id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
2,131 | https://bio-protocol.org/exchange/protocoldetail?id=2131&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Cancer Stromal Reaction Using an O-ring Co-culture Assay
Vivien Jane Coulson-Thomas
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2131 Views: 8354
Edited by: Guillermo Gomez
Reviewed by: Andrea IntroiniJingli Cao
Original Research Article:
The authors used this protocol in Nov 2010
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2010
Abstract
We have developed a 2D heterotypic co-culture technique between fibroblasts and cancer cells that enables the study of the stromal reaction. For such, stromal cells are seeded and cultured immediately around a tumour cell line, and the cells establish cell-cell contacts, as well as a gradient of soluble factors throughout the stromal cells, similar to that found in tissues. Thus, this system also enables the researcher to distinguish between events that are caused by direct cell-cell contact and secreted factors.
Keywords: Cancer Stromal reaction Fibroblasts Extracellular matrix and proteoglycans
Background
The growth and survival of a tumour within a tissue depends upon interactions with surrounding stromal cells, such as fibroblasts, inflammatory cells, endothelial cells and lymphatic cells. Research has shown that as tumours grow there is extensive cross-talk between the cancer cells and the surrounding fibroblasts. Moreover, the tumour cells may activate these fibroblasts into tumour-associated fibroblasts (TAFs). In some instances, these fibroblasts may restrict tumour growth (Coulson-Thomas et al., 2011 and 2013); however, in many cases these TAFs aid tumour cell growth and survival (Coulson-Thomas et al., 2010 and 2015). Therefore, in vitro cancer studies should also take into account the protective effects TAFs can have on cancer cells. Taking this into account, we developed a 2D heterotypic co-culture technique between fibroblasts and cancer cells that enables the study of TAFs and cancer cells in the same system.
Materials and Reagents
24-well clear flat bottom TC-treated Multiwell cell culture plate (Corning, Falcon®, catalog number: 353047 )
Circular glass coverslips, FisherbrandTM cover glasses, diameter (metric) 12 mm (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-545-80 )
O-Rings, PYREX® cloning cylinder (10 x 10 mm) (Corning, catalog number: 3166-10 )
Stromal cells, prostate fibroblasts (WPMY-1) (ATCC, catalog number: CRL-2854TM )
Prostate cancer PC-3 cells (ATCC, catalog number: CRL-1435TM )
Trypsin/EDTA 0.25% (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Phosphate buffer saline (PBS) pH 7.4, without calcium, magnesium and phenol red
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM)
Primary antibodies
Anti-collagen I (Calbiochem I-8H5, San Diego, CA and Sigma COL1, Sigma-Aldrich, catalog number: C2456 )
Anti-collagen IV, against α1 type IV (Santa Cruz Biotechnology, catalog number: sc-29010 )
Anti-collagen V (EMD Millipore, catalog number: AB763P and Abcam, catalog number: ab134800 )
Rabbit anti-fibromodulin H-50 (Santa Cruz Biotechnology, catalog number: sc-33772 )
Rabbit anti-biglycan H-150 (Santa Cruz Biotechnology, catalog number: sc-33788 )
Mouse anti-fibronectin (BD, BD Transduction LaboratoriesTM, catalog number: 610077 )
Goat anti-perlecan L-20 (Santa Cruz Biotechnology, catalog number: sc-27449 )
Anti-versican H-56 (Santa Cruz Biotechnology, catalog number: sc-25831 )
Mouse anti-smooth muscle α actin conjugated with Cy3 (Sigma-Aldrich, catalog number: clone 1A4 )
Alexa Fluor® 488 or Alexa Fluor® 594 (Thermo Fisher Scientific, Molecular Probes/Invitrogen, Eugene, OR)
Dulbecco’s modified Eagle medium (DMEM) culture medium (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
L-glutamine-penicillin-streptomycin (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 10378016 )
Paraformaldehyde (aqueous solution: 16%) (Electron Microscopy Sciences, catalog number: 15700 )
Complete culture medium (see Recipes)
4% paraformaldehyde (see Recipes)
Equipment
Ultra-Fine forceps with a straight tip (Sterilized) (Fine Science Tools, catalog number: 11399-80 )
CO2 cell culture incubator (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 51026280 )
Table top centrifuge (Eppendorf, model: 5702RH )
Automatic cell counter or hemocytometer
Biological safety cabinets (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 51026639 )
Note: The cell culture experiments must be carried out in sterile conditions.
Inverted fluorescence microscope (Zeiss, model: Observer.Z1 with Apotome )
Software
Prism-GraphPad software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Coulson-Thomas, V. J. (2017). Analysis of Cancer Stromal Reaction Using an O-ring Co-culture Assay. Bio-protocol 7(4): e2131. DOI: 10.21769/BioProtoc.2131.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Tumor microenvironment
Cell Biology > Cell isolation and culture > Cell differentiation
Cell Biology > Cell isolation and culture > Co-culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,132 | https://bio-protocol.org/exchange/protocoldetail?id=2132&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for Murine/Mouse Platelets Isolation and Their Reintroduction in vivo
Jae Hong Im
Ruth J. Muschel
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2132 Views: 18786
Edited by: Lee-Hwa Tai
Reviewed by: Shravani MukherjeeXiaoyi ZhengKate Hannan
Original Research Article:
The authors used this protocol in Mar 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2012
Abstract
Platelets and coagulation have long been known to be essential for metastasis in experimental models. In order to study the interactions between tumor cells, platelets and endothelium, we have adapted methods used in coagulation research for the isolation of platelets and their reintroduction into mice. Anti-coagulated murine blood served as the source for platelets. Platelets were separated from other elements of the whole blood by centrifugation. Here the critical elements are first inhibition of coagulation and second isolation and maintenance of the platelets in the presence of inhibitors of platelet activation. We then used the vital dye PKH26 to fluorescently label the platelets. Infusion of these labelled platelets allows microscopic observation of the introduced platelets. After reintroduction, these platelets appear to function normally and comprise approximately 50% of the total platelets. Because they are fluorescently labelled, they can easily be identified. Finally it would be possible to use these methods for the determination of specific effects of altered gene expression in platelets by using platelets from genetically engineered mice. These methods have facilitated study of the interactions between platelets and tumor cells in tissue culture and in murine models. They would also be applicable to video microscopy. Here we provide details of the methods we have used for platelet isolation from mice and their staining for further microscopy and re-introduction into mice.
Keywords: Platelets Coagulation Fluorescent labeling Vital dye Clot
Background
Platelets are known to be essential for metastasis, but also to play roles during tumor growth not to mention clot formation. In order to readily identify and track platelets we developed the means for fluorescently labeling and reinfusing platelets. This allows them to be readily identified in tissues without immunostaining. Using these methods, we showed that interactions between tumor cells and platelets play key roles in survival of the tumour cells early during metastasis (Im et al., 2004; Gil-Bernabe et al., 2012). Platelets formed clots with tumor cells in the blood stream and this coagulation promoted spreading and subsequent retention of the tumor cells during lung metastasis (Im et al., 2004). Tissue factor expressed by tumor cells is capable of mediating clot formation with platelets and recruitment of macrophages (Gil-Bernabe et al., 2012). The interaction of platelets, thrombin and fibrin also have been reported to promote metastasis by generating epithelial-mesenchymal transition of the cancer cells and evasion from the immune system by protection from NK cells as well as secretion of pro-metastatic chemokines and cytokines (Labelle et al., 2011; Nieswandt et al., 1999; Palumbo et al., 2005 and 2007). Precise tracking of platelets will provide opportunities to uncover how tumor cells utilize the host for their survival.
