 3, and 4 comprise nucleophilic sites in the ortho position to the imine linker, whereas amines b, c, and d incorporate h - bond donors. cyclohexylamine a and benzaldehyde 1 were used as controls. a dynamic catalyst system composed of 16 different imines was formed analogously to the model reaction, and equilibrium was again attained during the condensation phase. next, ethyl vinyl ketone and p - nitrobenzaldehyde were added directly to the system as shown in figure 2 a. the mbh reaction proceeded readily, and 2025 % yield of the desired adduct 5 was obtained after 24 h, as indicated by nmr analysis. thus, at least one of the 16 potential catalysts in the mixture possessed mbh activity. b) observed initial rate difference for mbh reaction upon selective replacement of investigated components 24 or b - d by equivalent amount of non - functionalized analogues 1 or a in the pre - generated catalyst system. conditions : 0.12 mmol p - nitrobenzaldehyde, 0.24 mmol ethyl vinyl ketone, 4 ms (300 mg), anhydrous thf (0.5 ml), pre - generated imine catalyst system (0.075 mmol of each initial component a - d and 14 except for the omitted building block and the replacement compound a or 1 of which 0.15 mmol was added). duplicate experiments ; for further experimental details and kinetic plots, see the supporting information. to minimize the number of experiments required to identify the active components in the mixture, a dynamic deconvolution scheme was devised, the results of which are shown in figure 2 b. equimolar amounts of the amine and aldehyde species were generally required, because the formed imines were inert under mbh conditions even in the presence of thioureas. hence, deconvolution could be efficiently accomplished through selective replacement of the evaluated component by an equivalent amount of a reference compound (a for amines, 1 for aldehydes). initial rates were then measured to fully correlate systemic catalytic activity with changes in system composition upon component replacement. replacement of potentially active components by inactive species would lead to retarded rates of the investigated reaction, compared with the complete system with all functionalities present (the reference bar in figure 2 b). conversely, removal of a component that is detrimental to catalytic activity should give enhanced initial rates. as can be seen from figure 2 b, replacement of the dimethylamino - containing component 2 gave a slight rate increase. a potential explanation for this observation can be the systemic effects of bifunctionality in the catalyst system. assuming one or more optimal combinations of nucleophile and h - bond donor, a scenario, in which pairing of an inactive component with a potentially active species would produce a bifunctional catalyst that exhibits low activity, can be envisaged. if this pairing would be thermodynamically more preferred than pairing of two active components, then removal of the inactive component would lead to re - equilibration in favor of the more active catalyst combination and thus increased rates. this scenario may be well applicable to the case of component 2. however, removal of diphenylphosphine - containing aldehyde 3 led to complete loss of catalytic activity, implying that the highly nucleophilic phosphine was the only nucleophile in the system capable of catalyzing the reaction. in further support of this observation, imidazole - based aldehyde 4 showed almost no rate change when replaced. removal of the weaker h - bonding thiourea c provided the largest systemic effect, with the product formation rate decreasing by almost 30 %. replacement of the stronger h - bond donor b instead led to a rate increase, suggesting that b had deleterious effects on the catalysis. to evaluate the accuracy of the deconvolution predictions all linear combinations of the catalysts were synthesized in situ by direct condensation of the corresponding amine and aldehyde, and tested in single experiments. only the four reactions involving the imines resulting from aldehyde 3 showed any product formation after 24 h. these four catalysts were then synthesized and purified, giving bench - stable compounds that were subsequently tested in controlled single experiments. the results are summarized in figure 3 and are in accordance with the dynamic deconvolution results. compound c3 turned out to be the most active catalyst, with a 19 % yield of the mbh product 5, compared to 15 % for b3 and only 3 % for a3 and d3. yields of compound 5 in parallel catalyst - screening experiments. conditions : 0.1 mmol p - nitrobenzaldehyde, 0.3 mmol ethyl vinyl ketone, 0.02 mmol bifunctional catalyst, 0.5 ml thf, 200 mg 4 ms, 24 h, rt. the relatively high catalytic ability of b3 was initially surprising, because the system experiments actually predicted the compound to be detrimental to catalysis. however, subsequent experiments showed that b3 was highly unselective, with formation of large amounts of byproducts. furthermore, product 5 was shown to be unstable in the presence of b3, and decomposed over time. these effects are an example of why care has to be taken in the collective screening of catalyst mixtures, because simple determination of the yield of 5 upon completed reaction would not lead to accurate predictions of the optimal catalyst activities. however, this study has showcased that kinetic measurements of initial rates is a possible way to measure systemic activities of catalyst mixtures. although c3 is by no means a state - of - the - art catalyst activity - wise, these results provide compelling evidence that the deconvolution methodology has accurately predicted the most active catalyst from a dynamic system. this protocol seems to be highly suited for detecting components crucial for activity, but it can also differentiate between less important functional groups that still contribute to the catalysis in the system. the method is simple and straightforward, and allows one - pot synthesis and subsequent screening of well - defined, covalently linked bifunctional organocatalysts without the need for separation, purification, and characterization of each individual molecule. the small model system investigated in this study is easily amenable to expansion, and the deconvolution protocol would be expected to increase further in efficiency with larger systems. furthermore, considering the range of dynamic covalent linkages developed in recent years, a wide range of potential dynamic catalysts architectures could be envisaged. having shown that the dynamic covalent chemistry enabled accelerated activity screening, we turned to investigating the behavior of the dynamic bifunctional catalyst c3 in more detail. when the mbh reaction was performed with 20 % loading of c3, a yield of 87 % also, c3 could efficiently catalyze an aza - mbh reaction with highly electrophilic phenyl n - tosyl imine 6 to give aza - mbh adduct 7 in a very good 85 % yield over 72 h (scheme 4). conditions : 0.2 mmol aldehyde / imine 6, 0.6 mmol ethyl vinyl ketone, 0.04 mmol c3, 4 ms (100 mg), 1.0 ml thf, n2. furthermore, we were interested in investigating if the dynamic covalent bond could be utilized to modulate the mbh activity. running the reaction with only amine c predictably only led to imine formation with p - nitrobenzaldehyde, but more surprisingly, utilizing aldehyde 3 as the sole catalyst led to almost no product and quick decomposition (table 1). when adding c and 3 together, the mbh reaction proceeded with very low selectivity and yield, with decomposition of the aldehyde presumably occurring over mbh adduct formation. however, when c and 3 were pre - stirred with 4 ms overnight, c3 was formed in quantitative yield, and the corresponding mbh reaction proceeded readily and selectively. conversely, pre - stirring four equivalents of h2o with c3 followed by reagent addition again produced almost no product formation, because the thiourea seemed to have catalyzed the partial hydrolysis of the imine back to the unfavorable aldehyde these results indicate that the dynamic bifunctional organocatalysts might be utilized as primitive switches, especially given the discovered self - modifying capabilities of this class of catalysts. tunable catalytic activity for c3 [a ] conditions : 0.1 mmol p - nitrobenzaldehyde, 0.3 mmol ethyl vinyl ketone, 0.02 mmol catalyst, 0.5 ml thf, n2. [b ] indicated by h nmr spectroscopy after 7 h. [c ] with 0.2 mmol h2o. the inclusion of a dynamic imine bond, as well as a transimination catalyst, into the same structure also opens further interesting possibilities. for the catalyst screening, the dynamic system was locked during the entire catalytic event to maintain accuracy in reaction kinetics measurements. however, it is also straightforward to unlock the dynamic system and allow living dynamic catalyst behavior, in which the catalyst structure is continuously changing during the reaction. in theory, organocatalysts capable of in situ error correction of their own molecular architecture could then be envisaged. a new class of dynamic bifunctional catalysts capable of catalyzing modifications of their own constitution was developed, and it was showcased how this property allows one - pot synthesis and evaluation of large systems of catalysts. the methodology uncovered a relatively effective catalyst for the morita baylis hillman reaction, and catalyst effectiveness could be regulated through manipulations of the dynamic covalent bond. dcc is integral for the screening approach, because it enables a deconvolution strategy that rapidly identifies the system components that contribute most to catalytic activity. the dynamic imine linkage allows proofreading of the dynamic system, with the reversibility ensuring a uniform catalyst distribution. the methodology can be utilized for catalyst discovery, and the obtained dynamic bifunctional scaffolds exhibit the potential for use as adaptable organocatalysts. further investigations on the screening methodology and the self - modifying ability of the dynamic catalysts are currently in progress. aldehydes and amines (0.075 mmol each) were dissolved in anhydrous thf (0.5 ml) in an eppendorf vial, and the solution was transferred to a dry reaction vial containing pre - activated 4 ms (300 mg) under n2. the mixture was stirred at room temperature for 20 h after which time the equilibrated system was obtained. tests for thiourea system equilibration were performed (see the supporting information), showing that the systems were at equilibrium after condensation. afterwards, p - nitrobenzaldehyde (18.1 mg, 0.12 mmol) in anhydrous thf (0.120 ml) was added under n2, followed by addition of ethyl vinyl ketone (23.9 l, 20.8 mg, 0.24 mmol). an aliquot of the reaction mixture (30.0 l) was withdrawn and added to 0.550 ml cdcl3 in an nmr tube, with phsime3 (0.020 l / ml cdcl3) as internal standard. nmr measurements were performed within 5 min, although control experiments indicated that the aliquot composition was stable for several hours in anhydrous cdcl3. product formation was monitored by integrating the characteristic peaks at =5.66 and 6.00 ppm and comparing to the internal standard. aldehydes and amines (0.075 mmol each) were dissolved in anhydrous thf (0.5 ml) in an eppendorf vial, and the solution was transferred to a dry reaction vial containing pre - activated 4 ms (300 mg) under n2. the mixture was stirred at room temperature for 20 h after which time the equilibrated system was obtained. tests for thiourea system equilibration were performed (see the supporting information), showing that the systems were at equilibrium after condensation. a dynamic system was generated according to the description above. afterwards, p - nitrobenzaldehyde (18.1 mg, 0.12 mmol) in anhydrous thf (0.120 ml) was added under n2, followed by addition of ethyl vinyl ketone (23.9 l, 20.8 mg, 0.24 mmol). an aliquot of the reaction mixture (30.0 l) was withdrawn and added to 0.550 ml cdcl3 in an nmr tube, with phsime3 (0.020 l / ml cdcl3) as internal standard. nmr measurements were performed within 5 min, although control experiments indicated that the aliquot composition was stable for several hours in anhydrous cdcl3. product formation was monitored by integrating the characteristic peaks at =5.66 and 6.00 ppm and comparing to the internal standard. as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be re - organized for online delivery, but are not copy - edited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors | the first example of a bifunctional organocatalyst assembled through dynamic covalent chemistry (dcc) is described. the catalyst is based on reversible imine chemistry and can catalyze the morita baylis hillman (mbh) reaction of enones with aldehydes or n - tosyl imines. furthermore, these dynamic catalysts were shown to be optimizable through a systemic screening approach, in which large mixtures of catalyst structures were generated, and the optimal catalyst could be directly identified by using dynamic deconvolution. this strategy allowed one - pot synthesis and in situ evaluation of several potential catalysts without the need to separate, characterize, and purify each individual structure. the systems were furthermore shown to catalyze and re - equilibrate their own formation through a previously unknown thiourea - catalyzed transimination process. |
detailed clinical and social data were collected by case managers for all tb patients undergoing treatment in london on july 1, 2003. analyses were restricted to pulmonary patients 1560 years of age (n = 970). we used univariate analyses to compare the characteristics of crack cocaine users, other hard - drug users (predominantly heroin users but excluding those who used only alcohol and marijuana), and those not known to use drugs. a separate category was included for hard - drug users not known to use crack cocaine to have a group with comparable levels of social deprivation, addiction related problems, and difficulty in accessing health services. to test the hypothesis that smear positivity at diagnosis was associated with crack cocaine use, we used a multivariate model with backwards elimination to exclude variables that did not make a significant contribution to the model. variables initially included are shown in table 1 ; the final model is shown in table 2. tb, tuberculosis ; ed, emergency department ; mdr, multidrug resistant ; inh, isoniazid ; dot, directly observed therapy. or, odds ratio ; ci, confidence interval ; inh, isoniazid resistant ; mdr, multidrug - resistant ; ed, emergency department. drug users to have been born in the united kingdom, of white or black caribbean ethnic origin, homeless, alcohol abusers, or have a history of imprisonment. non crack drug users tended to have the longest delays between diagnosis and treatment and crack users the shortest, but this tendency did not reach significance (table 1). crack cocaine users were statistically significantly more likely to seek treatment at emergency departments, to adhere poorly to treatment regimen, or default from treatment altogether. drug users were also more likely to have isoniazid - resistant disease. among crack cocaine users this was primarily related to a large outbreak of isoniazid - resistant tb (11). among crack cocaine users, diagnosis showed that 86% were smear positive compared with 36% of patients not known to use drugs (relative risk [rr ] 2.4, 95% confidence interval [ci ] 2.02.9), p<0.001) and 59% of drug users not known to use crack cocaine (rr 1.6, 95% ci 1.42.0, p<0.001). multivariate analysis showed that the risk for smear - positive disease was higher for drug users than for those not known to use drugs (odds ratio [or ] 1.9, 95% ci 1.23.0, p = 0.007) and highest in crack cocaine users (or 6.6, 95% ci 1.824.3, p = 0.005). other significant risk factors for smear positivity were being of black caribbean ethnicity, having multidrug - resistant disease, and seeking treatment at an emergency department. when the multivariate model was restricted to include only hard - drug users, crack cocaine users were still significantly more likely than other drug users to be smear positive (p = 0.02). smear - positive disease is 2.4 times more likely to be diagnosed in crack cocaine users than in non drug users, whereas hard - drug users not known to use crack cocaine are 1.6 times more likely to be diagnosed with smear - positive disease. crack cocaine users were significantly more likely than other drug users to be smear positive on diagnosis. the increased risk for smear - positive disease in crack cocaine users was not due to diagnostic delays. hard - drug users who were not confirmed as crack cocaine users had the longest diagnostic delays. crack cocaine users had the shortest diagnostic delays, potentially attributable to rapidly progressive, debilitating disease. crack cocaine users were also more likely to seek treatment at an emergency department rather than primary care services. again, the choice of healthcare service may be related to the severity of disease. we included non crack drug users as a comparison group because they have a similar social profile and similar access to healthcare. therefore, we are confident that the extremely high levels of smear positivity on diagnosis in crack cocaine users are not due to a long duration of clinical illness preceding diagnosis. in the multivariate model, crack cocaine use remains strongly associated with smear - positive disease after controlling for a wide variety of other potential confounders. other risk factors include ethnicity (drug use was common among black carribean patients and may have been underreported) ; treatment at an emergency department (possibly a marker of disease severity) ; and multidrug - resistant disease. we are uncertain why multidrug - resistant cases were more likely to be smear - positive on diagnosis ; however, previous studies have found that cavitary disease is a risk factor for drug resistance (12). the fact that smear positivity was significantly more prevalent in patients known to use crack cocaine when compared with other hard - drug users suggests that this additional risk may be attributable to a biological component. plausible biological mechanisms to explain the increased risk of smear - positive disease include poor alveolar macrophage antimicrobial activity in crack cocaine users due to decreased inducible nitric oxide synthase activity (13) and direct effects on the lung (10). it is likely that a proportion of hard - drug users were incorrectly classified as not using crack cocaine due to nondisclosure. this would reduce the apparent differences in levels of smear positivity between the groups. nevertheless, despite relatively small numbers of known crack cocaine users, there is a significantly (p = 0.02) higher proportion of smear - positive disease in these patients compared with other hard - drug users. persons frequenting crack houses are likely to have multiple risk factors for active pulmonary tb. prolonged sharing of closed and confined airspace, intensive coughing, and other acute pulmonary complications of crack cocaine inhalation promote transmission. drug users are more likely than non drug users to default treatment, to remain infectious for prolonged periods after diagnosis, and to acquire drug - resistant tb (15).. users may experience addiction - related problems that complicate access to healthcare and aggravate transmission, possibly aggravated by a biological driver that may increase susceptibility to infection and progression to infectious disease. additional studies are needed to investigate the possible biological role of crack cocaine in the development of infectious forms of tb. | we hypothesize that crack cocaine is independently associated with smear - positive tuberculosis (tb). in a case control study of tb in london, 19 (86%) of 22 crack cocaine users with pulmonary tb were smear positive compared with 302 (36%) of 833 non drug users. respiratory damage caused by crack cocaine may predispose drug users to infectivity. |
erythroderma is a well - recognized entity in the adult age group, but there are few studies on erythroderma in the pediatric age group. it is an uncommon, yet striking entity in children with an incidence of 0.11%. psoriasis affects 0.71% of the population under 18 and psoriatic erythroderma accounts for 1.4% of psoriasis among children and adolescents. as in adults, the cause of erythroderma in children is difficult to establish and diagnosis is delayed due to poor specificity of clinical and histological features. trauma, infections, and drugs as well as environmental, psychological, and metabolic factors can trigger psoriasis and its erythrodermic form. the generalized manifestations of the disease are erythema, desquamation, edema, and systemic compromise (fever, dehydration, malaise, malnutrition). follicular psoriasis, which is characterized by scaly, hyperkeratotic, follicular papules on the trunk, and extremities, is a common but neglected entity in the dermatological literature. major dermatology reference textbooks do not highlight this subtype of psoriasis, and there is paucity of reports on the subject. erythroderma with severe joint and nail involvement caused by follicular psoriasis has not been reported so far, making our case the first of its type in the literature. a 13-year - old boy presented with scaling and erythema of skin since six months and difficulty in closing the eyes completely since four months. his skin lesions started as dark, rough, horny papules over the knees and elbows, which became erythematous and scaly after a few months and gradually spread to involve the whole body. small areas of skin (spared of erythema and scaling) with these horny papules were still visible over the shoulders and flanks at the time of admission [figure 1 ]. the face showed tightening of skin, bilateral ectropion of lower eyelids, furrowing of skin of the nasolabial area, and fissuring at the angle of the mouth [figure 2 ]. palmoplantar hyperkeratosis was present and associated with thick, lusterless nails with subungual hyperkeratosis, and longitudinal ridging [figure 3 ]. skin of the shoulder spared of erythroderma showing discrete, horny, follicular papules tightening of skin of the face resulting in bilateral ectropion and furrows at the nasolabial area thickened nail with subungual hyperkeratosis the joints of both the knees were widened with bilateral genu valgum [figure 4 ]. family history was negative and there was no history of trauma, drugs, infections or any other triggers for his condition. enlarged knees with bilateral genu valgum based on the above findings and after careful exclusion of other causes of erythroderma in children, a clinical diagnosis of erythroderma due to follicular psoriasis was made. this was confirmed by histopathology [figure 5 ] which showed parakeratosis, hypogranulosis, elongated rete ridges with corresponding dermal papillary hyperplasia, suprapapillary thinning of epidermis, and neutrophilic infiltrate in the dermis. histology of the follicular lesions (h and e,100) showing parakeratosis, follicular plugging and ostial parakeratosis histology of the interfollicular area (h and e, 400) showing parakeratosis, hypogranulosis, suprapapillary thinning of epidermis and elongated rete ridges with corresponding dermal papillary hyperplasia the patient was managed conservatively using emollients and a well - controlled fluid and food intake. methotrexate was started in the dose of 7.5 mg / week after ensuring that the routine investigations were normal. a single injection of vitamin d (6 lakhs iu) was given for the joint deformities and braces were advised for the same. the erythroderma showed significant improvement in 3 weeks and the follicular lesions resolved completely by 8 weeks. severe erythrodermic psoriasis with joint and nail involvement is uncommon in children and that associated with follicular psoriasis has never been reported till date. the exact incidence is unknown, as we found only three reports mentioning a total of 15 cases in the literature. it affects both the sexes and although two thirds of these occurred in adults, cases have been described in children under the age of 10 years. the adult form is more common in females, presenting with discrete hyperkeratotic papules usually involving the thighs. the rarer childhood form presents either as grouped, asymmetrical, horny, follicular lesions affecting the trunk, axillae, and bony prominences or as a wide - spread eruption resembling pityriasis rubra pilaris, except that the latter has typical islands of spared skin associated with an orange - red erythema and palmoplantar keratoderma. there is a pre - disposition among dark - skinned patients and in those with pre - existing plaque type psoriasis, especially of the scalp, though follicular lesions may present without psoriasis vulgaris elsewhere (as occurred in our patient). when encountering follicular type lesions an index of suspicion and a careful general skin examination lichen spinulosus has grouped, minute, flesh - colored papules, which can be easily distinguished. established lesions show follicular plugging, dilation of the infundibulum and marked ostial parakeratosis with a neutrophilic infiltrate and loss of the granular layer (which is not seen in pityriasis rubra pilaris). erythroderma arising from any type of psoriasis in children is a life - threatening condition. careful monitoring of the patient and correction of the hematologic, biochemical, and metabolic imbalance improves the final outcome in these patients. however, diagnosing its underlying cause may require histopathological confirmation, as in our case, which brought to light the surprising diagnosis of follicular psoriasis. we hope to highlight the fact that this type of psoriasis may be more common in clinical practice than is thought to be and should also be considered as a possible diagnosis when erythroderma is preceded or accompanied by follicular papules. | erythroderma in children is an uncommon, yet striking entity with an incidence of 0.11%. psoriatic erythroderma accounts for 1.4% of psoriasis cases in children. follicular psoriasis is an underdiagnosed variant of psoriasis, with only about 15 cases reported till date, characterized by scaly follicular papules on the trunk and extremities. although two thirds of these reported occurred in adults, cases have been described in children under the age of 10 years. follicular lesions may present without psoriasis vulgaris elsewhere. we report here a 13-year - old boy who presented with severe erythrodermic psoriasis that started as dark, rough, horny, discrete, follicular papules over knees and elbows, associated with nail and joint involvement. such a presentation of follicular psoriasis causing erythroderma is uncommonly seen in children and has not yet been reported in literature. |
despite the directly observed treatment short course (dots) strategy, tuberculosis (tb) is still a major public health problem in the world (1). according to the world health organization (who), about 8 to 8 million people annually are diagnosed with tb, diabetes is a debilitating disease that impairs the cellular immune system and provides the ground for tb. the who estimates that by 2030, the population of diabetics is increasing and reaches about 316 million people, most of them are living in developing countries (4 - 6). diabetes mellitus (dm) is a common chronic metabolic disorder that affects mainly the country 's elder population. according to the center for disease control (cdc), the leukocyte dysfunction and reduction of serum bactericidal activity in dm patients increases the risk of tb infection (8, 9). patients with dm are at increased risk of pulmonary tb (10 - 17). knowing the epidemiological, clinical, laboratory and radiological aspects of patients with tuberculosis helps involved practitioners in rapid diagnosis and initiating appropriate treatment. prompt and appropriate treatment is the most effective way to prevent of treatment failure, relapse, or emergence of multi drug resistant tb (mdr - tb) which today is the main problems in fighting against tb (3). because the differences in the immune response in diabetics and non - diabetic infected hosts, epidemiological, clinical, radiological, laboratory tests results and response to treatment varies in these patients (8, 9). tuberculosis in older people with weak immunity is associated with less cough and fever in compare with younger individuals while, pleural effusion and cavitation are more common in patients with normal immune responses (3). to the best our knowledge, such study in diabetic patients with pulmonary tuberculosis has not been performed in khuzestan - a province with a population of over 4.5 million. since the majority of deaths in patients with pulmonary tuberculosis occur in hospitalized patients, thus, hospital - based studies provide useful information on various aspects of the disease. considering that knowing this information is necessary to control tb, this study aimed to compare the epidemiological characteristics, clinical, laboratory and radiological findings in patients with pulmonary tb in diabetic and non - diabetic patients. in this retrospective study, all cases of pulmonary tb, hospitalized in razi hospital during two years (2009 and 2010) were reviewed. to find more information, complete data and matching the data with health file of patients, tb documents in khuzestan health center razi hospital in ahvaz is the referral center for almost all cases of pulmonary tb, therefore, we assumed the above cases as s representative of all tb cases in khuzestan. patients data on demographics, residential area, habits, past medical history, laboratory and sputum microscopy analysis, as well as clinical signs and symptoms, radiological findings, the patient 's condition of diabetes (self - referred, under treatment of oral anti - diabetic medication and fasting blood sugar levels), receiving anti - tb drugs, tb treatment response and other relevant information were extracted from patient records. patients were divided into two groups ; a group of patients with pulmonary tuberculosis and with diabetes mellitus called as dm & ptb, and other group of patients with pulmonary tuberculosis but without diabetes mellitus called as non - dm & ptb. study inclusion criteria were as follow : patients who had pulmonary tuberculosis, based upon the national anti - tb program (ntp). pulmonary tb : at least two tests of positive sputum smear acid - fast test or one positive sputum smear acid - fast and a chest radiograph consistent with tb, smear - negative pulmonary tuberculosis ; at least 3 sputum tests negative for acid - fast bacilli (afb) but positive radiographic or a doctor 's decision on anti - tb treatment in the presence of clinical signs and symptoms consistent with tb and age older than 15 years. in additions, the exclusion criteria were cases with no state of sputum smear analysis, cases with incomplete information and non - diabetic patients but, with other underlying diseases that may influence the immune status. patient 's data in both groups were analyzed in spss-16 using chi - square test and fisher exact tests. from 169 cases of ptb, 5 patients were excluded due to incomplete data, 8 due to defects in the state of sputum smear results, and 8 due to hiv infection. of the remaining 148 patients, 36 patients had diabetes mellitus. mean age in the dm & ptb and non - dm & ptb group were (n = 36), 56.6 12.7 (n = 112) was 44.8 18.3 years, respectively. as shown in table 1, prevalence of pulmonary tuberculosis among older than 60-years diabetic patients have no significant difference with those below 60 years of age, whereas, the mean age in diabetic 's cases was higher than in non - diabetics. although more males than females are diagnosed with ptb, but this difference was not significant. also, while tb prevalence is higher in urban areas than in rural ones, he difference is not significant. clinical signs and symptoms in both groups are shown in table 2. although symptoms such as cough, night sweat, fever, and weight loss in both groups exist, but, sputum production, hemoptysis, and dyspnea in patients with diabetes were more prevalent than in non - diabetic patients. radiological features in non - diabetic and diabetic patients are shown in table 3. statistically significant abbreviations : dm & ptb, diabetes mellitus and with pulmonary tuberculosis data are presented as no. (%) statistically significant there is a similar frequency of infiltration and upper lobe opacity in both groups, but there is a higher frequency of the cavity lesions and reticulunodular pattern in diabetic patients comparing with non - diabetic patients. in diabetic and non - diabetic patients, cell blood count (cbc) was normal (normal range : 7000 - 10000) in 108 patients (96.4%), 31 patients (86.1%), which was not statistically significant (p > 0.05). mean value of erythrocyte sedimentation rate (esr) in diabetic and non - diabetic patients were respectively 49.6 and 53.3 mm / h, which was not statistically significant (p > 0.05). in diabetic patients, sputum smear was positive for afb in 24 (66.6%) patients, while in non - diabetic patients it was positive in 53 (47.3%) patients, which was statistically significant (p = 0.03). number of mdr - tb in the non - diabetic group was 2, and in diabetic group was 4, although statistically was not comparable, but regarding to the country rate and expected rate in ntp (2%) and percent in these patients (5.5% vs. 3.5%) is considerable. although some epidemiological features of pulmonary tuberculosis such as gender, age and residential area are similar in both diabetic and non - diabetic patients, but in clinical point of view, radiological and laboratory features were more dominant in diabetic pulmonary tuberculosis - infected patients comparing with non - diabetics patients. in dealing with patients suspected of having tb, these differences should be considered. these results are consistent with other studies (10, 11, 15 - 19). although, the incidence of tb in people over 60 years and under 60 years showed no significant difference ; however, the mean age of patients with pulmonary tuberculosis in diabetic patients was higher than non - diabetic patients. this is justified because, firstly, old tb infected persons are at in increased risk of tb reactivation ; secondly, the incidence of diabetes is higher in the older age. we can not easily say that the incidence of tuberculosis in elderly diabetics is higher than aged non - diabetics. to demonstrate this, we first need to compare non - tb diabetic and non - diabetic cases for age. (18) in their study in masih daneshvari hospital (the country 's referral center) in tehran, iran, showed that the mean age of diabetic patients with pulmonary tuberculosis is a little more than non - diabetic tb patients (57.8 vs 55.2 years). have also shown that the mean age of tb patients with diabetes is higher than non - diabetic tb patients (11). this study shows that patients in rural area have higher prevalence of diabetes and tb comparing to rural areas. suburbs, where people live in crowd environments greater chance of exposure to infectious tb patients may causes great number of afb in the air. because of the limited studies in this field, comparing the results of this study with other studies in other areas of the country is not possible. stevenson., has also pointed out a higher incidence of pulmonary tuberculosis in diabetic patients in urban areas than in rural areas (15). the present study revealed that cough, fever and night sweats in diabetic patients are the same in non - diabetic patients, but the sputum production, hemoptysis, and dyspnea are observed in the diabetics more frequent than in non - diabetics. has demonstrated that anorexia, dyspnea and hemoptysis in diabetes were higher than in non - diabetes but, cough and sputum production in both groups were similar (18). in general, the results of the clinical findings in this study are concordant to the results of other studies conducted in other regions (15, 17). it seems that diabetes mellitus patients, because of diabetes - induced immunodeficiency, are incapable of inhibiting the progression to disease, therefore, disease progress more rapidly and the blood vessel wall and pleural involvement results in hemoptysis and dyspnea. these results are in agreement with previous studies in medical literature (3, 10, 11, 13, 17). in this study the radiographic findings, such as upper lobe opacities and pleural effusions, are similar in both groups, but cavitation and nodular infiltration (miliary mottling) pattern are more observed in diabetic compared with non - diabetic patients (3). regarding the fact that the inflammatory response is suppressed in immunocopromised host, frequency of cavitary lesions in non - diabetic individuals with normal immunity is conceivable. however miliary pattern in patients with diabetes can be explained for of the spread of disease because of cellular immunity impairment. however, because the study was retrospective, it is not clear exactly how their diabetes was controlled and how they were their immune status. future studies are needed to clarify this issue with the substantial sample size and the level of cellular immunity. except in baghaei study (18) with similar radiological findings in both groups (except in cavitation), no other studies were found regarding this issue, addressing our country. they reported that diabetic patients had a higher prevalence of typical presentations along with cavitary lesions (18). but in the studies of other countries, the prevalence of cavities in chest radiography of diabetic patients with pulmonary tuberculosis has been suggested (10, 11, 17). in this study, in other words, the chances of isolating the tuberculosis bacillus in the sputum of diabetic tb patients are more than non - diabetic patients. these findings are in agreement with other studies in this subject (15), because these patients are associated with increased sputum production, and also because of more cavitation and tissue immune inhibition, the possibility of access to further sputum containing bacilli exist. in stevenson study, higher rates of sputum positivity have been reported in diabetic patients (15). in other comorbidities, such as the elderly or patients with advanced aids, tuberculosis bacillus isolation level is higher than tuberculosis patients with normal immunity (3). in this study, based on limited number of drug resistance cases, multidrug - resistant tb cases can not be discussed, however, the increasing number of patients with mdr - tb (comparing with ntp limit) has alarmed in diabetes and further prospective studies in this field is recommended. bashar., has also warned the importance of mdr - tb among diabetic individuals (16). to the best our knowledge, till now, there is no similar study in the province, and studies in this field in iran are very limited, so this study can be considered as a new work. the study design is retrospective and is limited to only one hospital. since our hospital is the only referral infectious diseases center in ahvaz, this limitation can be justified. future population - based studies are needed to generalize these results to the whole community in the region. epidemiology of tuberculosis in both diabetic and non - diabetic patients is similar. although the signs and symptoms of tb disease in diabetic patients are the same with non - diabetic ones, but sputum production, hemoptysis, and dyspnea are more prevalent in diabetics. chest radiography in diabetic patients is a useful diagnostic modality for detecting advanced lesions such as cavity and miliary lesions. according to the results of this study, in approach to every dm case presenting with respiratory symptoms such as productive cough, hemoptysis and dyspnea in association with cavitation or reticulonodular pattern in chest x - ray to the best our knowledge, till now, there is no similar study in the province, and studies in this field in iran are very limited, so this study can be considered as a new work. the study design is retrospective and is limited to only one hospital. since our hospital is the only referral infectious diseases center in ahvaz, this limitation can be justified. future population - based studies are needed to generalize these results to the whole community in the region. epidemiology of tuberculosis in both diabetic and non - diabetic patients is similar. although the signs and symptoms of tb disease in diabetic patients are the same with non - diabetic ones, but sputum production, hemoptysis, and dyspnea are more prevalent in diabetics. chest radiography in diabetic patients is a useful diagnostic modality for detecting advanced lesions such as cavity and miliary lesions. according to the results of this study, in approach to every dm case presenting with respiratory symptoms such as productive cough, hemoptysis and dyspnea in association with cavitation or reticulonodular pattern in chest x - ray | background : diabetes mellitus (dm) due to suppressive effect on cellular immunity can impact on progression of tuberculosis (tb).objectives : the aim of this study was to investigate the impact of dm on the epidemiological, clinical and para clinical aspects of pulmonary tb.patients and methods : the information of 148 admitted pulmonary tb patients in infectious ward of razi hospital in ahvaz from 2009 to 2010 was extracted from their medical files. the patients were divided into two groups as tb with dm (n = 36) and tb without dm (n = 112). the related data on epidemiology, signs, symptoms, radiology and sputum smear examination in both groups were compared in spss 16 by using chi squared test.results:the mean age of tb with dm patients was higher tb without dm patients (56.6 12.7 vs. 44.8 18.3 ; respectively, p = 0.006). whereas cough, night sweating, fever and weigh loss was not statistically different, sputum, hemoptysis and dyspnea was more prominent in tb with dm (69.4%, 33.4%, 44.5% vs. 36.6%, 9.8%, 20.5% ; p = 0.005, p = 0.001, p = 0.005, respectively). in chest x - ray, cavitation and reticulonodular pattern was more frequent in tb with dm (55.5%, 22.2% vs. 31.2%, 8% - p = 0.008, p = 0.02, respectively). the rate of sputum smear positivity in tb with dm and tb without dm was 66.6% and 47.3%, respectively (p = 0.03).conclusions : according to the results of this study, in approach to every dm cases suffering of respiratory symptoms such as productive cough, hemoptysis and dyspnea in association with cavitation or miliary mottling in chest x - ray, pulmonary tb should be considered at the top of the differential diagnosis list. |
the hernia sac passes through the obturator foramen, following the path of the obturator nerves and muscles. here we present a typical case of obturator hernia which was diagnosed by spiral ct preoperatively and the emergency operation was performed successfully. a 78-year - old woman was sent to our emergency department because of recurrent abdominal pain and constipation for 10 days. the colicky pain was getting worse in recent nearly six days, accompanied with nausea and vomiting. she also complained of intermittent right hip pain with radiation to the medial aspect of the thigh for several months, which worsened with extension, abduction, or internal rotation of right leg. the body weight was 38 kg. physical examination revealed a distended abdomen without tenderness or muscle guarding. the abdominal plain film revealed small intestine obstruction. enhanced ct scan demonstrated obvious intestinal obstruction with a low density mass in the right obturator canal area (figure 1) the diagnosis of right obturaor hernia was confirmed and emergency laparotomy was performed. during the operation, a 10 cm loop of small intestine was revealed herniated into the right obturator canal (figure 2). the incidence is nearly 1% of all hernias 2. with the nickname little old lady 's hernia, it usually occurs in multiparous and elderly emaciated women due to a wider pelvis and enlarged obturator canal. the patient had a positive howship - romberg sign, which was caused by the intermittent irritation of the obturator nerve. it was reported that 15~50% patients of obturator hernia may have positive howship - romberg sign 1. in her early course the loss of the adductor reflex, named as hannington - kiff sign, was observed on the affected side, while the patellar tendon reflex was intact on the same side 3. various imaging examinations have been applied to establish the diagnosis, including ultrasonography, herniography, ct scan and so on. among them, ct scan has superior sensitivity and accuracy 4. in our case, preoperative diagnosis of obturator hernia was confirmed by spiral ct scan and emergent operation was performed. chang concluded that the duration of symptoms was one of the major factors affecting the rate of bowel resection. there are a variety of operative approaches including inguinal, retropubic and transperitoneal approach 6,7. laparotomy via low midline incision was applied in this case because it had advantages of better exposure and facilitation of bowel resection when necessary. the advantages of laparoscopic surgery include less postoperative pain, shorter hospital stay and lower complications. however, it is usually reserved for the nonstrangulated hernia because of more challenging techniques and longer learning curve. methods of repair include simple suture closure, closure of the obturator with adjacent tissue, and mesh replacement during laparotomy 9. many authors preferred a simple closure of the hernial defect with one or more interrupted sutures, in case of bowel resection 6, 8. in this case we did the simple suture and outcome was satisfying. in conclusion, it should be kept in mind that obturator hernia is a rare but significant cause of intestinal obstruction especially in emaciated elderly women. | obturator hernia is a rare pelvic hernia with incidence of 1%. it 's a significant cause of intestinal obstruction in emaciated elderly women. delayed diagnosis and surgical intervention contributed to its relatively high morbidity and mortality. we present a typical case of obturator hernia with positive howship - romberg sign and hannington - kiff sign. the diagnosis was confirmed by spiral ct preoperatively. during the emergency laparotomy, the incarcerated intestine was reduced and removed. obturator foramen was repaired by simple suture. the patient recovered uneventfully and no recurrence occurred during the follow - up. the obturator hernia should be included in the differential diagnosis if clinically suspected. early diagnosis and prompt surgical treatment are essential to reduce the morbidity and mortality associated with obturator hernia. |
in food processing plants, residues of all kinds chemical, biological, organic, or inorganic inevitably accumulate on the surfaces of equipments in contact with food. attachment of undesirable microorganisms to these surfaces is a source of concern, since this can result in product contamination leading to serious economic and health problems [24 ]. in fact, this microbial contamination has two components : first, the saprophytic flora responsible for food spoilage and second, the pathogenic flora, which cause infections in humans and animals. to adversely affect the sensory, physical, and chemical qualities of food, a large population of spoilage - causing microorganisms is required, while in the case of food pathogens it only takes a few cells to affect product safety and cause food poisoning. in the phenomenon of bacterial adhesion to inert surfaces, the physicochemical properties (hydrophobicity and charges) and substrates or surface topography are playing important roles [57 ]. joints such as valves and any other difficult - to - reach spaces are the most favourable areas to bacterial adhesion. the effect of corrosion on solid materials must also be considered since it can lead to the formation and expansion of cavities and grooves. this in turn provides breeding sites for microorganisms, thereby compromising the efficacy of cleaning and disinfection procedures. the surface characteristics of the microorganisms themselves and the various environmental conditions encountered in agri - food industries (organic materials, ph, temperature, water activity, etc.) also influence microbial attachment to inert surfaces [2, 912 ]. once they have adhered to inert surfaces, the microorganisms may exhibit a greater degree of resistance to the chemical or natural cleaning and disinfecting agents used in the agri - food industries compared to bacteria in suspension [13, 14 ]. the potential for attachment and development of microorganisms on inert surfaces as well as the resistance of the resulting sessile cells has been and continues to be extensively studied [1519 ]. although an understanding of the parameters that govern the adhesion of these bacteria to solid surfaces could help developing new prevention procedures at the initial stages of microbial adsorption, there are still too many unknown factors concerning the adhesion capacity of the main food pathogens. the objective of this study was to find out the adhesion capacity of pathogens such as aeromonas hydrophila, escherichia coli o157:h7, salmonella enteritidis, and staphylococcus aureus on two commonly used materials in food processing plants (polystyrene and glass). the influence of culture medium ph on the rate of adhesion by these agents at the interfaces was also simultaneously evaluated. for this study, aeromonas hydrophila atcc 7966, escherichia coli o157:h7 atcc 35150, salmonella enteritidis e1347, and staphylococcus aureus atcc 29213 were selected. cryotubes of these strains, stored at 80c in tsb - ye (tryptic soy broth supplemented with 1% yeast extract ; difco laboratories, detroit, mi) containing 20% glycerol (difco laboratories, detroit, mi), were thawed and the bacterial cultures were revived by two successive precultures in 10 ml of tsb - ye (1% v / v) and then incubated for 24 h at 37c. the harvested bacteria were washed three times and resuspended in buffers at ph 6.0, 7.0, or 8.0. a total viable count was performed for each culture and the total cfus determined using tryptic soy agar (tsa ; difco laboratories, detroit, mi) were between 4 10 and 2 10 cfu / ml. polystyrene (hydrophobic) and glass (hydrophilic) substrates were selected for the adhesion tests. 25433 ; vwr international inc., west chester, pa) were used to obtain 5-cm coupons and 5-cm glass coupons were cut from microscope slides (no. 48300 ; vwr international inc., prior to physicochemical characterizations and adhesion tests, these substrates were soaked for 24 h in sodium hydroxide (1 n), washed and rinsed thoroughly eight times with deionized water (millipore, billerica, ma). the polystyrene coupons were sterilized for 5 min in boiling distilled water, while the glass coupons were directly autoclaved at 121c for 15 min in bioreactors. the attachment tests were conducted in sterile bioreactors (bst model sc60 suspend reactor, biosurface technologies corporation, bozeman, mt). using a sterile clamp and under a microbiological hood, the sterile coupons were mounted on metal rods (six rods per bioreactor) in pairs, separated by a stainless steel nut. to ensure a sufficient attachment of the bacterial cells, the cultures of the pathogens in the bioreactors were left in contact with the inert surfaces for 24 h at ambient temperature (20 2c) under low agitation (90 rpm). each experiment (bacterium - culture ph - surface type combination) was repeated three times and the means were used for the statistical analyses. to recover the sessile cells, two coupons of each material were removed from the rods using a sterile clamp and rinsed twice in tubes containing 10 ml of saline (one tube per rinse, carefully rotating the tubes) in order to eliminate the cells that had not adhered. the substrates were then placed in a tube containing 10 ml of sterile phosphate buffer (oxoid ltd, basingstoke, hampshire, england) and all of the adhered bacterial cells were detached in a sonication bath (vwr international inc., west the tubes were vortexed for 30 s before the microbial counts were performed. after preparation of serial dilutions, the bacterial counts were determined by plating on tsa (tryptic soy agar ; difco laboratories, detroit, mi) incubated at 37c for 24 h. the relative adhesion (%) was estimated using the following formula : (1)relative adhesion (%) = (adhered bacteria / initial concentration)100. in preliminary work, the two types of noncontaminated sterile materials were gold coated and observed under a scanning electron microscope in order to characterize the microstructure of the substrates. after two saline rinses, the contaminated coupons were fixed by immersion in 5 ml of 2.5% glutaraldehyde (v / v) in a 0.1 m sodium cacodylate buffer (ph 7.3) and left at room temperature for 2 h. the glutaraldehyde was then removed using a pasteur pipette and the substrates were rinsed four times by immersing them for 15 min in 0.1 m sodium cacodylate buffer (ph 7.3). dehydration was performed through an ascending series of ethanol (approximately 5 ml) concentrations (30%, 50%, 70%, and 80%) for 15 min for each concentration, and then three times for 15 min in 100% ethanol. dehydration was completed using co2 in a critical point dryer (model e3000 cpd, bio - rad, polaron equipment ltd. the samples were then mounted on an aluminum platform and covering with 8 nm of gold using a sputter coater (cressington 108, kurt j. lesker co., clairton, pa). the substrates were observed under a scanning electron microscope (hitachi s300n, hitachi, tokyo, japan). for the inert material, sterile dried substrates were positioned on a microscope stage for contact angle measurements. a microsyringe (chromatographic specialities inc., brockville, ontario, canada) was used to place a drop (1 l) of each wetting agent bidistilled water (barnstead fistreem glassstill, england), formamide, and -bromonaphthalene (aldrich chemical co., inc., milwaukee, wi)on the solid surfaces. the contact angles formed by these liquids were determined using a goniometer coupled with a 100 telescope (gaertner scientific corp., chicago, ill.). in each case, six measurements were taken with each liquid on each substrate to determine the surface charge of the substrates as well as their hydrophilic - hydrophobic characteristics. the total surface energy () of the solid substrates, the lifshitz - van der waals contribution to surface energies () and the lewis acid - base bonds () were calculated using an extension of the young - dupr equation : (2)(1+cos)lt=2[(slsllw)+(s+l) + (l+s)],tot=slw2(s+s)=slwsab, where represents the angle formed by the wetting liquid on the substrate and l, the surface tension of the wetting liquid. (l, l, l) and (s, s, s) are, respectively, the lifshitz - van der waals dispersion, electron donor (basic) and electron acceptor (acid) components of the wetting liquid and inert surface. once these parameters have been determined, for both the solid substrates (s) and for each bacterium (b) in an aqueous medium (l), the free energy of microbial adhesion, gadh(41), was estimated according to the following formula : (3)gadh=(slwblw)2(blwllw)2 (slwllw)2 + 2[l+(s+bl) + b(s++b+l) (s+b)(sb+) ]. in theory, the energy balance is favourable to bacterial adhesion if gadh 0. bacteria physicochemical properties were determined for bacterial cultures grown at phs 6, 7, and 8. the contact angle measurements were performed on bacterial lawns deposited on filter paper as described by mafu. and the total surface energy () of the bacteria and the lifshitz - van der waals (s) contribution to surface energies as well as the lewis acid - base bonds (s) were determined with the help of young - dupr relationship (2). the surface properties of the pathogens were evaluated in term of free energy of aggregation using the van der mei. approach (4) (4)gmwm=4(mlwwlw)2 4((m+m)+(w+w) (m+w)(mw+)), where (m, m, m) and (w, m, m) are, respectively, the lifshitz - van der waals dispersion, electron donor (base) and electron acceptor (acid) components of the microorganisms studied and those of the water. a preference for the aqueous medium, a characteristic of hydrophilic cell surfaces, is demonstrated by a gmwm value > 0, while hydrophobic organisms, which tend to agglomerate in aqueous suspensions, are characterized by a gmwm.05). at ph 6, 7, and 8, no interactions were determined between ph of culture and adhesion capability for individual bacterium (p >.05). the type of substrate did not influence the rate of attachment of pathogens (p >.05), however the effect of ph of the culture varied depending on the type of microorganism considered. e. coli displayed the lowest relative adhesion, regardless of environmental ph (table 3). the affinity of e. coli for the solid samples was significantly influenced by ph (p.05) and from 39% to 42% (p >.05), respectively. the adhesion capacity of a. hydrophila to inert surfaces was lower after being cultivated in an alkaline medium (p.05). the degree of contamination of polystyrene and glass by this enterobacteria was considerably higher than that observed for the other bacteria at ph 8 (p.05). also, after the contamination period, adhesion of s. aureus to the two types of coupons (table 3) was lower compared to the other experimental conditions (p.05). figure 2 demonstrates the mean relative adhesion rate of each bacterium as a function of the component of their surfaces. in fact, since the solid surfaces had no effect on the concentration of adhered cells (p >.05), the mean between the relative adhesion to polystyrene and to glass could be calculated in order to obtain an overall adhesion rate. only an high correlation coefficient (r = 0.94) between the free energy of aggregation of s. aureus and its mean rate of adhesion to the substrates has been found (figure 2). the greater the hydrophilic character displayed by this bacterium, the lower its tendency to attach to inert surfaces. on both types of surfaces, porous and nonporous, a very low number of e. coli and dispersed cells of a. hydrophila were observed (data not shown). s. enteritidis cells were generally isolated or formed small clusters, regardless of the adhesion conditions (figure 3). their dispersion was more uniform at ph 6 than at the other ph values (figures 3(a) and 3(b)). s. aureus invaded the abiotic surfaces in the form of single cells, small chains, or cell aggregates (figure 4). it was more difficult to observe staphylococci on polystyrene and glass at ph 8 (figures 4(e) and 4(f)). as demonstrated by the present results, it becomes clear that in all case, no visible extracellular material was observed on both food contact surfaces. bacterial adhesion to surfaces and biofilm formation are complex phenomena influenced by a number of factors. in this study, three of these factors, namely, microbial strains, culture ph, and type of surface, were analysed. polystyrene and glass were chosen as surfaces, respectively, hydrophobic and hydrophilic, for the attachment and biofilm formation tests. scanning electron microscopy observation (figures 3 and 4) showed that all the pathogens had the capacity to adhere to both types of surface. although the cavities and distortions of the samples observed under the scanning electron microscope increase the specific contact area for bacteria, the differences in surface irregularities between both solid surfaces had no observable impact on the relative adhesion of the microorganisms. these results are consistent with the findings of mafu., who found no correlation between the microstructure of the materials and the capacity of bacteria to adhere to surfaces. also in this study, the attachment of solid surfaces by microorganisms was influenced solely by culture ph, which concurs with the work of husmark and ronner as well as that of herald and zottola. the absence of fimbriae and curli [25, 26 ] might explain the low contamination of e. coli observed in this study as well as in other experiments conducted on the contamination of polymers by serotype o157 [24, 27, 28 ]. the data from these experiments are not in agreement with the predictions deduced from the free energies of adhesion (gadh) of pathogens on polystyrene (table 2). these energy characteristics demonstrated that conditions for adsorption of all microorganisms were thermodynamically favourable on polystyrene (gadh 0) surfaces. if the exposure time had been shorter (maximum of four hours, which corresponds to irreversible bacterial adsorption), the predictions for the adhesion, based on gadh, might have proven valid. in fact, the equation used to predict bacterial adhesion to surfaces (gadh) does not take into consideration the exopolysaccharides that might be produced for the irreversible attachment of microorganisms. in another attempt to explain adhesion detection with gadh values > 0, we endeavoured to determine whether the surface properties of the infectious agents influenced their adhesion rate. thus, the free energy of aggregation of s. aureus could be correlated to the degree of attachment of the cocci (figure 2). gilbert. also demonstrated that the adhesion of staphylococcus epidermidis to glass, unlike escherichia coli, was negatively correlated to the microorganism 's hydrophilicity and surface electronegativity. however, the physicochemical characteristics of the inert surfaces and of the other three pathogens examined throughout this study did not shed any light on their adhesion capacity. the explanation may lie in the composition of the suspension medium of the microorganisms, which was not taken into account in the estimation of ps and glass free energy. indeed, conditioning the substrates with compounds from the suspension medium can increase or decrease subsequent bacterial adhesion [23, 30, 31 ]. these ionic substances located at the microorganism - surface interface can change ionic strength which is a critical factor in adhesion. some of these elements can reduce the repulsive force between the bacterium and the solid surfaces [32, 33 ], due to electrostatic interactions, by masking charges of the same sign. thus, several stress responses are associated with the appearance of macromolecular agents in the medium. many microorganisms exposed to acidic and alkaline stress synthesize polysaccharides, peptides, or heat - stable proteins [10, 34 ], which play an active role in induction of tolerance to ph stress. for instance, synthesis by s. aureus of a surfactant, the toxin, inhibits the action of d - alanine, limiting cell adhesion to polystyrene. previous studies have also demonstrated the important roles played by cell organelles and bacterial mobility in transport and adhesion to various types of surfaces. pseudomonas fluorescens strains without flagella exhibited a weak capacity to attach to surfaces and develop a biofilm. flagella apparently play an essential role during the initial reversible stages of attachment by overcoming the repulsive forces. however, the nonmotile bacterium s. aureus adhered to the tested substrates at ph 6 in greater numbers than e. coli o157:h7 and a. hydrophila (table 3), which are motile microorganisms. the presence of flagella is apparently more important when the velocity of the environmental liquid is high [4, 36 ]. mcclaine and ford demonstrated that rotation of the flagellum caused detachment of fixed motile bacteria when flow rates were low (0.02 mlmin), while their adhesion was strengthened at high flow rates (2 mlmin). although the irreversible attachment of microorganisms is often associated with the production of exopolysaccharides, no extracellular matrix was detected by scanning electron microscopy, regardless of experimental conditions. this indicates that the presence of polymers is not necessary for permanent adhesion of microorganisms to a surface. the visible filaments attached to the substrates may be dependent on the suspension medium. maximum polysaccharide production is generally associated with an environment deficient in essential nutrients, such as carbon, nitrogen, calcium, and iron [26, 38 ]. contact time and environmental temperature are other factors that influence the formation of a three - dimensional network [39, 40 ]. however, these appendices are crucial for biofilm consolidation and their resistance to environmental stresses. several molecules from the culture media can contribute to produce a conditioning film at the surface of the substrates. these molecules include proteins, which are block copolymers presenting hydrophobic as well as hydrophilic sections. it is thus possible for such molecules to adhere to hydrophilic substrates such as glass, resulting in an hydrophobization of the surface. this phenomena would lead bacteria presenting the same adhesion trends on both ps and hydrophobically coated glass. the results of this work indicate that pathogens could adapt to various ph levels of cultural media and adhere indifferently to inert polystyrene and glass surfaces, regardless of their hydrophilic or hydrophobic nature which leads to biofilm formation and increases the possibility of resistance to sanitizing agents. therefore, to minimize surfaces contaminations, one should be aware of the influence of different environmental conditions which affects survival of bacteria in order to reduce their incidence in food systems. the operations must be carried out promptly and regularly (between two production cycles, for example), since they can effectively detach and eliminate the adhered bacteria when they have not yet formed a biofilm, thereby preventing contamination of raw materials and finished products and protecting consumer health. | the adhesion of aeromonas hydrophila, escherichia coli o157:h7, salmonella enteritidis, and staphylococcus aureus to hydrophobic and hydrophilic surfaces in cultures with different phs (6, 7, and 8) was studied. the results indicated that the type of material had no effect on the attachment capacity of microorganisms, while environmental ph influenced the adhesion of a. hydrophila, e. coli, and s. aureus to both solid substrates. the attachment of s. enteritidis (p >.05) was not affected by the type of substrate or the culture ph, whereas e. coli displayed the weakest affinity for both polystyrene and glass surfaces. no correlation was established between the physicochemical properties of the materials, or the bacterial and the rate of bacterial adhesion, except for s. aureus. photomicrographs have shown that surfaces were contaminated by small clusters of s. enteritidis while s. aureus invaded the food contact surfaces in the form of small chains or cell aggregates. |
low back pain (lbp) is a common condition, with 28.1% of adults in the us reporting to have experienced lbp within the previous 3 months.1 the prevalence of chronic lbp has increased from 3.9% in 1992 to 10.2% in 2006.2 national estimates of direct costs for chronic lbp in the us have been between $ 12.2 billion and $ 90.6 billion based on a systematic review.3 back pain treatment was the eighth most expensive medical condition in a national analysis of us private health insurance spending.4 the total economic burden, including lost productivity and decreased wages, associated with lbp in the us ranges between an estimated $ 60 billion and $ 200 billion annually.5,6 of adults in the us labor force, 70.2% receive employer - based health insurance.7 as such, both private health insurers and employers have a vested interest in maintaining a healthy and productive workforce.8 chronic lpb is commonly caused by the sacroiliac (si) joint.9 the prevalence of si joint pain among patients with chronic lbp is estimated to range from 15% to 30%, although not all of these patients with si joint pain require surgery.9,10 the prevalence of an international classification of diseases, ninth revision, clinical modification (icd-9-cm) diagnosis of si joint disruption and/or degenerative sacroiliitis has been reported as 0.9% among privately insured individuals in the us.11 to diagnose the si joint as the pain generator, three or more positive provocation tests are required, followed by an image - guided diagnostic injection confirming the si joint as the source of pain ; also, an immediate pain reduction of 50% or greater after a local anesthetic injection is required to confirm that the pain is generated from the si joint.12,13 si joint pain has traditionally been treated with either nonoperative care or open si joint arthrodesis surgery. methods of nonoperative care include epidural injections, physical therapy, pain medications, radiofrequency ablation, and pain medications. despite the fact that these nonoperative therapies are less invasive, they are of limited benefit because they do not address the fundamental cause of the pain but rather only relieve the symptoms of si joint pain. despite these limitations, nonoperative care such as epidural steroid injections, as well as facet joint and sacroiliac joint interventions, increased an average of 16.5% annually from 2000 to 2008.14 when si joint pain is unmanageable with nonoperative therapies, open si joint arthrodesis has been the only alternative. unfortunately, open si joint surgery is invasive, requiring bone harvesting and large incisions, and necessitates hospital stays and lengthy periods of non - weight bearing.1517 to address the need for additional treatment options for patients with si joint pain, several minimally invasive surgery (mis) arthrodesis systems have been developed. minimally invasive surgical procedures achieve permanent linkage by inserting implants to stabilize the si joint affected by si joint disruption and/or degenerative sacroiliitis. mis systems involve a smaller incision size and do not require bone grafting, which in turn curtails hospital length of stay and recovery time. recent studies of mis have demonstrated their clinical safety and effectiveness, including 4-year safety surveillance from a database of 5,319 mis - treated patients and two retrospective studies of 12- and 40-month follow - up, respectively.1921 despite the advent of new mis technologies and techniques, the economic implications of new mis si joint treatments have not yet been explored from a us private health insurance perspective. this economic model evaluates the cost to the us commercial payer of mis si joint fusion compared to continued nonoperative care in patients with chronic lbp caused by si joint disruption and degenerative sacroiliitis. we assessed whether and over what period of time the higher initial mis si joint fusion procedure costs were offset by decreased nonoperative care costs. this research was performed according to guidelines (gpp2) established to minimize conflict of interest in pharmacoeconomic studies.22,23 the coauthors of the present study (clinicians and methodologists) formed a multidisciplinary panel that provided the framework for the economic analysis and made all decisions about the model inputs, assumptions, analyses, and interpretation of the results. the economic model was used previously to compare the costs of mis si joint fusion to nonoperative care for the treatment of si joint disruption in the hospital inpatient setting among the us medicare population (beneficiaries 65 years of age and older). the methods described below are similar to those in the previously published model.24 the methods are repeated herein, with relevant adaptations for the us commercial payer population. the economic model estimated the cost differential (2012 us dollars [usd ]) associated with treating commercially insured patients with mis si joint fusion in the hospital inpatient and hospital outpatient settings compared to the cost of nonoperative care in the same patients. the cost differential to the commercial insurer (that is, difference in total insurance payments) was estimated by subtracting the cost of treating patients with mis si joint fusion from the cost of nonoperative care among commercial insurance beneficiaries. these sources include truven health marketscan (truven health analytics inc., ann arbor, mi, usa) data, premier s perspective comparative database (charlotte, nc, usa) data, the published literature, and clinical expert judgment. the costs included in the analysis were medical treatments, follow - up care, diagnostic tests, and retail pharmacy pain medication. the base - case analysis simulated the cost differential over a period of 3 years. this time period was selected based on the international society for pharmacoeconomics and outcomes research (ispor) task force recommendation of a 1- to 5-year time horizon for budget impact analyses for the united states.25 furthermore, a 3-year time horizon was selected to correspond with the available 3-year truven health commercial payer data to avoid extrapolation assumptions in the base - case analysis. outcomes were discounted at 3.0% per annum and are reported in 2012 usd. as previously noted, the assumptions described below are similar to those in the previously published economic model among the us medicare population.24 the primary assumptions are repeated herein, with relevant adaptations for the us commercial payer population : 1) the base - case analysis applies only to commercially insured patients in the us who suffer from chronic lbp due to si joint disruption and degenerative sacroiliitis and who are eligible for mis ; 2) this analysis applies to unilateral mis procedures performed in the hospital inpatient or hospital outpatient settings ; 3) mis patients who were classified as clinical failures undergo additional treatment, as described in table 1, where mis treatment failure was defined as having one or more of the following : implant failure, loosening, and/or malpositioning ; failure to relieve pain requiring repeat intervention ; and/or infection requiring reoperation ; 4) mis patients who were classified as clinical successes incur minimal additional medical resources, such as a reduced class of pain medications or a reduced dose ; 5) late complications of mis such as infection or loosening requiring revision were reflected in the 1-year treatment failure rate for mis ; 6) the health - related quality - of - life (hrqol) effects of mis and nonoperative care have not been included in the present analysis ; 7) the indirect costs associated with lost productivity and intangible costs of pain and suffering related to treatment morbidity have not been included in the present analysis ; and 8) the analysis assumed that a single cohort of patients were followed over several years with no new patients entering or leaving the cohort in subsequent years. not all patients with si joint pain and dysfunction necessarily have chronic pain and dysfunction despite medical intervention. however, it remains unknown how many patients truly seek care as little data exist on the effectiveness of nonoperative treatment. to estimate the population size, we assumed the percentage of si joint disruption patients who experience chronic pain despite medical treatment strategies is 50%. further, not all patients with si joint pain and dysfunction are candidates for surgery. because illness precludes some patients from general anesthesia the medical resource utilization and costs associated with nonoperative care was sourced from a previously published health insurance claims data analysis using the truven health marketscan database.11,26 in this us commercial payer population (n=78,533), the mean age was 45.2 years (sd [standard deviation ] 12.6) and approximately two - thirds (63.7%) were female. the most common diagnoses were sacroiliac subluxation (33.9%), followed by sacroiliitis (25.7%), and disorders of the sacrum (25.0%). these data represent commercial insurance payments (including retail pharmacy), which increased year - over - year. the cumulative commercial payer costs of beneficiaries with si joint disruption and/or degenerative sacroiliitis at 1, 2, and 3 years were $ 6,418, $ 11,540, and $ 16,789 per patient, respectively (inflated from 2011 to 2012 usd using the medical care component of the consumer price index).27 in the subgroup of patients who underwent lumbar spinal fusion (0.6%), the cumulative commercial payer costs at 1, 2, and 3 years were $ 37,456, $ 62,104, and $ 95,081 per patient, respectively (2012 usd). in the subgroup of patients who did not undergo lumbar spinal fusion (99.4%), the cumulative commercial payer costs at 1, 2, and 3 years were $ 6,246, $ 11,259, and $ 16,354 per patient, respectively (2012 usd). the sources of parameter estimates are shown in table 1 and include the premier database and medicare claims data. previously, 50 patients treated with mis (ifuse implant system ; si - bone, inc.)28 experienced early and sustained clinically significant improvements in hrqol (seven of nine domains) at 12-month follow - up.29 at a mean follow - up of 40 months post - implant, the majority (82%) had a > 2 point change in pain score,20 which is the criteria for minimal clinically important difference.29 similarly, a clinically significant improvement was observed in all but one patient at 1-year follow - up in a retrospective analysis of 40 patients with mis treatment using the same device.21 thus, an 82% 1-year treatment success rate for mis was assumed for the economic model. sacroiliac joint fusion with mis is performed in both the hospital inpatient (84%) and hospital outpatient (16%) settings.30 the mis index stay was defined as the hospital stay during which the patient underwent the mis si joint fusion. the cost of the mis index stay was sourced from the premier database, which contains a descriptor field that identifies a mis si joint fusion device (table 2). the cost of the mis index stay reflects hospital costs during the stay in which a unilateral mis si joint fusion procedure (with the ifuse implant system in particular) was performed between january 2010 and february 2013 for patients with commercial insurance. the mis index stay costs include costs associated with managing clinical, device - related, or procedure - related events that occurred during the index stay or within the assumed 90-day global period. global periods are typically negotiated with commercial payers on a facility - by - facility basis. mis procedures with clinical, device - related, or procedure - related events following the index stay and 90-day global period yet during year 1 are reflected in the costs associated with mis revisions or other subsequent treatments such as lumbar spinal fusion or nonoperative care. among commercially insured patients, the mean costs of hospital inpatient and hospital outpatient mis si joint fusion procedures (from a total of eleven sites) were estimated to be $ 18,710 (n=24) and $ 18,580 (n=9), respectively (2012 usd). these figures represent the actual costs for the hospital to provide the care to the patients from a hospital cost - accounting perspective and, therefore, do not reflect the cost to the commercial payer via insurance payments. to inflate hospital - based costs to commercial insurance payments, these figures were multiplied by 1.25 based on recent publications reporting the relationship between us medicare fee - for - service payments and hospital costs for orthopedic procedures.31,32 the medicare professional fee for the mis procedure ($ 1,033.38) was based on the 2012 payment for current procedural terminology code 27280 (arthrodesis, sacroiliac joint including obtaining graft);33 it was then multiplied by 1.25 based on the 2011 medicare payment advisory commission report to congress, which reports the relationship between medicare and commercial payer professional fees.34 the medical resource use associated with follow - up care for mis si joint fusion (including pain medications) was sourced from ackerman,24 with relevant adaptations for the commercial payer population (table 1). given that current procedural terminology global periods are negotiated with commercial payers on a facility - by - facility basis, two physician office visits in year 1 were assumed to be included under the postsurgical global period and would not incur additional cost, according to guidance and regulations issued by centers for medicare and medicaid services.35,36 follow - up costs were again multiplied by 1.25 to reflect commercial insurance payments.31,32 similar to a previously described economic model that compares costs of nonoperative care to mis among medicare beneficiaries,24 sensitivity analyses were performed in the present commercial payer analysis to determine the consequences of making alternative assumptions for model parameters, including : the inclusion of icd-9-cm code 721.3 (lumbosacral spondylosis) ; the setting of care (hospital inpatient versus hospital outpatient) ; the durability of the mis treatment success rate at year 1 (inclusive of the percentage of mis procedures with clinical, device - related, or procedure - related events) ; the distribution of subsequent treatments for mis failures ; the mis index stay costs ; the multiplier to convert hospital costs for the mis index stay to estimated commercial insurer payments ; the percentage of patients with lumbar spinal fusions performed within 1 year before receiving a diagnosis of si joint disruption and/or degenerative sacroiliitis;37 the time horizon ; and the discount rate for extrapolation. the robustness of the model results was assessed by varying the model inputs over plausible ranges to reflect realistic scenarios. for the sensitivity analysis conducted on the time horizon of the model, assumptions for extrapolation specifically, the cumulative cost of nonoperative care was assumed to increase linearly from year 4 to year 10. the ongoing costs associated with mis in year 4 to year 10 of the economic model were assumed to be the costs of pain medications and continued nonoperative care among mis treatment failures ; these ongoing costs were assumed to remain constant over time. in addition, two threshold analyses were performed : 1) to estimate at what year cost neutrality was achieved following the mis index stay ; and 2) to estimate the mis index stay commercial insurer payment that results in cost neutrality for the overall group by year following the mis index stay. cost neutrality is achieved when the cost of nonoperative care equals the cost of mis. of note, for the base - case analysis, we adjusted the commercial payer population size to reflect patients who suffer from chronic lbp due to si joint disruption and degenerative sacroiliitis who are eligible for mis. sensitivity analyses were performed for the percentage of patients with chronic pain and the percentage of patients who are eligible for mis surgery. as previously noted, the assumptions described below are similar to those in the previously published economic model among the us medicare population.24 the primary assumptions are repeated herein, with relevant adaptations for the us commercial payer population : 1) the base - case analysis applies only to commercially insured patients in the us who suffer from chronic lbp due to si joint disruption and degenerative sacroiliitis and who are eligible for mis ; 2) this analysis applies to unilateral mis procedures performed in the hospital inpatient or hospital outpatient settings ; 3) mis patients who were classified as clinical failures undergo additional treatment, as described in table 1, where mis treatment failure was defined as having one or more of the following : implant failure, loosening, and/or malpositioning ; failure to relieve pain requiring repeat intervention ; and/or infection requiring reoperation ; 4) mis patients who were classified as clinical successes incur minimal additional medical resources, such as a reduced class of pain medications or a reduced dose ; 5) late complications of mis such as infection or loosening requiring revision were reflected in the 1-year treatment failure rate for mis ; 6) the health - related quality - of - life (hrqol) effects of mis and nonoperative care have not been included in the present analysis ; 7) the indirect costs associated with lost productivity and intangible costs of pain and suffering related to treatment morbidity have not been included in the present analysis ; and 8) the analysis assumed that a single cohort of patients were followed over several years with no new patients entering or leaving the cohort in subsequent years. not all patients with si joint pain and dysfunction necessarily have chronic pain and dysfunction despite medical intervention. however, it remains unknown how many patients truly seek care as little data exist on the effectiveness of nonoperative treatment. to estimate the population size, we assumed the percentage of si joint disruption patients who experience chronic pain despite medical treatment strategies is 50%. further, not all patients with si joint pain and dysfunction are candidates for surgery. because illness precludes some patients from general anesthesia, we have assumed that 95% of patients are eligible for mis. the medical resource utilization and costs associated with nonoperative care was sourced from a previously published health insurance claims data analysis using the truven health marketscan database.11,26 in this us commercial payer population (n=78,533), the mean age was 45.2 years (sd [standard deviation ] 12.6) and approximately two - thirds (63.7%) were female. the most common diagnoses were sacroiliac subluxation (33.9%), followed by sacroiliitis (25.7%), and disorders of the sacrum (25.0%). these data represent commercial insurance payments (including retail pharmacy), which increased year - over - year. the cumulative commercial payer costs of beneficiaries with si joint disruption and/or degenerative sacroiliitis at 1, 2, and 3 years were $ 6,418, $ 11,540, and $ 16,789 per patient, respectively (inflated from 2011 to 2012 usd using the medical care component of the consumer price index).27 in the subgroup of patients who underwent lumbar spinal fusion (0.6%), the cumulative commercial payer costs at 1, 2, and 3 years were $ 37,456, $ 62,104, and $ 95,081 per patient, respectively (2012 usd). in the subgroup of patients who did not undergo lumbar spinal fusion (99.4%), the cumulative commercial payer costs at 1, 2, and 3 years were $ 6,246, $ 11,259, and $ 16,354 per patient, respectively (2012 usd). the sources of parameter estimates are shown in table 1 and include the premier database and medicare claims data. previously, 50 patients treated with mis (ifuse implant system ; si - bone, inc.)28 experienced early and sustained clinically significant improvements in hrqol (seven of nine domains) at 12-month follow - up.29 at a mean follow - up of 40 months post - implant, the majority (82%) had a > 2 point change in pain score,20 which is the criteria for minimal clinically important difference.29 similarly, a clinically significant improvement was observed in all but one patient at 1-year follow - up in a retrospective analysis of 40 patients with mis treatment using the same device.21 thus, an 82% 1-year treatment success rate for mis was assumed for the economic model. sacroiliac joint fusion with mis is performed in both the hospital inpatient (84%) and hospital outpatient (16%) settings.30 the mis index stay was defined as the hospital stay during which the patient underwent the mis si joint fusion. the cost of the mis index stay was sourced from the premier database, which contains a descriptor field that identifies a mis si joint fusion device (table 2). the cost of the mis index stay reflects hospital costs during the stay in which a unilateral mis si joint fusion procedure (with the ifuse implant system in particular) was performed between january 2010 and february 2013 for patients with commercial insurance. the mis index stay costs include costs associated with managing clinical, device - related, or procedure - related events that occurred during the index stay or within the assumed 90-day global period. global periods are typically negotiated with commercial payers on a facility - by - facility basis. mis procedures with clinical, device - related, or procedure - related events following the index stay and 90-day global period yet during year 1 are reflected in the costs associated with mis revisions or other subsequent treatments such as lumbar spinal fusion or nonoperative care. among commercially insured patients, the mean costs of hospital inpatient and hospital outpatient mis si joint fusion procedures (from a total of eleven sites) were estimated to be $ 18,710 (n=24) and $ 18,580 (n=9), respectively (2012 usd). these figures represent the actual costs for the hospital to provide the care to the patients from a hospital cost - accounting perspective and, therefore, do not reflect the cost to the commercial payer via insurance payments. to inflate hospital - based costs to commercial insurance payments, these figures were multiplied by 1.25 based on recent publications reporting the relationship between us medicare fee - for - service payments and hospital costs for orthopedic procedures.31,32 the medicare professional fee for the mis procedure ($ 1,033.38) was based on the 2012 payment for current procedural terminology code 27280 (arthrodesis, sacroiliac joint including obtaining graft);33 it was then multiplied by 1.25 based on the 2011 medicare payment advisory commission report to congress, which reports the relationship between medicare and commercial payer professional fees.34 the medical resource use associated with follow - up care for mis si joint fusion (including pain medications) was sourced from ackerman,24 with relevant adaptations for the commercial payer population (table 1). given that current procedural terminology global periods are negotiated with commercial payers on a facility - by - facility basis, two physician office visits in year 1 were assumed to be included under the postsurgical global period and would not incur additional cost, according to guidance and regulations issued by centers for medicare and medicaid services.35,36 follow - up costs were again multiplied by 1.25 to reflect commercial insurance payments.31,32 similar to a previously described economic model that compares costs of nonoperative care to mis among medicare beneficiaries,24 sensitivity analyses were performed in the present commercial payer analysis to determine the consequences of making alternative assumptions for model parameters, including : the inclusion of icd-9-cm code 721.3 (lumbosacral spondylosis) ; the setting of care (hospital inpatient versus hospital outpatient) ; the durability of the mis treatment success rate at year 1 (inclusive of the percentage of mis procedures with clinical, device - related, or procedure - related events) ; the distribution of subsequent treatments for mis failures ; the mis index stay costs ; the multiplier to convert hospital costs for the mis index stay to estimated commercial insurer payments ; the percentage of patients with lumbar spinal fusions performed within 1 year before receiving a diagnosis of si joint disruption and/or degenerative sacroiliitis;37 the time horizon ; and the discount rate for extrapolation. the robustness of the model results was assessed by varying the model inputs over plausible ranges to reflect realistic scenarios. for the sensitivity analysis conducted on the time horizon of the model, assumptions for extrapolation specifically, the cumulative cost of nonoperative care was assumed to increase linearly from year 4 to year 10. the ongoing costs associated with mis in year 4 to year 10 of the economic model were assumed to be the costs of pain medications and continued nonoperative care among mis treatment failures ; these ongoing costs were assumed to remain constant over time. in addition, two threshold analyses were performed : 1) to estimate at what year cost neutrality was achieved following the mis index stay ; and 2) to estimate the mis index stay commercial insurer payment that results in cost neutrality for the overall group by year following the mis index stay. cost neutrality is achieved when the cost of nonoperative care equals the cost of mis. of note, for the base - case analysis, we adjusted the commercial payer population size to reflect patients who suffer from chronic lbp due to si joint disruption and degenerative sacroiliitis who are eligible for mis. sensitivity analyses were performed for the percentage of patients with chronic pain and the percentage of patients who are eligible for mis surgery. in the overall group, the estimated cumulative 3-year commercial insurance payments for patients treated with nonoperative care were $ 16,339 per patient compared to $ 30,884 per patient for mis, resulting in a per - patient differential of $ 14,545 as shown in table 3. for patients with lumbar spinal fusion (n=553), the per - patient differential was $ 54,817, due to higher cumulative 3-year costs for nonoperative care of $ 92,470 per patient compared to cumulative 3-year costs for mis at $ 37,653 per patient. for patients without lumbar spinal fusion (99.4% of the sample population), the per - patient differential of $ 14,931 was similar to that of the overall group. sensitivity analyses were performed to address uncertainty in the economic model and to determine which variables substantially affected the results. when key model parameters were varied, such as the durability of mis treatment success at year 1 and the percentage of mis procedures with clinical, device - related, or procedure - related events, the costs fell within a relatively narrow range, suggesting that the economic model is robust to plausible parameter values based on realistic clinical scenarios. as expected, the results were sensitive to extending the time horizon, modifying the mis index stay costs, and changing the multiplier to convert hospital costs for the mis index stay to estimated commercial insurance payments (table 4 and figure 1). the results were less sensitive to changes in the distribution of subsequent treatments for mis failures, setting of care, and discount rate. in the base - case analysis that evaluated cumulative 3-year costs, the differential in commercial insurance payments (calculated as cost of nonoperative care cost of mis) was $ 14,545 per patient whereas, in the sensitivity analysis that estimated cumulative 5-year costs, the differential was $ 6,137 per patient (table 3). a threshold analysis was performed to estimate at what year cost neutrality was achieved following the mis index stay. by extending the time horizon, mis treatment achieved cost neutrality in the overall group at approximately 6 years (figure 2), whereby much of the costs for mis accrued in year 1, whereas the costs of nonoperative care accrued over time with 92% of up - front mis procedure costs being offset by year 5 (figure 3). for patients with lumbar spinal fusion, a threshold analysis also was performed to estimate the mis index stay commercial insurer payment that results in cost neutrality for the overall group by year following the mis index stay. the mis index stay was defined as the hospital stay in which the mis si joint fusion procedure was performed. the mis index stay commercial insurance payment that achieved cost neutrality at year 3 (the base - case time horizon) was $ 9,073, whereas the amount that achieved cost neutrality at year 5 (the ispor task force recommended time horizon for chronic conditions) was $ 17,333 (figure 4). sensitivity analyses were performed to address uncertainty in the economic model and to determine which variables substantially affected the results. when key model parameters were varied, such as the durability of mis treatment success at year 1 and the percentage of mis procedures with clinical, device - related, or procedure - related events, the costs fell within a relatively narrow range, suggesting that the economic model is robust to plausible parameter values based on realistic clinical scenarios. as expected, the results were sensitive to extending the time horizon, modifying the mis index stay costs, and changing the multiplier to convert hospital costs for the mis index stay to estimated commercial insurance payments (table 4 and figure 1). the results were less sensitive to changes in the distribution of subsequent treatments for mis failures, setting of care, and discount rate. in the base - case analysis that evaluated cumulative 3-year costs, the differential in commercial insurance payments (calculated as cost of nonoperative care cost of mis) was $ 14,545 per patient whereas, in the sensitivity analysis that estimated cumulative 5-year costs, the differential was $ 6,137 per patient (table 3). a threshold analysis was performed to estimate at what year cost neutrality was achieved following the mis index stay. by extending the time horizon, mis treatment achieved cost neutrality in the overall group at approximately 6 years (figure 2), whereby much of the costs for mis accrued in year 1, whereas the costs of nonoperative care accrued over time with 92% of up - front mis procedure costs being offset by year 5 (figure 3). for patients with lumbar spinal fusion, a threshold analysis also was performed to estimate the mis index stay commercial insurer payment that results in cost neutrality for the overall group by year following the mis index stay. the mis index stay was defined as the hospital stay in which the mis si joint fusion procedure was performed. the mis index stay commercial insurance payment that achieved cost neutrality at year 3 (the base - case time horizon) was $ 9,073, whereas the amount that achieved cost neutrality at year 5 (the ispor task force recommended time horizon for chronic conditions) was $ 17,333 (figure 4). us commercial payers have traditionally focused on 1- to 3-year timeframes for economic models, which correspond to their budget and contracting cycles. however, the information gleaned from economic models extends beyond forecasting the fiscal impact of a new medical technology on health plan budgets.38 rather, economic models facilitate : 1) exploring the extent to which costs of a new intervention may be offset by reductions in other medical costs ; and 2) identifying subpopulations that benefit most.38 this study demonstrates that cumulative 3-year costs associated with mis si joint fusion are higher than with nonoperative care where cost neutrality is achieved at approximately 6 years in the overall group and during year 1 for patients with lumbar spinal fusion. the base - case time horizon of 3 years was chosen based on available truven health commercial payer data in addition to the ispor task force guidelines on conducting budget impact analyses, which recommend a 1- to 5-year time horizon, with longer and shorter time horizons included to provide more complete information of budgetary consequences.25 for chronic conditions with longer - term consequences, it has been argued that employers and private health insurers should be interested in time horizons longer than 3 years,38 particularly when one considers conditions that affect working age individuals, such as si joint disruption, because productivity gains may offset increased health care expenditures.8,25,39 several recent economic models evaluating treatments for chronic conditions, including chronic low back pain, from the us private payer perspective have included longer timeframes, such as a lifetime.40,41 mis costs accrue largely in year 1, whereas the costs of nonoperative care accrue over time so that, as noted by the ispor task force, a longer time horizon is oftentimes required to capture the cost offsets from new interventions for chronic health conditions such as mis si joint fusion. importantly, sensitivity analyses were conducted by varying the time horizon from 1 to 10 years and are shown annually to provide the most complete and useful set of results. as shown in figures 2 and 3, longer time horizons may be required to capture the costs and benefits that accrue over time due to ongoing costs associated with chronic conditions. in addition, a threshold analysis was conducted to estimate the commercial insurance payment for the mis index stay that results in cost - neutrality over a 5-year time horizon, and the values were reported by year (figure 4). the mis index stay commercial insurance payment that achieved cost neutrality at year 5 (the ispor task force recommended time horizon for chronic conditions) was $ 17,333, which is similar to the hospital inpatient mis index stay costs among medicare fee - for - service beneficiaries of $ 17,344 from the premier database. the mean age in the truven health commercial payer data used here was 45.2 years (sd = 12.6) and approximately two - thirds of the population (63.7%) were female.11 while some si joint disruption patients are of child bearing age, the effect of mis si joint fusion on vaginal delivery and whether caesarean would be needed is not known. approximately 61% of covered workers in the us are in a self - insured health plan.42,43 in response to the patient protection and affordable care act, health insurers are predicting an increase in self - insured health insurance plans by us employers. in addition to direct medical costs, patients are subject to lost wages, and employers are subject to the indirect costs of lost productivity and lost time from work (for example, due to recurring nonoperative interventions), which have not been included in the present analysis. the substantial absenteeism, lost productivity, and lost wages in this working - age population5,6 are particularly relevant to employers given that productivity gains may offset increased health care expenditures.8,39 further, the average duration of employment at a given company in the us is 4.6 years,44 which makes a longer (eg, 5-year) time horizon particularly relevant when considering treatment of chronic conditions such as si joint disruption. in the economic analysis, mis costs accrued largely in year 1, whereas the costs of nonoperative care accrued over time with 59% and 92% of initial mis procedure costs being offset by year 3 and year 5, respectively (figure 3). as noted earlier, the hrqol effects of mis treatment and nonoperative care early and sustained clinical improvement through 1-year follow - up were reported among mis patients in the following hrqol domains : pain ; pain effect on social interest ; sleep ; activities (light, moderate, and vigorous) ; and overall happiness.20 in addition, duhon reported improvements in hrqol (6.7 point improvement in short form 36, p=0.003) at 6-months follow - up with mis.45 compared to nonoperative care, long - term costs of mis may be lower and hrqol improvements of mis may be greater due to the need for continued nonoperative therapy over time.24 because of the difficulty in diagnosing si pathology, lumbar spinal fusion is known to be performed on patients who actually have si pathology. in the present analysis, less than 1% of commercial payer patients underwent lumbar spinal fusion in the year before or 3 years after receipt of a si joint disruption diagnosis. in contrast, 3.7% of medicare patients diagnosed with si joint disruption and/or degenerative sacroiliitis underwent lumbar spinal fusion within 1 year before or 5 years after diagnosis.26 previous lumbar spinal fusion has been reported in 18% and 48% of patients treated with mis si joint fusion (mean ages 54 years and 58 years, respectively),20,21 suggesting that the 4-year window based on the truven health data that informed the present analysis may have been too short to completely capture the patients who underwent lumbar spinal fusion before or after mis si joint fusion. first, the mis treatment success rate at 1 year (82%) is based on two retrospective studies with 50 and 40 consecutive patients, respectively.20,21 in the first retrospective study by rudolf, 82% of patients reached minimal clinically important difference in pain score at a mean follow - up of 40 months post - implant. these patients also experienced improvements in seven of nine hrqol domains at 1-year follow - up ; the improvements were both statistically significant and clinically relevant despite the small sample size (n=50).20 the same mis system was evaluated in a retrospective study of 40 patients ; 39 out of 40 patients achieved clinically significant improvements at 1-year follow - up.21 in the rudolf study, half of perioperative complications were minor (mild hematoma at the incision site and superficial cellulitis) and required little to no intervention.20 the other perioperative complications (n=5) were major, with three patients requiring retraction of a misplaced implant in the operating room, one patient experiencing a nondisplaced fracture that healed without intervention, and one patient experiencing a deep soft tissue wound infection that resolved with a course of intravenous antibiotics. the 20% rate of perioperative complications resembles previously published rates.20 the 50-patient cohort experienced a revision rate of 8% after 3 years,20 which was also comparable to revision rates for other mis treatments (8%15%).16,18,4649 a recent post - market complaints database analysis for a new mis system reported a complication rate of 3.8% (204 of 5,319 patients) over a 4-year period.19 in that study, 96 revision surgeries (94 patients [1.8% ]) were performed at a median follow - up time of 4 months. a total of 56 revisions were performed in the early postoperative period due to either a symptomatic malpositioned implant (n=46) or an improperly sized implant in an asymptomatic patient (n=10).19 late revisions were primarily to treat symptom recurrence (n=34).19 preliminary results of a prospective, single - arm, multicenter study (n=26) further support the effectiveness data described above.45 at 6-months post - implant, significant improvements were noted in pain (49-point improvement in visual analog pain scale score, p<0.0001) and disability (15.8 point improvement in oswestry disability index, p<0.0001).45 similar to the previously published economic model among medicare beneficiaries,24 we have defined mis treatment failure as having one or more of the following : implant failure, loosening, and/or malposition ; failure to relieve pain requiring repeat intervention ; and infection requiring reoperations. the findings discussed above1921 suggest that the 82% 1-year mis treatment success rate is reasonable as a base - case value for the economic model. with that being said, the lasting effects of mis treatment on symptoms of si joint disruption can only be estimated because durability data for mis are only available for up to 4 years.19 therefore, a mis failure rate of 18% within the first 12 months has been incorporated in the economic model based on the reported clinical experience to date. recognizing the small sample sizes in the rudolf 20 and sachs21 studies (50 and 40 patients, respectively) and limited longer - term durability data, we varied the 1-year mis treatment success rate from 72% to 92% in a sensitivity analysis (figure 1). of note, modifying the mis treatment success rate at 1 year did not affect the results as much as other factors such as the time horizon. in the economic model, the multiplier to convert the mis index stay costs to commercial insurer payments was set at 1.25,31,32 acknowledging that there was substantial variability in the premier data for estimating the mis index stay costs and that the sample size was limited. the uncertainty in the relationship between mis index stay costs and commercial insurance payments was addressed by performing a sensitivity analysis in which the multiplier was varied from 1.0 to 1.5. furthermore, given that commercial insurer payment changes dynamically with adjustments in medicare payments, a sensitivity analysis was performed by using premier data mis index stay costs based on hospital inpatient costs of $ 17,344 for medicare fee - for - service beneficiaries, which is similar to the commercially - insured hospital inpatient and outpatient mis index stay costs of $ 18,710 and $ 18,580, respectively ; as such, the results remained similar. first, the mis treatment success rate at 1 year (82%) is based on two retrospective studies with 50 and 40 consecutive patients, respectively.20,21 in the first retrospective study by rudolf, 82% of patients reached minimal clinically important difference in pain score at a mean follow - up of 40 months post - implant. these patients also experienced improvements in seven of nine hrqol domains at 1-year follow - up ; the improvements were both statistically significant and clinically relevant despite the small sample size (n=50).20 the same mis system was evaluated in a retrospective study of 40 patients ; 39 out of 40 patients achieved clinically significant improvements at 1-year follow - up.21 in the rudolf study, half of perioperative complications were minor (mild hematoma at the incision site and superficial cellulitis) and required little to no intervention.20 the other perioperative complications (n=5) were major, with three patients requiring retraction of a misplaced implant in the operating room, one patient experiencing a nondisplaced fracture that healed without intervention, and one patient experiencing a deep soft tissue wound infection that resolved with a course of intravenous antibiotics. the 20% rate of perioperative complications resembles previously published rates.20 the 50-patient cohort experienced a revision rate of 8% after 3 years,20 which was also comparable to revision rates for other mis treatments (8%15%).16,18,4649 a recent post - market complaints database analysis for a new mis system reported a complication rate of 3.8% (204 of 5,319 patients) over a 4-year period.19 in that study, 96 revision surgeries (94 patients [1.8% ]) were performed at a median follow - up time of 4 months. a total of 56 revisions were performed in the early postoperative period due to either a symptomatic malpositioned implant (n=46) or an improperly sized implant in an asymptomatic patient (n=10).19 late revisions were primarily to treat symptom recurrence (n=34).19 preliminary results of a prospective, single - arm, multicenter study (n=26) further support the effectiveness data described above.45 at 6-months post - implant, significant improvements were noted in pain (49-point improvement in visual analog pain scale score, p<0.0001) and disability (15.8 point improvement in oswestry disability index, p<0.0001).45 similar to the previously published economic model among medicare beneficiaries,24 we have defined mis treatment failure as having one or more of the following : implant failure, loosening, and/or malposition ; failure to relieve pain requiring repeat intervention ; and infection requiring reoperations. the findings discussed above1921 suggest that the 82% 1-year mis treatment success rate is reasonable as a base - case value for the economic model. with that being said, the lasting effects of mis treatment on symptoms of si joint disruption can only be estimated because durability data for mis are only available for up to 4 years.19 therefore, a mis failure rate of 18% within the first 12 months has been incorporated in the economic model based on the reported clinical experience to date. recognizing the small sample sizes in the rudolf 20 and sachs21 studies (50 and 40 patients, respectively) and limited longer - term durability data, we varied the 1-year mis treatment success rate from 72% to 92% in a sensitivity analysis (figure 1). of note, modifying the mis treatment success rate at 1 year did not affect the results as much as other factors such as the time horizon. in the economic model, the multiplier to convert the mis index stay costs to commercial insurer payments was set at 1.25,31,32 acknowledging that there was substantial variability in the premier data for estimating the mis index stay costs and that the sample size was limited. the uncertainty in the relationship between mis index stay costs and commercial insurance payments was addressed by performing a sensitivity analysis in which the multiplier was varied from 1.0 to 1.5. furthermore, given that commercial insurer payment changes dynamically with adjustments in medicare payments, a sensitivity analysis was performed by using premier data mis index stay costs based on hospital inpatient costs of $ 17,344 for medicare fee - for - service beneficiaries, which is similar to the commercially - insured hospital inpatient and outpatient mis index stay costs of $ 18,710 and $ 18,580, respectively ; as such, the results remained similar. cost offsets from new interventions for chronic health conditions such as mis si joint fusion accrue over time. despite the higher up - front mis si joint fusion procedure costs, the costs of mis were largely offset by decreased nonoperative care costs over a 5-year time horizon from a us commercial payer perspective. this is particularly relevant to self - insured employers in light of the substantial absenteeism, lost productivity, and lost wages in this working - age population, whereby productivity gains may offset increased health care expenditures.8,39 optimizing effective resource use in both nonoperative and operative patients will facilitate cost - effective health care delivery and improved hrqol. the impact of si joint disruption and degenerative sacroiliitis on direct and indirect costs to commercial insurers, health plan beneficiaries, and employers warrants further consideration. | introductionlow back pain is common and treatment costly with substantial lost productivity and lost wages in the working - age population. chronic low back pain originating in the sacroiliac (si) joint (15%30% of cases) is commonly treated with nonoperative care, but new minimally invasive surgery (mis) options are also effective in treating si joint disruption. we assessed whether the higher initial mis si joint fusion procedure costs were offset by decreased nonoperative care costs from a us commercial payer perspective.methodsan economic model compared the costs of treating si joint disruption with either mis si joint fusion or continued nonoperative care. nonoperative care costs (diagnostic testing, treatment, follow - up, and retail pharmacy pain medication) were from a retrospective study of truven health marketscan data. mis fusion costs were based on the premier s perspective comparative database and professional fees on 2012 medicare payment for current procedural terminology code 27280.resultsthe cumulative 3-year (base - case analysis) and 5-year (sensitivity analysis) differentials in commercial insurance payments (cost of nonoperative care minus cost of mis) were $ 14,545 and $ 6,137 per patient, respectively (2012 us dollars). cost neutrality was achieved at 6 years ; mis costs accrued largely in year 1 whereas nonoperative care costs accrued over time with 92% of up front mis procedure costs offset by year 5. for patients with lumbar spinal fusion, cost neutrality was achieved in year 1.conclusioncost offsets from new interventions for chronic conditions such as mis si joint fusion accrue over time. higher initial procedure costs for mis were largely offset by decreased nonoperative care costs over a 5-year time horizon. optimizing effective resource use in both nonoperative and operative patients will facilitate cost - effective health care delivery. the impact of si joint disruption on direct and indirect costs to commercial insurers, health plan beneficiaries, and employers warrants further consideration. |