Materials and Reagents
Scalpel (Swann Morton, catalog number: 0208 )
Syringe, 1 ml (BD, catalog number: 300013 )
15 ml conical bottom polypropylene tube (SARSTEDT, catalog number: 62.554.502 )
5 ml pipette
Needle (27 G)
Mice (4-6 weeks old, weight over 20 g, Charles Liver, UK)
Isoflurane (Abbott, catalog number: 0044-5260-05 )
EGTA (Sigma-Aldrich, catalog number: E3889 )
PKH26 Kit (Sigma-Aldrich, catalog number: PKH26GL-1KT )
Sodium chloride, NaCl (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10378573 )
Potassium chloride, KCl (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10427460 )
Sodium phosphate monobasic monohydrate, NaH2PO4·H2O (Sigma-Aldrich, catalog number: S9638 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Glucose (Thermo Fisher Scientific, GibcoTM, catalog number: 15023021 )
Magnesium chloride, MgCl2 (Sigma-Aldrich, catalog number: M8266 )
Trisodium citrate (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10362234 )
Citric acid (Sigma-Aldrich, catalog number: 251275 )
Dextrose (Thermo Fisher Scientific, Fisher Scientific, catalog number: D16-1 )
Prostaglandin E1 (Sigma-Aldrich, catalog number: P5515 )
100% ethanol
Sodium bicarbonate, NaHCO3 (Thermo Fisher Scientific, Fisher Scientific, catalog number: S637-212 )
Distilled water
Bovine serum albumin, BSA (Sigma-Aldrich, catalog number: A2058 )
Sodium bicarbonate, Na2HPO4 (Thermo Fisher Scientific, Fisher Scientific, catalog number: S374 )
Sodium citrate (Sigma-Aldrich, catalog number: 71498 )
Modified Tyrode’s calcium-free buffer (see Recipes)
ACD buffer (see Recipes)
Undiluted prostaglandin E1 solution
Resuspension buffer (see Recipes)
Washing buffer (see Recipes)
Citrate-albumin buffer (see Recipes)
Equipment
Coulter counter (CDC Technology, model: HEMAVET® 1500 )
Centrifuge (Thermo Fisher Scientific, model: Jouan CR4i )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Im, J. H. and Muschel, R. J. (2017). Protocol for Murine/Mouse Platelets Isolation and Their Reintroduction in vivo. Bio-protocol 7(4): e2132. DOI: 10.21769/BioProtoc.2132.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Animal models
Immunology > Animal model > Mouse
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,133 | https://bio-protocol.org/exchange/protocoldetail?id=2133&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Penetration Assays, Fungal Recovery and Pathogenicity Assays for Verticillium dahliae
YZ Yun-Long Zhao
T Tao Zhang
Hui-Shan Guo
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2133 Views: 10639
Edited by: Arsalan Daudi
Reviewed by: Gazala AmeenVenkatasalam Shanmugabalaji
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Verticillium dahliae is a soil-borne phytopathogenic fungus that infects host roots and proliferates in vascular tissues. The great loss of economically important crop caused by V. dahliae has raised worldwide concern, however, little is known about the mechanism of its pathogenicity (Klosterman et al., 2011; Yadeta and Thomma, 2013). Our recent work has shown that V. dahliae develops hyphopodium as an infection structure to breach plant root cell wall (Zhao et al., 2016). Here, we provide a detailed protocol to analyze the penetration ability and the pathogenicity of V. dahliae as well as recover fungal hyphae from infected cotton stems developed from our previous studies (Zhang et al., 2016a and 2016b; Zhao et al., 2016). Cellophane membrane has been used in inducing appressorium development of foliar pathogens but not root pathogens (Bourett and Howard, 1990). We adopted the method of using the cellophane membrane to induce and assess the development of hyphopodium. Hopefully, it will greatly promote the research of molecular events involved in recognition of the host that regulate infectious development. This protocol is also helpful to identify the key component controlling the pathogenicity of V. dahliae and widen our understanding of the mechanism of plant-microbe interaction.
Keywords: Verticillium dahliae Penetration assays Fungal recovery Pathogenicity assays
Background
The cellophane membrane has been widely used to study the development of infection structure in foliar pathogens (Bourett and Howard, 1990; Kleemann et al., 2012; Gu et al., 2014), we firstly adopt this method to induce infection structure in root pathogen of V. dahliae, which is a simple and efficient method to study the hyphopodium development. Also, we previously developed a novel unimpaired root dip-inoculation method to assess the pathogenicity of V. dahliae in cotton (Gao et al., 2010). The regular procedure for infection of plants with the soil-borne pathogen is to uproot soil-grown plants, incubate the roots in a conidial suspension, and then replant the plants in fresh soil. Our inoculation method avoids damaging the roots and is convenient for operation, which combined the protocol of fungal recovery from stem facilitates the pathogenicity study of soil-borne pathogens that colonize the vascular tissues.
Materials and Reagents
Protection gloves (Medicom, catalog number: 1174D )
Protection coat (Medicom, catalog number: 8018 )
Cellophane membrane (DINGGUO CHANGSHENG, catalog number: XH444-1 )
Round (90 mm diameter) Petri dishes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 101VIRR )
Sterilized gauze (Thermo Fisher Scientific, Fisher Scientific, catalog number: 22-415-469 )
Pot for cotton growth (Shantou Xing Lv Yuan, dimensions: 300 x 200 x 100)
Sterilized pipette tips (Corning, Axygen®, catalog number: TF-1005-WB-L-R-S )
50 ml conical tubes (Corning, catalog number: 430828 )
Cotton seeds (Nongqishi Agricultural Institute, cv. Xinluzao NO.16)
Potato tubers
Glycerol
Distilled water (Milli-Q) (EMD Millipore, catalog number: QTUM00ICP )
70% (v/v) ethanol (EtOH in ddH2O)
30% H2O2 (ALADDIN, catalog number: H112519 )
Glucose (Sigma-Aldrich, catalog number: V900392 )
Agar (BD, BactoTM, catalog number: 214010 )
Sodium nitrate, NaNO3 (EMD Millipore, catalog number: 106537 )
Potassium dihydrogen phosphate, KH2PO4 (EMD Millipore, catalog number: 104873 )
Potassium phosphate dibasic, K2HPO4 (Sigma-Aldrich, catalog number: V900050 )
Magnesium sulfate heptahydrate, MgSO4·7H2O (EMD Millipore, catalog number: 105886 )
Potassium chloride, KCl (EMD Millipore, catalog number: 104933 )
Sodium citrate (Sigma-Aldrich, catalog number: V900095 )
Zinc sulfate heptahydrate, ZnSO4·7H2O (Sigma-Aldrich, catalog number: Z4750 )
Iron(II) sulfate heptahydrate, FeSO4·7H2O (Sigma-Aldrich, catalog number: V900038 )
Ammonium iron(III) sulfate dodecahydrate, NH4Fe(SO4)2·12H2O (Sigma-Aldrich, catalog number: V900032 )
Copper(II) sulfate pentahydrate, CuSO4·5H2O (Sigma-Aldrich, catalog number: C7631 )
Manganese(II) sulfate monohydrate, MnSO4·H2O (Sigma-Aldrich, catalog number: V900271 )
Boric acid, H3BO3 (Sigma-Aldrich, catalog number: V900267 )
Sodium molybdate dehydrate, Na2MoO4·2H2O (EMD Millipore, catalog number: 106521 )
Sucrose (Merck Millipore, catalog number: 107687 )
Murashige and Skoog (MS) medium including vitamins (Duchefa Biochemie, catalog number: M0222 )
Potato dextrose agar (PDA) (see Recipes)
TES (see Recipes)
Minimal medium (MM) (see Recipes)
MS liquid medium (see Recipes)
Czapek-Dox medium (see Recipes)
Equipment
Heat plate and cooking pot to boil potatoes (Supor, catalog number: SDHC8E15 )
Flasks and magnetic stirrer for preparation of solutions (Thermo Fisher Scientific, Fisher Scientific, catalog number: S88850206 )
Fungal growth incubator (SAIFU, catalog number: MJX-450S )
26 °C incubator shaker (Zhicheng, catalog number: ZHWY-2102C )
Autoclave (Hirayama, catalog number: HVE-50 )
Clean bench (Zhicheng, catalog number: ZHJH-C1209B )
Hemocytometer for conidia counting (Qiujing, catalog number: QJ1102 )
Rotator (Qilinbeier, catalog number: QB-208 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhao, Y., Zhang, T. and Guo, H. (2017). Penetration Assays, Fungal Recovery and Pathogenicity Assays for Verticillium dahliae. Bio-protocol 7(4): e2133. DOI: 10.21769/BioProtoc.2133.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,134 | https://bio-protocol.org/exchange/protocoldetail?id=2134&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
VLA-4 Affinity Assay for Murine Bone Marrow-derived Hematopoietic Stem Cells
FA Francesca Avemaria
SG Shiri Gur-Cohen
SA Seymen Avci
TL Tsvee Lapidot
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2134 Views: 7646
Edited by: Vivien Jane Coulson-Thomas
Reviewed by: Varpu MarjomakiRalph Bottcher
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Hematopoietic stem cells (HSCs) are defined by their functional ability to self-renew and to differentiate into all blood cell lineages. The majority of HSC reside in specific anatomical locations in the bone marrow (BM) microenvironment, in a quiescent non motile mode. Adhesion interactions between HSCs and their supporting BM microenvironment cells are critical for maintaining stem cell quiescence and protection from DNA damaging agents to prevent hematology failure and death. Multiple signaling proteins play a role in controlling retention and migration of bone marrow HSCs. Adhesion molecules are involved in both processes regulating hematopoiesis and stem- and progenitor-cell BM retention, migration and development. The mechanisms underlying the movement of stem cells from and to the marrow have not been completely elucidated and are still an object of intense study. One important aspect is the modification of expression and affinity of adhesion molecules by stem and progenitor cells which are required both for stem cell retention, migration and development. Adhesion is regulated by expression of the adhesion molecules, their affinity and avidity. Affinity regulation is related to the molecular binding recognition and bond strength. Here, we describe the in vitro FACS assay used in our research to explore the expression, affinity and function of the integrin α4β1 (also termed VLA-4) for murine bone marrow retained EPCR+ long term repopulation HSC (LT-HSC) (Gur-Cohen et al., 2015).