this study compared susceptibility to respiratory morbidity in a cohort of 9-year - old children exposed congenitally and postnatally to environmental tobacco smoke (ets) to susceptibility in a cohort of unexposed children. the epidemiologic study included 1129 children : 594 boys and 535 girls attending the second grade of grammar schools in krakw, poland. we found strong evidence that children exposed to ets in their homes were more susceptible to acute respiratory tract illnesses than unexposed children. a dose - response relationship between degree of exposure [for lower ets exposure, odds ratio (or) = 1.32 ; for higher ets exposure, or = 1.74 ] supports a causal explanation for the association observed. the significant trend of increased risk of respiratory infections due to ets level in nonatopic children whose mothers did not smoke cigarettes during pregnancy suggests a direct effect of ets exposure on the child 's respiratory health. ets combined with allergy nearly tripled the risk of acute respiratory tract illness (or = 3.39 ; 95% ci, 1.93 - 5.93), and maternal smoking during pregnancy had a modifying effect on the risk of respiratory illnesses due to ets after accounting for atopy. the stronger effect of ets in atopic children and in those whose mothers smoked during pregnancy may be result of biologic interaction of endogenous and environmental factors. the results of this study are of relevance to public health policy, as children with higher risk of respiratory infections may be more susceptible to environmental hazards later in adolescence or in adulthood. respiratory infections also increase demands for medical interventions in terms of outpatient services and hospital administrations. in addition, respiratory illnesses cause missed school days, and caring for a sick child may lead to absenteeism from work.imagesfigure 1.figure 2.figure 3.figure 4. |
|
a 31-year - old woman presented with a 6-month history of diarrhea, hyperglycemia requiring insulin, weight loss and a 2-month history of icterus and jaundice. laboratory evaluation revealed elevated liver function tests including alanine aminotransferase (alt) of 456 iu / l, aspartate aminotransferase (ast) of 233 iu / l, alkaline phosphatase of 791 iu / l, and total bilirubin of 4.4 mg / dl. abdominal ultrasound showed a pancreatic head mass measuring 5 5 5.5 cm concerning for malignancy. computed tomography (ct) of the abdomen confirmed a large pancreatic head mass measuring 5.7 5.7 6.5 cm obstructing both the pancreatic and common bile ducts. the mass also caused impingement of the superior mesenteric vein (smv) and contacted the superior mesenteric artery (sma). no liver lesions were identified, although several portocaval lymph nodes were noted to be borderline enlarged. initial attempt to obtain a tissue diagnosis was performed at the time of endoscopic placement of a biliary stent and brushings revealed only reactive ductal epithelium, which was negative for malignancy. she subsequently underwent an endoscopic ultrasound - guided fine needle aspiration which confirmed a pancreatic neuroendocrine tumor (pnet) with neoplastic cells positive for synaptophysin and chromogranin. serum chromogranin a level was noted to be elevated at 438 mg / ml (nl < 225 ng / ml). given the absence of evidence for distant disease, the patient was offered surgery and underwent an exploratory laparotomy. intraoperative visualization of the tumor revealed more extensive vessel involvement than appreciated by ct imaging. there was encasement of the smv with tumor growth around numerous branches of the sma and extension to the junction of the right renal vein and ivc. based on this appearance, an attempt at resection was aborted as a resection with smv reconstruction was not felt to be possible. her postoperative course was complicated by a pulmonary embolism, which was attributed to recent surgery and underlying malignancy. standard options including octreotide, sunitinib, and everolimus were considered and offered to the patient. however, given the patient 's age and disease limited to primary site, it was agreed that the goal of therapy, in this case, should be to achieve tumor shrinkage sufficient to allow a repeat attempt at curative surgical resection. she ultimately received 8 cycles which she tolerated well while maintaining an excellent performance status. toxicity was limited to one episode of emesis with each of the first two cycles. interval imaging done every 2 cycles showed continuous response to therapy with the tumor ultimately measuring 1.9 3.8 cm after cycle 8 (fig. although there appeared to be persistent abutment with the smv, there was resolution of impingement of the vein and importantly a clear fat plane was seen around the sma. based on this significant response to chemotherapy, the patient was offered a second attempt at surgical resection 9 months after her initial surgical exploration. her tumor was successfully resected without smv resection or reconstruction and final pathology revealed a 2.0 2.5 2.2 cm mass confined to the pancreas with negative margins and 16 lymph nodes resected all negative for metastatic spread. she did well postoperatively with resolution of hyperglycemia allowing discontinuation of insulin and only occasional diarrhea due to pancreatic insufficiency which improved with pancreatic enzyme replacement. three months after surgery, she remains free of disease recurrence by imaging and has had normalization of serum chromogranin a level to 206 ng / ml. pnet is a relatively uncommon tumor that arises in the endocrine cells of the pancreas and is also referred to as pancreatic islet cell tumor. there is variability in presentation partly dependent on if it is a functional (hormone - secreting) or nonfunctional tumor. functional tumors can produce symptoms related to excess production of hormones such as gastrin, insulin, and glucagon. the majority of functional tumors are benign but are less prevalent than nonfunctional tumors which are more likely to be malignant. nonfunctioning tumors typically remain silent until they cause symptoms due to mass effect similar to pancreatic adenocarcinoma. the overall annual incidence of pnets from 1973 to 2000 was reported to be 0.22 cases per 100,000 with a yearly trend of increased incidence. a more recent study confirms this trend with an annual incidence of 0.32 per 100,000 cases reported from 2000 to 2004. nevertheless, this remains a rare tumor which limits the opportunity to establish clinical trial - based evidence for standard therapy. the only standard option for advanced disease was a somatostatin analogue. for tumors that are localized with no evidence of distant spread, but are too advanced to surgically resect, there is no evidence to guide optimal management and therefore we are limited to extrapolating results obtained in the advanced metastatic disease setting. evidence for benefit beyond this was provided by a prospective, randomized placebo - controlled trial by the promid study group which reported an antiproliferative effect of octreotide lar on neuroendocrine midgut tumors. stable disease was achieved in 66.7% of patients in the octreotide lar group versus stable disease in 37.2% of patients in the placebo group with a median time to tumor progression of 14.3 months in the octreotide lar group and 6 months with the placebo group. definitive overall survival benefit was limited by crossover of patients in the placebo group to somatostatin analogue treatment at tumor progression. notably, this particular therapy does not achieve significant tumor regression. in our patient who was free of any symptoms and for whom the goal was to achieve tumor shrinkage, more recently, two new drugs, everolimus and sunitinib, have each been approved for treatment of advanced pnets. everolimus, a mammalian target of rapamycin (mtor) inhibitor, was shown to increase progression - free survival in a randomized, placebo - controlled trial. patients with advanced disease and radiologic evidence of disease progression were found to have an 11.4-month median progression - free survival with everolimus as compared to 5.4 months in the placebo group. analysis of secondary outcomes showed 5% of patients who received everolimus achieved a partial response by recist criteria. dose adjustments, either reductions or temporary interruptions, were necessary in 59% of patients and treatment discontinued in 13% due to adverse events. the most common drug - related adverse events reported were stomatitis, rashes, diarrhea and fatigue. everolimus was approved by the food and drug administration (fda) based on the above survival benefit and although it does not achieve a high rate of tumor shrinkage, it was considered an option in this patient. sunitinib is a multi - tyrosine kinase inhibitor which has also shown to have activity in patients with pnet. a randomized, double - blinded, placebo - controlled phase 3 trial was conducted and demonstrated that sunitinib improved progression - free survival when compared to placebo : median 11.4 months versus 5.5 months, respectively. in addition, there was a 9.3% tumor response rate with a median time to tumor response of 3.1 months in patients treated with sunitinib. the median duration of treatment with sunitinib was only 4.6 months with 22% of patients remaining on the study for over 1 year. the most common adverse events leading to discontinuation of the drug were fatigue, diarrhea and cardiac failure with dose - limiting toxicity from neutropenia and diarrhea. similar to everolimus, the survival benefit seen in this trial warrants consideration for a patient like ours but again, the < 10% partial response rate tempered our enthusiasm given our goal of down - staging her tumor. although both everolimus and sunitib provide benefit of increased progression - free survival, neither has been shown to achieve significant tumor shrinkage. numerous phase ii and multi - institutional trials have shown modest benefit with chemotherapeutic agents such as streptozocin, fluorouracil, doxorubicin, gemcitabine, oxaliplatin, temozolomide, thalidomide and capecitabine [7, 8 ]. the specific combination of capecitabine and tomozolomide has been shown in preclinical studies to have in vitro efficacy and clinical experience was reported in a retrospective study suggesting activity with this well - tolerated combination. in a study done at the moffitt cancer center, a cohort of 30 patients with pancreatic endocrine carcinomas were treated with oral capecitabine 750 mg / m twice daily for 14 days and oral temozolomide 200 mg / m daily for 5 days every 28 days with ondansetron given prior to each dose of temozolomide to decrease nausea. the radiographic response rate in patients with metastatic disease was 70% with a median progression - free survival of 18 months and median duration of radiographic response of 20 months. the median duration of treatment was 8 cycles, with a range from 3 to 23 cycles. the majority of side effects were grade 12 thrombocytopenia, hand - foot skin reaction and fatigue. our patient, with locally advanced disease, was treated with capecitabine and temozolomide for 8 total cycles with the goal of converting her disease to one that would be amenable to a curative surgical resection. she tolerated therapy well with minimal side effects and 9 months after initial exploratory surgery she ultimately underwent complete resection of a t2n0 tumor with 16 negative lymph nodes and negative margins. considering the relative rarity of pnets, there has undoubtedly been significant progress in the development of treatment options just in the past few years. everolimus and sunitinib provide options for agents that improve survival primarily through stabilization of disease but lack significant potential to cause tumor shrinkage relevant to locally advanced disease. chemotherapy with capecitabine and temozolomide appears to be a viable option with potential for a high rate of response that proved to be particularly valuable in our young patient and warrants consideration for clinical trial exploration as neoadjuvant therapy for locally advanced, unresectable pnets. | pancreatic neuroendocrine tumors (pnets) are relatively rare tumors that arise in the endocrine cells of the pancreas. historically, somatostatin analogues have been used in this disease primarily for symptom control and, to a limited extent, disease stability. more recently, sunitinib and everolimus have been approved for advanced stage pnets based on a survival benefit. however, both agents have a < 10% actual response rate and cause nontrivial side effect profiles that limit duration of therapy. in locally advanced disease, there is a paucity of data to support an optimal neoadjuvant approach with the expectation of down - staging to allow for curative resection. we describe in this case a young woman who was successfully down - staged using a chemotherapy regimen of capecitabine and temozolomide with minimal toxicity. |
cancer is one of the most common causes, which results in morbidity and mortality today, further, more than 10 million new cases and more than 6 million deaths occur each year worldwide. in india, oral squamous cell carcinoma (oscc) although tobacco and alcohol are the main etiologic factors in three - fourth of these cancers, the etiological factor in 1/4 of the cases remains unnoticed. there is growing evidence that human papilloma virus (hpv) may act as a cocarcinogen along with tobacco which eventually results in oral cancers. human papilloma virus are small, circular double stranded deoxyribonucleic acid (dna) viruses that belong to the papillomaviridae family. over 130 hpv types are known ; these are classified as low or high - risk, based on their association with cervical carcinoma. hpv transforms infected epithelial cells and causes defects in genes controlling apoptosis, cell cycle, and dna repair, thereby promoting tumorigenesis. the protein p16 is a cellular protein involved in cell cycle regulation. in normal cells, p16 protein is expressed in very low levels and is almost undetectable by ihc. due to the transforming activity of e7 oncogene, p16 is strongly expressed in tumor cells affected by hpv and may be easily detected by ihc. however, literature search revealed meager data exclusively correlating hpv and histological grades of oscc. hence, this study is focused on evaluating the expression of hpv in oscc and to correlate the association of hpv in histological grades of oscc using p16. a total of 30 formalin fixed paraffin embedded biopsied samples, histopathologically diagnosed as oscc were retrieved from the department of archival collection, m.s. serial sections of 4 m were taken, one section was subjected to h and e to ascertain the histological grades (modified broder 's grading system), while the consecutive sections were subjected to p16 ihc analysis. of the 30 cases, 10 cases were well differentiated oral squamous cell carcinoma (wdoscc), 10 cases were moderately differentiated oral squamous cell carcinoma (mdoscc) and the rest 10 cases were poorly differentiated oral squamous cell carcinoma (pdoscc). different grades of oscc and their sites / location procedure for p16 immunohistochemistry (ihc) - is elucidated in a flowchart 1 commercially available mouse monoclonal antibody for p16ink4a protein (biogenex, usa) was used. pll = poly l lysine, edta = ethylenediaminetetraacetic acid, h2o2 = hydrogen peroxide, igg = immunoglobulin g, dpx = dibutylphathalate xylene positive control slides of cervical carcinoma [figure 1a ] harboring hpv were taken to ascertain the validity of ihc kit and the accuracy of the technique. for negative control, the primary antibodies were omitted. the presence of brown precipitate at the site of cytoplasm, nucleus or both were indicative of p16 positive immunoreactivity regardless of staining intensity. the criteria given by opted to evaluate the p16 staining is delineated in table 2. (a) positive control slide of cervical cancer, (b) dispersed single cell staining in well - differentiated oral squamous cell carcinoma, (c) patchy staining in moderately differentiated oral squamous cell carcinoma, (d) diffuse staining in poorly differentiated oral squamous cell carcinoma, (e) no staining. kappa statistics of 0.900, revealed high agreement between the observers criteria for evaluating p16 staining the slides were examined by three pathologists using light microscope and the entire procedure was blinded to minimize the inter observer bias and the values were ascertained using kappa statistics. a total of 30 formalin fixed paraffin embedded biopsied samples, histopathologically diagnosed as oscc were retrieved from the department of archival collection, m.s. serial sections of 4 m were taken, one section was subjected to h and e to ascertain the histological grades (modified broder 's grading system), while the consecutive sections were subjected to p16 ihc analysis. of the 30 cases, 10 cases were well differentiated oral squamous cell carcinoma (wdoscc), 10 cases were moderately differentiated oral squamous cell carcinoma (mdoscc) and the rest 10 cases were poorly differentiated oral squamous cell carcinoma (pdoscc). different grades of oscc and their sites / location procedure for p16 immunohistochemistry (ihc) - is elucidated in a flowchart 1 commercially available mouse monoclonal antibody for p16ink4a protein (biogenex, usa) was used. pll = poly l lysine, edta = ethylenediaminetetraacetic acid, h2o2 = hydrogen peroxide, igg = immunoglobulin g, dpx = dibutylphathalate xylene positive control slides of cervical carcinoma [figure 1a ] harboring hpv were taken to ascertain the validity of ihc kit and the accuracy of the technique. for negative control, the primary antibodies were omitted. the presence of brown precipitate at the site of cytoplasm, nucleus or both were indicative of p16 positive immunoreactivity regardless of staining intensity. the criteria given by opted to evaluate the p16 staining is delineated in table 2. (a) positive control slide of cervical cancer, (b) dispersed single cell staining in well - differentiated oral squamous cell carcinoma, (c) patchy staining in moderately differentiated oral squamous cell carcinoma, (d) diffuse staining in poorly differentiated oral squamous cell carcinoma, (e) no staining. kappa statistics of 0.900, revealed high agreement between the observers criteria for evaluating p16 staining the slides were examined by three pathologists using light microscope and the entire procedure was blinded to minimize the inter observer bias and the values were ascertained using kappa statistics. the results revealed p16 positivity in 26 cases (86.66%) of 30 [graph 1 ]. portrayingp16 positivity in 86.66% of oral squamous cell carcinoma cases the number of p16 positive cases in different histological grades of oscc is collated in table 3. demonstrating p16 positive cases in histological grades of oscc different grades of oscc showed difference in grades / patterns of staining. wdoscc predominantly showed singly dispersed cell staining, while it was predominantly patchy and diffuse in moderately and pdoscc, respectively [table 4, graph 2 and figure 1 ]. different grades of p16 staining in different grades of oscc more diffuse p16 staining in poorly differentiated oral squamous cell carcinoma, predominant patchy staining in moderately differentiated oral squamous cell carcinoma and singly dispersed cell staining in well - differentiated oral squamous cell carcinoma associating hpv and head and neck cancer was first done in 1983 by syrjnen., and then was supported by several other authors on the basis of the following evidence : (i) the epitheliotropic nature of hpv (ii) the widely confirmed oncogenic potential, especially in cervical squamous cell carcinoma and (iii) the morphological similarities between oropharyngeal and genital epithelia. most hpv research has primarily focused on cervical cancer, as > 99% of cervical cancers harbor hpv. during the recent years, evidence of hpv infection emerged as a major prognostic and predictive marker in head and neck squamous cell cancer (hnscc). in oral cavity, among 12 types of hpv found, hpv 16 and 18 are the most common types followed by 6 and 11. moreover, the number of people at risk for infections of such oncogenic viruses and subsequent risk of neoplasia is well into the millions throughout the world. recent data from case - control and meta - analytic studies show that hpv would be indeed, an independent risk factor for the development of oropharyngeal and oral carcinomas. hpv associated oscc are more common in younger age groups due to physical contact and oral sex. it is well - established that the genital hpv infections is a sexually transmitted disease, associated with early sexual debut and multiple sexual partners. the mode of transmission of hpv to the mucosa is less understood and less defined at this stage, theories have proposed multiple pathways for hpv transmission, including perinatal transmission, auto - infection from oral - genital contact by hand and sexual transmission by oral - genital contact. it has been postulated that abrasions caused due to this continuous exposure might make mucosal surface more susceptible to hpv facilitating its entry into the basal cells. there has been wide variation in hpv positivity rates in cancers at different sites in the head and neck region. approximately, 25 - 75% of oropharyngeal cancers have tested hpv positive, with rates in tonsillar cancer being the highest, followed by cancers of the tongue and of the buccal mucosa. the probable reason could be that hpv being inhabitant of normal crypt epithelia and waldeyer 's ring, an antigen presenting site, may act as the reservoir for hpv. to understand the pathogenesis of hpv, [figure 2 ] in normal cell cycle, the hypophosphorylated retinoblastoma (rb) in complex with e2f transcription factors prevents the progress of cell cycle from g1 to s. when rb is phosphorylated by cyclin d - cyclin - dependent kinase 4 (cdk4), it releases e2f. the latter then induces target genes such as cyclin e, which stimulates dna replication and progression through the cell cycle. the gene product p16 normally binds to cdk 4, inhibiting their association with cyclin d. the inhibition of the complex cyclin d - cdk4 prevents phosphorylation of rb leading to inhibition of cell cycle progression through g1- to s - phase. a - normal cell cycle, b - role of rb in regulating g1 -s checkpoint, c - pathogenesis of hpv gi to s - red arrow indicates the hpv targeting the cells passing through g1 to s phase. abbreviations- g - gap phase, s- synthesis phase, m - mitosis phase, rb -retinoblastoma, p16 - p16ink4a cdk- cyclin dependent kinase, hpv - human papilloma virus, dna - deoxyribonucleic acid, e7- early genes, e2f- transcription factor the proposed mechanism of action of hpv is by integration of hpv into host genome and up regulates expression of e6 and e7 oncogenes. the interaction of e7 with rb gene results in release of the transcription factor e2f from the rb - e2f complex. as rb - e2f normally inhibits transcription of the p16 gene, expression of hpv e7 results in excessive and deregulated transcription and translation of p16. the e6 protein induces the loss of g1 checkpoint activation very early due to the degradation of p53. as a result, these infected cells are also resistant to p53 induced growth arrest and apoptosis, making them immortal. the mechanism of normal cell cycle and pathogenesis of hpv in tumorigenesis is represented in schematic way. usually, hpv gets detected by ihc, in - situ hybridization (ish) and polymerase chain reaction (pcr) methods. studies comparing these three methods revealed that all osccs cases, which confirmed hpv positivity by pcr / ish were also p16 positive by ihc. thereby, hpv detection was done using p16 ihc. in this study, we observed 86.66% of oscc cases being p16 positive representing hpv positivity in 87% of cases of oscc. this was in accordance with balaram., kojima., ostwald., who found 74%, 66%, and 62% hpv positivity, respectively, whereas koppikar. studies revealed 6%, 2%, and 0%, respectively exhibiting a low prevalence of hpv in oscc independent of the method used. it is also observed that hpv infection is more prominent in oscc cases from india than in patients from other countries ; for example, only 23% of japanese patients, 8 - 20% of american patients, and 19% of dutch patients are hpv positive. in india, 33.6% of oscc patients were hpv positive in eastern india as compared with 67% in south india and 15% in western india. this variability may be attributable to : ethnicity and geography ; small number of samples analyzed ; possible contamination ; detection technique used. interestingly, we also noted all the cases of pdoscc were hpv positive, which correlates to the aggressive nature. while few studies reported that detection of hpv was associated with late stage disease and poor prognosis, other studies have shown hpv positive cases having better prognosis and improved survival rate, with favorable to radiation treatment. however, treatment strategies do not currently differ on the basis of hpv status. in the future, determination of hpv status may be used to guide treatment decisions and posttreatment surveillance. on literature search, there were only a meager number of studies correlating hpv and histological grades of oscc. to the best of our knowledge, we found none of the studies emphasizing the correlation of hpv in histological grades of oscc. in this study, we found diffuse staining was more in the pdoscc, which may correlate increased viral overload and in turn correlates to the aggressive behavior of the tumor and vice versa singly dispersed cells in wdoscc showed less aggressiveness. this was in accordance with narges., who observed the significant relationship between histological grades and the percentage of positive cells in premalignant and malignant cervical lesions. however, further studies with increased sample size and other markers for correlating the aggressive behavior of the tumor are required which would provide a better understanding of their biological behavior. the identification of hpv 16 and 18 as high - risk types have resulted in the development of prophylactic vaccines based on their viral capsids. at present, two vaccines for prevention of hpv - related diseases have been developed - cervarix and gardasil. the vaccines are now part of the public vaccination program in several countries and are offered to girls from the age of 12 years or prior to sexual debut. the efficacy of the vaccines in preventing hpv - related hnscc is at present unknown. this is equally encouraging and gives us hope that it should be possible to develop such vaccines against head and neck cancers too ; which would be especially useful in advanced cases. public education especially focusing on young adults about of the role of hpv and unsafe sexual practices is of paramount importance in prevention of hpv associated oral cancer. the diffuse pattern of p16 positivity in pdoscc cases needs to be investigated further, which would provide better understanding of the biological behavior of oscc caused by hpv. | aims : the aim of this study is to evaluate the expression of human papilloma virus (hpv) in oral squamous cell carcinoma (oscc) and to correlate the association of hpv in histological grades of oscc using p16 (p16ink4a) immunohistochemistry (ihc).subjects and methods : this study consists of 30 histological diagnosed cases of oscc (10-well - differentiated oral squamous cell carcinoma [wdoscc ], 10-moderately differentiated oral squamous cell carcinoma [mdoscc ] and 10-poorly differentiated oral squamous cell carcinoma [pdoscc ]). the sections were subjected to ihc procedure using p16. two parameters in immunohistochemical p16 expression were evaluated by 3 observers based on the criteria by galgano m. tetal (2010) (a) percentage of p16 positive cases (b) pattern of p16 staining in various grades of oscc.statistical analysis used : kappa test.results:totally, 30 samples of 0scc, p16 positivity was noted in 26/30 (86.66%). of 26 positive cases, p16 staining was positive in 7/10 (70%) of wdoscc, 9/10 (90%) in mdoscc and, 10/10 (100%) pdoscc. incidentally, we also found single dispersed cell staining in wdoscc, patchy staining in mdoscc and more diffuse staining pattern predominant in pdoscc.conclusions:our study revealed an association between hpv and oscc. diffuse staining pattern was noted in pdoscc, which in turn depicts the increase viral overload, which might have an influence on its aggressive behavior. |
rhabdomyosarcoma (rms) is the most common soft tissue sarcoma in children, with the second peak of bimodal age distribution at adolescence. the head and neck, genitourinary system, trunk, and extremities are most commonly involved. rms in the genitourinary system represents 25% of all adolescent cases of rms ; but only 1 case of renal rms has been reported. the prognosis of rms is poorer in adolescents than in other age groups, so these tumors should probably be treated as a distinct entity. the rarity of adolescent renal rms has impeded research and prevented advances in the diagnosis and treatment of this cancer. we present a case of an adolescent with a renal rms presenting with tumor thrombosis extending into the inferior vena cava (ivc) and right atrium (ra) and review the literature. the patient 's father signed the necessary documents to consent to the use of her data for teaching and publication. her associated symptoms included right flank discomfort, abdominal pain, fatigue, 2 episodes of hematuria, and nocturia without oliguria. physical examination revealed no specific abnormalities except for some engorged superficial veins on the abdominal wall. her heart rate ranged from 45 to 116 beats / min, but the blood pressure was normal. the platelet count, blood urea nitrogen, serum creatinine, and electrolytes were within normal limits. significant abnormal laboratory data an abdominal ultrasonography showed a 6-cm heterogeneous echogenic mass in the right kidney. on a subsequent computed tomography (ct) scan, the lesion demonstrated heterogeneous enhancement following the intravenous injection of iodinated contrast media (figure 1). a tumor thrombus was seen extending from the right renal vein into the ivc to the left renal vein, to the ra, cranially, and to the level of the confluence of the common iliac veins, caudally. echocardiography confirmed a large thrombus in the ra that protruded into the right ventricle (rv) during systole. a chest ct, bone scintigraphy, and bone marrow aspiration revealed no evidence of lung or osseous metastases. axial (a), coronal (b), and sagittal (c) sections from abdominal contrast - enhanced computed tomography indicating a heterogeneously enhanced mass in the right kidney () with venous thrombosis extending into the right renal vein (not shown) via the inferior vena cava (black arrows) into the right atrium (a) and left renal vein (short white arrow). hydronephrosis of the right kidney (black arrowheads) and ascites (white arrowheads) were also noted. axial sections (d) and sagittal sections (c) of the heart revealed a tumor thrombus protruding into the right ventricle (long white arrows). axial sections in arterial (e), portal (f), and delayed venous phases (g) of contrast - enhanced computed tomography revealed mottled liver enhancement with periportal edema related to hepatic venous outflow obstruction. the patient was taken to the operating room and during surgery markedly engorged collateral veins were noted in the retroperitoneum. the presence of tumor thrombus in the renal veins, ivc, and ra was confirmed. a right atriotomy, thrombectomy of the ivc with partial wall resection and reconstruction, radical nephrectomy, and retroperitoneal lymph node dissection were performed. pathological examination demonstrated a 7.6-cm multilobulated mass, originating from the right kidney (figure 2). the tumor was composed of ovoid and pleomorphic tumor cells with hyperchromatic, bizarre nuclei, and eosinophilic cytoplasm (figure 3a). abundant giant tumoral cells were observed within a myxoid background with focal tumor necrosis and hemorrhage. radical nephrectomy specimen reveals a multilobulated, whitish mass () in the upper to middle poles of the right kidney. tumor thrombus is observed the inferior vena cava (black arrow) and left renal vein (white arrow). the upper portion in pictures a to d is tumor part and the lower portion is adjacent normal tissue. pleomorphic tumor cells with bizarre nuclei are in a loosely textured background (a) (hematoxylin eosin stain ; original magnification 200). immunohistochemical staining shows cytoplasmic positivity for vimentin (b), desmin (c), wt-1 (d), and myod1 (e). nuclear staining for ini-1 of vascular endothelium in brain is used as a positive control (g). mouse igg is used as a negative control (h) (b - l, original magnification 200). ini-1 = nuclear integrase interactor-1, myod1 = myogenic differentiation-1. the tumor demonstrated positive cytoplasmic staining for vimentin, desmin, wilm 's tumor-1 (wt-1), and myogenic differentiation-1 (myod1), and retention of nuclear integrase interactor-1 (ini-1) staining (figure 3). cytokeratin, renal cell carcinoma (rcc), human melanoma black-45 (hmb-45), smooth muscle actin, and sarcomeric actin were all negative. based on the surgical and pathological findings, a pleomorphic rms with budd chiari syndrome induced by ivc and ra thrombosis was diagnosed. adjuvant chemotherapy was recommended, but the patient declined further treatment. a chest radiograph and a chest ct scan obtained a month after surgery showed multiple lung metastases. the patient opted for seeking a second opinion elsewhere and died within a year of the initial operation. the tissue sections were dewaxed with xylene and rehydrated with decreasing ethanol concentrations ending with distilled water. the following primary antibodies were used : vimentin (cat no : ncl - l - vim-572, leica microsystems, clone srl 33), desmin (cat no : m076029, dako corporation, clone d33), wilm 's tumor-1 (wt-1) (cat no : ncl - l - wt1562, leica microsystems, clone wt49), myogenic differentiation-1 (myod1) (cat no : m351201, dako corporation, clone 5.8a), nuclear integrase interactor-1 (ini-1) (cat no : z2177, zeta, clone 25), cytokeratin (cat no : ncl - ae1/ae3, leica microsystems, clone ae1/ae3), renal cell carcinoma (rcc) (cat no : ncl - rcc, leica microsystems, clone 66.4.c2), human melanoma black-45 (hmb-45) (cat no : ncl - l - hmb45, leica microsystems, clone hmb45), smooth muscle actin (cat no : ncl - l - msa-594, leica microsystems, clone sc28), and sarcomeric actin (cat no : ncl - myotilin, leica microsystems, clone rs034). all tissue sections were autoclaved (tm-327 ; tomin medical equipment co., ltd., taipei, taiwan, roc) in a tris buffer (ph = 9.0) for 20 minutes. after cooling to room temperature, all the tissue sections were incubated with 3% h2o2 for 15 minutes so as to block endogenous peroxidase activity. subsequently, the tissue sections were incubated with primary antibodies for various intervals (816 hours) at room temperature. the biotinylated secondary antibody and the streptoavidin peroxidase conjugate (universal lsab2 kit ; dakocytomation) were then used according to the manufacturer 's instructions. 3,3-diaminobenzidine (dakocytomation) was used as a peroxidase substrate for developing the brown color and, subsequently, hematoxylin (merck ltd. we searched the medline database for publications of human research in english, without publication date limits, up to march 2015, utilizing the indexed search terms rhabdomyosarcoma and kidney or the tissue sections were dewaxed with xylene and rehydrated with decreasing ethanol concentrations ending with distilled water. the following primary antibodies were used : vimentin (cat no : ncl - l - vim-572, leica microsystems, clone srl 33), desmin (cat no : m076029, dako corporation, clone d33), wilm 's tumor-1 (wt-1) (cat no : ncl - l - wt1562, leica microsystems, clone wt49), myogenic differentiation-1 (myod1) (cat no : m351201, dako corporation, clone 5.8a), nuclear integrase interactor-1 (ini-1) (cat no : z2177, zeta, clone 25), cytokeratin (cat no : ncl - ae1/ae3, leica microsystems, clone ae1/ae3), renal cell carcinoma (rcc) (cat no : ncl - rcc, leica microsystems, clone 66.4.c2), human melanoma black-45 (hmb-45) (cat no : ncl - l - hmb45, leica microsystems, clone hmb45), smooth muscle actin (cat no : ncl - l - msa-594, leica microsystems, clone sc28), and sarcomeric actin (cat no : ncl - myotilin, leica microsystems, clone rs034). all tissue sections were autoclaved (tm-327 ; tomin medical equipment co., ltd., taipei, taiwan, roc) in a tris buffer (ph = 9.0) for 20 minutes. after cooling to room temperature, all the tissue sections were incubated with 3% h2o2 for 15 minutes so as to block endogenous peroxidase activity. subsequently, the tissue sections were incubated with primary antibodies for various intervals (816 hours) at room temperature. the biotinylated secondary antibody and the streptoavidin peroxidase conjugate (universal lsab2 kit ; dakocytomation) were then used according to the manufacturer 's instructions. 3,3-diaminobenzidine (dakocytomation) was used as a peroxidase substrate for developing the brown color and, subsequently, hematoxylin (merck ltd. we searched the medline database for publications of human research in english, without publication date limits, up to march 2015, utilizing the indexed search terms rhabdomyosarcoma and kidney or rms is divided in 4 histopathologic subtypes : embryonal, spindle cell / sclerosing, alveolar, and pleomorphic types. the embryonal type of rms usually occurs in children and usually affects the head and neck region, and the genitourinary tract, with a better prognosis. alveolar rms usually affects adolescents and young adults, whereas the other 2 subtypes usually affect adults in the head and neck, extremities or trunk and have poor prognoses. renal rms in adolescents is very rare, with 1 previous case of an embryonal type reported in the literature. the clinical presentation and laboratory results reflect the immune reactions to the cancer and the extent of tumor. the presence of arrhythmia and nocturia in our case is unusual, though, and may be explained by the extension of tumor thrombus into the ra and, during systole, to the rv. this could have led to hypovolemia and stimulation of baroreceptor reflexes, leading to increased heart rate, peripheral arterial resistance, and retention of fluid through the renin when the patient was laying down at night, the venous return increased, the heart rate reduced, and the retained fluid was excreted. clinicians should identify any underlying causes of arrhythmia in adolescents, as patients of this age have greater compensatory mechanisms for maintaining blood pressure. anemia, leukocytosis, and elevated c - reactive protein are due to tumor - related inflammation. coagulopathy, abnormal liver, and renal function may be seen with thrombosis of the ivc. our patient had extensive ivc thrombosis, but the well - established collateral circulation preserved her renal function. imaging features of renal rms are indistinguishable from rcc or other sarcomas, but provides useful information for surgical planning, particularly in cases with venous thrombosis extending into ivc and heart. the diagnosis of a primary renal sarcoma, therefore, is based on histological and immunohistochemical results, and should fully fit the criteria proposed by grignon. vimentin and myogenic regulatory proteins, such as desmin and myod1, are typically positive in cases of rms. myod1 is a myogenic transcriptional regulator found in the cell nucleus and a specific marker for rms. however, because of transactivation of myogenin, a proportion of pleomorphic rms cases demonstrate only cytoplasmic myod1 expression. cytoplasmic myod1 staining is less specific for rms and could also be seen in angiomyolipoma, perivascular epithelioid cell tumor, neuroblastoma, and ewing 's sarcoma because of cross reaction with undetermined proteins in the cytoplasm. additional stains are obtained to differentiate rms from other malignancies, for example, rhabdoid tumors, sarcomatoid rcc, angiomyolipoma, and wilm 's tumor. nephrectomy is usually the main treatment, followed by adjuvant chemotherapy with vincristine, dactinomycin, and cyclophosphamide (vac). however, the rapid development of lung metastases in this case, in spite of the complete resection of the primary tumor, suggests these patients may have a higher risk for poor outcomes and could benefit from early aggressive multimodal therapy. the histologic subtype is either embryonic or pleomorphic. currently, there is a lack of knowledge and consensus regarding the treatment of adolescent renal rms. renal rms with ivc thrombosis seems to require aggressive treatment, and multimodal therapy may play an important role. further studies on the molecular biology and most efficacious treatments of renal rms, with particular consideration of adolescent cases, are required to improve clinical outcomes. as this is a case - report, our conclusions are based only on data derived from this particular patient and the limited available literature. | abstractalthough the second peak of the age distribution of rhabdomyosarcoma (rms) is at adolescence, renal rms is extremely rare at this age group. this tumor is indistinguishable from other renal tumors based on clinical and imaging findings, and the diagnosis relies on histology and immunohistochemical staining. we report a unique case of adolescent renal rms associated with tumor thrombus extending into the inferior vena cava (ivc) and right atrium.an 18-year - old female adolescent presented with shortness of breath and palpitations, associated with right flank discomfort, and hematuria. a pleomorphic - type renal rms with budd chiari syndrome and arrhythmia induced by ivc and ra thrombosis was diagnosed. despite complete tumor resection, the patient developed multiple lung metastases a month after surgery. chemotherapy was recommended, but the patient declined. she died within a year of the initial operation.adolescent renal rms is rare and associated with poor outcome. early aggressive multimodal therapy seems to be appropriate, in particular, in the presence of tumor thrombosis. |
in 1952, wilson1 coined the term " necrotizing fasciitis " (nf) for the necrotizing soft tissue infections in which the fascia and tissue death are invariably involved. nf is an infection that spreads along the fascial planes causing subcutaneous tissue death with relative sparing of skin and underlying muscles, characterized by rapid progression, systemic toxicity, and even death2. histologically, obliterative vascular thrombosis and polymorphonuclear infiltration are initially confined to the deep dermis and superficial fascia3. liquefactive necrosis of subcutaneous fat, air tracking along deep fascial planes, and vascular thrombosis with resultant skin changes eventually occur. the portal of bacterial entry may be trivial, and patients usually present with pain disproportionate to the visible skin changes2. presenting symptoms are nonspecific and may include mild cellulitis, edema, and occasionally crepitation2. at onset, nf can be difficult to differentiate from cellulitis and other superficial infections of the skin4. studies have shown that only 15% to 34% of patients with nf have an accurate admitting diagnosis5. patients with nf usually demonstrate systemic effects, initially presenting with fever (temperature greater than 38), tachycardia, diaphoresis, and possibly even an altered mental state or diabetic ketoacidosis. the physical examination should include all parts of the body in a search for skin inflammation. misdiagnosis and delayed treatment can result in death from sepsis, mediastinitis, carotid artery erosion, jugular vein thrombophlebitis, or aspiration pneumonia6. nf is associated with systemic toxicity and high mortality rate if not treated timely and aggressively. our department experienced an nf patient who showed severe skin infection around the neck and required several operations. a 85-year - old female patient visited our emergency room due to painful swelling on the bilateral submandibular, submental, and upper neck areas. several days previous, she underwent endodontic treatment on a lower central incisor. after the treatment, however, her symptoms persisted, and swelling developed suddenly. she was febrile, with a body temperature of 39. no other medical condition was significant except a medical history of steroid due to arthralgia. laboratory findings were a white blood cell (wbc) of 10.2610/l, erythrocyte sedimentation rate (esr) of 3 mm / hr, neutrophil of 93.1%, activated partial thromboplastin time (aptt) of 45.9 seconds, and a c - reactive protein (crp) of 202.96 mg / l (table 1), suggesting an acute infected state. comuted tomography (ct) was performed and showed a disseminated deep neck abscess in the left submandibular space that extended into the upper mediastinum through the anterior neck space and to the supraclavicular and axillary areas.(fig. 3) by incising the submental and submandibular areas and dissecting with fingers and mesenbaum scissors. when the underlying fascia was opened, a small amount of pus was discharged, and the fascia was noted to be a discolored grayish color. these findings suggested fasciitis rather than odontogenic abscess. to drain the anterior neck and superior mediastinum, we incised the skin along the anterior border of the sternocleidomastoid muscle, revealing that that entire fascia along the anterior neck and carotid sheath was discolored to grayish. with a scissors and fingers, we detached the diseased fascia from the submental area to the upper mediastinum. to drain the supraclavicular and axillary areas, we incised the supraclavicular area and the anterior border of the trapezius muscle, and the infected areas were explored. silicon drains were inserted, and the patient was administered a triple antibiotic regimen of penicillin, aminoglycoside, and metronidazole. on microscopic examination, acute and chronic infection was found, and lymphocyte infiltrations were noted in the necrotic fascia. after 4 days, the patient 's condition was not improved, and ct showed that the infection had spread under the trapezius muscle. laboratory findings were wbc of 13.1810/l, esr of 15 mm / hr, neutrophil of 87.7%, aptt of 46.3 seconds, and a crp of 151.46 mg / l.(table 1) we drained the area under the trapezius muscle and obtained an artificial airway through tracheostomy.(fig. 4) we incised the anterior border of the trapezius muscle to a greater extent than in the original surgery, incised the suprascapular area, and inserted the drain through and through.(fig. after the operation, the patient was sent to the intensive care unit and and administered ventilator therapy for respiratory support. after 10 days, the skin infection had extended to the upper chest and shoulder area. follow - up ct images showed that the multifocal abscess around the left chest wall, shoulder area and carotid area had further deteriorated.(fig. 5) laboratory findings were a wbc of 12.2110/l esr of 11 mm / hr, neutrophil of 75.7%, aptt of 38.6 seconds, and a crp of 14.2 mg / l.(table 1) we suspected uncontrolled nf, as there was no significant gross interval change in the multispace abscess or nf. we immediately performed a third operation in which we incised the skin on the chest over the healthy area and dissected the infected skin. once the skin was elevated, we noted that the subcutaneous fat and superficial fascia were all necrotized. with finger dissection, the carotid space was dissected ; all necrotic tissue around the upper chest and trapezius area was dissected with messenbaum scissors. pus culture at this operation showed that the main microorganism was actinibacter baumanni, which is resistant to cabepenem and most antibiotics. 7) although the infection subsided after the third operation, the skin over the distal clavicular area was not able to be salvaged. using a bilobed rotational flap, the skin was closed on postoperative 37 days.(fig. 8) the tracheostomy tube was removed on postoperative 40 days. laboaratory findings on the day of discharge were a wbc of 10.0810/l esr of 5 mm / hr, neutrophil of 71.3%, aptt of 25.7 seconds, and a crp of 20.4 mg / l.(table 1) the wbc was not high, but crp and aptt were extremely high, suggesting a recovery pattern related to reduced crp and aptt. it is generally accepted that predisposing factors to nf include diabetes, alcoholism, tobacco abuse, immunosuppression, malnutrition, advanced age, peripheral vascular disease, renal failure, underlying malignancy, and obesity7. precipitating events of nf include surgery, minor invasive procedures (e.g., joint aspiration and acupuncture), intravenous drug use, penetrating injuries (e.g., insect and animal bites), soft tissue infection, burns, and child birth4. nf in the head and neck region is rare, with most cases having an odontogenic origin7. other causes of nf reported in the literature are tonsillar or pharyngeal infections, trauma, cervical adenitis, salivary gland infections, and tumor infection8,9. cervicofacial nf is rarely initially suspected because the disease is uncommon, the presenting signs and symptoms are often benign, and there is frequently a dental infection or pharyngitis thought to explain the findings6. in the presented case, patient had been administered corticosteroid due to arthralgia, which reflected an immunocompromised state, and the infection was induced by minor endodontic treatment. the patient was initially diagnosed with odontogenic infection, but necrotic fascia confirmed fasciitis. according to quereshy.7, oral streptococcal species are cultured from most nf, with staphylococcal and anaerobic organisms also occasionally identified. these infections appear to be caused by the same species of bacteria that cause chronic dental subapical infections, acute localized cellulitis, and tissue abscess. the classical infectious nf process usually begins 2 to 4 days after the initial insult. true nf features rapid, progressive liquefaction of the subcutaneous fat and connective tissue, while the overlying skin is spared. necrosis and liquefaction of fascia and fat occur early in the process, possibly mediated by the collagenase and hyaluronidase produced by group a streptococci. this liquefaction of fat results in separation of the skin from the underlying tissues, producing edematous fluid and the pathognomonic " dishwater pus, " which has an offensive odor in the presence of anaerobes. if not swiftly managed surgically, infectious spread along the fascial planes of the neck can widely undermine the skin into the face and thorax. further necrosis and liquefaction of the fat and fascia lead to arterial thrombosis, wet gangrene, and finally ischemic death of the skin. inflammatory factors lead to fever, tachycardia, and eventually, septic shock10. in the presented case, although all of the subcutaneous fat and superficial fascia were necrotized, only a small portion of the skin was necrotized, though to be due to lack of blood supply. the incision is typically placed at the margin of the skin erythema area, where ample blood supply is difficult. clinicians must know that nf may accompany weakness, apathy, confusion, fever, tachycardia out of proportion to temperature elevation, hypotension, volume depletion, hypocalcemia due to calcium sequestration into areas of fat necrosis, and increased glucose level from increased gluconeogenesis from protein and hypoproteinemia11. green.2 listed fever and signs and symptoms of systemic toxicity as diagnostic features of nf, including high fever, hypotension, prostration, and multiple organ failure. the condition is known as streptococcal toxin shock syndrome. the clinically diagnosis of nf in the head and neck can be very difficult, especially in the initial stage, as the symptoms may resemble those of simple cellulitis or erysipelas. the distinguishing features are fast progression, pain, systemic toxicity, and presence of subdermal gas. if muscle is primarily infected, then the diagnosis of streptococcal myositis or gas gangrene should be considered13. examination of a patient with nf will often show a lack of integrity of the subcutaneous fat, offering little resistance to the exploring finger. the skin will often feel undermined by the progressive infection11. when nf is suspected, prompt ct examination is mandatory. among the other diagnostic radiography techniques, ct scan is more sensitive than other imaging modalities because it shows inflammatory changes, such as fascial edema and thickening or abscesses. in contrast to abscess, nf shows an area of fluid accumulation without significant rim enhancement at the periphery14. although gas accumulation is not a consistent finding, gas in the tissues had been considered a hallmark of nf. another ct feature that may be considered characteristic of nf is a bizarre - shaped hypodense area, often irrespective of the cervical fascia compartment, that does not show significant rim enhancement on contrast injection14. this feature is distinguishable from an abscess, which appears as a single or multilobulated area of fluid attenuation, usually confined to one compartment and typically showing peripheral rim enhancement. the bizarre shape of the hypodense area has been suggested to be caused by rapid spreading of the liquefaction necrosis across multiple layers of cervical fascia15. in the presented case, a hypodense area without rim enhancement was observed, which is not characteristic of odontogenic abscess, and showed a small amount of pus, again in contrast to abscess. treatment involved securing the airway, broad - spectrum antimicrobial therapy, intensive care support, and prompt surgical debridement, repeated as needed14. airway management is critical with cervicofacial nf because the disease process may produce neck edema and necrosis, which increase the difficulty of intubation. often with nf, extended airway management is warranted ; in such situations, a tracheotomy is preferred over an endotracheal or nasotracheal tube11. gram staining may be helpful for selecting first - line antibiotics, and results of blood culture will most often be positive10. antibiotic therapy should be adjusted in response to culture results, but early triple - antibiotic therapy is the current standard of care11. reducing mortality rests on early diagnosis and prompt aggressive treatment. the early incision and debridement of all involved spaces can salvage the skin, which may still succumb to necrosis later in the disease course due to thrombolization of feeding vessels12. the initial goals of surgical debridement are to eradicate all necrotic tissue and drain loculated collections and fluid in the fascial planes. because of the rapid progression of this disease, serial debridement is often performed under general anesthesia in the operating room within the first 24 hours after the initial debridement2. in addition, wounds should be irrigated each time the dressing is changed, and one should be observant for the redevelopment of necrosis16. general agreement is that the defects should be kept open, and debridement should be repeated until completely healthy granulating tissue is obtained17. on average, appropriate nutritional support, pain management, fluid resuscitation, and replacement of electrolytes are important measures for patient survival11. unfortunately, septic shock can develop, which will lead to multiple organ failure and death18. major complications from nf are mediastinal involvement, septic shock, pleural effusion, lung empyema, airway obstruction, rupture of major vessels, brain abscess, disseminated intravascular coagulopathy, sepsis, acute renal failure, and respiratory failure. usually, such complications in immunocompromised patients, such as diabtes mellitus and cancer patients, lead to death7,14. banerjee.19 found that 44% of the cervical nf cases in their series had mediastinal involvement, 38% of whom died of the disease. infection can propagate from the head and neck to the mediastinum through the retropharyngeal or prevertebral space or can descend along the carotid sheath. direct downward extension of fasciitis involving the pretracheal fascia can also result in mediastinal or pleural involvement20. primary closure can be performed with various local flaps, skin graft, regional flaps and even free vascularized flaps16. in the presented case, the wound margin was necrotized ; after ample delay, the wound was reconstructed using a local flap. | necrotizing fasciitis (nf) is an infection that spreads along the fascial planes, causing subcutaneous tissue death characterized by rapid progression, systemic toxicity, and even death. nf often appears as a red, hot, painful, and swollen wound with an ill - defined border. as the infective process continues, local pain is replaced by numbness or analgesia. as the disease process continues, the skin initially becomes pale, then mottled and purple, and finally, gangrenous. the ability of nf to move rapidly along fascial planes and cause tissue necrosis is secondary to its polymicrobial composition and the synergistic effect of the enzymes produced by the bacteria. treatment involves securing the airway, broad - spectrum antimicrobial therapy, intensive care support, and prompt surgical debridement, repeated as needed. reducing mortality rests on early diagnosis and prompt aggressive treatment. |
progressive increase of reproductive aging has increased the number of couples seeking help for assisted reproductive techniques. demonstrated that an increase in follicle stimulating hormone (fsh) occurs several years before elevation in luteinizing hormone (lh) and concluded that the first intimation of decreased ovarian reserve may be due to an increased fsh/ lh ratio (1). though, fsh and lh act together in stimulating follicular growth and maturation, the relative importance of lh in follicle stimulation is still debatable in the clinical settings (2). liu. demonstrated that day 3 fsh / lh 2 is associated with higher rates of cancellation of ivf cycles (3). previous studies suggest that day 3 lh values 3 miu / ml may also predict poor response to ovarian stimulation (4, 5). thus, the present study was conducted with the endeavor to search for an accurate marker which would allow suitable selection of stimulation protocols and appropriate counseling before pursuing the stressful and expensive course of ivf. this is particularly important in our set - up we encounter, frequently as the patients belong to the lower and middle socioeconomic classes and can not afford multiple cycles of ivf. therefore, the objective of the present study was to evaluate whether elevated day 3 fsh / lh ratio 2 and lh values 3 miu / ml, in the presence of normal fsh, are predictive of poor responses to ovarian stimulation. this prospective study was carried out at the ivf and reproductive biology centre and lok nayak hospital, affiliated to maulana azad medical college, new delhi, india from march 2008 to october 2009 after obtaining ethical clearance from institutional ethical committee. all the 105 patients who underwent controlled ovarian hyper - stimulation (coh) for ivf were included in the study. women with the following characteristics were excluded from the study : (i) age > 40 years, (ii) more than three ivf cycles failures, (iii) donor oocytes recipients, (iv) frozen - thaw embryo recipients, (v) endocrinal abnormalities such as hyper - prolactinemia or hypothyroidism, (vi) ovarian stimulation other than the long protocol, (vii) polycystic ovarian syndrome or similar features like high lh / fsh ratio and (viii) high fsh and estradiol (e2) concentrations (day 3 fsh 11 miu/ ml and e2>50 fasting blood samples were obtained for baseline assays of fsh, lh, e2, and progesterone (p4) on day 2 of a spontaneous menstrual cycle prior to ovarian stimulation. fsh and lh measurements were standardized against the second irp who reference standard 78/549 and the second international standard (nib sc) 80/552, respectively. the measuring range for fsh and lh was 0.1 to 200 miu / ml while for e2 and p4 it was 5 to 4300 and 67 pg / ml and 0.03 to 60 ng / ml, respectively. e2 and all the women were divided into two groups based on (i) day 3 fsh / lh ratio ; with subgroup i consisting of women with fsh / lh 3 miu / ml and subgroup b with lh3 miu / ml. parameters were compiled and statistically compared between the two subgroups. a standard long step - down protocol was used for controlled ovarian stimulation. the gnrh analogue (0.5 mg) (leuprolide acetate and lupride ; sun pharmaceuticals, india) was administered subcutaneously during the last five days of a low dose oral contraceptive (ocs). ovarian stimulation was started after confirmation of down - regulation by e210 mm in diameter on baseline transvaginal sonogram. controlled ovarian hyperstimulation (coh) was initiated with the administration of 225 iu recombinant fsh (gonal - f ; serono sa, switzerland) with the same dose of leuprolide acetate (0.5 mg) till the day of final oocyte maturation. after the sixth day, the gonadotropin dose was adjusted according to the ultrasonographic and endocrinal parameters. the cycle was cancelled if ovaries were resistant to stimulation or peak e2 was 3 miu / ml) included 80 and subgroup b (day 3lh3 miu / ml) included 32 clients. demographic characteristics of subgroups based on day 3 fsh / lh ratio the total percentage is > 100% as some patients had more than one etiology cancellation rate was higher in subgroup ii than subgroup i but the difference was not significant (19.23% vs. 9.45%, p = 0.30). four out of 5 (80%) cancelled cycles in subgroup ii were because of under - stimulation while in subgroup i only 2 out of 7 cycles (28.57%) were cancelled due to this reason. the remaining 3 out of 7 cycles were cancelled due to unwanted risks of hyperstimulation and the remaining 2 because of failure to down - regulate. similarly, cancellation rate was not significant in two lh value subgroups (subgroup a vs. subgroup b, 8.75% vs. 15.6%, p = 0.31). while comparing ivf cycle outcomes between subgroup i and ii, day 3 lh was found to be lower in subgroup ii (table 2) compared to subgroup i (2.281.58 miu / ml vs. 5.142.35 miu / ml, respectively) and this difference was statistically significant (table 1, p = 0.02). subgroup ii also required higher fsh doses for stimulation in comparison with subgroup i. ivf cycle stimulation characteristics and outcome in subgroups based on day 3 fsh / lh ratio and day 3 lh on follow - up, we observed that subgroup ii had significantly poorer outcome in their ivf cycles which included fewer number of follicles > 16 mm in size (p = 0.03), less e2/follicle>16 mm ratio (p= 0.02), fewer retrieved oocytes (p = 0.04) and poorer pregnancy rates (p = 0.02) in spite of similar number and grade of transferred embryos. overall, the total pregnancy rate was 28% with a clinical pregnancy rate of 21%. twenty - five (33.8%) pregnancies were achieved in subgroup i (fsh / lh 3. (8) reported decreased ovarian response and lower pregnancy rates in 14 patients with fsh / lh ratios > 3.6. but high cancellation rate in the group with elevated fsh moreover, high responders were not excluded from the analysis in their study. in our study, various studies have shown that fsh / lh ratio is elevated secondary to lower lh and not due to higher fsh concentrations (3, 15, 16). however, mukherjee. reported that 11 out of 14 patients had elevated fsh / lh ratio in their study (5). fsh concentrations remained > 15 miu / ml in their first 6 months of follow - up. this indicates that elevation in fsh/ lh concentrations may have been simply forecasting an imminent rise in fsh levels. our findings were consistent with several other studies which do not support the predictive significance of low day 3 lh levels alone in ovarian stimulation outcome (17). (4) found that low day 3 lh values were predictive of a reduced response to ovarian stimulation. however, their study was based on a population subjected to ovulation stimulation other than ivf management ; hence, oocyte number and quality was not included. from experimental and clinical evidence threshold for lh requirements during folliculogenesis which together with the intricate auto and paracrine actions of the intra - ovarian regulators, it influences follicular development (4, 18, 19). whether the exogenous addition of lh may be of benefit to enhance oocyte quality is controversial (20, 21). the present study specifically examined peak e2/follicle>16 mm ratio and this difference was statistically significant between subgroups i and ii. since the pregnancy rate reflects the implantation potential of each embryo, it may be speculated that a higher fsh / lh ratio negatively impacts oocyte quality leading to a poor embryonic development. we also examined serum e2 and p4 concentrations on day 6 of coh and those of serum p4 on the day of -hcg measurement which was not done in previous studies. the present study demonstrated that an elevated fsh / lh ratio is associated with an inferior outcome in ivf. the day 3 fsh / lh ratio adds more predictive power over day 3 fsh alone, especially in younger patients with a normal fsh concentration 11 miu / ml. additional prospective randomized controlled trials on different regimens are warranted in order to clarify the physiological significance of an elevated fsh / lh ratio and decreased lh concentration in relation to ovarian function and outcome in ivf treatments. since day 3 serum fsh and lh concentrations are usually readily available, their ratio could be used as an additional important predictor for compromised ovarian reserve, in refining the treatment protocol accordingly and avoiding potential reticulations. | backgroundthis study was undertaken to evaluate the role of day 3 fsh / lh ratio and day 3 lh level as predictors of ivf cycle outcomes.methodsthis prospective observational study was undertaken in the ivf and reproductive biology centre and lok nayak hospital, affiliated to maulana azad medical college, in new delhi, india. the study included 105 women who underwent controlled ovarian hyperstimulation for in vitro fertilization. characteristics of ivf cycles and outcomes were studied in patient subgroups based on day 3 fsh / lh ratio (3 and 3 miu / ml). the student t - test, bartlett 's test, chi - squred (2) and fisher 's exact test, and linear regression model were used for data analysis. a p - value less than 0.05 was considered as statistically significant.resultswomen with an elevated fsh / lh ratio 2 (n = 31) required higher doses of gonadotrophins (3019.34 vs. 2482.43 iu). the outcome of ivf was poor in these patients and they had fewer number of mature follicles (> 16 mm) (5.44 vs. 6.09), less e2/mature follicle ratio (4.65 vs. 6.36), fewer retrieved oocytes (6.67 vs. 9.09) and fewer pregnancy rates (11.1% vs. 33.8%). on the other hand, patients with low basal lh levels (3 miu / ml) did not differ significantly in terms of response to controlled ovarian hyperstimulation except for fewer number of retrieved oocytes (7.33 vs. 7.91) but there was a trend towards poor pregnancy rates (7.33 vs. 7.91) but there was a trend towards poor pregnancy rates as compared to subgroup with lh levels > 3 miu / ml.conclusionelevated day 3 fsh / lh ratio is associated with inferior outcome in ivf treatment cycles and it could be used as an additional predictor of decreased ovarian reserve. |
nitrous acid, a component of photochemical smog and a common indoor air pollutant, may reach levels of 100 ppb where gas stoves and unvented portable kerosene heaters are used. nitrous acid is a primary product of combustion and may also be a secondary product by reaction of nitrogen dioxide with water. because the usual assays for nitrogen dioxide measure several oxides of nitrogen (including nitrous acid) together, previous studies of indoor nitrogen dioxide may have included exposure to and health effects of nitrous acid. to assess the respiratory effects of nitrous acid exposure alone, we carried out a double - blinded crossover chamber exposure study with 11 mildly asthmatic adult subjects. each underwent 3-hr exposures to 650 ppb nitrous acid and to filtered room air with three 20-min periods of moderate cycle exercise. symptoms, respiratory parameters during exercise, and spirometry after exercise were measured. a statistically significant decrease in forced vital capacity was seen on days when subjects were exposed to nitrous acid. this effect was most marked at 25 min and 85 min after exposure began. aggregate respiratory and mucous membrane symptoms were also significantly higher with nitrous acid. we conclude that this concentration and duration of exposure to nitrous acid alters lung mechanics slightly, does not induce significant airflow obstruction, and produces mild irritant symptoms in asthmatics.imagesfigure 1. |
|
the poor access to water supply is a prevalent issue in over 850 million people worldwide with over 2.5 billion limited by access to sanitation facilities. the global burden of disease and mortality rates could be reduced by about 9.1% and 6.3%, respectively, if rapid success is attained in facilitating access to water, sanitation, and hygiene facilities. a large proportion of these diseases are related to diarrhea incidences which contribute to the mortality rate of about 1.9 million and new diarrhea cases estimated at 4 billion annually especially among children under five years old. the world health statistics review done in 2009 showed that the highest case fatality rates due to diarrheal incidences occurred in india with over 386,000 diarrheal deaths. high mortality rates of about 13.9% are still attributed to diarrheal deaths in egypt among children less than five years old irrespective of the recent reduction in child mortality rates. the leading cause of infant mortality and health - related expenditures has been attributed to diarrheal incidences among children in indonesia. diarrheal diseases are also the third cause responsible for increased morbidity rates in all age groups in indonesia. previous literature has shown considerable studies regarding the effects of lack of appropriate water facilities, hand washing, and hygiene practices on child health outcomes. impaired cognitive learning and learning performance are long - term outcomes of the negative effects of infections such as diarrhea, worm infestations, and dehydrations which are largely attributed to poor water, sanitation, and hygiene conditions. diarrheal incidences in children during their first few years of life have been shown to limit their growth by about 8 cm and cause an iq point reduction when they progress to about 7 or 8 years of age. information regarding absenteeism from middle and higher income countries has shown that poor academic and social development, high dropout rates, and reduced learning performance are attributed to school absence in children [811 ]. absenteeism due to illness has been shown to be reduced by implementation of mandatory hand hygiene and sanitary procedures based on the results of previous interventions. the availability and utilization of alcohol - based sanitizers in schools have also been shown to reduce absenteeism by about 2050% [1417 ]. a hand hygiene intervention in two public elementary schools in chicago involving instructions in hand hygiene practices and provision of hand hygiene facilities significantly reduced absenteeism among students in prekindergarten to the eighth grade (ages 414). there have been considerable studies that have examined the effect of water treatment, hygiene, and sanitary practices on reducing absenteeism, diarrhea prevalence, and acute respiratory infections in school - age children. however, limited research has been done to evaluate the effectiveness of water, sanitation, and hygiene practices through randomized controlled clinical trials to gauge the long - term impact of these interventions on improving child health outcomes. the objective of the study is to examine and describe the gaps in the existing water, sanitation, and hygiene interventions to improve child health outcomes such as acute respiratory infections, diarrheal episodes, and absenteeism in various settings. a search was conducted in january 2013 using the scientific databases pubmed and google scholar for studies published between 2009 and 2012 and focusing on the effects of access to safe water, hand washing facilities, and hygiene education among school - age children. water access and waterborne illnesses, school enrollment and hygiene education, hand washing facilities and absenteeism, and hygiene education and children. studies included were those that documented the provision of water and sanitation in schools for children less than 18 years of age, interventions which assessed the impact of wash practices, and english - language, full - text peer reviewed papers. studies which did not have a school - based component in assessing wash practices were excluded. a secondary search was also done to review the references of the articles included in the final analysis. this was reduced to 15 studies after the exclusion criteria were applied and duplicates removed (figure 1). 40% (n = 6) of the studies were published in 2011 and 33% (n = 5) in 2012. 73% (n = 11) of the studies were conducted in developing countries including india, kenya, and egypt and were rural based (53%, n = 8). 60% (n = 9) of the studies incorporated an educational component in the interventions assessing the impact of water treatment and sanitation hygiene and this was shown to facilitate the success of those studies. the outcomes assessed were reducing illness - related absenteeism, gastro - intestinal, and respiratory infections and adoption of point - of - use water treatment in children. hygiene and sanitation interventions have had considerable impact on reducing diarrhea and absenteeism rates in school - age children. age / grade level : comparisons of the effectiveness of wash interventions were reported for some of the studies stratified by various age categories and measured in years.gender : the gender of the children in the various studies was noted to observe if there were any differences in the effectiveness of the interventions.socioeconomic status / household income : information on socioeconomic status was abstracted from the articles to observe its significance towards promoting access to water facilities and improving hygiene practices in children.parental literacy : it was assessed to monitor the effect of role - modeling behaviors in children towards imbibing knowledge, attitudes, and practices of sanitation and hygiene. age / grade level : comparisons of the effectiveness of wash interventions were reported for some of the studies stratified by various age categories and measured in years. gender : the gender of the children in the various studies was noted to observe if there were any differences in the effectiveness of the interventions. socioeconomic status / household income : information on socioeconomic status was abstracted from the articles to observe its significance towards promoting access to water facilities and improving hygiene practices in children. parental literacy : it was assessed to monitor the effect of role - modeling behaviors in children towards imbibing knowledge, attitudes, and practices of sanitation and hygiene. study design : information was gathered to determine the types of studies that were performed including randomized controlled trials, cross - sectional studies, cohort studies, and case series.study location : information was gathered about the locations where the studies were conducted.study duration : the period of the study was also recorded.sample size of the populations : it was also recorded. study design : information was gathered to determine the types of studies that were performed including randomized controlled trials, cross - sectional studies, cohort studies, and case series. knowledge : knowledge, as an educational component of the various studies reviewed, was assessed to observe their effects on sustained impact of the interventions. comparisons were also made to interventions that did not utilize this component to weigh its effectiveness. knowledge : knowledge, as an educational component of the various studies reviewed, was assessed to observe their effects on sustained impact of the interventions. comparisons were also made to interventions that did not utilize this component to weigh its effectiveness. the commonly studied age groups of children studied fell between 5 years and 16 years (53%, n = 8). 13% (n = 2) of the studies focused on children less than 5 years while 26% (n = 4) of the studies did not specify the age groups of the children. 40% (n = 2) of the studies were conducted in africa (figure 2). others were conducted in asia (33%, n = 5), north america (20%, n = 3), and europe (6%, n = 1). more than half (53%, n = 8) of the studies were randomized clinical trials while 47% (n = 7) were cross - sectional studies. 100% (n = 15) of the studies reviewed were school based, conducted in primary / middle / elementary schools, with one study incorporating a community component. more than half of the studies were done in rural settings (53%, n = 8). 33.3% (n = 2) of the studies done in africa were urban based, 80% (n = 4) of the studies done in asia were rural based, and 100% (n = 3) of the studies done in north america were urban based. 53% (n = 8) of the studies had sample sizes ranging between 500 and 1000. the data collection process was carried out using surveys at several levels including students, parents, teachers, health workers, social workers, or a combination of them (figure 3). several variable categories were gathered based on the literature review of the articles included in the final analysis. 80% (n = 12) of the studies reviewed assessed the ages of the children in relation to the outcomes. 53% (n = 8) of the studies included children with age groups between 5 years and 16 years. 13% (n = 2) of the studies reviewed involved children less than 5 years of age, while 26.6% (n = 4) of the studies did not specify the ages of the children. 27% (n = 3) of the studies which assessed age found a significant association with the outcomes. results from a study that examined the prevalence of helminthic infections in children showed that the age of children was a significant factor in the risk of helminthic and protozoan infections. older children aged 8 and 10 years were less prone to infections by helminthes and intestinal protozoa, unlike the younger children between 7 and 8 years who had very high infection rates. however, in another study, the infection rates were significantly associated with older children between 810 years old. the ages of the children were also significantly associated with latrine use especially in the 810 age groups. 86% (n = 13) of the studies assessed the school grade levels of the children. majority of the children studied fell between grades ranging from pre - kindergarten to the eighth grade (86%, n = 13). 13.3% (n = 2) of the studies did not specify the grades of the children. the association between school grades and the outcomes was significant in 23% (n = 3) of the studies. the child health outcomes reviewed were more significantly associated with children in higher grade levels. the gender of the participating children was described in majority of the studies reviewed (n = 12, 80%). 20% (n = 3) of the studies found a significant association between gender and the outcomes. two of those studies were randomized control trials assessing the impact of water treatment and sanitation hygiene (wash) on reducing absenteeism and diarrhea / ari prevalence and 1 was a cross - sectional study. in the randomized controlled trials, absenteeism reduction was significant in girls [1, 20 ], but in the cross - sectional study, the impact was associated with the male gender. 66% of the studies assessed parental literacy (n = 10) and 50% of those collected data specifically on maternal education (n = 5). maternal literacy was found to be insignificant in one of the studies involving the factors associated with the use of improved water sources and sanitation among children in cambodia and its effect was not specified in others studies [18, 2124 ]. the significance of parental literacy on the outcomes assessed was not stated in 5 of the studies reviewed [18, 20, 21, 24, 25 ]. the socioeconomic index was described in the studies reviewed to include wealth index, wealth, household income, household assets, and housing type. 60% of the studies analyzed the association between socioeconomic index and the outcomes (n = 9), but its significance was only stated in 3 studies [18, 20, 21 ]. higher socioeconomic status (defined by housing type) was a key independent factor associated with the use of improved water sources and sanitation. results from a study showed that children belonging to households of the middle 40% which were on a higher scale had a reduced risk of being infected compared to their poorer counterparts (or = 0.58, 95% ci : 0.380.90). individuals with higher socioeconomic index generally reflected the positive outcomes of the health interventions compared to those with a lower index. the socioeconomic index was described in the studies reviewed to include wealth index, wealth, household income, household assets, and housing type. 60% of the studies analyzed the association between socioeconomic index and the outcomes (n = 9), but its significance was only stated in 3 studies [18, 20, 21 ]. higher socioeconomic status (defined by housing type) was a key independent factor associated with the use of improved water sources and sanitation. results from a study showed that children belonging to households of the middle 40% which were on a higher scale had a reduced risk of being infected compared to their poorer counterparts (or = 0.58, 95% ci : 0.380.90). individuals with higher socioeconomic index generally reflected the positive outcomes of the health interventions compared to those with a lower index. n = 4) and the number of female - headed households (20%, n = 3) were the most common household variables assessed. 13.3% (n = 2) of the articles showed a significant association between female - headed households and the outcomes while the remaining article did not specify its significance. 25% (n = 1) of the studies that assessed family size showed a significant association with the outcomes. the other variables assessed included distance to school from home, distance to water source, climatic season, number of people sharing bedroom / toilet with child, pupil to latrine ratio, water quantity used, and crowding index. data on other household variables than the listed above were rarely collected in all the studies reviewed. n = 4) and the number of female - headed households (20%, n = 3) were the most common household variables assessed. 13.3% (n = 2) of the articles showed a significant association between female - headed households and the outcomes while the remaining article did not specify its significance. 25% (n = 1) of the studies that assessed family size showed a significant association with the outcomes. the other variables assessed included distance to school from home, distance to water source, climatic season, number of people sharing bedroom / toilet with child, pupil to latrine ratio, water quantity used, and crowding index. data on other household variables than the listed above were rarely collected in all the studies reviewed. latrine coverage in schools was the most common variable assessed (60%, n = 9) followed by school area / location and water source at school (13.3%, n = 2) each. information gathered on school characteristics included school area / location, latrine coverage, pupil - latrine ratio, water source at school, hand washing soap on basin, means of waste disposal, and washup point after toilet. 44.4% (n = 4) of the studies that assessed latrine coverage showed a significant association with the outcomes while 50% (n = 2) of the studies that assessed school area (highlands versus lowlands) and water sources found a significant association with the outcomes. the prevalence of diarrheal infections was lowest in children from households located in mountainous regions. in rural cambodian school children, diarrheal incidences were largely reduced in households which utilized improved water sources and sanitation facilities. latrine coverage in schools was the most common variable assessed (60%, n = 9) followed by school area / location and water source at school (13.3%, n information gathered on school characteristics included school area / location, latrine coverage, pupil - latrine ratio, water source at school, hand washing soap on basin, means of waste disposal, and washup point after toilet. 44.4% (n = 4) of the studies that assessed latrine coverage showed a significant association with the outcomes while 50% (n = 2) of the studies that assessed school area (highlands versus lowlands) and water sources found a significant association with the outcomes. the prevalence of diarrheal infections was lowest in children from households located in mountainous regions. in rural cambodian school children, diarrheal incidences were largely reduced in households which utilized improved water sources and sanitation facilities. the major data on environmental characteristics collected in most studies were those regarding drinking water sources in households (46.6%, n = 7) and obtaining water samples (26.6%, n = 4). 42.9% (n = 3) of the studies that assessed drinking water sources found a significant association with the outcome. improved water sources including public wells and stand pipes were significantly associated with positive health outcomes. chlorine treatment was not significantly associated with improved child health outcomes in a randomized controlled trial. other data assessed included water source contamination / water quality and water access (availability). the major data on environmental characteristics collected in most studies were those regarding drinking water sources in households (46.6%, n = 7) and obtaining water samples (26.6%, n = 4). 42.9% (n = 3) of the studies that assessed drinking water sources found a significant association with the outcome. improved water sources including public wells and stand pipes were significantly associated with positive health outcomes. chlorine treatment was not significantly associated with improved child health outcomes in a randomized controlled trial. other data assessed included water source contamination / water quality and water access (availability). 20% (n = 3) of the studies assessed the association between nutrition practices and the outcomes. the variables collected included : food handling food preparation, food consumption, acute malnutrition, breast feeding, and meat consumption. 20% (n = 3) of the studies assessed the association between nutrition practices and the outcomes. the variables collected included : food handling food preparation, food consumption, acute malnutrition, breast feeding, and meat consumption. other data collected in the studies reviewed included nasal swab samples (for influenza testing), age of respondents, crowding index, sewage spillage, and contaminated fomites. the most commonly assessed variables in the studies reviewed include hand washing (66.6%, n = 10), latrine coverage (60%, n = 9), sanitation practices (53.3%, n = 8), prior knowledge, and use of soap (46.6%, n = 7). majority of the studies showed a significant association between these variables and the outcomes (see table 1). a reduced risk of parasitic infections was observed in children with substantial knowledge regarding hygiene and sanitation practices (aor 0.78, ci 0.561.09). their knowledge was also reflected in their clean clothing (aor 1.62, ci 1.142.29). there was only one study that examined the impact of hygiene practices on absenteeism due to infectious illness among pupils in elementary schools. the students at the intervention school were required to wash their hands before the first lesson, before lunch, and before going home while those at the control school continued their usual hand washing practices. the rates of absenteeism for the students in the intervention school were significantly reduced compared with those in the control school (p = 0.002). the effects of reduced absenteeism were more prominent on female students (1.05, 95% ci 0.901.22) compared to their male counterparts (0.87, 95% ci = 0.721.05). there were 4 studies that examined the impact of the combination of hand hygiene instructions and provision of hygiene facilities. they included both us- and non - us - based studies conducted in texas, chicago, egypt, and pittsburgh. the study conducted in north texas was geared towards controlling a shigella outbreak in an elementary and middle school. installing liquid soap in dispensers in student restrooms followed by sustained instruction in hand washing and monitoring of hygiene practices among students the results showed that appropriate soap supplies and repeated instruction in hand washing and its monitoring were needed to control the shigella outbreak. the study conducted in chicago assessed the role of hand hygiene instruction in decreasing illness - related absenteeism in two public elementary schools during the peak flu season. students in the intervention group also received short repetitive instruction in hand hygiene every two months. the results of the study showed higher rates of attendance among students that received hand hygiene instruction during the flu season (p = 0.002, p < 0.001, resp.). the study conducted in egypt assessed the effects of hand hygiene campaigns on the incidence of laboratory - confirmed influenza and absenteeism in school children. children in the intervention schools were required to wash hands twice daily and health messages were provided through entertainment activities. an intensive campaign to promote hand hygiene was launched in the intervention schools to raise the awareness of students, teachers, nurses, and parents ; it required students to wash their hands at least twice during the school day for 45 seconds, followed by proper rinsing and drying with a clean cloth towel. the results showed a significant reduction in illness - related absenteeism, infections rates including diarrhea, conjunctivitis, and influenza by the following frequencies : 40%, 30%, 67%, and 50%, respectively (p < 0.0001). in another randomized controlled trial, children in 5 intervention schools received training about hand and respiratory hygiene and were provided and encouraged to use hand sanitizer regularly while the children in the other 5 schools acted as controls. prior to implementation of the interventions, there was a 45-minute presentation at intervention schools regarding influenza and proper hand washing technique and sanitizer use. hand sanitizer dispensers with 62% alcohol - based hand sanitizer were installed in each classroom and all major common areas of intervention schools. the children were required to utilize it several times daily including upon arrival, before and after lunch, and prior to departure was taught to students. they were also encouraged to wash hands or use additional doses of hand sanitizer as needed. the total absence episodes were significantly reduced among children in the intervention group compared to the controls, adjusted irr 0.74 (95% ci : 0.56, 0.97). there were 3 randomized controlled trials that utilized a combination of water treatment and hygiene practices and education (kenya, n = 2 ; india, n = 1) [21, 28, 29 ]. one of the prior studies done in kenya assessed the impact of a hygiene curriculum and the installation of hand washing and drinking stations towards reducing diarrhea and acute respiratory infections in students. hygiene education was provided through the provision of instructional materials and training for teachers and students while water stations installed were strategically located near latrines for hand washing to improve hygiene practices. the results showed a decrease in the median percentage of students with acute respiratory illness but no decrease in diarrhea among students. in another study conducted in kenya, the role of school children in the promotion of point - of - use water treatment and hand washing in schools and their impact on reducing pupil absenteeism rates water stations which utilized a flocculent / disinfectant called pur were installed and teachers and students received training on hygiene as well as instructional books. student absenteeism rates decreased after implementation by 26%. in another study conducted in india, the impact of a school - based safe water intervention on household adoption of point - of - use water treatment practices was assessed. the intervention consisted of providing classrooms of 200 schools with a commercial water purifier, training of students and teachers, and provision of basic hygiene and water treatment information. there was no evidence that the intervention was effective in improving uptake of water treatment practices. only one study was conducted in kenya which utilized multiple intervention components involving water treatment, hygiene promotion, and sanitation to assess their impact on pupil absence. schools were randomized to one of three study arms including water treatment and hygiene promotion (wt and hp), water treatment, hygiene promotion, and sanitation (wt, hp, and sanitation), and a control group. the intervention provided water guard (a 1.2% chlorine based point - of - use water disinfectant for water treatment). hygiene promotion incorporated an education component which involved a 3-day training of teachers as well as provision of hand - washing and drinking water containers while the sanitation component involved the provision of latrine facilities to the students. the addition of a sanitation component as an intervention arm resulted in a marginally significant reduction in absenteeism among the students (or 0.47, 0.211.05). the studies reviewed assessed 4 major outcomes of the effect of water and sanitation hygiene practices in children. these included absenteeism, infections (diarrhea / acute respiratory), knowledge / attitudes / practices, and adoption of point of use water treatment (table 2). information regarding absenteeism was defined and collected differently in the various studies reviewed [13, 19, 22, 27, 30 ]. absence periods were defined as number of days absent due to a single cause, with at most 2 days of attendance or a weekend between events and was recorded based on the number of absences due to infectious causes as reported by pupils, teachers and parents, or number of absences caused by illness per 100 student - weeks and was recorded based on the number of absences due to illness as reported by parents and school records, or measured using number of absences due to illness and non - illness from both parents and teachers. one of the studies did not define absence days but absence records were ascertained from schools. illness - related absenteeism children constitutes about 75% of all school absences and is largely attributed to respiratory and gastro - intestinal infections. incorporating an educational component in the interventions access to hand hygiene instruction and hygiene facilities improved attendance at public elementary schools during the flu season. of all the studies that were geared towards reducing absenteeism, gender was significant in 33% (n = 2) of the studies. the benefits of hand washing were more pronounced in females with the highest rates of absenteeism [10, 13 ]. some of the limitations of the existing studies were self - reporting with regard to illness incidences and compliance. others include small sample sizes, and loss to followup. the variables assessed regarding knowledge, attitudes, and practices included knowledge of prior water treatment, use of soap / sanitizer (46%, n = 7), latrine coverage in household and community (60%, n = 9), hand washing frequency (80%, n = 12), sanitation practice (latrine use, 53%, n = 8), household water treatment, water storage practices (20%, n = 3), and prior knowledge of hygiene practices (20%, n = 3). only 5 studies gathered information about the knowledge, attitudes, and practices of school children in relation to infections (diarrhea, intestinal protozoa, schistosomiasis) and the use of improved water sources. data regarding drying material availability, hygiene practices (taking bath, brushing teeth, and washing hair and feet), sewage spillage, and vaccination were sparsely collected in the studied reviewed. 46% (n = 7) of the studies in this review assessed water access, sanitation, and hygiene practices in relation to diarrhea prevalence and other infectious disease incidences among school - age children. the risk factors for diarrhea identified included ; a lack of education on hygiene practices, age of child, area of residence, maternal education, and source of water, toilet facility, disposal of waste and multiple children aged less than 5 yrs residing together. 40% (n = 6) of the studies utilized education as a key component of the interventions and it was found to be significant in 4 of those studies. a key factor which determined the child 's access to safe water sources and improved sanitation and hygiene infrastructure was socioeconomic status. individuals with higher socioeconomic index especially in the middle 40% generally reflected the positive outcomes of the health interventions compared to those with a lower index. the incidence of respiratory infections was also significantly associated with independent variables including child 's age, gender, and family wealth. the studies were conducted in india, (n = 1) and kenya, (n = 1). the study conducted in india assessed the impact of a school - based safe water intervention on household adoption of point - of - use water treatment practices while the study conducted in kenya evaluated the role of school children in the promotion of point - of - use water treatment and hand washing in households as well as its effect on students absence. they were both randomized controlled trials and utilized combined interventions including water treatment, hygiene practices, and hygiene education. the study conducted in india did not show statistically significant results while that conducted in kenya showed improved knowledge of water treatment (4991%, p < 0.0001) and this effect was retained even after a followup period of 13 months (p = 0.53). results of our systematic review yielded fifteen studies which assessed the impact of wash practices to improve the knowledge, attitudes, practices, and child health outcomes. these health outcomes include absenteeism, diarrhea, acute respiratory infections, and adoption of point of use water treatment. more than half of the studies (53%, n = 8) were randomized controlled trials, followed by 40% (n = 6) cross - sectional studies and 6% (n = 1) being a case series study. 60% (n = 9) of the studies were interventions that involved water treatment, hygiene practices, hygiene education, and sanitation in single form or in combination. various data collected included socio - demographics, household and school characteristics, and environmental factors. higher rates of infection by helminthes and protozoa were more prevalent in the younger age group consisting of children aged 7 - 8 years old compared to the older children aged 8 to 10 years. negative child health outcomes were more common in children in lower grade levels, specifically grade 3. the impact of the wash interventions differed with respect to gender and socioeconomic indices with children in higher socioeconomic levels showing better outcomes. 44.4% (n = 4) of the studies that assessed latrine coverage showed significant association with the outcomes while 50% (n = 2) of the studies that assessed school area (highlands versus lowlands) and water sources found a significant association with the outcomes. the structure, cleanliness, and general outlook of latrines were implicated in the rate of utilization of sanitary facilities by the school children, with children being more likely to utilize well - kept sanitary facilities or outside sources. the most commonly assessed variables with highest significance were latrine coverage and hand washing practices while the least commonly assessed were school characteristics including pupil - latrine ratio, availability of soaps in toilets, water source contamination, water availability, drying material availability, and several household variables including number of people sharing bedroom or toilet with child. this review showed that several independent variables were implicated in the adoption of wash practices and found to be significantly associated with the outcomes. they include the age of the child, gender, grade level, socioeconomic index, access to hygiene and sanitary facilities, and prior knowledge of hygiene practices. all the studies done in developing countries reported a positive effect of sanitation practices on reducing diarrhea prevalence [19, 22, 28 ]. most of the studies involved children within grade level 3, who were at high risk for gastrointestinal and acute respiratory infections which could have been a source of bias. studies have shown that children in grade 3 are at high risk of being infected with schistosomiasis in communities with high prevalence of this disease. some of the limitations observed in the various studies in this group included self - reporting of illness incidences leading to misclassification, underrepresented sample sizes, recall bias by parents in diarrheal incidences of their children, restricting studies to a particular age group, gender restriction, and the use of cross - sectional study designs. in the study done in pittsburg, reason for absence in students could only be ascertained in 34% of absences ; this is largely attributed to the inability to contact the parent or guardian. other limitations included a confounding of the impact of interventions due to similar ongoing interventions making it difficult to evaluate the outcomes, restriction of the study to a particular gender, and study sample restriction to only children present at the start of the school term leading to a loss of generalizability [13, 21, 27, 30 ]. this review identified a gap in assessment of nutrition practices which is a key factor related to the various outcomes studied especially diarrheal infections and should therefore be given more attention in future research. the studies assessed the health and educational effects of wash practices in schools on reducing absenteeism and diarrhea prevalence / infections among school - age children on a short term. however, there have been little or no empirical studies which examined the long term impact of wash interventions on child health outcomes, and therefore limited data to support future interventions. this was noted as a limitation in various studies showing a high loss to followup, where followup was present. the positive effect of an education component in the intervention on the uptake and adherence to hygiene practices should be noted in future research. knowledge was implicated in several studies in this review as a facilitator in the uptake of hygiene practices and interventions [5, 21 ]. several key independent variables including age of the child, gender, grade level, socioeconomic index, access to hygiene and sanitary facilities use and prior knowledge of hygiene practices which were significantly associated with child health outcomes should be noted and controlled for in future interventions. the review concluded that the importance of access to safe water, hand washing facilities, and hygiene education can not be underscored in abating water - borne illnesses, malnutrition, school absenteeism, and generally improving the quality of life and learning performance in children. | purpose. this review was done to explore the impact of water treatment, hygiene, and sanitary interventions on improving child health outcomes such as absenteeism, infections, knowledge, attitudes, and practices and adoption of point - of - use water treatment. methods. a literature search was conducted using the databases pubmed and google scholar for studies published between 2009 and 2012 and focusing on the effects of access to safe water, hand washing facilities, and hygiene education among school - age children. studies included were those that documented the provision of water and sanitation in schools for children less than 18 years of age, interventions which assessed wash practices, and english - language, full - text peer reviewed papers. results. fifteen studies were included in the final analysis. 73% (n = 11) of the studies were conducted in developing countries and were rural based (53%, n = 8). the child 's age, gender, grade level, socioeconomic index, access to hygiene and sanitary facilities, and prior knowledge of hygiene practices were significantly associated with the outcomes. nutrition practices which are key factors associated with the outcomes were rarely assessed. conclusion. further research is required to assess the long - term impact of such interventions in different settings. |
a zinc prophenol - catalyzed direct asymmetric aldol reaction between glycine schiff bases and aldehydes is reported. the design and synthesis of new prophenol ligands bearing 2,5-trans - disubstituted pyrrolidines was essential for the success of this process. the transformation operates at room temperature and affords syn -hydroxy--amino esters in high yields with good to excellent levels of diastereo- and enantioselectivity. |
|
thirty adult new zealand white rabbits (2.0 to 3.0 kg, 20 weeks old) were used for this study. the animals were handled in accordance with the association for research and vision and ophthalmology statement for the use of animals in ophthalmic and vision research. all surgical procedures were performed identically in both experimental and control eyes by a single surgeon (jhj) as follows. in the first group (15 rabbits), the animals were treated with intramuscular injections of bevacizumab (1.25 mg/0.05 ml) in the right superior rectus muscle and with normal saline (0.05 ml) in the left superior rectus muscle. in the second group (15 rabbits), animals received subconjunctival injections of bevacizumab (2.5 mg/0.1 ml) in the superior conjunctiva of the right eye and normal saline (0.1 ml) subconjunctival injections in the left eye. each rabbit was anesthetized with ketamine (400 mg / kg ; huons, seoul, korea) and xylazine (5 mg / kg ; bayer, seoul, korea) and placed in a stereotactic frame. the eyelids were opened using a speculum, and proparacaine was dropped into the conjunctival cul - de - sac. in the first group, the superior conjunctiva and tenon 's capsule were opened, and the superior rectus muscle was isolated from other tissues using cotton swabs and a muscle hook. intramuscular injections were performed under direct visualization of the superior rectus muscle. after exposure, the superior rectus muscle was grasped with forceps, and a 30-gauge needle was placed 5 mm behind the insertion of the superior rectus muscle along the direction of the muscle fiber, and bevacizumab or normal saline was injected slowly. in the second group, subconjunctival injections were performed 3 mm behind the superior corneal limbus. the needle was removed 30 seconds after completion of injection to allow diffusion of the bevacizumab into the subconjunctival space and muscle and also to reduce leakage in both groups. after surgery, 3 mg / ml of ofloxacin (tarivid ; santen, osaka, japan) eye drops were administered in each eye in both groups. all animals were observed and examined regularly for evidence of gross inflammatory reactions and scar formation by an investigator (hyc) in a blinded fashion. the animals were randomly sacrificed with an overdose of barbiturate anesthesia either one day, two weeks or four weeks post operation, and all eyes were enucleated and examined. after sacrifice, the sites of muscle injection (5 mm behind the muscle insertion) and subconjunctival injection (3 mm behind the muscle insertion) were processed for light microscopic histopathologic evaluation of acute inflammatory reactions and late fibrotic scar formation of muscle tissue. one day postoperatively, acute inflammatory reactions were evaluated in five rabbits from each group. sections were stained with hematoxylin and eosin (h&e) for general histologic observation and also with antibodies for cd 11b that were specific for inflammatory cells : macrophages, monocytes and neutrophils. we performed h&e staining to assess global histologic changes of both groups two weeks after surgery. both eyes from every rabbit were evaluated for post inflammatory fibrotic scar formation and global histologic changes of each group four weeks postoperatively. isolated tissues were examined using masson 's trichrome staining for scar tissue formation and h&e staining for general histologic observation. the fibrosis was graded based on the amount of collagen formation as follows : 0 = no fibrosis ; 1 = mild perimuscular fibrotic reaction (stained collagen was detectable only in thin bands immediately adjacent to the muscle) ; 2 = easily detected thick bands ; 3 = well - developed, dense bands of collagen ; and 4 = a severe fibrotic response replacing large areas. we investigated ultra - structural muscle tissue changes after bevacizumab muscle injection (one day and four weeks after surgery) by electron microscope. the specimens were pre - fixed with 2.5% glutaraldehyde (4, phosphate buffer, ph 7.2) and were post - fixed with 1% osmium tetroxide in the same buffer. the materials were dehydrated with a graded ethyl alcohol series and embedded in epoxy resin (epon 812 mixture). thick sections (1 m) were stained with 1% toluidine blue for light microscope examination. thin sections (50 to 60 nm) were prepared by an ultramicrotome (reichert supernova ; leica, wein, austria) and were double stained with uranyl acetate and lead citrate. thin sections were also examined with a transmission electron microscope (jem 1200ex - ii ; jeol, tokyo, japan). all surgical procedures were performed identically in both experimental and control eyes by a single surgeon (jhj) as follows. in the first group (15 rabbits), the animals were treated with intramuscular injections of bevacizumab (1.25 mg/0.05 ml) in the right superior rectus muscle and with normal saline (0.05 ml) in the left superior rectus muscle. in the second group (15 rabbits), animals received subconjunctival injections of bevacizumab (2.5 mg/0.1 ml) in the superior conjunctiva of the right eye and normal saline (0.1 ml) subconjunctival injections in the left eye. each rabbit was anesthetized with ketamine (400 mg / kg ; huons, seoul, korea) and xylazine (5 mg / kg ; bayer, seoul, korea) and placed in a stereotactic frame. the eyelids were opened using a speculum, and proparacaine was dropped into the conjunctival cul - de - sac. in the first group, the superior conjunctiva and tenon 's capsule were opened, and the superior rectus muscle was isolated from other tissues using cotton swabs and a muscle hook. intramuscular injections were performed under direct visualization of the superior rectus muscle. after exposure, the superior rectus muscle was grasped with forceps, and a 30-gauge needle was placed 5 mm behind the insertion of the superior rectus muscle along the direction of the muscle fiber, and bevacizumab or normal saline was injected slowly. in the second group, subconjunctival injections were performed 3 mm behind the superior corneal limbus. the needle was removed 30 seconds after completion of injection to allow diffusion of the bevacizumab into the subconjunctival space and muscle and also to reduce leakage in both groups. after surgery, 3 mg / ml of ofloxacin (tarivid ; santen, osaka, japan) eye drops were administered in each eye in both groups. all animals were observed and examined regularly for evidence of gross inflammatory reactions and scar formation by an investigator (hyc) in a blinded fashion. the animals were randomly sacrificed with an overdose of barbiturate anesthesia either one day, two weeks or four weeks post operation, and all eyes were enucleated and examined. after sacrifice, the sites of muscle injection (5 mm behind the muscle insertion) and subconjunctival injection (3 mm behind the muscle insertion) were processed for light microscopic histopathologic evaluation of acute inflammatory reactions and late fibrotic scar formation of muscle tissue. one day postoperatively, acute inflammatory reactions were evaluated in five rabbits from each group. sections were stained with hematoxylin and eosin (h&e) for general histologic observation and also with antibodies for cd 11b that were specific for inflammatory cells : macrophages, monocytes and neutrophils. we performed h&e staining to assess global histologic changes of both groups two weeks after surgery. both eyes from every rabbit were evaluated for post inflammatory fibrotic scar formation and global histologic changes of each group four weeks postoperatively. isolated tissues were examined using masson 's trichrome staining for scar tissue formation and h&e staining for general histologic observation. the fibrosis was graded based on the amount of collagen formation as follows : 0 = no fibrosis ; 1 = mild perimuscular fibrotic reaction (stained collagen was detectable only in thin bands immediately adjacent to the muscle) ; 2 = easily detected thick bands ; 3 = well - developed, dense bands of collagen ; and 4 = a severe fibrotic response replacing large areas. we investigated ultra - structural muscle tissue changes after bevacizumab muscle injection (one day and four weeks after surgery) by electron microscope. the specimens were pre - fixed with 2.5% glutaraldehyde (4, phosphate buffer, ph 7.2) and were post - fixed with 1% osmium tetroxide in the same buffer. the materials were dehydrated with a graded ethyl alcohol series and embedded in epoxy resin (epon 812 mixture). thick sections (1 m) were stained with 1% toluidine blue for light microscope examination. thin sections (50 to 60 nm) were prepared by an ultramicrotome (reichert supernova ; leica, wein, austria) and were double stained with uranyl acetate and lead citrate. thin sections were also examined with a transmission electron microscope (jem 1200ex - ii ; jeol, tokyo, japan). mild conjunctival redness developed at the surgical site in some of the eyes in the first group. however, no significant ocular, periocular or orbital changes were noted in the treated eyes, and no gross changes were visible in the treated muscles at necropsy. in the first group (muscle injection group), the extraocular muscle layers in all eyes were intact with no evidence of tissue injury or muscle fiber disorganization. the muscle fibers lacked hyper - contracted muscle fiber, showed even staining and were of uniform size in diameter with arrangement. however, there was minimal influx of cd-11 positive cells into the connective tissue of the extraocular muscle after direct muscle injections of bevacizumab and normal saline one day after the procedure. these cellular responses were of the same degree without significant differences between eyes that received bevacizumab injection and normal saline injection (fig., we did not observe tissue necrosis or inflammatory cell infiltration in eyes that received bevacizumab and normal saline muscle injections ; there were no remarkable differences between experimental and control eyes. masson trichrome staining revealed that the median value of fibrosis grading in the bevacizumab injection group and the normal saline injection group was 0 (no fibrosis), and the capillary networks and muscle global appearance of each muscle section were intact four weeks after bevacizumab injection and normal saline injection (fig., we observed no inflammatory cellular infiltration in h&e staining and no significant influx of cd-11 positive cells into muscle or connective tissue in eyes that received bevacizumab and normal saline injections one day after the procedure. there was no evidence of muscle necrosis and fibrosis in any of the sections from eyes that received bevacizumab and normal saline subconjunctival injections at two and four weeks after the procedure (fig. the nuclei and cell membranes remained morphologically unaffected, and the distinct banding patterns of sarcomeres were intact after the injections. in addition, the appearance of myonuclei was within the normal range, and we observed no significant differences between the control groups. the vascular beds, nerve endings and satellite cells appeared intact, and no significant differences were noted at all times in all sections (fig. in the first group (muscle injection group), the extraocular muscle layers in all eyes were intact with no evidence of tissue injury or muscle fiber disorganization. the muscle fibers lacked hyper - contracted muscle fiber, showed even staining and were of uniform size in diameter with arrangement. however, there was minimal influx of cd-11 positive cells into the connective tissue of the extraocular muscle after direct muscle injections of bevacizumab and normal saline one day after the procedure. these cellular responses were of the same degree without significant differences between eyes that received bevacizumab injection and normal saline injection (fig., we did not observe tissue necrosis or inflammatory cell infiltration in eyes that received bevacizumab and normal saline muscle injections ; there were no remarkable differences between experimental and control eyes. masson trichrome staining revealed that the median value of fibrosis grading in the bevacizumab injection group and the normal saline injection group was 0 (no fibrosis), and the capillary networks and muscle global appearance of each muscle section were intact four weeks after bevacizumab injection and normal saline injection (fig., we observed no inflammatory cellular infiltration in h&e staining and no significant influx of cd-11 positive cells into muscle or connective tissue in eyes that received bevacizumab and normal saline injections one day after the procedure. there was no evidence of muscle necrosis and fibrosis in any of the sections from eyes that received bevacizumab and normal saline subconjunctival injections at two and four weeks after the procedure (fig. the nuclei and cell membranes remained morphologically unaffected, and the distinct banding patterns of sarcomeres were intact after the injections. in addition, the appearance of myonuclei was within the normal range, and we observed no significant differences between the control groups. the vascular beds, nerve endings and satellite cells appeared intact, and no significant differences were noted at all times in all sections (fig. the histological characteristics of mammalian extraocular muscles, which perform the functions of both red and white muscles, differ in many respects from those of other striated muscles. extraocular muscle is distinguished by the finest fibers of any striated muscles, and the nerve supply to the extraocular muscles is astonishingly rich. extraocular muscles vary in diameter from 9 to 17 m and contain different types of muscle fibrils with intricate, ultramicroscopic structures and fibers with highly differentiated nerve endings. physiologically, extraocular muscle requires and receives more oxygen than other skeletal muscles and contracts much more quickly than other voluntary muscles. all of these characteristics of extraocular muscles are related to fine extraocular muscle regulation, and any muscle injuries caused by extrinsic agents can lead to extraocular muscle dysfunction. some drugs that have been used in the ophthalmic arena have produced extraocular muscle toxicity [8 - 11 ]. although the molecular patho - mechanisms of each drug are different, they follow similar histopathological courses. in acute stages, inflammatory cell infiltration is observed in muscle tissue, and necrobiotic changes may follow, ranging from fiber vacuolation and myocyte edema up to total disintegration of intracellular structures and myonecrosis. subsequently, satellite cells become activated, and muscle fibers are regenerated ; in the final stages of inflammation, injured muscle demonstrates muscle atrophy and surrounding tissue fibrosis. the present study found no significant tissue destruction on h&e staining or tissue fibrosis on masson 's trichrome stain after intramuscular and subconjunctival bevacizumab injection. cd-11b immunohistochemistry revealed no significant inflammatory cell infiltration in extraocular muscle tissue compared to control eyes. although the intramuscular bevacizumab and normal saline injection groups showed minimal inflammatory cell infiltration in the connective tissue during the acute phase, this infiltration spontaneously disappeared and was probably related to direct needle injury or to the surgical procedure itself. electron microscopic findings also revealed no significant necrosis of the muscle fiber and no remarkable vascular changes. there are many ocular disorders in which vegf plays a major role, such as retinal and choroidal vasoproliferative disorders, neovascular glaucoma and corneal neovascularization. furthermore, vegf is a vital factor in the inflammatory process and wound healing response, and it is present in extraocular muscle and retroorbital tissue. therefore, we expect that bevacizumab will be a useful future treatment modality in intraocular or extraocular ocular disorders. in the current study, we observed no evidence of muscle injury or vascular network damage in any of the sections examined. nevertheless, a normal histological appearance does not rule out functional changes to extraocular muscles. the effects of repeated exposure and the half - life of bevacizumab in the extraocular muscle are unknown ; therefore, further studies will be required to evaluate the long - term safety of this drug and the possibility of functional side effects. in summary, we believe that the conventional dose of bevacizumab induced no extraocular muscle toxicity and was a safe agent for extraocular muscle. | purposethe purpose of this study was to investigate the myotoxicity of bevacizumab on extraocular muscles in a rabbit model.methodsthirty new zealand white rabbits were used for this study. the animals were evenly divided into two groups. in the first group, 15 rabbits were treated with intramuscular injections of bevacizumab (1.25 mg/0.05 ml) in the right superior rectus muscle and normal saline solution (0.05 ml) in the left superior rectus muscle. in the second group, 15 rabbits were treated with subconjunctival injections of bevacizumab (2.5 mg/0.1 ml) in the right superior subconjunctival area and normal saline solution (0.1 ml) in the left superior subconjunctival area. five rabbits in each group were sacrificed at one day, two weeks and four weeks after the injections. extraocular muscle samples were prepared for light microscopic (lm) and electron microscopic (em) examination. degrees of acute inflammation were evaluated via cd-11b immunohistochemistry, and global muscle change was investigated using hematoxylin and eosin stains. intensity of fibrosis was evaluated using masson trichrome stains, and ultrastructural changes were observed on em.resultswe observed no significant inflammatory cell infiltration, muscle necrosis or fibrotic change in treated and control eyes. em findings revealed no significant damage to muscle or vascular tissue after bevacizumab injection.conclusionswe found no signs of extraocular muscle toxicity after lm and em intramuscular and subconjunctival bevacizumab injections in a rabbit model. |
during an influenza pandemic, measures to stop the transmission of influenza virus will be a critical part of the public health response. although influenza is known to be transmitted through respiratory secretions containing the virus, infectious material can be passed from person to person in many different ways. the relative importance of the different pathways is uncertain and probably varies depending upon the setting, the severity of the illness, the characteristics of the viral strain, environmental conditions, and other factors.1 in order to choose the appropriate interventions to block the spread of the virus, it is necessary to understand which routes of transmission occur and when they are likely to be important. the role of airborne transmission in the spread of influenza has been a question of particular concern to the public health community while planning for a possible pandemic.2, 3 if patients can readily infect others via aerosols (small airborne particles) produced during coughing, speaking, sneezing, and breathing, then interventions such as patient isolation and cohorting, increased air ventilation and filtration, air disinfection, and the use of respirators or other personal protective equipment may help to protect healthcare workers and other patients from the illness. on the other hand, such interventions can be costly and timeconsuming and would place additional burdens on healthcare systems when they are already under considerable strain during a pandemic. because of these issues, organizations such as the institute of medicine and the world health organization have called for more research to provide a better understanding of influenza transmission, especially airborne transmission.3, 4 several reports have provided support for the idea that airborne influenza transmission can occur.5, 6, 7, 8 influenza virus rna has been detected in respirable airborne particles collected in healthcare facilities and other locations.9, 10, 11, 12, 13, 14, 15, 16 influenza virus rna also has been found in aerosol particles collected directly from infected patients while they were coughing and breathing.17, 18, 19, 20, 21, 22, 23 six studies have demonstrated that influenza patients expel airborne particles containing viable virus.13, 18, 19, 21, 24, 25 pantelic. found that subjects with influenza emitted up to 1000 viable influenza virions over 30 minutes during normal tidal breathing.25 lindsley. detected viable influenza a virus in airborne particles produced during coughing by 7 of 17 influenza patients (41%).24 however, even with these reports, the likelihood of airborne transmission is still unclear, in part because many questions remain about the production of aerosols carrying infectious influenza during respiratory activities. for example, no studies have compared the production of virusladen airborne particles between different types of respiratory activities, such as coughing and exhalation. this is an important question, because the airflow dynamics of coughs and exhalations are very different. coughing produces a highvelocity jet that can propel a plume of aerosol particles long distances, which disperses the airborne particles widely.26 exhalations have much lower velocities and are likely to produce higher particle concentrations in the immediate vicinity of a patient and lower concentrations further away. exhalations are also more common than coughs, which could affect the amount of infectious aerosol that is generated. these differences could have a significant impact on disease transmission and on the choice of interventions. a comparison of infectious particle production during coughing and exhaling also would provide clues as to the sites of origin of influenzaladen particles from within the respiratory tract. humans produce more aerosol particles when they cough vs. when they exhale.27, 28 most of the aerosol particles produced during normal breathing are thought to originate deep in the respiratory tract, while coughing may produce aerosol both from the lower airways and also from the upper airways.29, 30, 31 thus, if coughing produces much more infectious aerosol than exhaling, this would suggest that much of the virus in coughgenerated particles may be coming from the upper airways. conversely, if the production of infectious aerosol particles during coughing and exhaling is similar, then that would suggest that much of the virusladen aerosol is originating in the bronchioles and alveoli. the purpose of this study was to directly compare the production of aerosol particles containing viable influenza virus by infected people during coughs and exhalations. greater knowledge about the generation of infectious aerosol particles during different respiratory maneuvers will help to better understand the likelihood and dynamics of the possible modes of influenza transmission in different scenarios and will assist in the selection and evaluation of interventions to prevent the spread of disease. all procedures involving human subjects were reviewed and approved by the national institute for occupational safety and health (niosh) and west virginia university (wvu) institutional review boards. cough and exhalationgenerated aerosols were collected using an aerosol particle collection system (figure 1) similar to that described previously.24 an ultrasonic spirometer (easy one, ndd medical technologies) measured the volume and flow rate of each cough, and a modified 10liter pistonstyle mechanical spirometer (sensormedics model 762609) served as an accumulation chamber for the cough and exhalation aerosols. aerosol particles were collected using an skc biosampler with a 5ml vessel (# 2259593, skc) containing 5 ml of viral transport media (vtm) consisting of hank 's balanced salt solution (hbss ; invitrogen) supplemented with 01% bovine serum albumin (bsa ; sigmaaldrich), 100 units / ml penicillin g, and 100 units / ml streptomycin (invitrogen). the particle collection efficiency for the skc biosampler (i.e., the percentage of particles of a given size that are collected by the sampler) is approximately 10% for particles with aerodynamic diameters of 01 m ; 50% for 03 m particles ; 96% for 1 m particles ; 100% for 2 m particles ; and 50% for 8 m particles.32, 33, 34 particles larger than 1015 m are expected to be removed by the sampler elbow and not collected. collection system for airborne particles produced by subjects during coughing and exhalation. before each respiratory activity, the piston spirometer was purged and partially filled with 4 liters of dry filtered air. the subject then sealed their mouth around the mouthpiece and coughed or exhaled as instructed. the cough or exhalation traveled through the ultrasonic spirometer, which measured the volume and flow rate, and then into the piston spirometer. when the subject was finished, the valve was closed and the skc biosampler was used to collect the aerosol particles produced by the subject. potential test subjects presenting with influenzalike symptoms at an outpatient clinic were recruited after they had been seen by their healthcare provider. potential participants were excluded from the study if they reported respiratory illnesses such as severe asthma, chronic obstructive pulmonary disease, or tuberculosis ; serious illnesses such as diabetes or heart disease ; pregnancy ; or any condition that would make it difficult or uncomfortable to inhale deeply and cough and exhale forcefully. after the study was explained to the test subject and informed consent was obtained, two nasopharyngeal swabs and an oropharyngeal swab were taken from the subject and placed in 3 ml of vtm (these will be referred to as nop swabs). the subject was instructed to inhale as deeply as possible, seal their mouth around the mouthpiece, and cough into the machine using as much of the air in their lungs as possible. next, the subject was asked to repeat the procedure but to exhale as much and as rapidly as possible rather than coughing. this was also repeated three times, and the exhalationgenerated aerosol was collected after each exhalation using the aerosol sampler. the order of the coughing and exhalation was alternated so that oddnumbered subjects were asked to cough three times followed by three exhalations, while evennumbered subjects were asked to exhale three times followed by three coughs. to prevent crosscontamination, the collection system was purged three times with clean dry air after each cough or exhalation, and a new mouthpiece was used for each subject. after the coughs or exhalations were completed, the vtm were removed from the skc biosampler and placed in a storage tube. all samples in vtm were kept on ice until the end of the day and then transported to the laboratory and stored at 80c until analysis. each subject was only asked to perform one test session. in previous studies of cough and exhalation aerosols by our group and others, the largest problem has been detecting the small amounts of viable virus present in these aerosol samples.13, 18, 19, 21, 24 in this study, a viral replication assay (vra) was used to determine whether viable influenza virus was present in the samples that were collected.35 the vra is more sensitive and easier to use with small sample quantities than a traditional viral plaque assay or tissue culture infectious dose assay.35 in experiments with aerosols containing viable influenza virus, the vra amplified the amount of infectious virus in the samples by a factor of 46 10. 35 for the nop swab samples, madin darby canine kidney (mdck) cells (ccl34) were plated at a density of 50 10 per well in a 96well plate (costar 96well tissue culture plate, corning). the wells were washed by adding 100 l of phosphatebuffered saline (pbs) ml to the inoculum and removing the resulting supernatant. the cells were overlaid with 100 l supplemented dulbecco 's modified eagle 's medium (dmem)/f12 and incubated for 20 hours at 35c in a humidified 5% co2 incubator to allow for viral replication. total rna was isolated from the cells and supernatant with the magmax96 total rna isolation kit (ambion) and transcribed into cdna using the high capacity cdna reverse transcription kit (life technologies). a 5 l cdna volume was analyzed using quantitative pcr (qpcr) with a custom primer / probe set specific for the matrix (m1) gene or the h3 hemagglutinin gene of influenza a virus. details about the primers and probes are provided in the online supporting information. for the cough and exhalation aerosol samples, a 6well formatted vra assay was used to increase the sensitivity for detecting influenza virus in the aerosol samples. mdck cells plated at a density of 15 10 per well (costar 6well tissue culture plate, corning) were incubated at 35c in a humidified 5% co2 incubator overnight. for each sample, duplicate wells with confluent cellular monolayers were next washed two times with 2 ml pbs (invitrogen) and treated with a 12 ml sample volume for 45 minutes. the wells were washed by adding 12 ml of pbs to the inoculum and removing the resulting supernatant. one ml of supplemented dulbecco 's modified eagle 's medium (dmem)/f12 containing 100 units / ml penicillin g/100 g / ml streptomycin (invitrogen), 2 mm lglutamine (invitrogen), 02% bsa (sigmaaldrich), 10 mm hepes (invitrogen), 022% sodium bicarbonate (invitrogen), 001% deaedextran (mp biomedicals, llc, solon, oh), and 2 g / ml nptosyllphenylalanine chloromethyl ketone (tpck) (sigmaaldrich) was added to each well. treated mdck cells were subsequently incubated for 20 hours at 35c in a humidified 5% co2 incubator to allow for viral replication. the treated cellular monolayer was lysed with 1 ml of magmax lysis / binding solution concentrate (ambion) and the lysate was pooled with the reserved culture supernatant (final volume of ~ 2 ml) and stored at 80c until total rna was isolated. to account for the larger sample volume in the 6well formatted vra, total rna was isolated using a modified magmax96 total rna isolation kit (ambion) protocol. a 1 ml volume of moleculargrade 2propanol (sigma) was mixed by inversion into each thawed, pooled sample followed by the addition of 20 l prepared bead mix (thermo scientific). the supernatant was discarded and the resulting rnabound bead pellet was resuspended in 150 l wash solution 1 and transferred to a 96well processing plate. the manufacturer 's instructions were followed for the remainder of the total rna isolation procedure. total rna was eluted with 30 l of elution buffer and transcribed into cdna using the high capacity cdna reverse transcription kit (life technologies). a 5 l cdna volume was analyzed for the m1 gene using qpcr. during the qpcr assay portion of the vra, the limit of quantitation (loq) of the qpcr assay was 15 viral copies per pcr tube, which corresponded to a threshold cycle (ct) value of 341. the limit of detection (lod) based on qpcr only was 10 viral copies per tube, which corresponded to a threshold cycle (ct) value of 358. in cases where a pcr product was detected but the ct value was higher than the ct value for the loq, then the pcr product was evaluated by agarose gel electrophoresis to verify that the pcr product was the correct size (101 base pairs for the m1 matrix gene). sample volumes of 10 l were loaded into a 45% agarose gel (nusieve gtg agarose, lonza) along with 10 l of a 100bp dna ladder (n3231l, new england biolabs). the lod with this additional step was as little as 1 viral copy per reaction tube. for additional verification, dna sequence analysis was performed on randomly chosen cough and exhale samples by a commercial laboratory (genewiz, inc.) using predefined sanger dna sequencing. because of the low concentration of influenza virus in the cough and exhalation aerosol samples, in many cases the amount of virus detected using the qpcr assay was below the limit of quantitation for the assay. for this reason, the results are reported here only as positive or negative for influenza a. to reduce the possibility of falsepositive results, only test subjects who had nop swabs that were positive for influenza by the m1 and h3 gene assays were considered to be confirmed to have an influenza infection and were used in the data analysis. when analyzing the experimental data, a sample was considered to be positive for influenza if a pcr product was detected in one or more of the qpcrs and the product was confirmed to be the correct size by gel electrophoresis. for example, each cough or exhalation aerosol sample was tested by inoculating and incubating two culture wells of mdck cells, isolating and reverse transcribing the rna produced by the cells in each well, and conducting duplicate qpcr assays for each well. because of the low amounts of viable influenza found in the cough and exhalation aerosols, many of the qpcrs had ct values that were close to the maximum limit of 45 cycles for the qpcr assay. for this reason, if any one of the four qpcrs yielded a pcr product of the correct size, then that sample was considered influenza positive even if no pcr product was detected in the other three reactions. the full results from the qpcr assays are presented in the supporting information with the online version of this article. statistical analyses included comparison of proportion of positive coughs and exhalations using mcnemar 's test for paired dichotomous data.36 the chisquare test was performed to test for differences in positive cough and exhalation proportions between the two orders of testing (cough then exhalation vs. exhalation then cough). cough and exhalationgenerated aerosols were collected using an aerosol particle collection system (figure 1) similar to that described previously.24 an ultrasonic spirometer (easy one, ndd medical technologies) measured the volume and flow rate of each cough, and a modified 10liter pistonstyle mechanical spirometer (sensormedics model 762609) served as an accumulation chamber for the cough and exhalation aerosols. aerosol particles were collected using an skc biosampler with a 5ml vessel (# 2259593, skc) containing 5 ml of viral transport media (vtm) consisting of hank 's balanced salt solution (hbss ; invitrogen) supplemented with 01% bovine serum albumin (bsa ; sigmaaldrich), 100 units / ml penicillin g, and 100 units / ml streptomycin (invitrogen). the particle collection efficiency for the skc biosampler (i.e., the percentage of particles of a given size that are collected by the sampler) is approximately 10% for particles with aerodynamic diameters of 01 m ; 50% for 03 m particles ; 96% for 1 m particles ; 100% for 2 m particles ; and 50% for 8 m particles.32, 33, 34 particles larger than 1015 m are expected to be removed by the sampler elbow and not collected. collection system for airborne particles produced by subjects during coughing and exhalation. before each respiratory activity, the piston spirometer was purged and partially filled with 4 liters of dry filtered air. the subject then sealed their mouth around the mouthpiece and coughed or exhaled as instructed. the cough or exhalation traveled through the ultrasonic spirometer, which measured the volume and flow rate, and then into the piston spirometer. when the subject was finished, the valve was closed and the skc biosampler was used to collect the aerosol particles produced by the subject. potential test subjects presenting with influenzalike symptoms at an outpatient clinic were recruited after they had been seen by their healthcare provider. potential participants were excluded from the study if they reported respiratory illnesses such as severe asthma, chronic obstructive pulmonary disease, or tuberculosis ; serious illnesses such as diabetes or heart disease ; pregnancy ; or any condition that would make it difficult or uncomfortable to inhale deeply and cough and exhale forcefully. after the study was explained to the test subject and informed consent was obtained, two nasopharyngeal swabs and an oropharyngeal swab were taken from the subject and placed in 3 ml of vtm (these will be referred to as nop swabs). the subject was instructed to inhale as deeply as possible, seal their mouth around the mouthpiece, and cough into the machine using as much of the air in their lungs as possible. next, the subject was asked to repeat the procedure but to exhale as much and as rapidly as possible rather than coughing. this was also repeated three times, and the exhalationgenerated aerosol was collected after each exhalation using the aerosol sampler. the order of the coughing and exhalation was alternated so that oddnumbered subjects were asked to cough three times followed by three exhalations, while evennumbered subjects were asked to exhale three times followed by three coughs. to prevent crosscontamination, the collection system was purged three times with clean dry air after each cough or exhalation, and a new mouthpiece was used for each subject. after the coughs or exhalations were completed, the vtm were removed from the skc biosampler and placed in a storage tube. all samples in vtm were kept on ice until the end of the day and then transported to the laboratory and stored at 80c until analysis. in previous studies of cough and exhalation aerosols by our group and others, the largest problem has been detecting the small amounts of viable virus present in these aerosol samples.13, 18, 19, 21, 24 in this study, a viral replication assay (vra) was used to determine whether viable influenza virus was present in the samples that were collected.35 the vra is more sensitive and easier to use with small sample quantities than a traditional viral plaque assay or tissue culture infectious dose assay.35 in experiments with aerosols containing viable influenza virus, the vra amplified the amount of infectious virus in the samples by a factor of 46 10. for the nop swab samples, madin darby canine kidney (mdck) cells (ccl34) were plated at a density of 50 10 per well in a 96well plate (costar 96well tissue culture plate, corning). the wells were washed by adding 100 l of phosphatebuffered saline (pbs) ml to the inoculum and removing the resulting supernatant. the cells were overlaid with 100 l supplemented dulbecco 's modified eagle 's medium (dmem)/f12 and incubated for 20 hours at 35c in a humidified 5% co2 incubator to allow for viral replication. total rna was isolated from the cells and supernatant with the magmax96 total rna isolation kit (ambion) and transcribed into cdna using the high capacity cdna reverse transcription kit (life technologies). a 5 l cdna volume was analyzed using quantitative pcr (qpcr) with a custom primer / probe set specific for the matrix (m1) gene or the h3 hemagglutinin gene of influenza a virus. for the cough and exhalation aerosol samples, a 6well formatted vra assay was used to increase the sensitivity for detecting influenza virus in the aerosol samples. mdck cells plated at a density of 15 10 per well (costar 6well tissue culture plate, corning) were incubated at 35c in a humidified 5% co2 incubator overnight. for each sample, duplicate wells with confluent cellular monolayers were next washed two times with 2 ml pbs (invitrogen) and treated with a 12 ml sample volume for 45 minutes. the wells were washed by adding 12 ml of pbs to the inoculum and removing the resulting supernatant. one ml of supplemented dulbecco 's modified eagle 's medium (dmem)/f12 containing 100 units / ml penicillin g/100 g / ml streptomycin (invitrogen), 2 mm lglutamine (invitrogen), 02% bsa (sigmaaldrich), 10 mm hepes (invitrogen), 022% sodium bicarbonate (invitrogen), 001% deaedextran (mp biomedicals, llc, solon, oh), and 2 g / ml nptosyllphenylalanine chloromethyl ketone (tpck) (sigmaaldrich) was added to each well. treated mdck cells were subsequently incubated for 20 hours at 35c in a humidified 5% co2 incubator to allow for viral replication. the treated cellular monolayer was lysed with 1 ml of magmax lysis / binding solution concentrate (ambion) and the lysate was pooled with the reserved culture supernatant (final volume of ~ 2 ml) and stored at 80c until total rna was isolated. to account for the larger sample volume in the 6well formatted vra, total rna was isolated using a modified magmax96 total rna isolation kit (ambion) protocol. a 1 ml volume of moleculargrade 2propanol (sigma) was mixed by inversion into each thawed, pooled sample followed by the addition of 20 l prepared bead mix (thermo scientific). the supernatant was discarded and the resulting rnabound bead pellet was resuspended in 150 l wash solution 1 and transferred to a 96well processing plate. the manufacturer 's instructions were followed for the remainder of the total rna isolation procedure. total rna was eluted with 30 l of elution buffer and transcribed into cdna using the high capacity cdna reverse transcription kit (life technologies). during the qpcr assay portion of the vra, the samples were subjected to 45 pcr amplification cycles. the limit of quantitation (loq) of the qpcr assay was 15 viral copies per pcr tube, which corresponded to a threshold cycle (ct) value of 341. the limit of detection (lod) based on qpcr only was 10 viral copies per tube, which corresponded to a threshold cycle (ct) value of 358. in cases where a pcr product was detected but the ct value was higher than the ct value for the loq, then the pcr product was evaluated by agarose gel electrophoresis to verify that the pcr product was the correct size (101 base pairs for the m1 matrix gene). sample volumes of 10 l were loaded into a 45% agarose gel (nusieve gtg agarose, lonza) along with 10 l of a 100bp dna ladder (n3231l, new england biolabs). the lod with this additional step was as little as 1 viral copy per reaction tube. for additional verification, dna sequence analysis was performed on randomly chosen cough and exhale samples by a commercial laboratory (genewiz, inc.) using predefined sanger dna sequencing. because of the low concentration of influenza virus in the cough and exhalation aerosol samples, in many cases the amount of virus detected using the qpcr assay was below the limit of quantitation for the assay. for this reason, the results are reported here only as positive or negative for influenza a. to reduce the possibility of falsepositive results, only test subjects who had nop swabs that were positive for influenza by the m1 and h3 gene assays were considered to be confirmed to have an influenza infection and were used in the data analysis. when analyzing the experimental data, a sample was considered to be positive for influenza if a pcr product was detected in one or more of the qpcrs and the product for example, each cough or exhalation aerosol sample was tested by inoculating and incubating two culture wells of mdck cells, isolating and reverse transcribing the rna produced by the cells in each well, and conducting duplicate qpcr assays for each well. because of the low amounts of viable influenza found in the cough and exhalation aerosols, many of the qpcrs had ct values that were close to the maximum limit of 45 cycles for the qpcr assay. for this reason, if any one of the four qpcrs yielded a pcr product of the correct size, then that sample was considered influenza positive even if no pcr product was detected in the other three reactions. the full results from the qpcr assays are presented in the supporting information with the online version of this article. statistical analyses included comparison of proportion of positive coughs and exhalations using mcnemar 's test for paired dichotomous data.36 the chisquare test was performed to test for differences in positive cough and exhalation proportions between the two orders of testing (cough then exhalation vs. exhalation then cough). for this study, 61 adult volunteer subjects were recruited from college students presenting with influenzalike symptoms at wvu medicine student health services in morgantown, west virginia, usa, during january and february in 2015. a summary of the demographic information, oral temperatures, cough volume, cough peak flow rate, and symptoms reported by the test subjects in which viable influenza a virus was detected is shown in table 1. information for all of the patients is included in the online supporting information nasopharyngeal and oropharyngeal (nop) swabs were tested for viable influenza a virus using the viral replication assay (vra) with qpcr assays for the m1 matrix gene. fiftythree nop swab samples (87%) were positive for viable influenza a. the h3type hemagglutinin gene was detected in all 53 samples, consistent with the prevalence of h3n2 influenza a in the united states during the 20142015 influenza season. only test subjects with influenzapositive nop swabs were considered to be confirmed to be infected with influenza and were used in the data analysis. viable influenza a virus was found in cough aerosol samples from 28 of 53 subjects and in exhalation aerosol samples from 22 of 52 subjects confirmed to have influenza (one exhalation aerosol sample was lost before analysis). the difference in the number of influenzapositive coughs vs. influenzapositive exhalations was not statistically significant (p = 02207). 37 subjects had influenzapositive nop swabs and influenzapositive cough or exhalation aerosols, while for 15 subjects, influenza was detected in the nop swabs but not in the cough or exhalation aerosols. thirteen subjects had both cough aerosol and exhalation aerosol samples that contained viable influenza a virus, 15 had positive cough aerosol samples but negative exhalation samples, 9 had positive exhalation samples but negative cough samples, and 15 had negative cough and exhalation samples. the order in which the experiment was performed (coughs followed by exhalations, or exhalations followed by coughs) did not have a significant effect on the results (p = 02499). the influenza results for all test subjects are shown in table 2. presence or absence of viable influenza a virus in nop swabs, cough aerosol particles, and exhalation aerosol particles for each patient. h3 and m1 indicate the influenza a gene that was targeted in the pcr portion of the vra to confirm that the qpcrs in the vra were amplifying influenza virus, the size of the pcr products were verified by agarose gel electrophoresis. an example electrophoretic gel is shown in figure 2. a total of 484 qpcrs were performed to analyze the cough and exhalation aerosol samples from the 61 subjects. of these, a matrix gene pcr product was detected in 89 reactions. in 79 reactions (89%), gel electrophoresis of the pcr product produced a 101base pair band, indicating the presence of influenza a. in the remaining 192 pcrs, a pcr product was not detected and no 101base pair bands were observed. the pcr products from 12 h3 gene analyses of the nop swabs also were tested and found to be of the correct size (150 base pairs). as additional verification, the vra m1 gene pcr products from 7 cough aerosol samples and 9 exhalation aerosol samples were sent to a commercial laboratory for sequence analysis. all 7 of the cough aerosol pcr products and 7 of the 9 exhalation aerosol pcr products were confirmed to match the matrix gene segment m1 from influenza a. two of the exhalation aerosol pcr products could not be sequenced. electrophoretic gel used to determine the presence or absence of a 101base pair pcr product corresponding to the influenza a m1 matrix gene. the pcr products for the nop swabs, cough aerosols, and exhalation aerosols for three test subjects are shown. (+) indicates the sample is positive for influenza a. () indicates the sample is negative. the pcr products for the cough and exhalation samples for subject fc178 were confirmed to be from the influenza a m1 matrix gene by dna sequence analysis. the negative control contained all pcr reagents, primers, and probe but no template. the positive control contained 10 m1 copies and was run in parallel with the experimental samples. humans infected with influenza virus have been shown to expel small airborne particles containing viable virus into the environment when they cough or exhale, which suggests that the potential exists for the airborne transmission of influenza.13, 18, 19, 21, 24 however, it is not clear how often airborne transmission actually occurs or what factors affect the likelihood of transmission by the airborne route, in part because many questions remain about the processes involved in infectious aerosol production and the dynamics of these aerosols in the environment. consistent with previous studies, our results show that aerosol particles containing viable influenza virus are produced by infected individuals both during coughing and during exhalation. viable virus was detected more often in cough aerosol samples (53% of influenzapositive subjects) compared to exhalation aerosols (42% of influenzapositive subjects). as people breathe constantly but cough sporadically, this suggests that patients infected with influenza may release more virus into the air over time in small airborne particles by breathing compared to coughing. on the other hand, as coughing involves much higher air velocities than breathing, coughing may spread the virus further in a given location. thus, both mechanisms for producing infectious aerosols may be important depending upon such factors as the distance from a patient, the timescale, the infectious dose, and the air flow within a room. viable influenza virus was detected in the cough aerosol, exhalation aerosol, or both from 37 of 53 influenzapositive test subjects (70%), which suggests that this is a common phenomenon. it should be noted that the aerosol collection system used in these experiments does not capture particles larger than 1015 m in the collection media, and thus collects only small particles capable of airborne transmission and not the large droplets often referenced in droplet disease transmission. viable influenza was detected in both the cough and exhalation aerosols for 35% of these subjects (13/37), while it was only detected in the cough aerosol for 41% (15/37) and only in the exhalation aerosol for 24% (9/37). these results are consistent with somewhat more infectious aerosol being released during coughing than breathing, although they probably also reflect the fact that the airborne viable virus concentrations are quite low and are difficult to detect. two patients had influenzapositive cough aerosols but negative nop swabs, while one had a positive exhalation aerosol but a negative nop swab. one possible explanation is that, because some patients did not tolerate the nasopharyngeal swabs well, the sample obtained may not have been sufficient for detection of influenza. 19 reported that the amount of influenza rna detected in nop swabs was only weakly correlated with the amount detected in exhaled breath ; thus, it may be that these three patients had sufficient influenza virus in their lower respiratory tract to produce infectious aerosol particles but insufficient virus in their nasopharyngeal region to be detected. finally, the possibility of a falsepositive cough or breath sample or a falsenegative nop swab result can not be excluded. for consistency and to reduce the possibility of falsepositive results, only patients with positive nop swabs were considered to be confirmed to be infected with influenza and included in our analysis. because of the low concentrations of airborne viable influenza virus in the cough and exhalation aerosol samples, we were not able to quantify the amount of airborne viable virus present in the original samples in our experiments. however, this should not be interpreted to mean that the risk of infection is low. our samples were collected from only three coughs and three exhalations, while a person infected with influenza would be expected to cough dozens of times and breathe hundreds of times per hour and thus could still release a considerable amount of airborne infectious material over the course of a day. in addition, the infectious dose for airborne influenza is very low ; one study found that inhalation of small aerosol particles containing only 07 to 35 plaqueforming units (pfu) of influenza was sufficient to cause seroconversion in 50% of the human subjects tested.37 the fact that the number of aerosol samples with viable influenza was not significantly greater for coughing than for exhalation is consistent with the theory that a substantial portion of the influenzaladen aerosol produced by infected people originates in the deepest parts of the lungs rather than in the upper airways and oropharyngeal region. smaller aerosol particles have been proposed to be produced in the alveolar and bronchial regions during both breathing and coughing by the formation and rupture of menisci as airways contract and expand. larger particles are thought to be created by shear forces acting on fluidcovered upper airways, where air velocities are much higher than in the deeper regions. this phenomenon is thought to occur primarily during coughing because the air flow rates are much higher than during breathing.29, 30, 31 since, in this theory, deep lung particle generation occurs during both breathing and coughing while upper airway particle generation occurs only during coughing, then the modest increase in the number of positive samples seen during coughing compared to exhalation in our experiments supports the idea that much of the infectious aerosol is originating in the deep lung regions. the ability of our system to collect cough and exhalation aerosols separately was useful for the present study, but it also significantly limited the study because of the small amount of aerosol that was collected. by comparison, the system used by milton. collects aerosols produced by natural coughs and exhalations over a 30minute period, and that group has reported greater success in detecting and quantifying airborne influenza virus.19, 25, 38 thus, our results suggest that future work studying infectious aerosol production and the presence of infectious aerosols in the environment should collect sample volumes that are as large as practically possible, which would likely entail using high sample flow rates and long sample times. unfortunately, however, maintaining high flow rates and long sample times while attempting to collect airborne viruses and maintain their viability is very challenging, especially when the viruses are contained in submicrometer aerosol particles. finally, it is important to acknowledge the limitations of our experiments. first, the single most difficult aspect of studying the production of aerosols containing viable influenza virus during respiratory activities is the low concentration of such viruses in the air and the difficulty in collecting enough material and maintaining viability to detect the viable virus. to maximize the sensitivity of our assays and reduce the possibility of falsenegative results as much as possible, the evaluation criteria for our results were designed to provide the greatest likelihood of detecting small amounts of viable influenza virus, with steps then taken to minimize the possibility of falsepositive results. however, we recognize that the possibility of some falsepositive outcomes can not be ruled out in our analysis. second, our test subjects were asked to inhale as deeply as possible and then cough or exhale using as much of the air in their lungs as possible. most natural coughs and normal tidal breathing use smaller fractions of the total lung capacity, which may reduce aerosol generation. on the other hand, natural coughs are stimulated by a need to clear secretions from the airways, and thus, natural coughs may produce more aerosol particles than forced coughs. it is also possible that the ratio of the amount influenzaladen aerosol particles produced during natural coughing to that produced during natural breathing may be different than the ratio we found when comparing forced coughs to forced exhalations. third, the particle collection efficiency of the skc biosampler decreases from about 96% for 1 m aerosol particles to about 50% for 03 m particles and 10% for 01 m particles.32, 33, 34 thus, many of the smallest particles carrying influenza virus may not have been collected in our experiments. as noted earlier, particles larger than 1015 m were not collected and thus their potential contribution to disease transmission is not known. in addition, some cough aerosol particles may have deposited inside the system before they could be collected. in our previous study using the cough aerosol collection system,24 swab samples from the face of the spirometer piston and the biosampler elbow found little influenza, suggesting that particle losses in these locations were minimal. however, other parts of the system, such as the mouthpiece, were not tested. last, influenza viral shedding peaks around the first day of acute respiratory illness and then declines rapidly.19, 21, 39, 40, 41 in our study, patients presented at the clinic an average of two days after their symptoms developed (table 1), well after the expected maximum in viral shedding. in addition, our test subjects were collegeaged ambulatory outpatients with no other reported respiratory illnesses or significant health conditions. patients who are more severely ill would generally be expected to have higher viral loads and may be more likely to produce cough and exhalation aerosols containing infectious influenza virus, especially in the early stages of illness.40, 42 patients who are younger or older, immunocompromised, or have underlying pulmonary illness such as asthma or chronic obstructive pulmonary disease also may have very different infectious aerosol generation patterns. this could be an important factor during an influenza pandemic, when healthcare facilities would be expected to receive large numbers of severely ill patients. the purpose of this study was to directly compare the expulsion of aerosol particles containing potentially infectious influenza virus during coughing and exhalation. our results confirm that the production of aerosols containing viable influenza virus is common among infected people. viable virus was detected more often in cough aerosols than in exhalation aerosols, but the difference was not large. as individuals breathe more often than they cough, these results suggest that breathing may generate more airborne infectious material than coughing over time our results are also consistent with the theory that much of the aerosol containing viable influenza originates deep in the lungs, although more direct investigation would be needed to verify this. figure s1. for the direct pcr analysis of the nasopharyngeal and oropharyngeal (nop) swabs, | backgroundto prepare for a possible influenza pandemic, a better understanding of the potential for the airborne transmission of influenza from person to person is needed.objectivesthe objective of this study was to directly compare the generation of aerosol particles containing viable influenza virus during coughs and exhalations.methodssixtyone adult volunteer outpatients with influenzalike symptoms were asked to cough and exhale three times into a spirometer. aerosol particles produced during coughing and exhalation were collected into liquid media using aerosol samplers. the samples were tested for the presence of viable influenza virus using a viral replication assay (vra).resultsfiftythree test subjects tested positive for influenza a virus. of these, 28 (53%) produced aerosol particles containing viable influenza a virus during coughing, and 22 (42%) produced aerosols with viable virus during exhalation. thirteen subjects had both cough aerosol and exhalation aerosol samples that contained viable virus, 15 had positive cough aerosol samples but negative exhalation samples, and 9 had positive exhalation samples but negative cough samples.conclusionsviable influenza a virus was detected more often in cough aerosol particles than in exhalation aerosol particles, but the difference was not large. because individuals breathe much more often than they cough, these results suggest that breathing may generate more airborne infectious material than coughing over time. however, both respiratory activities could be important in airborne influenza transmission. our results are also consistent with the theory that much of the aerosol containing viable influenza originates deep in the lungs. |
removal of smear layer has been considered as an important step in periodontal regenerative therapy. scaling and root planning alone with saline irrigation does not remove the smear layer. the addition of a detergent to edta proved to remove smear layer more efficiently than edta alone. traditional surgical and non - surgical periodontal therapies aim at arresting periodontal disease by removal of plaque from disease affected roots. thus, etching has been recommended as an adjunct to mechanical root surface debridement to remove smear layers and root - associated endotoxins,[24 ] and to expose collagen fibers on the dentin surface. however, concerns have been expressed regarding the possible necrotizing effect on surrounding vital periodontal tissues of etching agents operating at low ph, and thus, etching at neutral ph with calcium chelating agents such as ethylenediaminetetraacetic acid (edta) have been explored giving favorable results with respect to less flap failure and more connective tissue attachment. several studies have shown that contaminated cementum as well as the smear layer inhibit cell migration and attachment leading to impaired marginal periodontal healing. however, both histological and clinical surgical studies have presented contradictory results regarding the success of marginal periodontal healing following etching, and thus, the rationale for routine use of etching in conventional periodontal therapy has been questioned. nevertheless, in regenerative procedures where recolonization of large areas of the root surface by periodontal connective tissue is a necessity, removal of the smear layer is of singular importance. in addition, etching has been reported to expose collagen fibers on the root surface. etching at neutral ph was shown to preserve tissue vitality, while etching at low ph induced an immediate necrosis. it was concluded that etching at neutral ph appeared in the short - term perspective to produce a more biocompatible surface compared to etching at low ph. etching of such a surface may yield variable results compared to the more homogenous dentin exposed after scaling and root planning. cell and fiber attachment to healthy cementum surfaces in vitro is facilitated by citric acid etching. although the same is not seen after etching of periodontitis affected cementum surfaces, cementum bound endotoxin is capable of both cell death and decrease cell proliferation. smear layer is resistant to saline irrigation and the effect of edta alone has already been proven. the addition of texapon, a derivative of sodium lauryl sulfate (sls) with edta, has shown to provide better smear layer removal than edta alone. soft soap, a detergent, belongs to the sls family and is cost effective. hence, the aim of the present in vitro study is to evaluate the efficacy of 15% edta - s (edta with soft soap) preparation for the removal of smear layer at human root surfaces. twenty teeth (molars) indicated for extraction, due to periodontal disease were obtained from the department of diagnosis and oral surgery at the s.d.m.c.d.s, dharwad. after extraction, the teeth were stored in a container with saline solution to avoid dehydration of the specimens. using high speed cylindrical bur under copious irrigation, two parallel retention grooves were made on the root surface, one at cemento - enamel junction (cej) and other 4 mm apical to the first groove. an experimental smear layer was induced by instrumenting the root surfaces 12 times with gracey 7 - 8 curette (hu - friedy). following root planning, the root surface was cut using diamond disc and crown was separated from the root. all root conditioning agents were drawn in a 5 ml syringe (15% edta, saline control, and 15% edta with soft soap 1:1 concentrate). samples were then randomly divided into five groups ; one sample from each group was randomly selected for the application of root conditioning agent. the efficacy of two different methods of application active application with brush and passive with cotton pellet was also assessed. the samples were treated with the test and the control agents and allowed to dry for three min. after lapse of the allotted time interval, the specimen was thoroughly irrigated with copious amount of saline. the specimens were then mounted on metallic stubs, coated with 20 nm of gold (ion sputtering) for observation and photography by scanning electron microscopy (jeol jsm 840a) at 3500 for the presence or absence of smear layer. root surface without smear layer, with the dentinal tubules completely opened without evidence of smear layer in the dentinal tubulesroot surface without smear layer, with the dentinal tubules completely opened, but with some evidence of smear layer in the dentinal tubules entranceroot surface without smear layer with the dentinal tubules partially openedroot surface covered by a uniform smear layer with evidence of dentinal tubule openingroot surface covered by a uniform smear layer without evidence of opening of the dentinal tubulesroot surface covered by an irregular smear layer, with the presence of grooves and or scattered debris root surface without smear layer, with the dentinal tubules completely opened without evidence of smear layer in the dentinal tubules root surface without smear layer, with the dentinal tubules completely opened, but with some evidence of smear layer in the dentinal tubules entrance root surface without smear layer with the dentinal tubules partially opened root surface covered by a uniform smear layer with evidence of dentinal tubule opening root surface covered by a uniform smear layer without evidence of opening of the dentinal tubules root surface covered by an irregular smear layer, with the presence of grooves and or scattered debris smear layer removal was evaluated according to sampaio., index. root surface without smear layer, with the dentinal tubules completely opened without evidence of smear layer in the dentinal tubulesroot surface without smear layer, with the dentinal tubules completely opened, but with some evidence of smear layer in the dentinal tubules entranceroot surface without smear layer with the dentinal tubules partially openedroot surface covered by a uniform smear layer with evidence of dentinal tubule openingroot surface covered by a uniform smear layer without evidence of opening of the dentinal tubulesroot surface covered by an irregular smear layer, with the presence of grooves and or scattered debris root surface without smear layer, with the dentinal tubules completely opened without evidence of smear layer in the dentinal tubules root surface without smear layer, with the dentinal tubules completely opened, but with some evidence of smear layer in the dentinal tubules entrance root surface without smear layer with the dentinal tubules partially opened root surface covered by a uniform smear layer with evidence of dentinal tubule opening root surface covered by a uniform smear layer without evidence of opening of the dentinal tubules root surface covered by an irregular smear layer, with the presence of grooves and or scattered debris scanning electron microscope of the control group revealed a root surface covered by an irregular smear layer, with the presence of grooves and or scattered debris. the edta groups, both passive and active applications, revealed open dentinal tubules with evidence of smear layer present. the edta - s groups with active application revealed completely open dentinal tubules with no evidence of smear layer, whereas edta - s passive application revealed open dentinal tubules with evidence of smear layer present [figures 15 ]. presence of heavy smear layer (score-6) 15% edta group : passive application for three minutes. root surface covered by smear layer with evidence of dentinal tubules opening (score-4) 15% edta - s group : passive application for three minutes. root surface covered by smear layer with evidence of dentinal tubules opening (score-4) 15% edta group : active application for three minutes. root surface devoid of smear layer with evidence of dentinal tubules opening, but some evidence of smear layer at dentinal tubule opening (score-2) 15% edta - s group : active application for three minutes. root surface devoid of smear layer with evidence of dentinal tubules opening, but no evidence of smear layer at dentinal tubule opening (score-1) the purpose of this study was to assess the efficacy of edta preparation with soft soap, a detergent in removing the smear layer on the root surface of human teeth. several authors have shown that three minute etching with edta is sufficient for the removal of smear layer compared to 10, 20, 30, 40 sec, and 1 and 2 minutes. on the other hand, soft soap is widely used in the medical field to remove incrustation in scaly skin diseases ; it is also used in solution form with warm water as an enema and this signifies its reaction with the mucous membranes and degree of safety. hence, an attempt was made to incorporate the advantages of edta and detergent like soft soap. the addition of soft soap, a tense active detergent, decreases the surface strain., 2005 achieved better results with 15% edta - t (texapon) in comparison with edta alone and found it to be statistically similar at 20% and 24% edta - t. hence, in this pilot study, we used 15% edta - s ; further studies are required to evaluate removal of smear at varying concentrations and time of application. the optimal ph for vital fibroblast cell function varies between 7.2 - 7.4, though some cells may tolerate ph of 6.6 - 7.8. demineralized root surfaces serve as a reservoir of biologically active extracellular matrix proteins and growth factors which are essential for bone and cementum formation. we also found that smear layer removal by active application was better than passive application, which was in conjunction with the study by pilatti. the application with the brush seems to provide a larger surface area compared to application by cotton pellet. thus, the method of application also plays an important role in determining the success of root conditioning. the etching of surface with edta is more effective than saline solution (control group).edta 15% is more effective, when mixed with soft soap than when used alone.active application of 15% edta - s was more efficacious than passive application. the etching of surface with edta is more effective than saline solution (control group). edta 15% is more effective, when mixed with soft soap than when used alone. | background : to evaluate the efficacy of 15% ethylenediaminetetraacetic acid (edta)-s (edta with soft soap) preparation for the removal of smear layer at human root surfaces.materials and methods : twenty teeth indicated for extraction due to periodontal disease were sectioned using high speed cylindrical bur under copious irrigation. the root surfaces were instrumented with gracey 7 - 8 curette (hu - friedy), 12 times to induce an experimental smear layer. following root planning, the root surface was cut using diamond disc and separated from the crown. samples were randomly distributed into five groups. one group was control, saline and test groups were edta 15% alone, by active and passive applications (groups 2 and 3), and edta 15%+soft soap, by active and passive applications (groups 4 and 5). specimens were then subjected to scanning electron microscope study. smear layer removal was evaluated according to sampaio., index.results:edta-s removed the smear layer better than plain edta and the control group, while active application of the root conditioning agent had significant difference than the passive application of the agent.conclusion:edta-s has favorable benefits over edta alone, and active application is better in comparison with passive application of root conditioning agent.clinical relevance : removal of smear layer has been considered as an important step in periodontal regenerative therapy. scaling and root planning alone with saline irrigation does not remove the smear layer. edta is a commonly used root conditioning agent in periodontal therapy. the addition of a detergent to edta proved to remove smear layer more efficiently than edta alone. |
diabetes is one of the most common chronic diseases of human societies and is a major problem for public health. in terms of early and late complications of the disease, the patients and the societies impose many problems (1). diabetes care may account for up to 15% of national health care budgets (2). this hidden disease imposes indirect and inestimable costs to society and causes complications such as ischemic heart disease, hypertension, types of heart failure, retinopathy, neuropathy, nephropathy, cataracts, and more. direct and indirect costs of diabetes and complications compared to other diseases are very high. diabetes is an expensive medical problem in iran so that the aggregate annual direct costs of diabetes were estimated to be $ 112.42410.732 million. diabetes complications contributed to 53% of the aggregate excess direct costs of diabetes (3). in diabetic patients, if monitoring of health situation is done with high quality in coordination with nutrition program and physician orders, the quality of care will improve dramatically (4). the best way to reduce costs of health sector is to increase the empowerment of people, prevent chronic diseases and manage appropriate health activities through monitoring patients. in fact, fast diagnosis based on regular and accurate monitoring by using information communication technology (ict) devices, can help prevent death (5). telemedicine as a main tool for remote health care delivery, home care with fast and timely access to health information (6, 7), reducing medical errors (8), increasing coordination among health care professionals (9), reducing travelling and physical presence of patients in urban health centers in remote areas (10), providing education to patients and providers, (11) and so on, can help significantly reduce health care costs and correct performance management particularly in chronic disease management (12,13). to enjoy the full benefits of e - health, making use of methods and modern technologies is very important. one of the innovations in the field of information technology in healthcare applications is agent technology. agent is a software component that uses artificial intelligence techniques to select the best course of action to achieve the user targets. some of the important abilities of agent technology are : a) they can react timely and flexibly to unexpected and dynamic changes in environment ; b) they have an autonomous and independent behavior for tasks that are assigned to them ; c) they perform proactive to reach their goals, 4- they can communicate with users or other agents, and 5- they have the ability to reason, plan and learn. also one of the characteristics of agents is mobility that because of this feature they are very suitable for remote electronic health and telemedicine (16). the aim of this study is developing a framework for agent based diabetes information management at national level through identifying required agents. proposed framework characteristics in order of priority in 2012 - 2013, a research was conducted with the help of endocrinology and metabolism research institute of tehran university of medical sciences and health information management research center in this university in order to provide a model for national diabetes information management to support decision - making, create alerts and remote monitoring of patient status and provide appropriate treatment and prevention of diabetes with high speed approach by using mobile health and agent technology. the main tool is a questioner that is designed in three sections based on studying library resources and performance of major organizations in the field of diabetes in and out of the country and also interviews with experts in the medical, health information management and software fields. the questionnaire in order to determine the validity distributed among experts in the above three areas., questions are related to the general features of agent - based diabetes management systems and the third section examines the specific features of the systems in hospitals, for medical staff and for patient care. an open question was at the end of the questionnaire in order to find expert opinions about the structure of multi - agent diabetes management. the questionnaire was distributed in delphi methods among 20 experts from health information management, software and physicians in diabetic research center. finally with the help of spss 17, results were analyzed in order to identify agents required in health information management for the prevention and treatment of diabetes and rapid analysis. the first diabetes virtual clinic in iran at tehran university of medical sciences is a non agent and user center system that by providing useful information to patients and providers helps better self - care and tele care. the most important point in virtual clinic is possibility of tele consultation and people s access to updates, accurate and necessary information about diabetes from preventive measures to decreasing side effects and better and new treatments. recently health care systems shift towards high speed access, accurate health information, online health services, high quality health care, and shared information to better decision - making. dynamic health environment needs high interoperability among professionals with different skills, various specialties and complicated processes. hence, in 2012 - 2013, a research was conducted with the help of endocrinology and metabolism research institute of tehran university of medical sciences and health information management research center in this university in order to provide a model for diabetes information management using agent technology to support decision - making, create alerts and remote monitoring of patient status and provide appropriate treatment and prevention of diabetes with high speed approach. according to the findings, important business processes in diabetes management include the following : monitor, diagnosis, consultation, information processing, decision support system, archiving documents and patient records, appropriate interface for communication between patients and health electronic systems, monitoring operations and service delivery and allocating tasks. using free plane software, the most important applications in the field of diabetes management are plotted : capabilities of diabetes management system, based on agent technology in three sections : medical centers and hospitals, medical staff, and patient care, according to the viewpoints of experts in this research, in order of priority include : in hospitals and health care centers : tele monitoring (mean 1/90), tele education (mean 2/35), transferring information to the doctors as soon as possible (mean 2/75), providing appropriate treatment for patients (mean 3/50), determining the exact location of the patient (mean 4/50)for patients : tele education (mean 2/05), intelligent alarm (mean 2/10), patient monitoring (mean 2/40), self treatment (mean 3/50), determining the exact location of hospitals and health care centers (mean 4/95)for health care personnel : tele education (mean 2/15), intelligent knowledge management (mean 2/45), intelligent alarm (mean 2/65), electronic health record management (mean 2/75). in hospitals and health care centers : tele monitoring (mean 1/90), tele education (mean 2/35), transferring information to the doctors as soon as possible (mean 2/75), providing appropriate treatment for patients (mean 3/50), determining the exact location of the patient (mean 4/50) for patients : tele education (mean 2/05), intelligent alarm (mean 2/10), patient monitoring (mean 2/40), self treatment (mean 3/50), determining the exact location of hospitals and health care centers (mean 4/95) for health care personnel : tele education (mean 2/15), intelligent knowledge management (mean 2/45), intelligent alarm (mean 2/65), electronic health record management (mean 2/75). in order to accelerate diabetes management systems based on agent, the following items must be considered : cultural readiness, providing the required technical infrastructure, application of appropriate mechanisms for security and privacy, appropriate investment, user involvement, and private sector participation. in addition to these, in agent - based diabetes management system structure, designing and creating a database backup has particular importance and a rich database must also be designed in order to provide support for various training formats and tasks. providing immediate feedback for patients, promoting interaction of the patients with the organization that provides remote health care and reinforcing their motivation for the use of telemedicine systems, patients and clinicians focusing on abnormal data that will prevent future occurrence of dangerous situations, can be considered some of the benefits of agent technology in telemedicine services delivery. it should be noted that the use of agent system only with technical view does not lead to the elimination of obstacles. in delivering health care to diabetic patients, considering social and human aspects these issues should be considered before designing and implementing agent - based systems to provide health services for diabetic patients. so, having a systematic view for implementation of agent systems and paying attention to all aspects such as : feedbacks, user acceptance, budget, motivation, hierarchy, useful standards, individual s affordability, identifying barriers and opportunities are necessary. also accelerating the application and implementation of multi - agent diabetes management systems needs providing the necessary infrastructure and appropriate readiness. furthermore, for the users, especially elderly people to make use of the system, special attention should be paid to the ease of use and user friendliness. use of reminders for patients about drug use and injection in addition to the built - in alarm system is also very important. | background : one of the characteristics of agents is mobility which makes them very suitable for remote electronic health and tele medicine. the aim of this study is developing a framework for agent based diabetes information management at national level through identifying required agents.methods:the main tool is a questioner that is designed in three sections based on studying library resources, performance of major organizations in the field of diabetes in and out of the country and interviews with experts in the medical, health information management and software fields. questionnaires based on delphi methods were distributed among 20 experts. in order to design and identify agents required in health information management for the prevention and appropriate and rapid treatment of diabetes, the results were analyzed using spss 17 and results were plotted with freeplane mind map software.results:access to data technology in proposed framework in order of priority is : mobile (mean 1/80), sms, email (mean 2/80), internet, web (mean 3/30), phone (mean 3/60), wifi (mean 4/60).conclusions : in delivering health care to diabetic patients, considering social and human aspects is essential. having a systematic view for implementation of agent systems and paying attention to all aspects such as feedbacks, user acceptance, budget, motivation, hierarchy, useful standards, affordability of individuals, identifying barriers and opportunities and so on, are necessary. |
f10.7, ap, and dst replicate time series of radiative cooling by nitric oxide quantified relative roles of solar irradiance, geomagnetism in radiative cooling establish a new index and extend record of thermospheric cooling back 70 years f10.7, ap, and dst replicate time series of radiative cooling by nitric oxide quantified relative roles of solar irradiance, geomagnetism in radiative cooling establish a new index and extend record of thermospheric cooling back 70 years the climate of the thermosphere is controlled in part by cooling to space driven by infrared radiation from carbon dioxide (co2, 15 m), nitric oxide (no, 5.3 m), and atomic oxygen (o, 63 m). the sounding of the atmosphere using broadband emission radiometry (saber) instrument [russell., 1999 ] on the nasa thermosphere - ionosphere - mesosphere energetics and dynamics (timed) satellite has been measuring infrared cooling from co2 and no in the thermosphere since january 2002 [mlynczak., these data provide integral constraints on the energy budget and climate of the atmosphere above 100 km. in this paper physically, changes in no emission are due to changes in temperature, atomic oxygen, and the no density. these physical changes, however, are driven by changes in solar irradiance and changes in geomagnetic conditions. we will show that the 13 year time series of no cooling derived from saber can be accurately fit with a multiple linear regression using standard solar and geomagnetic indices. this fit enables several fundamental properties of the no cooling to be determined, including the relative importance of solar ultraviolet irradiance and geomagnetic conditions and their variability with time. in addition, the time series of solar and geomagnetic indices extends back to 1947, allowing a reconstruction of thermospheric cooling by no back in time nearly 70 years. this reconstruction then provides a long - term time series of an integral radiative constraint on thermospheric climate that can be used to test climate models. the test can be done in two ways : first, validating the overall no radiative cooling time series, and second, validating the relative roles of solar and geomagnetic effects in determining the total cooling over time over seven very different solar cycles. previously, lu. showed a high correlation coefficient (0.89) between f10.7, the kp index, and the daily global no power for 7 years of saber data. this paper extends that work to short- and long - term climate timescales at much higher accuracy (0.985 correlation coefficient) with simpler mathematical expressions for the linear regression fits. the results presented below show that solar and geomagnetic effects jointly determine the radiative cooling by no. we therefore propose a new index, the thermosphere climate index (tci), based on the results herein. the tci can be used to assess the general state of the thermosphere because it reflects the main processes that control a key radiative cooling element of thermospheric climate. the time series of radiative cooling in the thermosphere as measured by the saber instrument on the nasa timed satellite has previously been described in detail [mlynczak., 2014, and references therein ]. we specifically look here at the daily global infrared power (w) radiated by the no molecule. this parameter is the total amount of energy radiated on a daily, global basis due to infrared emission from the no molecule at 5.3 m. the no power is derived by integrating with respect to altitude each vertical profile of radiative cooling (w / m) due to no and then integrating this with respect to latitude (area) and longitude. approximately 1500 vertical profiles of radiative cooling per day go into the global calculation. at this time over 4750 days of data comprise the time series of no infrared power and radiative cooling. the data are observed to exhibit large day - to - day variability associated with geomagnetic effects and long - term variability associated with changes in the uv output over the 11 year solar cycle. as this paper focuses on thermospheric climate, we use the daily global power radiated by no and construct a time series of the 60 day running mean of the no power. sixty days is chosen as this is the time required for the timed satellite to sample all local times. there is a strong 60 day period in the no power [mlynczak., 2008 ], implying a strong dependence of the no power on local time that is very repetitive. the local time variation is due to tidal effects in the no cooling [oberheide., the 60 day running mean gives a consistent average of the no power over all local times for each reported point in the time series. by doing so, we avoid potential biases in the no power time series due to improper sampling of local time variability. for purposes of the multiple linear regression fits, we also compute the 60 day running means of the f10.7, ap, and dst indices. f10.7 is a commonly used proxy for solar uv and euv irradiance and its variation. sixty day running means of no power, ap index, dst index, and f10.7 index from january 2002 to march 2015. visual correlations between the ap, f10.7, and dst indices and the no power are evident upon examination of figure1. these strongly suggest that the no power time series can be fit with a multiple linear regression involving these three standard solar and geomagnetic indices. the integrated power (area under each curve) from january 2002 to january 2015 agrees to better than 2 ppm. the inclusion of dst in addition to ap and f10.7 was found to slightly improve the agreement in regions where there is a marked peak in the no power. without dst sixty day running mean of the daily global radiated power from nitric oxide observed by saber (blue curve) and the multiple linear regression fit using the 60 day running means of f10.7, ap, and dst. the fit shown in figure2 is remarkable in the sense that the complex photochemical and geomagnetic energetic processes that ultimately lead to thermospheric infrared cooling can be represented so accurately by three standard solar and geomagnetic indices. this allows extension of the fit back in time with the extant databases of the three standard indices. both f10.7 and ap are available back to 1947, and dst is available back to 1957. from these we can construct a time history of no cooling back nearly 70 years and covering almost seven solar cycles, from the peak of solar cycle (sc) 18 to the peak of sc 24 today. figure3 (top) shows the reconstruction of the thermospheric no power, which will be referred to as the thermosphere climate index (tci), as discussed in the next section. the blue curve is the reconstruction back to 1957 using ap, f10.7, and dst. figures3 (middle) and 3 (bottom) are the 60 day running means of ap and f10.7 (respectively) used in the reconstruction back to 1947. from this figure, we can see several interesting features about the time evolution of radiative cooling by no. first, the largest radiative cooling occurred back in the late 1950s during sc 19. the peak no emission briefly exceeded 4 10 w, a level that was reached only one other time in the early 1990s near the peak of sc 22. the large no power associated with sc 19 was followed by a much weaker sc 20 in which the peak no power was roughly half that of its predecessor. the minimum in no power during the prolonged minimum of sc 23 in 20082009 is the lowest power value in the time series. in addition, although sc 24 is yet to complete, the no power during the peak of sc 24 is the smallest of any prior peak in the reconstructed time series. given the fundamental role no plays in the energy budget of the thermosphere, the time series shown in figure3 provides a long - term record of an integral constraint on the energy budget of the atmosphere above 100 km. as such, the time series can be used to test upper atmosphere climate models over a variety of solar and geomagnetic conditions of the past 70 years. (top) time series of the 60 day running mean of the no power extended back to 1947, which we now refer to as the thermosphere climate index (tci). the tci is constructed from 1957 to the present day using extant databases of f10.7, ap, and dst. from 1947 to 1957 corresponding 60 day averages of (middle) ap and (bottom) f10.7 used to construct the index. the tci represents a fundamental integral constraint on the climate system of the thermosphere and provides a time series for testing upper atmosphere climate models over nearly seven complete solar cycles. the long - term time series shown in figure3 can be separated into its solar uv and geomagnetic components by using the coefficients derived for the fit shown in figure2. the expression for the fit shown in figure2 is 1 each term is the 60 day running mean of that parameter. the no power is in units of 10w, ap and dst are in nanotesla, and f10.7 is in solar flux units (sfu, 1 sfu = 1 10 w m hz). the coefficients a0, a1, a2, and a3 are, respectively, 1.0271, 1.5553 10, 4.0665 10, and 8.2360 10. the fraction of no cooling due to deposition of solar irradiance is (a1 f10.7)/(a1 f10.7 + a2 ap + a3 dst), and the fraction due to geomagnetic effects is (a2 ap + a3 dst)/(a1 f10.7 + a2 ap + a3 dst). this immediately provides an assessment of the relative roles of solar and geomagnetic processes that ultimately lead to radiative cooling by no. figure4 shows the percentage of the radiative cooling in figure3 due to solar irradiance (red curve) and geomagnetism (blue curve), obtained from these expressions. over the nearly 70 year record, about 70% of the radiative cooling is due to energy deposition of solar uv radiation and about 30% is due to geomagnetic processes. overlaid in figure4 in grey is the 60 day running mean of the daily sunspot number. from this we can see that during solar maximum conditions (as indicated by the peak in sunspots) solar irradiance is responsible for up to 90% of the radiative cooling by no. however, during solar minimum conditions, geomagnetic processes account for more than 40% of the cooling and, briefly on several occasions, are essentially comparable to solar uv. relative contributions of solar irradiance (red) and geomagnetic processes (blue) to the variability of the no cooling. the grey curve is the 60 day running mean of the daily sunspot number. solar irradiance is the dominant mechanism for energy deposition resulting in no cooling at solar maximum, while geomagnetic processes are much more important during solar minimum. solar and geomagnetic indices are individually very useful for gauging levels of solar and geomagnetic variability and activity. however, they do not individually provide information on the state of the atmosphere in response to that variability and activity. we therefore propose a new index, the thermosphere climate index (tci) that provides a quantitative measure of the state of the thermosphere. the tci would be the 60 day running mean of the no power computed from the fit of the 60 day running means of f10.7, ap, and dst to the saber - observed no power as given in equation 1. we suggest that the new index is critical because the thermosphere response in radiative cooling due to no and to carbon dioxide (co2) has been shown to occur well after the maximum in sunspot number during solar cycle 24, as we will document in a forthcoming publication. the proposed tci combines both solar irradiance and geomagnetism into one index to replicate accurately a key parameter of thermospheric climate. we further suggest that upon further modeling, the tci could be given adjectival descriptors to describe the thermal state of the thermosphere, such as those applied to the kp index and geomagnetic storms. the multiple linear regression fit of f10.7, ap, and dst to the observed saber no power tacitly assumes that these parameters adequately capture the processes associated with solar uv and geomagnetic effects that ultimately result in infrared cooling to space by no. these drivers ultimately originate with the sun as uv photons and solar wind particles. however, we point out that there is a slow, long - term driver internal to the earth system associated with the continual buildup of co2. roble and dickinson predicted that the continued buildup of co2 would lead to a long - term cooling of the thermosphere. thus, it is to be expected that over time, there would be a slow decrease in the no emission as the temperature of the lower thermosphere decreases. roble and dickinson predict decreases in lower thermospheric temperature ranging from 5 k near 100 km to 35 k near 200 km for a doubling of the co2 concentration. at 130 km, the peak altitude of no emission, a decrease of 15 k is predicted. for a nominal temperature of 525 k at 130 km, a 15 k cooling would result in a reduction of no emission of about 15% for doubled co2 amounts. we estimate that since 1947 the co2 in the atmosphere has increased by approximately 100 ppmv (annual rate of 1.5 ppmv), which is roughly one third the amount expected for co2 doubling since preindustrial times. thus, the decrease in no emission since 1947 due to co2 increase would be about 5%, assuming all other temperature - dependent processes related to no chemistry (of which there are several) are essentially constant. the long - term effects of thermospheric cooling due to carbon dioxide increase on no cooling merit further investigation. a key time series of the global infrared power radiated by no from the thermosphere can be fit quite accurately with a multiple linear regression of three solar and geomagnetic indices. this has enabled reconstruction of the no power time series back to 1947 using extant databases of the f10.7 solar radio flux, the ap index, and the dst index. the reconstructed time series enables tests of upper atmosphere climate models over the last six solar cycles. the multiple regression fit has also enabled the relative roles of solar irradiance and geomagnetic processes in driving the no cooling to be determined. in general, solar uv irradiance is the primary factor that determines the no cooling, particularly at solar maximum. during solar minimum conditions, the proposed thermosphere climate index is a new metric that accurately replicates the state of the thermosphere. its main advantage is that it provides a key measure of the state of the thermosphere that is not captured by other individual metrics. this is an important point as individual metrics such as sunspot number do not adequately reflect all of the processes which cause the atmosphere to respond to solar variability. | infrared radiation from nitric oxide (no) at 5.3 m is a primary mechanism by which the thermosphere cools to space. the sounding of the atmosphere using broadband emission radiometry (saber) instrument on the nasa thermosphere - ionosphere - mesosphere energetics and dynamics satellite has been measuring thermospheric cooling by no for over 13 years. in this letter we show that the saber time series of globally integrated infrared power (watts) radiated by no can be replicated accurately by a multiple linear regression fit using the f10.7, ap, and dst indices. this allows reconstruction of the no power time series back nearly 70 years with extant databases of these indices. the relative roles of solar ultraviolet and geomagnetic processes in determining the no cooling are derived and shown to vary significantly over the solar cycle. the no power is a fundamental integral constraint on the thermospheric climate, and the time series presented here can be used to test upper atmosphere models over seven different solar cycles.key pointsf10.7, ap, and dst replicate time series of radiative cooling by nitric oxide quantified relative roles of solar irradiance, geomagnetism in radiative cooling establish a new index and extend record of thermospheric cooling back 70 years |