Keywords: Hematopoietic stem cells HSC mobilization Bone marrow retention VLA-4 aPC/EPCR/PAR1 signaling
Background
Integrins are type I transmambrane glycoprotein receptors that mediate cell-cell and cell-matrix adhesion interactions, signaling and communication. All integrins are heterodimers of non-covalently associated α and β subunits. In humans integrin heterodimers are formed from 9 types of β subunits and 24 types of α subunits. This diversity is further increased by alternative splicing of some integrin RNAs. Each heterodimer consists of a large extracellular domain which binds proteins in the extracellular environment, a single transmembrane domain, and an intracellular cytoplasmic tail domain. The largest integrin subfamily is composed by integrin β1 (CD29) that is able to associates with 12 different α subunits (α1-11 and αv). Integrin β1 together with integrin chains α4, α5, α6 and α9 are expressed by murine hematopoietic stem and progenitor cells (HSPCs) and play important roles in regulating their BM retention, migration and development.
Integrins, like other transmembrane receptors, display an ‘outside-in signaling’, i.e., to transduce the signal intracellularly after the binding with their ligand. Moreover, integrins have a peculiar feature: they are able to shift between high- and low-affinity conformation states for ligand binding (‘inside-out’ signaling) (Takagi and Springer, 2002). According to the cell type, integrins can be either basically activated or basally inactive. In the inactive state, the integrin extracellular domains are not bounded to the ligands, and are in a bent conformation. Following intracellular activation signals, the extracellular domain is straightened, stabilizing the extended active conformation. Thus, the external ligand binding site, is now exposed to the ligand binding, allowing the transmission of the signals from the outside to the inside (Luo et al., 2007).
Very Late Antigen-4 (VLA-4, also known as CD49d/CD29 or α4β1) is a member of the integrin α4 family together with α4β7. Within the integrin family, VLA-4 has some unique features. In contrast to related members of β1 subfamily, VLA-4 is predominantly expressed on hematopoietic lineage cells (Hemler, 1990) and is functionally involved in both cell-cell and cell-ECM adhesive interactions. Moreover, despite sequence homology with other integrin α subunits, the α4 strand because of the lack of the inserted I-domain doesn’t undergo post-translational cleavage near the transmembrane region. Finally, the α4 chain contains a trypsin-like cleavage site, constitutively expressed on most leukocytes and on hematopoietic stem and progenitor cells (Hynes, 1992).
VLA-4 plays a major role in the regulation of immune cell recruitment to inflamed endothelia and sites of inflammation through its interactions with two alternative ligands, vascular cell adhesion molecule-1 (VCAM-1) and the alternatively spliced connecting segment 1 (CS-1) of fibronectin (Hemler, 1990; Papayannopoulou et al., 1998). It also participates in many cellular events and is crucial for BM retention and mobilization of immature stem and progenitors cells from the bone marrow (Lapidot and Petit, 2002; Peled et al., 2000).
Migration of hematopoietic stem cells to the bone marrow is a regulated multistep process that requires precise regulation and activation of various molecules including chemoattractants, selectins and integrins. While the initial steps of hematopoietic stem and progenitor cells tethering and rolling along BM blood vessel endothelium are primarily regulated by selectins, various integrins have been shown to be involved in the next stages of this process. VLA-4 plays an important role in homing, lodgment and retention of HSCs within the marrow microenvironment (Rettig et al., 2012). Previous studies demonstrate that treatment of donor BM cells with a neutralizing anti α4 integrin antibody before injection into lethally irradiated recipients, inhibits their homing to the femurs of recipient mice, increasing the number of HSPCs in the peripheral blood and spleen. Moreover, recipient mice pretreated with neutralizing antibodies against VCAM-1 gave similar results, adding evidences to the important role of the VLA-4/VCAM-1 axis in HSPC homing to the bone marrow (Papayannopoulou et al., 1995).
Recently, factors traditionally related to coagulation and inflammation have been shown to independently control long term (LT) HSCs retention in the bone marrow and their recruitment to the blood (Aronovich et al., 2013; Gur-Cohen et al., 2015). Adult murine BM LT-HSCs, endowed with the highest repopulation and self-renewal potential, express endothelial protein C receptor (EPCR) which is used as a marker to isolate them (Balazs et al., 2006).
Protease-activated receptor-1 (PAR1) is functionally expressed by bone marrow stromal and endothelial cells as well as HSC and immature and maturing leukocytes (Gur-Cohen et al., 2016). Activated protein C ([aPC], the major ligand for EPCR)-EPCR/PAR1 signaling facilitate LT-HSC BM repopulation, retention, survival, and chemotherapy resistance by restricting nitric oxide (NO) production. Inhibition of NO generation by aPC/EPCR/PAR1 signaling on LT-HSC, inhibits downstream CDC42 activity and induces CDC42 polarity, as well as increasing VLA4 expression, affinity and adhesion. Conversely, acute stress and clinical mobilization up-regulate thrombin generation and activate different PAR1 signaling leading to NO generation that overcomes BM EPCR+LT-HSC retention, inducing TACE mediated EPCR and VLA-4 shedding, up-regulation of CXCR4 and PAR1 on LT-HSC, stromal PAR1 mediated CXCL12 secretion, resulting in stem and progenitor cell recruitment to the blood stream (Gur-Cohen et al., 2015). VLA-4 is expressed at a higher level by bone marrow EPCR+LT-HSC together with higher affinity to its ligands, inducing their BM retention and protection from DNA damaging agents. The restriction of NO by EPCR/PAR1 signaling increase the affinity of VLA-4 regulating anchorage and bone marrow retention of LT-HSC and chemotherapy resistant (Gur-Cohen et al., 2015).
Multiple small molecules have been developed in an attempt to regulate integrin dependent adhesion. The affinity states of human VLA-4 can be recognized by monoclonal antibodies sensitive to its molecular conformation (Masumoto and Hemler, 1993). Importantly, changes in VLA-4 affinity can be detected in real-time and on a physiologically relevant time frame using a ligand mimicking LDV-containing fluorescent small molecule (LDV-FITC) by FACS (Chigaev et al., 2001). VLA-4 recognize with high affinity a peptide sequence within fibronectin, which comprises 25 amino acid, termed CS-1 (Hynes, 1992). LDV (leu-asp-val) is the tripeptide identified as the minimal sequence for specific VLA-4 recognition of CS-1 segment of fibronectin. Here we describe a method to detect VLA-4 affinity monitoring mean fluorescent intensity through flow cytometry using LDV-FITC.