anti - synthetase syndrome (as) is a clinical entity which is described classically by the triad of interstitial lung disease (ild), inflammatory myositis and presence of aminoacyl - trna synthetase antibodies (asa) [1, 2 ]. the anti - histidyl - trna synthetase (anti - jo-1) antibody is the most commonly reported antibody associated with this condition [1, 2 ]. owing to the higher prevalence of lung involvement, the overall prognosis for this syndrome seems to be worse than other myositis disorders. some studies describe a mortality of close to 70% in patients who have this condition. it is also hypothesized that as can also result in pulmonary hypertension in about 50% of cases. the clinical spectrum is vast but is usually characterized by chronic progression of shortness of breath, persistent cough, along with crepitations on lung exam with a restrictive pattern of lung disease. the disease, rare as it is, is more prevalent in women than in men. radiological findings can range from non - specific interstitial pneumonia (nsip), characterized by a wide range of radiological presentations : ground glass opacities in peripheral to lower zones ; bronchial dilatation and linear opacities ; honey combing ; or bronchiectasis. it can also present as organizing pneumonia with patchy consolidations and ground glass opacities with multiple nodules or masses. another possible presentation is as usual interstitial pneumonia characterized by lung inflammation, repair and fibrosis. in some cases, there are also typical findings of reticulation, bronchial dilation and honeycombing with minimal ground glass opacities. our patient is a 43-year - old male with no significant past medical history who presented to our emergency room with a chief complaint of shortness of breath for the duration of 2 weeks. two weeks before presentation, the patient was prescribed azithromycin by his primary care provider for a presumed diagnosis of pneumonia. on further history, the patient endorsed a non - productive cough associated with subjective fevers, chills, weakness and malaise for 1 month. he denied any past medical history of autoimmune, systemic or immune - compromising conditions. he denied any nausea, vomiting, diarrhea, muscular weakness or neurological symptoms, orthopnea or paroxysmal nocturnal dyspnea. at baseline he had no known drug allergies, took no other medications and his social history was negative other than 20 pack year smoking history. our patient worked a desk job and his occupational history was negative for any kind of environmental pollutants known to be associated with lung disease. on admission to the emergency room, the patient was afebrile, with a respiratory rate of 26 breaths / min, heart rate of 115 beats / min, with a room air saturation of 75% and blood pressure of 90/60 mm hg. physical exam was pertinent for hyperkeratosis over the index fingers and his thumbs bilaterally along with thickening noticed over the metacarpophalangeal joints and proximal interphalangeal joints. early resuscitation was initiated and the patient was treated with 6 l of oxygen via nasal cannula and given 30 cc / kg of normal saline for fluid resuscitation with normalization of his blood pressure and heart rate prior to admission to the general medical telemetry unit. on admission, his labs were remarkable for a white blood cell count of 25,000 units / l, hemoglobin level was 13.5 g / dl and platelet count of 385 10/l. on his metabolic panel, the patient s sodium level was 133 mg / dl with a bun of 13 mg / dl and creatinine of 0.69 mg / dl, with troponin being 0.09 g / l and b - type natriuretic peptide being 79 pg / ml. his liver function was remarkable for a normal alkaline phosphatase and bilirubin level with aspartate transaminase and alanine transaminase of 259 units / l and 266 units / l, respectively with a cpk of 7,500 international units / l. albumin was measured at 2.4 g / dl with a globulin level of 4.2 g / dl. his arterial blood gas values were remarkable at 7.37/43/52 on 6 l nasal cannula oxygen. mg / l and procalcitonin level was 34 ng / ml. ana showed a speckled patter with 1:320 titers, anti - jo-1 antibody was also positive at 8 and anti - ccp antibody was positive at 153. a ct scan of his chest on admission (fig. non - confluent areas of ill defined opacities were also seen in both lungs with denser consolidations and air broncho - grams mainly in the right middle lobe and both the lower lobes which were thought to be a combination of infiltrates and atelectasis. a chest x - ray (fig. 2) showed a small right - sided pleural effusion with a patchy right sided opacity. an echocardiogram (echo) evaluation revealed a moderate to large pericardial effusion (fig. 3). a chest x - ray at the end of the course of treatment showed complete resolution of the prior findings (fig. non - confluent areas of ill defined opacities were also seen in both lungs with denser consolidations and air broncho - grams mainly in the right middle lobe and both the lower lobes which were thought to be a combination of infiltrates and atelectasis. the patient required intensive care unit transfer 2 days into admission for worsening hypoxia and hypotension initially treated with 24 h of non - invasive positive pressure ventilation and subsequent mechanical ventilation. despite maximal ventilator support and pulmonary artery catheterization for optimal fluid management, the patient continued to decline. a decision to pursue veno - venous (vv) extracorporeal membrane oxygenation (ecmo) was undertaken for a diagnosis of severe acute respiratory distress syndrome 4 days into admission. owing to the radiographic and clinical findings suspicious for acute interstitial pneumonia and diagnostically negative bronchoscopic, viral, fungal, bacterial and mycobacterial serology, the patient was treated with broad spectrum antibiotics, namely, vancomycin, zosyn and azithromycin. the radiographic appearance, serologic findings combined with physical exam findings like mechanic s hands, non - specific interstitial pneumonia with a pattern of ild with elevated ck and positive anti - jo-1, heightened the suspicion of a rare form of acutely progressing as. hence, the decision was made to treat the patient with high dose methylprednisolone 1 g daily for 3 days, followed by 125 mg, four times a day for 4 days, followed by a taper of 60 mg, four times a day for 4 days. the steroid medication was further weaned down to prednisone 40 mg daily, a dosage which he was discharged on. with regard to his cardiovascular status, the patient had minimal vasopressor requirements despite his initial shock physiology. follow - up serial echocardiography noted worsening pericardial effusion, necessitating the need for both diagnostic and therapeutic pericardial window. fluid analysis showed no signs of infection with discharge surveillance echo showing no re - accumulation of pericardial fluid. the patient developed non - oliguric renal failure thought to be secondary to acute tubular necrosis from a combination of hypotension and sepsis. rhabdomyolysis was not felt to contribute to renal failure with cpks peaking at 7,500 international units / l followed by a gradual fall. the course was also complicated by an upper gastrointestinal bleed which endoscopically was attributed to erosive gastritis managed conservatively via proton pump inhibitors. over the course of his stay, the patient showed significant improvement in his respiratory, cardiovascular and renal status and was decannulated from ecmo in 2 days (yes sure it was 2 days) with transition to mechanical ventilation. as is a clinical entity which is described classically by the triad of ild, inflammatory myositis and presence of asa [1, 2 ]. the spectrum, presentation and course of this rare condition vary greatly but anti - jo-1 antibody is the most commonly reported antibody [1, 2 ]. other possible antibodies associated with this syndrome are anti - pl-7, anti - pl-12, anti - ej, anti - oj, anti - ks, anti - zo, anti - ha - yrs, and anti - srp. there is no clear consensus for diagnosis of this syndrome except the demonstration of anti - ars antibodies in the serum and ild, myositis and arthritis. minor criteria for the diagnosis of as include the presence of mechanic s hands, anti - ars antibodies are seen in 30 - 40% of patients with myositis, and in 7 - 10% of patients with idiopathic interstitial pneumonia. the most common anti - ars antibody is the anti - jo-1 antibody (60% cases of as), followed by anti - pl-7 and anti - pl-12 antibodies (10 - 15% cases of as). other antibodies are less common and are seen in less than 5% of as patients. patients with anti - jo-1 antibodies often present with arthritis, myositis and mechanics hands, whereas those with non - anti - jo-1 antibodies present with fever and ild. pulmonary involvement is encountered in majority of the cases of as and is associated with morbidity as well as mortality. the most common pulmonary manifestation of as is the presence of ild. the prevalence of ild in patients with as depends on the type of anti - ars antibody (anti - jo-1 vs. non - anti - jo-1), clinicoradiological vs. radiological presentation ; chest radiograph vs. hrct chest, and the duration of follow - up. the presence of anti - as antibody is a stronger marker for ild than myositis [14, 15 ]. for our patient, the clinical picture along with patchy consolidation and ground glass opacities in the lungs suggestive of non - specific interstitial pneumonia, supplemented by very high crp, ana titer of 1:320 and anti - jo-1 antibody positive and elevated ck, raised the suspicion for as, despite the uncharacteristically acute presentation of this condition. though as usually presents in a chronic fashion with gradually progressive muscle weakness and myopathy, the classic clinical, radiological and lab findings made us consider this in our differential. of course the definitive diagnosis could have been strengthened by lung biopsy ; however, owing to the clinical instability of the patient, this was not a feasible option and likely would not have changed management. our literature review found very few cases of this condition associated with pericardial effusion and none necessitated the use of vv ecmo in the treatment of as when examining the literature. unfortunately, treatment for the as is limited, with use of immunosuppressive medications like glucocorticoids forming the basis of therapy. serious complications of this condition include pulmonary hypertension and fibrosis. prognosis is largely determined by the extent of pulmonary involvement and its progression. our patient had a rapidly progressing and deteriorating respiratory status requiring mechanical ventilation failure requiring ecmo. however, initiation of pulse dose steroids while bridging with vv ecmo improved the clinical course rapidly and the patient did well clinically and was discharged home with physical therapy assistance. he was instructed to wean off the steroid in a taper regimen as instructed by rheumatology with instructions to follow - up with them on an outpatient basis. it would be prudent for clinicians, to keep this rare diagnosis in the differential of a patient with acute onset dyspnea, who has classic radiological and lab findings, along with a clinical picture suspicious for as. our case is rare with regard to the uncharacteristically acute nature of presentation, acute decompensation in clinical condition, development of acute interstitial pneumonitis requiring rescue ecmo and accompaniment of significant pericardial effusion on presentation, followed by rapid improvement with initiation of steroids. it would be prudent for clinicians, to keep this rare diagnosis in the differential of a patient with acute onset dyspnea, who has classic radiological and lab findings, along with a clinical picture suspicious for as. our case is rare with regard to the uncharacteristically acute nature of presentation, acute decompensation in clinical condition, development of acute interstitial pneumonitis requiring rescue ecmo and accompaniment of significant pericardial effusion on presentation, followed by rapid improvement with initiation of steroids. | anti - synthetase syndrome (as) is a clinical entity which is described classically by the triad of interstitial lung disease (ild), inflammatory myositis and presence of aminoacyl - trna synthetase antibodies (asa). we describe a rare presentation of this condition with regard to the uncharacteristically acute nature of presentation, acute decompensation in clinical condition, development of acute interstitial pneumonitis requiring rescue extracorporeal membrane oxygenation (ecmo) and accompaniment of significant pericardial effusion on presentation, followed by rapid improvement with initiation of steroids. |
the uncertainty quantification of pk parameters from preclinical experiments to clinical has been extensively investigated in the literature. prediction methods for clearance is by far the most studied case because of its importance for systemic drug elimination and oral bioavailability. clearance is defined as the volume of blood, from which the drug is removed, per unit of time. reported evaluations of in vivo clearance prediction - methods are often based on relatively small datasets (up to 50 compounds), although a few investigations are based on larger datasets (up to 400 compounds).9,12,17,20 the main reason for evaluation - data scarcity is that many compounds are only administered by the oral route to humans, making unambiguous distinction of in vivo clearance and bioavailability impossible. although some studies show that simple allometric prediction from a monkey performs best,12,17,21 there are typically cost and ethical reasons against using higher species in preclinical research. it has been suggested, albeit using smaller datasets, that the rat and dog data may perform equally well.6,13 allometry may indeed work well for compounds excreted renally, or whose clearance is limited by liver blood flow, but may not be applicable for low - clearance compounds limited by cytochrome p450 enzyme activity.13,29 in some studies, methods using correction factors, such as the rule of exponents method or fraction (unbound) corrected intercept method have been shown to predict better than allometry or at least decrease the risk of overprediction.6,8,12 including a correction for species differences in intrinsic clearance could also possibly decrease the prediction error of allometric methods.30 however, as reported by the publication using the largest dataset,12 the best allometric methods only predict approximately 60% of compounds within twofold of the human clearance. in vitro - in vivo extrapolation methods (hepatocytes or microsomes) for hepatic clearance predictions have varying success rates reported in the literature, ranging from 2090% of compounds predicted within twofold.6,13,14,22,3134 the variation may be due to the differences in experimental setups and in experimental / empirical correction factors (see fagerholm14 for an extensive review). it has been reported that in vitro - in vivo extrapolation, using a regression - line correction established in the utilized hepatocyte assays, may be the method of choice because it will correct for systematic errors in the experimental setup.31 overall, it seems reasonable to suggest that the uncertainty in clearance predictions falls in the order of a factor three for high - performance methods (this can, for example, be approximated by a lognormal distribution with 95% chance of falling within threefold from the predicted point estimate). volume of distribution at steady state (vss) is defined as the proportionality factor between the total amount of drugs in the body at steady state and plasma (or blood) concentration. similar to clearance, vss can be predicted using several different methods with allometry historically being most used. indeed, allometry may be a reasonable method to predict vss because of the physiological aspects governing this parameter, such as organ weights and volumes. there is little consensus of the best method for predicting vss.7,11,13,15,18 two publications7,11 suggest that the semimechanistic oie - tozer equation predicts relatively well if nonhuman in vivo data are available. to confidently predict vss, especially when in vivo data are scarce, it is important to consider the physicochemical properties of the compound and that they conform to the assumptions made in the model. one way to investigate the predictive power of a method is to apply the method between preclinical species.7 similar to clearance, it seems reasonable to suggest that the vss predictions will fall within threefold of the true value. the absorption of drugs from the gut into the systemic circulation is a complex dynamic process.35,36 the main determinants for the extent and kinetics of this process are dose, solubility / dissolution rate, and permeability. however, gut metabolism, stability of the drug in the intestine, fasted / fed state, and mass transfer may also affect the dynamics. bioavailability (f) is defined as : 1where fa denotes fraction absorbed, fg denotes fraction that escapes gut metabolism, and fh denotes fraction that escapes hepatic metabolism. absorption is often predicted using the biopharmaceutics classification system, which categorizes the candidate drugs on the basis of their solubility and permeability. compounds with high solubility and high permeability (biopharmaceutics classification system i) have an almost complete and rapid absorption. however, for compounds with low permeability or low solubility, or both (biopharmaceutics classification system ii iv), it is more difficult to accurately predict the absorption process, and compounds in these classes may display a large variation in both extent and kinetics between patients and administrations.37,38 in vitro methods are routinely used to get a qualitative understanding of absorption properties.3941 translating fa and fg from animal to human is difficult because of interspecies differences in intestinal physiology as well as enzymatic activity.42,43 for example, bioavailability in dogs is often higher than in humans, possibly because of a more leaky intestine paracellular pathway,44,45 and monkeys often have lower bioavailability because of a higher enzymatic activity in the gut.46 physiologically based pharmacokinetic models are reported to underpredict bioavailability, but the number of investigated compounds is limited (8 per biopharmaceutics classification system class).19 most drug - discovery programs actively strive to develop compounds with sufficiently high solubility and permeability in order to reduce the uncertainty and risk of variation in exposure. for such compounds, it is reasonable to assume that absorption can be controlled by formulation. in the three case studies presented here, the working hypothesis has been that the compounds will have good absorption properties in humans. this has been based on in vitro (permeability, crystalline solubility) combined with in vivo animal pk studies. naturally, if solubility and permeability properties are less favorable, or gut metabolism is suspected, one should account for uncertainty in absorption parameters (using the same principles as outlined for cl and vss). as mentioned earlier, differences in pd effect can be attributed to differences in metabolism between species (i.e., active metabolites), leading to different pharmacological / toxicological responses.1,47 another example is species differences in receptor distribution, which have been reported for the opioid receptors in the brain48 and in histamine receptor subtypes in bronchi.49 differences in relative receptor density between species can be found both for serotonergic and dopaminergic receptors.50,51 cardiac glycosides (e.g., digoxin and related compounds) are an example of compounds with a large difference in affinity between species, in the order of 100-fold lower affinity in rodents compared with humans.52 further, translational modeling of disease progression is not straightforward, but can sometimes be scaled with the expected lifespan of the species.53 taking all these factors into account, uncertainty in pd can influence the dose prediction significantly, especially for a first - in - class compound targeting an unprecedented class of target or pathway. on the other hand, confidence increases when clinical data on the same target / pathway have been generated, the preclinical disease model has been shown to translate to human, or the system pharmacology of the target is understood, or a combination of those.5457 the human dose is often predicted using relatively simple models, which can be represented by closed - form expressions. as a base case, the dose prediction for a compound with assumed one - compartment kinetics, systemic clearance cl, a desired average steady - state concentration (css), bioavailability f, and dosing interval is calculated as : 2 alternatively, for a compound with a desired coverage above a minimum effective concentration (mec), the predicted dose is calculated as : 3where ka denotes the absorption rate - constant. for nonlinear models with no closed - form expression for dose, simulation - based methods are needed. to investigate the uncertainty of the dose prediction, pk and pd parameters can be represented by empirical distributions based on available information on translational performance. specifically, for a pk parameter, the distribution around the point estimate reflects the uncertainty of each method, as well as potential variability in input data. the shape of the distribution can be chosen based on reasonable assumptions or inferred empirically from compounds tested in man. a log - normal distribution is useful to avoid negative values (exemplified in figure 1d). alternatives to log - normal distributions include fuzzy numbers or other interval analyses that are common in engineering applications58 and that have also been used in physiologically based pharmacokinetic applications2,23 (exemplified in figure 1e). in those probabilistic frameworks, it is straightforward to include correlations between parameters. however, there is presently not much information in the literature on potential correlations of pk / pd parameter uncertainties. in the case studies, no correlations were incorporated in the monte - carlo simulations. in the next step, the model and the parameter distributions are fed into a monte - carlo simulation to calculate the distribution of the dose prediction. basically, random samples for each parameter are drawn from the chosen distribution (the number of samples depends on the problem, and is typically greater than 1,000). the dose is calculated for each set of parameters, resulting in an empirical dose distribution. monte - carlo simulations using closed - form dose expressions, like eqs. 2 and 3, are computationally feasible and can typically be generated within milliseconds on a standard computer. for more complex pk / pd models, the calculation may be significantly slower, because each dose calculation involves an optimization (e.g., to assure that plasma concentration is above a certain threshold at a specific timepoint), and each evaluation step in the optimization requires numerical integration of the ordinary differential equations of the model. it is often expedient to present the resulting dose distribution as a cumulative probability plot (which describes on the y - axis the probability that the dose is less than or equal to the value on the x - axis, cf. science communication in general and uncertainty communication in particular are actively discussed in the environmental science,5961 as well as in other areas, like radiotherapy.62,63 we mention the following main challenges in order to effectively communicate uncertainty in human dose - predictions : communication of results based on modeling and simulation is hard and requires careful preparation. such preparation is often performed iteratively and involves complete listing of modeling assumptions, translation of model equations into words or overview figures, choice of simulations and interpretation of results, and reflection on consequences of the modeling predictions. note in particular that formulas and technical terms are easy to list but difficult to interpret for scientists without adequate training in mathematics.60 human dose - predictions tend to focus on pk properties of the drug, and not so much on pd properties. however, translating the pd model from animal pharmacology to the human situation is based on assumptions and associated with uncertainties.1,23,24 therefore, no or low emphasis on pd uncertainty may underestimate overall uncertainty / risk and, hence, bias decision - makers. it is easy to mistake variability for uncertainty, and a consequent language is essential to avoid this problem. such preparation is often performed iteratively and involves complete listing of modeling assumptions, translation of model equations into words or overview figures, choice of simulations and interpretation of results, and reflection on consequences of the modeling predictions. note in particular that formulas and technical terms are easy to list but difficult to interpret for scientists without adequate training in mathematics.60 human dose - predictions tend to focus on pk properties of the drug, and not so much on pd properties. however, translating the pd model from animal pharmacology to the human situation is based on assumptions and associated with uncertainties.1,23,24 therefore, no or low emphasis on pd uncertainty may underestimate overall uncertainty / risk and, hence, bias decision - makers. it is easy to mistake variability for uncertainty, and a consequent language is essential to avoid this problem. fundamental communication elements are words, numbers, and visualizations. concerning words, it is important to be aware of variation in interpretation of phrases of likelihood (e.g., likely and probable).64,65 to elucidate the meaning of such words, it is recommended to define a consistent language according to numerical levels of confidence as exemplified by the verbal quantifiers in table 1. the number of levels of such a table depends on the amount and quality of data, the type of research question, and the expected level of granularity of the response. it is also wise to strive for a simple language and avoid technical jargon.61 concerning numbers, they can be directly used to communicate, for example, confidence levels, and there is empirical evidence that including both verbal and numerical characterization improves communication.59 communication by visualization is central in science to convey causal relationships, temporal trends, data, etc.27 probability words as quantitative subjective probability judgments mapping of probability words into quantitative subjective probability judgments, used by the intergovernmental panel on climate change third assessment59,65 based on recommendations developed by moss & schneider.69 successful communication depends on several factors : identify the science relevant to decision - making ; separate need - to - know science from nice - to - know science. determine the decision - maker 's background knowledge in the subject area. design communication to fill the critical gaps between what people know and need to know. collect systematic feedback provided by empirical evaluation, and use the information to evaluate the adequacy of the communication and to revise it accordingly.60 identify the science relevant to decision - making ; separate need - to - know science from nice - to - know science. determine the decision - maker 's background knowledge in the subject area. design communication to fill the critical gaps between what people know and need to know. collect systematic feedback provided by empirical evaluation, and use the information to evaluate the adequacy of the communication and to revise it accordingly.60 the case studies that we show in the next section represent the final outcome of this iterative approach (points 13 above). the feedback (step 3) was continuously collected from various industrial and academic stakeholders during approximately one year and is summarized in the discussion section. we have chosen to communicate by visual means complemented with verbal quantifiers (exemplified in table 1). specifically, we have condensed complex information from multiple sources into a single uncomplicated plot that captures the uncertainty in human dose - prediction, and, in that way, pinpoints the need - to - know science. we present three case studies of how uncertainty in preclinical human dose - prediction can be quantified and communicated. in these case studies, clearance was estimated from in vitro and in vivo data using two different scaling methods. first, clearance was predicted from human hepatocyte data using a regression correction method based on 36 marketed drugs reflecting the same principles as in sohlenius - sternbeck.31 this study reports that 66% of compounds have a predicted intrinsic clearance within twofold. second, clearance was also scaled from in vivo data obtained from rats and dogs using the liver blood flow method.17 using a clinical dataset of 18 compounds, this method predicts in vivo clearance within twofold for 67% of the compounds and within threefold for 94% of the compounds.6 the uncertainty distribution for each clearance method was represented by a log - normal distribution with 95% of samples falling within threefold of the predicted point estimate. variability in input data to the scaling methods was considered negligible in comparison to the translational uncertainty. if two predictions are available for the same parameter, it is common to take the average value of the predictions as the point estimate. for each iteration of the monte - carlo simulation, one sample is drawn from each of the two distributions, and the average value is used. in this way, two (similar) predictions of cl, for example, result in a consensus prediction with less uncertainty than each individual prediction. volumes of distribution for all three case studies were predicted using the semi - mechanistic oie - tozer equation.66 for this method, 78% of the predictions were within twofold and 89% within threefold of the in vivo result using a dataset of 18 compounds.7 for a larger dataset of 400 compounds, 67% of the predictions were within twofold.11 unbound vss for each series in the case studies was consistent across species (rat and dog ; i.e., the slope of a simple unbound allometric plot fell between 0.8 and 1.2), which further adds confidence in prediction. vss was assumed log - normally distributed with 95% of samples falling within threefold of the predicted point estimate. similar to clearance predictions, variability in input data to the scaling method was considered negligible in comparison to the translational uncertainty. for all case studies, it was assumed that rate of absorption was rapid (ka = 1h), unless a scenario with an absorption - modifying formulation was simulated. in addition, the fraction of the dose absorbed was assumed high (fa = 1) and gut metabolism negligible (fg = 1). hence, the major contributor to f was first - pass metabolism in the liver and f was calculated as : 4where lbf is the liver blood flow and cl is the systemic blood clearance. the target audiences for communication of the three case studies have been pk / pd - modelers, medicinal chemists, bioscientists, and governance bodies. the first case study considers five compounds (cmp 1a1e), that were evaluated in the lead - optimization phase of a drug - discovery project. the aim was to support ranking of the compounds for subsequent progression into toxicological studies. for each compound, 3. however, because of an estimated short half - life (34 hours) of the compounds, small changes in pk parameters had a large impact on the dose prediction, thereby increasing overall uncertainty. the project team was considering an extended release (er) formulation in order to generate a flatter concentration - time profile and to decrease dependence on elimination half - life and thereby obtain a more clinically realistic dose level. during these discussions, it became apparent that understanding and efficiently communicating uncertainty in the dose predictions were pivotal to progress the project. parameters and distributions were generated as described in the uncertainty quantification section (table 2 ; example in figure 1d). predictions for cl using methods based on in vitro data (in vitro - in vivo extrapolation from hepatocytes) and in vivo data (rat / dog liver blood flow17) were in a similar range and did not diverge more than twofold for any of the compounds. the point estimate of mec was derived from potency measures in a whole blood in vitro assay (table 2). the in vitro assay potency results fell within twofold of the potency seen ex vivo in human whole blood, for two reference compounds with reported clinical data, targeting the same pathway. hence, the uncertainty in pd was set to let 95% of the samples fall within twofold of the point estimate. the absorption constant, ka, was fixed because it is a parameter that can be largely controlled by formulation choices as long as the compounds are judged to show properties suitable for er formulation. specifically, ka was kept fixed at 1 h and 0.1 h when simulating immediate release (ir) and er formulations. parameters for case study 1 cl, clearance ; lbf, liver blood flow ; mec, minimum effective concentration ; vss, volume of distribution at steady state ; heps, hepatocytes. point estimates and 95% uncertainty ranges. ranking of the compounds was communicated by a cumulative probability distribution of the daily dose for each compound, all summarized into a single plot combined with verbal quantifiers (figure 2a). we next investigated the effect of an er formulation using the same communication layout (figure 2b). as already pointed out, the uncertainty around the point estimate of the ir dose was large because of the short half - life of the compounds. for example, the 90% confidence interval for cmp 1e ranges from 10 mg to more than 100,000 mg. the confidence interval for an er preparation is significantly narrower and ranges from 450 mg. cmp 1b was predicted to have a somewhat longer half - life compared with the others, and, consequently, this compound exhibits the steepest slope in figure 2a. along the same line of reasoning, the cumulative probability curves for the er formulation generally show much steeper slopes, compared to the corresponding curves for the ir formulation. the tendency of the compounds to fall into two groups in the er scenario illustrates a substantial difference in potency between the compounds and it was deemed likely that cmp 1c1e would have a daily dose below 100 mg. based on the information in figure 2a, b and table 2, the project team concluded that the point estimates for an ir dose were low enough to facilitate once daily dosing for the best compounds. however, the uncertainty in these dose estimates was relatively large and the lead - optimization program was planned to account for er feasibility. figure 2c efficiently communicated this rationale to decision - makers for one of the top compounds. in summary, the first case study demonstrates how proper uncertainty quantification and communication support compound selection in the lead - optimization phase of a drug - discovery project. it also shows how different administration schedules and formulations can be analyzed within this framework. the second case study considers five compounds (cmp 2a2e), that were evaluated in the lead - optimization phase of another drug - discovery project. the project team explored a first - in - class target, and, in the current phase of the project, it was not known if the css (eq. the goal was to select one compound for further toxicological and pharmacological profiling, taking both uncertainty in model and choice of dosing schedule into account. pk parameters and their uncertainties were quantified as described in the uncertainty quantification section. for pd, therefore, the mec and css for each compound were predicted from in vitro potency data, and threefold translational uncertainty was assumed around the predicted point estimates (table 3). dose predictions for the case of css - driven effect show that cmp 2a2d are likely to have a human dose 1,000 mg. parameter ranges (table 3), compounds (cmps) 2a2d are likely to have a human dose below 500 mg, and cmp 2e is likely to have a dose below 1,000 mg for a model with steady - state concentration (css)-driven effect (a). if the effect is driven by the minimal effective concentration, cmp 2a is likely to have a human dose below 500 mg, whereas the others are not (b) ; and assuming this model is medium likelihood that cmp 2a can be administered once daily (c). parameters for case study 2 cl, clearance ; heps, hepatocytes ; mec, minimum effective concentration ; vss, volume of distribution at steady state. taking also other factors than the human dose - prediction into account, the project team prioritized cmp 2a and b and was interested in understanding the influence of once daily vs. twice daily dosing schedules. simulations indicate that cmp 2a may be feasible for once daily administration while cmp 2b is not (figure 3c). hence, cmp 2a stands out as superior to cmp 2b based on the human dose - prediction. this compound was assumed to be least sensitive for different dosing approaches and was selected for further profiling. in summary, the second case study adds to the first by demonstrating how model uncertainty (css - driven vs. mec - driven effect) influences dose quantification and uncertainty level for different dosing schedules, and how these aspects can be quantified and efficiently communicated. the third case study applies a pk / pd - link model containing a one - compartment pk model (first order absorption, linear elimination) connected to a receptor - occupancy model with elementary kinetics defined as : 5where c denotes drug plasma concentration, rtot denotes the total receptor concentration, rc denotes the drug - receptor complex and kon and koff are kinetic parameters (the dissociation constant is derived as kd = koff / kon). for this case study, the human dose was predicted by requiring a certain level of receptor occupancy (e.g., 50%) over a certain period of the day (e.g., 16 hours). the aim was to predict the required human dose and its uncertainty for a candidate drug, cmp 3a, in order to assure a certain level of receptor occupancy. human pk parameters were predicted from empirical scaling from both in vitro (hepatocytes) and in vivo (mouse / rat / dog) data (table 4). parameters for case study 3 cl, clearance ; cmp, compound ; heps, hepatocytes ; lbf, liver blood flow ; pk, pharmacokinetic ; ro, receptor occupancy ; vss, volume of distribution at steady state ; pd, pharmacodynamic. point estimates and 95% uncertainty ranges for six parameters based on domain knowledge, data, and literature. for pd parameters, the required receptor occupancy level was observed at 24 hours in rodents (rat 37%, mouse 63%) and translated to the same average level, 50%, but at 16 hours in humans. the difference in coverage (24 hours in rodents compared to 16 hours in humans) reflects well - established species differences in the particular disease area. the uncertainty for human translation was represented by a log - normal distribution with 95% chance of falling in the range of 3763%. furthermore, human point - estimates for receptor - occupancy parameters kd and koff were obtained from pk / pd analysis of mouse data (with kd protein - binding corrected). uncertainty in determination of kd and we assume that, with 95% confidence, kd and koff in humans independently varies by a factor of three to corresponding mouse parameters. in summary, uncertainty in six key pk and pd parameters influenced the human dose prediction (table 4). using a pk / pd - link model, we algorithmically searched for the minimal required human dose for each combination of receptor - occupancy coverage and dosing schedule. this calculation was defined as an optimization problem : find the minimal predicted dose that ensures a certain level of receptor occupancy, given a certain number of doses per day, a certain coverage time, and the predicted human pk parameters. a simple half - interval search was used to find the minimal dose. here, we took advantage of a flexible and efficient matlab library to ensure computational feasibility.67 then, the monte - carlo simulation was used to integrate uncertainty from all specified sources and to predict empirical distributions for dose and cmax (figure 4). data indicate that it is likely that the human dose is 1,000 mg. parameter ranges (table 3), compounds (cmps) 2a2d are likely to have a human dose below 500 mg, and cmp 2e is likely to have a dose below 1,000 mg for a model with steady - state concentration (css)-driven effect (a). if the effect is driven by the minimal effective concentration, cmp 2a is likely to have a human dose below 500 mg, whereas the others are not (b) ; and assuming this model is medium likelihood that cmp 2a can be administered once daily (c). parameters for case study 2 cl, clearance ; heps, hepatocytes ; mec, minimum effective concentration ; vss, volume of distribution at steady state. taking also other factors than the human dose - prediction into account, the project team prioritized cmp 2a and b and was interested in understanding the influence of once daily vs. twice daily dosing schedules. simulations indicate that cmp 2a may be feasible for once daily administration while cmp 2b is not (figure 3c). hence, cmp 2a stands out as superior to cmp 2b based on the human dose - prediction. this compound was assumed to be least sensitive for different dosing approaches and was selected for further profiling. in summary, the second case study adds to the first by demonstrating how model uncertainty (css - driven vs. mec - driven effect) influences dose quantification and uncertainty level for different dosing schedules, and how these aspects can be quantified and efficiently communicated. the third case study applies a pk / pd - link model containing a one - compartment pk model (first order absorption, linear elimination) connected to a receptor - occupancy model with elementary kinetics defined as : 5where c denotes drug plasma concentration, rtot denotes the total receptor concentration, rc denotes the drug - receptor complex and kon and koff are kinetic parameters (the dissociation constant is derived as kd = koff / kon). for this case study, the human dose was predicted by requiring a certain level of receptor occupancy (e.g., 50%) over a certain period of the day (e.g., 16 hours). the aim was to predict the required human dose and its uncertainty for a candidate drug, cmp 3a, in order to assure a certain level of receptor occupancy. human pk parameters were predicted from empirical scaling from both in vitro (hepatocytes) and in vivo (mouse / rat / dog) data (table 4). parameters for case study 3 cl, clearance ; cmp, compound ; heps, hepatocytes ; lbf, liver blood flow ; pk, pharmacokinetic ; ro, receptor occupancy ; vss, volume of distribution at steady state ; pd, pharmacodynamic. point estimates and 95% uncertainty ranges for six parameters based on domain knowledge, data, and literature. for pd parameters, the required receptor occupancy level was observed at 24 hours in rodents (rat 37%, mouse 63%) and translated to the same average level, 50%, but at 16 hours in humans. the difference in coverage (24 hours in rodents compared to 16 hours in humans) reflects well - established species differences in the particular disease area. the uncertainty for human translation was represented by a log - normal distribution with 95% chance of falling in the range of 3763%. furthermore, human point - estimates for receptor - occupancy parameters kd and koff were obtained from pk / pd analysis of mouse data (with kd protein - binding corrected). uncertainty in determination of kd and koff from mouse data we assume that, with 95% confidence, kd and koff in humans independently varies by a factor of three to corresponding mouse parameters. in summary, uncertainty in six key pk and pd parameters influenced the human dose prediction (table 4). using a pk / pd - link model, we algorithmically searched for the minimal required human dose for each combination of receptor - occupancy coverage and dosing schedule. this calculation was defined as an optimization problem : find the minimal predicted dose that ensures a certain level of receptor occupancy, given a certain number of doses per day, a certain coverage time, and the predicted human pk parameters. a simple half - interval search was used to find the minimal dose. here, we took advantage of a flexible and efficient matlab library to ensure computational feasibility.67 then, the monte - carlo simulation was used to integrate uncertainty from all specified sources and to predict empirical distributions for dose and cmax (figure 4). data indicate that it is likely that the human dose is < 200 mg when uncertainty in both pk and pd are integrated (figure 4a). understanding of human pk would significantly reduce the overall uncertainty ; here simulated for the case with pk parameters fixed at the predicted point estimates (figure 4a). in order to design preclinical safety studies and interpret in vitro safety screens, it is pivotal to have a good understanding of expected exposure levels in humans. the monte - carlo simulation outputs such predictions as well, and data indicate that it is likely that cmax is < 0.4 m taking pk / pd uncertainty into account (figure 4b). overall, data indicate that pd uncertainty is important to consider, in particular when key biomarkers are not accessible in at least one of the species, and when change in disease state is not well understood. parameter ranges (table 4), it is likely that the human dose of compound (cmp) 3a is < 150 mg (black solid line) (a) ; it is likely that cmax in humans is < 0.5 m (black solid line) (b). in both a and b, the red steeper curve illustrates the information gain if human pharmacokinetic (pk) was known (here assumed known at the predicted point estimate) and only uncertainty in pharmacodynamic (pd) contributed to overall uncertainty. in summary, the third case study adds to the two others first by demonstrating how arbitrary (nonlinear) pk / pd model structures, as well as uncertainty in several pd parameters can be considered. the analysis can be connected to a dose optimization step and still be computationally feasible when no closed - form dose expression can be analytically derived. the third case study also shows how other parameters, like cmax, can be communicated in the same way as dose. in the case studies, uncertainty in human dose - prediction is quantified by a systematic integration of information from various uncertain sources, and reported as a single uncomplicated plot complemented with verbal quantifiers that facilitates communication and enables informed decisions. the approach allows drug - project teams to evaluate various scaling scenarios or models, to identify the most influencing parameters, to rank compounds (e.g., compounds with similar predicted dose point - estimates but different uncertainty), and to properly assess the risk before the first time in humans. other uncertainty considerations, such as safety aspects, commercial feasibility, cost of goods, and competitive landscape, can be directly connected to the framework as they often use the predicted human dose as one of the input parameters (cf. the same reasoning can be applied to the predicted cmax or area under the curve distribution or other derived parameters. the empirical calculations can be performed efficiently, not only for closed - form expressions, but also for nonlinear ordinary differential equation systems. in this way, calculations can be instantly revised as soon as new data are generated, or a different scenario is to be tested. taken together, the approach exemplified by the three case studies represents a useful way of quantifying and communicating uncertainty in human dose - predictions. however, in our experience, such communications always raise questions (e.g., how is ranking influenced by variability / uncertainty, and what is the chance of having a dose less than a certain amount). in particular, this is the case when uncertainties differ between compounds (because of different types, amounts, or quality of input data), or a combination of those. a monte - carlo approach can address these and other questions. there are several ways of communicating the result of a dose prediction based on a probabilistic approach. a concentration - time plot (figure 1c) is one obvious alternative to the cumulative probability plot of dose advocated in this tutorial (figure 2a). first, we have experienced that many audiences misinterpret the uncertainty in the concentration - time plot as population variability. second, the concentration - time plot gets crowded when more than one compound or scenario, or both, are compared (figure 1c shows just one compound and would be hard to interpret if all compounds 1a1e were included, as in figure 2a). nevertheless, the concentration - time plot remains a useful complement to the dose distribution. in case study 1, the need to investigate er feasibility of the compound series was successfully communicated by figure 2. it was also apparent that an er formulation was likely to generate a dose below 100 mg / day for any of the three compounds 1c e. the plots were used to illustrate the risk with the ir once daily approach and gain confidence in the chosen mitigation plan using an er preparation. in addition, figure 2c efficiently communicates that an er formulation would potentially be superior to twice daily administration for one of the compounds. indeed, the high uncertainty associated with once daily ir formulation (figure 2a) illustrates the importance of communicating uncertainties ; only communicating point estimates gives a false sense of security. in this and the two other case studies, the compounds show good absorption properties and bioavailability was derived from cl only. however, we acknowledge that a more conservative approach with uncertainty in fa can be argued. generally, for low permeability compounds or compounds predicted to be highly metabolized in the gut, the bioavailability estimate should take fa and fg into consideration. plausible uncertainty distributions for these parameters must then be proposed in the same way as for other parameters. the method used for human dose - prediction is drug - project specific and should be chosen based on the pharmacological understanding of the target. case study 2 shows the impact of model choice on the distribution of the predicted dose (css vs. mec - driven approach). of course, model averaging can be considered in situations where information is lacking and a single model can not be selected. commonly, uncertainty in clearance and bioavailability, and sometimes volume of distribution and rate of absorption, strongly influences overall uncertainty in the prediction. uncertainty in pd parameters can have a large impact on dose, as seen in case study 3, but is even more project - specific compared to pk parameters. uncertainty in pd can be decreased by, for example, understanding the target and its biological pathway, using preclinical animal models with known translational properties, or taking advantage of published clinical data for compounds with the same target or compounds already approved for the indication. the same type of communication can be used to inform about remaining uncertainty in pd when pk is known from a clinical phase i study (cf. furthermore, for early toxicological studies, the uncertainty in predicted exposure levels (cmax and area under the curve), can be used to better assess and communicate uncertainty in safety margins. in order to quantify uncertainty in the dose prediction, it is useful to list the contributing parameters and then assess the uncertainty of each parameter, as well as correlations between those measures if independence can not be assumed. naturally, it is not uncommon that compounds in a series are supported by various amounts of data (e.g., clearance can be predicted from either hepatocyte data, or animal data, or both). however, such differences in input data can be directly incorporated in the uncertainty calculation. notably, for cases where the predictions of a parameter vary substantially between two or more methods, it is advisable to further investigate the underlying reason because one of the methods may be more suitable for the compound series. however, in principle, the computational framework also works for this case. in general, it is hard to determine the translational uncertainty in scaling methods and pd relationships, and to assign or infer reasonable distributions representing those uncertainties. however, there is lack of consensus in ranking these methods, partly because datasets are limited and differ in size. different physicochemical properties for compounds may also influence which methods are best suited for a certain compound class. as a rule - of - thumb, literature data on translation of pk parameters indicate that good methods predict 8090% of the compounds within threefold from the true parameter value.622 however, these evaluations of methods are based on data for compounds that have reached the clinical phase and have been reported in the literature ; potential bias in any direction can not be excluded. in our case studies, we have assumed log - normally distributed uncertainty with 95% probability to be within threefold from the point estimate. it is recommended to increase confidence in prediction by using different types of data (e.g., in vitro and in vivo, more than one scaling method, and information from other compounds with similar properties). in our experience, decision - makers in drug discovery gain a lot from having a rough indication of the uncertainty levels. integrating information in the way proposed here quantifies the overall uncertainty (although not being exact) in a manner that is easy to understand. therefore, we believe it is worthwhile doing this analysis when uncertainty levels can be captured in at least the right order of magnitude. fundamental to science communication is to determine how much and what information the audience needs to make an informed decision ; what is considered good communication for one audience may not suit another. communicating modeling and simulation can often be difficult, especially when trying to describe the impact of assumptions and uncertainty to people not used to working with prediction models or translational aspects, or both. also, it is challenging to find the right balance between communication of the point estimate and the uncertainty. hence, finding the right communication strategy requires iterative trials with intermediate collection and analysis of feedback from the audience. generally, the reception of the communications has been very positive from various academic and industrial stakeholders from different scientific backgrounds. for example, medicinal chemists emphasize the value of rough uncertainty quantifications during the design - make - test - analyze process. negative feedback during the process was mainly related to the three challenges in order to effectively communicate uncertainty in human dose - predictions listed in the uncertainty communication section. to overcome these challenges, we have strived to avoid technical jargon and minimize the usage of equations in our presentation. furthermore, as pointed out by pidgeon and fischhoff, scientists from a different field can get an exaggerated sense of scientific uncertainty when uncertainties that are most difficult to understand or model are discussed in depth, whereas uncertainties of commonly accepted methods (e.g., a certain pk scaling method) are never brought up. the approach used in the case studies is designed to put the same emphasis on all contributing factors to the overall scaling uncertainty in order to avoid this problem. the hardest communication problem has been related to the distinction between variability for uncertainty (e.g., the uncertainty distribution of cl may be incorrectly interpreted as the population variability of cl). to overcome this problem, we have strived to use a consequent language (table 1), focused on dose distribution plots and not concentration - time plots (as discussed above). another important factor for successful communication is to allow the audience to take active part in the reasoning behind the prediction. by using efficient software, users can revisit and change the assumptions, or simulate a different scenario, and get an instant reply. communication should be designed specifically for the target audience (see point 1 in the numbered list in section uncertainty communication). in our experience, the cumulative probability plots are useful both for modelers and nonmodelers (e.g., decision - makers). however, the underlying assumptions and calculation steps should be motivated more rigorously for modelers compared to nonmodelers. in this way, we can balance the right to know and full disclosure with need - to - know. however, the number of iterations can be reduced by a well chosen starting point. the approach outlined by three case studies in this tutorial can be such a useful starting point for communicating human dose - predictions in pharmaceutical research organizations. in summary, the three case studies have been communicated by three means (figures 4 ; tables24) : a single plot showing the cumulative probability of predicted dose levels, allowing several compounds or scenarios, or both, to be simultaneously evaluated. a summary table of underlying assumptions, detailing which parameters were considered uncertain and to what extent. a headline interpreting the presented data and summarizing them into the key finding (e.g., it is likely that the human dose is < 100 mg). a single plot showing the cumulative probability of predicted dose levels, allowing several compounds or scenarios, or both, to be simultaneously evaluated. a summary table of underlying assumptions, detailing which parameters were considered uncertain and to what extent. a headline interpreting the presented data and summarizing them into the key finding (e.g., it is likely that the human dose is < 100 mg). together, these three pieces fit into a single slide in presentation format (e.g., powerpoint). simple because the data is easily generated, revised, and summarized into a single slide, efficient because the audience is provided the information that they need in a form they can use, and sound because we have strived to transparently acknowledge main sources of scientific uncertainty. | human dose - prediction is fundamental for ranking lead - optimization compounds in drug discovery and to inform design of early clinical trials. this tutorial describes how uncertainty in such predictions can be quantified and efficiently communicated to facilitate decision - making. using three drug - discovery case studies, we show how several uncertain pieces of input information can be integrated into one single uncomplicated plot with key predictions, including their uncertainties, for many compounds or for many scenarios, or both. |
primary non - hodgkin lymphomas of the gastrointestinal tract are rare, accounting for only 14% of malignancies arising in the stomach, small intestine or colon. mucosa - associated lymphoid tissue (malt) lymphoma comprises 78% of all b - cell lymphomas and at least 50% of primary gastric lymphomas. it reaches its peak incidence between the ages of 50 and 60 years and there is a slight male predominance. patients with gastric malt lymphoma typically present with nonspecific symptoms such as nausea, vomit, non - ulcer dyspepsia, epigastric discomfort, anorexia, weight loss, or occult gastrointestinal bleeding. physical examination is often normal, but may reveal a palpable mass or peripheral lymphadenopathy when the disease is advanced. laboratory studies also tend to be normal at presentation and anemia may be present in selected cases. the diagnosis should be confirmed by biopsy. findings on upper endoscopy are diverse, including mucosal erythema, benign - appearing gastric ulcer or nodular lesion. multiple biopsies should be obtained from both suspicious - appearing lesions and normal - appearing mucosa in the stomach since gastric malt lymphoma can occasionally present as multifocal disease with involvement of tissue that appears to be unaffected on initial visualization. conventional pinch biopsies may miss the diagnosis, since gastric malt lymphoma can infiltrate the submucosa without affecting the mucosa. in epithelial tissues, malt lymphomas are composed of morphologically heterogeneous small b - cells including marginal zone (centrocyte - like) cells, monocytoid cells, and small lymphocytes. the risk of misdiagnosing such lesions as poorly differentiated gastric cancer in endoscopic biopsies, particularly in low - grade malt lymphomas in which lel may be particularly abundant, is well described. a 76-year - old woman was referred for the management of poorly differentiated gastric adenocarcinoma diagnosed at the time of a routine screening upper endoscopy. her past medical history was unremarkable and family history showed that her father had gastric cancer. a diagnostic upper endoscopy in our unit revealed a 2 cm raised, submucosal lesion with central erosion in the upper body of the stomach (fig. 1). repeat biopsies of the lesion were interpreted as inflamed gastric mucosa with positive helicobacter pylori. we also performed systematic gastric biopsies to rule out any foci of malt lymphoma changes within the stomach, however the results were not significant. computed tomography of the chest and abdomen was negative for any lymphadenopathy or distant metastases. based on the localized endoscopic findings and repeat negative biopsy results, we performed an endoscopic submucosal dissection (esd) for diagnostic therapy. histological study revealed a well - circumscribed lymph follicle containing large germinal centers in the submucosa invading the muscularis mucosa and mucosa (fig. centrocyte - like cells and epitheliotropic proliferation (lel) invading into the mucosa with obliteration of the gastric glands (fig. 3) were also seen. while the lel was initially interpreted as poorly differentiated adenocarcinoma, the pathological evidence obtained from esd established the diagnosis of a malt lymphoma of the stomach (c - stage ie). after eradication of h. pylori with antibiotics, the patient has had no local or distant recurrences during the subsequent 2 years of surveillance follow - up. the world health organization (who)/revised european american lymphoma (real) classification scheme groups all lymphomas involving extranodal sites (gastrointestinal tract, thyroid, lung, breast, orbit and skin) into the category of malt lymphomas. although patients with gastric malt lymphoma often present with stage i or ii extranodal disease, those patients may have vastly different presentations depending on its size and location : asymptomatic, gastric outlet obstruction, or weight loss. gastric malt lymphoma often presents as multifocal disease within the stomach and systematic gastric biopsy is crucial for diagnosis. in this localized malt lymphoma case, theoretically, since gastric malt lymphomas develop from mucosa - associated lymphoid tissue, esd should be adequate to obtain lymphoma tissue for the definite diagnosis. a previous study showed an association between previous h. pylori infection and the development of gastric malt lymphoma and that eradication of h. pylori with antibiotics results in regression of gastric malt lymphomas [6, 7 ]. is classified as an indolent non - hodgkin lymphoma, stable asymptomatic patients with persistently positive biopsies have been successfully followed until disease progression. in conclusion, esd is a reasonable option for the diagnosis of localized gastric malt lymphomas in selected cases in whom adequate tissue samples are difficult to obtain. | the risk of misdiagnosing neoplastic cells typically infiltrating an epithelium forming a lymphoepithelial lesion as poorly differentiated gastric cancer in endoscopic biopsies, particularly in low - grade mucosa - associated lymphoid tissue (malt) lymphomas, is described. a 76-year - old woman was referred for management of a poorly differentiated gastric adenocarcinoma. diagnostic endoscopy in our unit showed a 2 cm raised, submucosal lesion with central erosion in the upper body of the stomach, but repeat biopsies of the lesion were interpreted as inflamed gastric mucosa and negative for malignancy. systematic gastric biopsies to rule out any foci of malt lymphoma changes were also negative. therefore, endoscopic submucosal dissection was performed to obtain an accurate specimen. histology revealed centrocyte - like cells and a lymphoepithelial lesion invading into the mucosa with obliteration of the gastric glands, which was initially interpreted as poorly differentiated adenocarcinoma. |
health risk of osteoporosis is increasing in korean women and there were many trials to reduce and prevent osteoporotic fracture risk (1, 2). vitamin k plays a role in bone metabolism and may decrease the risk of fracture (3, 4). vitamin k also acts synergistically with vitamin d on bone mineral density (bmd) and positively influences the balance of calcium, a key mineral in bone metabolism. as a cofactor for carboxylase activity, vitamin k facilitates the gamma - carboxylation of osteocalcin to increase the formation of bone (5). if the process of gamma - carboxylation is hindered by lack of vitamin k, the concentration of undercarboxylated osteocalcin (ucoc), which has low affinity to hydroxyapatite in bone, increases. an inverse relation between ucoc and bmd, and high serum ucoc levels in women in their 20 sec and 50 sec was recently reported (6). since high ucoc level may make women in their 50 sec vulnerable to bone fracture, vitamin k supplementation may be worthwhile for women of this age group to improve bmd. vitamin k supplementation provided protection against fractures, age related bmd decline, and osteoporosis in some studies (7 - 9), while other studies do not support a bmd benefit of vitamin k supplementation (10 - 14). although studies examining the effects of vitamin k supplementation on bmd or osteoporosis have been conducted in many asian countries (15 - 18), the role of vitamin k in bone health in korean postmenopausal women remains unclear. the present intervention study was designed to test the effects of vitamin k supplementation with vitamin d and calcium for 6 months on bmd and ucoc among the advanced postmenopausal korean women over sixty years old. we enrolled the advanced postmenopausal women over 60-yr - old, who did not want to take anti - resorptive agent such as bisphosphonate. therefore, postmenopausal women over sixty years old living in seoul, korea, who visited the out patients clinic at cha hospital in seoul from january - may 2010 were recruited (n = 385) (fig. 103 women were excluded for taking vitamin k, anti - lipid medications, hormone replacement therapy, or medications influencing bone metabolism aspects such as bisphosphonate, calcitonin, steroids, phenytoin, carbamazepine, rifampicin, heparin, and warfarin. as well, 199 women with diabetes, hypertension, body mass index (bmi) > 30 kg / m, or metabolic bone diseases were excluded. the remaining 78 women were randomly assigned to either the treatment group (vitamin k, n = 40) or a control group (n = 38). for 6 months, the treatment group received 15 mg of vitamin k2 (menatetrenone) three times a day after every meal, combination form containing 400 iu of active vitamin d3 once a day, and 315 mg of calcium carbonate twice daily. during the same period, the control group received 400 iu of vitamin d and 315 mg of calcium twice daily. during the course of the study, 33 women dropped out due to relocation or loss to follow - up. fasting blood (10 hr of fasting in the morning) was collected at baseline and at months 3 and 6. total cholesterol, triglyceride and high density lipoprotein (hdl) cholesterol were measured by an enzymatic colorimetric assay using a model 7600 apparatus (hitachi, tokyo, japan). the bmd in the lumbar spine (l1-l4) and femur neck, and ward measurements were performed using a qdr 4500 apparatus (hologic, waltham, ma, usa) at baseline and 6 months. the serum ucoc was assayed by an enzyme - linked immunosorbent assay using two monoclonal antibodies. anti - osteocalcin (oc) antibody and a solid - phase anti - glu 21, 24-oc antibody with recombinant human ucoc (takara shuzo, shiga, japan) were used. the coefficients of variation (cvs) in the intra- and inter - assay were 7.3% and 9.7%, respectively. the study participants reported their medications to the principal investigators at screening, and at months 3 and 6, and were interviewed about side effects at every visit. for assess study compliance, the remaining pill count was checked at all visits, and blood samples were collected at baseline and months 3 and 6. an independent t test was used to compare the baseline demographics and any changes that occurred after 6 months of intervention between the vitamin k group and the control group. to compare any changes in each group after 6 months, the paired t test was used. an intention to treat (itt) analysis in addition, perprotocol (pp) analysis of the 45 subjects was also conducted. these analyses were done using spss version 18.0 (spss, chicago, il, usa). all participants provided written informed consent and this study was reviewed and approved by the institutional review board of cha hospital (eki - gla-06 - 32). we enrolled the advanced postmenopausal women over 60-yr - old, who did not want to take anti - resorptive agent such as bisphosphonate. therefore, postmenopausal women over sixty years old living in seoul, korea, who visited the out patients clinic at cha hospital in seoul from january - may 2010 were recruited (n = 385) (fig. 103 women were excluded for taking vitamin k, anti - lipid medications, hormone replacement therapy, or medications influencing bone metabolism aspects such as bisphosphonate, calcitonin, steroids, phenytoin, carbamazepine, rifampicin, heparin, and warfarin. as well, 199 women with diabetes, hypertension, body mass index (bmi) > 30 kg / m, or metabolic bone diseases were excluded. the remaining 78 women were randomly assigned to either the treatment group (vitamin k, n = 40) or a control group (n = 38). for 6 months, the treatment group received 15 mg of vitamin k2 (menatetrenone) three times a day after every meal, combination form containing 400 iu of active vitamin d3 once a day, and 315 mg of calcium carbonate twice daily. during the same period, the control group received 400 iu of vitamin d and 315 mg of calcium twice daily. during the course of the study, 33 women dropped out due to relocation or loss to follow - up. fasting blood (10 hr of fasting in the morning) was collected at baseline and at months 3 and 6. total cholesterol, triglyceride and high density lipoprotein (hdl) cholesterol were measured by an enzymatic colorimetric assay using a model 7600 apparatus (hitachi, tokyo, japan). the bmd in the lumbar spine (l1-l4) and femur neck, and ward measurements were performed using a qdr 4500 apparatus (hologic, waltham, ma, usa) at baseline and 6 months. the serum ucoc was assayed by an enzyme - linked immunosorbent assay using two monoclonal antibodies. anti - osteocalcin (oc) antibody and a solid - phase anti - glu 21, 24-oc antibody with recombinant human ucoc (takara shuzo, shiga, japan) were used. the coefficients of variation (cvs) in the intra- and inter - assay were 7.3% and 9.7%, respectively. the study participants reported their medications to the principal investigators at screening, and at months 3 and 6, and were interviewed about side effects at every visit. for assess study compliance, the remaining pill count was checked at all visits, and blood samples were collected at baseline and months 3 and 6. an independent t test was used to compare the baseline demographics and any changes that occurred after 6 months of intervention between the vitamin k group and the control group. to compare any changes in each group after 6 months, the paired t test was used. an intention to treat (itt) analysis in addition, perprotocol (pp) analysis of the 45 subjects was also conducted. these analyses were done using spss version 18.0 (spss, chicago, il, usa). all participants provided written informed consent and this study was reviewed and approved by the institutional review board of cha hospital (eki - gla-06 - 32). a total of 385 postmenopausal women over sixty were screened and 78 women were enrolled in the study (fig. 1). the main reasons for ineligibility were the used of restricted medications and occurrence of diseases that could affect bone metabolism. in the itt analysis comparing the characteristics of the vitamin k group with the control group (table 1), the age at menopause in the vitamin k group (49.6 2.7 yr) was significantly different from the age at menopause in the control group (50.8 1.7 yr, p = 0.03). other characteristics did not differ in the treatment group in both itt and pp analyses. in the pp analysis (table 2), characteristics of women in the vitamin k group were not different from those in the control group. the mean (sd) age, age at menopause, and duration of menopause were 67.3 6.3, 50.6 1.9, and 16.6 6.8 yr, respectively, in the vitamin k group and 67.8 6.4, 51.0 1.9, and 16.8 7.0 yr, respectively, in the control group. bmds in lumbar and femur were similar in both the vitamin k and the control groups. in addition, the ucoc concentration in the vitamin k group (2.1 1.7 ng / dl) was not significantly different from that in the control group (1.5 1.0 ng / dl, p = 0.214). the mean (sd) osteocalcin level was 9.6 6.4 ng / dl in the vitamin k group and 11.7 6.4 ng / dl in the control group. there were no significant differences in blood urea nitrogen, creatinine, calcium and serum bone - specific alkaline phosphatase (bsalp) between the vitamin k and the control groups. the bmd in l1-l4 and femur neck, and in the ward in the vitamin k group were not different from those in the control group. the serum ucoc level in the vitamin k group (2.1 1.7 ng / dl) was higher than that in the control group (1.5 1.0 ng / dl), but showed no significant difference (p = 0.21). osteocalcin level was nonsignificantly lower in the vitamin k group (9.6 6.4 ng / dl) than in the control group (11.7 6.4 ng / dl, p = 0.29). no significant differences in bmd and biomarker values between the vitamin k and the control groups indicated that the randomization worked well. after 6 months of treatment, the l3 bmd in the vitamin k group compared to the control group increased statistically significantly (0.01 0.03 g / cm vs -0.008 0.04 g / cm, p = 0.049). compared to bmd at baseline, bmd in femur at month 6 was significantly increased in both the vitamin k and the control groups. however, after 6 months of treatment, bmd in the vitamin k group was not statistically different from bmd in the control group. in addition, compared to the baseline, the vitamin k group significantly decreased ucoc concentration (-1.6 1.6 ng / dl, p < 0.01), whereas the ucoc level in the control group did not change (-0.4 1.1 ng / dl). the change in ucoc concentration in the vitamin k group, but not in the control group, confirmed the compliance of the participants in the vitamin k group with the study protocol. osteocalcin was also non - significantly increased in the vitamin k group (1.6 5.8 ng / dl), but not in the control group (-1.1 6.0 ng / dl). triglyceride level decreased in the vitamin k group (-10.0 59.1 ng / dl) (table 3). three people complained of nausea sensation twice after taking vitamin k. no other participants including people in the control group reported adverse events during the study period. in summary, after 6 months treatment of vitamin k to the postmenopausal women over sixty, the l3 bmd increased significantly compared to the control group. in addition, the changes in some biochemical markers differed by treatment. compared to the control group, the vitamin k group significantly decreased serum ucoc concentration (p = 0.008). osteocalcin level was higher in the vitamin k group than in the control group, but the difference was not significant (p = 0.14). in this study, supplementation with vitamins k and d, and with calcium for 6 months of treatment significantly improved the l3 bmd compared to supplementation with vitamin d and calcium in postmenopausal korean women over sixty years old. in addition, femur bmd was increased in the vitamin k group (vitamin k + vitamin d + calcium), but a similar increase was observed in the control group (vitamin d + calcium supplementation). the ucoc concentration significantly decreased in the vitamin k group compared to the control group (p < 0.01), and the osteocalcin level increased nonsignificantly in the vitamin k group (p = 0.14). the triglyceride level decreased in the vitamin k group, but was not statistically different from the control group. when vitamin k concentration in the body is low, insufficient amount of osteocalcin completes -carboxylation ; consequently, ucoc concentration increases and the affinity to calcium to bone matrix decreases. gla - residues of osteocalcin combine with calcium and require vitamin k to activate the reaction site. therefore, measuring ucoc concentration is a more accurate method of monitoring vitamin k than prothrombin in the liver (19). in a previous cross - sectional study in postmenopausal women, elevated serum ucoc and low spinal bmd were observed in the low plasma phylloquinone (vitamin k1) group (20). in another study, healthy elderly scottish women who took vitamin k1 with vitamin d and calcium showed a sustained increase in bmd at the site of the ultradistal radius in comparison with women taking calcium and vitamin d (21). a combined vitamin k2 therapy with vitamin d3 for postmenopausal japanese women produced low serum ucoc and improved bmd values (22). in an examination of the effects of vitamin k2 (45 mg / day) supplementation with calcium (1,500 mg / day) on lumbar bmd in postmenopausal women in indonesia, a meaningful increase in bmd and a decrease in ucoc level were reported (18). on the other hand, a study reported no vitamin k effect on bmd in north american women, prompting the suggestion that women receiving calcium and vitamin d supplements do not need additional vitamin k supplementation to prevent osteoporosis (23). another recent study of vitamin k1 supplementation for 2 - 4 yr in canadian women also reported no benefits on age - related decline in bmd (12). our study showed that compared to the control group that took vitamin d and calcium, additional vitamin k supplementation to vitamin d and calcium improved l3 bmd in korean postmenopausal women over sixty. our previous cross - sectional study involving korean women reported an inverse association between ucoc and bmd (6). this dichotomy may partially be due to an ethnic difference and subjects ' age in the bone metabolism or response to vitamin k or ucoc. a study of inflammatory bowel disease patients in japanese women reported a decrease in the concentrations of vitamin k and d, and a resulting decrease in bmd (24). the foregoing results imply that ethnic - related diversity in gastrointestinal absorption may explain the different response to vitamin k supplement and its subsequent effects on bmd (25). several studies reported that obesity has been related to the level of vitamin k in adipose tissue, reflecting it 's fat - soluble nature. in one study, obese patients displayed a lower ucoc concentration and their ucoc / osteocalcin ratio was negatively related with body mass index (26). another study reported that people with a high serum triglyceride level had high bmd in skeletal muscles (27). on the other hand, adult obesity has been inversely related to circulating indicators of serum vitamin k (28). limitations of the study were the small number of participants, relatively high dropout rate, and lack of a placebo group (i.e., no supplementation). the dosages of vitamin k, vitamin d and calcium and the duration of treatment may have been insufficient to induce responses in related biochemical markers and total bmd. moreover also, bone quality was not measured, which might be only a minor limitation. a previous study (6) suggested that ucoc concentration is inversely associated with age, with higher ucoc concentrations in younger women. this suggests that the effect of the vitamin k on osteocalcin may also be age - related. given the advanced age of our study subjects (mean age 68 yr) and relatively short treatment period, the study may have not been able to discern an increase all part of bmd. however, it is noteworthy that changes in ucoc concentration among older women have been reported, with ucoc concentration in women in their 50 sec being higher than that in women in their 60 sec and 70 sec (6). therefore, vitamin k may be more effective in preventing bone loss or improving bmd in women aged 50 - 59 yr, especially in perimenopausal women or women with few years of menopause. a study testing the influence of vitamin k supplementation to perimenopausal women or women with few years of menopause for more than 6 months is needed. in addition, inconsistent findings from different countries suggest that a comparison of korean data with data from other countries is warranted. a study design involving a longer duration of vitamin k supplementation and with postmenopausal women having a short duration of menopause may prove valuable. finally, physical activity was not measured. in conclusion, in this randomized study, supplementation with vitamin k, d and calcium for 6 months improves l3 bmd and reduces ucoc concentration in korean postmenopausal women over sixty. vitamin k supplement along with vitamin d and calcium reduced serum concentration of undercarboxylated osteocalcin while increasing bone mineral density in korean postmenopausal women over sixty - years - old sang hyeon je, nam - seok joo, beom - hee choi, kwang - min kim, bom - taeck kim, sat - byul park, doo - yeoun cho, kyu - nam - kim and duck - joo lee this study is to evaluate effects of vitamin k supplementation on bone mineral density (vmd) in postmenopausal korean women. 78 postmenopausal women over sixty years old were assigned to either control (calcium & vitamin d, n = 40) or vitamin k - supplemented group (calcium, vitamin d & vitamin k, n = 38). after 6 months of treatment, the vitamin k group showed decrease of undercarboxylated osteocalcin and increase of bmd. the intention to treat (itt) | there are inconsistent findings on the effects of vitamin k on bone mineral density (bmd) and undercarboxylated osteocalcin (ucoc). the present intervention study evaluated the effect in subjects over 60-yr - old. the vitamin k group (vitamin k + vitamin d + calcium supplement ; 15 mg of vitamin k2 [menatetrenone ] three times daily, 400 iu of vitamin d once a day, and 315 mg of calcium twice daily) and the control group (vitamin d + calcium supplement) were randomly assigned. during the six months of treatment, seventy eight women participated (38 in the vitamin k group and 40 in the control group) and 45 women completed the study. the baseline characteristics of study participants did not differ between the vitamin k and the control groups. in a per protocol analysis after 6 months, l3 bone mineral density has increased statistically significantly in the vitamin k group compared to the control group (0.01 0.03 g / cm2 vs -0.008 0.04 g / cm2, p = 0.049). ucoc concentration was also significantly decreased in the vitamin k group (-1.6 1.6 ng / dl vs -0.4 1.1 ng / dl, p = 0.008). in conclusion, addition of vitamin k to vitamin d and calcium supplements in the postmenopausal korean women increase the l3 bmd and reduce the ucoc concentration. |
hepatitis is caused by many factors including alcohol, viruses, drugs, immune injury, and idiopathic factors and has remained a serious human health problem throughout the world [1, 2 ]. the features of hepatitis are the release of inflammatory cytokines, the elevation of aspartate aminotransferase (ast) and alanine aminotransferase (alt), and hepatocyte apoptosis and necrosis. although many treatments are currently used in the clinic, the therapeutic effect is not ideal. concanavalin a (cona) has the ability to stimulate the activation of t lymphocytes, mostly cd4 t - cells, leading to immune hepatitis in mice [3, 4 ]. natural killer (nk) t - cells and macrophages are also closely associated with the progression of liver injury caused by cona. therefore, cona - induced hepatitis is an ideal model to investigate the mechanisms and treatments of t - cell - dependent hepatotoxicity. injection of cona increases the proinflammatory cytokines il-1, il-6, ifn-, and tnf- [69 ]. research has shown that there is a close relationship between high cytokine levels and early liver injury. moreover, il-1 is a central cytokine associated with liver injury [11, 12 ]. several signaling pathways have been associated with the underlying mechanisms of cona - induced hepatitis. studies have shown that cona - induced immune hepatitis was significantly attenuated with the inhibition of the phosphorylation of jnk [1316 ]. apoptosis or programmed cell death is associated with liver injury caused by cona [15, 17 ]. bcl-2 family members, including bcl-2, bcl - xl, bax, and bad, play key roles in the apoptotic pathway. bax and bad represent proapoptotic proteins, while bcl-2 and bcl - xl represent antiapoptotic proteins. autophagy, first described by ashford and porter, is characterized by the formation of autophagosomes and autolysosomes and is an intracellular degradation system that focuses on defective organelles. autophagy plays important roles in various biological processes, including innate immunity, inflammatory responses, and adaptive immunity. however, autophagy is also called type ii programmed cell death and is intimately associated with eukaryotic cell death and apoptosis. therefore, we consider that autophagy is a double - edged sword. microtubule - associated protein 1 light chain 3 (lc3) and beclin-1 are widely considered as markers of autophagy. shikonin, a natural product extracted from lithospermum erythrorhizon, has many biological functions, including antibacterial, antioxidant, anti - inflammatory, and antitumor activities. recently, shikonin was shown to play an important role in regulating the process of inflammation, exerting strong anti - inflammatory effects. lee and colleagues found that shikonin could effectively inhibit allergic airway inflammation in a model of asthma and suppress bone marrow - derived dendritic cell (bm - dc) maturation in vitro. shikonin exerted anti - inflammatory effects by interfering with the degradation of i-b and then suppressed the activation of nf-b, as described by andjar and colleagues. xiong. also found that shikonin could reduce the release of proinflammatory cytokines in cerulein - induced acute pancreatitis in mice. however, the mechanism of action of shikonin in a model of cona - induced autoimmune hepatitis remains unclear. the present study investigated the underlying mechanism of action of shikonin in cona - induced autoimmune hepatitis. we hypothesized that shikonin could reduce the level of il-1 upregulated in cona - induced hepatitis and ameliorate liver injury, as measured by serum hepatic enzymes, proinflammatory cytokines, and histological changes, which may be partly associated with the c - jun n - terminal kinase (jnk)/p - jnk pathway. shikonin, dimethyl sulfoxide (dmso), and cona were purchased from sigma - aldrich (st. louis, mo, usa). antibodies used in the study were from cell signaling technology (danvers, ma, usa), including il-1, tnf-, ifn-, lc3, beclin-1, caspase 9, bax, bcl-2, total jnk, p - jnk, and p62. the pcr kit was purchased from takara (takara biotechnology, dalian, china). the microplate test kits for ast and ast were purchased from nanjing jiancheng bioengineering institute (jiancheng biotech, china). male balb / c mice (68 weeks old, 23 2 g) were purchased from shanghai laboratory animal co., ltd. the mice were housed in a clean environment at 24 2c and an alternating 12 h light and dark cycle. the study was approved by the animal care and use committee of shanghai tongji university. a total of 48 mice were randomly divided into four groups as follows : a normal control group treated with saline solution, a dmso group treated with 2% dmso, and two shikonin groups treated with shikonin at doses of 7.5 mg / kg and 12.5 mg / kg. shikonin was dissolved in 2% dmso. the serum and liver tissues were gathered and used to analyze data immediately, including liver enzymes, the levels of cytokines, and pathological changes. cona was dissolved in normal saline solution at a concentration of 2.5 mg / ml and injected at 20 mg / kg via tail vein to induce acute hepatitis according to previous study. shikonin was diluted with 2% dmso and injected intraperitoneally 2 h prior to cona challenge. a total of 96 mice were treated by tail intravenous injection of cona 2 h before administrating shikonin. the mice were randomly divided into four groups:(1)normal control (n = 24) : mice were injected with saline solution only.(2)cona group (n = 24) : mice were injected with 20 mg / kg cona via the tail vein.(3)low dose group (n = 24) : mice were intraperitoneally injected with 7.5 mg / kg shikonin 2 h before cona challenge.(4)high dose group (n = 24) : mice were intraperitoneally injected with 12.5 mg / kg shikonin before cona challenge. normal control (n = 24) : mice were injected with 20 mg / kg cona via the tail vein. low dose group (n = 24) : mice were intraperitoneally injected with 7.5 mg / kg shikonin 2 h before cona challenge. high dose group (n = 24) : mice were intraperitoneally injected with 12.5 mg / kg shikonin before cona challenge. based on a previous study, blood was collected at three time points 3, 6, and 24 h rapidly after the mice were sacrificed. after blood collection, the serum was separated by centrifugation at 2000 rpm at 4c for 10 min and used to detect liver function and cytokine levels. the levels of alt and ast were measured with an automated chemical analyzer (olympus au1000, japan). il-1, tnf-, and ifn- were measured by enzyme - linked immunosorbent assay (elisa) kits (r&d systems, usa) according to the manufacturer 's protocols. the middle portion of the left liver lobe was cut and fixed in 4% paraformaldehyde for at least 24 h. after fixation, the specimen was embedded in paraffin ; sections were cut at a thickness of 5 m and stained with hematoxylin and eosin (h&e). the inflammatory level and tissue damage prepared paraffin - embedded liver sections (5 m) were heated at 60c for 1 h and then dewaxed and rehydrated by using xylene and different concentrations of alcohol. to recover the antigens, the paraffin - embedded sections were treated with an antigen - retrieval technique, including heating in a water bath at 95c for 10 min, and then covered in hydrogen peroxide solution (3%) for 20 min at 37c to block the activity of endogenous peroxidase. the nonspecific binding sites were blocked with 5% bovine serum albumin (bsa) at 37c for 20 min and then incubated for 10 min at room temperature. the liver specimens were incubated overnight with il-1 (1 : 100), tnf- (1 : 100), ifn- (1 : 100), bax (1 : 100), bcl-2 (1 : 100), p - jnk (1 : 100), and lc3i / ii (1 : 500). the next day, the liver sections were incubated with a secondary antibody, and a diaminobenzidine kit was used to analyze antibody binding. finally, the slices were observed under a light microscope. the ratios of brown staining areas and total areas were calculated using image - pro plus software 6.0. after recovery from 80c storage, liver tissues were rapidly ground in liquid nitrogen and then lysed with ripa lysis buffer supplemented with protease inhibitors (pi) and phenylmethanesulfonyl fluoride (pmsf). the protein concentration was detected with the bicinchoninic acid (bca) protein assay (kaiji, china). equivalent amounts of total protein (120 g) were boiled and mixed with 5 sds - page sample loading buffer. the proteins were separated by using different concentrations of sodium dodecyl sulfate (sds) polyacrylamide gels and then transferred to polyvinylidene difluoride (pvdf) membranes. nonspecific binding was blocked with 5% nonfat milk (diluted in pbs) for 1 h and incubated overnight at 4c with primary antibodies : -actin (1 : 1000), il-1 (1 : 200), tnf- (1 : 200), ifn- (1 : 200), bcl-2 (1 : 500), bax (1 : 500), caspase 9 (1 : 500), beclin-1 (1 : 500), lc3 (1 : 1000), p62 (1 : 500), total jnk (1 : 1000), and p - jnk (1 : 500). membranes were washed with pbst three times for 10 min and then incubated with a secondary goat anti - rabbit or anti - mouse antibody (1 : 2000) for 1 h at 37c. finally, the membranes were washed with pbst three times for 10 min and then scanned using the odyssey two - color infrared laser imaging system. total rna was extracted from frozen liver tissues and transcribed into cdna using the reverse transcription kit (takara biotechnology, china), according to the manufacturer 's protocols. sybr green quantitative rt - pcr was performed to detect target gene expression using a 7900ht fast real - time pcr system (applied biosystems, ca, usa), according to the protocols for sybr premix ex taq (takara biotechnology (dalian) co., ltd., the fresh liver tissues were fixed in 4% paraformaldehyde for 1 h. then the fixed liver tissues were washed three times by pbs for 15 min before they were dehydrated overnight in 30% sucrose at 4c. then the sections were infiltrated with oct (sakura, usa) for 2 h and stored at 80c. 5 m liver sections were cut by a freezing microtome. the prepared sections (5 m) dried at room temperature for 10 min ; then the sections were washed three times by pbs for 5 min each time. and then the prepared sections were incubated with ros fluorescent probe - dhe (60 m, diluted by pbs) for 90 min. after incubation, the sections were washed three times by pbs for 5 min each time. one - way analysis of variance (anova) was used to analyze the datum of q - pcr, elisa, ros scavenging activity, the levels of ast and alt, the gray value of western blotting, and the areas of inflammation and necrosis in immunohistochemistry. in all comparisons, p values to determine whether the drug and the solvent affected liver function, we examined the effects of shikonin and 2% dmso on liver enzymes and the release of cytokines. as shown in figure 1(a), serum ast and alt levels did not differ between the 2% dmso and shikonin groups and the control group. the serum il-1, tnf-, and ifn- levels were comparable between the four groups. cona can activate t - cells to induce autoimmune hepatitis. to detect the effect of shikonin on cona - induced hepatitis, mice were pretreated with shikonin 2 h before cona injection. based on the experimental design, the serum and liver tissues of mice were collected at three time points : 3, 6, and 24 h. figure 2(a) shows that the serum ast and alt levels were significantly increased at the three time points, with a peak at 6 h after cona injection. however, pretreatment with shikonin clearly reduced the serum levels of liver enzymes and the high dose was more effective. as shown in figure 2(b), abundant necrotic areas were observed in the cona group, while the shikonin groups showed minor liver injury at the three time points, indicating that pretreatment with shikonin dramatically decreased liver necrosis. image - pro plus software showed statistically significant differences between the groups. taken together, these results indicated that pretreatment with shikonin effectively reduced cona - induced liver injury in mice. the development of autoimmune hepatitis is closely associated with the release of proinflammatory cytokines, including il-1, tnf-, and ifn-. the levels of il-1, tnf-, and ifn- were determined by elisa and found to be significantly increased in the cona group, showing a peak at 6 h after cona induction (figure 3(a)). shikonin pretreatment dramatically reduced the levels of these proinflammatory cytokines, particularly at 6 h. to confirm our results, we used real - time pcr to detect the mrna expression of il-1, tnf-, and ifn- at each time point. the mrna expression of these cytokines was decreased by shikonin pretreatment compared with the cona group, especially in the high dose group (figure 3(b)). the protein expression of il-1, tnf-, and ifn- was significantly increased in the cona group at all the three time points and reached peak at 6 h (figure 3(c)), consistent with the mrna expression. however, the protein expression of these cytokines decreased in both shikonin pretreatment groups, and shikonin administered at 12.5 mg / kg was more effective, indicating that the effects of shikonin on cona - induced hepatitis were dose - dependent. immunohistochemical staining was used to determine the expression of the inflammatory cytokines in the normal control, cona, and cona + shikonin groups (figure 3(d)). these results provided strong evidence that pretreatment with shikonin could decrease the release of inflammatory cytokines such as il-1, tnf-, and ifn- in autoimmune hepatitis caused by cona. we investigated the expression of bcl-2, bax, caspase 9, lc3, beclin-1, and p62. we used real - time pcr and western blot technologies to detect the expression of apoptosis and autophagy markers at the mrna and protein levels, as shown in figures 4(a) and 4(b). bax and caspase 9, the proapoptotic proteins, were significantly upregulated in the cona group and downregulated in the shikonin pretreatment groups at all the three time points. bcl-2, an antiapoptotic marker, was downregulated in the cona group and upregulated in the shikonin treatment groups. the expression of lc3, beclin-1, and p62 was inhibited with increasing drug doses, with the highest level in the cona group. figure 4(c) shows that the results of immunohistochemistry were consistent with those of western blotting. in conclusion, these results provided strong evidence that shikonin can attenuate hepatocyte apoptosis and autophagy and protect the liver tissue from pathological damage in cona - induced autoimmune hepatitis. we showed that shikonin can attenuate autoimmune hepatitis caused by cona through the inhibition of the release of proinflammatory cytokines, such as il-1, tnf-, and ifn-. however, the underlying mechanism remains unclear. evidence indicates that the jnk / p - jnk pathway is closely associated with inflammatory responses and the progression of apoptosis and autophagy. therefore, we examined whether shikonin could protect liver tissues by suppressing the jnk / p - jnk pathway in cona - induced hepatitis. western blot analysis was used to determine the protein levels of total jnk and the phosphorylation of jnk. however, the level of phosphorylated jnk was significantly increased in the cona - treated group and clearly decreased in the shikonin - pretreated groups at all the three time points (figure 5(a)). immunohistochemical staining was used to detect the expression of p - jnk, as shown in figure 5(b). the results of western blotting and immunohistochemical staining suggested that shikonin treatment can ameliorate liver injury in cona - induced hepatitis in part through the jnk / p - jnk pathway. previous studies have shown that il-1 plays a crucial role in cona - induced hepatitis and was suggested to play a role in the activation of jnk. figure 5 shows that the protein level of il-1 was consistent with the changes of p - jnk. autoimmune hepatitis is an inflammatory disease and its incidence has been increasing, which has resulted in an important global burden and poses a serious risk to human lives. however, there are no effective treatment measures, underscoring the need to identify effective therapy options. shikonin, a promising anti - inflammatory drug, has attracted the attention of scientists worldwide. several studies show that the release of inflammatory cytokines is involved in autoimmune hepatitis, including il-1, tnf-, ifn-, and il-6, giving rise to the development of liver injury [7, 26 ]. il-1, which is secreted by activated macrophages, plays a significant role in the necrosis of liver tissues. several studies have shown that shikonin exerts anti - inflammatory effects by downregulating the expression of the inflammatory cytokine il-1 in animal models [24, 28 ]. however, the mechanism of shikonin in concanavalin a - induced autoimmune hepatitis remains largely uncertain and requires further investigation. here, we established a model of cona - induced acute hepatitis to investigate the mechanism underlying the anti - inflammatory effect of shikonin. our results showed that shikonin pretreatment has a protective effect on cona - induced liver injury, as shown by serum liver enzymes levels, the release of inflammatory cytokines, and pathological changes. the levels of serum ast and alt and the range of necrosis of liver tissues on biopsy were markedly reduced by both doses of shikonin (7.5 mg / kg and 12.5 mg / kg), particularly in the high dose group. our results showed that pretreatment with shikonin suppressed the release of the inflammatory cytokines tnf- and ifn- and most significantly il-1. therefore, we examined shikonin could prevent liver tissue from injury caused by cona by inhibiting the expression of il-1 and the phosphorylation of jnk [29, 30 ]. jnk, one of the members of the family of mitogen - activated protein kinases (mapks), is activated by many types of factors, such as immune responses, cell stress, and especially the inflammatory cytokine il-1 [31, 32 ]. the active form of jnk is p - jnk, which is closely associated with apoptosis induced by il-1. reported that the apoptosis of pancreatic beta - cells induced by il-1 occurs mainly via the activation of the jnk pathway. revealed that the cell - permeable peptide inhibitor of jnk (jnki1) could effectively protect beta - cells from death induced by il-1. kim. found that the jnk pathway is closely associated with il-1 production in alzheimer 's disease. cona administration induced the phosphorylation of jnk to generate p - jnk, which was translocated from the cytoplasm to the mitochondrial membrane or cell nucleus causing liver injury. found that ellagic acid (ea) pretreatment significantly attenuated liver injury in cona - induced hepatitis through the phosphorylation of jnk. a recent study showed that astaxanthin protects liver tissues in a model of cona - induced immune hepatitis via the jnk / p - jnk pathway. we examined whether shikonin protected liver tissues in cona - induced hepatitis via the inhibition of the jnk / p - jnk signaling pathway. our results showed that cona enhanced the expression of p - jnk, and this was significantly decreased by pretreatment with shikonin, indicating that shikonin attenuated liver injury caused by cona by reducing the phosphorylation of jnk. to investigate how shikonin reduced liver injury by modulating the phosphorylation of jnk, we detected the expression of bcl-2, bax, and caspase 9. bcl-2 and bax belong to the bcl-2 family, which is an antiapoptotic protein, while bax represents a proapoptotic protein, and the balance of bcl-2 and bax determines cell survival or cell apoptosis (figure 6). the phosphorylation of jnk results in the inactivation and phosphorylation of bcl-2, leading to the release of cytochrome c and the activation of caspase - mediated apoptosis. our results showed that pretreatment with shikonin could increase the expression of bcl-2 and reduce the expression of bax and caspase 9 through the effect of p - jnk. these results indicated that shikonin could attenuate hepatic cell apoptosis in cona - induced hepatitis through the jnk / p - jnk pathway. recent studies showed that bcl-2 is a central regulator of autophagy and apoptosis and functions by interacting with beclin-1. when bcl-2 is inactivated by the effect of p - jnk, it causes the displacement of bcl-2 from beclin-1, thereby triggering autophagy. the induction of autophagy results in the formation of autophagosomes, which can generate several markers of autophagy, including lc3, beclin-1, and p62. the results of pcr and western blotting demonstrated that shikonin pretreatment decreased the expression of lc3 and beclin-1 and increased the expression of p62 compared with the cona - treated group. cona - induced hepatitis involves many complex and multifactorial mechanisms and these mechanisms need to be investigated further. moreover, additional studies are needed to examine the protective effects of shikonin on liver injury. | objective. shikonin possesses anti - inflammatory effects. however, its function in concanavalin a - induced acute liver injury remains uncertain. the aim of the present study was to investigate the functions of shikonin and its mechanism of protection on cona - induced acute liver injury. materials and methods. balb / c mice were exposed to cona (20 mg / kg) via tail vein injection to establish acute liver injury ; shikonin (7.5 mg / kg and 12.5 mg / kg) was intraperitoneally administered 2 h before the cona injection. the serum liver enzyme levels and the inflammatory cytokine levels were determined at 3, 6, and 24 h after cona injection. results. after the injection of cona, inflammatory cytokines il-1, tnf-, and ifn- were significantly increased. shikonin significantly ameliorated liver injury and histopathological changes and suppressed the release of inflammatory cytokines. the expressions of bcl-2 and bax were markedly affected by shikonin pretreatment. lc3, beclin-1, and p - jnk expression levels were decreased in the shikonin - pretreated groups compared with the cona - treated groups. shikonin attenuated cona - induced liver injury by reducing apoptosis and autophagy through the inhibition of the jnk pathway. conclusion. our results indicated that shikonin pretreatment attenuates cona - induced acute liver injury by inhibiting apoptosis and autophagy through the suppression of the jnk pathway. |
the first few days after birth are a critical period for mothers (1). childbirth is a significant life transition event, especially for primiparous women (2). in the postpartum period, mothers are faced with multiple biological, psychological, and social changes and the need to adapt to new problems and concerns (3). some mothers are very stressed and anxious and experience difficulties adapting to their new lives and responsibilities (4). the postpartum period is a critical time, during which mothers may feel very fatigued, exhausted, and anxious. anxiety is one of the most common complaints in the postpartum period. in a previous study by denis, the prevalence of postpartum anxiety was reported to be 18% in a study in maryland in the u.s. (6) and 12.7% in a study in south australia (2). in vancouver, canada, the incidence of postpartum anxiety was reported to be 14.2% in the first week after delivery, 12.1% in the fourth week, and 9.2% in the eighth week (5). in a study on the prevalence of anxiety and fear of childbirth in the postpartum period in tehran, iran, 14.7% of mothers reported mild anxiety, 26% had medium - to - low anxiety, 23% had above average anxiety, 27.3% had relatively severe anxiety, and 12.7% had severe anxiety (7). in another study in shiraz, iran, severe postpartum anxiety was observed in 85.5% of mothers, with 14% reporting mild anxiety (8). studies in ramsar (9), mashhad (10), and west azerbaijan, iran (11), reported that the prevalence of anxiety was 36.4%, 35.7%, 29%, and 39%, respectively. these results point to a higher prevalence of anxiety among mothers in iran compared to that in other countries. anxiety may delay or prevent the release of oxytocin during the breast - feeding period and potentially interfere with the breast milk letdown reflex (12). anxiety may strengthen avoidance behavior of mothers, as well as negatively influence the emotional bond between the mother and infant, putting the mother - infant attachment bond at risk (13). in addition, anxiety is a very strong predictor of postpartum depression (15), which is usually observed at the same time (2, 16). as a diagnosis of postpartum anxiety can help prevent subsequent depression (15), interventions need to be designed to reduce this disorder. various methods have been used to reduce anxiety, with therapeutic touch and massage some of the oldest applications (17). the prevalence of anxiety and the cost of treatment in the u.s. has led half of patients to use supplementary and alternative medicine, including massage, so that massage was the fourth most applied therapy among patients with anxiety (5.2%) (18). massage regulates the autonomic nervous system and therefore decreases the levels of cortisol, adrenaline, and noradrenalin. it can also adjust neural activity in the amygdale, frontal brain, and the control network. in addition, massage stimulates the sensory afferent c fibers in the skin, affecting the human body and mind. intermittent pressure applied during massage increases blood circulation and lymphatic drainage (19), which causes changes in the heart rate and blood pressure (20). this type of therapy also causes muscle relaxation, leading to increased comfort, reduced pain, and eventually reduced anxiety (17). relaxation in the postpartum period decreases the activity of the sympathetic nervous system and can prevent postpartum depression, and it can also increase effective mother - infant attachment (21). the use of complementary medicine in maternity care may reduce pharmacological interventions and their effects on infants (22). as noted earlier, there is a high prevalence of postpartum anxiety among iranian mothers, with remarkable negative outcomes, and prevention strategies and interventions can minimize the incidence of mental disorders after childbirth and improve the developmental outcomes of infants in a timely manner. thus, this study was designed to examine the effects of slow - stroke back massage on postpartum anxiety. this single - blind randomized controlled clinical trial consisted of 100 primiparous mothers referred to the shahidan mobini hospital (sabzevar, iran) between july and september 2015. the proposal was approved by the ethics committee of iran university of medical sciences (ir.iums.rec.1394.26109 94.3.3), and the study was registered with the iranian registry of clinical trials (irct i d : n15 201506042248). the inclusion criteria were as follows : being primiparous with a healthy baby, maternal age of 18 - 45 years, ability to read and write, and breastfeeding while in the hospital. the exclusion criteria included a history of chronic diseases, addiction, known mental health problems, facing a disaster in the last 6 months in their lives or their relatives lives, infertility, use of analgesics or epidural anesthesia during labor or in the postpartum period, and the presence of any ulcer, infection, or any other lesion in an area that would prevent massage. a dual - block randomization design was used to allocate the mothers to the two groups : massage (n = 50) and control (n = 50). in the dual - block two in one design, there were two possible sequences of ab and ba. based on the list, each mother was assigned to the experimental or control group. to prevent the effects of postpartum fatigue and insomnia on the outcome of the study, the intervention was performed in the 4 - 18 hours postpartum period (23). the sampling was carried out from july to september 2015. in this single - blind trial, the observer and mothers could not be blinded due to the nature of the study. based on the inclusion criteria, about 45% of mothers were not eligible to participate in the study due to muliparity. a total of 105 mothers met the study criteria and were included in the study. after providing the necessary clarifications in relation to the objectives of the study and obtaining written consent from the mothers, the participants completed a socio - demographic questionnaire. the mothers were then transferred to a quiet room, with a temperature of 27c, soft light, and free of environmental stimuli. after the mothers were made comfortable on beds in the room, they completed spielberger s state anxiety inventory (stai). in the experimental group, slow - stroke back massage was performed for 20 min, in a sitting position. vaseline, an odorless ointment, was chosen for the massage because the smell of the mother is an important stimulus for infants (24) and is necessary for the development of attachment between the mother and infant. using odorless vaseline the individual who performed the massage received training under the supervision of traditional medicine experts and earned a certificate to perform massage. in the control group, after 20 min and again the following morning, the mothers completed the stai. using the following formula, the required sample size was estimated as 45 subjects, with a confidence level of 95%, power of 80%, and assuming that the effect of the massage on the level of maternal anxiety on the first postpartum data was significant : considering a probability of incomplete questionnaires of 10%, the sample size was determined as 50 for each group. the tools used in this study included a socio - demographic questionnaire and the stai. the socio - demographic information included the mother s and father s ages, ethnicity, infant gender and birth weight, maternal education and occupation, economic and residence status, number of pregnancies and abortions, desirability of the pregnancy, the mother s and father s satisfaction with the infant s gender, and history of drug usage during the pregnancy and postpartum period. the stai is a standard questionnaire containing 20 items, which are designed to check the status of fear, tension, unrest, and anxiety feelings of individuals in the current situation and the moment. there are four possible responses to each statement : with 1 denoting never, 2 denoting sometimes, 3 denoting high, and 4 denoting very high. each statement is assigned a score of between 1 and 4, with 4 indicating a high level of anxiety. the total score of the scale is between 20 and 80, with a score of 20 - 31 indicating mild anxiety, 32 - 42 signifying moderate anxiety, and 43 - 53 denoting moderate - to - severe anxiety. scores of 54 - 64 denote relatively severe anxiety, whereas scores of 65 - 75 mean severe anxiety. the validity and reliability of this questionnaire have been demonstrated previously in research conducted in iran. furthermore, its scientific reliability was confirmed in 1993 by mahram (cronbach s alpha in the norm society and in the criterion community were 0.945 and 0.941, respectively) (26). in studies by kordi. (27) and dareshouri mohammadi (28), the reliability of the stai was reported to be r = 0.82 and r = 0.92, respectively. slow - stroke back massage was originally described by elizabeth (29) as a slow rhythmic light touch with the hands. in the present study, the procedure of the massage consisted of the following steps : the mother was seated on the edge of the bed. then, the researcher grasped the top of the mother s shoulders with both hands and placed the thumbs of each hand just below the base of the skull, making tiny circular movements on the upper neck. in the next stage, the researcher placed the palm of one hand at the base of the skull and made a long and smooth stroke all the way down the patient s spine to her waist. the second hand followed the first at the base of the skull and stroked down the spine as the first hand returned to the base of the skull. next, the researcher placed her hands on either side of the mother s neck under the mother s ears and stroked down and over the mother s collarbones with her thumbs just over the shoulder blades and repeated the motion several times. then, she placed the thumb of each of her hands beside the spine, beginning with the shoulders, and moved the thumbs down the spine to the waist and repeated this movement several times. finally, she completed the procedure by placing her palms on each side of the mother s neck and making continuous, long, sweeping strokes down the neck, across each shoulder, and down the back near the spine and repeated the entire process several times (30). spss, version 22 software was used to analyze the data. to compare the demographic variables of the control and experimental groups, a repeated measures analysis of variance was used to compare changes in the anxiety levels before and after the intervention. statistical significance in the tests was considered as p < 0.05. the tools used in this study included a socio - demographic questionnaire and the stai. the socio - demographic information included the mother s and father s ages, ethnicity, infant gender and birth weight, maternal education and occupation, economic and residence status, number of pregnancies and abortions, desirability of the pregnancy, the mother s and father s satisfaction with the infant s gender, and history of drug usage during the pregnancy and postpartum period. the stai is a standard questionnaire containing 20 items, which are designed to check the status of fear, tension, unrest, and anxiety feelings of individuals in the current situation and the moment. there are four possible responses to each statement : with 1 denoting never, 2 denoting sometimes, 3 denoting high, and 4 denoting very high. each statement is assigned a score of between 1 and 4, with 4 indicating a high level of anxiety. the total score of the scale is between 20 and 80, with a score of 20 - 31 indicating mild anxiety, 32 - 42 signifying moderate anxiety, and 43 - 53 denoting moderate - to - severe anxiety. scores of 54 - 64 denote relatively severe anxiety, whereas scores of 65 - 75 mean severe anxiety. scores of more than 76 are suggestive of very severe anxiety (25). the validity and reliability of this questionnaire have been demonstrated previously in research conducted in iran. furthermore, its scientific reliability was confirmed in 1993 by mahram (cronbach s alpha in the norm society and in the criterion community were 0.945 and 0.941, respectively) (26). in studies by kordi. (27) and dareshouri mohammadi (28), the reliability of the stai was reported to be r = 0.82 and r = 0.92, respectively. slow - stroke back massage was originally described by elizabeth (29) as a slow rhythmic light touch with the hands. in the present study, the procedure of the massage consisted of the following steps : the mother was seated on the edge of the bed. then, the researcher grasped the top of the mother s shoulders with both hands and placed the thumbs of each hand just below the base of the skull, making tiny circular movements on the upper neck. in the next stage, the researcher placed the palm of one hand at the base of the skull and made a long and smooth stroke all the way down the patient s spine to her waist. the second hand followed the first at the base of the skull and stroked down the spine as the first hand returned to the base of the skull. next, the researcher placed her hands on either side of the mother s neck under the mother s ears and stroked down and over the mother s collarbones with her thumbs just over the shoulder blades and repeated the motion several times. then, she placed the thumb of each of her hands beside the spine, beginning with the shoulders, and moved the thumbs down the spine to the waist and repeated this movement several times. finally, she completed the procedure by placing her palms on each side of the mother s neck and making continuous, long, sweeping strokes down the neck, across each shoulder, and down the back near the spine and repeated the entire process several times (30). spss, version 22 software was used to analyze the data. to compare the demographic variables of the control and experimental groups, a repeated measures analysis of variance was used to compare changes in the anxiety levels before and after the intervention. statistical significance in the tests was considered as p < 0.05. this study consisted of 100 primiparous women assigned to a massage therapy group (n = 50) or a control group (n = 50). about 46% of the mothers had a secondary education, and 94% were homemakers. in terms of economic status, 81% of the mothers had an adequate family income, and 9% belonged to low - income families. the ethnicity of the majority of the mothers in both groups was fars, iranian. there were no missing values, as the number of items that the mothers had to complete was low. the results indicated that the two groups were matched in terms of socio - demographic characteristics (table 1). there was no significant difference between the average anxiety level of the control group at the pretest and post - test stages and the next morning (p = 0.973). in the experimental group, there was a significant difference between the average state anxiety before and immediately after the massage and the next morning (p < 0.001), with the mean anxiety score reduced in this group (table 2). there was no significant difference between the average state anxiety of the mothers in the two groups before the massage (p = 0.268), whereas there was a significant between - group difference after the massage (p < 0. this study is the first to assess the effect of massage on anxiety levels in the postpartum period. the aim of this study was to evaluate the effect of slow - stroke back massages on the anxiety of primiparous women on the first postpartum day. the results showed that slow - stroke back massage was an effective intervention to reduce anxiety levels on the first postpartum day in primiparous women. in this study, after receiving the massage, the anxiety level of the experimental group was significantly reduced (p < 0.001), and the difference in the anxiety scores of the two groups was significant (p < 0.001), with the scores in the intervention group significantly reduced compared to those of the control group. this represents a higher improvement of the anxiety in the intervention group than the control group after the intervention. research on mothers on the first day after labor (23), third day after labor (31) and second day after birth (32) reported similar results. the results of the present study revealed that the level of anxiety in the control group did not change after the intervention (p = 0.973). this result was not consistent with the results of karagozoglu s (33) and bazrafshan s (34) studies, who reported increased anxiety. this may be due to differences in the taking care method of the control group in the two studies. in the present study, the researcher remained with the mother for 20 min in a calm room, which was different from ordinary hospital rooms. in the present study, the average anxiety score in the two groups before the intervention was moderate (32 - 42). in other studies of pregnant women in iran (34) and india (35), the average level of anxiety before the intervention (43 53) was high. unlike the present study, the aforementioned studies were carried out during pregnancy, in which the level of anxiety and depression may be high. this may explain the differences in the level of anxiety between those studies and the present one. the results of two studies in iran showed that the maternal psychological state (36) and well - being index (37) of mothers improved in the postpartum period (36, 37). thus far, studies have reported positive effects of massage on anxiety in patients undergoing colorectal surgery (38), patients with heart failure (39), elderly individuals (40), patients prior to labor (41), patients undergoing eye surgery (42), and patients with generalized anxiety (18). the results of the present study are consistent with the results of the previous studies and indicate that massage can decrease postpartum anxiety. the findings of this study showed that slow - stroke back massage in the first few days after birth reduced the mother s anxiety level. therefore, it is recommended that midwives and nurses use massage in the early days after labor to help the mother achieve relaxation. with the current facilities in iran, it seems that using simple and safe methods, such as massage, is appropriate action to reduce anxiety after labor and its consequences. although providing these services and psychological support may seem difficult for the midwifery and nursing staff and broaden their duties, taking these actions and supplying sufficient human resources in hospitals seems essential to improve the mental health of mothers and to reduce the problems caused by it. in addition, a mother s close relative or husband could be taught the procedure and asked to apply it in the hospital and during the first postpartum weeks. in this study, however, this screening test only reveals the anxiety of the subjects. to improve the assessment, we recommend that in the future, study assessment be done by interviews and that maternal satisfaction with the procedure be assessed. in addition, we recommend that maternal well - being should be evaluated during the 2-month postpartum period in future studies to determine whether the effects of the intervention are prolonged. during the postpartum period, mothers may be very anxious due to insomnia, pain, fatigue, and breast - feeding initiation problems. although the family is close to the mother, they always care for the baby, and they really do not know how they can help improve maternal well - being. this study showed that slow - stroke back massage is an effective, simple, inexpensive, and noninvasive intervention to reduce the anxiety level on the first postpartum day in nulliparous women. as mobini hospital is the only obstetric and gynecologic center in sabzevar city, and all pregnant mothers are referred to this center, the results can be generalized to all sabzevarian mothers. this study did not evaluate some interfering factors, such as satisfaction with the behavior of the hospital staff, the enjoyment level of the social protection, and other life stressors during the past year. it is also possible that the random allocation of the mothers to two groups buffered the effects of those variables on the study outcome. the second weak point of the study is that postpartum fatigue may be a confounder, which we could not assess, as there is no validated instrument for fatigue assessment in the postpartum period in iran. the first strong point of the study is that the mothers cooperated fully with the study and filled out the stai correctly. the second one is that the same researcher performed all the massage procedures on all the mothers. during the postpartum period, mothers may be very anxious due to insomnia, pain, fatigue, and breast - feeding initiation problems. although the family is close to the mother, they always care for the baby, and they really do not know how they can help improve maternal well - being. this study showed that slow - stroke back massage is an effective, simple, inexpensive, and noninvasive intervention to reduce the anxiety level on the first postpartum day in nulliparous women. as mobini hospital is the only obstetric and gynecologic center in sabzevar city, and all pregnant mothers are referred to this center, the results can be generalized to all sabzevarian mothers. this study did not evaluate some interfering factors, such as satisfaction with the behavior of the hospital staff, the enjoyment level of the social protection, and other life stressors during the past year. it is also possible that the random allocation of the mothers to two groups buffered the effects of those variables on the study outcome. the second weak point of the study is that postpartum fatigue may be a confounder, which we could not assess, as there is no validated instrument for fatigue assessment in the postpartum period in iran. the first strong point of the study is that the mothers cooperated fully with the study and filled out the stai correctly. the second one is that the same researcher performed all the massage procedures on all the mothers. | backgroundanxiety disorder is common during the postpartum period. back massage relaxation techniques are one of the most important nonpharmacological interventions to prevent and control postpartum - related anxiety.objectivesto determine the effectiveness of slow - stroke back massage on the anxiety levels of primiparous mothers in the first days after delivery.materials and methodsthis single - blind controlled clinical trial consisted of 100 primiparous mothers with normal deliveries. the mothers were randomly allocated to interventional (n = 50) or control (n = 50) groups using binary blocks. both groups were followed up just before, immediately after, and the morning after the intervention. data were collected using a demographic questionnaire and spielberger s state anxiety inventory (stai) questionnaire.resultsthe mean age of the mothers was 22 years. there were no significant between - group differences in age (p = 0.333), education (p = 0.427), and medication during labor and the postpartum period (p = 0.412). there was no statistically significant difference between the mean anxiety scores of the experimental (6.66 35.48) and control groups (9.05 37.42) before the intervention (p = 0.268). immediately after the massage and the next morning, there was a significant between - group difference in the anxiety scores (p < 0.001).conclusionsthe findings demonstrate that slow - stroke back massage is a simple, inexpensive, noninvasive, and effective method to reduce the anxiety levels of primiparous women during the first postpartum day. |
retinal detachment is the separation of multilayer neurosensory retina from the underlying retinal pigment epithelium. the incidence of rhegmatogenous retinal detachment (rrd) has significant geographic variations ranging between 6.3 and 17.9 per 100,000 people per year.1 in current clinical practice, scleral buckling, pars plana vitrectomy (ppv), and pneumatic retinopexy (pr) are used to treat rrd2 with reported primary success rates of 95%, 71%92%, and 64%, respectively.3 pr is both safe4 and cost - effective.5 it is used in 14%17% of cases of rrd making it the second most popular primary modality after ppv.6 the classic indications for pr are retinal breaks confined to the superior clock - hours, retinal break or breaks within 12 clock - hours, absence of proliferative retinopathy grade c or d, a cooperative patient who can be positioned, and clear media.7 in addition, in cases with other relative indications, pr was shown to have satisfactory results.7 in spite of the fact that the immediate anatomical success rate of pr has been reported to be lower than that of other techniques, the final best - corrected visual acuity (bcva) has been shown to be similar.810 it seems that though the success rate reported by studies investigating pr in the past 3 decades is declining,1012 it remains a popular technique.6 two recent large retrospective studies that investigated the risk factors for failure of pr reported an initial anatomical success rate of 61%63.3% with a final rate of 96.1%99.2%.13,14 the aim of this article was to 1) evaluate the initial and final success rate (both anatomically and functionally) of pr surgery for primary treatment of rrd ; 2) characterize the complications directly related to this procedure ; and 3) identify the subset of patients who are most likely to benefit from this procedure as a primary modality. all necessary authorizations were obtained from the institutional review board of the tel aviv medical center. the medical records of patients who underwent pr between the years 2009 and 2012 at the department of ophthalmology of the tel aviv medical center, a tertiary care hospital in tel aviv, israel, were reviewed. in our department, pr is used to repair rrd with retinal breaks located between 8 oclock and 4 oclock. the procedure is not performed in cases with inferior breaks or lattice between the 4 oclock and 8 oclock positions, retinal break > 1 hour, inability to detect retinal breaks in detached retina, clinically significant media opacity preventing identification of breaks, proliferative vitreoretinopathy grade c, previous retinal surgery, or poor patient compliance. patients who underwent ocular surgery (except cataract surgery) in the same eye prior to pr were excluded from this study. the demographic and preoperative characteristics extracted from each patient s medical record are depicted in table 1. all patients were treated with a similar pr technique, adapted from hilton by one of the three surgeons (la, ba, or ss).15 after attempting to identify all the retinal breaks via fundal examination, the necessity, alternatives, and potential complications of the procedure were explained to the patient by the physician before obtaining consent. the pr was performed under retrobulbar or subconjunctival combined with topical anesthesia. in the first stage, afterward, 0.5 ml of sf6 or 0.3 ml of c3f8 was injected into the vitreous. all patients were postoperatively positioned in order to correctly apply pressure to the area of detached retina. single operation success : successful retinal reattachment following a single pr throughout 2 months of follow - up.13 this group included patients who received additional laser or cryotherapy in the postoperative period. additional retinal detachment repair procedures performed in this group were the result of re - detachment occurring after a period of 2 months. final anatomical success : eyes in which the retina remained attached throughout the follow - up period. statistical analyses were performed using spss 21.0 (ibm corporation, armonk, ny, usa). we compared both baseline and follow - up characteristics of primary success patients and failure patients by using, whenever appropriate, student s t - test for normally distributed variables or kruskal we used or fisher s exact test as indicated for the analysis of categorical variables. we then performed stepwise backward multivariate logistic regression analysis that attempted to determine the baseline variables that enabled to predict success or failure introducing as independent variables those that reached a significant level of 1 hour, inability to detect retinal breaks in detached retina, clinically significant media opacity preventing identification of breaks, proliferative vitreoretinopathy grade c, previous retinal surgery, or poor patient compliance. patients who underwent ocular surgery (except cataract surgery) in the same eye prior to pr were excluded from this study. the demographic and preoperative characteristics extracted from each patient s medical record are depicted in table 1. all patients were treated with a similar pr technique, adapted from hilton by one of the three surgeons (la, ba, or ss).15 after attempting to identify all the retinal breaks via fundal examination, the necessity, alternatives, and potential complications of the procedure were explained to the patient by the physician before obtaining consent. the pr was performed under retrobulbar or subconjunctival combined with topical anesthesia. in the first stage, afterward, 0.5 ml of sf6 or 0.3 ml of c3f8 was injected into the vitreous. all patients were postoperatively positioned in order to correctly apply pressure to the area of detached retina. single operation success : successful retinal reattachment following a single pr throughout 2 months of follow - up.13 this group included patients who received additional laser or cryotherapy in the postoperative period. additional retinal detachment repair procedures performed in this group were the result of re - detachment occurring after a period of 2 months. final anatomical success : eyes in which the retina remained attached throughout the follow - up period. statistical analyses were performed using spss 21.0 (ibm corporation, armonk, ny, usa). we compared both baseline and follow - up characteristics of primary success patients and failure patients by using, whenever appropriate, student s t - test for normally distributed variables or kruskal we used or fisher s exact test as indicated for the analysis of categorical variables. we then performed stepwise backward multivariate logistic regression analysis that attempted to determine the baseline variables that enabled to predict success or failure introducing as independent variables those that reached a significant level of 3 months in 82% of the patients, > 12 months in 39%, and > 24 months in 9.5%. out of 84 eyes, 50 reached single operation success (59.5% ; 95% confidence interval [ci ], 48.8170.24), while 82 obtained final anatomical success (97.6% ; 95% ci, 94.33100.87). out of the 34 patients from the single operation failure group, 79.4% underwent a single additional reattachment procedure. the mean interval between the primary pr and additional reattachment procedure was 15.4 days (median, 17 days ; range, 1570 days). an overall average of 0.7021.095 additional retinal detachment operations was necessary to achieve final anatomical success. table 1 depicts the clinical characteristics at baseline and after follow - up of the 50 (59.5%) single operation success patients versus the 34 (40.5%) single operation failure patients. briefly, patients from both groups did not differ significantly in any of the variables examined. we used stepwise backward multivariate analysis to determine the effect of the variables that were associated with single operation success at a p - value of < 0.3 (age, preoperative logmar, time after cataract surgery, and clock - hours detached). when examining the subgroup of pseudophakic patients (n=22), 52.65% of the variation in single operation outcome was explained by the number of clock - hours detached (partial r=43.76%, p=0.001) and to a lesser extent by time after cataract surgery (partial r=8.89%, p=0.074). table 2 depicts the outcomes of the single operation success group versus the single operation failure group. there was a significant difference between both groups in terms of final bcva (logmar 0.2290.249 and logmar 0.7470.567, p<0.001). the difference in delta (final bcva preoperative bcva), however, was not significant (logmar 0.5440.816 and logmar 0.311.15, p=0.314). the single operation failure group had higher rates of cataract development and cataract surgery than the single operation success group (12.5% vs 30.3%, p=0.048, and 6.12% vs 48.48%, p<0.001, respectively). the single operation success group required less additional retinal detachment operations to achieve final anatomical success (0.20.5 vs 1.41.3, p<0.001). out of 84 eyes, 50 reached single operation success (59.5% ; 95% confidence interval [ci ], 48.8170.24), while 82 obtained final anatomical success (97.6% ; 95% ci, 94.33100.87). out of the 34 patients from the single operation failure group, 79.4% underwent a single additional reattachment procedure. the mean interval between the primary pr and additional reattachment procedure was 15.4 days (median, 17 days ; range, 1570 days). an overall average of 0.7021.095 additional retinal detachment operations was necessary to achieve final anatomical success. table 1 depicts the clinical characteristics at baseline and after follow - up of the 50 (59.5%) single operation success patients versus the 34 (40.5%) single operation failure patients. briefly, patients from both groups did not differ significantly in any of the variables examined. we used stepwise backward multivariate analysis to determine the effect of the variables that were associated with single operation success at a p - value of < 0.3 (age, preoperative logmar, time after cataract surgery, and clock - hours detached). when examining the subgroup of pseudophakic patients (n=22), 52.65% of the variation in single operation outcome was explained by the number of clock - hours detached (partial r=43.76%, p=0.001) and to a lesser extent by time after cataract surgery (partial r=8.89%, p=0.074). table 2 depicts the outcomes of the single operation success group versus the single operation failure group. there was a significant difference between both groups in terms of final bcva (logmar 0.2290.249 and logmar 0.7470.567, p<0.001). the difference in delta (final bcva preoperative bcva), however, was not significant (logmar 0.5440.816 and logmar 0.311.15, p=0.314). the single operation failure group had higher rates of cataract development and cataract surgery than the single operation success group (12.5% vs 30.3%, p=0.048, and 6.12% vs 48.48%, p<0.001, respectively). the single operation success group required less additional retinal detachment operations to achieve final anatomical success (0.20.5 vs 1.41.3, p<0.001). in this retrospective study, single operation success via pr was achieved in 59.5% of the cases. these rates are consistent with the lower part of the wide spectrum of rates reported in the literature with reported success rates ranging from 44% to 94%.16 the relatively low single operation success rate may be the result of including rrd cases that have, by classic definition, lower primary success rates (multiple breaks in multiple quadrants). vitreous hemorrhage, which coexisted in 11.9% of the rrd cases, may have prevented full identification of all the retinal tears. it is worth mentioning that the nine initial studies between 1986 and 1988 reported single operation success rates that ranged from 84% to 93.55%.16 this is in sharp contrast to the findings of this study and the lower rates reported by three recent studies that demonstrated a range of 60.7%69.6%.13,14,17 no statistically significant differences were found when comparing the baseline characteristics of the single operation success versus single operation failure groups. previous studies have reported substantially higher success rates for phakic rrds in comparison to pseudophakic or aphakic rrds.16 our findings are similar to those of a recent study by fabian who came to the conclusion that the anatomical outcome is similar in both groups. the main theory for the reported lower success rate is the presence of multiple missed breaks in pseudophakic and aphakic eyes. therefore, before performing pr in pseudophakic rrd, an in - depth examination of the peripheral retina is warranted.15 multivariate analysis of the subgroup of pseudophakic patients revealed that 43.76% of the variation in single operation outcome was explained by the number of clock - hours detached (r=43.76%, p=0.001). the odds ratio for each clock - hour detached in this group was 3.83 (95% ci, 1.0414.12). this in fact means that the size of detachment in pseudophakic patients predicted an increased risk of single operation failure. a study by tornambe on 302 eyes concluded that more extensive detachments are associated with lower single operation success. we speculate that larger detachments could potentially harbor numerous breaks that are more likely to go undetected in pseudophakic patients. the mean bcva at the final follow - up for single operation success was statistically significantly better for single operation success patients when compared to single operation failure (logmar 0.2290.249 and logmar 0.7470.567, p<0.001, respectively). these findings are supported by previous studies that reported better visual outcomes in the single operation success groups.13,14,16 in this study, the difference in delta (final bcva preoperative bcva) between both groups was not statistically significant. we speculate that this may be a result of a relatively low amount of additional retinal detachment procedures required in the single operation failure group (1.41.3). these findings are supported by those of ambler who demonstrated that initial failure of pr does not adversely affect the visual outcome. as there was a substantial difference in the final bcva of both groups, cataract is one of the leading causes of blindness in israel.19 in this study, the single operation failure group had higher rates of cataract development and cataract surgery than the single operation success group (12.5% vs 30.3%, p=0.048, and 6.12% vs 48.48%, p<0.001, respectively). the higher rate of cataract development and cataract surgery in the single operation failure group may have been the result of additional retinal detachment operations performed, such as ppv, which increase the likelihood of developing clinically significant cataract.20,21 therefore, combined surgery by phacoemulsification and vitrectomy in one session may be considered in cases with a significant cataract.22 the retrospective nature of this study in itself is a limitation as there may be several additional factors that were not studied, which may influence the outcomes. as part of the methodology of this study, a relatively large number of parameters that may have affected the outcomes were collected and studied in order to minimize the influence of such factors. in summary, pr as demonstrated in this study carries a lower single operation success rate than initially published 3 decades ago. careful patient selection is warranted before performing pr in rrd, particularly in pseudophakic patients with large detachments. those in which the procedure does not succeed the first time will require on average 1.4 additional procedures to achieve final anatomical success. | backgroundpneumatic retinopexy (pr) remains a popular technique for the treatment of rhegmatogenous retinal detachment (rrd).objectiveto evaluate the single operation and final success rate of pr for primary treatment of rrd and to determine factors associated with anatomical and visual outcomes.methodsthis retrospective case review study analyzed the data of patients who underwent pr for primary treatment of rrd. patients with a follow - up period of < 2 months were excluded. single operation success was defined as successful retinal reattachment following a single pr throughout 2 months of follow-up.resultseighty-four eyes met the inclusion criteria. single operation success was achieved in 50 eyes (59.5%), while 82 obtained anatomical success at the final follow - up visit (97.6%). an average of 0.7021.095 additional retinal detachment operations was necessary to achieve final anatomical success in the entire cohort (n=84) and 1.41.3 in the single operation failure group (n=34). both groups (single operation success vs failure) did not differ significantly in any of the preoperative variables. multivariate analysis of pseudophakic patients (n=22) revealed that 52.65% of the variation in single operation outcome was explained by the number of clock - hours detached (partial r2=43.76%, p=0.001). the final best - corrected visual acuity was significantly better in the single operation success group (logarithm of minimum angle [logmar ] 0.2290.249 vs logmar 0.7470.567, p<0.001).conclusioncareful patient selection is warranted before performing pr in rrd, particularly in pseudophakic patients with large detachments. ultimately 60% of the cases will attach after the procedure with the rest requiring on average 1.4 additional procedures to achieve final anatomical success. |
ochronosis is defined as the accumulation of metabolites of oxidation and polimerization of homogentisic acid (hga) in the connective tissues, which have high affinity to collogen. because of the defect occurred in the gene which codes homogentisate 1,2 dioxygenase located on the 3q chromosome, homogentisic acid accumulates in tissues and excreted in urine. ochronosis is seen mostly in adults and peaks in the forth decade. with increasing age complaints of hip, although ochronotic pigmentation of tissues, black discoloration of urine due to sodium hydroxide (naoh), degenerative arthropathy of large joints are classical findings, definitive diagnosis is made with quantitative detection of homogentisic acid in the urine and detection of ochronotic pigmentation in the histopathologic examination of tissue biopsies. in this paper we present a case complaining of knee pain and having arthroscopically detected black discoloration of menisci and cartilage which led us to the biopsy and further laboratory tests and finally diagnosed as ochronosis. a forty two year - old male admitted to our outpatient clinic with right knee pain and clicking on exertion for two years. there was pain on the lateral joint line by palpation and mc murray test was positive. x - ray revealed arthrosis in the lateral tibiofemoral and patellofemoral joint spaces. magnetic resonance imaging (mri) of the right knee revealed effusion, partially torn anterior cruciate ligament, thickening of quadriceps tendon. there were 3 cm 2 cm in diameter outerbridge stage 4 chondral defect in patellar joint surface and medial femoral condyle. 1). acl was partially torn but the posterior cruciate ligament (pcl) was intact. arthroscopic view of the lateral joint space revealed a large, yellow and black colored grade 4 chondral defect in the lateral tibial condyle. lateral meniscus was thickened, black colored at the inferior surface and torn (fig. biopsy was taken from the black colored areas of femoral condyle (fig. 3a and b). we have done further investigation with the suspect of ochronosis because of the black discoloration of tissues seen in the arthroscopic intervention. urine was normal in color but when treated with sodium hydroxide (naoh) color of the urine became darker (fig. the patient is under follow up by cardiology for valvular insufficiency and orthopedics for ochronotic arthropathy. it was first described by virchow in a postmortem examination of a 67 year - old patient in 1866. it is characterized by deposition of ochronotic pigment in the tissues due to homogentisic oxidase enzyme deficiency in the tyrosine metabolism. ochronotic pigment can accumulate in hyaline cartilage, tendon, skin, teeth, nail, sclera, tympanic membrane, heart valves, renal tubular cells, duramater, pancreas and walls of great arteries. ochronosis is easily recognized with ochronotic pigmentation of tissues, degenerative arthropathy, especially in large joints and dark discoloration of urine because of alcalinisation. all patients in the literature were examined with knee arthroscopy with different reasons and the diagnosis of ochronosis is made through a further investigation of the intraarticular tissues because of the black discoloration. as in the other cases, black discoloration of cartilage and meniscal tissues moreover, we detected osteoarthritis and vacuum phenomenon in the intervertebral joints, arthrosis of large joints like hip, knee and glenohumeral joints and increased homogentisic oxidase in urine. unlike other cases we detected thickening of quadriceps tendon and asymptomatic supraspinatus tear in the mri and mitral valve insufficiency as an extraarticular finding. increasing homogentisic acid levels in the blood and resulting accumulation in tissues become symptomatic especially in the forth decade along with decreasing renal functions. in ochronotic arthropathy, articular cartilage becomes more sensitive to mechanic stresses causing fragmentation and resulting in nonspecific tenosynovitis. high grade glenohumeral arthropathy is very rare but must be kept in mind in ochronotic arthropathy. homogentisic acid polyphenol oxidase enzyme, which is located especially in tendons and ligaments, produces free radicals through oxidation and causes tendon and ligament ruptures. mri of our patient revealed partial rupture of acl, a thickened quadriceps tendon and asymptomatic rupture of supraspinatus tendon. high dose ascorbic acid (100 mg / kg) may reduce hga excretion in the urine but does not prevent development of arthropathy. because the modalities addressing the cause of the disease are unclear, treatment of ochronotic arthropathy is symptomatic. nonsteroid antiinflammatory drugs and preparates containing glucosamine and chondroitin sulphate, intraarticular hyaluronic acid and steroid injections, arthroscopic debridement and arthroplasty are the treatment options. arthroscopy is helpful in diagnosis of ochronotic arthropathy and may lead to further investigation and treatment of concomitant pathologies. written informed consent was obtained from the patient for publication of this case report and case series and accompanying images. a copy of the written consent is available for review by the editor - in - chief of this journal on request. adnan kara : study concept or design, data collection, data analysis or interpretation, writing the paper. hasan basri sezer : writing the paper.bekir eray kilinc : writing the paper.metin uzun : writing the paper.key learning pointochronosis is a rare disease affecting connective tissues. arthroscopy is helpful in diagnosis of ochronotic arthropathy and may lead to further investigation and treatment of concomitant pathologies. arthroscopy is helpful in diagnosis of ochronotic arthropathy and may lead to further investigation and treatment of concomitant pathologies. arthroscopy is helpful in diagnosis of ochronotic arthropathy and may lead to further investigation and treatment of concomitant pathologies. | introductionochronosis is a rare disorder which is defined as the deposition of metabolites of oxidation and polymerization of homogentisic acid, which have high affinity to collogen, in the connective tissues. it is a clinical condition characterized with ochronotic pigmentation of tissues, degenerative arthropathy of especially large joints and black discoloration of urine. in this paper we present a case of ochronosis diagnosed with biopsy and additional tests when a black discoloration of menisci and joint cartilage were detected during arthroscopic intervention for a degenerative meniscus tear.presentation of casea forty two year - old male patient was operated for lateral meniscus tear of his right knee. the arthroscopic examination of right knee revealed black colored synovial hypertrophy and torn lateral meniscus. partial meniscectomy was performed. the diagnosis of ochronosis was made after histopathologic examination.discussionochronotic pigment can accumulate in hyaline cartilage, tendon, skin, teeth, nail, sclera, tympanic membrane, heart valves, renal tubular cells, duramater, pancreas and walls of large arteries. in ochronosis the most frequently involved joints are knee and hip. in ochronotic arthropathy, articular cartilage become more sensitive to mechanical stresses. our patient had meniscal tear, cartilage damage and black discoloration of synovial tissues and meniscus.conclusionarthroscopy may be helpful in diagnosis of ochronotic arthropathy. |
deletions, point mutations, amplifications, insertions, inversions and translocations can alter the dna sequence. transmission from parent to offspring results in fixation of these mutations within a population. as schematized in the poster, mice caught in the wild can contain one of four bases (a, c, g or t) at a given locus ; a female and male are initially mated in the laboratory to produce offspring. inbreeding by brother - sister matings for 20 consecutive generations creates inbred strains (see box 1 for definition of terms) of mice, and each individual strain is virtually homozygous for every gene in the genome (isogenic) (silver, 1995). inbred strains have thus captured a portion of the natural variation present in wild mice. the mouse genome database describes the origins and characteristics of inbred strains and is a comprehensive database for information about the mouse (www.informatics.jax.org). given the large number of inbred strains, it is estimated that these collective resources now exhibit more variation than that present in the human population. natural variation accounts for the differences in phenotype exhibited among inbred strains (as well as between individuals). sequence differences can alter transcripts and proteins by altering their functional properties, as well as the timing, level and site(s) of expression in the body. monogenic traits are controlled by only one gene, whereas complex traits are controlled by two or more genes. intercrosses and backcrosses between inbred strains exhibiting the extremes of a specific phenotype permit a general localization of genes influencing the trait by matching phenotype to genotype. modifier genes, namely genes that can modify the phenotype of an already existing mutation or disease allele ; thus, a disease can manifest as mild or severe, depending on the influence of modifier alleles (nadeau, 2003). the chromosomal location of each type of gene can be refined through the use of consomic, conplastic, congenic, recombinant inbred (ri) and/or recombinant congenic (rc) strains (roberts., 2007). an array of possible forms of a gene, which can each cause different phenotypic effects. the mating of a heterozygous individual with one of its inbred parents, or with an individual of the same genotype as one of its inbred parents, to follow the inheritance of alleles and phenotypes. a strain derived by backcrossing an allele or mutation of interest onto the background of a different strain for at least ten generations to achieve allelic transfer. a strain that carries the mitochondrial genome from a donor strain and the nuclear genome of a recipient strain. conplastic strains are made by intercrossing two inbred strains, followed by sequential crosses of females to recipient males. a strain that carries one pair of homologous whole chromosomes from a donor strain on the genetic background of a recipient strain. a complete set of consomic strains is 21, which includes those with each of the 19 autosome pairs, the x chromosome pair and the y chromosome. a genetic analysis that proceeds from phenotype to genotype by positional cloning or candidate gene analysis. a cross between two individuals with the same heterozygous genotype (usually a brother by sister mating), to follow the inheritance of alleles and phenotypes. a set of strains derived from intercrossing two inbred strains, followed by a small number of backcross generations prior to inbreeding. a subset of the donor genome remains present on the background of the recipient strain. a set of strains derived from intercrossing two inbred strains, then brother by sister mating their f2 offspring for at least 20 generations to derive new inbred strains. each strain represents a random mixture of genes from the two parental strains that are fixed in the new inbred strain. a genetic analysis that proceeds from genotype to phenotype by genetic engineering techniques, such as homologous recombination in embryonic stem (es) cells. an electronic version of this poster is available online. natural variation can be used to identify genes involved in a variety of quantitative traits and diseases (hunter and crawford, 2008). already established and developing resources are designed to mimic the diversity present in human populations. the collaborative cross (cc) is a combination of the genotypes of eight inbred strains, specifically chosen because of the diversity of their genomes (only four strains are shown in the poster for simplicity) (churchill., 2004). each of the eight inbred strains that contribute to the cc is being sequenced, so that the molecular genetic contribution of each chromosomal region will be known by determining the genotype of each cc strain using the mouse diversity chip (yang., 2009). because the molecular composition of each cc strain will be known, phenotyping each strain for a trait such as immune response, blood glucose level, bone density or social behavior will allow researchers to determine a refined chromosomal location for quantitative trait loci (qtls) affecting the trait of interest using in silico methods. an advantage of the cc is that all data are cumulative, allowing for cross - referencing of phenotype and genotype databases derived from the cc strains. heterogeneous stock (hs) populations also represent contributions from eight inbred strains ; however, hs populations are maintained by random matings of mice within a colony (valdar., 2006). therefore, although the molecular contribution from the eight progenitor inbred strains is known, new inbred strains are not created. thus, each individual hs mouse has a unique combination of alleles (see poster). hs mice are designed to contain random variation within a population that would be similar to that found in the human population, allowing for a controlled molecular knowledge of the alleles that contribute to each mouse. because each individual derived from the hs cross is unique, the molecular component of each mouse must be genotyped, and each mouse must be phenotyped to identify genes affecting the trait of interest. the benefit of these novel resources is the ability to map a trait of interest to a small chromosomal region, and ultimately to identify the genes and pathways responsible so as to better prevent and treat human disease. current sequencing efforts for the human genome are revealing a large number of genetic alterations that occur from generation to generation. the nature of these private mutations and their impact on phenotype has yet to be fully evaluated. such individual variation contributes to a phenotype by uniquely affecting the individual who carries such changes. these types of changes can be evaluated in the mouse by using reverse genetics or transgenesis. the ability to introduce a mutation by design is termed reverse genetics. of all experimental organisms, fluent reverse genetics is currently only available in escherichia coli, yeast and the mouse, owing to the remarkable renewing properties of mouse embryonic stem cells (mescs) (soriano, 1995). this feature is one of the main reasons for the pre - eminence of the mouse as the leading mammalian model system (oliver., 2007). mescs are derived from early - stage embryos and can be grown in culture yet retain the ability to contribute to the formation of a mouse on reintroduction into an early - stage host embryo usually at the blastocyst stage, as illustrated in the poster. because mescs can be grown in culture, the mouse genome can be engineered by transfection with dna constructs that have been engineered in vitro to carry a specifically designed mutation (the insertion of loxp sites is shown in the poster). the dna construct can be precisely integrated into the mouse genome via homologous recombination, so that the existing dna sequence is altered exactly by design (capecchi, 1989). alternatively, the gene can be disrupted by random or transpositional gene - trapping mutagenesis (evans., 1997). gene trapping varies from targeted mutagenesis in that a construct carrying a reporter gene can insert into a gene, disrupting its function. the sequence flanking the insertion is determined subsequently, and the expression of the reporter can allow for the assessment of where the gene is expressed. a disadvantage is that the insertions might not disrupt the gene, or that they have the potential to affect flanking genes owing to their position. for either targeted mutations or gene - trapped mutations, transfected mesc clones can be selected after screening for disrupted alleles in the gene of interest. after injection into a blastocyst, the selected mesc clone mixes into the host embryo to contribute to a chimera composed of host and mutated cells ; this chimeric adult can propagate the mesc mutation by germline transmission to create a genetically engineered mouse strain. the ability to engineer the mouse genome via mescs stimulated the development of sophisticated genome engineering and gene expression strategies (glaser., 2005). chief among these is conditional mutagenesis based on the use of cre - loxp site - specific recombination (branda and dymecki, 2004). two 34-bp loxp sites are introduced into a chosen gene, either by gene targeting or trapping, so that normal gene expression is undisturbed. floxed gene is mutagenized upon exposure to cre recombinase, which mediates dna recombination between the loxp sites. the mutagenic event can be controlled in space and time by regulating cre recombinase expression and/or activity (schnutgen., 2006). for example, it could be that complete elimination of a gene of interest results in embryonic lethality due to a requirement in embryogenesis ; however, mating a conditional allele of this gene to a cre expresser during adulthood would result in the elimination of the gene long after it is required for embryonic development, allowing the researcher to investigate the function of the gene in the adult. a growing panel of mouse lines that express cre recombinase in specific cell types, termed the cre zoo, is being developed to achieve spatial precision in mutagenesis (see transgenics section). additionally, temporal regulation of cre recombinase activity can be achieved by expressing cre as a fusion protein with a steroid receptor ligand - binding domain, usually the mutant estrogen domain termed thus, crossing a cre driver mouse with a mouse carrying a floxed gene enables conditional mutagenesis in an inducible way. a gene that does not inherently belong to the organism, but is introduced into its genome from an outside source is called a transgene. transgenesis can be achieved in mice by the microinjection of manipulated dna into the pronucleus of a fertilized egg (palmiter and brinster, 1985). the dna inserts at random into the genome, and if it does so prior to cell division, it can contribute to all cells of the organism. exogenous transposons as well as engineered or targeted mutations are also transgenes ; however, these are not examples of microinjection transgenics. to obtain ova for microinjection, female mice must be superovulated using hormone injections to obtain a maximum number of embryos after mating to males. fertilized eggs are harvested and injected with linearized dna constructs in the laboratory, then surgically implanted into the oviducts of foster mothers that are the subsequent liveborn mice represent founders carrying the transgene ; these mice must be analyzed for the presence or absence of the exogenous dna. for example, neomycin allows cells to grow in media that contains g418, and hypoxanthine phosphoribosyltransferase (hprt) allows growth in medium containing hypoxanthine, aminopterin and thymidine (hat). growing the cells in such media is required, but repeated selection can be detrimental to the cells (plagge., 2000). furthermore, the presence of internal promoters required to drive the expression of selection cassettes can influence the expression of flanking genes. this can be achieved by the use of another site - specific recombination system derived from yeast : the flp recombinase catalyzes recombination at frt sites (farley., 2000). the most commonly used mescs are ab2.2, which are derived from the 129/ola inbred strain, and jm8, which are derived from the c57bl/6n inbred strain. the availability of knockouts on either strain background reduces the likelihood that modifier genes will affect the phenotype after mice are made. however, each strain background has different germline transmission rates (pettitt., 2009). germline transmission of the mesc genetic component is required to obtain mice that carry the construct. however, aneuploidy of the mescs can preclude the ability of the clone to achieve germline transmission. obtaining early passage mescs and reducing the manipulations required to generate the desired construct can make germline transmission more likely. human disease can also be caused by lesions other than deletions that alter gene function. for example, point mutations can be modeled using a knock - in, whereby the precise lesion found in the human is introduced into the mouse using a two - step procedure in mescs (plagge., 2000). alternatively, a transgene expressing the human disease mutation can be introduced into the knockout background. the first application of mouse transgenesis was a physiological one : the introduction of human growth hormone resulted in increased size (palmiter., 1982). subsequent applications of transgenesis were to express a gene under the control of exogenous regulatory elements, or to drive a reporter gene under the control of regulatory elements. such experiments have been very powerful for cancer studies, as well as for understanding mechanisms of gene regulation. shown in the poster is an example of a cre driver mouse : a promoter element is used to drive expression of cre recombinase in a spatial- or temporal - specific pattern. as explained earlier, in the reverse genetics section, cre drivers are required for conditional deletion of a region of dna from mice that contain loxp sites. other applications of transgenics are to express a bacterial artificial chromosome (bac) or yeast artificial chromosome (yac) in the mouse, for gene rescue or for humanization (expression of a human gene or genomic region in the mouse). there are several problems with microinjection transgenics, which must be understood for their proper use. because integration is random, endogenous regulatory elements can influence the expression of the transgene.the linearized dna commonly integrates as a head - to - tail concatamer in copy numbers that vary from one to > 200 per haploid genome. copy number influences the level of expression, and copies can be lost in subsequent generations by gene conversion.if the dna integrates late in embryonic cell division, the founder mice can be mosaic, and must be bred to achieve contribution of the transgene to all cells. this is a common problem for large transgenes such as bacs.integration can result in an insertional mutation, as demonstrated in the transposon section (see below). because integration is random, endogenous regulatory elements can influence the expression of the transgene. the linearized dna commonly integrates as a head - to - tail concatamer in copy numbers that vary from one to > 200 per haploid genome. copy number influences the level of expression, and copies can be lost in subsequent generations by gene conversion. if the dna integrates late in embryonic cell division, the founder mice can be mosaic, and must be bred to achieve contribution of the transgene to all cells. integration can result in an insertional mutation, as demonstrated in the transposon section (see below). recent techniques using site - specific recombinases obtained from bacteriophages have been developed to alleviate these concerns. these include the use of docking sites for site - specific integrases so that the effect of position and copy number is reduced, thus eliminating the requirement for multiple founders (branda and dymecki, 2004). an adaptation of cre - loxp conditional expression uses knock - in alleles to overcome many of the disadvantages of classical transgenics. a gene can be placed under the control of a ubiquitous promoter (driving the expression of the gene in all cells at all times) or self promoter (driving the expression of the gene under the control of its normal promoter), but transcriptional stop sequences, which are flanked by loxp sites, can be inserted to block its expression. when the animal is mated to a cre expresser, or cre is spatially introduced (as in viral cre delivery), recombination occurs between the loxp sites, allowing for deletion of the stop cassette, inducing expression of the gene in a tissue or site of interest (zadelaar., this application is powerful for cancer studies, because expression of a single copy gene is precisely regulated by time and location ; it can be designed to allow expression in a single cell (marumoto., 2009). in forward genetics approaches, many agents, including chemicals, radiation and viruses, are used to disrupt genes to identify their functions and the diseases associated with them. the most powerful mutagen for forward genetic screens in mice is the alkylating agent n - ethyl - n - nitrosourea (enu), which can produce mutation rates as high as 1.510 per mutagenized genome in male mouse spermatogonial stem cells (russell., 1979 ; guenet, 2005). enu primarily produces point mutations, which include loss - of - function, gain - of - function, and super - active and partially active coding region mutations, as well as non - coding rna and regulatory mutations. after treatment with enu, male mice are mated in genetic screens designed to uncover mutations of interest (justice, 2000). dominant mutations are isolated by their phenotype in the first generation of breeding (hrabe de angelis and balling, 1998). mutations that result in visible phenotypes, such as changes in the coat, morphology or movement, are simple to detect. more advanced phenotype screening methods for behavior, hematology, pain perception and biochemistry have uncovered many previously unknown dominant mutations. screens for modifying mutations are likely to be the most common use of forward genetics in the future, because they are a powerful method for identifying disease suppressors (carpinelli., 2004). in a modifier screen, a new unknown dominant mutation present in the enu - treated male gamete is isolated by its ability to modify (either by enhancing or suppressing) a known recessive or dominant phenotype that is produced by a mutation carried by a female mouse with which the male is mated, or that is present as a homozygous viable trait in the strain background. here, the idea of complex traits is taken to the extreme : instead of relying on natural variation, potent mutations are induced in dna, and the animal reveals important interactions. screens for recessive mutations using three - generation pedigree breeding schemes or using balancer chromosomes have been carried out (kasarskis., 1998 ; herron., 2002 ; kile., 2003 although recessive screens require more breeding time, their use has produced mutations to understand developmental pathways, immunology and responses to infection (beutler. a mutation is mapped to a molecular interval, and then genes are sequenced to identify lesions caused by enu treatment and not repaired. banks of sperm and dna samples from mutagenized males are useful for identifying point mutations in desired genes (coghill., 2002). the identification of point mutations is now straightforward owing to advances in sequencing technology and in mutation detection. once a mutation is identified, the affected gene must be confirmed by a second mutation, perhaps by a gene knockout, or by a rescue of the mutant phenotype using a transgene. transposable elements are discrete pieces of dna that can jump around in the genome of a living organism. for each dna transposon, a corresponding protein, called a transposase, mediates the jumping. two exogenous transposon - transposase duos have proven to be powerful forward genetic mutagens in the mouse : sleeping beauty (sb), which was a non - functioning system that has been resurrected from salmonid fish, and piggybac, which is native to the cabbage looper moth (bestor, 2005 ; horie., 2010). unlike enu mutagenesis, which requires large amounts of sequencing to pinpoint each tiny change, transposable elements are powerful because their sequence is known, so when a transposon insertion mutates a gene, the transposon sequence provides a each of these elements works by a cut - and - paste mechanism so that the transposase (represented by scissors in the poster) cuts the transposon out of one location, allowing the transposon to hop to a new location. the transposon is flanked by direct repeats (represented by arrowheads), which are required for transposition. in its new location, the transposon can enhance gene expression (green arrow), disrupt gene expression (stop sign), or have no effect on gene expression. the most powerful application of the transposon systems in mice has been to identify genes that promote cancer (collier and largaespada, 2007). the system has applications outside mutagenesis, because the transposons can be engineered to deliver dna cargo to many locations in the genome using the direct repeat sequences. genome - wide association studies (gwas) are continually identifying a growing number of loci that are associated with human diseases [see the catalog compiled by the national human genome research institute (nhgri) at www.genome.gov/gwastudies/index.cfm ], increasing the need to investigate the function of these disease alleles in vivo. furthermore, whole - genome sequencing is just beginning to reveal what might be a multitude of rare, individual mutations that underlie human disease and other complex traits (manolio., 2009). the only means to understand biological processes that occur in cells and physiological processes that occur in whole organisms is to recapitulate alleles associated with disease in a controlled setting, and to explore the effects of selected mutations and/or variants, both individually and in combination. the mouse is the only mammalian system that currently has the resources as well as the technology to fulfill this challenge. the combination of forward and reverse genetics, along with transgenesis and the ability to exploit natural variation, provides a variety of approaches to selectively manipulate the mouse genome and reveal the impact of genetic variants as well as discover missing heritability factors. to move the field forwards on a large scale, the international knockout mouse consortium (ikmc) will soon achieve its goal of having a mouse mutant or a targeted mesc for every gene, providing a crucial resource for functional annotation (www.knockoutmouse.org). mouse disease clinics, which use broad - based phenotyping platforms, will assess these strains to understand gene function and model human disease (http://eumodic.org ; http://nihroadmap.nih.gov/komp2/). the complex trait community will soon generate up to 1000 strains that can be phenotyped for many traits and under many conditions (http://www.complextrait.org/). in support of these efforts, 45 of the most commonly used inbred strains that show a high degree of diversity are being analyzed for common variation or are being sequenced, providing powerful information on the origin and evolution of inbred strains of mice (http://www.ensembl.org/mus_musculus/info/index). the challenge now is to expand our creativity by developing novel assays to detect a broad spectrum of phenotypes that are relevant to human health and disease. studies in mice and humans are thus poised to inform the other, resulting in new avenues for disease prevention, risk assessment, diagnosis and treatment. the future holds great promise as we follow the unwinding dna road towards a fuller understanding of the genetic basis for human health. | the mouse is the leading organism for disease research. a rich resource of genetic variation occurs naturally in inbred and special strains owing to spontaneous mutations. however, one can also obtain desired gene mutations by using the following processes : targeted mutations that eliminate function in the whole organism or in a specific tissue ; forward genetic screens using chemicals or transposons ; or the introduction of exogenous transgenes as dnas, bacterial artificial chromosomes (bacs) or reporter constructs. the mouse is the only mammal that provides such a rich resource of genetic diversity coupled with the potential for extensive genome manipulation, and is therefore a powerful application for modeling human disease. this poster review outlines the major genome manipulations available in the mouse that are used to understand human disease : natural variation, reverse genetics, forward genetics, transgenics and transposons. each of these applications will be essential for understanding the diversity that is being discovered within the human population. |
in recent years, air pollution has been a serious problem in some asian countries. an important consequence of air pollution is its effect on health, particularly on the respiratory system1, 2. as an assessment of respiratory health, forced expiratory volume in 1 second (fev1) is an important measure of the health of older people. the annual decline in fev1 is an important predictor of morbidity and mortality related to cardiovascular disease3. usually, fev1 reaches a maximum in the third decade of life and then decreases gradually with age4, 5. in addition to physiologic factors such as aging, other factors influence the decline in fev1. air pollution, as well as respiratory diseases such as asthma and chronic bronchitis, also causes a more rapid decline in fev12, 7, 8. respiratory symptoms, including dyspnea, wheezing, coughing, and sputum production, occur as a result of air pollution2, and reflect airway inflammation9. however, it is not clear if patients with respiratory symptoms caused by air pollution experience an accelerated decline in fev1. because of rapid industrialization in the 1960s in japan, air pollution caused by flue gas emitted from industrial plants became a serious problem10. one of the measures, the air pollution control law, was intended to improve the environment. this law regulated acceptable levels of air pollutants and implemented measures aimed at preventing pollution. the acceptable level of sodium dioxide (so2) was stated to be 40 parts per billion (ppb), that of nitrogen dioxide (no2) was 20 ppb (until 1978, when it was changed to 40 ppb), and the acceptable level of suspended particulate matter (spm) was 100 g / m. air environmental conditions improved as evidenced by reports from the air pollution office (comprising the general environmental air measurement office and motor exhaust measurement office). as an example, 1.concentration of air pollutants in the mizushima district of kurashiki from 1969 to 200910, 11 shows the average annual levels of so2, no2 and spm recorded in mizushima district from 1969 to 200912, 13. the level of pollutants decreased to below the minimum acceptable level from the mid-1970s. the other measure, the pollution - related health damage compensation law, protects the cultural lives and health of people. it compensates officially acknowledged victims with pollution - related illnesses for medical fees and other medical services (e.g., medications). concentration of air pollutants in the mizushima district of kurashiki from 1969 to 200910, 11 decades have passed since air pollution was a serious problem in japan. environmental conditions have improved over time, as has the help and aid for affected individuals. many studies on air pollution have focused on the immediate or relatively short - term effects on measures of health14,15,16. there is a lack of studies in settings in which the environment has improved and a long period of time has elapsed. our research team has reported several longitudinal studies that targeted officially acknowledged victims with pollution - related illness12, 13, 17. however, in one of those studies, smokers were excluded to confine observations to the effect of air pollution12. in our previous report examining the lung function of officially acknowledged victims with pollution - related illness in two geographical areas within japan those two studies found that the annual change in fev1 in non - smokers who were officially acknowledged victims with pollution - related illness was within the normal range. however, those studies were limited in their application because the effect of smoking was not examined and because factors associated with the annual change of fev1 were not clear. if the factor associated with a greater decline in fev1 became clear, it could assist in maintaining lung health in countries in which air pollution is present. the aim of the present study, therefore, was to examine the factors, including cigarette smoking, associated with the annual change in fev1 of officially acknowledged victims with pollution - related illness in settings in which the environment has improved and a long period of time has elapsed. the present study is unique in that the investigation is a longitudinal study of victims in an area in japan in which air pollution was once a serious problem but where, over the years, air quality has improved. the present study was approved by the ethics review committee of nagasaki university graduate school of biomedical sciences (nagasaki, japan). this study was undertaken by analyses of retrospective data obtained from annual health surveys conducted with officially acknowledged victims of air pollution - related illnesses from the mizushima district of kurashiki (okayama prefecture, japan) between 2000 and 2009. this area suffered from air pollution during 19601970, but the environment improved thereafter. officially acknowledged victims of air pollution - related illnesses were registered after fulfilling two main conditions in the pollution - related health damage special measures law (1969) and pollution - related health damage compensation law (1973). the first requirement was to register a victim that had been diagnosed to have an air pollution - related illness, such as asthma or chronic bronchitis, by a respiratory physician. respiratory diseases attributed to air pollution in the pollution - related health damage compensation law were categorized into four groups : asthma, chronic bronchitis, a combination of asthma and chronic bronchitis, or another respiratory disease. the diagnosis was made based on the results of medical examinations by certified respiratory physicians and official requirements of the law. chronic bronchitis was diagnosed by the presence of chronic and copious amounts of sputum and a persistent cough. the second requirement was that individuals had to reside or spend 8 h per day in an area specified as having significant air pollution. table 1table 1.time required for certification of exposure to air pollutioncategorychronic bronchitis asthma a (months)24 12 b (months)4830c (months)36 18 category a : subject resided in the designated area before 1973.category b : subject did not reside in the designated area but spent 8 h / day in the designated area.category c : subject resided in the designated area and then relocated, but returned for work in the designated area for 8 h / day. they were different for each disease and area in which the subject resided or spent time (including work time). category b : subject did not reside in the designated area but spent 8 h / day in the designated area. category c : subject resided in the designated area and then relocated, but returned for work in the designated area for 8 h / day. this was similar to the subjects of a study by tanaka.12, 13. in 2009, the number of officially acknowledged victims of air pollution - related illness in kurashiki was 1392. of these, 774 (56%) were 65 years of age in 2009. however, 44 individuals were subsequently excluded from this analysis because they had not undergone annual spirometry on 7 occasions. flow diagram of the study pulmonary function was measured by spirometry (fudac 70 ; fukuda sangyo inc., chiba, japan). officially acknowledged victims of air pollution - related illnesses were required to undergo spirometry once a year. spirometry was undertaken by trained staff at mizushima kyodo hospital (okayama, japan). following standardized instructions, spirometry was repeated until 3 reproducible forced expiratory volume - time curve curves had been obtained. a nose - clip was applied to each subject, and subjects were in the sitting position during tests. in our analyses, values of forced vital capacity (fvc) and fev1 were used, and these are presented in milliliters or as a percentage of the predicted value (% fvc and % fev1) derived from the predicted equations. smoking habit was divided into two groups : non - smoker or smoker (including former smokers) as of the year 2000. respiratory symptoms evaluated comprised breathlessness, wheezing and cough and sputum production. respiratory physicians evaluated the presence and severity of symptoms during medical interviews according to a five - grade system. classification of medical management referred to the extent to which an individual required medical care (e.g., frequency of medical care and necessity for hospitalization). this parameter was also evaluated according to a five - grade system (table 2table 2.severity of respiratory symptoms and classification of medical managementgradebreathlessnesswheezecough and sputumproductionmedical managementclassification1too breathless to leave the house, or breathless when dressing or undressingsevere episodes 10 days / month during the last yeardaily cough and sputum, with a large amount of sputum or difficulty clearing sputumrequires hospitalization for exacerbation of symptoms and always requires assistance with activity during daily living2breathless after walking about 50 m or after a few minutes on level groundsevere episodes 5 days / month during the last year, or mild episodes 10 days / month during the last yeardaily cough and sputum, with a moderate amount of sputum or difficulty clearing sputumalways needs medical treatment and hospitalization required for exacerbation of symptoms3breathless when walking on level ground and keeping up with people of the same age, but not breathless when walking at own pacesevere episodes 1 day / month during the last year, or mild episodes 5 days / month during the last yeardaily cough and sputum, but not troublesome during daily lifealways needs medical treatment and sometimes needs hospitalization4breathless when walking up a slight hill or the stairsmild episodes 1 day / month during the last yeardaily cough and sputum for 3 months / yearalways needs to consult a doctor and sometimes needs respiratory medication5breathless only during strenuous exerciseno episodes of wheezingno cough or sputumno need for medical management). the regression coefficient for the annual mean change in fev1 was calculated using simple linear regression analyses. further, bivariate analyses were conducted to examine the relationship between the annual change in fev1 and other factors. spearman rank correlation analyses, mann - whitney test, and kruskal - wallis test were included in bivariate analyses. factors found to be independent variables associated with the annual change in fev1 in bivariate analyses were evaluated stepwise in multiple regression analyses. significance levels of 10% for bivariate analyses and 5% for multiple regression analyses were adopted. in additional analyses to examine the relationship between annual change in fev1 and percentage predicted fev1, pearson correlation analyses were carried out with a significance level set at 5%. characteristics of subjects measured in the year 2000 are shown in table 3table 3.characteristics of the patient cohort as measured in the year 2000characteristicmean sd or n (%) age, years68.8 7.6male gender, n272 (37)height, cm153.2 8.5weight, kg56.3 10.1bmi, kg / m23.9 3.7smoking habit, nnon - smoker567 (78)smoker163 (22)fev1, ml1546 561% pred fev17 11fvc, ml2559 750% pred fvc9 21fev1 annual change, ml / year29 32disease, nasthma218 (30)cb411 (56)asthma and cb97 (13)others4 (1)respiratory symptomsbreathlessness, ngrades 13180 (25)grade 4483 (66)grade 564 (9)wheeze, ngrades 13207 (28)grade 4276 (38)grade 5247 (34)cough and sputum production, ngrades 13373 (51)grades 45357 (49)medical management classification, ngrades 13192 (26)grades 45538 (74)bmi : body mass index ; fev1 : forced expiratory volume in one second ; % pred fev1 : percentage of the predicted value of forced expiratory volume in 1 second ; fvc : forced vital capacity ; % pred vc : percentage of the predicted value of forced vital capacity ; cb : chronic bronchitis ; other : other conditions such as pulmonary emphysema. there were more females (63%) than males (37%), and more non - smokers (78%) than smokers (22%). categories of respiratory symptoms and classifications of medical management were rationalized into two or three groups. bmi : body mass index ; fev1 : forced expiratory volume in one second ; % pred fev1 : percentage of the predicted value of forced expiratory volume in 1 second ; fvc : forced vital capacity ; % pred vc : percentage of the predicted value of forced vital capacity ; cb : chronic bronchitis ; other : other conditions such as pulmonary emphysema tables 4table 4.correlation coefficients (r) and significance levels (p) of annual changes in fev1factorrage0.011height0.100weight0.034p 65 years (i.e., 31 to 22 ml / year)23,24,25. even if people had suffered damage from air pollution at one time, those who were non - smokers demonstrated more preserved lung function over time. all symptoms were identified to be significant in bivariate analyses, but none of these symptoms were found to be significant in multiple regression analyses. some studies have suggested that males with a chronic cough or sputum production and females with a chronic cough demonstrate a rapid decline in respiratory function26, 27. as a result, respiratory symptoms are usually associated with a decline in fev1. conversely, another study found that respiratory symptoms do not necessarily result in a decline in fev128. classification of medical management was identified as a specific factor associated with the annual change in fev1. presence of a single respiratory symptom did not significantly affect the annual change in fev1, but the classification of medical management might be a comprehensive index and reflect the overall severity of respiratory disease (including all respiratory symptoms). interestingly, as classification of medical management and/or respiratory symptoms became more severe, the decline in fev1 became less in the present study. in the understanding potential long - term impacts on function with tiotropium (uplift) study, patients with severe chronic obstructive pulmonary disease (copd) showed smaller declines in fev1 than those with less severe copd31. another study reported that the annual change in fev1 was less in patients with advanced stages of copd32. in general, more treatments (e.g., bronchodilators or other medication) are administered as disease severity increases. as a result, this phenomenon may explain why the annual decline in fev1 becomes smaller with lower % fev1 (fig. another factor that could be associated with the annual change in fev1 is the age of subjects. in the present study, in contrast, the mean age of subjects in studies that examined longitudinal changes in pulmonary function ranged from 20 years to 60 years20, 33, 34. the slope of the prediction equation in those studies was steeper than that in the present study. however, in studies that involved older subjects, the slope of the prediction equation was less pronounced35, 36 however, the decline may be slowed at an advanced age and then the impact of aging may be slight. moreover, height was not selected by multiple regression analyses, and is a factor that may also be influenced by aging. however, the most important factor affecting pulmonary function and the decline of fev1 was smoking18, 19. the impact of the factors affecting fev1 might, therefore, be affected by disease progression or aging. the present study was limited by the fact that it was retrospective and that some information pertaining to participants was incomplete. for example, details regarding the amount of tobacco smoked by subjects were not available. furthermore, detailed data pertaining to the medications taken by participants was lacking. the type and dose of medication (e.g., bronchodilators or other treatments) the findings of our study suggest that smoking is the strongest factor affecting the annual change in fev1 in officially acknowledged victims with pollution - related illnesses who now live in environments with improved air conditions. in this population, current smokers showed a more rapid decline in fev1 than former smokers or non - smokers. in some asian countries in which air pollution is a serious problem, interventions are required to improve the environment and to reduce the prevalence of smoking to improve the health of citizens. | [purpose ] we examined factors affecting annual change in pulmonary function in residents previously exposed to air pollution in an area where pollution has been reduced and a long time period has elapsed. [subjects and methods ] data of 730 officially acknowledged victims of pollution - related illness from an annual survey during 2000 to 2009 were analyzed. the primary outcome was forced expiratory volume in 1 second (fev1), along with factors such as age, body composition, smoking habits, respiratory symptoms, and classification of medical management (an index of the need for treatment). multiple regression analyses were used to identify factors associated with the annual change in fev1. [results ] three significant factors were identified : smoking habit, classification of medical management, and gender. smoking habits and classification of medical management had stronger effects on the annual change in fev1 than gender. [conclusion ] with an improved environment, continuation of smoking accelerates the decline in fev1. |
a 32-year - old female patient with symptoms of widespread pain, fatigue and sleep problems presented at the outpatient clinic one year ago. physical examination indicated that range of motion of spine and peripheric joints were not limited and painful. she had 11 positive tender points (according to acr 1990 fms classification criteria) and her wpi and ss scores were 9 and 5, respectively. routine laboratory tests (hemoglobin [hgb ] : 13.3 g / dl, aspartate aminotransferase [ast ] : 22 u / l, alanine aminotransferase [alt ] : 18 u / l, creatinine : 0.49 mg / dl, thyroid stimulating hormone [tsh ] : 0.707uiu / ml, sedimentation : 14 mm / h and c - reactive protein : 5 pregabalin was prescribed with a dosage of 75 mg / day to be taken at night for the first three days. the dosage was then increased to 75 mg twice a day for 1 week. during this period, the patient complained of drowsiness and dizziness ; however, the effects were not severe enough to require discontinuing the medication. patient s visual analog scale pain score and fibromyalgia impact questionnaire score decreased from 8 to 4 and from 50 to 33, respectively, over time. patient was also asked about drug side effects, such as vertigo, drowsiness, dry mouth, and weight gain. in her last examination, one year after the prescription, the patient complained of mastalgia and tenderness in her breasts without galactoria. laboratory test results were as follows : serum prolactin (prl) : 54.2 ng / ml (3.226), tsh : 1.45iu / ml, serum b12 vitamin : 223pg / ml, erythrocyte sedimentation rate : 22 mmhg / h, serum dehydroepiandrosterone sulphate (dhea - s) : 556 mg / dl, serum follicle stimulating hormone (fsh) : 7.44, serum luteinizing hormone (lh) : 11.35 iu / l, serum estradiol : 37 pg / ml, fasting blood sugar : 100 mg / dl, and serum insulin : 4.8iu / ml. hpl etiology was not observed ; therefore hpl was considered a side effect of pregabalin. it was explained to the patient that after stopping the medication, the complaints might resolve themselves over time. however, the patient did not want to wait for her complaints to resolve in time, and so kebergolin 0.5 mg / day for one week was prescribed. after one week of use, prl value decreased to 2.44 ng / ml and breast tenderness and mastalgia complaints were completely resolved. as patient did not want to use any further medication, an exercise and physical therapy program was scheduled. these include hormones, immune system, external stressors, psychiatric aspects, and dysfunction of central and autonomic nervous systems. recent studies suggest that fms is a neurosensitive disorder characterized by abnormal processing of pain. various neurotransmitters (i.e., serotonin, norepinephrine, dopamine, substance p) seem to be involved in central sensitization. there are various pharmacological treatment recommendations for fsm. european league against rheumatism (eular) primarily advises the use of pregabalin, duloxetine, and amitriptyline. guidelines suggest pregabalin in first - line treatment [4, 5 ]. in cases of fms, voltage - sensitive calcium channels remain open longer, an effect of an increase in the number of alpha 2-delta subunits. this causes greater glutamate release in presynaptic gap and increase in superficial dorsal root neurons excitability. pregabalin is a medication that is structurally analogous to gamma - amino butyric acid (gaba). it is usually prescribed for chronic pain syndromes such as postherpetic neuralgia, diabetic and peripheric neuropathic pain, partial seizures, sleep disorders, anxiety disorders, and fibromyalgia. pregabalin, an alpha 2 delta ca channel ligand, has analgesic, anxiolytic and anticonvulsive properties. being a calcium channel antagonist, it decreases the release of many neurotransmitters such as substance p, norepinephrine, and glutamate [68 ]. common adverse effects of pregabalin include dizziness, vertigo, nausea, vomiting, hypotension, headache, hallucinations, fatigue, cognitive impairment, drowsiness, and peripheric edema. constipation, rhabdomyolysis, hypersensitivity reaction, akathisia, urticaria, and mastalgia are rarely encountered adverse effects and provided as prospectus information. in the present case, hpl, identified as a rare premarketing side effect that has not been reported in the literature, was observed. the most frequent cause is prl - secreting tumors. before examining for pituitary tumors as part of differential diagnosis, pregnancy, primary hypothyroidism, liver or renal failure, polycystic ovary syndrome, and medication should be considered. in the present case, gynecology and endocrinology departments were consulted in order to analyze those etiologic factors. according to results of physical examinations, laboratory tests and mri findings, the patient s hpl was thought to be drug - induced. medications are the most frequent cause of non - tumoral hpl. in the case of drug - induced hpl, prl levels range from 25 to 100 ng / ml, similar to the present patient s prl level [11, 12 ]. several drugs are reported to cause hpl, such as antipsychotics, antidepressants (e.g., tricyclic and tetracyclic selective serotonin reuptake inhibitors [ssris ]), opiates, antihypertensive medications (verapamil, methyldopa, reserpine), gastrointestinal medications (metoclopramide, domperidone, histamine receptor blockers) and estrogens. dopamine (prolactin inhibiting factor [pif ]) is the most important hypothalamic - inhibiting factor of prl. it binds to the d2 receptor, affecting lactotroph (unique among endocrine cells in having a high basal secretory activity, and which are located in the anterior pituitary gland) cell membranes. this activation causes suppression of the prl gene expression and inhibition of prl exocytosis ; first, inhibition of adenylyl cyclase and inositol phosphate metabolism, then modification / alteration of several potassium and calcium channels. antipsychotics like phenothiazines (chlorpromazine - fluphenazine), thioxanthenes (thiothixene), and butyrophenones (haloperidol) block dopamine and can lead to development of hpl. in addition, gastrointestinal medications used to increase gastrointestinal motility may cause hpl in the same way, by blocking dopamine receptors. most evidence suggests that opioid peptides do not directly affect the pituitary gland and stimulate prl release by inhibiting hypothalamic dopamine secretion. among antihypertensive medications, kelley., researched the mechanism of this effect of verapamil, a calcium channel blocker. researchers concluded that verapamil decreases central dopamine generation, perhaps through n - type calcium channels. several peptides or neurotransmitters, such as serotonin, oestrogens, tachykinins (substance p, neurokinin a - b and neuropeptide k), gonadotropin - releasing hormone associated peptide (gap), opioids (especially - endorphins), histamine and gaba can also affect the modulation of prl secretion. gaba, a neurotransmitter secreted mostly in the hypothalamus, has a mostly inhibiting effect. gaba modulates secretion of pituitary hormones through dopaminergic tone or influence on the anterior pituitary cells. stimulation of gaba - a and gaba - b receptor decreases prl secretion ; however, nakayama., reported that gaba - c receptor activation led to an increase in prl levels in cultured rat anterior pituitary cells. pregabalin is an analog of gaba, but it shows no effect on gaba receptors. activation mechanism is disclosed with calcium channel blocking. though it can not be precisely explained how pregabalin induced hpl in the present case, only the use of pregabalin accounts for its occurrence. in conclusion, this is the first case report demonstrating hpl due to pregabalin usage. although it has been identified as a premarketing adverse side effect, there is no recent case report in the literature. as it is a very rare side effect, in clinical practice, mastalgia is generally not questioned, though the most frequent side effects are routinely questioned. based on this case report, when pregabalin is used, the authors suggest professionals also inquire about breast tenderness. | several pharmacological and non - pharmacological modalities have been proposed for the treatment of fibromyalgia syndrome (fms), a common rheumatic disease. pregabalin is suggested as a first - step medication for fms in the newest guidelines. drowsiness, dizziness, and peripheral edema are well - known side effects of pregabalin ; however, mastalgia is rarely seen. presently described is a case of fms in a patient who developed mastalgia and hyperprolactinemia (hpl) while taking pregabalin. |