Materials and Reagents
Syringe with needle 1 ml 25 G x 5/8 in. (0.5 x 16 mm) (BD, catalog number: 300014 )
Dishes 35 x 10 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 153066 )
70 μm nylon strainer (Sinun Tech, catalog number: Polymer Screens )
FACS tubes (Corning, FalconTM, catalog number: 352054 )
Cells of interest (here murine bone marrow cells obtained from 8 weeks old mice)
Dulbecco’s phosphate-buffered saline (PBS+/+) (Biological Industries, catalog number: 02-020-1A )
EDTA (5 mM final concentration in water, pH 7.4) (Avantor® Performance Materials, J.T.Baker, catalog number: 8993-01 )
Wet ice
Antibodies to detect LT-HSCs by flow cytometry:
Sca-1 PEcy7 (clone D7) (Biolegend, catalog number: 108114 )
c-kit APC (clone 2B8) (Biolegend, catalog number: 105812 )
CD150 Brilliant Violet (clone TC15-12F12.2) (Biolegend, catalog number: 115922 )
CD48 Pasific Blue (clone HM48-1) (Biolegend, catalog number: 103418 )
EPCR PE (clone eBio1560) (Affymetrix, eBioscience, catalog number: 12-2012-82 )
Lineage: CD4 (clone GK 1.5), CD8a (clone 53-6.7), GR1 (clone RB6-8C5), B220 (clone RA3-682), Ter119 (clone TER-119), CD11b (clone M1/70)
Calcium chloride dihydrate (EMD Millipore, catalog number: 102382 )
Magnesium chloride hexahydrate (EMD Millipore, catalog number: 105833 )
HEPES buffer solution (Biological Industries, catalog number: 03-025-1B )
Hank’s balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14175095 )
Bovine serum albumin solution (10%, BSA) (Biological Industries, catalog number: 03-010-1B )
2.4-((N’-2-methylphenyl)ureido)-phenylacetyl-L-leucyl-L-aspartyl-L-valyl-L-prolyl-L-alanyl-L-alanyl-L-lysine (LDV-FITC) (R&D System, catalog number: 4577 )
Deionized water (DDW)
Gentian violet (Sigma-Aldrich, catalog number: 548-62-9 )
Acetic acid (Sigma-Aldrich, catalog number: 64-19-7 )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: 30525-89-4 )
LDV medium (see Recipes)
LDV-FITC stock and working solutions (see Recipes)
Turk’s solution (see Recipes)
4% PFA (see Recipes)
Note: Flurochrome should be chosen according to the flow cytometry machine.
Equipment
Forceps (Kent Scientific, catalog number: INS700100-2 )
Scissors (Kent Scientific, catalog number: INS750046 )
Centrifuge (Eppendorf, model: 5810R )
Centrifuge swing-bucket rotor A-462 4 x 250 ml rectangular buckets (Eppendorf, catalog number: 5810709008 )
Adapters (Eppendorf, catalog number: 5810752000 )
Inverted light microscope (Olympus, model: CHK2-F-GS )
Note: This product has been discontinued by the manufacturer.
Hemocytometer (Sigma-Aldrich, Bright-LineTM, catalog number: Z359629 )
Incubator 37 °C, 5% CO2 (Thermo Fisher Scientific, Thermo ScientificTM, model: 150i )
Cold room or refrigerator (4 °C)
Flow cytometer (i.e., Macs Quant instrument [Miltenyi, BergischGladbach, Germany] or BD LSR II flow cytometer)
2 L glass flask or bottle (Kimble Chase Life Science and Research Products, catalog number: 26500-2000 )
Plastic weigh boat (Sigma-Aldrich, catalog number: Z186856 )
Note: Color combinations can be adjusted to match the laser combinations available.
Software
FlowJo V10 software (Tree Star, optional)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Avemaria, F., Gur-Cohen, S., Avci, S. and Lapidot, T. (2017). VLA-4 Affinity Assay for Murine Bone Marrow-derived Hematopoietic Stem Cells. Bio-protocol 7(4): e2134. DOI: 10.21769/BioProtoc.2134.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Hematopoietic stem cell
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,135 | https://bio-protocol.org/exchange/protocoldetail?id=2135&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Adhesion Assay for Murine Bone Marrow Hematopoietic Stem Cells
SA Seymen Avci
SG Shiri Gur-Cohen
FA Francesca Avemaria
TL Tsvee Lapidot
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2135 Views: 10722
Edited by: Vivien Jane Coulson-Thomas
Reviewed by: Xiujun Fan
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
Hematopoietic stem cells (HSCs) are defined by their functional abilities to self-renew and to give rise to all mature blood and immune cell types throughout life. Most HSCs are retained in a non-motile quiescent state within a specialized protective microenvironment in the bone marrow (BM) termed the niche. HSCs are typically distinguished from other adult stem cells by their motility capacity. Movement of HSCs across the physical barrier of the marrow extracellular matrix and blood vessel endothelial cells is facilitated by suppression of adhesion interactions, which are essential to preserve the stem cells retained within their BM niches. Importantly, homing of HSCs to the BM following clinical transplantation is a crucial first step for the repopulation of ablated BM as in the case of curative treatment strategies for hematologic malignancies. The homing process ends with selective access and anchorage of HSCs to their specialized niches within the BM. Adhesion molecules are targets to either enhance homing in cases of stem cell transplantation or reduce BM retention to harvest mobilized HSCs from the blood of matched donors. A major adhesion protein which is functionally expressed on HSCs and is involved in their homing and retention is the integrin alpha4beta1 (Very late antigen-4; VLA4). In this protocol we introduce an adhesion assay optimized for VLA4 expressing murine bone marrow stem cells. This assay quantifies adherent HSCs by flow cytometry with HSC enriching cell surface markers subsequent to the isolation of VLA4 expressing adherent cells.
Keywords: Very late antigen 4 Integrin alpha4beta1 Adhesion-assay Endothelial protein C receptor (EPCR) Long-term repopulating hematopoietic stem cells (LT-HSC) Flow cytometry
Background
HSCs are mostly retained in the BM and are regulated by adhesive interactions with their microenvironment, the niche. In this way HSCs are kept in a non-motile quiescent state which protects them from DNA damaging agents (Boulais and Frenette, 2015; Mendelson and Frenette, 2014; Miyamoto et al., 2011; Morrison and Scadden, 2014). The defining properties of HSCs are their functional ability to durably repopulate the irradiated BM of transplanted recipients, which requires their homing, self-renewal and developmental potential (Gur-Cohen et al., 2016). Since adhesion gives rise to activation of intracellular signaling pathways, the type of interaction can mirror the developmental state and behavior of the cells (Sugiyama et al., 2006). Adhesion assays are methods to distinguish between adhesive and non-adhesive cells. In this protocol we introduce a cell adhesion assay under static conditions that separates VLA4 expressing adhesive cells from non-adhesive cells, which are quantified by FACS analysis.
In mouse, hematopoietic stem and progenitor cells (HSPCs) are enriched in a population that lacks lineage markers (Lin; CD8a, CD4, GR1, B220, TER-119, CD11b), and expresses c-Kit (K) and Sca-1 (S). Hence, these cells are also called Lin- Sca-1+ c-Kit+ (LSK) cells (Adolfsson et al., 2001; Okada et al., 1991; Spangrude et al., 1988). EPCR (endothelial protein C receptor) has been identified as a stem cell marker also in various other tissues (Balazs et al., 2006; Iwasaki et al., 2010; Kent et al., 2009; Ramalho-Santos et al., 2002; Wang and Gerdes, 2015).
Adhesion molecules play a major role in the retention and egress of these HSCs in the BM and to the blood circulation. VLA4 is a receptor for both fibronectin and VCAM-1 and is expressed by most leukocytes, as well as by some non-hematopoietic cells (Hemler et al., 1990), while its expression is higher on murine BM EPCR+ LT-HSCs as compared to EPCR negative progenitor cells and circulating LT-HSC (Gur-Cohen et al., 2015). It has long been proposed that VLA4 expression by LT-HSCs might be important for binding and detachment of stem cells within the human BM microenvironment. Inhibition of VLA4 or VCAM-1 binding by neutralizing antibodies causes mobilization of HSPCs from the BM to the blood circulation of mice and primates (Craddock et al., 1997; Papayannopoulou et al., 1995) which is consistent with the notion that VLA4 is crucial for CXCL12/CXCR4-mediated LT-HSC quiescent retention in the BM (Papayannopoulou et al., 1995; Papayannopoulou and Scadden, 2008). In addition to HSPC BM retention, VLA4 is also essential for murine HSPC BM homing (Papayannopoulou and Craddock, 1997). VLA4 possesses different conformations that correlate with its affinity states (Alon et al., 1995; Chen et al., 1999; Feigelson et al., 2001) which are influenced by divalent cations and inside-out signaling (Chigaev et al., 2003; Chigaev et al., 2011). The majority of VLA4 affinity inside- out signaling is mediated by G-protein coupled receptors (Laudanna et al., 2002; Chigaev et al., 2008; Arnaout et al., 2007). Furthermore, elevation of intracellular nitric oxide (NO) was shown to cause cGMP-mediated inhibition of VLA4 affinity (Chigaev et al., 2011). We have previously shown two different pathways, the aPC-EPCR-PAR1 and the thrombin-PAR1 axis, which regulate the NO level up and down, respectively. Thereby, these pathways influence a number of intracellular molecules including Cdc42, CXCR4 and VLA4 leading to retention or mobilization of HSPCs (Gur-Cohen et al., 2015). As described by Gur-Cohen et al. (2015), we herein propose the VLA4 mediated adhesion assay for EPCR+ stem cells as a powerful tool to predict LT-HSC retention potential to their bone marrow niches.