purification of endogenous regiiiendogenous regiii was purified from the small intestines of c57bl/6 mice. intestinal tissues were homogenized in 20% acetic acid solution containing protease inhibitors using a pre - chilled homogenization probe and lysed by sonication using a misonix xl sonicator. the extract was dialyzed against 25 mm mes ph 5.0, 25 mm nacl and was loaded onto a cation exchange column (sp - sepharose, sigma). the column was washed with 25 mm mes ph 5.0, 150 mm nacl, and eluted with 25 mm mes ph 5.0, 500 mm nacl. the eluate was concentrated and loaded onto a sephacryl s-100 column (ge healthcare). regiii-containing fractions were identified by western blot, pooled, and purified by passage over immobilized anti - regiii (8). the eluate was concentrated, transferred to immobilon p, and subjected to edman degradation on an abi494 sequencer (pe biosystems) to determine the n - terminal sequence. expression and purification of recombinant proteins recombinant pro - regiii (rpro - regiii) and rpro - hip / pap were expressed and purified as previously described (8). to generate the recombinant processed form of regiii, a 417-bp amplicon was generated using the rpro - regiii expression construct (pet3a - regiii) (8) as template and the specific primers 5-attgcgaggcatatgagcagctgccccaagggctccc-3 (forward) and 5-ctatggggatccctaggccttgaatttgcagacatagggt-3 (reverse). the forward primer contained an ndei restriction site (underlined) for cloning into pet3a. the reverse primer contained the native stop codon followed by an engineered bamhi site (underlined). the amplicon was digested with ndei and bamhi and ligated into ndei / bamhi - digested pet3a (novagen). similarly, the rhip / pap expression construct was generated using pet3a - hip / papmut (8) as template and specific primers 5-attgcgaggcatatgattcgatgtccaaaaggctccaag-3 (forward) and 5-ctatggtgatcatcagtgaactttgcagacatagggtaacc-3 (reverse). the forward primer contained an ndei site (underlined) while the reverse primer contained a bcli site (underlined) after the native stop codon. the amplicon was digested with ndei and bcli and ligated into ndei / bamhi - digested pet3a. point mutations were introduced into rpro - hip / pap using the quikchange ii site - directed mutagenesis kit (stratagene) and specific primers harboring the desired mutations. expression and purification of recombinant wild - type and mutant proteins was carried out as previously described (8). antimicrobial assays and peptidoglycan binding assays were carried out as previously described (5). proteins were stored at 20 c for a maximum of 1 week prior to assay. immunoblotting intestinal extracts were prepared from wild - type c57bl/6 or mmp7 mice (jackson laboratories) as previously described (5). extracts from human intestinal tissues were prepared by extraction in acetic acid as previously described (9). 20 g of each extract was loaded onto 15% sds - page gels and blotted onto immobilon p (millipore). blots were probed with anti - regiii antiserum (8) and goat anti - rabbit - horseradish peroxidase (amersham biosciences), and were detected by chemiluminescence using the pierce supersignal west pico chemiluminescent detection kit. in vitro trypsin proteolytic processing recombinant pro - regiii and pro - hip / pap were digested with bovine pancreatic trypsin (sigma) at a 1:200 molar ratio of trypsin : lectin at 37 c for 2 h. proteins were immediately analyzed by sds - page on 15% gels, and were subjected to n - terminal edman sequencing. nmr spectroscopy to prepare samples for nmr experiments, escherichia coli bl21-codonplus (de3)-rilp transformed with expression plasmids were grown in m9 minimal media containing 1 g / liter of nh4cl for uniformly n - labeled samples, further substituting unlabeled glucose with 3 g / liter of c6-glucose for uniformly n / c - labeled samples. backbone n, c, and h chemical shift assignments of rpro - hip / pap were generated from triple resonance nmr data recorded at 25 c using a cryoprobe - equipped varian inova 600 mhz spectrometer. backbone assignments were made from a 300 m sample of n / c - labeled protein in 25 mm mes ph 5.5, 25 mm nacl using standard methods (10). all spectra were processed using nmrpipe (11) and analyzed with nmrview (12). regiii is proteolytically processed by trypsin in vivo two distinct forms of endogenous regiii are present in the mouse small intestine (5). the higher molecular weight form co - migrates at 16.5 kda with recombinant regiii that lacks its n - terminal secretion signal, while the lower molecular weight form migrates at 15 kda. the presence of the lower molecular weight form suggested that regiii might be proteolytically processed in vivo. to test this idea we purified endogenous regiii from mouse small intestine by acid extraction, gel filtration chromatography, and antibody affinity chromatography. edman sequencing of the purified proteins verified that the higher molecular weight regiii form indeed harbors an n terminus (glu) that is generated by removal of the signal sequence (fig. the n terminus of the lower molecular weight form is ser, corresponding to the predicted trypsin cleavage site located at arg this site is conserved among all mouse and human regiii family members (fig. 1b), and is also present in other reg subfamilies including regi (13). liquid chromatography - tandem mass spectrometry (lc - ms / ms) of both regiii forms did not reveal any further modifications of the protein (data not shown). these results indicate that the n terminus of endogenous mouse regiii is proteolytically processed by trypsin or a trypsin - like protease in vivo. small intestinal -defensins are a distinct family of antimicrobial peptides that also undergo n - terminal proteolytic processing. while human -defensins are processed by trypsin (9), the processing enzyme for mouse -defensins is matrix metalloproteinase-7 (mmp-7) (2). to verify that mmp-7 is not the processing enzyme for mouse regiii we performed western blots on small intestinal tissue extracts from wild - type and mmp7 mice. thus, regiii and -defensins are processed by distinct proteases in the mouse small intestine. a, purification and n - terminal sequencing of endogenous mouse regiii reveals processing at the conserved n - terminal trypsin site. b, conserved canonical trypsin site (indicated by arrow) is present near the n terminus of mouse and human regiii family members. 20 g of protein extract from wild - type and mmp7 mice were immunoblotted with anti - regiii antibody. 20 g of human intestinal protein extract was immunoblotted and probed with anti - regiii antiserum. recombinant pro - hip / pap (rpro - hip / pap ; with the n - terminal signal sequence replaced by methionine) and recombinant processed hip / pap (rhip / pap ; with the n - terminal tryptic fragment replaced by methionine) were included for size comparison., small intestinal e, in vitro incubation of purified recombinant pro - regiii (rpro - regiii) and rpro - hip / pap with bovine trypsin results in quantitative cleavage at the conserved trypsin site to yield a homogeneous product. proteins were digested with a 1:200 molar ratio of trypsin : lectin and were analyzed by sds - page. n - terminal sequencing verified cleavage at arg ser and arg ile, respectively. a, purification and n - terminal sequencing of endogenous mouse regiii reveals processing at the conserved n - terminal trypsin site. b, conserved canonical trypsin site (indicated by arrow) is present near the n terminus of mouse and human regiii family members. 20 g of protein extract from wild - type and mmp7 mice were immunoblotted with anti - regiii antibody. 20 g of human intestinal protein extract was immunoblotted and probed with anti - regiii antiserum. recombinant pro - hip / pap (rpro - hip / pap ; with the n - terminal signal sequence replaced by methionine) and recombinant processed hip / pap (rhip / pap ; with the n - terminal tryptic fragment replaced by methionine) were included for size comparison. s.i., small intestinal e, in vitro incubation of purified recombinant pro - regiii (rpro - regiii) and rpro - hip / pap with bovine trypsin results in quantitative cleavage at the conserved trypsin site to yield a homogeneous product. proteins were digested with a 1:200 molar ratio of trypsin : lectin and were analyzed by sds - page. n - terminal sequencing verified cleavage at arg ser and arg ile, respectively. in the human small intestine, hip / pap is the predominantly expressed ortholog of regiii (6, 14) and performs a similar antibacterial function (5). immunoblotting of human small intestinal extract revealed two forms of hip / pap with different molecular weights, suggesting that hip / pap is also expressed as a pro - protein that is proteolytically processed in vivo (fig. although the small amounts of hip / pap present in human tissue presented an obstacle to purification and sequencing, we established that the lower molecular weight form co - migrates with recombinant hip / pap engineered to lack the 11 amino acids n - terminal to the predicted arg the idea that the hip / pap n terminus is processed in vivo by trypsin is supported by two additional observations. first, two trypsin isoforms are produced by human small intestinal epithelia and have been shown to process other intestinal proteins in vivo (9). second, in vitro incubation of recombinant pro - hip / pap (rpro - hip / pap) with bovine trypsin (at a 1:200 molar ratio of enzyme to lectin) resulted in quantitative cleavage at arg proteolytic processing by trypsin activates regiii lectin antimicrobial activity we next investigated the biological relevance of lectin proteolytic processing. to test the hypothesis that processing regulates regiii lectin antibacterial activity, we incubated recombinant pro - regiii (rpro - regiii) with trypsin in vitro and quantitated antimicrobial activity against listeria monocytogenes in standard antibacterial assays (5). mock - digested rpro - regiii exhibited limited antibacterial activity, with l. monocytogenes numbers declining by 68% in the presence of 10 m rpro - regiii (fig. however, trypsin - digested rpro - regiii exhibited enhanced antibacterial potency, with l. monocytogenes numbers declining by > 96% in the presence of 10 m of digested regiii (fig. a comparison of proteolytically cleaved and uncleaved rpro - hip / pap yielded similar results (fig. the enhanced activity of trypsin - cleaved hip / pap is not attributable to the n - terminal prosegment itself, as addition of 50 m of synthetic n - terminal peptide to l. monocytogenes did not affect bacterial viability (fig. 2c). these data demonstrate that removal of the n - terminal prosegment by trypsin enhances regiii and hip / pap antibacterial activity. a and b, trypsin proteolysis of recombinant pro - regiii (rpro - regiii) and recombinant pro - hip / pap (rpro - hip / pap) activates antibacterial activity. purified rpro - regiii (a) and rpro - hip / pap (b) were digested with bovine trypsin as in fig. l. monocytogenes was exposed to the indicated lectin concentrations at 37 c for 2 h, and surviving bacteria were quantitated by dilution plating. an assay which included trypsin but no lectin c, addition of 50 m of the hip / pap n - terminal peptide did not diminish l. monocytogenes viability, indicating that the prosegment alone does not exhibit antibacterial activity. d and e, antibacterial activities of recombinant mature regiii and hip / pap. the 11-amino acid prosegments of regiii and hip / pap were removed and replaced with methionine to yield rregiii and rhip / pap, and bactericidal activity was determined in comparison with rpro - regiii (d) and rpro - hip / pap (e). f, hip / pap n - terminal prosegment does not inhibit bactericidal activity in trans. the synthetic hip / pap n - terminal peptide depicted in c was added to bactericidal assays with rhip / pap. a and b, trypsin proteolysis of recombinant pro - regiii (rpro - regiii) and recombinant pro - hip / pap (rpro - hip / pap) activates antibacterial activity. purified rpro - regiii (a) and rpro - hip / pap (b) were digested with bovine trypsin as in fig. l. monocytogenes was exposed to the indicated lectin concentrations at 37 c for 2 h, and surviving bacteria were quantitated by dilution plating. an assay which included trypsin but no lectin was run as a control. c, addition of 50 m of the hip / pap n - terminal peptide did not diminish l. monocytogenes viability, indicating that the prosegment alone does not exhibit antibacterial activity. d and e, antibacterial activities of recombinant mature regiii and hip / pap. the 11-amino acid prosegments of regiii and hip / pap were removed and replaced with methionine to yield rregiii and rhip / pap, and bactericidal activity was determined in comparison with rpro - regiii (d) and rpro - hip / pap (e). f, hip / pap n - terminal prosegment does not inhibit bactericidal activity in trans. the synthetic hip / pap n - terminal peptide depicted in c was added to bactericidal assays with rhip / pap. to further establish that prosegment removal activates lectin antibacterial activity, we generated recombinant forms of regiii and hip / pap that lacked their n - terminal prosegments. 10 m of recombinant mature regiii (rregiii) decreased l. monocytogenes viability by over 99%, as compared with a 12% decrease for rpro - regiii (fig. similarly, 10 m of recombinant mature hip / pap (rhip / pap) killed > 99.9% of organisms, as compared with 56% for rpro - hip / pap (fig. addition of the hip / pap n - terminal prosegment in trans did not reduce the antibacterial activity of rhip / pap (fig. 2f), indicating that the prosegment is inhibitory only when covalently attached (in cis). peptidoglycan pull - down assays established that prosegment removal did not diminish the ability of either the human or mouse protein to bind peptidoglycan (fig. 3). collectively, these data establish that the regiii lectin n - terminal prosegment inhibits antibacterial activity in cis, but does not affect peptidoglycan binding. recombinant unprocessed and processed regiii and hip / pap were compared in peptidoglycan pull - down assays. pellet (p) and supernatant (s) fractions were analyzed by sds - page. recombinant unprocessed and processed regiii and hip / pap were compared in peptidoglycan pull - down assays. pellet (p) and supernatant (s) fractions were analyzed by sds - page. we previously reported bactericidal activity for recombinant regiii and hip / pap that were expressed with an intact n - terminal prosegment (5). to determine why we were able to detect antibacterial activity in these protein preparations, we investigated the fate of the pro - hip / pap n terminus during storage. we noted that the rpro - hip / pap is labile and the n terminus is progressively removed over time during storage at 4 c (supplemental fig. the presence of small amounts of mature hip / pap is thus likely to account for the antibacterial activity of protein preparations derived from recombinant prosegment - containing lectins. this may also explain why we detect modest antibacterial activity in rpro - regiii and rpro - hip / pap following mock digestion for 2 h at 37c (fig. n - terminal acidic residues are essential for prosegment inhibitory activity we next sought to gain insight into the inhibitory mechanism of the regiii lectin n - terminal prosegment. we noted the presence of either two or three acidic residues (glu or asp) at conserved positions in both mouse and human regiii family members (fig. to evaluate the functional importance of the three acidic residues contained within the hip / pap prosegment (glu, glu, and glu), we mutated combinations of these residues to ala and assessed the mutant rpro - hip / pap proteins for antibacterial activity (fig. recombinant pro - hip / pap - e32a (10 m) reduced l. monocytogenes viability by 30%, while rpro - hip / pap - ee / aa (harboring e27a and e28a mutations) produced a 75% decline in bacterial colony forming units (cfus) at the same concentration (fig. in contrast, mutation of all three acidic residues (rpro - hip / pap - eee / aaa) yielded a prosegment - containing protein that produced a > 99.9% reduction in the viability of l. monocytogenes at a 10 m concentration (fig. this demonstrates that multiple n - terminal acidic residues are essential for hip / pap prosegment inhibitory function, and suggests that the degree of inhibitory activity is dictated by charge. a, primary structure of the pro - hip / pap n terminus showing the positions of engineered mutations. b, comparison of antibacterial activity among rpro - hip / pap, rhip / pap, and rpro - hip / pap harboring mutations in n - terminal glutamic acid (e) residues. n - terminal acidic resides are essential for prosegment inhibitory activity. a, primary structure of the pro - hip / pap n terminus showing the positions of engineered mutations. b, comparison of antibacterial activity among rpro - hip / pap, rhip / pap, and rpro - hip / pap harboring mutations in n - terminal glutamic acid (e) residues. a, ribbon diagram of the pro - hip / pap crystal structure (rcsb accession : 1uv0) (15). the disordered n - terminal 10 amino acids are indicated by a dotted line, and the locations of the n - terminal disulfide bond (red) and the trypsin cleavage site are indicated. b, experimental nr1 and r2 relaxation rates were determined for pro - hip / pap, and a plot of the r1/r2 ratio is shown. the location of the arg ile trypsin site is indicated by a dashed red line. a, ribbon diagram of the pro - hip / pap crystal structure (rcsb accession : 1uv0) (15). the disordered n - terminal 10 amino acids are indicated by a dotted line, and the locations of the n - terminal disulfide bond (red) and the trypsin cleavage site are indicated. b, experimental nr1 and r2 relaxation rates were determined for pro - hip / pap, and a plot of the r1/r2 ratio is shown. the location of the arg ile trypsin site is indicated by a dashed red line. structural analysis of the hip / pap - prosegment interaction although the crystal structure of pro - hip / pap has been determined (15), it offered limited information about the hip / pap - prosegment interaction. in particular, n - terminal residues 2735 are disordered and thus absent from the structure (fig. 5a) and residues 3641 appear to be involved in crystal packing interactions, raising questions about the observed structure of this essential region of the protein. we therefore used nuclear magnetic resonance (nmr) spectroscopy to structurally characterize the interaction between hip / pap and its n - terminal prosegment. using uniformly n, c - labeled pro - hip / pap and standard triple resonance methods (16) we assigned the chemical shifts of 98% of the backbone resonances. we first analyzed the conformational dynamics of pro - hip / pap by measuring n relaxation rates, which are influenced by fast (ps - ns) and slow (s - ms) motions of backbone amides throughout a protein. in particular, we measured rate constants for spin - lattice relaxation (r1), and spin - spin relaxation (r2), finding that the ratio of these values (r1/r2) was highest in residues 2734 (fig. this indicates a high degree of backbone conformational mobility at the n terminus. furthermore, talos analyses of backbone chemical shifts (17) and h - h noes indicated that the prosegment adopts an extended structure. together, these data suggest that the prosegment is flexible and transiently interacts with the rest of the protein. a, orientation of arg and lys side chains near the hip / pap n - terminal trypsin site. b, mutations of basic hip / pap residues yield active rpro - hip / pap. comparison of antibacterial activity among rpro - hip / pap, rhip / pap, and rpro - hip / pap harboring the indicated mutations in basic residues. c, hip / pap basic residues (arg, lys, lys) are dispensable for antibacterial activity. limited trypsin proteolysis was performed on rpro - hip / pap - rkk / aaa. sds - page analysis of the undigested and digested proteins is depicted. digested and undigested proteins were analyzed for bactericidal activity as outlined in fig. hip / pap basic residues are essential for prosegment inhibition of antibacterial activity. a, orientation of arg and lys side chains near the hip / pap n - terminal trypsin site. b, mutations of basic hip / pap residues yield active rpro - hip / pap. comparison of antibacterial activity among rpro - hip / pap, rhip / pap, and rpro - hip / pap harboring the indicated mutations in basic residues. c, hip / pap basic residues (arg, lys, lys) are dispensable for antibacterial activity. limited trypsin proteolysis was performed on rpro - hip / pap - rkk / aaa. sds - page analysis of the undigested and digested proteins is depicted. digested and undigested proteins were analyzed for bactericidal activity as outlined in fig. hip / pap basic residues are essential for prosegment inhibition of antibacterial activity these findings suggested that the hip / pap n - terminal peptide may inhibit antibacterial activity through dynamic interactions with other residues in the hip / pap core protein. given that acidic amino acids in the n terminus are essential for prosegment inhibitory activity, we hypothesized that interactions with nearby hip / pap basic residues may be required for repression of antibacterial activity. because the prosegment is only 11 amino acids in length, we reasoned that it was likely to be constrained to local interactions with amino acids near the trypsin site. examination of the hip / pap primary sequence revealed three basic residues (arg, lys, lys) positioned immediately c - terminal to the arg while introduction of a single mutation (r39a) was insufficient to activate antimicrobial activity in rpro - hip / pap, mutation of all three basic amino acids to alanine (rpro - hip / pap - rkk / aaa) yielded a prosegment - containing variant that exhibited potent antibacterial activity, producing a > 99% decline in l. monocytogenes viability (fig. critically, the presence of these mutations had no effect on the antimicrobial activity of the mature protein lacking the prosegment (fig. these data demonstrate that basic hip / pap residues, positioned c - terminal to the trypsin site, are essential for prosegment inhibitory activity but are dispensable for antibacterial function. structural effects of activating pro - hip / pap mutations overall, these results suggested a model in which the prosegment maintains hip / pap in an inactive state through transient interactions between acidic n - terminal residues and basic residues positioned c - terminal to the trypsin site. mutation of these charged residues derepresses hip / pap antibacterial activity in the prosegment - containing protein, thus mimicking the derepression that occurs when the peptide is removed by proteolysis. to further examine this interaction we compared n / h heteronuclear single quantum coherence (hsqc) spectra of rpro - hip / pap glutamic acid - to - alanine mutants with the wild - type protein (supplemental fig. s2). we observed significant chemical shift changes (> 0.05 ppm) only in residues n - terminal to and including ile (fig. this verified that the gain - of - function phenotype produced by the eee / aaa and rkk / aaa mutations did not result from gross protein misfolding. furthermore, the lack of significant chemical shift changes in the main body of the protein argues against prosegment inhibitory activity being related to global changes in the core hip / pap structure. notably, n / h hsqc spectra of hip / pap with and without the wild - type prosegment showed no significant chemical shift changes aside from those at the trypsin cleavage site, confirming that proteolysis itself also does not cause a global conformational change (data not shown). analysis of peak intensity did not reveal evidence of prosegment - modulated dimer or oligomer formation, even at the high concentration (300 m) used for nmr spectroscopy (data not shown). however, as these spectra were collected in the absence of ligand, the possibility remains that multimer formation may occur in the presence of peptidoglycan ligands. we noted a striking co - linear pattern of change in key n - terminal backbone amide chemical shifts when comparing the n / h hsqc spectra of rpro - hip / pap and single, double or triple glutamic acid - to - alanine mutants. peaks from ser, ala, arg, and ile shifted in the same direction in each of the rpro - hip / pap mutants (fig. 7b), with the triple eee / aaa mutant exhibiting chemical shift changes that are close to the additive sum of those observed for the single e32a and double e27a / e28a mutants (table 1) (18). such a co - linear chemical shift pattern signifies a molecule that is in conformational equilibrium between two states, with intermediate chemical shifts deriving from a population - weighted average of these states (16). furthermore, the additivity of these chemical shift changes indicates a simple, non - cooperative interaction between the charges on the prosegment and the rest of the hip / pap protein. notably, similar chemical shift changes for the ser ile segment were observed in the activated rpro - hip / pap - rkk / aaa mutant, suggesting that the same conformational change is being triggered from the opposite side of the putative charge / charge interaction (fig. close inspection of the n / h hsqc spectrum for this mutant shows that peaks for residues ser ile are doubled on this vector, indicative of further conformational exchange occurring on a slow time scale. collectively, these data support a model in which perturbation of the interaction between hip / pap and its prosegment drives a shift in the conformational equilibrium toward a biologically active state (fig. our data further suggest that the degree to which the prosegment shifts the hip / pap population to the inactive state is simply determined by the number of intramolecular charge - charge interactions rather than any specific ordering of the prosegment against the core hip / pap structure. table 1simple additivity of chemical shift differences in hip / pap e / a mutantss35a36r37i38ppmppmppmppm e / aa (e32a) 0.565 0.265 0.543 0.399 ee / aaa (e27a / e28a) 0.542 0.268 0.318 0.510 eee / aaaa (e27a / e28a / e32a) 1.017 0.511 0.859 0.872 calculated eee / aaab (e / a + ee / aa) 1.107 0.533 0.861 0.909 achemical shift differences (tot) were obtained using the following equation : tot = [h) + (n) ] (normalized for proton with the scale factor = 0.17, established from estimates of atom - specific chemical shift ranges in a protein environment) (14).bcalculated chemical shift differences were determined by tot = e / a + ee / aa. simple additivity of chemical shift differences in hip / pap e / a mutants chemical shift differences (tot) were obtained using the following equation : tot = [h) + (n) ] (normalized for proton with the scale factor = 0.17, established from estimates of atom - specific chemical shift ranges in a protein environment) (14). calculated chemical shift differences were determined by tot = e / a + ee / aa. a, chemical shift changes in the n / h hsqc spectra of rpro - hip / pap and the activated mutant rpro - hip / pap - eee / aaa are plotted as a function of residue number. b, superimposed n / h hsqc spectra of n - labeled rpro - hip / pap and activating rpro - hip / pap mutations reveal colinear chemical shift perturbations among four residues surrounding the trypsin cleavage site at arg / ser. arrows indicate the direction of larger chemical shift changes from wild - type and progression toward enhanced hip / pap killing activity. a, chemical shift changes in the n / h hsqc spectra of rpro - hip / pap and the activated mutant rpro - hip / pap - eee / aaa are plotted as a function of residue number. b, superimposed n / h hsqc spectra of n - labeled rpro - hip / pap and activating rpro - hip / pap mutations reveal colinear chemical shift perturbations among four residues surrounding the trypsin cleavage site at arg / ser. arrows indicate the direction of larger chemical shift changes from wild - type and progression toward enhanced hip / pap killing activity. the regiii lectins constitute a vital component of the intestinal epithelial antibacterial arsenal which protect the host against pathogens (19) and maintain homeostasis with symbiotic bacteria (5). however, little is known about how regiii antibacterial activity is regulated. in this report we show that regiii lectins are subject to repression by an inhibitory n - terminal prosegment that is removed in vivo by trypsin. the inhibitory activity of the n - terminal segment depends on charge - charge interactions with the main body of the protein. derepression of antibacterial activity occurs when these interactions are perturbed, either through proteolytic removal of the prosegment or by mutation of the charged residues (fig. the hip / pap hinge region (dashed line) undergoes a two - state conformational shift between a closed (inhibited) and an open (active) form. maintenance of the closed, inactive state depends on transient interactions between negatively charged prosegment residues and positively charged residues on the hip / pap core protein. inhibition is relieved either by cleavage at a conserved trypsin site in the hinge region, or by mutation of either charged region, leading to a 1000-fold increase in antibacterial activity. note that the hinge region in the activating mutants is in a constitutively open form, as demonstrated by nmr. we propose that disruption of prosegment - core protein interactions alleviates inhibition by unmasking a region (shown in white) necessary for bacterial cell surface damage or for multimerization that may be required for bactericidal activity. the hip / pap hinge region (dashed line) undergoes a two - state conformational shift between a closed (inhibited) and an open (active) form. maintenance of the closed, inactive state depends on transient interactions between negatively charged prosegment residues and positively charged residues on the hip / pap core protein. inhibition is relieved either by cleavage at a conserved trypsin site in the hinge region, or by mutation of either charged region, leading to a 1000-fold increase in antibacterial activity. note that the hinge region in the activating mutants is in a constitutively open form, as demonstrated by nmr. we propose that disruption of prosegment - core protein interactions alleviates inhibition by unmasking a region (shown in white) necessary for bacterial cell surface damage or for multimerization that may be required for bactericidal activity. this regulatory mechanism may have evolved to give the host control over the timing and location of the expression of regiii antibacterial activity. as regiii lectin antibacterial activity involves damage to microbial cell surfaces (5), it is possible that these proteins could also damage host cell membranes. this would suggest a need to maintain regiii lectins in an inactive state prior to their luminal release. two trypsin isozymes are expressed in human gut epithelial cells and are stored as inactive zymogens that are activated by proteolysis in the intestinal lumen (9). it thus seems likely that trypsin - mediated activation of regiii proteins occurs only after they are secreted. given the fact that we were able to detect processed regiii and hip / pap in small intestinal tissue extracts, we can not completely rule out the possibility of some intracellular cleavage. however, it is likely that this reflects extracellular processing of proteins that are trapped in the mucus layer that overlies the intestinal epithelium. thus, we propose that this regulatory mechanism evolved to ensure that lectin bactericidal activity is inhibited during intracellular storage, and activated upon secretion into the gut lumen. in the small intestine, members of the -defensin family of antimicrobial peptides also require activation through proteolytic removal of an n - terminal prosegment by specific intestinal proteases (2, 9). while trypsin is the processing enzyme for at least one member of the human -defensin family (9), mouse -defensins undergo processing by matrix metalloproteinase-7 (matrilysin ; mmp-7) (2). our findings demonstrate that trypsin coordinately activates multiple innate immune effector proteins in both mice and humans, suggesting that this protease may function as a central regulator of diverse intestinal antibacterial responses in multiple host species. our results indicate that hip / pap prosegment inhibitory activity is governed by interactions between acidic prosegment residues and cationic residues on the remainder of the protein. the prosegments of key intestinal -defensins confer inhibitory activity through a similar charge - charge interaction (20). however, our results suggest that the functional outcome of this interaction is quite different in the two protein families. the -defensin prosegment neutralizes cationic amino acids that bind to negatively charged bacterial phospholipids and are thus essential for antibacterial function (21). in contrast, while hip / pap cationic amino acids are required for peptide inhibitory activity, they are dispensable for antibacterial function, indicating that the hip / pap prosegment represses antibacterial activity through a distinct mechanism. this is consistent with our finding that regiii and hip / pap bind to bacterial surfaces through specific recognition of peptidoglycan, and that this binding interaction is not modulated by the prosegment. collectively, these observations suggest that the regiii lectins may mediate their antibacterial functions via mechanisms that differ from the -defensins. nmr spectroscopy has provided structural insight into the hip / pap - prosegment interaction. our analysis revealed a distinctive colinear correspondence between backbone amide shifts as point mutations were made to either side of a putative charge - charge interaction pair. notably, point mutants with derepressed killing activity demonstrated the greatest degree of chemical shift changes. such correspondence between structural and functional changes is distinctive, and has previously been observed in several other systems (2224). the linearity of this behavior further suggests that intramolecular interactions between hip / pap and its n - terminal prosegment govern a shift between two states with differing activities. although the physical basis for this shift is not yet clear, we envision at least three possibilities. one is that disruption of hip / pap - prosegment interactions results in allosteric changes in residues that are physically distant from the n terminus. this seems very unlikely given the limited chemical shift changes observed outside the n - terminal region in comparisons of the wildtype and eee / aaa n / h hsqc spectra. a second possibility is that the activating mutations increase accessibility of the trypsin site to cleavage. however, the lack of hip / pap proteolysis in our in vitro antibacterial assays suggests that this is unlikely to explain the enhanced bactericidal activity of the activated pro - hip / pap mutants (supplemental fig. a third possibility is that disruption of the hip / pap - prosegment interaction unmasks surfaces on the hip / pap core structure that are required for bactericidal activity, and that our chemical shift changes reflect a hinging motion of the prosegment away from the rest of the protein. such movement could allow the hip / pap molecule to adopt an optimal conformation to damage microbial cell surfaces, or could induce formation of multimers that may be required for bactericidal activity (fig. the latter of these two mechanisms has been observed in other systems in which bactericidal activity requires formation of protein oligomers (2527). although our nmr spectra did not show evidence of hip / pap multimerization at high concentration (300 m) in the absence of ligand, it is possible that such association requires both the presence of peptidoglycan ligands and the disruption of hip / pap - prosegment interactions. in summary, we have uncovered a novel mechanism controlling c - type lectin biological activity. we propose that impaired regulation of regiii antibacterial activity in human populations could result in compromised intestinal immunity and a predisposition to enteric infections and inflammation. furthermore, the structural insights from these studies could aid in the design of novel antimicrobial therapeutics. | members of the regiii family of intestinal c - type lectins are directly antibacterial proteins that play a vital role in maintaining host - bacterial homeostasis in the mammalian gut, yet little is known about the mechanisms that regulate their biological activity. here we show that the antibacterial activities of mouse regiii and its human ortholog, hip / pap, are tightly controlled by an inhibitory n - terminal prosegment that is removed by trypsin in vivo. nmr spectroscopy revealed a high degree of conformational flexibility in the hip / pap inhibitory prosegment, and mutation of either acidic prosegment residues or basic core protein residues disrupted prosegment inhibitory activity. nmr analyses of pro - hip / pap variants revealed distinctive colinear backbone amide chemical shift changes that correlated with antibacterial activity, suggesting that prosegment - hip / pap interactions are linked to a two - state conformational switch between biologically active and inactive protein states. these findings reveal a novel regulatory mechanism governing c - type lectin biological function and yield new insight into the control of intestinal innate immunity. |
successful walking is affected by the integration of complex cognition and neuromuscular, sensory, and skeletal factors, which can degenerate with disease and aging2. elderly walking is characterized by reduced velocity and increased basal plane. in particular, elderly persons have difficulty changing directions3, resulting in a high fall risk. statistical reports have shown that one in three persons over the age of 65 experience a fall annually4. elderly persons who have fallen can worry about falling again and develop a phobia of falling, which leads to anxiety. the falling phobia results in reduced mobility, which limits a person s activities and further increases the risk of falling, thus creating a vicious cycle5. increased balance, improved cardiovascular function, and good flexibility achieved through regular exercise are effective management strategies in reducing the risk of falling in elderly individuals6, 7. to improve their physical condition, elderly individuals have participated in various interventions, such as resistance exercises using elastic bands8, muscle strength exercises using equipment9, and tai chi exercises10. however, because they had to perform monotonous motions repeatedly, they lost interest easily, which resulted in low participation. it has also been reported that the limitations of locations, tools, and equipment required for exercising are some of the drawbacks of this approach11. thus, it is necessary to provide an interesting, efficient complex exercise program that can be performed anywhere, and that maintains a high level of motivation in the participants. as such, the aim of this study was to conduct a complex exercise program for the elderly, and determine the effects of the program on walking ability during direction change and on falls efficacy. the study also aimed to determine the applicability of this program to other complex exercise programs, and assess the improvements in the mobility of the elderly based on the effects of the program. in total, 40 subjects who attended the welfare center in gwangju city were selected for this study and assigned randomly to two groups : the complex exercise group (n = 20), which participated in a complex exercise program, and the general exercise group (n = 20), which did not participate in the complex exercise program. this study was approved by the hospital, and all participants provided their written informed consent. the complex exercise group consisted of twelve men and eight women (average age, 68.813.48 years ; average height, 158.005.19 cm ; average weight, 58.9411.36 kg), and the general exercise group consisted of seven men and 13 women (average age, 71.505.54 years ; average height, 160.077.14 cm ; average weight, 62.6412.12 kg). the selection criteria were as follows : a minimum of 24 points on the korean mini - mental state examination (k - mmse), no medication due to mental illness, no orthopedic disease in the lower limbs, the ability to walk 10 meters or more independently, and the ability to understand the study objective and provide voluntary consent. the complex exercise program consisted of resistance and aerobic exercises. a bridge exercise, arm and leg stretching in the prone position, the cat pose, and full - body stretching were performed to strengthen the trunk and increase flexibility. aerobic exercise was achieved by setting the intensity level at 6070% of the participants heart rate reserve, and walking training was conducted according to the participants individual capabilities. full - body stretching and walking in place were performed for 5 minutes each as warm - up and cool - down exercises, respectively. the main exercises were performed for 30 minutes, including two 5-minutes rest periods, for a total of 50 minutes. the four square step test (fsst) is a tool that evaluates complex walking ability. subjects step over four bars placed on the ground orthogonally in the shape of a plus sign + ; the height and length of which were 2.5 cm and 90 cm, respectively12. one of the quadrants formed by the plus sign, and continues walking over the bars, one by one, in a clockwise direction, until he / she arrives back in the starting quadrant. then, the exercise is repeated in the counterclockwise direction. during the test, if the subject touches a bar, loses his / her balance, or fails to put both feet in the same quadrant, the exercise is re - started. the figure - of-8 walk test (f8wt) measures walking skills in elderly persons with mobility impairments. it was developed to assess curved walking abilities in daily living, which can not be measured by straight - line walking tests13. the subject walks a figure 8 pattern around cones, and the time and number of steps needed to complete the exercise are recorded. in this study, the inter - rater reliability time was 0.90 and the step count was 0.92, while intra - rater reliability time was 0.84 and the step count was 0.8214. the falls efficacy scale (fes) is a self - administered questionnaire designed to determine the degree of self - confidence regarding falling ; it represents fears experienced while conducting ten activities required for daily living15. the measurement data obtained with these tests were analyzed using spss version 17.0 for windows. a paired t - test was conducted to determine within - group differences in the results before and after the experiment, and an independent t - test was conducted to determine between - group differences in the results before and after the experiment. the results before and after the intervention are presented in table 1table 1.the within - group and between - group comparisons of the outcome measurescomplex exercise group (n=20)general exercise group (n=20)pre - testpost - testpre - testpost - testfsst (sec)25.8 (8.4)21.6 (5.9)27.0 (7.3)23.9 (6.5)f8wt (sec)15.9 (5.7)11.8 (3.9)16.3 (5.9)13.9 (4.6)f8wt (steps)22.4 (6.8)19.1 (5.8)21.9 (6.3)20.6 (6.0)fes81.4 (8.5)94.7 (6.2)82.7 (8.6)89.7 (5.3) means (sd). significant difference within group (p<0.05) ; significant difference within groups (p<0.05) ; significant difference between groups (p<0.05). fsst : four square step test ; f8wt : figure - of-8 walking test ; fes : falls efficacy scale. changes in the fsst values showed a significant decrease in both the complex exercise program and general exercise groups (p<0.05). significant difference within group (p<0.05) ; significant difference within groups (p<0.05) ; significant difference between groups (p<0.05). fsst : four square step test ; f8wt : figure - of-8 walking test ; fes : falls efficacy scale changes in the f8wt time showed a significant decrease in both groups (p<0.05) ; however, no significant difference was found between the groups. changes in the f8wt step count showed a significant decrease in both groups as well (p<0.05). the complex exercise group showed a more significant improvement than the general exercise group did. changes in the fes values showed a significant improvement in both the complex exercise group and in the general exercise group. in this study, a complex exercise program was prescribed to a group of elderly individuals, resulting in improved walking ability during direction change and in falls efficacy. the fsst is a test that measures the ability to change direction while lifting a foot. this result indicates that the complex exercise group improved their direction change ability by improving their balance through regular exercise incorporating various movements. this finding is consistent with the results of another study, in which patients with chronic stroke participating in functional exercises incorporating various positions showed improved fsst scores, along with a speed moment more reduced than that of the general exercise group. our results also support the study results of song.16, who reported walking ability improvements through muscular strengthening and flexibility exercises. the f8wt (time and step count) was conducted to determine the between - group differences in the walking abilities of the elderly participants before and after the experiment, and the results showed a significant difference in the f8wt step count, but not in the f8wt time. the f8wt (time and step count), which was conducted to determine the curve walking abilities of the elderly, showed a significant difference in the f8wt step count, which indicated that the complex exercise group took fewer steps and had a longer stride when passing over two barriers in the curved lane than the general exercise group. this result was due to improvements in the balance of the complex exercise group when navigating a curved line, thereby requiring fewer steps. it has been reported that superior balance requires fewer steps and lengthens the stride required to maintain balance when walking around a curved line17. in experiments that compared straight walking and curved walking abilities, the differences between the two types of walking were greater in a group of patients with parkinson s disease than in healthy subjects. in particular, the patients with parkinson s disease exhibited a smaller step width and stride length18. the lack of significant difference between the two groups in the time taken to complete the f8wt indicates that there was no significant difference in the time required to navigate a curved path. the f8wt specifies a gap between barriers of 1.5 meters and a width of 1.2 meters. when the elderly subjects passed over the barriers, they chose a long stride to pass over the barrier safely ; thus, there was no significant difference between the two groups. will and motivation are important to changes in falls efficacy. both groups experienced a positive psychological effect with respect to falling due to the regular exercises. balance improved and fear of falling decreased due to the effects of the exercise program, thus improving falls efficacy. it has been reported that increased muscle strength improves balance, which increases safety in performing daily living activities20. in addition, increased lower extremity muscle strength has been found to correlate significantly with increased walking speed and falls efficacy21. in this study, a complex exercise program improved walking ability during direction change and falls efficacy in elderly individuals. in future research, the difference between the effects of various exercises and the complex exercise will be investigated. in addition, further studies comparing the effects of this complex exercise program on elderly patients suffering from a variety of diseases will be needed in the future. | [purpose ] this study was to assessed the efficacy of a complex exercise program for the elderly, with respect to the effects on walking ability during direction change and on falls efficacy. [subjects ] in total, 40 subjects were selected for this study and assigned randomly to either a complex exercise (n = 20) or a general exercise (n = 20) group. [methods ] the complex exercise consisted of resistance and aerobic exercises. the exercise program was conducted three times a week for eight weeks. we assessed outcome measures of the four square step test, the figure - of-8 walk test, and the falls efficacy scale. [results ] after the intervention, the four step square test, figure - of-8 walk test, and falls efficacy scale values increased significantly in both the complex exercise program and general exercise groups. the complex exercise group showed a more significant improvement than the general exercise group in the figure - of-8 walk test step and falls efficacy scale scores. [conclusion ] complex exercise improved walking ability during direction change and falls efficacy in elderly individuals. |
radiographic images are routinely used in the field of endodontics for diagnosis, treatment planning, and follow - up of periapical bone lesions. however they do not provide information on the size of a lesion and its spatial relationship with the anatomic structures as it is a two - dimensional representation of a three - dimensional object. also, the radiographs can not differentiate between cystic and non - cystic lesions. the traditional method for assessing studies have shown that conventional radiographs are not an ideal tool for monitoring healing, as there are a lot of variables involved in the developing and processing of a radiographic film. additionally, there are limitations such as superimposition of anatomic structures, inability to observe minute changes in bone density, and inter - observer variations, in the interpretation of radiographs. moreover, for monitoring the healing, multiple radiographs are required, which expose the patients to unnecessary radiation. in the healing phase of a lesion, vascular changes are a most important feature and the radiographs do not reveal these changes in the bone. ultrasound real time imaging [usg ] and color power doppler [cpd ] have recently been found to be useful in the diagnosis and follow - up of periapical healing. these applications are further enhanced by their combination with cpd, to assess blood flow. cpd gives a color - coded representation of the doppler signal and its time modification. cotti, reported that usg imaging is a very useful technique, which can give significant diagnostic information in relation to periapical lesions in the anterior region, where the buccal bone is thin. bone surfaces demonstrate total reflection of the ultrasound waves, thus structures in and beyond the intact bone are not normally detectable by ultrasound. however, where the bone cortex has thinned or perforated, usg can still be performed through such bone windows. this technique provides specific information on the size of a lesion, its vascular supply, and its internal content, and moreover, it is sensitive enough to distinguish the fluid content. this clinical study was designed to asses the reliability of the ultrasound with cpd as a tool for monitoring the healing of periapical lesions at time periods of six weeks, three months, and six months. ten patients with a noncontributory medical history were selected for this study. after a thorough clinical examination and radiographic evaluation, patients with asymptomatic maxillary anterior teeth, with approximately similar - sized periapical lesions [average dimension 1.3 to 1.9 cm ] of endodontic origin were included in this study. these patients were subjected to an investigation and treatment protocol involving a preoperative ultrasonographic examination followed by a nonsurgical, single - visit endodontic therapy. for the ultrasound technique, the machine used was the state - of - the - art ge voluson pro 730. preoperative ultrasound examination was carried out with an intracavitary multifrequency ultrasound probe of 8 12 mhz. the probe was first covered with a disposable latex for the control of infection and then covered with a layer of ultrasound gel. the probe was positioned intraorally on the buccal sulcus corresponding to the apical area of the tooth. all lesions were measured in three planes, that is, anteroposterior, superoinferior, and mesiodistal, and the dimensions were recorded. cpd was applied to each examination to detect the blood flow and the information was recorded. the periapical lesions were classified as granulomatous or cystic, based on the findings on usg combined with cpd, as seen in table 1. preoperative ultrasound features of all the ten cases nonsurgical root canal treatment was performed on all the patients in a single visit. pre - procedural mouth rinsing was carried out with 0.12% chlorhexidine before the involved tooth was isolated with a rubber dam. access opening was done with a sterile bur [endo access bur, dentsply ] at a slow speed, with sterile saline as a coolant. it was followed by canal preparation using the hybrid technique - coronal two - third, with a gates glidden drill and apical one - third with the hand k - files. each file was followed by irrigation with 2 ml of 1% naocl in a syringe, with a 27 gauze needle. after completion of the shaping procedure, the canal was rinsed with 15% ethylenediaminetetraacetic acid (edta) solution for one minute, using 5 10 ml of the solution. passive ultrasonic irrigation was carried out with 1% naocl for at least three minutes, after completing the canal preparation. various studies have proved that 2% chlorhexidine significantly reduces the bacterial loads in the root canal. the canal was obturated using the lateral condensation method, with zinc oxide eugenol as the sealer. the patients were followed up after treatment with clinical, radiological, and ultrasonographical evaluation to monitor the healing process at the end of six weeks, three months, and six months. clinically the patients were evaluated for pain, swelling, tenderness on palpation and percussion, and presence or absence of sinus. all the radiographs were taken using the paralleling technique, with the help of the xcp rinn instrument and analyzed with the help of the adobe photoshop cs image analysis software, and changes in the lesion dimensions were noted[911 ] [figures 23 ]. (a) preoperative radiograph [granuloma ], (b) six weeks postoperative radiograph [no changes are seen ], (c) three months postoperative [decrease in size of lesion ], (d) six months postoperative [completely healed ] (a) preoperative radiograph [cyst ], (b) six weeks postoperative radiograph, (c) three months postoperative [decrease in the size of lesion ], (d) six months postoperative [further decrease in the size of lesion ] ultrasonographically, the echo changes, changes in the dimension and volume of the lesion, and vascularity of the periapical lesions were observed and recorded. the ultrasonographical examination was carried out by a qualified, experienced radiologist [figures 1a g ]. (a) preoperative : showing dimension and volume, (b) preoperative : application of cpd showing no vascularity, (c) postoperative six weeks : showing dimension and volume, (d) postoperative six weeks : application of cpd showing presence of vascularity, (e) postoperative three months : showing dimension and volume, (f) postoperative three months : application of cpd showing presence of reduced vascularity than before, due to bone deposition, (g) postoperative six months : complete healing of the lesion the informed consent of all patients who participated in this study was obtained after the nature of the procedure and possible discomforts and risks had been fully explained. follow up of the periapical lesions at the end of 6 weeks showed no detectable changes radiographically as compared to the pre - operative one. evidence of healing in the radiograph was noticed only at the end of 3 months, where the size of the lesions had decreased in 8 cases. at the end of 6 months, 3 cases had completely healed, 5 cases were healing lesions and two cases had failed. ultrasonographically decrease in the size and volume of the lesion was evident as early as 6 weeks post - operatively. changes in echo and vascularity were also seen in eight cases. by the end of 3 months, further decrease in the size of the lesion and volume and at the end of 6 months, 3 patients showed complete healing, 5 cases were healing lesions and two cases had failed. accurate assessment of the periradicular status is crucial in the diagnosis, treatment, and evaluation of healing in endodontic therapy. the traditional method of assessing the success of endodontic therapy involves clinical examination and the use of periodic recall radiographs. the problem of unreliability in the radiographic interpretation of periapical lesions has been addressed by numerous studies since 1970. to better predict the outcome of nonsurgical endodontic treatment, it is important to evaluate new and more promising methods of imaging for the study of periapical lesions. ultrasound with cpd is recognized as one of the most risk - free methods for evaluating any disease in the human body. cotti, reported positive findings using the ultrasound in the differential diagnosis of periapical lesions and found it to be a very useful imaging technique, which could give significant diagnostic information in relation to periapical lesions in the anterior region, where the buccal bone is thin. apart from its use as a diagnostic tool, the ultrasound is also used in orthopedics for monitoring the healing of fractured bones. studies have shown that as compared to conventional radiographs, ultrasound with cpd clearly reveals the healing of the fracture along with details of the improvement in vascularity of the affected bone. in the present study, the follow - up protocol during the recall period to monitor post endodontic healing included, clinical examination, radiographic examination, and ultrasonographic examination. during the recall period, the clinical examination showed that only two patients, case nos. 5 and 7, were clinically symptomatic. the radiographic follow - up for all the ten cases, showed no detectable changes at the end of six weeks. significant evidence of healing was noticed only at the end of three months for eight cases ; the lesion size had decreased from the preoperative size, in case of no. 5, the lesion showed no changes and in case of no 7, the lesion showed a slight increase in size, indicative of a progressing lesion. in this study, the ultrasonographic probe was used intraorally to avoid interference of the labial blood supply with that of the lesion. moreover, extraoral probe placement would be more difficult than intraoral placement because of the interference of the nasal structures. the thin anterior buccal bone and possible fenestration allowed the ultrasound images to be obtained in all the cases and the echo characteristics of the apical lesions were determined. table 2 shows that with the help of ultrasonographic examination, changes in size and volume of the lesion, changes in echo, and the presence of vascularity were detectable as early as six weeks postoperatively [figures 1c and d ] for eight cases. the changes detected by ultrasound and cpd in the eight healing cases also included proliferation of the blood vessels (neovascularization). this clearly demonstrates that ultrasound coupled with cpd is a superior tool as compared to radiographs, for evaluating post - endodontic healing at the end of six weeks. no changes were seen in cases 5 and 7 at the end of six weeks. preoperative and postoperative ultrasound and color power doppler findings in the periapical lesions by the end of three months, a further decrease in the size of the lesion and volume and increase in echogenecity and decrease in the flow signal [figures 1e and f ], in terms of vascularity was observed for the eight healing cases. the observed decrease in vascularity is known to indicate remodeling of the cortical plate, which interferes with the cpd signals. case 5 showed no changes and case 7 shows a slight increase in the size of the lesion. at the end of six months an ultrasound examination of the three patients showed echogenicity comparable to the normal bone in the healing lesion, as seen in figure 1 g. the lesion size and volume in the remaining five cases decreased in a manner that could be related to progressive healing. no doppler signal was noted at six months, as is evident in figure 1 g. the cpd detects minute areas of blood flow in the healing bone by recording the change in frequency caused by the moving red blood cells. it demonstrates the progressive formation of new blood vessels in the bone during the initial healing period. as bone remodeling proceeds this is attributed to the decrease in penetration of the doppler ultrasound waves with an increase in bone deposition over the affected region. in contrast, a lack in development of flow signals during the first six weeks may indicate delayed bone healing or non - healing lesions. in this study it was also possible to recognize the initial signs of healing in eight patients, by ultrasonography, in as early as six weeks, by observing the change in the initial hypoechoic regions becoming hyperechoic postoperatively. ultrasound has an advantage over ct scans, in that it is free of ionizing radiations. however, the major disadvantage of ultrasound is that it can only be used if there is a bony defect over the lesion, through which ultrasonic waves can traverse. the other limitation of ultrasound is that it can not be used easily in the posterior region of the mouth as accessibility is difficult with the present probe design. the presence of a thick cortical plate in the posterior region prevents the ultrasound waves from traversing easily. this study confirms that ultrasound real time imaging is a useful imaging technique, which can give significant information in relation to a periapical lesion in the anterior region. the images obtained are easy to read once the observer is trained. by obtaining a real time image, a working diagnosis can be made without delay and it also prevents unnecessary exposure of the patient to ionizing radiation. no harmful effects of ultrasound waves have been observed in the tissues as a result of ultrasound examination. as of now ultrasound devices do not have probes specifically designed for intraoral use. in order to make ultrasound more practical, an effective modification of the probe, especially for intraoral use, from this study it can be concluded that ultrasound with color power doppler is a very important and efficient tool for diagnosis and also for monitoring post - endodontic healing. | aims : to assess the reliability of ultrasound imaging coupled with color power doppler for monitoring the healing after nonsurgical endodontic therapy.materials and methods : ten asymptomatic maxillary anterior teeth with approximately similar - sized periapical radiolucent lesions of average dimension 1.3 1.9 cm, as observed on an intraoral periapical radiograph, and confirmed by ultrasound was selected for the study. after confirming the diagnosis all the teeth were subjected to nonsurgical endodontic treatment. postoperative healing was monitored using postoperative subjective feedback, a radiograph, and an ultrasound with a color power doppler, at intervals of six weeks, three months, and six months.results:eight among the ten cases studied showed signs of healing, with an ultrasound, as early as six weeks postoperatively, but the radiographs showed a noticeable change only at the end of three months. at the end of the follow - up period of three months and six months, the findings in terms of change in the lesion size were the same with both the radiograph and ultrasound. ultrasonography was able to predict the healing very consistently at all recall periods from six weeks onward providing vital information such as changes in vascularity and bone formation as compared to radiographs.conclusions:ultrasound with color power doppler is an efficient tool for monitoring bone healing as compared to the conventionally employed radiographic method. |
because of continuous efforts to minimize scarring and make procedures less invasive, reduced port surgery (rps) procedures, such as laparoendoscopic single - site surgery, have been developed and have gained popularity in not only general but also pediatric surgery over the past few years. for rps, the initial umbilical incision plays an important role in both functional ability and cosmetic impact. larger incisions enable better manipulation of forceps, extraction of larger surgical specimens, and easier exteriorization of the intestine for anastomosis. however, minimally invasive surgery seeks to maintain cosmesis by preserving the umbilical profile because the umbilicus is an important abdominal landmark and plays an important cosmetic role for most patients. unfortunately, given the size of the pediatric umbilical ring, a conventional longitudinal incision at the umbilicus does not provide enough space for triangulation of several instruments, specimen removal, or exteriorization of the intestine for anastomosis. extension of the longitudinal incision past the umbilical ring causes visible scarring, resulting in reduced cosmesis. several techniques for the initial umbilical incision have been described that all facilitate removal of surgical specimens (up to a certain size) and improve cosmetic outcomes. for the pediatric population, these special incisions (eg, circumumbilical incision) can leave a visible scar around the umbilicus, disrupting its configuration, especially if the incision is large when compared with the size of the umbilicus. to overcome these problems, we developed a new umbilical incision, made in an inverted y shape (benz incision). the benz incision is a simple and effective technique for enlarging the orifice of the abdominal opening, and it allows for umbilical remodeling without complications. the aim of this article is to present our innovative umbilical incision technique, which is associated with successful outcomes, minimal esthetic effects, and optimum patient compliance. from november 2010 to may 2014, 75 children underwent benz incisions, at the umbilicus, at saitama children 's medical center and nagoya university hospital. the benz incision was used for rps and laparoscopic surgical procedures that required specimen removal or exteriorization of the intestine for anastomosis. a retrospective study was then conducted on these patients, and the technical aspects and surgical outcomes were evaluated. the ethics committees at our hospitals approved this retrospective survey. with the patient under general anesthesia, we marked 3 points in the umbilical region, which corresponded to the vertices of an equilateral triangle. after pulling out the center of the umbilicus, we then drew 3 lines (13 mm each) in an inverted y shape (figure 1a). the incisions were extended beneath the skin, by dissecting the subcutaneous tissue from the underlying fascia using an electrocautery, and the linea alba and peritoneum were incised longitudinally. the fascial opening was then enlarged in the shape of a circle, with a circumference of approximately 78 mm (figure 1b). access port devices such as e - z access with a lap protector (hakko medical, nagano, japan), gelpoint (applied medical, rancho santa margarita, california), sils port (covidien, mansfield, massachusetts), and alexis wound retractor (applied medical) were then inserted through the umbilical incision. at the end of the operation, 30 absorbable sutures. if necessary, the periumbilical subcutaneous fat tissue was trimmed to maintain the concavity of the umbilicus. the sides of each adjoining flap were also trimmed, as shown in figure 1c. the tips of the 3 skin flaps were anchored to the caudal end of the fascia with a no. 60 absorbable dermal sutures (figure 1d). with a cotton ball placed in the umbilicus, air was aspirated from the space around the cotton ball to compress the skin flaps to the surrounding tissue, as well as preserve the natural concavity of the umbilicus. a, an inverted y shaped incision is marked, with three 13-mm incisions in the shape of the mercedes - benz logo. the fascial opening is enlarged to a circle shape with a radius of 13 mm. d, the tips of the 3 skin flaps are anchored to the caudal end of the fascia to retain the umbilicus ' concave curvature toward the caudal aspect, and the sides of each adjoining flap are then closed. with the patient under general anesthesia, we marked 3 points in the umbilical region, which corresponded to the vertices of an equilateral triangle. after pulling out the center of the umbilicus, we then drew 3 lines (13 mm each) in an inverted y shape (figure 1a). the incisions were extended beneath the skin, by dissecting the subcutaneous tissue from the underlying fascia using an electrocautery, and the linea alba and peritoneum were incised longitudinally. the fascial opening was then enlarged in the shape of a circle, with a circumference of approximately 78 mm (figure 1b). access port devices such as e - z access with a lap protector (hakko medical, nagano, japan), gelpoint (applied medical, rancho santa margarita, california), sils port (covidien, mansfield, massachusetts), and alexis wound retractor (applied medical) were then inserted through the umbilical incision. at the end of the operation, the fascia and peritoneum were closed with 4 or 5 no. if necessary, the periumbilical subcutaneous fat tissue was trimmed to maintain the concavity of the umbilicus. the sides of each adjoining flap were also trimmed, as shown in figure 1c. the tips of the 3 skin flaps were anchored to the caudal end of the fascia with a no. 60 absorbable dermal sutures (figure 1d). with a cotton ball placed in the umbilicus, air was aspirated from the space around the cotton ball to compress the skin flaps to the surrounding tissue, as well as preserve the natural concavity of the umbilicus. a, an inverted y shaped incision is marked, with three 13-mm incisions in the shape of the mercedes - benz logo. the fascial opening is enlarged to a circle shape with a radius of 13 mm. d, the tips of the 3 skin flaps are anchored to the caudal end of the fascia to retain the umbilicus ' concave curvature toward the caudal aspect, and the sides of each adjoining flap are then closed. of the 75 patients who received benz incisions in this study, 45 were male patients and 30 were female patients. the median age of the patients was 6 years 6 months (range, 26 days to 18 years), and the median body weight was 21.7 kg (range, 3.154.3 kg). the benz incision was used for rps and laparoscopic surgical procedures requiring removal of surgical specimens or exteriorization of the intestine for anastomosis. by use of the access port device, which was inserted into the benz incision, a combination of exteriorization of the intestine and rps or a combination of specimen removal and rps was performed. the operative procedures in which the benz incision at the umbilicus was applied are listed in table 1. operative procedures by benz incision at umbilicus cbd = congenital biliary dilatation, rps = reduced port surgery, si = single incision, hd = hirschsprung 's disease. in all cases the benz incision was effective at enlarging a fascial opening to a circumference of approximately 78 mm, which provides sufficient space for performing operations in the standard fashion. the benz incision allowed for easy manipulation of the surgical instruments without conflict, as well as removal of surgical specimens. roux - en - y anastomosis and retrocolic fixation were performed in an extracorporeal manner without stress, and the anastomosed intestine was then internalized through the benz incision without difficulty. in all cases blood loss was minimal, and the operative time was not significantly increased. a postoperative stitch abscess developed in 1 patient, but this healed without treatment. in another patient, ischemic flaps of the umbilicus developed after a 10-hour operation, although these also healed without special treatment. the operative wounds were satisfactory and were almost invisible 3 months after surgery in all cases (figure 1e). rps was developed over the past decade and has gained popularity, especially in general surgery. more recently, it has been gradually accepted for use in pediatric populations, despite the limited working space. unfortunately, the size of the pediatric umbilical ring is so small that a longitudinal incision at the umbilicus does not allow several instruments to be triangulated and does not provide enough space for removal of specimens or exteriorization of the intestine for anastomosis. special umbilical incisions such as the circumumbilical incision and omega - shaped incision have been proposed as simple techniques to provide acceptable cosmetic results in patients undergoing laparoscopic procedures that require specimen extraction. however, over three quarters of the circumference of the umbilicus is prone to umbilical ischemia and deformity of the natural umbilical profile. wounds outside the umbilical ring, such as those occurring with the circumumbilical or omega - shaped incision, typically result in scar formation, although scarring inside the umbilicus is generally invisible. moreover, it is difficult to make these incisions extended if a larger fascial opening is required to extract large specimens. in general surgery, hachisuka described an umbilical zigzag skin incision that can enlarge the fascial opening to a diameter of 6 cm while maintaining cosmesis. unfortunately, this type of incision can not create a wide enough opening for surgery in a small umbilicus and fascia while still preserving cosmesis. therefore it was necessary to develop an incision technique specific for pediatric patients with small umbilici that creates the larger umbilical opening and profile required for the highly advanced, and evolving, field of laparoscopic surgery. in the pediatric field various techniques such as making several skin flaps and anchoring the tip of the caudal skin flap to the caudal end of the fascia to create a natural - appearing umbilicus have been reported. therefore we developed an umbilical incision technique in accordance with the procedure for umbilicoplasty for use in laparoscopic surgery in pediatric patients whose umbilical rings are smaller than those of adults. our new technique creates 3 skin flaps and preserves the natural shape of the umbilicus. we chose incisions of 13 mm in length and created them in an inverted y shape, similar to the mercedes - benz logo (3-pointed star). the benz incision can enlarge the fascial opening to approximately 78 mm in circumference, whereas a conventional longitudinal umbilical incision of 26 mm can only create an opening with a circumference of 52 mm (figure 2). in our experience thus far, skin flaps of 13 mm in length are appropriate for smooth manipulation during rps and can fit in the umbilical ring of an infant. our benz incision not only provides a larger opening but also retains the natural appearance of the umbilicus. by use of the benz incision, transumbilical laparoscopic surgery has been performed for multiple procedures, as shown in table 1, and all procedures were successfully completed without severe complications. although there was no control group, blood loss was minimal and the operative duration was not significantly increased compared with standard approaches. for a wide range of applications, creation of an ileal j - pouch and mincing of an enlarged spleen during splenectomy therefore use of the benz incision at the umbilicus has successfully reduced the number of incisions for ports in pediatric patients, without increasing complications. the benz incision can enlarge the fascial opening to approximately 78 mm in circumference, whereas a conventional longitudinal 26-mm single incision in the pediatric umbilical ring can only produce a circumference of 52 mm. in our study a stitch abscess developed in patient, and ischemia developed in the skin flaps in another patient after a 10-hour operation. however, these complications were resolved without treatment within 3 months of surgery, and therefore it appears that the benz incision at the umbilicus does not increase wound infections. furthermore, no visible postoperative scar is left because the incision is entirely within the umbilical region. if a larger fascial opening is required to extract large specimens, the incision can easily be extended from each incision line to the flaps. in addition to laparoscopic surgery, we successfully applied our technique to ramstedt pyloromyotomy, and we believe that our new umbilical incision is applicable to various types of surgical procedures. the benz umbilical incision can provide a wide enough fascial opening to maintain the triangulation of instruments, removal of specimens, and exteriorization of the intestine for anastomosis. therefore we conclude that the benz incision at the umbilicus appears to be a feasible, effective, and scarless approach for rps in pediatric patients with small umbilical rings. | background and objectives : for reduced port surgery in pediatric patients, the initial umbilical incision plays an important role in both functional ability and cosmetic impact. larger umbilical incisions enable better manipulation of forceps, extraction of larger surgical specimens, and easier exteriorization of the intestine for anastomosis. we have pursued an incision of the small pediatric umbilicus that allows for enlargement of the orifice of the abdominal opening with preservation of the natural umbilical profile. this article aims to present a new umbilical incision technique and describe the outcomes.methods:we devised a new umbilical incision technique for reduced port surgery in pediatric patients. our incision is made in an inverted y shape (benz incision), allowing for access port device insertion. the benz incision technique was applied between november 2010 and may 2014 and was retrospectively studied.results:seventy-five patients underwent benz incisions. the median age of all patients was 6 years 6 months (range, 26 days to 18 years), and the median body weight was 21.7 kg (range, 3.154.3 kg). benz incisions were applied for various procedures, including reduced port surgery with hepaticojejunostomy for congenital biliary dilatation, portojejunostomy for biliary atresia, meckel diverticulectomy, tumor resection, varicocelectomy, cholecystectomy, splenectomy, ileus surgery, ileocecal resection, and total colectomy. all patients were successfully treated, without a significant increase in operating time or severe complications. the cosmetic profile of the umbilicus was maintained after surgery.conclusion:the benz incision is a feasible, effective, and scarless approach for reduced port surgery in pediatric patients whose umbilical rings are too small for the conventional approach. |
nuclear and mitochondrial dna is damaged by radiation, by organic and inorganic chemical agents and by the misdirected activity of enzymes. exogenous and endogenous processes that contribute to genomic damage include oxidation, alkylation, and deamination of dna. adducts arising from nucleic acid damage may cause mutations, jeopardize epigenetic patterns, block dna and rna synthesis, inhibit and alter the coding of mrna transcription and translation, and promote strand breaks. one example, bcnu (1,3-bis(2-chloroethyl)-1-nitrosourea), has been used to treat lymphoma, multiple myeloma, and several types of brain cancer. among the toxic dna adducts formed by this chemotherapeutic agent is 1,n - ethanoadenine (ea, figure 1a), which blocks dna replication. in the ea dna adduct, the exocyclic n - nitrogen of adenine is connected to the n1 ring nitrogen by a saturated two - carbon bridge, creating a five - membered ring involving the n1 and n atoms that otherwise would be involved in canonical watson crick h - bonding (figure 1a). ea is repaired to some extent by the escherichia coli repair protein 3-methyladenine dna glycosylase (alka) and the human alkyladenine dna glycosylase mpg (also called aag, anpg, or apng). however, for both of the enzymes, the excision of ea is far less efficient than that of the structurally related 1,n - ethenoadenine (ea), in which the two - carbon bridge is unsaturated (figure 1d). because ea lacks the structural features needed to form a watson crick base pair with thymine, it is likely to be both toxic and mutagenic. in the absence of repair, ea blocks polymerase bypass and miscodes during attempted replication by mammalian dna polymerases in vitro. the analogous ea adduct, which is also missing the identical base - pairing capabilities, is both toxic and mutagenic in e. coli in the absence of protection by the alkb repair enzyme. previously, we reported that alkb can effectively alleviate the toxicity of the ea lesion in vivo ; in alkb - proficient cells, ea is easily tolerated and not significantly mutagenic. however, ea is extremely toxic to alkb - deficient cells, showing an 86% reduction in replication. preliminary in vitro experiments done in parallel show that alkb could only partially convert ea to generate an open - ring intermediate 2 (figure 1a, box), trappable with pfbha. in an attempt to reconcile the potent ability of the protein to suppress toxicity in vivo with only partial conversion of the lesion in vitro, we speculated that intermediate 2, via flexible bond rotation, can take on a structure to form a regular watson crick base pair with thymine (figure 1a, box). that restructured base pair would not block dna replication and hence enables tolerance of the lesion. chemical structures of ea, m6a, m1a, and ea and proposed mechanisms of alkb - mediated enzymatic reactions on alkyl - dna adducts. (a) ea, (b) m6a, (c) m1a, and (d) ea. the alkb protein is an -ketoglutarate- and fe(ii)-dependent dioxygenase that can efficiently repair various alkyl lesions in both dna and rna, in single- and double - stranded contexts. it has at least nine human homologues : abh1 through abh8 and fto, some of which have also been proposed or proven to act upon alkylated dna and rna. alkb, together with ada, alka, and aidb, is one of the four proteins in the e. coli adaptive response to alkylating agents. the reported substrate scope for the alkb enzyme includes 1-methyladenine (m1a), 3-methylcytosine (m3c), 3-ethylcytosine (e3c), 1-methylguanine (m1 g), 3-methylthymine (m3 t), 3,n - ethenocytosine (ec), ea, and ea. in the current work, we used high - resolution esi - tof mass spectrometry to investigate the ability of alkb to repair ea. to our surprise we found that the oxidizing enzyme alkb is capable of complete repair of the ea base (figure 1a). the observation of alkb s complete conversion of ea to adenine along a defined reaction path makes plausible the strategy of designing inhibitors to block the repair activity, thus potentially increasing the anticancer efficacy of bcnu. the ea dealkylation process requires two oxidation reactions, one at n1 and a second at n, to achieve complete restoration of the undamaged adenine base. the observation of n oxidation in the reaction of alkb with ea suggested that the enzyme might act on other n - modifications of adenine. the m6a base is functionally similar to n- and 5-methylcytosine (m4c and m5c), and is an important epigenetic signal for dna replication and repair, protein dna interactions, host - pathogen interactions and other cellular processes ; there is approximately one m6a for every 200 bases in the e. coli genome. as controls against which to compare the chemistry of alkb on m6a (and ea), we used m1a and ea (figure 1c and 1d), which are good substrates for alkb both in vivo and in vitro. as we were preparing this manuscript, jia. reported that the obesity - associated fto protein (one of alkb s mammalian homologues) can remove the methyl group from m6a in both rna and dna ; they indicated that the demethylation of fto on m6a in mrna correlates with epigenetic regulation in mammalian cells. in our present study the implications of this discovery include the possibility that alkb might be not only a dna repair enzyme in e. coli but also a participant in cellular epigenetic control, which may help cells defend against alkylation damage to nucleic acids. this study utilized chemical synthesis to incorporate structurally defined lesions into specific sites of oligonucleotides. the modified oligonucleotides were allowed to react with purified alkb and snapshots were taken at various time points to identify the products and intermediates of reactions. this method enabled us to efficiently monitor the ability of alkb to repair alkylation damage using a high - resolution mass spectrometry tool employed by us earlier with a number of dna lesions. four 16mer oligonucleotides were chemically synthesized containing the alkyl - dna adducts shown in figure 1. the sequence used was 5-gaagacctxggcgtcc-3 ; the flanking sequence of each lesion (x) was identical, fixing the local sequence context for the repair reaction. the 16mers with individual lesions were incubated with the cofactors for the alkb reaction : fe(ii) and -ketoglutarate (see experimental section). in the presence of all cofactors, two sets of experiments were conducted for each lesion, one with the alkb protein and one with the purification buffer of alkb but without the protein. following the repair reaction, hplc - esi - tof mass spectrometry was utilized to identify the products and intermediates. the 16mer oligonucleotides demonstrated a good signal in the 4 charge envelope of the mass spectra. to give one example to illustrate the method of analysis, the molecular weight (mw) of m1a in the 16mer is calculated as 4902.88 da for the neutral species, and the mw of its monoisotopic peak (all c, n, etc.) when ionized with four negative charges (the 4 charge envelope) in the electric field of the spectrometer is calculated as having an m / z of 1224.71 (all mws are shown in table 1). the multiple peaks in each 4 charge envelope reflect the number of c or other heavier isotopes (figure 2a). keeping with m1a as the example, its monoisotopic peak is observed as 1224.67, consistent with the theoretical calculation. the next peak in that envelope has an m / z of 1224.92, 0.25 amu larger than the 1224.67 peak, which indicates a species containing c, n, or another isotope that adds a nominal mass of 1.0 to the total weight of the 16mer (e.g., 0.25 = m / z = one c / charge state of 4). additional peaks in the spectrum represent additional heavy isotopes within the parental 16mer. data represent the 4 charge envelopes and the monoisotopic peak (all c, n, etc. (a) m1a, (b) m1a + alkb, (c) ea, and (d) ea + alkb. previously, we investigated m1a and ea lesions as substrates for alkb both in vitro and in vivo ; we used those two adducts as controls for the present study on the structurally similar compounds, m6a and ea. in our in vitro study of m1a repair, the lesion was completely repaired to the undamaged base adenine (figure 2b, m / z = 1221.13), while no change occurred in the absence of alkb (figure 2a, m / z 1224.67). the in vitro results confirm that m1a is a good substrate for alkb, and reproduce our prior findings. moreover, the current observations correlate very well with the strong reparability of m1a suggested by earlier in vivo lesion bypass studies. ea was observed at m / z of 1227.22 for its 4 charge monoisotopic peak in the absence of alkb (figure 2c). in the presence of alkb, the ea lesion was mostly converted to the undamaged product, adenine (m / z = 1221.24, figure 2d). we also observed peak clusters consistent in mw with epoxide (1231.22) and glycol (1235.72) intermediates (figure 1d and figure 2d), which are consistent with previous observations. in our in vitro experiment with ea, the oligonucleotide with ea in the absence of alkb was observed at m / z of 1227.67 for its 4 charge monoisotopic peak, which agrees well with the calculated m / z 1227.71 (figure 3a and table 1). in the presence of alkb, indeed, ea was converted to four new species in the mass spectrum (figure 3b). the peak at m / z of 1221.16 corresponds to the 16mer with an undamaged adenine base, which we did not find in our previous study. one possible reason could be that the maldi mass spectrometry tool we used earlier has poorer resolution than the current hplc - esi - tof method. another reason is that maldi analyzes the samples immediately after the reactions, giving less time for conversion of intermediates to adenine. however, the hplc - esi - tof method detects mass signals after the hplc separation at room temperature, which might provide product and intermediate profiles different than those detected in the maldi analyses. we also controlled the hplc autosampler temperature at 5 c and found the formation of undamaged adenine more limited under this condition (figure 4). detailed analyses of the product and intermediate kinetics will be presented in a later section. we also found peaks at m / z of 1231.66 and 1235.67, which match up with intermediates with one and two extra oxygen atoms added to the ea motif, respectively. by carefully comparing the high - resolution mws between the new species with m / z of 1228.16 and the 16mer with adenine in the lesion position, we determined that this new species has two extra atoms, consistent with the addition of one oxygen and one carbon (intermediate 6 or 9 in figure 1a). esi - tof mass spectra from reactions of alkyl adducts and alkb protein. data represent the 4 charge envelopes and the monoisotopic peak (all c, n, etc. (a) ea, (b) ea + alkb, (c) m6a, and (d) m6a + alkb. in our previously proposed mechanism (figure 1a, boxed), alkb can oxidize the carbon atom attached to the n1 position of the adenine base. the mono - oxidized intermediates 1 and 2 (figure 1a) equilibrate between the ring - closed and ring - opened forms, both bearing an observed m / z of 1231.66. the opened - ring intermediate 2 can take on a conformation in which it can form a watson crick base pair and thereby not block dna replication. this hypothesis is strongly supported by in vivo experiments showing ea is neither toxic nor mutagenic in alkb - proficient e. coli cells. in the current study, we observed ea to be completely repaired to the adenine base, which requires oxidation reactions at both the n1 and n - attached carbon atoms (figures 1a and 3b). a clue as to the reaction path of ea was the observation of an alkb - induced glycol (m / z of 1235.67) identical to the glycol formed during removal of the etheno bridge from ea (figure 1d). in order for ea to form a glycol (intermediate 4, figure 1a) such as that of ea the presence of the glycol and the observation of other intermediates indicated by their masses in figure 1a allowed us to assemble a reaction network that would explain the removal of the ethano - bridge from ea. as shown in figure 1a, alkb can oxidize each carbon of the saturated two carbon bridge and completely restore the undamaged adenine base. the first oxidation can occur either at the n1- or n - attached carbon of the ea moiety and generate intermediate 1 or 3, respectively. each ring - closed intermediate will equilibrate with its ring - opened form 2 or 7. further oxidation of 1 or 3 will generate a common intermediate 4, which can also exist in the respective ring - opened form of 5 or 8. further oxidation of the ring - opened intermediate 2 or 7 will also generate 5 or 8. the two - carbon unit attached to ea in intermediate 5 or 8 can then be released as glyoxal to form the undamaged adenine (figure 1a), identical to the final step of ea repair after epoxide hydrolysis (figure 1d). if the glycol 4 or the -hydroxy aldehyde intermediate 5 or 8 is further oxidized, two aldehyde products will form : the terminal carbon will be released as formaldehyde, and the other carbon attached to either the n- or n1-position of the adenine base will generate intermediates 6 or 9. the formation of intermediate 6 or 9 should adopt a mechanism similar to typical oxidative cleavage of a glycol to two aldehydes by sodium periodate. it is possible that intermediate 6 or 9 can be spontaneously converted to the adenine base by amide hydrolysis, or they may remain side products in the reaction rather than formal intermediates. to elucidate the kinetic distributions of the four new species in the alkb reaction, we carried out a series of enzymatic reactions at 37 c with varied time durations at a fixed enzyme we chose the time points at 1, 2, 5, 10, 20, 40, 60, and 80 min to quench the reactions and subsequently carried out hplc - esi - tof analysis using an autosampler set to 5 c in an effort to keep the products and intermediates intact. as presented in figure 4, we observed that the ea starting material was completely consumed even after the 1 min incubation. this result indicates that the alkb reaction on ea happened very fast under the current reaction conditions. we also observed that a major species in all mass spectra was the peak at m / z of 1231.66 (from 77.4% to 91.5%, figure 4 and table s1, si), which matches up with intermediate with one extra oxygen atom added to ea. the percentage of this mono - oxidation intermediate decreased as incubation at 37 c went to longer times. the intermediate with two extra oxygen atoms added to ea displayed a relative low percentage for all time periods. the ratios of the fully repaired product (undamaged adenine) and the ea+2 species (intermediate 6 or 9 in figure 1a) gradually increased as the incubation time increased (figure 4). the ratio of adenine increased from 2.6% to 10.0% during the 180 min interval. by performing the hplc - esi - tof analysis of the incubation of ea with alkb using an autosampler at room temperature, we observed a significantly increased amount of adenine (figure 3b), which might be generated from the spontaneous decomposition of the oxidized intermediates. percentages (y - axis) of the four species in the alkb reactions on ea at 1, 2, 5, 10, 20, 40, 60, and 80 min incubation time points (x - axis) (see data in table s1, si). the observed m / z of 1224.73 for the 4 charge monoisotopic peak from the m6a starting material was seen in the absence of alkb (figure 3c). in the presence of the alkb protein, the peak at 1224.73 corresponds to the unreacted 16mer containing m6a (about 68% for a 60 min incubation). the 1221.24 peak envelope is assigned to the unmodified base adenine (15%). the peak envelope at 1228.72 (17%) matches the theoretical mw of the ho - m6a very well (1228.71 at 4 charge state). it decomposes to a as the reaction time progresses (figure s3, si). we believe this to be the first instance of observing the hydroxymethyl intermediate in the alkb reaction for simple methyl adducts, which strongly supports alkb s oxidative demethylation mechanism. with respect to the 100% conversion of m1a under similar reaction conditions, the incomplete repair and buildup of hydroxy intermediate seen for the alkb reaction with m6a suggest that m6a is more sluggishly processed than m1a. unlike the alkb reaction on m6a, we did not observe a hydroxy intermediate (i.e., no ho - m1a) in the m1a reaction. the different behaviors of m1a and m6a could originate from the charge state of the lesions : at physiological ph, m1a is positively charged, whereas m6a is neutral. the positively charged ho - m1a intermediate should be less stable than the neutral ho - m6a, leading to faster accumulation of adenine and inability to observe the hydroxy intermediate. the alleviation of ea toxicity by alkb in e. coli provides an opportunity to investigate further the repair efficiency of such lesions by human homologues, such as habh2. if habh2 or its homologues can efficiently repair ea in vivo, the anticancer efficacy of bcnu (and possibly other dna damaging anticancer drugs) would be greatly reduced. the design of a chemical inhibitor to block the repair activity of alkb or habh2 on ea should enhance the anticancer efficacy of bcnu. unlike m1a, ea, or ea, the m6a moiety is normally not considered a lesion. (m5c being the fifth element in addition to the regular four dna bases). the results presented here imply that alkb might not only act as a repair enzyme to defend against exogenous or endogenous attacks by alkylating agents but may also help the cell to control its replication cycle. besides its direct reversal repair of alkyl lesions, such as m1a and ea, alkb, which is strongly induced by dna damage, might also demethylate m6a to stop the cell replication cycle temporarily and provide extra time for the cell to repair alkyl adducts. after the majority of alkyl lesions are removed, alkb and other repair enzymes can be degraded or down - regulated, followed by progression of the normal cell cycle. the epigenetic control of oxidative demethylation of m6a and its influence on cellular function regulation is also supported by the recent discovery of fto s demethylation of m6a. in this study, we demonstrated that alkb can demethylate m6a and completely convert ea to undamaged adenine and other intermediates. these results indicate that alkb can act not only as a dna repair enzyme but also as a component that may modulate the cellular replication cycle, thus aiding e. coli in surviving alkylation attacks. further investigation of the cellular functions of alkb will provide insights into alkb s defense mechanisms for the cellular response to environmental attacks as well as the design and development of inhibitors for alkb s human homologues to improve treatments for cancer therapy. oligonucleotides containing the adducts in figure 1 were prepared using the solid - phase phosphoramidite method, and were deprotected, purified, and identified as described previously. for all four adducts, the oligonucleotide sequence of the 16mers was 5-gaagacctxggcgtcc-3, (x = adduct). dna concentration was measured by uv absorbance using the extinction coefficients () at 260 nm. for any alkyl - modified base, we substituted its extinction coefficient with the extinction coefficient of its unmodified counterpart due to the tiny difference between the values in the context of a 16mer oligonucleotide. all assays were carried out with alkbn11 protein, a truncated version of alkb in which the first eleven residues were removed. protein was purified as described and shown previously to have similar activity to the wild type protein. all alkb incubation reactions utilized similar conditions as previously described. reactions were performed at 37 c in 45 mm hepes (ph 8.0), 0.9 mm -ketoglutarate, 67 m fe(nh4)2(so4)26h2o, and 1.8 mm ascorbate, followed by dry ice storage until hplc - esi - tof ms analysis. a typical reaction was performed with 5 m dna, all cofactors, and with or without 2.5 m alkb in a 10-l volume for 1 h. in the case of a reaction with no alkb protein added, the elution buffer for alkb purification was added instead. for the time and volumetric dependency reactions (figures 4 in text and s1s4 in si), the reaction time and volumetric ratio varied correspondingly. oligonucleotide analyses were carried out on an agilent esi - tof mass spectrometer (palo alto, ca). nitrogen gas was set with drying at 10 l / min, the heated capillary at 325 c and the nebulizer set at 15 psig. hplc separations were performed by using a zorbax sb - aq column (2.1 mm 150 mm ; 3.5 m ; agilent technologies, palo alto, ca) with a flow rate of 0.2 ml / min. solvent a used 10 mm ammonium acetate in water ; solvent b used 100% acetonitrile. a linear gradient was carried out in the following steps : 2 to 30% b over 30 min, 30 to 2% b over 5 min, and 2 to 2% b over 10 min. ms analyses were normally carried out at room temperature except for the data presented in figure 4, which were collected with the temperature of the autosampler set at 5 c. | the dna and rna repair protein alkb removes alkyl groups from nucleic acids by a unique iron- and -ketoglutarate - dependent oxidation strategy. when alkylated adenines are used as alkb targets, earlier work suggests that the initial target of oxidation can be the alkyl carbon adjacent to n1. such may be the case with ethano - adenine (ea), a dna adduct formed by an important anticancer drug, bcnu, whereby an initial oxidation would occur at the carbon adjacent to n1. in a previous study, several intermediates were observed suggesting a pathway involving adduct restructuring to a form that would not hinder replication, which would match biological data showing that alkb almost completely reverses ea toxicity in vivo. the present study uses more sensitive spectroscopic methodology to reveal the complete conversion of ea to adenine ; the nature of observed additional putative intermediates indicates that alkb conducts a second oxidation event in order to release the two - carbon unit completely. the second oxidation event occurs at the exocyclic carbon adjacent to the n6 atom of adenine. the observation of oxidation of a carbon at n6 in ea prompted us to evaluate n6-methyladenine (m6a), an important epigenetic signal for dna replication and many other cellular processes, as an alkb substrate in dna. here we show that m6a is indeed a substrate for alkb and that it is converted to adenine via its 6-hydroxymethyl derivative. the observation that alkb can demethylate m6a in vitro suggests a role for alkb in regulation of important cellular functions in vivo. |
gw182-family proteins are essential for microrna - mediated translational repression and deadenylation in animal cells. here we show that a conserved motif in the human gw182 paralog tnrc6c interacts with the c - terminal domain of polyadenylate binding protein 1 (pabc) and present the crystal structure of the complex. mutations at the complex interface impair mrna deadenylation in mammalian cell extracts, suggesting that the gw182-pabc interaction contributes to microrna - mediated gene silencing. |
|