Materials and Reagents
Tissue culture 6-well plates (Corning, Costar®, catalog number: 3516 )
NuncTM 8.8 cm2 Petri dish (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 153066 )
1 ml slip tip Sub-Q syringe with disposable 26 G x 5/8 inch needle (BD, catalog number: 309597 )
Autoclaved pipet tips:
200-1,000 µl blue, gilson tip (Greiner Bio One, catalog number: 740290 )
200 µl universal tip (Neptune Scientific, catalog number: 2100.N )
0.5-10 µl pipet tips (Corning, Axygen®, catalog number: T-300 )
FACS tubes (Corning, Falcon®, model: 352054 )
Sterilized 40 µm pore-sized nylon mesh (Sinun Tech, catalog number: Plymer Screends ) (see Recipes)
Mice
Fibronectin (Sigma-Aldrich, catalog number: F0895 )
Human CXCL12 (human SDF-1 alpha) (reprokineTM, catalog number: RKP48061 ) or (PeproTech, Rocky Hill, NJ, USA)
BSA (Sigma-Aldrich, catalog number: A9647 )
LymphoprepTM Ficoll (STEMCELL Technologies, catalog number: 07861 )
Antibodies:
EPCR PE (Affymetrix, eBioscience, catalog number: 12-2012-82 ) or EPCR PerCP-eFluor 710(Affymetrix, eBioscience, catalog number: 46-2012-80 ) or EPCR Biotin (Affymetrix, eBioscience, catalog number: 13-2012-82 ) combined with streptavidin-PE (BioLegend, catalog number: 405203 )
Sca-1 PE (BioLegend, catalog number: 108108 ) or Sca-1 PE/Cy7 (BioLegend, catalog number: 108114
c-Kit APC (BioLegend, catalog number: 105812 )
Lineage antibodies
Note: This is a set of antibodies that target the antigens i-vi listed below which are cell lineage markers. In mice these markers do not occur on stem and progenitor cells.
CD8a FITC (BioLegend, catalog number: 100706 )
CD4 FITC (BioLegend, catalog number: 100406 )
GR1 FITC (BioLegend, catalog number: 108406 )
B220 FITC (BioLegend, catalog number: 103206 )
TER-119 FITC (BioLegend, catalog number: 116206 )
CD11b FITC(BioLegend, catalog number: 101206 )
Or Lineage Cocktail-Biotin (Miltenyi Biotec, catalog number: 130-092-613 ) combined with streptavidin-FITC (BioLegend; catalog number: 405202 )
Note: The combination of fluorophores used for the experiment needs to be adjusted according to the experimental demands.
1x Dulbecco’s phosphate buffered saline without calcium and magnesium (PBS-/-) (generated from 10x PBS, see Recipes) (Biological Industries, catalog number: 02-023-5A )
Roswell park memorial institute (RPMI) 1640 medium ([+] 300 mg/L L-glutamine, [+] 25 mM HEPES) (Thermo Fisher Scientific, GibcoTM, catalog number: 52400025 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 12657-029 )
Penicillin-streptomycin (Pen-Strep) solution (Biological Industries, catalog number: 03-031-1B )
L-glutamine solution (Biological Industries, catalog number: 03-020-1B )
Gentian violet (Sigma-Aldrich, catalog number: G2039 )
Acetic acid (Sigma-Aldrich, catalog number: ARK2183 )
0.1 M sodium azide solution (Sigma-Aldrich, catalog number: 0 8591 )
Acetone (Sigma-Aldrich, catalog number: 40289 )
Note: This product has been discontinued.
Ethanol (Sigma-Aldrich, catalog number: 24103 )
Note: This product has been discontinued.
Cell dissociation solution (Sigma-Aldrich, catalog number: C5914 )
ddH2O
Coating solution (see Recipes)
Blocking solution with 2% (m/v) BSA (see Recipes)
Complete RPMI medium (see Recipes)
Turk’s solution (see Recipes)
FACS buffer (see Recipes)
Equipment
HeracellTM 150i CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: 150i CO2 incubator)
Autoclave
Scissors
Forceps
Refrigerator (4° C)
Centrifuge (Eppendorf, model: 5810R )
Centrifuge swing-bucket rotor A-462 4 x 250 ml rectangular buckets (Eppendorf, catalog number: 5810709008 )
Adapters (Eppendorf, catalog number: 5810752000 )
Finnpipette model 4500 single channel pipette:
0.5-10 μl (Thermo Fisher Scientific, Thermo Scientific, catalog number: FA-10R )
5-40 μl (Thermo Fisher Scientific, Thermo Scientific, catalog number: FA-40R )
20-200 μl (Thermo Fisher Scientific, Thermo Scientific, catalog number: FA-200R )
100-1,000 μl (Thermo Fisher Scientific, Thermo Scientific, catalog number: FA-1000R )
Inverted light microscope (Olympus, model: CHK2-F-GS )
Note: This product has been discontinued by the manufacturer.
Counting chamber/hemocytometer (Reichert Bright-Line) (Sigma-AIdrich, Bright-LineTM, model: Z359629 )
Flow cytometer (model optional):
MACSQuant VYB instrument (Miltenyi Biotec, model: 130096116 )
FACSCalibur instrument (BD)
FACS LSRII instrument (with all four fixed-aligned lasers) (BD)
Software
CellQuest software
FACSDiva software
FlowJo (Tree Star or V10) or MacsQuant
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Avci, S., Gur-Cohen, S., Avemaria, F. and Lapidot, T. (2017). Adhesion Assay for Murine Bone Marrow Hematopoietic Stem Cells. Bio-protocol 7(4): e2135. DOI: 10.21769/BioProtoc.2135.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Hematopoietic stem cell
Cell Biology > Cell movement > Cell adhesion
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,136 | https://bio-protocol.org/exchange/protocoldetail?id=2136&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Establishment of New Split-root System by Grafting
Xiangqiang Kong
Z Zhen Luo
HD Hezhong Dong
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2136 Views: 8751
Edited by: Marisa Rosa
Reviewed by: Tzvetina Brumbarova
Original Research Article:
The authors used this protocol in Mar 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2012
Abstract
A new split-root system was used to simulate non-uniform salt, drought or nutrient deficiency stress in the root zone, in which the root system was divided into two or more equal portions. Here, we established a split-root system by grafting of cotton seedlings. In contrast to the conventional split-root, the main roots of the new system remained intact, which provided a better system for studying cotton response to unequal treatment in the root zone. The new system was suitable for plant growth in nutrient solution and the two root systems can fully be immerged in the nutrient solution.
Keywords: Cotton Split-root system Graft Unequal treatment Scion Stock
Background
The split-root system has been used to study plant responses to heterogeneous soil conditions such as partial root drying, unequal salt distribution, and heterogeneous nutrient distribution. The conventional split-root system in cotton and other plants are established by dividing the lateral roots into two equal parts after cutting of the main root of a seedling (Bazihizina et al., 2009; Dong et al., 2010). The new system was suitable for plant growth in nutrient solution and for a girdling experiment because there was sufficient distance between the root and position of the graft (Kong et al., 2012 and 2016).