one of the tantalizing questions raised by molecular biology is whether the basic structures of life as we know them arose through a darwinian evolutionary process and, if so, what were the evolutionary pressures acting on them ? the genetic code was initially believed to be universal throughout all living things, even though some variations in both nuclear and mitochondrial systems have recently been found (see for a review). these variations are, however, limited and correspond essentially to the reassignment of one or a few codons to another amino acid. the idea that the genetic code could have evolved to its present form has been repeatedly suggested. for instance, it has been proposed that early codes were simpler, in that they coded for only a few amino acids, and that the number of amino acids coded in the genetic code increased as the code evolved. several hypotheses have been put forward to explain the evolution of the genetic code to its present form, and to find out what the genetic code is optimized for. one possible scenario is that the genetic code evolved so as to minimize the consequence of errors during transcription and translation. to test this hypothesis, some researchers have tried to estimate the percentage of optimal achievement of the natural code by quantifying the cost of single - base changes. more recently, haig and hurst and freeland and hurst improved that approach by comparing the natural code with random codes. to this end, they defined a fitness function,, that measures the efficiency of the code in limiting the consequences of transcription and translation errors. this function supposedly evolved towards a minimum through evolution. to measure how close the natural code is to the actual minimum of, they generated random genetic codes, and computed the fraction of those that are better - that is, have a smaller value of - than the natural code. they found that only a very small fraction of the random codes are better than the natural code, and concluded that the natural code is therefore optimal in that it minimizes the effect of translation and transcription errors. haig and hurst tested several fitness functions,, based on different physicochemical parameters, and found that single - base changes in the natural code had the smallest average effect when using, as a cost measure, the change in polarity or hydropathy between the corresponding amino acids. these parameters, although not unique, are clearly biologically relevant, as they are related to hydrophobicity, a property known to be important in protein conformation (see, for example, for reviews). changing, through a transcription or a translation error, a nonpolar amino acid into a polar one at some strategic position in the sequence of a protein can have dramatic consequences on its conformation. using these parameters, and assuming that all point mutations occur with the same frequency, haig and hurst found that the fraction of random codes that beat the natural code is of the order of 10. it has been shown experimentally that individual translation errors occur more frequently at the first and third codon positions than at the second, and that there are transition / transversion biases. taking this into account, freeland and hurst proposed a modified fitness function, which models more accurately the probability of translation errors. they found that with this improved modeling, the fraction of random genetic codes that are better than the natural one decreases from 10 to 10. they retrieved from their calculations a well known property of the genetic code : single - base substitutions in the first and third codon position are strongly conservative with respect to changes in polarity. here, we highlight the importance of another parameter in the optimization of the genetic code, namely the frequency at which different amino acids occur in proteins. this frequency differs from protein to protein, and even from species to species, but there is a general pattern that prevails (table 1). in figure 1, we have plotted the number of codons coding for the same amino acid (synonyms) versus the amino - acid frequency. the correlation between these two quantities, first noted by king and jukes, led us to suspect that the amino - acid frequency is an important parameter in the optimization of the genetic code, which should also be taken into account in the fitness function. our calculations indeed confirm that the genetic code is even more optimal with respect to translation errors if the amino - acid frequencies of table 1 are properly incorporated in. in addition, we bring further improvements to by using quantities other than polarity to measure the roles of the different amino acids in protein conformation and stability. it should be stressed that the biological relevance of the parameters used in is crucial in the estimation of the relative robustness of the natural code. indeed, one can always construct an artificial fitness function such that the natural biological structure apparently lies at its minimum. clearly, the hydrophobicity parameters used by haig and hurst are biologically motivated, but we would like to do better by refining our cost measure. in particular, we have devised a mutation matrix describing the average cost of single amino - acid substitutions in protein stability, obtained by computer experiments. for instance, it takes into account that mutating cysteine into any other amino acid may be very costly as it may break a disulfide bond. such an effect would not be apparent if only a single property, say hydrophobicity, was taken into account. we show that, with a fitness function depending on this mutation matrix and the amino - acid frequencies, only about two out of 10 randomly generated codes are better than the natural code. this suggests that the genetic code is even better optimized to limit translation errors than was previously thought. it is built out of 64 codons, each consisting of three consecutive dna bases (a, g, c, t) or rna bases (a, g, c, u). these 64 codons are divided into 21 sets of synonyms, which each code for one of the 20 natural amino acids or correspond to a stop signal ; hence, to each codon, c, an amino acid (or stop signal) a is assigned through a function a(c). consider now an error during transcription from dna to rna or during translation from rna to protein, in which codon c is mistaken for codon c '. this error thus results in amino acid a(c) being replaced by amino acid a ' = a(c '). the associated cost is estimated by a function g(a, a '), which measures the difference between the amino acids a and a ' with respect to their physicochemical properties or their role in (de)stabilizing protein structures ; when a or a ' corresponds to a stop codon, we set g(a, a ') = 0. different cost functions g will be discussed in the next section. following freeland and hurst, the fitness of a code is measured by the average of the cost g over all codons c and all single - base errors c - > c ' where p(c ' | c) is the probability of misreading codon c as codon c '. if one focuses on transcription errors only, as do haig and hurst in, then all p(c'| c) values must be taken as equal. but here we consider translation errors, as do free - land and hurst in, and hence p(c ' | c) changes according to whether c and c ' differ in the first, second or third base, and lead to a transition or a transversion. a transition is the substitution of a purine (a, g) into another purine, or a pyrimidine (c, u / t) into another pyrimidine, whereas a transversion interchanges purines and pyrimidines. on the basis of experimental data indicating that transitions are more common than transversions, and that errors on the third base are more frequent than errors on the first base, which are themselves more frequent than errors on the second base, freeland and hurst have chosen the following values of p(c ' |c), which we also use here : p(c ' | c) = 1/n if c and c ' differ in the 3rd base only, p(c ' | c) = 1/n if c and c ' differ in the 1st base only and cause a transition, p(c ' | c) = 0.5/n if c and c ' differ in the 1st base only and cause a transversion, p(c ' | c) = 0.5/n if c and c ' differ in the 2nd base only and cause a transition, p(c ' | c) = 0.1/n if c and c ' differ in the 2nd base only and cause a transversion, p(c ' | c) = 0 if c and c ' differ by more than 1 base. where n is a normalization factor ensuring that c'p(c ' | c) = 1. obviously, these probabilities only roughly approximate the true transition / transversion and base position biases. however, the computed fitness of the genetic code has been shown to be relatively insensitive to their precise values. let us now return to the correlations between the number of codons coding for an amino acid and the frequency of this amino acid (see figure 1). king and jukes, who first noted this correlation, suggested that most of the amino acids in genomes have arisen by random mutations that do not affect the properties and function of the proteins. as a consequence, the number of synonymous codons determines the frequency of amino acids. an alternative interpretation, assuming a very different chain of causality, is that the amino - acid frequencies are fixed by their physicochemical properties. for instance, tryptophan would be a rare amino acid because its specific properties are seldom needed in proteins or because it is difficult to synthesize. the correlation between the amino - acid frequencies and number of synonymous codons (figure 1) would then be interpreted as being due to an adjustment of the natural genetic code to the frequency of the amino acids. independent of the assumed chain of causality, it is natural to expect that a codon error replacing a frequent amino - acid type with another leads to more absolute errors and thus has more consequences, at least on average, than an error affecting a rare amino acid. the frequencies with which the different amino acids occur in proteins, which are similar in different organisms (table 1), are only imperfectly taken into account in the fitness function given by equation (1), because of the imperfect correlation between amino - acid frequency and number of synonymous codons (figure 1). to account properly for the amino - acid frequencies, we propose a modified fitness function : where p(a) is the relative frequency of amino acid a, and n(c) is the number of codons in the block to which c belongs. in other words, n(c) is the number of synonyms coding for the amino acid a(c) that c codes for. note that equation (2) supposes that there is no codon bias, that is, the different synonyms of a given amino acid appear with the same frequency. to measure the effect of the amino - acid frequency on the value of the fitness function, we define, for the sake of comparison, another fitness function where all the amino acids are supposed equally frequent, that is, p(a) = 1/20 : the function g(a, a ') in equations (1) and (2) measures the cost - as far as protein stability and structure is concerned - of substituting amino acid a by a '. hence, a natural choice for g consists of taking the squared difference in hydrophobicity h of the amino acids a and a ' : g (a, a ') = (h(a) - h(a ')) (4) there exist various hydrophobicity scales for amino acids., which is the one used by haig and hurst and freeland and hurst. in the second scale, h(a) is the average solvent accessibility of amino acid a derived from a set of 141 well resolved and refined protein structures with low sequence identity (see methods) ; solvent accessibilities are computed using survol. although hydrophobic forces dominate in proteins, other types of interactions also contribute to protein stability (see for reviews). we therefore also attempted to devise a better cost function g(a, a '), measuring more accurately the difference between amino acids a and a '. this new function is inspired by recent computations of the change in free energy of a protein when a single amino acid is mutated. it is obtained by mutating in silico, in all proteins of the aforementioned set of 141 protein structures and at all positions, the wild - type amino acids into the 19 other possible ones, and evaluating the resulting changes in folding free energy with mean force potentials derived from the same structure dataset. the matrix elements m(a, a ') are obtained as the average of all the computed folding free - energy changes, which correspond to a substitution a a '. details on the procedure and the value of the matrix elements m(a, a ') are given in the methods section. this matrix is taken as a cost function : g (a, a ') = m(a, a ') (5) for the purpose of comparing g with a reference matrix that exclusively reflects the structure of the genetic code, we define the cost function : g (a, a ') = 3 - (a, a ') (6) where (a, a ') is zero when a and a ' coincide, and otherwise equal to the minimum number of bases that must be changed to transform a codon coding for a into a codon coding for a '. as a last cost function, used only for comparison with earlier work, we consider the point accepted mutations 74 - 100 (pam74 - 100) substitution matrix, one of the most commonly used matrices in the context of protein - sequence alignment : g (a, a ') = pam74 - 100 (a, a ') (7) this matrix is derived from the pattern of amino - acid substitution frequencies observed within naturally occurring pairs of highly diverged homologous protein sequences. however, the use of this matrix for measuring the genetic code 's fitness has been criticized, as matrices derived from substitution patterns observed in homologous proteins reflect not only the similarity between amino acids with respect to their physicochemical and energetic properties, but also the facility with which one amino acid is mutated into another and thus their proximity in the genetic code. however, as the pam74 - 100 matrix is derived from highly diverged protein sequences, this effect can be expected to be relatively limited. this is indeed the case, as the linear correlation coefficient between the nondiagonal entries of g and g is only 0.43. nevertheless, the correlation coefficient between g and g is still much lower, namely 0.19, so that g may in no way be suspected to include information on proximity in the genetic code. finally, note that the correlation coefficient between g and g is equal to 0.60 ; these matrices thus share common features but contain also different information. this is not surprising considering that their derivations use very different starting points (protein three - dimensional structures in one case, sequence similarity in the other). to evaluate the robustness of the natural genetic code with respect to translation errors, we computed the fitness functions, and using equations (1) to (3) for the natural genetic code, and compared it to the corresponding fitnesses of random codes. the random codes are obtained by maintaining the codon block structure of the natural genetic code, where each block corresponds to synonyms coding for the same amino acid (or stop signal). when generating a random code, the stop signal is kept assigned to the same block as in the natural genetic code, whereas the different amino acids are randomly interchanged among the 20 remaining blocks. thus, each random code is simply specified by a different function a(c) in equations (1) to (3). this is the procedure previously used by haig and hurst and freeland and hurst. thus, in a first stage, we computed the fitness functions and for the natural genetic code and for 10 randomly generated codes, using the three cost functions g, g and g. we then calculated the fraction f of random codes whose value of is lower than that of the natural code. this fraction is supposedly a good estimate of the relative merit of the natural genetic code comparative to other codes. it appears that this fraction f is always smaller for than for. this is especially true for the cost function g where f is 300 times smaller. this result indicates that the natural code appears to be better optimized with respect to translation errors if the amino - acid frequencies are taken into account. to investigate this further, we have analyzed which of the cost functions g, g or g genetic code appears to be best optimized for. we compared the fraction f of better codes for each of the cost functions using the fitness function. for the hydrophobicity functions g and g, the result is roughly the same : f is about 0.5 - 1.0 in 10. the relative statistical error on this value is of the order of n, where n is the number of random codes better than the natural one that were found in our sample of 10 random codes ; thus, n is about 650 - 1,200, and the error is insignificant. for the mutational cost function g this result shows that the natural genetic code appears even more optimal if the cost function g is used than if hydrophobicity - based cost functions are considered. as g has been computed from protein stability changes effected by point mutations, we may conclude that the genetic code is optimized in such a way as to limit the effect of translation errors on the three - dimensional structure and stability of the coded proteins. note that the improvement brought by the choice of g results from the fact that it probably better accounts for the cost of a mutation than a mere difference of hydrophobicity ; for example, glycine, proline and cysteine have close neighbors in hydrophobicity, whereas the cost of their mutation as accounted for by g is high. this is due to their special role in determining protein structure : glycine and proline can adopt backbone torsion angles essentially inaccessible to other amino acids, and cysteine can form disulfide bonds. to check the significance of this result, we have computed the fraction f of random codes that beat the natural one for random choices of the amino - acid frequencies, distinct from the natural frequencies p(a). we have generated 10 sets of random p(a) values, and, for each of them, estimated the fraction f (out of a sample of 10 random codes). the percentage of random amino - acid frequency sets that result in a lower fraction f than the natural frequencies is shown in table 3. we find that a random assignment of the amino - acid frequencies does not decrease / in most (at least 97%) of the cases, and this tendency persists for all cost functions g. thus, the probability that the decrease of f, observed in table 2, when passing from to, was due to chance is quite limited. we may therefore conclude that the genetic code is optimized so as to take into account the natural amino - acid frequencies. we also investigated whether the result that the natural code is better optimized if amino - acid frequencies are taken into account does not depend crucially on the amino - acid frequencies used. for this purpose, we calculated the fraction f of random codes with lower value than the genetic code for the four sets of amino - acid frequencies listed in table 1, which are computed from genomes of eukaryotes, archaea, bacteria and from all these genomes together. the results turn out to be essentially insensitive to the chosen frequency set : the fractions f differ at most by a factor of two, which leaves all conclusions unchanged. we have also included in table 2 the results based on the fitness function. it can be argued that this function partly takes, but imperfectly, the amino - acid frequencies into account. indeed, for this fitness function each codon is assigned the same weight, which corresponds to each amino acid being assigned a frequency proportional to the number of synonyms n(a) coding for it. in the case of the natural genetic code, this frequency corresponds approximately to the amino - acid frequency as there is a correlation between n(a) and p(a), as shown in figure 1. but for random codes, where the amino acids are randomly interchanged between the codon blocks, this correspondence breaks down. thus, the way in which takes amino - acid frequencies into account depends on the code considered. this explains why the fraction f of random codes better than the natural one is roughly of the same order using and. note that f is always larger for than for, indicating again the importance of the amino acid frequencies in the optimality of the genetic code. for sake of comparison, we have added in table 2 the values of the fraction f of random codes with a lower value than the natural one, using the cost functions g and g, which include information about the structure of the genetic code. with g, the fraction f is the same as with g, whereas with g, we did not find any random code better than the natural one among the 10 random codes tested. to estimate f without having to generate a larger ensemble we computed, from the values of for the 10 random codes, the probability function () to have a given value of. we fitted log(()) to a polynomial of fourth degree, and extrapolated this curve down to the value of for the natural code. this provides an estimate of the fraction f of random codes that have a lower value. we found with this procedure that / is of the order of 10 with g, and thus about 10 times smaller than with g andg. it is not surprising that the fraction f of random codes that does better than the natural code is extremely small for g, as this matrix exclusively reflects the proximity of amino acids in the genetic code and renders the issue of the code 's fitness tautologous. it can indeed be argued that g contains information on the proximity of amino acids in the genetic code, superimposed on the desired measure of their similarity in preserving protein structure, because it is computed from amino - acid substitutions in families of evolutionarily related proteins, which are more frequent between amino acids that are closer in the genetic code. the fact that g and g yield similar f values (see table 2) can be taken to indicate that this is not the case, and thus that both these cost functions can reliably be used to estimate the code 's fitness against translation errors. it could, however, also be argued that g describes protein structure less well than g and includes somewhat more information about the genetic code (as monitored by correlation coefficients of 0.43 and 0.19 of gand g with respect to g). these two effects tend to compensate each other, and could be expected to yield similar f values for g and g. it therefore seems safer to use g as cost function, because, owing to its very definition, it seems to capture important structural information and to be independent of the code 's structure. we also investigated how optimal the genetic code is with respect to amino - acid interchanges that do not affect codon degeneracy. we exhaustively generated all alternative codes that preserve the amino - acid degeneracy and computed the fraction f of these codes that do better than the natural code with respect to mistranslation. we found that f is of the order of 10 for the three fitness functions, and (table 4). it is thus similar to the f value computed on the unrestricted set of alternative codes for and, and much larger for. this result simply reflects the correlation between the codon degeneracy and the amino - acid frequency (figure 1). indeed, this correlation implies that a much larger proportion of the better codes maintain the degeneracy, if the frequency of the amino acids is taken into account in the fitness function, as in. in contrast, in and the amino - acid frequency is not considered and f is of the same order with the restricted and unrestricted sets. it has been proposed that the genetic code has evolved from a simpler ancestral code, encoding only a few amino acids present at early times, and that new amino acids appearing as biosynthetic derivatives of the original ones were incorporated by subdivision and reassignment of their synonymous codons. this so - called coevolution hypothesis is supported by the observation that biosynthetically related amino acids are close within the genetic code. to investigate the optimality of the genetic code in the coevolution framework, we computed the fraction f of alternative codes that perform better than the natural code against translation errors and that differ from the natural code by shuffling amino acids belonging to the same biosynthetic pathway. we found that f is equal to 2.9 10, whereas it is equal to 2 10 for the unrestricted all shufflings (table 4). this means that the fraction f of better codes is somewhat larger in the biosynthesis - restricted set than in the complete set, and thus that the optimality rate is slightly lower. this result can also be viewed differently. when considering the total number of codes in the two sets (which are of the order of 10 and 10), it means that there are only six codes that beat the natural code in the restricted set, whereas there are 10 such codes in the unrestricted set. this is particularly striking given that our definitions of cost functions and sets of biosynthetically related amino acids only constitute approximations. we can thus conclude that the genetic code is quite robust against mistranslation in the space of all alternative codes, and is close to being fully optimal if historical biosynthetic constraints are taken into account. a complementary measure of the optimality of the genetic code is its percentage of optimization, defined as 100%(code - mean)/(best - mean), where code is the fitness of the genetic code, best fitness of the best of all possible codes and mean the average fitness over all codes. this measure indicates how close the fitness value of the genetic code is to the fitness value of the optimal code. note however that this optimality measure has no absolute meaning and may not be compared among fitness functions defined on the basis of different cost functions g ; to illustrate this, consider the following example : if g is defined by |h(a)-h(a')| instead of (h(a)-h(a ')) (see equation (4)), the fraction f of better codes remains unchanged but the percentage of optimality does change. it is, however, meaningful to compare the percentage of optimization of the genetic code in the unrestricted and biosynthesis restricted sets with a same g function. for, we find that this percentage is equal to 97% and 98% in the two sets, respectively. this indicates that the fitness value of the genetic code is not very far from that of the best possible code, whether focusing on the subset of alternative codes preserving biosynthetic proximities, or considering all possible codes. it is built out of 64 codons, each consisting of three consecutive dna bases (a, g, c, t) or rna bases (a, g, c, u). these 64 codons are divided into 21 sets of synonyms, which each code for one of the 20 natural amino acids or correspond to a stop signal ; hence, to each codon, c, an amino acid (or stop signal) a is assigned through a function a(c). consider now an error during transcription from dna to rna or during translation from rna to protein, in which codon c is mistaken for codon c '. this error thus results in amino acid a(c) being replaced by amino acid a ' = a(c '). the associated cost is estimated by a function g(a, a '), which measures the difference between the amino acids a and a ' with respect to their physicochemical properties or their role in (de)stabilizing protein structures ; when a or a ' corresponds to a stop codon, we set g(a, a ') = 0. different cost functions g will be discussed in the next section. following freeland and hurst, the fitness of a code is measured by the average of the cost g over all codons c and all single - base errors c - > c ' where p(c ' | c) is the probability of misreading codon c as codon c '. if one focuses on transcription errors only, as do haig and hurst in, then all p(c'| c) values must be taken as equal. but here we consider translation errors, as do free - land and hurst in, and hence p(c ' | c) changes according to whether c and c ' differ in the first, second or third base, and lead to a transition or a transversion. a transition is the substitution of a purine (a, g) into another purine, or a pyrimidine (c, u / t) into another pyrimidine, whereas a transversion interchanges purines and pyrimidines. on the basis of experimental data indicating that transitions are more common than transversions, and that errors on the third base are more frequent than errors on the first base, which are themselves more frequent than errors on the second base, freeland and hurst have chosen the following values of p(c ' |c), which we also use here : p(c ' | c) = 1/n if c and c ' differ in the 3rd base only, p(c ' | c) = 1/n if c and c ' differ in the 1st base only and cause a transition, p(c ' | c) = 0.5/n if c and c ' differ in the 1st base only and cause a transversion, p(c ' | c) = 0.5/n if c and c ' differ in the 2nd base only and cause a transition, p(c ' | c) = 0.1/n if c and c ' differ in the 2nd base only and cause a transversion, p(c ' | c) = 0 if c and c ' differ by more than 1 base. where n is a normalization factor ensuring that c'p(c ' | c) = 1. obviously, these probabilities only roughly approximate the true transition / transversion and base position biases. however, the computed fitness of the genetic code has been shown to be relatively insensitive to their precise values. let us now return to the correlations between the number of codons coding for an amino acid and the frequency of this amino acid (see figure 1). king and jukes, who first noted this correlation, suggested that most of the amino acids in genomes have arisen by random mutations that do not affect the properties and function of the proteins. as a consequence, an alternative interpretation, assuming a very different chain of causality, is that the amino - acid frequencies are fixed by their physicochemical properties. for instance, tryptophan would be a rare amino acid because its specific properties are seldom needed in proteins or because it is difficult to synthesize. the correlation between the amino - acid frequencies and number of synonymous codons (figure 1) would then be interpreted as being due to an adjustment of the natural genetic code to the frequency of the amino acids. independent of the assumed chain of causality, it is natural to expect that a codon error replacing a frequent amino - acid type with another leads to more absolute errors and thus has more consequences, at least on average, than an error affecting a rare amino acid. the frequencies with which the different amino acids occur in proteins, which are similar in different organisms (table 1), are only imperfectly taken into account in the fitness function given by equation (1), because of the imperfect correlation between amino - acid frequency and number of synonymous codons (figure 1). to account properly for the amino - acid frequencies, we propose a modified fitness function : where p(a) is the relative frequency of amino acid a, and n(c) is the number of codons in the block to which c belongs. in other words, n(c) is the number of synonyms coding for the amino acid a(c) that c codes for. note that equation (2) supposes that there is no codon bias, that is, the different synonyms of a given amino acid appear with the same frequency. to measure the effect of the amino - acid frequency on the value of the fitness function, we define, for the sake of comparison, another fitness function where all the amino acids are supposed equally frequent, that is, p(a) = 1/20 : the function g(a, a ') in equations (1) and (2) measures the cost - as far as protein stability and structure is concerned - of substituting amino acid a by a '. hence, a natural choice for g consists of taking the squared difference in hydrophobicity h of the amino acids a and a ' : g (a, a ') = (h(a) - h(a ')) (4) there exist various hydrophobicity scales for amino acids., which is the one used by haig and hurst and freeland and hurst. in the second scale, h(a) is the average solvent accessibility of amino acid a derived from a set of 141 well resolved and refined protein structures with low sequence identity (see methods) ; solvent accessibilities are computed using survol. although hydrophobic forces dominate in proteins, other types of interactions also contribute to protein stability (see for reviews). we therefore also attempted to devise a better cost function g(a, a '), measuring more accurately the difference between amino acids a and a '. this new function is inspired by recent computations of the change in free energy of a protein when a single amino acid is mutated. it is obtained by mutating in silico, in all proteins of the aforementioned set of 141 protein structures and at all positions, the wild - type amino acids into the 19 other possible ones, and evaluating the resulting changes in folding free energy with mean force potentials derived from the same structure dataset. the matrix elements m(a, a ') are obtained as the average of all the computed folding free - energy changes, which correspond to a substitution a a '. details on the procedure and the value of the matrix elements m(a, a ') are given in the methods section. this matrix is taken as a cost function : g (a, a ') = m(a, a ') (5) for the purpose of comparing g with a reference matrix that exclusively reflects the structure of the genetic code, we define the cost function : g (a, a ') = 3 - (a, a ') (6) where (a, a ') is zero when a and a ' coincide, and otherwise equal to the minimum number of bases that must be changed to transform a codon coding for a into a codon coding for a '. as a last cost function, used only for comparison with earlier work, we consider the point accepted mutations 74 - 100 (pam74 - 100) substitution matrix, one of the most commonly used matrices in the context of protein - sequence alignment : g (a, a ') = pam74 - 100 (a, a ') (7) this matrix is derived from the pattern of amino - acid substitution frequencies observed within naturally occurring pairs of highly diverged homologous protein sequences. however, the use of this matrix for measuring the genetic code 's fitness has been criticized, as matrices derived from substitution patterns observed in homologous proteins reflect not only the similarity between amino acids with respect to their physicochemical and energetic properties, but also the facility with which one amino acid is mutated into another and thus their proximity in the genetic code. however, as the pam74 - 100 matrix is derived from highly diverged protein sequences, this effect can be expected to be relatively limited. this is indeed the case, as the linear correlation coefficient between the nondiagonal entries of g and g is only 0.43. nevertheless, the correlation coefficient between g and g is still much lower, namely 0.19, so that g may in no way be suspected to include information on proximity in the genetic code. finally, note that the correlation coefficient between g and g is equal to 0.60 ; these matrices thus share common features but contain also different information. this is not surprising considering that their derivations use very different starting points (protein three - dimensional structures in one case, sequence similarity in the other). to evaluate the robustness of the natural genetic code with respect to translation errors, we computed the fitness functions, and using equations (1) to (3) for the natural genetic code, and compared it to the corresponding fitnesses of random codes. the random codes are obtained by maintaining the codon block structure of the natural genetic code, where each block corresponds to synonyms coding for the same amino acid (or stop signal). when generating a random code, the stop signal is kept assigned to the same block as in the natural genetic code, whereas the different amino acids are randomly interchanged among the 20 remaining blocks. thus, each random code is simply specified by a different function a(c) in equations (1) to (3). this is the procedure previously used by haig and hurst and freeland and hurst. thus, in a first stage, we computed the fitness functions and for the natural genetic code and for 10 randomly generated codes, using the three cost functions g, g and g. we then calculated the fraction f of random codes whose value of is lower than that of the natural code. this fraction is supposedly a good estimate of the relative merit of the natural genetic code comparative to other codes. it appears that this fraction f is always smaller for than for. this is especially true for the cost function g where f is 300 times smaller. this result indicates that the natural code appears to be better optimized with respect to translation errors if the amino - acid frequencies are taken into account. to investigate this further, we have analyzed which of the cost functions g, g or g genetic code appears to be best optimized for. we compared the fraction f of better codes for each of the cost functions using the fitness function. for the hydrophobicity functions g and g, the result is roughly the same : f is about 0.5 - 1.0 in 10. the relative statistical error on this value is of the order of n, where n is the number of random codes better than the natural one that were found in our sample of 10 random codes ; thus, n is about 650 - 1,200, and the error is insignificant. for the mutational cost function g, f is several orders of magnitude lower, namely 2 in 10. this result shows that the natural genetic code appears even more optimal if the cost function g is used than if hydrophobicity - based cost functions are considered. as g has been computed from protein stability changes effected by point mutations, we may conclude that the genetic code is optimized in such a way as to limit the effect of translation errors on the three - dimensional structure and stability of the coded proteins. note that the improvement brought by the choice of g results from the fact that it probably better accounts for the cost of a mutation than a mere difference of hydrophobicity ; for example, glycine, proline and cysteine have close neighbors in hydrophobicity, whereas the cost of their mutation as accounted for by g is high. this is due to their special role in determining protein structure : glycine and proline can adopt backbone torsion angles essentially inaccessible to other amino acids, and cysteine can form disulfide bonds. to check the significance of this result, we have computed the fraction f of random codes that beat the natural one for random choices of the amino - acid frequencies, distinct from the natural frequencies p(a). we have generated 10 sets of random p(a) values, and, for each of them, estimated the fraction f (out of a sample of 10 random codes). the percentage of random amino - acid frequency sets that result in a lower fraction f than the natural frequencies is shown in table 3. we find that a random assignment of the amino - acid frequencies does not decrease / in most (at least 97%) of the cases, and this tendency persists for all cost functions g. thus, the probability that the decrease of f, observed in table 2, when passing from to, was due to chance is quite limited. we may therefore conclude that the genetic code is optimized so as to take into account the natural amino - acid frequencies. we also investigated whether the result that the natural code is better optimized if amino - acid frequencies are taken into account does not depend crucially on the amino - acid frequencies used. for this purpose, we calculated the fraction f of random codes with lower value than the genetic code for the four sets of amino - acid frequencies listed in table 1, which are computed from genomes of eukaryotes, archaea, bacteria and from all these genomes together. the results turn out to be essentially insensitive to the chosen frequency set : the fractions f differ at most by a factor of two, which leaves all conclusions unchanged. we have also included in table 2 the results based on the fitness function. it can be argued that this function partly takes, but imperfectly, the amino - acid frequencies into account. indeed, for this fitness function each codon is assigned the same weight, which corresponds to each amino acid being assigned a frequency proportional to the number of synonyms n(a) coding for it. in the case of the natural genetic code, this frequency corresponds approximately to the amino - acid frequency as there is a correlation between n(a) and p(a), as shown in figure 1. but for random codes, where the amino acids are randomly interchanged between the codon blocks, this correspondence breaks down. thus, the way in which takes amino - acid frequencies into account depends on the code considered. this explains why the fraction f of random codes better than the natural one is roughly of the same order using and. note that f is always larger for than for, indicating again the importance of the amino acid frequencies in the optimality of the genetic code. for sake of comparison, we have added in table 2 the values of the fraction f of random codes with a lower value than the natural one, using the cost functions g and g, which include information about the structure of the genetic code. with g, the fraction f is the same as with g, whereas with g, we did not find any random code better than the natural one among the 10 random codes tested. to estimate f without having to generate a larger ensemble we computed, from the values of for the 10 random codes, the probability function () to have a given value of. we fitted log(()) to a polynomial of fourth degree, and extrapolated this curve down to the value of for the natural code. this provides an estimate of the fraction f of random codes that have a lower value. we found with this procedure that / is of the order of 10 with g, and thus about 10 times smaller than with g andg. it is not surprising that the fraction f of random codes that does better than the natural code is extremely small for g, as this matrix exclusively reflects the proximity of amino acids in the genetic code and renders the issue of the code 's fitness tautologous. it can indeed be argued that g contains information on the proximity of amino acids in the genetic code, superimposed on the desired measure of their similarity in preserving protein structure, because it is computed from amino - acid substitutions in families of evolutionarily related proteins, which are more frequent between amino acids that are closer in the genetic code. the fact that g and g yield similar f values (see table 2) can be taken to indicate that this is not the case, and thus that both these cost functions can reliably be used to estimate the code 's fitness against translation errors. it could, however, also be argued that g describes protein structure less well than g and includes somewhat more information about the genetic code (as monitored by correlation coefficients of 0.43 and 0.19 of gand g with respect to g). these two effects tend to compensate each other, and could be expected to yield similar f values for g and g. it therefore seems safer to use g as cost function, because, owing to its very definition, it seems to capture important structural information and to be independent of the code 's structure. we also investigated how optimal the genetic code is with respect to amino - acid interchanges that do not affect codon degeneracy. we exhaustively generated all alternative codes that preserve the amino - acid degeneracy and computed the fraction f of these codes that do better than the natural code with respect to mistranslation. we found that f is of the order of 10 for the three fitness functions, and (table 4). it is thus similar to the f value computed on the unrestricted set of alternative codes for and, and much larger for. this result simply reflects the correlation between the codon degeneracy and the amino - acid frequency (figure 1). indeed, this correlation implies that a much larger proportion of the better codes maintain the degeneracy, if the frequency of the amino acids is taken into account in the fitness function, as in. in contrast, in and the amino - acid frequency is not considered and f is of the same order with the restricted and unrestricted sets. it has been proposed that the genetic code has evolved from a simpler ancestral code, encoding only a few amino acids present at early times, and that new amino acids appearing as biosynthetic derivatives of the original ones were incorporated by subdivision and reassignment of their synonymous codons. this so - called coevolution hypothesis is supported by the observation that biosynthetically related amino acids are close within the genetic code. to investigate the optimality of the genetic code in the coevolution framework, we computed the fraction f of alternative codes that perform better than the natural code against translation errors and that differ from the natural code by shuffling amino acids belonging to the same biosynthetic pathway. we found that f is equal to 2.9 10, whereas it is equal to 2 10 for the unrestricted all shufflings (table 4). this means that the fraction f of better codes is somewhat larger in the biosynthesis - restricted set than in the complete set, and thus that the optimality rate is slightly lower. this result can also be viewed differently. when considering the total number of codes in the two sets (which are of the order of 10 and 10), it means that there are only six codes that beat the natural code in the restricted set, whereas there are 10 such codes in the unrestricted set. this is particularly striking given that our definitions of cost functions and sets of biosynthetically related amino acids only constitute approximations. we can thus conclude that the genetic code is quite robust against mistranslation in the space of all alternative codes, and is close to being fully optimal if historical biosynthetic constraints are taken into account. a complementary measure of the optimality of the genetic code is its percentage of optimization, defined as 100%(code - mean)/(best - mean), where code is the fitness of the genetic code, best fitness of the best of all possible codes and mean the average fitness over all codes. this measure indicates how close the fitness value of the genetic code is to the fitness value of the optimal code. note however that this optimality measure has no absolute meaning and may not be compared among fitness functions defined on the basis of different cost functions g ; to illustrate this, consider the following example : if g is defined by |h(a)-h(a')| instead of (h(a)-h(a ')) (see equation (4)), the fraction f of better codes remains unchanged but the percentage of optimality does change. it is, however, meaningful to compare the percentage of optimization of the genetic code in the unrestricted and biosynthesis restricted sets with a same g function. for, we find that this percentage is equal to 97% and 98% in the two sets, respectively. this indicates that the fitness value of the genetic code is not very far from that of the best possible code, whether focusing on the subset of alternative codes preserving biosynthetic proximities, or considering all possible codes. our results confirm and specify those of freeland and hurst : the genetic code seems structured so as to minimize the consequences of translation errors on the three - dimensional structure and stability of the coded proteins. we have shown that, using the cost function g which best reflects the roles of various amino acids in protein structures, and taking amino - acid frequencies into account, about 2 out of 10 random codes do better than the natural code. 2 10 possible codes preserving the codon block structure, which means that we can expect about 10 better codes overall. moreover, if the codon block structure is not preserved, the number of possible codes is larger by orders of magnitude, and therefore the number of codes better than the natural one will certainly be much larger. however, if we preserved the block structure and in addition restricted the space of alternative codes by interchanging only amino acids belonging to the same biosynthetic pathway, we found that there are only six codes performing better than the natural code. the genetic code thus seems quite robust with respect to mistranslation compared to alternative codes, and almost fully optimal if the constraint is imposed that biosynthetically related amino acids are encoded in codons that are close within the genetic code. this does not prove, but is in agreement with, the coevolution hypothesis, which assumes that the genetic code has evolved from an simpler ancestral code of only a few amino acids, by subdivision and reassignment of synonymous codons, and that the present genetic code has kept imprints of this evolution. so we can assert from our analysis that the genetic code has been optimized through evolution up to a certain point, even though it is probably not fully optimal, at least with respect to the parameters considered here, except perhaps if historical, biosynthesis - related, constraints are imposed. our analysis does not, however, give us much information about the mechanism of this evolution as there is unfortunately no trace left of evolution of the code or amino - acid frequencies in early times. for instance, we do not know whether the relative frequency of occurrence of amino acids in proteins adapted so as to increase the optimality of the genetic code with respect to translation errors, or, on the contrary, whether the genetic code evolved to take into account pre - existing amino - acid frequencies. we can, however, argue that if the amino - acid frequencies adapted to the genetic code, as assumed by king and jukes, a discrepancy in amino - acid composition between frequently and infrequently expressed genes might be detectable today (unless the period during which evolution took place was long enough for this discrepancy to vanish). if, alternatively, the genetic code adapted to the amino - acid frequencies, and thus if these frequencies acted as an evolutionary pressure, one can imagine two scenarios. either the code optimized to take into account the prebiotic frequencies of the amino acids that became involved in it, or it optimized for the amino - acid frequencies of already formed proteins (or of a subset of them) that were important for life and maybe linked to the code 's control. perhaps can we assume, more realistically, that the genetic code and amino - acid frequencies evolved together during some evolutionary period, thereby approaching an optimal code / amino - acid relation. more generally, the parameters that acted as evolutionary pressure on the genetic code probably included all the mechanisms that encode and maintain the genetic information, and were not just restricted to the frequency of amino acids and the preservation of protein structure. for example, the genetic code is obviously related to the translation apparatus, composed of the ribosomes and trnas, whose action we described schematically here by the probabilities p(c ' | c) to misread codon c as c '. all these mechanisms probably evolved together with the genetic code during the early stages of life. although the code still evolves today, as reflected by its departure from universality in some organisms, its evolution is very limited and concerns only the reassignment of a few codons. as the same change sometimes recurs in different lineages, the code seems to have reached the bottom of a funnel in the evolutionary landscape that contains several roughly equivalent optimal codes. but apart from such restricted modifications, the code no longer evolves significantly, and has not undergone important modifications since an early stage in the development of life. this stability probably arose because even small modifications in the code would have entailed loss of functionality of genes that were already being expressed. moreover, the advent of more sophisticated transcription / translation control mechanisms, which involve huge protein systems, could have decreased the evolutionary pressure on the genetic code. even though our present information on the genetic code is insufficient to discriminate between evolutionary scenarios, our analysis enables us to put some constraints on the situation at the time when evolution of the code was pretty much frozen. in particular, it appears that the frequencies of the amino acids that were used in proteins synthesized at that time were similar to the present frequencies. we do not know what determines the present amino - acid frequencies, but presumably they result, at least in part, from the amino acids ' physicochemical properties. for instance, the ratio of hydrophobic to hydrophilic amino acids is intrinsically related to the globular structure of proteins and certainly contributes to the pressure on amino - acid frequencies. thus, we can assert that some of the pressures that determine the present amino - acid frequencies were already present at the time the code took on its definitive form. in addition, the increased optimality of the genetic code with respect to g implies that the three - dimensional structure of proteins probably played an equally important role in fixing the structure of the code. as the three - dimensional structure of a protein essentially determines its function, this suggests, more generally, that the protein function acted as a main evolutionary pressure on the code structure. consequently, at the time when the genetic code took its present form, primitive life was presumably already synthesizing complex proteins. this provides a tentative picture of primitive life at that time : the translation apparatus was similar to the present one, and organisms were made of complex proteins whose amino - acid frequencies were comparable to the present ones. the derivation is based on a dataset of 141 high - resolution protein structures determined by x - ray crystallography and listed in. to avoid bias, these 141 proteins are chosen to present either less than 20% sequence identity or less than 25% sequence identity and no structural similarity. the protein main chains are described by their heavy atoms, and each side chain is represented by a pseudo - atom c. for a given amino - acid type, the c has a well defined position relative to the main chain, corresponding to the geometric average of all heavy side - chain atoms of this type in the dataset ; for glycine, the c pseudo - atom is positioned on the c. side - chain degrees of freedom are thus neglected. each residue, at each position of each of the 141 proteins, is mutated in turn into the 19 non - wild - type amino acids. the mutations are made by keeping the main - chain structure unchanged, and substituting the c of the given amino acid by that of the mutant amino acid. for each of these mutations, the change in folding free energy is evaluated using the database - derived potentials and the procedure detailed below. for each substitution of amino acid a into a ', the average of all computed changes in folding free energy, at all protein positions, is computed and defined as minus the matrix element m(a, a '). we then symmetrize m by setting m(a, a ') = [m(a, a')+m(a',a)]/2 and only consider the lower half of m(a < a '). this procedure does not define the diagonal elements of m. on the basis of the principle that the structural role of a given amino acid is fulfilled by no other amino acid better than by itself, we assign to all the diagonal element the same maximum value : m(a, a) = max [m(a',a ") ] + 1. then, to simplify m without modifying its structure, we center it around its mean value : finally, we multiply all matrix elements m(a, a ') by 2 and replace them by the closest integer. the potentials we use to evaluate the protein conformations are derived from observed frequencies of sequence and structure patterns in the aforementioned dataset of 141 proteins. we consider two types of potentials, called torsion and c -c potentials. they take into account the propensities of single residues and residue pairs to be associated with a (,,) backbone torsion angle domain. we use two variants of the torsion potential, called torsionshort - range and torsionmiddle - range. both are computed from propensities of a (,,) domain ti, at position i along the sequence, or pairs of domains (ti, tj), at positions i and j, to be associated with an amino acid ak at position k. but we have k - 1 i, j k + 1 for the torsionshort - range potential and k - 8 i, j k + 8 for the torsionmiddle - range potential. the folding free energy g(s, c) of a sequence s in the conformation c computed from these propensities is expressed as : where p are normalized frequencies, n is the number of residues in the sequence s, k is the boltzmann constant and t is a conformational temperature taken to be room temperature. the normalization factor k ensures that the contribution to g(s, c) of each residue in the window [k - 1, k + 1 ] for the torsionshort - range potential or [k - 8, k + 8 ] for the torsionmiddle - range potential is counted once. they are based on propensities of pairs of amino acids (ai, aj) at position i and j along the sequence to be separated by a spatial distance dij, calculated between the pseudo - atoms c. we consider two variants of c - c potentials. the first one, called c - clong_range potential, describes purely nonlocal interactions along the sequence, and only takes into account residues separated by at least 15 residues along the sequence, that is j i + 16. the second one, simply called c - c potential, though dominated by nonlocal interactions, possesses a local interaction component. the nonlocal component is obtained by considering together the frequencies of all residues separated by seven sequence positions and more, thus with j i + 8. the local component is obtained by computing separately the frequencies of residues separated by one to six positions along the sequence, for i + 1 < j < i + 8. the folding free energies are expressed as : with j i + 16 and the normalized frequencies p independent of j - i for the c - clong_range potential, and i + 1 < j and the normalized frequencies p independent of j - i for j i + 8 for the c - c potential. the discretization of the spatial distances dij is performed by dividing the distances between 3 and 8 into 25 bins of 0.2 width and merging the distances greater than 8. to increase the reliability of the statistics, these bins are smoothed by combining the counts in each bin with those of the 10 flanking bins at each side. the predominance of the central bin is preserved by weighting the counts from each flanking bin by a factor 1/n, where n is the position relative to the central bin ; n is equal to 1 for the two closest bins and to 10 for the two most distant bins. the so - defined folding free energies are reliable for common amino acids and structure motifs, but not for less common ones. to correct for the sparse data, we substitute the sequence - specific frequencies p(c, s), where s denotes a sequence pattern and c a structure motif, which appear in expressions (9) and (10) immediately above defining the torsion and c - c folding free energies, by a linear combination of these frequencies and the product of the separate frequencies of s and c, denoted p(s) and p(c) respectively : where m is the number of occurrences of the sequence pattern s in the dataset, and a parameter. this expression ensures that the sequence - specific contribution dominates for rare sequence patterns and tends to zero for frequent ones. this behavior is modulated by the parameter, which we consider here equal to 50. to estimate the stability changes caused by a single - site mutation, we compute the folding free energy changes as : where cm and cw are the mutant and wild - type conformations and sm and sw the mutant and wild - type sequences, respectively. with this convention, g is positive when the mutation is destabilizing, and negative when it is stabilizing. the conformations cm and cw of the mutant and wild - type protein are assumed to be nearly identical. more precisely, the backbone conformations are taken as identical and only the position of the c pseudo - atom, which is amino - acid dependent, is different in the mutant and wild - type structures. the folding free energies of the wild - type and mutant proteins are computed with linear combinations of the torsion and c - c potentials described in the previous section. previous analyses have shown that the combination that gives the best evaluation of the g values depends on the solvent accessibility, a of the mutated residue ; a is defined as the solvent - accessible surface in the protein structure, computed by survol, multiplied by 100 and divided by its solvent - accessible surface in an extended tripeptide gly - x - gly. when the mutated residue is at the surface, with a solvent accessibility a equal to or larger than 50%, the optimal folding free - energy change has been shown to be equal to : when the mutated residue is half buried, half exposed to the solvent, with a solvent accessibility between 20 and 40%, the optimal folding free energy is : finally, when the mutated residue is totally buried in the protein core, with a solvent accessibility less than or equal to 20%, the optimal folding free energy is : when the mutated residue has a solvent accessibility comprised between 40 and 50%, we do not evaluate its folding free energy. we have indeed observed that in this case, the solvent accessibility of the mutated residue is not a good measure to guide the choice of the optimal potential. the derivation is based on a dataset of 141 high - resolution protein structures determined by x - ray crystallography and listed in. to avoid bias, these 141 proteins are chosen to present either less than 20% sequence identity or less than 25% sequence identity and no structural similarity. the protein main chains are described by their heavy atoms, and each side chain is represented by a pseudo - atom c. for a given amino - acid type, the c has a well defined position relative to the main chain, corresponding to the geometric average of all heavy side - chain atoms of this type in the dataset ; for glycine, the c pseudo - atom is positioned on the c. side - chain degrees of freedom are thus neglected. each residue, at each position of each of the 141 proteins, is mutated in turn into the 19 non - wild - type amino acids. the mutations are made by keeping the main - chain structure unchanged, and substituting the c of the given amino acid by that of the mutant amino acid. for each of these mutations, the change in folding free energy is evaluated using the database - derived potentials and the procedure detailed below. for each substitution of amino acid a into a ', the average of all computed changes in folding free energy, at all protein positions, is computed and defined as minus the matrix element m(a, a '). we then symmetrize m by setting m(a, a ') = [m(a, a')+m(a',a)]/2 and only consider the lower half of m(a < a '). this procedure does not define the diagonal elements of m. on the basis of the principle that the structural role of a given amino acid is fulfilled by no other amino acid better than by itself, we assign to all the diagonal element the same maximum value : m(a, a) = max [m(a',a ") ] + 1. then, to simplify m without modifying its structure, we center it around its mean value : finally, we multiply all matrix elements m(a, a ') by 2 and replace them by the closest integer. the potentials we use to evaluate the protein conformations are derived from observed frequencies of sequence and structure patterns in the aforementioned dataset of 141 proteins. we consider two types of potentials, called torsion and c -c potentials. they take into account the propensities of single residues and residue pairs to be associated with a (,,) backbone torsion angle domain. we use two variants of the torsion potential, called torsionshort - range and torsionmiddle - range. both are computed from propensities of a (,,) domain ti, at position i along the sequence, or pairs of domains (ti, tj), at positions i and j, to be associated with an amino acid ak at position k. but we have k - 1 i, j k + 1 for the torsionshort - range potential and k - 8 i, j k + 8 for the torsionmiddle - range potential. the folding free energy g(s, c) of a sequence s in the conformation c computed from these propensities is expressed as : where p are normalized frequencies, n is the number of residues in the sequence s, k is the boltzmann constant and t is a conformational temperature taken to be room temperature. the normalization factor k ensures that the contribution to g(s, c) of each residue in the window [k - 1, k + 1 ] for the torsionshort - range potential or [k - 8, k + 8 ] for the torsionmiddle - range potential is counted once. they are based on propensities of pairs of amino acids (ai, aj) at position i and j along the sequence to be separated by a spatial distance dij, calculated between the pseudo - atoms c. we consider two variants of c - c potentials. the first one, called c - clong_range potential, describes purely nonlocal interactions along the sequence, and only takes into account residues separated by at least 15 residues along the sequence, that is j i + 16. the second one, simply called c - c potential, though dominated by nonlocal interactions, possesses a local interaction component. the nonlocal component is obtained by considering together the frequencies of all residues separated by seven sequence positions and more, thus with j i + 8. the local component is obtained by computing separately the frequencies of residues separated by one to six positions along the sequence, for i + 1 < j < i + 8. the folding free energies are expressed as : with j i + 16 and the normalized frequencies p independent of j - i for the c - clong_range potential, and i + 1 < j and the normalized frequencies p independent of j - i for j i + 8 for the c - c potential. the discretization of the spatial distances dij is performed by dividing the distances between 3 and 8 into 25 bins of 0.2 width and merging the distances greater than 8. to increase the reliability of the statistics, these bins are smoothed by combining the counts in each bin with those of the 10 flanking bins at each side. the predominance of the central bin is preserved by weighting the counts from each flanking bin by a factor 1/n, where n is the position relative to the central bin ; n is equal to 1 for the two closest bins and to 10 for the two most distant bins. the so - defined folding free energies are reliable for common amino acids and structure motifs, but not for less common ones. to correct for the sparse data, we substitute the sequence - specific frequencies p(c, s), where s denotes a sequence pattern and c a structure motif, which appear in expressions (9) and (10) immediately above defining the torsion and c - c folding free energies, by a linear combination of these frequencies and the product of the separate frequencies of s and c, denoted p(s) and p(c) respectively : where m is the number of occurrences of the sequence pattern s in the dataset, and a parameter. this expression ensures that the sequence - specific contribution dominates for rare sequence patterns and tends to zero for frequent ones. this behavior is modulated by the parameter, which we consider here equal to 50. to estimate the stability changes caused by a single - site mutation, we compute the folding free energy changes as : where cm and cw are the mutant and wild - type conformations and sm and sw the mutant and wild - type sequences, respectively. with this convention, g is positive when the mutation is destabilizing, and negative when it is stabilizing. the conformations cm and cw of the mutant and wild - type protein are assumed to be nearly identical. more precisely, the backbone conformations are taken as identical and only the position of the c pseudo - atom, which is amino - acid dependent, is different in the mutant and wild - type structures. the folding free energies of the wild - type and mutant proteins are computed with linear combinations of the torsion and c - c potentials described in the previous section. previous analyses have shown that the combination that gives the best evaluation of the g values depends on the solvent accessibility, a of the mutated residue ; a is defined as the solvent - accessible surface in the protein structure, computed by survol, multiplied by 100 and divided by its solvent - accessible surface in an extended tripeptide gly - x - gly. when the mutated residue is at the surface, with a solvent accessibility a equal to or larger than 50%, the optimal folding free - energy change has been shown to be equal to : when the mutated residue is half buried, half exposed to the solvent, with a solvent accessibility between 20 and 40%, the optimal folding free energy is : finally, when the mutated residue is totally buried in the protein core, with a solvent accessibility less than or equal to 20%, the optimal folding free energy is : when the mutated residue has a solvent accessibility comprised between 40 and 50%, we do not evaluate its folding free energy. we have indeed observed that in this case, the solvent accessibility of the mutated residue is not a good measure to guide the choice of the optimal potential. the relative frequency p(a) (in %) of amino acid a (right - hand column of table 1), as a function of the number of synonyms n(a) that code for it. the mean frequencies of the individual amino acids (p(a)) in the genomes of living organisms the frequencies p(a) were computed as averages over the frequencies observed in genomes of archaea (aeropyrum pernix k1, archaeoglobus fulgidus, halobacterium sp. nrc-1, methanococcus jannaschii, methanobacterium thermoautotrophicum, pyrococcus abyssi, pyrococcus horikoshi and thermoplasma acidophilum), bacteria (aquifex aeolicus, bacillus halodurans, bacillus subtilis, borrelia burgdorferi, buchnera aphidicola, campylobacter jejuni, chlamydia trachomatis, deinococcus radiodurans, escherichia coli k-12, haemophilus influenzae, mycobacterium leprae, mycobacterium tuberculosis, mycoplasma genitalium, mycoplasma pneumoniae, pasteurella multocida, pseudomonas aeruginosa, rickettsia prowazekii, thermotoga maritima, treponema pallidum, ureaplasma parvum, vibrio cholerae and xylella fastidiosa) and eukaryotes (arabidopsis thaliana, caenorhabditis elegans, drosophila melanogaster, homo sapiens and saccharomyces cerevisiae). fraction of random codes that are fitter than the genetic code fraction f of random codes that have a lower value of the fitness function, or) than the natural code, using each of the four cost functions g, g, g, g and g. values marked with an asterisk have been obtained by extrapolation as explained in text. the number of randomly generated codes is equal to 10 and the amino - acid frequencies used are the average ones listed in the right - hand column of table 1. percentage of random amino - acid frequency assignments yielding lower fractions f than the natural one percentage of the sets of random amino - acid frequency assignments for which the fraction f of random codes that beat the natural code is lower than the corresponding fraction computed with the natural frequency p(a) values. this percentage is estimated for the four cost functions - g, g, g and g - on the basis of 100 random frequencies and, for each of them, 10 random codes. for all cost functions except g, we were only able to give an upper bound (estimated to be equal to 1%), because our sample of random codes is too small and we did not find any random frequency set for which f is lower than that obtained with the natural frequencies. fraction f for different sets of allowed amino - acid interchanges in the alternative codes fraction f of random codes that have a lower value of the fitness function (, or) than the natural code, using the cost function g. for the unrestricted set, the f values were estimated from 10 randomly generated codes, where the only constraint is the preservation of the code 's block structure (as in table 2). for the biosynthesis - restricted set, only permutations of amino acids sharing the same metabolic pathway were considered, that is, interchanges of amino acids contained in one of the four sets { f, s, y, c, w }, { l, p, h, q, r }, { i, m, t, n, k }, { v, a, d, e, g } (single - letter amino - acid notation). as the number of alternative codes is reasonable (207,360,000), they have not been randomly chosen, but all have been tested. the degeneracy - restricted set contains results obtained by shuffling only amino acids with the same degeneracy in the natural code, corresponding to the sets { m, w }, { c, d, e, f, h, k, n, q, y }, { i }, { a, g, p, t, v }, { l, r, s}. here also, all 522,547,200 possible codes have been systematically tested. the percentage of optimization of the natural code compared to the optimal alternative ones, as defined in the text, is given in parentheses for. for the two restricted sets, for which all alternative codes were exhaustively generated, the value of the optimal code was computed exactly. for the unrestricted set, the optimal value was taken as the best of the unrestricted and two restricted sets. | backgroundthe genetic code is known to be efficient in limiting the effect of mistranslation errors. a misread codon often codes for the same amino acid or one with similar biochemical properties, so the structure and function of the coded protein remain relatively unaltered. previous studies have attempted to address this question quantitatively, by estimating the fraction of randomly generated codes that do better than the genetic code in respect of overall robustness. we extended these results by investigating the role of amino - acid frequencies in the optimality of the genetic code.resultswe found that taking the amino - acid frequency into account decreases the fraction of random codes that beat the natural code. this effect is particularly pronounced when more refined measures of the amino - acid substitution cost are used than hydrophobicity. to show this, we devised a new cost function by evaluating in silico the change in folding free energy caused by all possible point mutations in a set of protein structures. with this function, which measures protein stability while being unrelated to the code 's structure, we estimated that around two random codes in a billion (109) are fitter than the natural code. when alternative codes are restricted to those that interchange biosynthetically related amino acids, the genetic code appears even more optimal.conclusionsthese results lead us to discuss the role of amino - acid frequencies and other parameters in the genetic code 's evolution, in an attempt to propose a tentative picture of primitive life. |
the online version of this article (doi:10.1007/s00192 - 014 - 2549 - 9) contains supplementary material, which is available to authorized users. this video is also available to watch on http://videos.springer.com/. please search for the video by the article title. the objective of this study was to identify new tactile imaging and muscle contraction markers to characterize female pelvic floor conditions. vaginal tactile imaging [1, 2 ] allows 3-d quantitative elasticity assessment of pelvic floor support structures and carries a potential in assessment of surgical repair. we designed a new vaginal tactile imaging probe that images the entire vagina, the pelvic floor support structures, and pelvic floor muscle contractions. the probe has an orientation sensor, temperature sensors, and 96 pressure sensors positioned every 2.5 mm along both sides of the probe. the examination procedure includes four steps.step 1.probe insertion : this step provides the pressure responses (p) for vaginal anterior and posterior compartments along the entire vaginal length. we can use this information to calculate pressure gradients (grp) and anatomical dimensions.step 2.probe elevation : this step provides the pressure responses for the apical anterior and posterior compartments that are related to pelvic floor support structures.step 3.probe rotation : this step provides the pressure patterns for the left and right sides of the vagina (circumferential tactile image from vaginal walls).step 4.pelvic floor muscle contractions : this step provides the muscle dynamic pressure responses (dp) of the pelvic floor muscle contraction recorded from opposite sides along the entire vaginal length. probe insertion : this step provides the pressure responses (p) for vaginal anterior and posterior compartments along the entire vaginal length. we can use this information to calculate pressure gradients (grp) and anatomical dimensions. probe elevation : this step provides the pressure responses for the apical anterior and posterior compartments that are related to pelvic floor support structures. probe rotation : this step provides the pressure patterns for the left and right sides of the vagina (circumferential tactile image from vaginal walls). pelvic floor muscle contractions : this step provides the muscle dynamic pressure responses (dp) of the pelvic floor muscle contraction recorded from opposite sides along the entire vaginal length. in 2013 two patients were excluded from the data analysis because they had previously had pelvic floor surgery. the analyzed data set included 20 subjects aged from 41 to 70 years. among them four had normal pelvic floor conditions, four stage i, seven stage ii, four stage iii, and one stage iv prolapse. a standard physical examination was performed, including a bimanual pelvic examination, pelvic organ prolapse quantification (pop - q), assessment of tissue rigidity, and assessment of pelvic floor muscle tone. the tactile imaging data from all examinations were reviewed in a blinded fashion with no knowledge of the subject s pelvic floor conditions to avoid bias in the data review process. the clinical information was then added to this data set after the tactile imaging data (pressure, pressure gradients, muscle contracting response) were finalized. one - way analysis of variance (anova) (pa), paired t test (pt), and pearson s correlation coefficients (r) were calculated to determine whether the various parameters showed dependence on the pelvic floor conditions. the subjects were asked to complete an assessment of comfort and pain levels for the tactile imaging procedure. we identified the following parameters as potential markers to characterize the female pelvic floor conditions. site 1 corresponds to the lower one third of the vagina and site 2 to the upper one third of the vagina. we found that nine parameters are sensitive to prolapse conditions (p < 0.05 for one - way anova and/or p < 0.05 for t test with correlation factor r from 0.73 to 0.56). these parameters demonstrate a mild - moderate correlation with women age and parity (see table 1). during step 4 part of the identified markers also demonstrates correlation with patient age and parity. a typical examination consisting of four steps takes 12 min. of the patients, 54 % classified vti comfort level as more comfortable than manual palpation, 36 % as the same, and 10 % as less comfortable than manual palpation. of the patients, 73 % classified vti pain as none, 24 % as mildly painful, and 3 % as a painful.table 1summary for 11 parameters identified as potential markers for pelvic floor characterizationno.marker locationmeasured / calculated valueinterpretationexamination step (no.)one - way anova, p vs prolapse staging t test, p vs prolapse stagingcorrelation coefficient, r vs prolapse stagingcorrelation coefficient, r vs agecorrelation coefficient, r vs parity1anterior site 1pressuretactile feedbackprobe insertion (1)0.0110.0060.730.170.222anterior site 1pressure gradienttissue elasticityprobe insertion (1)0.0890.0200.610.130.233posterior site 1pressuretactile feedbackprobe insertion (1)0.0080.0120.710.710.390.374posterior site 1pressure gradienttissue elasticityprobe insertion (1)0.0140.0200.690.400.315posterior site 1pressuretactile feedbackprobe elevation (2)0.0300.0130.630.520.266posterior site 2pressuretactile feedbackprobe rotation (3)0.350.0610.400.260.137sides site 1pressuremuscle strengthprobe rotation (3)0.0910.0480.660.260.118anterior site 1pressure changemuscle strengthmuscle contraction (4)0.1020.0570.580.240.009anterior site 2pressure changemuscle strengthmuscle contraction (4)0.0670.0160.560.110.3310posterior site 1pressure changemuscle strengthmuscle contraction (4)0.0800.0190.610.150.2111posterior site 2pressure changemuscle strengthmuscle contraction (4)0.0460.580.390.200.27 summary for 11 parameters identified as potential markers for pelvic floor characterization our findings suggest that the tactile imaging markers such as pressure, pressure gradient, and dynamic pressure response during muscle contraction may be used for further quantitative characterization of female pelvic floor conditions. h. van raalte : grant / research support ; shareholder of advanced tactile imaging, inc. v egorov : grant / research support ; ceo and shareholder of advanced tactile imaging, inc. | introduction and hypothesistactile imaging (ti) is the high - definition pressure mapping technology which allows recording pressure patterns from vaginal walls under applied load and during pelvic floor muscle contraction. the objective of this study was to identify new tactile imaging and muscle contraction markers to characterize female pelvic floor conditions.methodsthe study subjects included 22 women with normal and prolapse conditions. they were examined by a new vaginal tactile imaging probe that images the entire vagina, the pelvic floor support structures, and pelvic floor muscle contractions.resultswe identified 11 parameters as potential markers to characterize the female pelvic floor conditions. these parameters correlate with prolapse conditions, patient age, and parity.conclusionsour findings suggest that the tactile imaging markers such as pressure, pressure gradient, and dynamic pressure response during muscle contraction may be used for further quantitative characterization of female pelvic floor conditions.electronic supplementary materialthe online version of this article (doi:10.1007/s00192 - 014 - 2549 - 9) contains supplementary material, which is available to authorized users. this video is also available to watch on http://videos.springer.com/. please search for the video by the article title. |
in recent years, it has become widely accepted that catalytic promiscuity, i.e., the ability of many enzymes to catalyze the turnover of multiple chemically distinct substrates, plays a key role in the evolution of new functions, allowing for rapid responses to environmental changes. furthermore, interest in this phenomenon has exploded as it has been increasingly shown to be a powerful tool for gaining knowledge not just into the process of natural functional evolution, but also as a factor that can be exploited in effective artificial enzyme design. such promiscuity appears to be highly pronounced among many phosphotransferases, such as the recently evolved bacterial phosphotriesterase (pte), serum paraoxonase 1 (pon1), and members of the alkaline phosphatase (ap) superfamily, to name a few examples. this latter superfamily has additionally played a central role as a model system for understanding enzyme catalytic promiscuity, i.e., the ability of a given enzyme to catalyze more than one distinct chemical reaction. the characterized members of the ap superfamily are highly promiscuous hydrolytic enzymes capable of interchangeable cleavage of p o, s o, and p c bonds. that is, they have been shown to catalyze the hydrolysis of a range of substrates that differ in the nature of their ts solvation and protonation patterns, and thus in their requirements for efficient catalysis (see discussion in refs (1618)). furthermore, all known ap superfamily members are metallohydrolases that employ similar catalytic scaffolds, which are comprised of at least one divalent metal ion in their respective active sites (figure 1). this metal ion plays an important role in activating the nucleophile, which is generally thought to be an alcohol or alkoxide depending on the particular superfamily member, by increasing the concentration of its active deprotonated form. additionally, while there are a number of similarities between different known members of the superfamily, there are also broad differences in their metal requirements, overall structures, and specific choice of nucleophile, which can in turn be linked to changes in specificity patterns. despite these differences, a particular hallmark of this superfamily is crosswise - promiscuity, in that the native substrate for one member of the superfamily is often a promiscuous substrate for another, in some cases with high (and almost comparable) proficiencies toward both the native and promiscuous substrates. as a result, these enzymes provide a perfect showcase to generate a systematic roadmap of the process of functional evolution within an enzyme superfamily, as well as a broader model system for understanding the evolution of phosphohydrolase activity. an active site comparison of selected members of the ap superfamily. shown here are the active sites of (a) rhizobium leguminosarum phosphonate monoesterase (pdb code 2vqr), (b) escherichia coli alkaline phosphatase (1alk), (c) pseudomonas aeruginosa arylsulfatase (1hdh) and (d) xanthomonas axonopodis nucleotide pyrophosphatase / phosphodiesterase (2gsn). the figure highlights the presence of divalent metal ions as well as the conservation of some of the residues surrounding them. among the different superfamily members, the name giving member ap as well as the very closely related nucleotide pyrophosphatase / phosphodiesterase (npp) have been the subject of extensive scrutiny. a lesser - studied subset of enzymes that stand out in this superfamily are those classified as phosphonate monoester hydrolases (pmhs), such as the enzymes from rhizobium leguminosarum (rlpmh) and burkholderia caryophylli (bcpmh). these highly promiscuous enzymes efficiently promote the hydrolysis of at least five different substrate classes (figure 2) and stand out in particular as their promiscuous phosphodiesterase activity is almost as efficient as their native phosphonate monoesterase activity (table s1) ; note that the pte activity reported in this work is ambiguous, as discussed in the results and discussion. moreover, these pmhs provide the first example of biological pmh activity and are the only currently known enzyme capable of catalyzing the hydrolysis of xenobiotic sulfonate esters by direct s note also that both enzymes are large homo tetramers with 56 kda subunits and have extremely large binding pockets (10 20 wide and 15 deep). therefore, one would assume that such enzymes could easily accommodate a range of substrates of different shapes and sizes. perhaps unsurprisingly, therefore, both pmhs are moderately efficient catalysts for the hydrolysis of the compounds shown in figure 2 (kcat / km values in the range of 1010, see table s1) and, in the case of rlpmh, apparently only marginally affected by mutations of the key active site residues with presumably multiple catalytic backups present in the active site (table s2) that can take over the role of the mutated residues. a closely evolutionarily related enzyme in the ap superfamily is the arylsulfatase from pseudomonas aeruginosa (pas) (figure 1c). this enzyme only shares about 27% sequence similarity to rlpmh but has high structural similarity, in that 64% of the residues between the two enzymes structurally align with an rmsd of 2.54. this enzyme also has recently been the subject of extensive experimental and computational studies. both pas and the pmhs contain a mononuclear metal center with distorted octahedral conformation, which is most likely mn in the pmhs and ca in pas. in addition, all three enzymes use an unusual geminal diol nucleophile (figure 1), a feature they share with all known sulfatases. this noncanonical residue is a post - translationally modified cysteine or serine, which is first converted to an aldehyde and then hydrated to give rise to its active form. despite these apparent similarities, the two pmhs and pas have very different specificity patterns. that is, pmhs are phosphonate monoesterases, while pas is primarily a sulfatase, although all three enzymes have relatively low discrimination between native and promiscuous substrates. in contrast, other superfamily members such as ap and npp have dinuclear zinc centers in their catalytic sites (ap also possesses a third metal ion that appears to play an important role in determining the activity) and utilize ionized serine or threonine residues as nucleophiles, respectively (figure 1). thus, a direct atomic - level comparison between individual ap superfamily members and also related promiscuous phosphatases can provide better and broader understanding of the features that drive selectivity and promiscuity in these highly multifunctional systems. structure of rlpmh (pdb i d : 2vqr) and the corresponding substrates studied in this work. both rlpmh and bcpmh are dimers of dimers, in which the monomeric units of each dimer communicate with its corresponding oligomeric unit through the c - terminal loop highlighted in this figure (which is in turn an adaptation from an analogous figure presented in ref (12)). this loop reaches into the adjacent active site, helping position key catalytic residues. the substrates studied in this work are phenyl p - nitrophenyl phosphonate (ppp), ethyl p - nitrophenyl phosphate (pet), p - nitrophenyl sulfate (pns), phenyl p - nitrophenyl sulfonate (pps), and the p - nitrophenyl phosphate monoanion (pnph). in the present work, we have performed an extensive number of empirical valence bond (evb) simulations (total simulation time of 4 s) of both the native and several characterized promiscuous activities of bcpmh and rlpmh, reproducing key experimental observables such as activation barriers, qualitative predictions from the ph - rate profiles for bcpmh activity, and the effect of mutations on rlpmh activity. we demonstrate that, despite their broad promiscuity, the pmhs studied in this work hydrolyze all substrates through a unified mechanism with similar substrate binding positions, transition states, and electrostatic contributions to transition - state stabilization. additionally, we showcase the importance of compensatory and cooperative electrostatic effects, which allow for an electrostatically flexible active site environment that can accommodate a range of substrates with different charge distributions, transition - state geometries, and requirements for efficient catalysis. finally, in order to test whether these observations are general to other members of the superfamily, we provide a detailed comparison of a range of ap superfamily members, in terms of active site shape, volume, and polarity. from this analysis we find a strong correlation between these properties and both substrate charge preference and number of known promiscuous activities, once again emphasizing the central role of the electrostatic environment of the active site in determining enzyme specificity and promiscuity. it is commonly accepted that enzymes achieve their tremendous catalytic proficiencies through an exquisite network of interactions that preferentially stabilize their transition states over their ground states, and it has been argued that this is achieved through preorganization of the catalytic residues into an optimal conformation for transition - state stabilization. this has been demonstrated for a wide range of systems through both experimental and computational work. we illustrate here that while having an optimal electrostatic environment is clearly important to the catalysis of these enzymes toward individual substrates, one should also take into account the cooperativity between these residues, where the effect of the combined electrostatic environment from all relevant residues on the transition state stabilization is greater than the effect of each residue determined individually. we demonstrate that this cooperativity renders the active site electrostatic environment sufficiently flexible to accommodate a broader range of substrates with different electrostatic needs for efficient catalysis (without necessarily altering either substrate binding position or enzyme conformation). additionally, our comparative analysis of different alkaline phosphatases shows that the higher the number of polar active side residues, the greater the propensity toward catalytic promiscuity. this highlights the importance of such cooperative electrostatic interactions as a common feature to functional evolution among members of the ap superfamily, illustrating the power of subtle amino acid substitutions to drive very different solutions for the same chemical problem. initial structures for both rlpmh and bcpmh (1.42 and 2.40 resolution, respectively) were obtained from the protein data bank (accession codes 2vqr and 2w8s). as the deposited structure for rlpmh contains only the monomeric unit without the transformation matrix, the structure of the full tetramer was obtained directly from the authors. potential flips of histidine, asparagine, and glutamine side chains were evaluated using the molprobity server, and those suggested by the software were applied to the structure. in all cases, the substrates were placed manually in the active site in such a way to optimize nonbonded interactions between the substrate and nearby amino acid side chains, including charge structures for the corresponding q13a, n78a, y105a, t107a, h218a, and k337a variants presented in ref (8) were generated by manual truncation of the relevant side chains starting from the wild - type crystal structure, and structures were equilibrated using the same protocol as for the wild - type enzymes in order to allow the active site to adapt to the perturbation introduced. both pmhs are metalloenzymes with a single metal per active site of the tetramer (4 total), and the most likely candidate for this role has been identified as being a divalent manganese ion. we recently presented a set of force - field - independent parameters to describe a range of alkali earth and transition - metal centers based on qvist and warshel s original cationic dummy model, which describes the metal as a delocalized charge spread over a number of dummy atoms placed around the metal center (in this case six particles in octahedral coordination, as shown in figure s1). these particles are bonded to the central atom and to each other, and the frame is allowed to freely rotate in its coordination sphere without the need for external constraints or artificial bonds. we demonstrated that this model also allows one to capture subtle structural effects upon metal substitution without the need for the artificial restraints that need to be imposed in a fully bonded model, while simultaneously capturing key electrostatic properties of the metal center. we have successfully used our ca model in simulations of the selectivity of pon1, and the mn model presented in our original paper has been used in the present work to describe the catalytic metal center in the pmhs. all relevant reactions were simulated in the active sites of both enzyme species and in a 24 water droplet, in order to quantify the catalytic effect of the enzyme compared to background reaction in aqueous solution. to model the reaction in solution, we used truncated residues to model the nucleophile (acetaldehyde hydrate as a model for the formylglycine) and the relevant general acids (ethylamine and ethylimidazole for lys and his, respectively). in the enzyme simulations, one of the main computational difficulties encountered comes from the fact that truncating the 16 c - terminal residues of rlpmh causes the enzyme to lose its tetrameric structure, with a corresponding loss of activity. this strongly suggests that interactions at the subunit interfaces can be important to catalysis, as can also be observed from the protrusion of the interfacial loop almost into the active site of the adjacent subunit (see figure 2). thus, it is necessary to include the entire (2056 amino acid) tetramer, which creates substantial computational cost. to simplify this problem and reduce computational cost, the system was divided into three layers : the evb (reacting) atoms, an active region encompassing all residues within a 24 sphere of the reacting atoms centered at the metal center, and an external layer in which the remainder of the system was present, but the atoms were constrained to their crystallographic positions (as is commonly done in similar studies, see e.g., refs (24 and 45)). the simulation sphere encompassing the active region was centered on the catalytic mn ion, and all crystallographic water molecules within 18 of this center were retained in our simulations, with the exception of any crystal waters clashing directly with the substrate once it was placed in the active site. the solvation sphere was then completed and extended to 24 using tip3p water molecules subjected to the surface constraint all atom solvent (scaas) spherical boundary conditions. a 10 kcalmol harmonic restraint was applied to the outer layer of the active region and associated solvent molecules (15%, 3.6), in order to ease the transition between the active and constrained regions, which is why only an 18 of crystallographic water molecules were retained for the simulation. all forces on the constrained atoms were set to zero, in order to prevent them from distorting the dynamics of the active region. ionizable residues within 18 of the center were ionized during the course of the simulation, leading to a total system charge of 1 (without including the substrate). the protonation states of histidine side chains were investigated using the molprobity server, propka 3.1, and by visual inspection. all other residues, in particular those outside the active region, were set to their neutral form for system stability. the mn ions in the adjacent monomeric units (the positions of which were kept constrained) were removed in order to avoid the presence of residual charge outside the simulation sphere (we note that the adjacent active sites all fall within the constrained external layer and all surrounding residues are therefore not allowed to move). in contrast, the catalytic metal center in the active region was described using a 7-pointed dummy model with distributed charges as described above. all molecular dynamics (md) and evb simulations in this work were conducted using the opls - aa force field implemented in the q simulation package (version 5.0.6). for the substrate and nucleophile, opls - aa compatible force field parameters were generated with macromodel 9.1 (opls - aa force field, 2001, schrdinger llc). the only exceptions were the force field parameters for the carbon and oxygen of the deprotonated geminal diol, which were available in the literature and obtained from ref (53). partial charges for the reacting atoms were generated at the hf/6 - 31 g level of theory using the gaussian 09 simulation package, followed by the standard resp procedure. all the simulations performed herein used time steps of 1 fs, while the temperatures of the system were regulated using the berendsen thermostat (with a 100 fs bath relaxation time). the systems were initially heated from 1 to 300 k over a short 80 ps simulation, applying a 200 kcalmol harmonic force constant on the solute atoms to restrain them to their crystallographic positions. this allowed for the solvent molecules to equilibrate around the protein and the removal of initial contacts due to substrate placement. the system was then cooled down to 5 k for another 10 ps and then gradually heated to 300 k for 90 ps of simulation time, while the force constants of the harmonic restraint were gradually decreased from 200 to 0.5 kcalmol. subsequently, a 5 ns equilibration was performed at 300 k for both wild - type and mutant enzyme simulations (300 ps for the reference reaction in solution) using a 0.5 kcalmol position restraint on the substrate atoms, the side chain of the nucleophile, the catalytic metal center, and the side chain of the general acid (h218 or k337, depending on the mechanism being considered) to keep the reacting atoms in place. an rmsd plot of the active monomer for the wild - type enzyme and each enzyme variant is shown in figures s2 and s3. as shown in this figure, due to the fixed excluded region, these systems equilibrated rapidly, with rmsd of < 0.5 from the reference crystal structure. after the final equilibration step, we ran an additional 500 ps of molecular dynamics, during which 10 snapshots of the whole system were taken every 50 ps to be used as starting points for subsequent evb simulations. finally, although we remained as faithful as possible to a fully nonbonded model for the catalytic metal center, we introduced an angle parameter (50 kcalmolrad, equilibrium angle 180) between the center of the mn dummy model and the residue d324 (mn ometal ofree, where ometal corresponds to the oxygen atom closest to the mn, and ofree the one not coordinated to it), which would otherwise become bidentately coordinate to the metal center and make the active site unstable as can be seen from the results and discussion, despite the inclusion of this extra parameter, we are able to systematically reproduce the activation energies of both wild - type and mutant forms of these pmhs with different substrates with good agreement to experimental data. our methodology of choice in this work to model chemical reactivity was the evb approach of warshel and co - workers. this is an empirically - based multiscale valence - bond / molecular mechanics approach that is fast enough to allow for the extensive sampling required to obtain convergent free energies for complex biochemical processes, while having a proven track record as a powerful tool for quantifying and rationalizing the catalytic power of native and mutant enzymes. all evb calculations were performed using the standard evb free energy perturbation / umbrella sampling (evb - fep / us) procedure outlined in refs (33 and 57), as implemented in the q simulation package. the reaction under study was described in terms of two valence bond structures, as illustrated in section s4 of the supporting information. it should be pointed out that as all atoms in the two valence bond states are treated using the same force field, the only differences between the reacting (evb) and nonreacting atoms are the use of morse rather than harmonic potentials to describe bonds that are being broken and formed during the reaction (see the supporting information) and the fact that unlike the rest of the protein, the evb atoms do not have a cutoff for calculation of the nonbonded interactions. all evb - fep / us simulations were performed at 300 k, using 51 mapping windows of 200 ps per window, resulting in 10.2 ns of simulation time for each individual trajectory, sampling over 10 starting conformations per system (102 ns per system) and 4 s cumulative simulation time for all systems studied in this work. all md and evb simulations were performed using a 1 fs time step, and long - range effects were treated using the local reaction field (lrf) approach. finally, as outlined above, we also modeled the corresponding uncatalyzed reaction for each substrate of interest in this work, as we needed these calculations not only for the calibration of the evb parameters, but also to compare the reactions for different environments. coordinates for each system were based on the equilibrated enzyme system, but in the absence of the enzyme itself, and the reactions were modeled using the relevant substrate as well as acetaldehyde and protonated ethylamine as models for the nucleophile and the general acid, as described in the initial system setup section. all equilibration and evb protocols were the same as for the full enzyme system, with the exception that the background reaction in the absence of the enzyme was only equilibrated for 300 ps rather than 5 ns. as with the corresponding enzymatic reactions, a weak position restraint of 0.5 kcalmol was placed on all solute atoms (nucleophile, substrate, and model for general acid) in order to keep the reacting fragments in the center of the simulation sphere. this weak restraint is sufficient to keep the nitrogen atom of the general acid within 3.5 of the leaving group oxygen throughout the 300 ps equilibration of the background reaction, in part due to electrostatic interactions between the charge on the general acid and the substrate. the relevant background reaction was calibrated based on estimations using experimental data, as described in detail in the supporting information. furthermore, the parameters describing the relative positions of the vb parabolas and the coupling between them were then transferred unchanged to the enzyme in order to be able to quantify and correctly predict the catalytic effect of wild - type and mutant enzymes. (a) overlay of the active sites in rlpmh and pas, illustrating conservation of active site structure between the two enzymes. (b) a simplified version of the proposed catalytic mechanism for both pmhs considered in this work, based on refs (8 and 12). since the catalytic metal is suggested to be mn, which is a hard lewis acid, the nucleophile could be stable as an alkoxide, in agreement with the ph - rate profiles shown in figure s4. a unique