Materials and Reagents
Plastic boxes (60 x 45 x 15 cm) (Linhui, catalog number: LH-600 )
Sterilized wet sand
Blade (Pao Shen Enterprises, KW-trio®, catalog number: 03541 )
Parafilm (Bemis, catalog number: PM996 )
Disposable cup (Jiaxing, catalog number: hot paper cup-HC02W )
Plastic bags (Yiwu, catalog number: 10*15 )
Cotton seeds (SCRC41, a commercial Bt [Bacillus thuringiensis] transgenic cotton [Gossypium hirsutum L.] which developed by the Cotton Research Center, Shandong Academy of Agricultural Sciences, Jinan)
Sulfuric acid, H2SO4 (Sinopharm Chemical Reagent, catalog number: 7664-93-9 )
Calcium nitrate, Ca(NO3)2 (Sinopharm Chemical Reagent, catalog number: 10124-37-5 )
Potassium nitrate, KNO3 (Sinopharm Chemical Reagent, catalog number: 7757-79-1 )
Magnesium sulfate, MgSO4 (Sinopharm Chemical Reagent, catalog number: 7487-88-9 )
Ammonium dihydrogen phosphate, NH4H2PO4 (Sinopharm Chemical Reagent, catalog number: 7722-76-1 )
EDTA·FeNa (Sinopharm Chemical Reagent, catalog number: 15708-41-5 )
Orthoboric acid, H3BO3 (Sinopharm Chemical Reagent, catalog number: 10043-35-3 )
Zinc sulfate, ZnSO4 (Sinopharm Chemical Reagent, catalog number: 7446-20-0 )
Copper sulfate, CuSO4 (Sinopharm Chemical Reagent, catalog number: 7758-99-8 )
Manganese sulfate, MnSO4 (Sinopharm Chemical Reagent, catalog number: 15244-36-7 )
(NH4)6Mo7O24 (Sinopharm Chemical Reagent, catalog number: 12027-67-7 )
Potassium hydroxide, KOH (Sinopharm Chemical Reagent, catalog number: 1310-58-3 )
Nutrient solution (see Recipes)
Equipment
Growth chamber (Percival Scientific, model: AR-41L2 )
Aeration instrument (JeanPole, catalog number: B00WDWUS8W )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kong, X., Luo, Z. and Dong, H. (2017). Establishment of New Split-root System by Grafting. Bio-protocol 7(4): e2136. DOI: 10.21769/BioProtoc.2136.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant physiology > Abiotic stress
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,137 | https://bio-protocol.org/exchange/protocoldetail?id=2137&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Murine Orthotopic Allograft to Model Prostate Cancer Growth and Metastasis
RH Robert M. Hughes
BS Brian W. Simons
PH Paula J. Hurley
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2137 Views: 10697
Edited by: Lee-Hwa Tai
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
Prostate cancer is one of the most common cancers in men in the United States. Comprehensive understanding of the biology contributing to prostate cancer will have important clinical implications. Animal models have greatly impacted our knowledge of disease and will continue to be a valuable resource for future studies. Herein, we describe a detailed protocol for the orthotopic engraftment of a murine prostate cancer cell line (Myc-CaP) into the anterior prostate of an immune competent mouse.
Keywords: Orthotopic allograft Myc-CaP Prostate Cancer Metastasis in vivo Mouse model
Background
Prostate cancer is a leading cause of cancer death in men due to a subset of cancers that metastasize. The genetic and molecular factors that drive local tumor development and progression to metastatic disease, however, remain incompletely understood. Both genetically engineered mouse (GEM) models and xenograft models of prostate cancer have contributed to our understanding of the genetics of prostate cancer (Ittmann et al., 2013; Park et al., 2010). Genetic manipulation, either by prostate specific transgenic overexpression such as in Hi-Myc mice (Ellwood-Yen et al., 2003) or by prostate specific deletion such as in Pten-/- mice (Wang et al., 2003), is advantageous because it models tumor development and progression in the organ microenvironment in an immune competent mouse. Development of metastatic prostate cancer is variable among these GEM models, with a low frequency in some such as the Pten-/- model (Wang et al., 2003), and a higher frequency in other models such as TRAMP (transgenic adenocarcinoma mouse prostate) (Greenberg et al., 1995) and Hi-Myc/Pten-/- (Hubbard et al., 2016). Despite their great utility for prostate cancer research, it is difficult, time-consuming, and costly to further genetically manipulate GEM models. To overcome some of these limitations, researchers have relied on both subcutaneous and orthotopic xenografts of human cell lines. Cell lines can be genetically manipulated in vitro in a variety of ways. While subcutaneous xenografts are advantageous due to their ease of injection and monitoring, orthotopic xenografts better recapitulate the local tumor microenvironment which may affect sensitivity to drugs (Wilmanns et al., 1992; Kuo et al., 1993), methylation patterns (Fleming et al., 2010), growth rate (Fleming et al., 2010), and ultimately predictions for clinical response (Killion et al., 1998; Hoffman, 1999). In addition, some human prostate cancer cell line models metastasize from xenografts implanted orthotopically. A limitation of all xenograft models is that they require immunocompromised mice making it difficult to model tumor progression in an intact immune system. The Myc-CaP cell line (Watson et al., 2005) allows for engraftment either subcutaneously or orthotopically in immune competent syngeneic (FVB/N) mice (Watson et al., 2005; Hurley et al., 2015). Myc-CaP was derived from a prostate carcinoma from a Hi-Myc mouse (Watson et al., 2005). When engrafted orthotopically, Myc-CaP cells metastasize to abdominal lymph nodes, liver, and lung (Hurley et al., 2015). Additionally, Myc-CaP is amenable to in vitro manipulation of gene expression (Hurley et al., 2015). Thus, Myc-CaP can be used as an easily manipulable model for both tumor growth in the prostate and metastatic growth in mice with an intact immune system. Herein, we describe the methods for orthotopic engraftment of Myc-CaP cells into the mouse anterior prostate.
Materials and Reagents
Institutional ACUC approval of orthotopic allograft protocol
Mask, cap, clean lab coat, arm covers, and sterile gloves
Tissue culture flasks
70% alcohol wipes (DUKAl, catalog number: 852 )
Cotton swab
30 G ½” needle (BD, catalog number: 305106 ) – orthotopic engraftment
Reflex 9 mm stainless steel wound clips (Roboz Surgical Instrument, catalog number: RS-9262 )
21 G 1” needle & 3 ml syringe (BD, catalog number: 309575 ) – lung inflation
POLYSORBTM size 3-0 USP (2 metric), 30 inches (75 cm) UNDYED on V-20 needle absorbable surgical sutures (COVIDIEN, catalog number: GL322 )
Myc-CaP cells (ATCC, catalog number: CRL-3255 )
FVB/N male mice (THE JACKSON LABORATORY), 10 weeks and older
Note: Post-pubescent mice have androgen signaling and a larger prostate that facilitates ease of engraftment. We also recommend using mice that are approximately the same age and weight. Male GEM models can also be used as long as they are fully back-crossed to FVB/N.
Matrigel (Corning, catalog number: 354234 )
1x phosphate buffered saline (PBS), pH 7.4 (Thermo Fisher Scientific, GibcoTM, catalog number: 10010-023 )
1x trypsin-EDTA (Mediatech, catalog number: 25-053-CI )
Fluriso isoflurane (VetOne, catalog number: 501017 )
10% povidone-iodine ‘Betadine’ prep solution, 16 oz. (Henry Schein, catalog number: 6906950 )
50 mg/ml injectable Carprofen (Zoetis, catalog number: 07-844-7425 )
Ethanol, reagent alcohol 200 proof, PHARMCO-AAPERTM (Thermo Fisher Scientific, Fisher Scientific, catalog number: 16-100-824 )
ImmPRESS HRP Anti-Rabbit Polymer Detection Kit (Vector Labs, catalog number: MP-7401 )
ImmPACT DAB Peroxidase Substrate (Vector Labs, catalog number: SK-4105 )
Myc-CaP growth medium (see Recipes)
Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11965-092 )
Fetal bovine serum (Gemini Bio-Products, catalog number: 100-106 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
Bovine pituitary extract (BPE) (Thermo Fisher Scientific, GibcoTM, catalog number: 13028-014 )
Recombinant human EGF (R&D Systems, catalog number: 236-EG )
Bovine insulin powder (Gemini Bio-Products, catalog number: 700-112 )
Equipment
Incubator
Centrifuge
Cell culture laminar flow hood, vacuum suction, centrifuge, cell counter
2 L induction chamber
Scissors (Roboz Surgical Instrument, catalog number: RS-5914 )
Fine forceps (Roboz Surgical Instrument, catalog number: RS-5132 )
Mouse housing and handling facility
Isoflurane gas anesthetic system (VetEquip, catalog number: 922100 ) including a vaporizer, induction chamber, tubing, nose cones, and oxygen tank
Glass bead sterilizer (GERMINATOR 500) (Roboz Surgical Instrument, catalog number: DS-401 )
Rechargeable shaver
Space gel heating pads (Braintree Scientific, catalog number: SPGL )
25 µl, model 702 RN syringe (Hamilton, catalog number: 7636-01 )
Syringe guide 25 µl-500 µl/7000 SYR (Hamilton, catalog number: 14906 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hughes, R. M., Simons, B. W. and Hurley, P. J. (2017). A Murine Orthotopic Allograft to Model Prostate Cancer Growth and Metastasis. Bio-protocol 7(4): e2137. DOI: 10.21769/BioProtoc.2137.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Tumor formation
Cancer Biology > Invasion & metastasis > Animal models
Cell Biology > Cell Transplantation > Allogenic Transplantation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,138 | https://bio-protocol.org/exchange/protocoldetail?id=2138&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In situ Hybridization (ISH) and Quantum Dots (QD) of miRNAs
Sajni Josson
Murali Gururajan
Leland W.K. Chung
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2138 Views: 10224
Edited by: HongLok Lung
Reviewed by: Chiara Ambrogio
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
miRNA are short non-coding RNA which inhibit translation of mRNA. miRNA regulate several cellular processes. Certain miRNA are known to induce oncogenesis. miRNA can be measured by real-time PCR and be imaged using a combination of in situ hybridization (ISH) and quantum dots (QD). The advantage of using quantum dots is that several miRNA can be simultaneously measured using multiplexed QD. Additionally, miRNA can be visualized in different regions of the tissue. Since miRNA are biomarkers of various disease states, miRNA can be visualized and quantitated in tissue sections for diagnostic and prognostic purposes. Here we describe ISH-QD analysis of tissue sections. Tissue sections from xenografts or clinical specimens are used. These are deparaffinized, treated with Proteinase K and hybridized with a biotin-probe to specific to the miRNA. The in situ hybridization is performed by labeling the biotin-probes and followed by labeling with streptavidin tagged quantum dots. Image acquisition of the quantum dots is performed and analyzed for the miRNA expression levels. Combining ISH and QD gives a powerful tool to detect miRNA in different cells of the tissue.
Keywords: miRNA in situ hybridization Multiplexed quantum dots Cancer Cancer associated stroma Cellular compartments Biomarkers Tissue staining
Background
miRNAs can be easily detected by quantitative real-time PCR or Northern blotting. However, imaging miRNAs has been challenging. Recent advances in quantum dots imaging have made it possible to determine expression of miRNAs in tissues. Using this process, miRNAs can be visualized in different compartments of a tissue, such as tumor, stroma, immune cells, etc. Additionally, miRNAs can be multiplexed to determine co-localization of miRNAs which mediate specific processes, in different cellular regions. Different tissues can be used for ISH-QD such as tissues from xenografts or human clinical samples. Tissues from animal studies are formalin fixed and paraffin embedded. These tissues were used for ISH-QD analysis (Figure 1).
Figure 1. In situ hybridization coupled to Quantum dots labelling for visualization of miRNA. In the ISH-QD protocol, miRNA are detected on formalin fixed paraffin embedded tissue sections using biotinylated miRNA probes binding to streptavidin-conjugated QDs. The specific QD gives a specific fluorescent signal which is quantified using the Inform v1.3 software.
Materials and Reagents
Gloves
Tissue slides
Superfrost plus slides
Coverslips
LNATM Scramble-miR probe (Exiqon, catalog number: 699004-370 )
LNATM miR-409-3p 5’ biotin labeled (Exiqon, catalog number: 610701-370 )
LNATM miR-409-5p 5’ biotin labeled (Exiqon, catalog number: 615615-370 )
RNaseZap (Thermo Fisher Scientific, AmbionTM)
Xylene
Ethanol
Sterile PBS (pH 7)
Nail polish
Horse serum (Vector Laboratories, catalog number: S-2000 )
Streptavidin block reagent (Thermo Fisher Scientific, InvitrogenTM)
Streptavidin conjugated QDs 625 nm (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: A10196 ) (1 µm stock from Invitrogen)
Streptavidin conjugated QDs 565 nm (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: Q10131MP ) (1 µm stock from Invitrogen)
6% IgG-free, protease free BSA (Jackson ImmunoResearch, catalog number: 001-000-162 )
BSA
0.4% Triton X-100
0.1% Tween-20
Mounting media
4’6-diamidino-2-phenylindole (DAPI) (Vector Laboratories)
1 M Tris-HCl (pH 7.4)
0.5 M EDTA
NaCl
RNase free Milli-Q water, autoclaved (all solutions prepared in this water)
Exiqon microRNA ISH buffer set and Proteinase K (Exiqon, catalog number: 90000 )
20x SSC, pH 7.0
Proteinase K stock (see Recipes)
Proteinase K buffer (see Recipes)
Proteinase K solution (15 µg/ml) (see Recipes)
SSC solutions (see Recipes)
Hybridization mix (see Recipes)
Streptavidin blocking solution (see Recipes)
QD solutions (see Recipes)
PBS-T (see Recipes)
Equipment
Autoclave
Hybridizer (DAKO Statspin Hybridizer)
Glass cutter
Slide rack and glass jars
PAP pen or ImmEdge pen (Vector Laboratories, catalog number: H-4000 )
Water bath
CRi multi-spectral camera with built-in Nuance software and inForm software (PerkinElmer, Waltham, MA)
Software
Nuance v3.1 software
Inform v1.3 software
Graphpad Prism software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Josson, S., Gururajan, M. and Chung, L. W. (2017). In situ Hybridization (ISH) and Quantum Dots (QD) of miRNAs. Bio-protocol 7(4): e2138. DOI: 10.21769/BioProtoc.2138.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Biochemistry > RNA > miRNA tagging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,139 | https://bio-protocol.org/exchange/protocoldetail?id=2139&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
miRNA Characterization from the Extracellular Vesicles
Sajni Josson
Murali Gururajan
Leland W.K. Chung
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2139 Views: 7590
Edited by: HongLok Lung
Reviewed by: Shalini Low-Nam
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Cancer cells and cancer associated stromal cells co-evolve secrete extracellular vesicles to the surrounding regions and regulate several processes involved in cancer metastasis. miRNAs have been known to be mediators of cancer progression and metastasis. miRNAs consist of short noncoding RNA. miRNAs are stable in extracellular fluids such as serum, plasma and urine. miRNAs are secreted by cells in normal and diseased conditions. miRNAs signatures have been identified specific to certain disease conditions. Therefore they are valuable biomarkers for different diseases. In our study we identified certain miRNAs, miR-409-3p and miR-409-5p, which were secreted by activated stromal fibroblast cells and were taken up by cancer cells to induce explosive tumor growth, through activation of epithelial to mesenchymal transition of cancer cells. Here we describe a procedure to determine miRNAs (miR-409-3p and miR-409-5p) in extracellular vesicles, which were secreted by prostate cancer stromal cells expressing miR-409. In this procedure, conditioned media from the stromal fibroblasts was used to extract the vesicular fraction. RNA was purified from the vesicular fraction, and specific miRNA was reverse transcribed and quantitated using real-time PCR assay.
Keywords: miRNA Extracellular vesicles Quantitative real-time PCR Cancer Cancer associated stroma Biofluids Biomarkers Exosomes
Background
miRNA are short non-coding RNA of 20-23 nucleotides in size. miRNAs have been detected in tissues and body fluids. miRNA expression levels have been determined using Northern blotting and quantitative real-time PCR. miRNA are powerful biomarkers for disease conditions. Under frozen conditions, they are stable in biofluids. Recent emphasis is on the miRNA in the vesicular fractions of cells and extracellular fluids (Josson et al., 2015). Extracellular vesicles (EV) contain different proteins, lipids, DNA, RNA and miRNA. EVs range from sizes of 30 nm to a few µm. EVs has been isolated using kits or differential centrifugation (Morello et al., 2013). In this study we describe the detection of miRNA in the vesicular fraction of activated stromal fibroblast cells. miRNAs are typically detected by Northern blot or quantitative real-time PCR assay (Josson et al., 2015). Using the recently available exosome purification kits we isolated exosomes and purified the miRNA from this fraction. The specific miRNA was reverse transcribed and quantitated using real-time PCR assay.