feature of the pmhs being considered in the present work is that they are the only nonsulfatase enzymes known to date to possess a post - translational modification from a cysteine to an aldehyde (formylglycine, fgly). the current proposed mechanism for both native and promiscuous pmh activities is shown in figure 3. in a first step (i ii), hydration of the post - translationally modified aldehyde yields a reactive geminal diol, which can act as a nucleophile. this geminal diol is activated by the catalytic metal center and exists in its alkoxide form. following substrate binding (ii iii), this geminal diol then attacks the phosphorus / sulfur center (iii iv) of the relevant substrate (figure 2) to give rise to a hemiacetal intermediate (iv). in the final step (iv i), this intermediate is hydrolyzed by hemiacetal cleavage to regenerate the aldehyde and yield the final product. the two pmhs considered in this work show an absolute dependence on divalent metal ions, with the most likely candidate for fulfilling this role being mn, based on experimental data presented in refs (8 and 12). a transition metal would be expected to substantially decrease the pka of the metal - bound nucleophile to yield an alkoxide, as also suggested by the acid limb of the ph - rate profiles shown in figure 2 of ref (12) (reproduced as figure s4), which most likely corresponds to the deprotonated nucleophile (see discussion in ref (12)). the ph - rate profiles, which are coincidental for all substrates except the phosphate triester, also suggest the involvement of an acid catalyst, most likely either h218 or k337 (see also figures 3 and s4). it has been argued that steps iv i of figure 3 can play an important role in facilitating promiscuity. specifically, harnessing hemiacetal cleavage allows for a common mechanism irrespective of the functional group used in the intermediate, while simultaneously providing a thermodynamically less challenging route to facilitate c o cleavage, compared to the repeated cleavage of an extremely stable p(s)o bond. however, kinetic data on base - catalyzed hemiacetal cleavage in aqueous solution demonstrate that this reaction is extremely fast. additionally, as all substrates will be broken down by a common mechanism through a common intermediate, the selectivity will be already determined in steps iii iv, which is also therefore the focus of the present work (figure 3). our mechanistic model assumes an anionic nucleophile and general acid catalysis from either k337 or h218 to protonate the departing leaving group. as discussed below, in this work k337 was chosen as the general acid based on empirical pka calculations and experimental data. that is, the experimental ph - rate profiles suggest a two - pke model, with a pke1 of 7.07.2 (5.8 for the sulfate monoester) and a pke2 of 7.58.1 (see figure s4). the first pka is likely to correspond to the nucleophile, contributing to catalysis in its deprotonated form as discussed above, and the second pka to the general acid. the pke2, which is very close to the pka of around 8 suggested for k337 by propka, led to the choice of this residue as the putative general acid, as also suggested by refs (8 and 12). the only exception to this model is the p - nitrophenyl phosphate monoester, of which the dianionic form will be extremely resistant to attack by an anionic nucleophile (see ref (62)). however, the pka of the already basic nonbridging oxygens of this substrate (pka 5.0) is likely to be substantially elevated due to the close proximity of the anionic nucleophile. this, in turn raises the possibility that this substrate binds as a monoanion, as has already been demonstrated by simulations, for example, for protein tyrosine phosphatase 1b. note also that, as shown in figure s4 and ref (12), the monoanionic sulfate and dianionic phosphate monoesters give rise to very different ph - rate profiles that not only have different slopes but also are shifted by 2 ph units. thus, we have herein considered a mechanism involving an anionic nucleophile attacking a monoanion phosphate, which yields excellent agreement with experiment as discussed below. calculated and experimentally derived activation energies for the enzyme - catalyzed reactions of the five substrates studied here by the wild - type forms of (a) rlpmh and (b) bcpmh. in the present work we have not examined phosphate triester hydrolysis, which shows a very different kcat / km ph - rate profile to all other substrates studied (figure s4). the inverted ph - rate profile observed for this substrate suggests either the involvement of a completely different set of residues or a completely different mechanism of catalysis. additionally, bcpmh shows extremely poor activity toward this substrate (kcat / km of 1.6 10 ms), which is actually slower than the corresponding uncatalyzed alkaline hydrolysis of the model substrate paraoxon. taken together, this suggests that the hydrolytic mechanism of this substrate, if it at all binds in the same active site, is impossible to prove conclusively through calculations due to lack of concrete experimental data. as mentioned before, the reactions examined in this work correspond to the third step (iii iv) of the catalytic cycle shown in figure 3. since experiments show that the hemiacetal cleavage is a fast step, we focused only on this second step, which is the most chemically challenging step of the cycle, being thus the one related to the measured kinetic parameters. figure 4 shows a comparison between our calculated and, where available, experimental activation free energies (derived from kcat, which provides an upper limit for the reaction rate)., it can be seen that the model used in the present work reproduces the experimental activation free energies within an accuracy of 1.7 kcalmol for all substrates. it has additionally been argued that the pmhs considered in this work can accept both diesters and phosphonates with such high proficiency in the same active site due to similar geometrical and steric demands for the respective substrates and transition states. to probe this further, we have examined transition - state geometries for all uncatalyzed and enzyme - catalyzed reactions considered in this work. table 2 shows a comparison of p(s)o distances to the oxygen atoms of the incoming nucleophile and departing leaving group for all substrates and reactions. representative transition - state structures in the bcpmh active site are also illustrated in figure 5. from these results, it can be seen that the pmhs hydrolyze all substrates through a unified mechanism with similar substrate binding positions and transition states. with the exception of the phosphonate, little change is seen in transition - state geometry upon moving from aqueous solution to the enzyme active sites, in agreement with related experimental work by herschlag and co - workers, as well as theoretical analysis by hou and cui, on alkaline phosphatase. even in the case of the phosphonate, the overall transition - state size (considering the distance between onuc olg) stays very similar, and the main change is that the symmetry of the transition states changes, with p onuc becoming slightly elongated and p olg slightly compressed compared to the corresponding uncatalyzed reaction. hence, as suggested in previous works for alkaline phosphatase, we find very little effect on the transition - state geometries of moving to the enzyme active when compared with those obtained through modeling the corresponding uncatalyzed reaction in aqueous solution. all energies are given in kcalmol and are averages and standard deviations based on 10 individual evb simulations generated from different starting structures, as outlined in the methodology section. g(expt.) corresponds to experimental values of the enzyme - catalyzed reaction, based on the kinetic data presented in refs (8 and 12). to locate the origin for the differences in the observed catalytic activity, we have performed a comparison of the electrostatic contributions of individual residues to the hydrolysis of each substrate, calculated using the linear response approximation following previous works (e.g., refs (66 and 67) ; see figure 6). this analysis shows that, strikingly, despite the calculations of residue interactions being completely independent of each other, with different charge distributions and different transition states, all residues that make substantial electrostatic contributions to the calculated activation barrier are conserved among different substrate. this is similar to the observations from our previous computational work on the arylsulfatase from pas. however, although qualitatively similar, there are some key quantitative differences between the different substrates, most notably in the case of d12, d324, h325, and e327. while this itself is hardly surprising, considering these are electrostatically quite different substrates, it highlights that the active site pre - organization is not perfect, but rather cooperative electrostatic interactions render this preorganization flexible enough to readily adapt to the electrostatic needs of different substrates (see also the related discussion of catalytic backups in serum paraoxonase 1). to further explore this observation, we have also examined the charge change on the central p / s atom and all atoms bonded to it upon moving from reactant to transition state for the wild - type bcpmh catalyzed hydrolysis of the different substrates studied in the present work. these atoms were split into three fragments : a central fragment comprising the p / s atom, the nonbridging oxygens of the substrate, and the c atom of the phenyl group of phenyl p - nitrophenyl sulfonate (pps) and phenyl p - nitrophenyl phosphonate (ppp) connected to the central p / s atom as well as the oxygen atoms of the departing leaving group (olg) and attacking nucleophile (onuc) as individual fragments (see table s3). as the transition states for the reactions studied involve partial bond formation to the nucleophile and leaving group, we have summed up the charges on the central atoms (p / s, nonbridging oxygens, and carbon) and treat this as one unit, which we will henceforth refer to as central fragment for simplicity. the schematic for this division is shown in table s3 which also provides absolute charges for each fragment at the reactant and transition states as well as the charge shift upon moving from reactant to transition state. these have then in turn been ranked against the measured kcat / km for bcpmh for each substrate. from this table, it can be seen that while there is little trend in the charge shift on the leaving group oxygen (which is partially protonated by the general acid), there are subtle but clear trends in the partial charges of the nucleophile oxygen and the central fragment. that is, for the native substrate, ppp, there is a substantial charge shift corresponding to a loss of + 0.2728 au on onuc. this charge shift gradually decreases across the series, correlated with a reduction in kcat / km. in parallel to this, for the native substrate, there is a small buildup of negative charge (0.0468 au) on the central fragment, which increases to 0.0884 au for the promiscuous activity with the lowest observed kcat / km (the sulfate monoester). therefore, there appears to be a correlation between the calculated charge shift at the transition state and the subsequent catalytic efficiency of the enzyme. this also ties in with experimental observations that other alkaline phosphatases such as ap and npp clearly discriminate on the basis of substrate charge. the most radical example of such charge discrimination in this superfamily, in fact, is in the arylsulfatase from pseudomonas aeruginosa (pas), where the hydrolysis of large bulky monanionic diesters such as bis - p - nitrophenyl phosphate shows only 100-fold lower values than the monanionic substrate p - nitrophenyl sulfate (with kcat / km = 4.9 10 ms for the sulfate monoester and 2.5 10 ms for the phosphate diester). in contrast, the dianionic analogue of the sulfate monoester, p - nitrophenyl phosphate, is a much poorer substrate than the sulfate monoester (kcat / km = 790 ms), despite having the same ground - state geometry and similar predicted transition - state geometries to the sulfate monoester. even further examples of such charge discrimination have been seen by baxter and co - workers in studies of aluminum and magnesium fluoride transition - state analogues (tsa) of phosphoryl transfer enzymes, where they showed clear preference for preserving anionic charge at the expense of tsa geometry over a broad range of ph. all data are averages and standard deviations over 10 individual simulations as outlined in the methodology section. for an extended version of this table, including both p(s)o and h n / olg distances, we refer the reader to the table s4. representative transition - state structures for the bcpmh catalyzed hydrolysis of (a) ppp, (b) pet, (c) pns, (d) pps, and (e) pnph. electrostatic contribution of key residues to the calculated activation barrier for the hydrolysis of the five substrates for wild - type form of bcpmh. clearly, these enzymes have evolved to provide the key active site interactions that optimally stabilize the transition state for the native reaction, which in turn leads to the observed preference for the native substrate. however, in the electrostatic cooperativity model we present in this work, these interactions are sufficiently flexible to accommodate the electrostatic needs of other substrates, although the same residues can make quantitatively different contributions as shown in figure 6. these differences in ability to stabilize different transition states would in turn lead to the selectivity displayed by these enzymes for different substrates. hollfelder and co - workers have performed a detailed alanine scan of the rlpmh active site residues, testing against both the phosphonatase (ppp) and phosphodiesterase (pet) activities of the enzyme. both substrates appear to be highly insensitive to active site single mutations, with the individual substitution of each key active site residue in rlpmh leading to, at worst, a 20-fold reduction in kcat. an exception to this is modifying the nucleophile to alanine, but even in this extreme case, these enzymes still show some activity. to probe the origin of the seeming resilience of these enzymes to substitution of individual active site residues, we have performed evb calculations to obtain free energy profiles for the chemical step for the hydrolysis of substrates ppp and pet of figure 2 by a range of ala - substituted forms of rlpmh presented in ref (8). critically, when moving from wild - type to mutants, we used exactly the same parameter set, unchanged, allowing us to in parallel rigorously validate our valence bond model for the reaction mechanism catalyzed by these enzymes and its predictive power (see the supporting information for theoretical background). the only exception to this is the k337a mutant that has the general acid functionality of k337 removed, and for which we model the reaction as proceeding with h218 as the general acid instead (for all other calculations, h218 is kept in its neutral form as close proximity to the k337 side chain and the catalytic metal ion will depress its pka). note again that although we have focused on k337 as a putative general acid in this work, due to the agreement between the predicted pka of k337 and the experimental ph - rate profiles as outlined in the previous section, in practice either of these two residues could fulfill the role of general acid. calculated and experimentally derived activation energies for the rlpmh catalyzed reactions of (a) ppp and (b) pet. shown here is data both for the reaction catalyzed by the wild - type enzyme as well as several mutant forms of the enzyme. the data plotted in this figure are presented in table 3, and the error bars represent standard deviations over 10 independent trajectories. a comparison between calculated and experimental activation barriers for the hydrolysis of these substrates by each key rlpmh variant is shown in figure 7 with the corresponding energetics presented in table 3. it can be seen that we are able to reproduce the experimentally observed effect of all active site mutants (gwtmut) to within an average error margin of 1 kcalmol. the most challenging of these mutations to model is the y105a mutation (as can also be seen from the large error bar shown in figure 7), as this mutation leads to a larger perturbation in the active site, for example repositioning residues such as t107 and y215. this results in a larger standard deviation for these calculations in the case of the phenyl phosphonate than in other simulations. however, the average over 10 trajectories is still in good agreement with experimental results. taken together with our other simulations, this provides support for the quality of our calculations, the suggested mechanism, and our assumption that the group transfer is the key step in determining the specificity. additionally, an examination of the corresponding p o distances at the transition state for each variant and substrate shows that, as we move from the background reaction to the enzyme (table s5), the single mutants in the active site have little effect on the transition - state geometry. here, we will provide a brief discussion of our simulations of each mutant below and refer the reader to figure 5 for an overview of how each residue interacts with the substrates of interest in the equilibrated wild - type enzyme. all energies are given in kcalmol and are averages and standard deviations over 10 individual trajectories using different starting conformations, as outlined in the methodology section. g(expt.) corresponds to experimental values of the enzyme - catalyzed reaction, based on the kinetic data presented in refs (8 and 12). electrostatic contribution of key residues to the calculated activation barrier for group transfer reactions of (a) ppp and (b) pet for different rlpmh variants. as suggested in ref (8), this residue seems to play a key role by holding k337 in place. for the simulations of the q13a variant, we observe that both k337 and h218 are perturbed, and the rms displacement of k337 after equilibration compared to the wild - type enzyme is 0.80 and 0.78 for ppp and pet, respectively. however, the effect of losing this interaction translates to only a 0.4 kcalmol reduction in activation barrier for both substrates both experimentally and from our simulations (see table 3). note that, as shown in table s2, this mutation primarily affects km rather than kcat for both substrates considered here. n78 is a key active site residue, as it provides a hydrogen - bonding interaction to the nonbridging oxygen of both ppp and pet. this interaction stabilizes the substrate and also helps to optimally position the substrate in the active site. loss of this interaction results in a 1.4 kcalmol increase in barrier for both substrates. as shown in table 3 and figure 7 we are able to reproduce the detrimental effect of the n78a mutant, which is slightly larger for pet than for ppp. this could be in part due to the presence of the phenyl ring in ppp, which can help to position the substrate in the active site even in the absence of the hydrogen bond from n78. in the wild - type enzyme this residue does not directly interact with the nucleophile or the substrate. however, it is part of a hydrogen - bond network that keeps d324 and r61 correctly positioned for catalysis (figure 1). it has been experimentally shown that this mutation drastically reduced the kinetic efficiency of the enzyme. as can be seen from table 2, while we are able to reproduce the experimental activation barrier within 1 kcalmol, for both the phosphonate monoester and the phosphate diester, we obtain larger standard deviations for this variant in the case of the phosphonate monoester. in the case of the phosphate diester, upon truncating y105 to alanine and equilibrating the system, we see an increase in the number of water molecules around the nucleophile as well as repositioning of other residues, such as t107 and y215. specifically, the interaction between the nucleophile and t107 is broken, and y215 occupies the space left by mutation. in the case of the phosphonate monoester, however, the large hydrophobic phenyl ring of the phosphonate (compared to the smaller ethyl group in the diester) blocks water access to the nucleophile and restricts the movement of other residues around it. t107 is another key active site residue, as it directly interacts with the nucleophile, helping optimally position it for catalysis (figure 1). unsurprisingly, truncating this residue to alanine leads to an increase in activation barrier of 1.2 kcalmol for the phosphonate and 1.7 kcalmol for the diester (a trend we reproduce computationally, see table 3 and figure 7). this is primarily due to loss of the hydrogen bonding interaction with t107 as well as the resulting subtle repositioning of the nucleophile in the active site. interestingly, this mutation appears not only to impact the catalytic activity, but also to increase km from 2.8 mm in the wild - type enzyme to 15 and 57 mm in the mutant form for both phosphonate and diester substrates. it has been argued that this increase in km is due to substrate binding, suggesting that this residue as well as k337 are directly involved in this step. h218 could also play a role as a general acid, due to its close proximity with the leaving group. however, in its unprotonated form, h218 also plays a key role in positioning k337 for optimal leaving group stabilization (the distance between n of h218 and k337 is 3.44 in the rlpmh crystal structure). the role of k337 is two - fold : it helps to position the substrate in the active site in the michaelis complex (through a hydrogen bonding interaction to one of the nonbridging oxygens of the substrate) as well as to stabilize the leaving group upon departure by acting as a general acid and protonating it. one would expect, then, that mutation of this key residue to alanine would result in a substantial increase in activation barrier. however, the experimentally observed increase is only 0.2 kcalmol for the phosphonate monoester and 0.7 kcalmol for the phosphate diester, which is lower than for example either the n78a or t107a mutations. this suggests that another positively charged residue is taking up the role of k337 in leaving group stabilization. as discussed above, the role of general acid could be fulfilled by either k337 or h218, and in absence of the close proximity of the k337 positive charge upon mutation (the distance between the n of h218 and the nitrogen of k337 is 3.44 in the wild - type crystal structure), one would presume that h218 is more likely to be protonated than in the wild - type. therefore, we tested modeling h218 as a general acid, demonstrating that this in fact provides activation barriers in very good agreement with experiment (table 3), suggesting that in the absence of k337, h218 takes up the role of this residue in leaving group stabilization (either through hydrogen - bonding / charge so far, we have not yet discussed the details of the proton transfer to the leaving group from either k337 or h218. in the present work, we have used a two - state valence bond model to describe this process, as outlined in the methodology section. in our model, for both the lysine- and histidine - catalyzed mechanisms (wild - type and k337a mutants, respectively), the group transfer and proton transfer reactions take place in a single, concerted but slightly asynchronous reaction step (figures s5 and s6 and table s4s6). as seen from these figures and associated table, when the general acid is modeled as being k337, the transition state is dominated by the group transfer reaction, with the proton transfer reaction taking place very slightly after the group transfer. this would tie in with the fact that the p - nitrophenol leaving group is sufficiently basic to not a priori need protonation to depart. in the case of h218 as the general acid (in the k337a mutant), the proton transfer becomes more concerted with the group transfer reaction (figure s6). this would be in agreement with our previous dft study of the hydrolysis of phosphate and sulfate monoesters, in which we carefully examined all proton transfer steps involved and demonstrated that they either immediately precede or succeed the group transfer step, but along the same reaction coordinate (without the need for discrete intermediates). such a model also agrees with high - level qm / mm calculations of the phosphoryl transfer reaction catalyzed by dutpase, which show a similar coupling between proton transfer and group transfer reactions, suggesting that a two - state vb model is adequate for capturing the key features of the relevant reaction mechanisms, and this is also borne out by the agreement with the experimental data. finally, a comparison of the electrostatic contributions of individual residues to catalysis for both substrates and all variants (figure 8) shows that, as with the wild - type reactions, changes in activity correspond to cooperative electrostatic effects, where the active site residues are able to compensate the absence of key active site residues and stabilize the transition state of different substrates. this effect was also seen in our previous computational studies of the evolutionarily related pas and has also been alluded to in other recent works. a similar phenomenon has been observed in experimental studies of serum paraoxonase 1, suggesting that such electrostatic flexibility is a feature of multiple enzymes that catalyze phosphoryl transfer. although our data strongly point toward electrostatic cooperativity as the origin for the observed selectivity and promiscuity among members of this superfamily, it is important to also examine other possible origins of this effect. before proceeding further in this discussion, it is worth mentioning that there are several different ways to define this concept, that range from an enzyme performing distinct chemistry using a similar set of residues and the same mechanism to cases where different sites of an enzyme are used to perform different chemical reactions (a form of protein moonlighting). common to all these definitions, however, is the fact that promiscuity can be regarded simply as a converse of specificity, in that a highly specific enzyme would only be able to perform a single chemical reaction, whereas a catalytically promiscuous enzyme would be able to perform multiple distinct chemical reactions. in addition, while the enzymes studied in the present work are multifunctional, with very high proficiencies for both phosphonate monoester and phosphodiester hydrolysis, they nevertheless show high selectivity and an order of preference between these and other promiscuous reactions that they catalyze (see table s1). therefore, in the present discussion, we will use specificity as a converse to promiscuity (i.e., referring to the number of reactions the enzyme catalyzes) and selectivity to indicate the discrimination between different reactions catalyzed by the same enzyme. an important point to take into account in the present work is that, with the exception of the monoesters, the reactivity of the substrates examined herein is substantially lower by several orders of magnitude under neutral conditions than at high ph (see table s1). therefore, it is plausible to consider that a part of the broad substrate specificity might result because the enhanced reactivity of the active site nucleophile by the catalytic metal center already provides substantial rate accelerations for a broad range of substrates. this would be consistent with the small effects of < 10-fold (on kcat) on the enzymatic activity of the mutation of they key residues that interact with the substrate oxygens, specifically n78 and k337. however, while having an activated nucleophile is clearly important for the overall activity toward different substrate, this in itself is not fully sufficient to describe the observed promiscuity, as there are clear variations in rate acceleration between the different substrates, even when considering the alkaline reaction as the relevant reference state for the uncatalyzed reaction (see values presented in table s1). additionally, as discussed and demonstrated in several of our previous works, despite the superficial similarities between the different transition states involved (substitution of p for s, adding or removing functional groups), they have very different charge distributions and thus solvation patterns, leading to very different requirements for efficient catalysis. this can also be seen in both the quantitative differences in the residue contributions shown in figure 6, and the fact that although multifunctional, bcpmh (for which more kinetic data is available with different substrates, see table s1 and ref (12)) shows up to 25,000-fold differences in kcat / km values toward different substrates. these range from 0.59 ms for the sulfate monoester to 1.5 10 ms for the phosphonate monoester. following from this, there is also large sensitivity among alkaline phosphatases to the nature of the leaving group. for example, in the case of bcpmh, simply changing the leaving group to phenol substantially reduces the catalytic activity for all substrates by up to 350-fold (in terms of kcat / km). in the case of ap, for which linear free energy relationships do exist, these also show moderate - to - strong leaving group dependence (see, e.g., refs (22, 79, and 80)). in particular, reported literature values for the ap - facilitated hydrolysis of sulfate monoesters phosphorothioates, phosphate monoesters and phosphate diesters all show steep leaving group dependence, with lg values in the range from 0.76 to 0.95. therefore, although the transition states are superficially very similar, the enzyme is actually highly selective between the different substrates and leaving groups. as these enzymes are all metalloenzymes, the catalytic metal center plays a major role in substrate positioning in all cases, guiding the ultimate orientation of the electrophile relative to the nucleophile. this is further facilitated by the involvement of a number of key residues that are strategically positioned to assist in overall substrate positioning, which for the pmhs studied here are n78, h218, and k337. these residues primarily interact with the leaving group or nonbridging oxygens of the relevant substrates and keep the electrophile in similar positions relative to the nucleophile for different substrates and electrophiles. however, due to the large binding pocket (10 20 wide and 15 deep), there is extensive space to accommodate variations in binding conformations of spectator and leaving groups, which in turn would facilitate the accommodation of a broader range of substrates shapes. such substrate repositioning through diversity in placement of leaving and spectator groups would therefore also play a role in determining the resulting overall catalytic efficiency and promiscuity. this is in line with our computational evidence, which highlights the importance of cooperative electrostatic interactions, brought about by active site plasticity, in accommodating a range of different substrates. tying in with this, if plasticity is important for facilitating promiscuity in these enzymes, one can ask whether flexibility would be reduced for catalysis by enzymes that show high specificity for their physiological substrates. a classical set of proteins where rigidity is very important in ligand binding specificity vs promiscuity are the periplasmic binding proteins, as illustrated by the structure of the cellulose - binding protein from thermotoga maritima. this protein has a bipartite active site, comprised of a solvent excluded region involved in highly specific ligand binding and is adjacent to a second and more flexible solvent - filled cavity in which semi - specific ligand binding occurs. detailed studies of these systems as well as exploration of the role of water molecules have provided important insight into how the interplay between flexibility and rigidity allows both specificity and promiscuity to be encoded into a single binding site, moving beyond a single highly specific and fixed protein scaffold. other examples of highly specific enzymes that show comparably rigid active sites (in the substrate - bound conformation) are orotidine 5-monophosphate decarboxylase and -phosphoglucomutase, among others. these enzymes can exist in more than one conformational form and undergo ligand - gated conformational changes, engulfing their substrates upon ligand binding. however, once the substrate is bound, crucial tight binding hydrogen - bonding networks are involved in keeping the key catalytic residues in place, and, for example, truncation of various functional groups on the respective substrates can lead to tremendous reductions in catalytic activity due to the loss of key stabilizing interactions (see, for example, richards substrate - in - pieces studies of these systems that quantify the contribution of different parts of the substrate to binding and catalysis). yet another example is a recent study of the evolution of -lactamases from their promiscuous ancestral variants to their modern specific counterparts (such as tem-1 -lactamase). this work demonstrates that, within these enzymes, evolution from a generalist to a specialist enzyme is coupled to a loss of conformational flexibility. finally, as pointed out by a reviewer, it should be noted out that the experimental work on which the present study is based was performed using nonphysiological substrates, where the leaving group is the weakly basic nitrophenoxide anion (as the physiological substrate has not been identified). the relatively small requirement for stabilizing negative charge at weakly basic anions will in turn increase the contribution of the enhanced reactivity of the active site nucleophile to the total rate accelerations outlined in table s1, facilitating the turnover of a broader range of substrates. as discussed in the introduction, the phenomenon of catalytic promiscuity appears to be common among members of the ap superfamily. although the members of this family (which include ap, npp, pmh, and pas) have diverged considerably, they still share considerable similarities in active site architecture and key catalytic residues, as highlighted in figure 1 and discussed in ref (15). in the present work, we have performed a detailed computational study of the hydrolysis of a range of substrates by two pmh, demonstrating the key role of cooperative electrostatic interactions at the pmh active site. moreover, there is no significant conformational change in the active site alongside the reaction coordinate when comparing the different reactions studied. this suggests an important role for electrostatic rather than conformational active site plasticity in facilitating the observed promiscuity in these enzymes. in order to examine this effect, we have studied the geometry of the active site cavity for different members of the ap superfamily, using the fpocket 2 software package. we have inspected several members of this superfamily, as well as related promiscuous phosphatases, in the search for a possible correlation between the physical properties of the different active sites and their corresponding catalytic promiscuity. the corresponding results are summarized in figure 9 and tables s7 and s8. from this data, it can be seen that when comparing different ap superfamily members, clear trends emerge with respect to the active site volumes and the number of activities that have been reported for each enzyme to date. specifically, according to this analysis, pockets with a larger polar surface allow the enzyme to exploit distinct residue conformations to create an optimal electrostatic environment and accommodate different transition states. in addition to this, the large volume of the different pockets would allow for the accommodation of a more diverse range of substrates, which can then be hydrolyzed through cooperative enzyme substrate electrostatic interactions in the corresponding active sites. through this comparison, we find that ap, npp, and the pmhs have the largest active site volumes and polar solvent accessible surface areas (sasas), mostly due to the width of their active sites. tying in with this, the arylsulfatases and other members of the superfamily have comparably smaller and narrower pockets. interestingly, this can be directly correlated to the number of reported activities in the literature (figure 9 and table s7) where ap has both the largest and most accessible active site as well as the highest number of reported activities. this is closely followed by npp and the pmhs, with five clear activities each (not including the anomalous pte activity of bcpmh for reasons outlined above). finally, a blast search with rlpmh against known protein structures yielded the related alkaline phosphatase, pas, as the protein with the highest sequence identity. as can be seen from figure 9, upon moving from the pmhs to pas, the active site starts to reduce in volume to give a much narrower pocket, in line with the lower number of reported activities for pas. the remaining enzymes all have smaller active site volumes compared to ap, npp, and pmh, and all of them, according to braunschweig enzyme database, have so far been reported to have only one activity each. when this observation is combined with the similar mechanisms and highly polar active site residues that members of this superfamily possess (figure 10) as well as with the experimental evidence for the existence of catalytic backups in pon1, this strongly suggests that the cooperative electrostatic flexibility observed in pmh and related enzymes is a common feature for evolution in the ap superfamily as well as related phosphotransferases. one limitation of this analysis, however, is that while we consider the total number of characterized activities, it neither takes into account the possibility of further as - yet uncharacterized activities in these enzymes nor the relative proficiency of these enzymes toward their promiscuous substrates. for example, even though ap has the highest number of known activities among the enzymes we examine, only two of those six activities (phosphate and phosphothioate monoester hydrolysis) are particularly proficient with kcat / km values of 3.3 10 and 2.0 10 ms, while the other activities can have kcat / km values as low as 10 ms. however, clearly, a very high number of polar residues in the active site, as shown in figure 10 and table s7, as well as very large active sites, would allow for the presence of multiple distinct catalytic backups and a shifting electrostatic field upon substrate binding that can accommodate substrates of other shapes and charge distributions. additionally, it is of course useful to consider not only the total binding interactions available for transition - state stabilization but also the binding interactions that are actually needed to account for a given observed enzymatic rate acceleration, because nonspecificity will be favored whenever these total possible interactions greatly exceed the number of required interactions. for example, in the case of phosphate monoester hydrolysis, strong interactions between the enzyme and heavily charged reacting phosphate may be more than sufficient to account for the enzymatic rate acceleration. this would favor a lack of specificity for the leaving group and, perhaps, also floppiness in transition - state binding, provided there is no strict requirement of the precise placement of enzymatic side chains around the phosphate. in contrast, there may be a greater requirement for precision in the binding of the less highly charged transition state for sulfate monoester hydrolysis, which would also tie in with the experimental observation that pas, a native sulfatase, is a more proficient phosphatase than the corresponding phosphatases in the ap superfamily are sulfatases. correlation between the number of known catalytically activities (in parentheses) and the total volume and sasa for several members of the ap superfamily. surface representation of the active sites of (a) burkholderia caryophylli pmh, (b) escherichia coli ap, (c) pas, and (d) xanthomonas axonopodis npp (pdb ids : 2w8s, 1alk, 1hdh, and 2gsn, respectively), displaying the polar character inside the pocket. (b) and (d) show a strong presence of negatively charged residues (red) near the metal site. for both (a) and (c), there are more apolar residues present (white), although bcpmh still has a larger number of polar residues in its active site, mostly due to the very large size of the binding pocket this would be supported by our observed correlation between larger active site volume / polar sasa and a great number of activities and is in sharp contrast to enzymes such as orotidine 5-monophosphate decarboxylase, which is highly selective for the decarboxylation of orotidine monophosphate, because the enzyme makes use of every possible interaction with omp in the stabilization of the decarboxylation state. interestingly, there appears to be also some sort of correlation between tertiary structure and the number of reported activities, in that the enzymes with the highest number of characterized activities shown in figure 9, namely ap, npp, and pmh, are dimers and a tetramer, respectively, whereas all other enzymes are monomeric. one would assume that having a large number of polar residues in the active site would result in electrostatic strain that would have to be compensated elsewhere in the structure, which could potentially be correlated to the oligomeric states of these proteins. overall, however, the clear correlation between increased promiscuity and a larger active site volume and sasa highlights the crucial importance of substrate charge and active site electrostatics in facilitated selectivity and evolution among these highly promiscuous enzymes. in the present work, we have performed a detailed evb study of both the native and several promiscuous activities of two pmh, bcpmh and rlpmh, as well as rlpmh variants with mutations in key active site residues. our calculations can reproduce key experimental observables such as experimentally observed activation barriers for the wild - type reactions of all substrates and qualitative mechanistic predictions based on examining ph - rate profiles as well as energetic trends upon mutation of key active - site residues in rlpmh. we demonstrate that despite their broad promiscuity, both pmhs studied in this work hydrolyze all five chemically distinct substrates through a unified mechanism, binding substrates in similar positions and without the need for any significant local or global conformational changes. additionally, we demonstrate that the apparent resilience of these enzymes to active site mutations as well as the overall promiscuity is due to compensatory electrostatic effects from different residues, allowing enough flexibility in the electrostatic environment of the active site to accommodate multiple substrates with distinct transition states and charge distributions. finally, we provide a detailed structural and physical comparison of a range of highly promiscuous members of the ap superfamily. these results demonstrate the strong correlation between the structural and electrostatic features of these enzyme s active sites and the corresponding variations in both substrate charge preference and the number of known promiscuous activities. this further supports our hypothesis by strongly suggesting that active site shape, size, and more critically number of polar residues available can be directly correlated the ability to accommodate increasing numbers of promiscuous activities. our simulations and comparative analysis therefore highlight the importance of cooperative electrostatic interactions and an electrostatically flexible active site as a common feature in the evolution of promiscuous side reactions among members of the ap superfamily. in the present work we demonstrate that, in addition to the electrostatic preorganization originally suggested by warshel in 1978, the active site can also electrostatically reorganize to accommodate the needs of different substrates. this provides a classical example of protein flexibility allowing the reaction to occur, as these enzymes do not know in advance what substrate is going to bind. rather, they adjust their active site environment to a given substrate after the binding step. these insights, in turn, helps us not only to understand protein evolution within a superfamily at the molecular level but also highlights a concrete feature that can be manipulated in targeted artificial enzyme design. | it is becoming widely accepted that catalytic promiscuity, i.e., the ability of a single enzyme to catalyze the turnover of multiple, chemically distinct substrates, plays a key role in the evolution of new enzyme functions. in this context, the members of the alkaline phosphatase superfamily have been extensively studied as model systems in order to understand the phenomenon of enzyme multifunctionality. in the present work, we model the selectivity of two multiply promiscuous members of this superfamily, namely the phosphonate monoester hydrolases from burkholderia caryophylli and rhizobium leguminosarum. we have performed extensive simulations of the enzymatic reaction of both wild - type enzymes and several experimentally characterized mutants. our computational models are in agreement with key experimental observables, such as the observed activities of the wild - type enzymes, qualitative interpretations of experimental ph - rate profiles, and activity trends among several active site mutants. in all cases the substrates of interest bind to the enzyme in similar conformations, with largely unperturbed transition states from their corresponding analogues in aqueous solution. examination of transition - state geometries and the contribution of individual residues to the calculated activation barriers suggest that the broad promiscuity of these enzymes arises from cooperative electrostatic interactions in the active site, allowing each enzyme to adapt to the electrostatic needs of different substrates. by comparing the structural and electrostatic features of several alkaline phosphatases, we suggest that this phenomenon is a generalized feature driving selectivity and promiscuity within this superfamily and can be in turn used for artificial enzyme design. |
gestational acute respiratory distress syndrome (ards) has an estimated incidence of 1670 per 100 000 pregnancies with a mortality rate approaching 50%. here, we present a case of a woman in her 21st week of pregnancy who developed severe ards with multiple etiologic confounders including lymphangioleiomyomatosis (lam), influenza, diffuse alveolar hemorrhage (dah) and preeclampsia. the patient progressed beyond the supportive capabilities of conventional interventions and ultimately required extracorporeal membrane oxygenation (ecmo) support. fortunately, utilization of novel therapies and timely interventions by multidisciplinary teams enabled this complicated and critically ill pregnant patient and her baby to survive. a 37-year - old, primigravid woman at 21 weeks gestational age presented to a local hospital complaining of fever, cough and progressive shortness of breath. she was initially treated for suspected pneumonia but decompensated rapidly requiring emergent intubation for profound hypoxemia. given the complexity of her illness, she was transferred to our tertiary care facility. upon admission, the patient 's chest x - ray (cxr) was notable for bilateral interstitial infiltrates, and she was therefore started on empiric broad - spectrum antibiotics and oseltamivir. she was ventilated with lung - protective settings and paralyzed to alleviate ventilator dyssynchrony. she was started on high - dose methylprednisolone for her dah, and inhaled nitric oxide (ino) was added to optimize oxygenation. after a transient period of improvement, new infiltrates were appreciated on cxr, prompting computed tomography (ct) of her chest. this revealed multiple cysts throughout the lung parenchyma, suspicious for the diagnosis of lam (fig. 1). figure 1:ct chest (axial slices in lung window) demonstrating innumerable cysts scattered throughout all lung fields without basal / apical predilection or cardiophrenic sparing. ct chest (axial slices in lung window) demonstrating innumerable cysts scattered throughout all lung fields without basal / apical predilection or cardiophrenic sparing. the patient 's hypoxemia and dah worsened, and she ultimately required venovenous ecmo support on hospital day 15. six days into her ecmo course, recombinant activated factor vii (fviia) was endobronchially instilled. ten days after commencing ecmo and at 24 weeks gestational age, the patient developed preeclampsia and hellp syndrome. the maternal fetal medicine team performed an urgent cesarean section, and a viable female neonate was delivered. simultaneously, a right - sided wedge biopsy of the lung was performed, and based on histologic findings, the diagnosis of lam was confirmed (fig. 2a d). on ecmo day 14 and post - operative day 3 from cesarean delivery she was extubated to high - flow nasal cannula (hfnc) 2 days later. over the course of 2 weeks the neonate required significant ventilatory and nutritional support but was eventually discharged home without neurologic disability. figure 2:histologic images from lung biopsy demonstrating perivascular leukocytic infiltrate (h&e 400) (a), staining for smooth muscle actin (sma 40) (b), hmb-45 (400) (c) and desmin (100) (d). histologic images from lung biopsy demonstrating perivascular leukocytic infiltrate (h&e 400) (a), staining for smooth muscle actin (sma 40) (b), hmb-45 (400) (c) and desmin (100) (d). since discharge from our institution, due to a severe perturbation in her diffusing capacity of the lung for carbon monoxide (dlco), she was started on sirolimus, a treatment for lam. her most recent pulmonary function testing (pft) revealed a dlco of 41% predicted and a 6-min walk culminated in desaturation from baseline pulse oximetry of 9880%. a representative section from her most recent chest ct, performed 8 months after discharge, figure 3:ct chest (axial slices in lung window) demonstrating interval resolution of pneumothoraces and persistent, diffuse numerous thin - walled pulmonary cysts without cardiophrenic sparing. ct chest (axial slices in lung window) demonstrating interval resolution of pneumothoraces and persistent, diffuse numerous thin - walled pulmonary cysts without cardiophrenic sparing. in pregnant patients with ards unresponsive to conventional interventions, consideration may be given for ecmo support. limited data exist regarding the effectiveness of ecmo during pregnancy ; however, the h1n1 influenza outbreak of 2009 revealed maternal survival rates of > 60% and neonatal survival as high as 70% with extracorporeal support. ecmo cannulation is complicated in the pregnant patient due to fetal inferior vena cava compression, which may impede venous drainage if femoral cannulation is required. due to anatomic limitations in our patient, thus, inflow cannulation was performed in the right internal jugular vein, and outflow cannulation was achieved in the right femoral vein. initially, intermittent increases in intrathoracic pressure due to coughing exacerbated her recirculation fraction and compromised systemic oxygen delivery, but this subsided with resolution of alveolar hemorrhage. lam is a rare and progressive systemic disease that involves smooth muscle infiltration of the lung, culminating in cystic change of lung parenchyma. the diagnosis of lam during pregnancy is associated with significantly worse maternal outcomes including an increased incidence of premature delivery. histologic studies of lam have demonstrated variable expression of estrogen / progesterone receptors, suggesting a hormonal role in the pathogenesis of lam. vegf - d is a serologic marker for lam, and levels > 800 pg / ml have been shown to have 100% specificity. tissue staining for smooth muscle actin, desmin and hmb-45 is diagnostic for lam. in a randomized controlled trial, initiation of sirolimus in patients with lam culminated in preservation of fev1 and fvc at 1 year compared with placebo ; however, this treatment effect was not sustained after cessation of therapy. limited evidence exists regarding the safety of mtor inhibitors, specifically sirolimus, during pregnancy. dah is a syndrome characterized by injury to the alveolocapillary basement membrane, resulting in red blood cell extravasation into the alveolar spaces. treatment largely relies on supportive care ; however, a small denmark series demonstrated that local (endobronchial) administration of recombinant activated factor vii (fviia) at 50 mcg / kg in 50 cc of normal saline may be beneficial. the therapeutic effect of endobronchial fviia draws on its ability to directly bind receptors on the alveolar surface where tissue factor resides in large concentrations. in conclusion, this is the first reported case of lam - associated gestational ards requiring ecmo. the individual contributions of influenza, dah, lam and severe preeclampsia are difficult to quantify in this complicated patient. endobronchial administration of fviia to treat dah in a pregnant patient with lam is novel. most importantly, the initiation of ecmo support was critical to the survival of our patient and her child. despite its technical challenges | gestational acute respiratory distress syndrome (ards) is a complicated problem with the potential to gravely harm both mother and fetus. this case report describes a young woman in her second trimester of pregnancy who developed progressive respiratory failure in the setting of newly diagnosed influenza, diffuse alveolar hemorrhage and lymphangioleiomyomatosis. the patient 's condition was refractory to conventional interventions and required extracorporeal membrane oxygenation (ecmo) support. her course was further complicated by preeclampsia requiring preterm delivery with cesarean section while on ecmo. through novel therapies and a multidisciplinary approach to care, both the patient and her child would overcome these unique and challenging conditions and survive. |
renal cell carcinoma (rcc) is the most common cancer of the kidney, accounting for 85% of renal tumors. according to the american cancer society estimates, rcc is the seventh most common cancer and is the tenth leading cause for cancer - specific deaths. data from india regarding the incidence and mortality of rcc are lacking, but rcc does not figure in the top ten cancers - incidence and mortality wise. up to 30% patients with rcc present with metastatic disease and recurrence develops in approximately 40% of patients treated for a localized tumor. there has been a paradigm shift in the management of metastatic rcc (mrcc) with the emergence of tyrosine - kinase inhibitors (tkis) and monoclonal antibodies as systemic therapy. despite these advancements, survival has largely remained unchanged, and prognosis for stage iv disease continues to remain poor. all patients with a histopathological diagnosis of rcc in tertiary care university hospital in south india between january 2009 and december 2013, and a minimum follow - up of 12 months were included in this analysis. all patients with metastatic disease received sunitinib as the first line therapy, irrespective of histology and risk score. analysis consisted of demographic profile, sites of metastases, starting dose of sunitinib, response, toxicity profile, progression - free survival (pfs), and overall survival (os). the presence of comorbidities especially smoking, obesity, and chronic renal failure (chronic kidney disease [ckd ]) were noted. patients were started on sunitinib at a dose of 37.5 mg or 50 mg once a day based on eastern cooperative oncology group performance score. the schedules followed were 4 weeks on and 2 weeks off drug, or a 2-week on 1-week off schedule. response evaluation was done using response evaluation criteria in solid tumors version (recist) criteria. response was classified as complete response (cr), partial response (pr), stable disease (sd), or progressive disease (pd). clinical progression and cancer - related deaths progression - free survival was calculated as the time between the start of therapy and the date of progression or death from any cause. os was calculated as the time between start of therapy and the date of death due to any cause. toxicity profile was calculated according to the common terminology criteria for adverse effects version 4.0. the median age of patients at presentation was 58 years (range : 1580 years). risk factors such as smoking, obesity, and ckd were noted in 64 (59.25%), 36 (33.33%), and 9 (8.33%), respectively. the most common presentations were hematuria in 64 patients (59.25%) followed by loin pain in 62 patients (57.4%). the clinical triad of hematuria, loin pain, and fever was present in 23 patients (21%) only [table 1 ]. demographic and clinical characteristics of patients with renal cell carcinoma in this study, most of the patients were included in intermediate and poor risk except 3.7% of the study group, which was depicted in table 2. heng risk stratification the histopathological variants and sites of metastases are mentioned in tables 3 and 4, respectively. clear cell carcinoma was the most common histologic variant, reported in 84.25% of patients. of the 108 patients, 34 (31.48%) had localized disease and the remaining 74 (68.51%) had metastatic disease at initial presentation [table 5 ]. the most common sites of metastases were lung in 47 patients (48.45%), followed by bone in 23 patients (23.71%). the 34 patients who had radical nephrectomy for localized disease, 23 (67.64%) became metastatic over a median period of 13.65 months. palliative nephrectomy was done in 26 patients with persistent hematuria or intractable pain in which 21 (80.76%) patients had disease progression. the number of patients eligible for sunitinib at first visit was 97 (89.98%). out of them, 74 (76.28%) patients had metastasis upfront and 23 (13.70%) patients developed metastasis later on during the course of follow - up. of the 74 patients who had metastasis at presentation, 21 (28.37%) patients did not return after the first visit and a further 28 were lost to follow - up after one cycle. seventy - six (78.35%) patients received sunitinib at a dose of 50 mg / day or 37.5 mg / day based on ps (ps 0 - 1 - 50 mg and ps 2 - 37.5 mg). in these 76 patients who are eligible for sunitinib, 28 (36.84%) received only one cycle and lost for follow - up the remaining 48 (49.98%) patients had received at least two cycles of sunitinib (range : 236). of the 48 patients, 40 (83.33%) were started on 4 weeks on and 2 weeks off schedule and 8 were started on 2 weeks on 1 week off schedule. the most common adverse effect noticed in our population was mucositis in 31 patients (18.67%) followed by hand - foot syndrome in 25 patients (15.06%). the treatment response is measured using recist criteria and response achieved is shown in table 7. after disease progression, only seven patients received second - line treatment, three received sorafenib, and four received everolimus. cigarette smoking doubles the likelihood of renal - cell carcinoma and contributes to as many as one - third of all cases. obesity is also a risk factor, particularly in women, in whom there is a linear relation between increasing body weight and the increased risk of renal - cell carcinoma. lung metastases are the most common sites of distant relapse, occurring in 50%60% of patients. the median time before a relapse after nephrectomy is 1518 months, and 85% of relapses occur within 3 years. approved agents for first - line use in clear cell rcc include pazopanib, sunitinib, and bevacizumab and interferon combination according to esmo and nccn guidelines. in nonclear cell variants, this study was carried out in mrcc, and the objectives were to evaluate the demographic profile, sunitinib, adverse effects, response rates, and survival. comparison of our study with previous studies the median age of presentation in our study is 58 years. this is lower than other studies by motzer. and yuasa. similar to other studies the males were more than females in our study, however, the ratio of male to female was much higher (9.8:1) when compared to those studies. the percentage of patients who were eligible for sunitinib in our study (i.e. with a performance score of 01) was lower when compared to other studies. delay in diagnosis, poor follow - up after radical nephrectomy, compliance, lack of awareness, and lack of cancer care centers might be reasons for a low - performance score at presentation. the percentage of patients who were anemic (low hb - which is a risk stratification parameter) at presentation was more in our study when compared to other studies ; this may be because of poor nutrition and low - socioeconomic status. the number of patients who had calcium < 10 g / l was more in our study when compared with yuasa. the percentage of patients with ldh more than 1.5 times the upper limit of normal was 64.81%. it was less when compared with 80.95% in yuasa. in our study, 68.42% of patients presented earlier with metastatic disease, i.e., < 1 year when compared to 47.61% in yuasa. the most common histology seen in our population was clear cell carcinoma seen in 84.25% which was similar to other studies. the most common site of metastasis was lung followed by bone and liver metastasis which was similar to other studies and the least common site of metastasis was the brain. only 55.55% of our patients underwent nephrectomy when compared to 77.77% in yuasa. and 90.2% in kim. the clinical efficacy rate (cr + pr + sd) was 86% in our study when it was 81% in yuasa. and the median values of pfs [figure 1 ] and os [figure 2 ] in our patients were similar to other previous studies. the median pfs was 10.2 months in our study, 11.4 months in krishna., 9.3 months in yuasa., 8.2 months in kim., and 11.0 months in motzer meier estimates of progression - free survival (pfs) kaplan meier estimates of overall survival (os) the median os in our patients was similar to previous reports. the median os in our patients was 28.2 months when compared to 22.6 months in krishna., 32.2 months in yuasa. and 23.1 months in kim. despite our patients faring worse in nutritional parameters such as hemoglobin, body mass index, serum calcium, and ps, the median os and pfs are similar to other studies probably hinting toward better disease biology among our patients which needs further validation in large - scale studies. a few limitations of this study are its retrospective nature, small sample size, and high levels of attrition. median values of os and pfs in this study are similar to other reported studies despite the presence of poor risk factors in the patient population. the pitfall in this study is significant attrition due to poor compliance to treatment and follow - up, which is a major factor in the clinic, limiting optimal, and standard treatment, thereby compromising outcomes. this poor follow - up may be due to toxicity, major concern which needs tailoring the dose of therapy, adequate counseling, and careful follow - up which are essential for better outcomes. | introduction : renal cell carcinoma (rcc) is the most common cancer of the kidney accounting for 85% of renal tumors. metastatic rcc (mrcc) had a poor prognosis and with the introduction of tyrosine - kinase inhibitors, such as sunitinib, pazopanib the outcomes improved. there is only one study reported from india on the use of sunitinib in mrcc. we present our analysis of mrcc and use of sunitinib at our institute over 5 years.materials and methods : all patients with mrcc receiving sunitinib were analyzed with respect to patient characteristics, response, toxicity, and outcomes.results:a total of 108 patients were seen during the study period. the male to female ratio was 9.8:1. the median age of patients at presentation was 58 years (range : 1580 years). of the 108 patients, 68.51% had metastatic disease at initial presentation. the most common sites of metastases were lung followed by bone. of the 97 patients eligible for sunitinib, only 76 received at least one cycle of sunitinib, out of which only 48 received further cycles (range : 236). the median progression - free survival (pfs) and overall survival (os) in our patients were 10.2 and 28.2 months, respectively. the most common adverse effect noticed in our population was mucositis followed by hand - foot syndrome.conclusion:sunitinib is an option for the treatment of mrcc and shows a good pfs in indian patients. median os and pfs in this study are similar to other reported studies despite the presence of poor risk factors in the patient population. the pitfall in this study is significant attrition due to poor compliance to treatment and follow - up, which is a major factor in the clinic thereby compromising outcomes. |
classic polyarteritis nodosa (cpan) is a multisystem disease characterized by necrotizing nongranulomatous vasculitis of medium - sized or small muscular arteries without glomerulonephritis1 and was first described by kussmaul and maier in 1866.2 the clinical features vary widely depending on the size and extent of involvement of the vessel.3,4 the organs commonly affected are soft tissue, muscles, the gastrointestinal system, and the nervous system, but, unlike microscopic polyangiitis (mpa), it spares the lungs.5 involvement of visceral and renal arteries is characteristic, but although polyarteritis nodosa is known to involve the kidneys,6 it is uncommon for it to present as acute renal failure (arf), and, to our knowledge, cpan presenting as acute interstitial nephritis is virtually unknown. acute interstitial nephritis, as described by councilman in 1897, is an acute inflammation of kidney characterized by cellular and fluid exudation in interstitial tissue, accompanied by degeneration of epithelium. additionally, although corticosteroids and immunosuppressants improve prognosis of patients with cpan, there is no consensus on the most appropriate therapy for cpan with arf, and prognosis of the disease remains uncertain. here we present a patient with arf due to polyarteritis nodosa manifesting clinically as acute interstitial nephritis who responded to immunosuppressants. a 69-year - old woman presented to our hospital with a 2-week history of nausea, abdominal pain, extreme generalized weakness and fatigue, and a 1-week history of poor oral intake. additionally, she had noticed a new onset of pruritic rash over the abdomen, spreading over the trunk. two weeks prior to the onset of her symptoms, she had presented with dysuria to her primary care physician and was treated with a week s course of ciprofloxacin for presumed urinary tract infection, but, despite this, her symptoms persisted. her past medical history was significant for atrial fibrillation, lumpectomy for breast cancer, done six years previously, and diverticulosis. on examination at our institution, her temperature was 37.2 c, her blood pressure was 110/70 mmhg, and her pulse rate was 156 beats per minute. positive physical examination findings were a diffuse, predominantly truncal, maculopapular, erythematous rash. examination of her lower extremities revealed severe tenderness over both calf areas but no pedal edema. laboratory data revealed hemoglobin (hb) 9.7 g / dl, hematocrit 32.2%, leukocyte count of 9300 cells / ul (differential : granulocytes 91%, lymphocytes 2%, monocytes 6%, and eosinophils 1%), platelets of 276,000/mm3, blood urea nitrogen (bun) of 134 mg / dl (normal, 1020 mg / dl), creatinine, 11.6 mg / dl (her baseline creatinine a month prior to her presentation was 1.1 mg / dl). mmol / l) ; chloride, 88 mmol / l (normal, 96106 mmol / l) ; potassium, 4.2 mmol / l (normal, 3.55.1 mmol / l) ; phosphorus, 7.5 mg / dl (normal, 2.74.5 mg / dl) ; and bicarbonate, 18 mmol / l (normal, 2432 mmol / l). urine analysis showed specific gravity of 1.010 ; trace proteins, 3 to 5 dysmorphic red blood cells ; no casts and no leucocytes ; and glucose, 50 mg / dl. the 24-hour urine microalbumin / creatinine ratio was 797 mcg / mg with a urine creatinine of 30.6 mg / dl. although there was no peripheral eosinophillia, her urine was positive for eosinophils by wright s stain. serum protein electrophoresis was normal, while her antinuclear antibody and serologies for hepatitis b and c were all negative. her complement component3 (c3) was normal at 112 and complement component 4 (c4) was mildly depressed at 15.1. enzyme - linked immunosorbent assay (elisa) was used to test for presence of serum myeloperoxidase - antineutrophil cytoplasmic antibodies (mpo - anca) ; this was found elevated to 54 eu, (normal value is 140 mm / hr, the results of tests that were done after the biopsy diagnosis was made. a renal biopsy was performed after admission, and it showed acute necrotizing intrarenal vasculitis with diffuse acute ischemic tubular injury. low magnification showed an interlobular or arcuate artery showing full - thickness fibrinoid necrosis with luminal occlusion. one glomerulus out of 25 in the specimen showed a fibrocellular crescent and global glomerulosclerosis. an magnetic resonance image of the brain at that time revealed nonspecific white matter signal changes, likely representing small vessel ischemic disease but vasculitis could not be definitively ruled out. renal arteriogram was negative for micro aneurysms. given her severe uremia, she was placed on intermittent hemodialysis via a split - tip tunneled hemodialysis catheter. in addition, she was started on a daily oral cyclophosphamide at a dose of 1 mg / kg / day and daily oral prednisone at a dose of 1 mg / kg / day initially. six weeks into her treatment, her creatinine fell to 1.9 mg / dl and intermittent hemodialysis was discontinued (table 1). vasculitis is a rare entity, which comprises distinct groups often based on the size and site of the part of the vascular tree involved. renal involvement is likely due to ischemic injury as a result of luminal vascular occlusion by the inflammatory process and manifests as varying degrees of renal insufficiency, hypertension, and hematuria. polyarteritis nodosa is a systemic vasculitis that involves medium and small muscular arteries and presents with constitutional symptoms of fever, malaise, extremity and calf pains, purpura, and skin rash. drug - induced acute interstitial nephritis, on the other hand, often manifests with rash, fever, eosinophilia, eosinophiluria, and acute renal failure, usually after ingestion of an offending drug. added to the usual protean symptoms of malaise, myalgia, and fatigue for months, our patient had presented with a new - onset diffuse rash and rapidly progressive acute renal failure. with a history of having been exposed to a quinolone antibiotic, the presence of a new - onset truncal rash, acute renal failure on laboratory data, and eosinophils in the urine, we made a presumptive clinical diagnosis of drug - induced acute interstitial nephritis. the renal biopsy as previously mentioned, however, showed acute necrotizing and intrarenal vasculitis, diffuse acute ischemic tubular injury, fibrinoid necrosis, and a fibrocellular crescent. ancas are seen in about 50% to 80% of patients with mpa and are positive in 10% of patients with polyarteritis nodosa.9 in one series, 2 of the 5 reported cpan cases with rprf were positive for mpo - anca.7 the chapel hill consensus conference, in 1994, suggested the term microscopic polyangiitis to describe the phenomenon of pauci - immune vasculitis affecting primarily small vessels and the presence of pulmonary capillaritis and glomerulonephritis.1 the terminology sought to differentiate this syndrome from classic polyarteritis nodosa, which the conference felt needed to be restricted to arteritis involving medium - sized and small arteries without involvement of smaller vessels. therefore, patients with vasculitis affecting arterioles, venules, or capillaries, including glomerular capillaries, were excluded from this class. this reclassification has led to many more diagnoses of mpa and the concomitant decrease in the prevalence of polyarteritis nodosa.10 however, despite this proposed distinction, separating these two phenomena clinically is not always straightforward, and our patient with the albeit rare crescent, positive myeloperoxiase - antineutrophil cytoplasmic antibodies, absence of hepatitis b, and negative arteriogram was initially classified in the mpa category. however, the absence of small vessel involvement, the absence of significant proteinuria, the dominant involvement of medium arteries on biopsy, and the paucity of glomerulonephritis pointed to cpan. also, she met 3 of the 10 criteria, that is, myalgias and calf tenderness, elevated bun and creatinine not related to obstruction or dehydration, and a tissue biopsy with appropriate histological changes set forth by the 1990 american11 college of rheumatology criteria for classification of polyarteritis nodosa. hence, she was reclassified as idiopathic polyarteritis nodosa. despite multiple attempts, there still remains a dilemma with classification of vasculitis.13 there has been a revision of the international chapel hill consensus (chc) conference nomenclature in 2012, which has differentiated cpan from anca associated vasculitis (aav) by the presence of anca.13 intriguingly, our case, based on the current nomenclature classification, could be classified under mpo - anca. however, it remains that there is predominant glomerulonephritis, mostly associated with small vessel disease. the majority of the mpo - anca vasculitis variants are associated with pulmonary capillaritis, with no clinical evidence in our case. it is also true that pan and anca - associated vasculitis can exhibit clinically and pathologically indistinguishable necrotizing arteritis of medium and small arteries.14 thus, despite the new nomenclature for epidemiological differentiation, we believe this is idiopathic polyarteritis nodosa with a rare anca positivity. this is an unusual clinical manifestation of cpan. in one review of 10 cases of interstitial nephritis by dixon,12 therefore, on the one hand, this demands that clinicians bear this in mind when faced with a seemingly obvious case of drug - induced ain and, on the other hand, demonstrates the potential for good response of this unique cpan syndrome to chemotherapy even in the face of clinically severe renal failure requiring dialysis. we believe the patient s overall prognoses improved due to earlier diagnosis, rapid initiation of treatment, and careful treatment monitoring. early and accurate diagnosis is very important as delay in management worsens morbidity and mortality risks and also diminishes the odds for renal recovery. despite being dialysis - dependent on admission, a dramatic clinical response was observed in the subsequent weeks, with nearly complete resolution of the kidney injury with immunosuppressive combination therapy using cyclophosphamide and prednisone. although this combination is frequently used for treatment of systemic vasculitis to induce remission, their use is often complicated by drug toxicity and deleterious side effects. however, inadequate dosing and treatment leads to relapses and thus organ damage from vasculitis.8 we therefore considered histological examination, in our case the kidney biopsy, as essential for correct diagnosis and appropriate treatment. as previously noted, she was successfully treated with immunosuppressive therapy using prednisone and cyclophosphamide. in conclusion, we encountered a patient with biopsy - proven cpan with a rare mpo - anca positivity who developed arf but nevertheless showed good outcome with immunosuppressive treatment. to our knowledge, there is a paucity of literature of cases of classic polyarteritis nodosa manifesting with arf and clinical presentation of acute interstitial nephritis. timely recognition of this clinical entity and obtaining histological confirmation are crucial key steps in its management, while early initiation of immunosuppressive treatment potentially bodes well for the afflicted patient even in the face of dialysis - dependent renal injury. | in the medical literature, there have been few reported cases of classic polyarteritis nodosa (cpan) presenting with acute renal failure (arf) and, unlike microscopic polyangiitis (mpa), no documentation to our knowledge of cpan with clinical presentation similar to acute interstitial nephritis. we describe a case of arf and a clinical picture suggestive of acute interstitial nephritis (ain). however, renal biopsy of this patient showed acute necrotizing intrarenal vasculitis, suggestive of cpan. although no guidelines exist for the most appropriate therapy for patients presenting in this fashion, combination therapy with cyclophosphamide and steroids, in our patient, resulted in clinical improvement and resolution of dialysis - dependent renal failure. these findings suggest the potential for good prognosis in patients with cpan who present with a presumed diagnosis of ain and dialysis - dependent arf. |
hepatoid adenocarcinoma (hac) is a very unusual histological type of primitive extrahepatic cancer. hac can virtually never be distinguished at pathologic examination, on the basis of morphology alone, from hepatocellular carcinoma, whose gross and microscopic features (sheet - like or trabecular proliferation of neoplastic cells with abundant, eosinophilic cytoplasm, arranged in a solid pattern with sinusoid - like spaces lined by endothelium) it shares. a final differential diagnosis can be obtained, in most cases, only through immunohistochemistry. as possible origins of this tumor, cancer arising from ectopic liver cells embedded in the organs where hac develops and neoplastic transformation of persistent germ cells or of nonhepatic epithelium capable of multipotential differentiation have been hypothesized. the majority of hacs produce alpha - fetoprotein, whose plasma levels may be very high ; however, some cases have been described in whom alpha - fetoprotein was normal. hac occurs in patients with no history of hepatic disease, alcoholism or addiction to other potential sources of hepatic damage ; their livers demonstrate no functional or morphological abnormalities. blood samples do not reveal elevated levels of hepatic enzymes, and imaging examinations fail to detect any major alteration as to volume and structure of the liver, except in the cases where hepatic metastases develop. no more than 30 hacs, to our knowledge, have been reported to date. twelve of them, in most cases leading to a poor prognosis, occurred in the lungs ; moreover, 2 histologically inhomogeneous pulmonary cancers have been described containing scattered hepatoid foci [9, 10 ]. the majority of extrapulmonary hacs occur in the stomach, while 1 or 2 cases each were found in the mediastinum, esophagus, gallbladder, pancreas, ampulla of vater, renal pelvis, bladder, endometrium, ovary, and testicle. we were not able to find, in the english literature, any published paper reporting soft - tissue localizations of hac. a 68-year - old nonsmoker, nonalcoholic woman, who did not report any exposition to agents inducing liver damage and who had no history of hepatic or pulmonary disease nor of any kind of cancer, underwent a conventional radiography of her left shoulder, complaining of localized pain. an ill - defined radiolucent area (fig. 1a), expression of osteolysis, was found within the scapula. a magnetic resonance examination of the shoulder was therefore performed a few days later, which demonstrated a large (8 5.5 4.5 cm) smooth - margined mass, moderately inhomogeneous and fairly enhancing after intravenous administration of paramagnetic contrast medium, infiltrating the scapular girdle both in its muscular (mainly in the supraspinatus muscle) and in its bony component (fig. 1b, c), confirming the radiographic finding and indicating a malignant soft - tissue mass with adjacent bone invasion. ultrasound - guided fine - needle aspiration biopsy of the soft - tissue mass showed malignant cells in a trabecular pattern containing biliary thrombi (fig. 2) ; these features were considered by the pathologist a clue to the diagnosis of a soft - tissue localization of a hepatocellular carcinoma. no significant abnormalities were found in blood samples : in particular, hepatic enzymes, the other liver function parameters and the serum level of alpha - fetoprotein (2.4 ng / ml) were all normal. moreover, at both ultrasound and computed tomography (ct) examinations the liver had normal size and margins, with normal hepatic vessels ; no focal lesions were detected and echotexture and density were homogeneous. a 4.5 4 4 cm solid, partly inhomogeneous mass with pleural adhesion was, however, found at ct in the upper lobe of the left lung (fig. pathologic examination of a ct - guided biopsy of the pulmonary mass revealed hepatocellular carcinoma - like neoplastic tissue whose pattern was undistinguished from the specimen obtained in the soft - tissue mass. a double localization of hac, in the lung and in the soft tissues of the shoulder, was therefore diagnosed, the latter presumably being a metastasis from the former. fifteen months after the diagnosis, she is alive and symptom - free ; the size of both the soft - tissue and the pulmonary lesions has significantly reduced and no further localizations have appeared in any other organ or in the lymph nodes. due to its low prevalence, hac is never taken into consideration when an extrahepatic mass is found at imaging or endoscopy. one might suspect that in some cases of hac the correct diagnosis is not achieved, particularly in the elderly or in patients with severe underlying disease, in whom the diagnostic workout sometimes concludes with a generic cytological ascertainment of the presence of malignant cells within a lesion. in addition to its rarity, hac may be underdiagnosed because of the absence of unequivocal imaging features. in the only paper published in the radiological literature on this topic some ct characteristics have been identified as relatively common to hacs, whatever their localization. according to these authors, hacs are usually large - sized tumors, with the same density of the normal liver at baseline scan (the presence of necrotic areas, however, often makes masses appear inhomogeneous), and moderately enhance after intravenous iodinated contrast medium administration ; invasion of adjacent anatomical landmarks (such as the pleural surface for pulmonary hacs), regional lymphadenopathies and distant metastases are frequently observed. in this series, however, only one of the tumors was localized in the lung, and none of the imaging features described is considered by the authors themselves typical enough to direct the diagnosis. 3) shares some of these ct characteristics (large size, slight inhomogeneity, adhesion to the pleura), its features being nevertheless largely nonspecific. similar characteristics as to volume, structure and invasion of the adjacent tissues (fig. 1b, c) can be identified in the shoulder mass, which makes our case unique : to our knowledge soft - tissue hacs have never been previously described, either isolated or in association with involvement of the lung, the stomach or other organs. moreover, serum alpha - fetoprotein in our patient was normal, which did not aid the diagnosis. on the other hand, to date this patient has experienced a better prognosis than the average of her counterparts. in conclusion, we suggest that hac although rare should be included in the differential diagnosis when, in patients with a normal liver (especially if serum alpha - fetoprotein is raised), a mass similar in histology to hepatocellular carcinoma is found at any extrahepatic location. | hepatoid adenocarcinoma (hac) is a rare type of extrahepatic cancer, whose pathologic features are indistinguishable from those of hepatocellular carcinoma. about thirty cases, nearly half of which occurring in the lung, have been described in patients with a normal liver. no imaging features are typical enough to allow a correct diagnosis. a localization of hac in the soft tissues of the shoulder with invasion of the scapula in a woman without other symptoms is reported in this paper ; soft - tissue hacs have never been described to date. an associate pulmonary hac was eventually found in this patient. |
end - stage renal disease (esrd) is one of the most serious complication of systemic lupus erythematosus (sle) and caries significant short- and long - term morbidity. approximately, 50% of sle patients have clinical evidence of lupus nephritis (ln) at the time of diagnosis, with an even greater incidence of esrd among children and adolescents. even with aggressive therapy, some patients with active proliferative ln will have a decline in renal function leading to esrd. recent clinical studies including a number of randomized controlled treatment trials of sle patients with renal disease have clarified the therapeutic role of a variety of immunosuppressive regimens both in proliferative and membranous ln. the goal of each of these trials has been to achieve clinical efficacy with a remission of the nephritis while minimizing deleterious side effects of treatment. the histopathologic classification of ln continues to guide therapy, and treatment for all major classes of ln has seen some shift in management during this time. the treatment of ln today is markedly different that it was a decade ago. in this report, we are introducing a newly designed treatment algorithm on how to most effectively prevent the esrd in children with ln. genetics and environmental and hormonal factors all play a role in the predilection to sle and perhaps to ln. the disease process, including a breakdown in self - tolerance, polyclonal hyperactivity of b cells along with defective auto - regulation of t cells that leads to autoantibody production, and deposition of immune deposits with a subsequent inflammatory responses. there is evidence that increased apoptosis and impaired clearance and defective clearance of apoptotic cells facilitate the emergence of anti - dna antibodies and immune complex formation. the deposition of circulating immune complexes, the in situ formation of others and the activation of complement are major components of glomerular involvement in ln. these include the size, charge, and avidity of the immune complexes as well as the clearing ability by the mesangium and local hemodynamics. the glomerular localization of immune complexes activates complement - mediated damage, procoagulant factors, leukocyte chemo - attraction, and release of cytokines associated with cellular proliferation and matrix formation. in some patients, vascular and tubulointerstitial damage the presentation of childhood ln can be quite variable, often few signs or symptoms exist. from 30% to 50% of patients have clinically evident renal disease at presentation, but renal involvement occurs in as many as 60 - 80% of patients during the disease course and the risk of progression to esrd is 18 - 50%. ln is manifested by proteinuria, micro hematuria with dysmorphic erythrocytes and erythrocyte casts. in some, development of ln other patients, including those with proliferative disease and some with membranous lupus nephropathy, develop the nephrotic syndrome, hypertension, and anemia. nephrotic patients with membranous lupus and lupus patients with anti - phospholipid antibodies are particularly pre - disposed to thrombotic complications such as deep vein thrombophlebitis, renal vein thrombosis, and pulmonary emboli. clinical risk factors at the time of initial presentation include elevated serum creatinine, hypertension, nephrotic range proteinuria, anemia and black and hispanic race and ethinicity. all patients with clinical and laboratory evidence of active ln should undergo renal biopsy in order to determine the type and severity of glomerular lesion according to international society of nephrology / renal pathology society (isn / rps) classification of ln. biopsy is most highly recommended in patients with sle who present with abnormal serum creatinine, hematuria, proteinuria > 0.5 g/24 h or spot urine protein / creatinine ratio of > 0.5 and active urine sediment. in general, isn / rps class i denotes normal glomeruli by light microscopy but with mesangial immune deposits by immunofluorescence (if) and electron microscopy. isn / rps class ii, which is mesangial proliferative ln, is characterized by mesangial hypercellularity demonstrated by lm, with greater than three mesangial cells in areas away from the vascular pole by lm as well as mesangial immune deposits. isn / rps class iii is focal ln, defined as focal segmental and/or global endocapillary and/or extra - capillary glomerulonephritis affecting less than 50% of the glomeruli. it is characterized by segmental and/or global endocapillary and/or extra - capillary glomerulonephritis affecting more than 50% of glomeruli [table 1 ]. ln class iv is subdivided into diffuse segmental versus diffuse global proliferation, and both class iii and iv may have active a (proliferative), and inactive chronic c (sclerosing) lesions. sle patients may have combined lesions noted as class iii plus v or iv plus v. class vi is defined as advanced sclerosing ln with more than 90% global glomerular sclerosis. in ln, full house staining (the presence of igg, iga, igm, and c3 and c1q) is very suggestive of ln as is if deposition along the tubular basement membranes and the glomerular basement membranes [table 1 ]. international society of nephrology / renal pathology society classification of lupus nephritis prompt diagnosis after the onset of ln and subsequent initiation of appropriate therapy are associated with improved outcomes regardless of the histologic subclass. patients with active proliferative ln (class iii and class iv) should receive intravenous methylprednisolon (mp) 1.0 g / m / day for 1 - 3 days then prednisone 0.5 - 1.0 mg / kg / day tapered to 0.5 g/24 h or spot urine protein / creatinine ratio of > 0.5 and active urine sediment. in general, clinical renal manifestations isn / rps class i denotes normal glomeruli by light microscopy but with mesangial immune deposits by immunofluorescence (if) and electron microscopy. isn / rps class ii, which is mesangial proliferative ln, is characterized by mesangial hypercellularity demonstrated by lm, with greater than three mesangial cells in areas away from the vascular pole by lm as well as mesangial immune deposits. isn / rps class iii is focal ln, defined as focal segmental and/or global endocapillary and/or extra - capillary glomerulonephritis affecting less than 50% of the glomeruli. it is characterized by segmental and/or global endocapillary and/or extra - capillary glomerulonephritis affecting more than 50% of glomeruli [table 1 ]. ln class iv is subdivided into diffuse segmental versus diffuse global proliferation, and both class iii and iv may have active a (proliferative), and inactive chronic c (sclerosing) lesions. sle patients may have combined lesions noted as class iii plus v or iv plus v. class vi is defined as advanced sclerosing ln with more than 90% global glomerular sclerosis. in ln, full house staining (the presence of igg, iga, igm, and c3 and c1q) is very suggestive of ln as is if deposition along the tubular basement membranes and the glomerular basement membranes [table 1 ]. prompt diagnosis after the onset of ln and subsequent initiation of appropriate therapy are associated with improved outcomes regardless of the histologic subclass. patients with active proliferative ln (class iii and class iv) should receive intravenous methylprednisolon (mp) 1.0 g / m / day for 1 - 3 days then prednisone 0.5 - 1.0 mg / kg / day tapered to < 0.5 mg / kg / day after 8 - 12 weeks of treatment plus mycophenolate mofetil (mmf) 1.2 g / m / day for 6 months followed by maintenance lower doses of mmf 0.6 g / m / day or azathioprine (aza) 2 mg / kg / day for 3 years. kidney disease improving global outcomes (kdigo) recent guideline for glomerulonephritis recommends cyclophosphamide (cyc) induction therapy for patients with severe proliferative (class iii / iv) ln, with respect to level of proteinuria, and decline in renal function. furthermore, based on the kdigo guideline one can not conclude that induction therapy with mmp is equal or superior to cyc therapy in terms of future renal function and numbers of flares as the long - term follow - up in the randomized clinical trials reported with mmf therapy are shorter than the cyc containing regimen. patients with membranous ln (class v) plus diffuse or local proliferative ln (class iii and class iv) should receive either the standard 6 monthly pulses of cyc (0.5 - 1 g / m / month) followed by infusion every 3 month or to a shorter treatment course consisting of 0.5 g / m iv cyc every 2 weeks for six doses (total dose 3 g) followed by maintenance therapy with daily aza (2 mg / kg / day) or mmf (0.6 g / m / day) for 3 years. both regimens are equally effective, but the shorter regimen is less toxic with fewer severe and total infections. controlled clinical trials and meta - analyses compared treatment with cyc to mmf found that mmf - treated patients had greater reductions in proteinuria, improved renal histology with fewer adverse effects. with the results of these clinical trials, mmf is considered as a first - line induction agent for severe ln. patients with membranous ln (pure class v) and subnephrotic proteinuria do extremely well regardless the treatment and may be treated with low doses mmf (1.2 g / m / day) and prednisone 0.5 mg / kg / day. in class v ln with nephrotic syndrome both mmf and iv cyc proved equivalent in inducing partial or complete remission of the nephrotic syndrome. patients with class vi ln generally do not response to immunosuppression and should be prepared for renal replacement therapy. in a large randomized controlled trial of 86 patients with diffuse proliferative ln (classes iii and iv) with or without membranous ln (class v) showed that treatment with plasmapheresis, prednisone, and short - term oral cyc led to a more rapid decline in circulating autoantibody levels, but no difference in outcome when compared with prednisone and cyc alone. in patients fail to respond adequately to induction therapy within 6 months, a switch from either cyc to mmf or from mmf to cyc plus pulse mp followed by daily low dose prednisone is probably more effective than no change in their medications. combination of mmf plus rituximab or mmf plus calcineurin inhibitors may be an effective co - therapy for those refractory to induction or maintenance therapies. there are limited data on the use of repeated dosing of rituximab either every 6 months or when the cd19 - 20 b cell count rises. aza = azathioprine, ci = calcineurin inhibitors, cyc = cyclophosphamide, mp = methylprednisolone, pd = prednisone a number of adjunctive agents have proved helpful in treating ln patients including angiotensin - converting enzyme inhibitors or angiotensin - receptor blockers. use of hydroxychloroquine is recommended for all patients with ln regardless of the type or severity of glomerular lesions. the use of hydoxychloroquine may help with extra - renal symptoms, but there are only limited data on their effect in renal involvement. the treatment of ln has changed significantly over the past decade because of new data from well - conducted randomized clinical trials on how to best treat ln by achieving favorable outcomes with the least amount of therapy - associated toxicities. the current approach to treating ln has largely been guided by histologic findings by isn / spn classification with appropriate consideration of presenting clinical parameters and degree of renal impairment. new regimens using lower doses and shorter treatment durations of intravenous cyc have been advanced to reduce toxicity without sacrificing efficacy of therapy. mmf has emerged as a viable alternative to cyc for induction therapy for both proliferative and membranous ln. large controlled clinical studies using the mmf and aza for maintenance therapy have been approved. | chronic kidney disease is one of the most common complication of systemic lupus erythematosus, which if untreated can lead to the end - stage renal disease (esrd). early diagnosis and adequate treatment of lupus nephritis (ln) is critical to prevent the chronic kidney disease incidence and to reduce the development of esrd. the treatment of ln has changed significantly over the past decade. in patients with active proliferative ln (classes iii and iv) intravenous methylprednisolone 1 g / m2/day for 1 - 3 days then prednisone 0.5 - 1.0 mg / kg / day, tapered to < 0.5 mg / kg / day after 10 - 12 weeks of treatment plus mycophenolate mofetile (mmf) 1.2 g / m2/day for 6 months followed by maintenance lower doses of mmf 1 - 2 g / day or azathioprine (aza) 2 mg / kg / day for 3 years have proven to be efficacy and less toxic than cyclophosphamide (cyc) therapy. patients with membranous ln (class v) plus diffuse or local proliferative ln (class iii and class iv) should receive either the standard 6 monthly pulses of cyc (0.5 - 1 g / m2/month) then every 3rd month or to a shorter treatment course consisting of 0.5 g / m2 iv cyc every 2 weeks for six doses (total dose 3 g) followed by maintenance therapy with daily aza (2 mg / kg / day) or mmf (0.6 g / m2/day) for 3 years. combination of mmf plus rituximab or mmf plus calcineurin inhibitors may be an effective co - therapy for those refractory to induction or maintenance therapies. this report introduces a new treatment algorithm to prevent the development of esrd in children with ln. |
primary percutaneous coronary intervention (pci) is a standard interventional treatment modality for managing patients with st - segment elevation myocardial infarction (stemi). remarkable advances in pci have been made with the development of interventional technologies and the accumulation of experience by interventional cardiologists in patients with acute myocardial infarction (ami) requiring urgent revascularization. however, several issues can cause difficulties for interventional cardiologists, such as multivessel coronary artery disease (mvd) on a diagnostic coronary angiogram, which is seen in 50 - 80% of patients.1)2)3)4) more adverse cardiovascular events occur in patients with mvd than those without mvd, and a lack of accurate guidelines makes it difficult for cardiologists to determine the extent of revascularization.5)6) two interventional strategies have been used for managing stemi with mvd. infarct - related or culprit vessel - only revascularization (cvr) is an intervention of the infarct - related artery (ira) only ; no other diseased vessels are targeted, regardless of their significance. the other strategy is multivessel revascularization (mvr), defined as an intervention of more than one significant stenotic vessel. it includes treating all diseased vessels, referred to as complete revascularization, and is divided into " staged " (ira intervention followed by elective second staged non - ira revascularization) and ad hoc (simultaneous ira and non - ira intervention during an index procedure) pci based on the timing of the non - ira intervention. the potential disadvantages of multivessel intervention should also be considered, such as the risk of contrast - induced nephropathy, radiation exposure, the development of stent thrombosis or other periprocedural complications, and the risk of ongoing ischemia by remnant lesions.7) in addition, cardiogenic shock at initial presentation can affect the pci strategy in patients with stemi. there are still limited data on the optimal pci strategy in patients with mvd presenting with stemi. this review describes the current status of mvr in stemi patients based on recently published data and proposes an optimal revascularization strategy. the current american college of cardiology / american heart association (acc / aha) and european revascularization guidelines for stemi recommend cvr during primary pci as the primary interventional strategy in patients with mvd.8)9) although cvr is a universally accepted treatment modality in stemi patients, several studies have shown the efficacy of simultaneous ira and non - ira intervention during primary ad hoc pci and a staged pci procedure. culprit vessel - only revascularization is an interventional strategy that revascularizes only the ira during primary pci, regardless of the significance of non - iras. thus, it is a conservative management approach that allows for revascularization of the ira only followed by medical therapy, and some studies have shown more favorable outcomes of cvr than mvr during primary pci. an early study by roe.10) described increased 6-month mortality and major adverse cardiac events (maces) with mvr. corpus.5) analyzed 506 patients with mvd ; 152 were treated with mvr and 354 were treated with cvr during primary pci. mvr was associated with higher rates or re - infarction (13.0% vs. 2.8%, p 33 points) who underwent pci showed poorer cardiovascular outcomes compared to those who underwent cabg. although this scoring system can not be applied to all patients with mvd, it may be helpful for determining whether pci or surgery is better in individual patients. a functional assessment of myocardial viability is also crucial for reducing unnecessary revascularization of non - ira. dobutamine echocardiography42) and myocardial nuclear imaging, such as single photon emission tomography or positron emission tomography,43) are well - known modalities used to evaluate myocardial viability. cardiac magnetic resonance imaging (cmri) has increasingly been performed to accurately predict infarct size, regional wall motion abnormalities, ejection fraction, and myocardial irreversibility.44)45) in addition, cmri can predict functional recovery of the left ventricle after pci.46) however, because there are no available data on the clinical benefits of cmri - guided intervention for assessing the significance of non - ira, the fractional flow reserve (ffr) procedure is practical for determining the level of ischemia using a pressure wire. the fractional flow reserve versus angiograph for multivessel evaluation (fame) study was a randomized, prospective, multicenter trial that investigated the benefits of ffr - guided pci. this technique was associated with lesser stent implantation, less injection of contrast, and a reduction in adverse cardiac events, death, or myocardial infarction.47)48)49) this remarkable result supports the active use of ffr for assessing ischemia during intermediate coronary stenosis. based on the current literature, the optimal revascularization strategy for stemi patients with mvd remains controversial. assessment of myocardial viability and a functional evaluation of myocardial perfusion are essential before non - ira intervention. current guidelines supporting cvr during primary pci as a default strategy may impact initial management, and ad hoc pci should be carefully performed only in hemodynamically unstable patients. promising results for staged pci in stemi patients with mvd suggest that this strategy should be considered before other methods. thus, individualization of treatments and a consideration of the advantages or disadvantages of the intervention remain important. further large - scale, randomized, controlled trials are necessary to establish the optimal revascularization strategy for these high - risk patients. | primary percutaneous coronary intervention (pci) is a standard interventional treatment modality for st - segment elevation myocardial infarction (stemi). diagnostic coronary angiogram during pci reveals multivessel coronary artery disease in about half of patients with stemi, and it is difficult to make decision on the extent of intervention in these patients. although revascularization for the infarct - related artery only is still effective for stemi patients, several studies have reported the efficacy of multivessel revascularization during primary pci, as well as in a staged pci procedure. clinicians should consider clinical aspects such as initial cardiogenic shock and myocardial viability when performing primary multivessel intervention, including the risks and benefits of multivessel revascularization in patients undergoing primary pci. this review describes the current status of performing multivessel pci in patients with stemi and proposes an optimal revascularization strategy based on the previous literature. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.