Materials and Reagents
6 well plates
6-well dish
MicroAmp® optical 96-well reaction plate (Thermo Fisher Scientific, Applied BiosystemsTM)
MicroAmp® optical adhesive tape (Thermo Fisher Scientific, Applied BiosystemsTM)
SON normal human stromal fibroblast cells expressing miR-409 miRNA
Penicillin-streptomycin (1%, stock: 10,000 U/ml)
Exosome depleted FBS media supplement (System Biosciences, catalog number: EXO-FBS-50A-1 )
Exo-Quick-TC (System Biosciences, catalog number: EXOTC10A-1 )
SeraMir exosome RNA purification kit (System Biosciences, catalog number: RA808A-1 )
Heat inactivated fetal bovine serum (Bio-Whittaker)
DMEM
F-12K
Sodium bicarbonate
Insulin
Triiodothyronine
Transferrin
Biotin
Adenine
dNTP mixture (Thermo Fisher Scientific, Applied BiosystemsTM)
M_MLV reverse transcriptase (Thermo Fisher Scientific, Applied BiosystemsTM)
10x RT buffer (Thermo Fisher Scientific, Applied BiosystemsTM)
RNase inhibitor (Thermo Fisher Scientific, Applied BiosystemsTM)
dH2O (Thermo Fisher Scientific, Applied BiosystemsTM)
Taqman miRNA primer sets for hsa-miR-409-3p, hsa-miR-409-5p and RNU6B (Thermo Fisher Scientific, Applied BiosystemsTM)
Taqman universal PCR master mix, No AmpErase® UNG (Thermo Fisher Scientific, Applied BiosystemsTM)
T-medium (see Recipes)
Reverse transcription mix for 1 reaction (see Recipes)
Real Time PCR reaction mixture for a single reaction (see Recipes)
Equipment
Centrifuge
Nanodrop 2000/2000c spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanodropTM 2000 / 2000c Spectrophotometer )
Applied Biosystems 7500 Real-Time PCR machine (Thermo Fisher Scientific, model: 7500 Real-Time PCR System )
PCR machine
Software
Taqman software
Graphpad Prism software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Josson, S., Gururajan, M. and Chung, L. W. (2017). miRNA Characterization from the Extracellular Vesicles. Bio-protocol 7(4): e2139. DOI: 10.21769/BioProtoc.2139.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Biochemistry > RNA > miRNA tagging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,140 | https://bio-protocol.org/exchange/protocoldetail?id=2140&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Purification of Cyanobacterial Circadian Clock Protein KaiC and Determination of Its Auto-phosphatase Activity
Qiang Chen
Lingling Yu
Xiao Tan
Sen Liu
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2140 Views: 7394
Edited by: Dennis Nürnberg
Reviewed by: Anna A. ZorinaEsteban Paredes-Osses
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Circadian rhythms are biological processes displaying an endogenous oscillation with a period of ~24 h. They allow organisms to anticipate and get prepared for the environmental changes caused mainly by the rotation of Earth. Circadian rhythms are driven by circadian clocks that consist of proteins, DNA, and/or RNA. Circadian clocks of cyanobacteria are the simplest and one of the best studied models. They contain the three clock proteins KaiA, KaiB, and KaiC which can be used for in vitro reconstitution experiments and determination of the auto-phosphatase activity of KaiC as described in this protocol.
Keywords: KaiA KaiC Circadian clock Phosphorylation Oscillator
Background
The rotation of planet Earth causes the ~24 h day-night oscillation. To fit in and then efficiently take advantage of this rhythmic change of the environment, most if not all organisms have an endogenous activity rhythm of ~24 h, which is called circadian rhythm. Circadian rhythms provide evolutionary advantages to those organisms. The long-term disruption of circadian rhythms is extremely harmful (Ma et al., 2013). In humans, many diseases, including cancer, hypertension, and sleep disorders, are closely related with a disrupted circadian rhythm (Shi et al., 2013; Roenneberg and Merrow, 2016).
Circadian rhythms are controlled by endogenous rhythm generators called circadian clocks. A functional circadian clock has three functionalities: accepting the environmental information, turning the environmental cues into oscillating signals, and relaying these signals to down-stream modulators (Pattanayak and Rust, 2014). Cyanobacteria are the simplest organisms having a well-studied circadian clock, in which the oscillation generator is controlled by three proteins: KaiA, KaiB, and KaiC (Mackey et al., 2011; Johnson et al., 2011; Chen et al., 2013; Egli and Johnson, 2013). KaiC is a multi-functional protein, which has auto-kinase, auto-phosphatase, and ATPase activity (Egli, 2015). The auto-kinase activity results in the phosphorylation of the two key residues T432 and S431 in KaiC, whereas the auto-phosphatase activity results in their de-phosphorylation (Rust, 2012). When incubated alone, KaiC shows mainly phosphatase activity (Nishiwaki and Kondo, 2012). KaiA can stimulate the auto-kinase activity of KaiC, and KaiB antagonizes KaiA’s function, which makes the phosphorylation state of KaiC oscillate in a ~24 h rhythm (Dong et al., 2016).
In 2005, Nakajima et al. successfully reconstituted the KaiABC oscillator in vitro by mixing the purified proteins, KaiA, KaiB, and KaiC, in a buffer containing ATP and Mg2+ (Nakajima et al., 2005). The simple procedure made the KaiABC system a highly attractive model for studying the molecular mechanism of circadian clocks. In this protocol, a major part of the reconstitution system, the in vitro determination of the auto-phosphatase activity of KaiC is described, in which the phosphorylation states of KaiC are analyzed by SDS-PAGE.
Materials and Reagents
1.5 ml microcentrifuge tubes
15 ml tube (Corning, Axygen®, catalog number: SCT-15mL-25-S )
50 ml centrifuge tube (Corning, Axygen®, catalog number: SCT-50mL-25-S )
Petri dish (Corning, catalog number: 70165-60 )
Hitrap FF Q column: 5 ml (GE Healthcare, catalog number: 17-5156-01 )
NAP-5/25 buffer exchange column (GE Healthcare, catalog number: 17-0853-02 )
Centrifugal filter: 10 kDa, Amicon Ultra (EMD Millipore, catalog number: PR02967 )
0.22 µm filter (Pall, catalog number: PN 4612 )
PCR tube (Bio-Sharp, catalog number: BS-02-P )
0.45 µm filter
E. coli strain BL21 (DE3) (New England Biolabs, catalog number: C2527 )
pGEX-6P-1-KaiC: Provided by Prof. Carl Johnson (Vanderbilt University, USA). The KaiC-coding sequence is from Synechococcus elongatus PCC 7942
Bacto-tryptone (Oxoid, catalog number: LP0042 )
Bacto-yeast extract (Oxoid, catalog number: LP0021 )
Agar A (Beijing Dingguo Changsheng Biotechnology, catalog number: DH010 )
Calcium chloride (CaCl2) (1 M; Sigma-Aldrich, catalog number: V900266 )
Ampicillin (1 mg/ml; North China Pharmaceutical Group Corporation, catalog number: A102048-25g )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sigma-Aldrich, catalog number: 16758 )
Glutathione S-transferase (GST) resin (EMD Millipore, catalog number: 70541 )
PreScission protease (PSP) (GE Healthcare, catalog number: 27-0843-01 )
Kanamycin (1 mg/ml; GENVIEW, catalog number: AK177-10G )
3x loading dye
Tris-base (AMRESCO, catalog number: 0497 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 7647-14-5 )
Dithiothreitol (DTT) (Life Science Products&Services, catalog number: DB0058-25g )
Tween-20 (Enox, catalog number: 557 )
ATP (Life Science Products&Services, catalog number: AB0020-25g )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
EDTA (Bio Basic, catalog number: EB0185 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
SDS (Life Science Products&Services, catalog number: SB0485 )
Bis-acrylamide (Sigma-Aldrich, catalog number: 146072 )
Ammonium persulfate (APS) (Xilong Scientific, catalog number: 51504 )
TEMED (CUSABIO, catalog number: V900853 )
Pierce Coomassie (Bradford) Protein Assay Kit (Sangon Biotech, catalog number: C503031 )
Bromophenol blue (Sigma-Aldrich, catalog number: 115-39-9 )
Methanol (Tianjin Kermel Chemical Reagent, catalog number: 32058 )
Acetic acid (Heng Xing, catalog number: 81601 )
Acrylamide (AMRESCO, catalog number: 0341 )
Protein marker (SM0431, Fermantas) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 26610 )
GSH (Reduced Glutathione) (Sangon Biotech, catalog number: A100399 )
Ethanol (Heng Xing, catalog number: 32061 )
PSP buffer (see Recipes)
Buffer A (see Recipes)
Buffer B (see Recipes)
Reaction buffer (see Recipes)
1 M IPTG (see Recipes)
10x running buffer (see Recipes)
8% separation gel (see Recipes)
5% stacking gel (see Recipes)
Coomassie blue staining solution (see Recipes)
De-staining buffer (see Recipes)
Equipment
Autoclave sterilizer (Shanghai Huaxian Medical Equipment, model: HVA-85 )
Laminar flow hood (SU ZHOU AN TAI, model: SW-CJ-2F )
Electric Thermostatic incubator (Shanghai Yuejin Medical Apparatus Factory, model: SHP-250 )
Pipettes (Gilson, catalog numbers: 711111170000 and 711111050000 )
Orbital shaker (Thermo Fisher Scientific, Thermo ScientificTM, model: SHKE4000-1CE )
High-speed refrigerated centrifuge (Hitachi, model: CR21G )
Refrigerated centrifuge (Sigma Laborzentrifugen, model: 5811XQ 14241g )
Benchtop centrifuge (Eppendorf, model: 1024 and 5424 )
Ultra-low temperature freezer (Haier, model: 906 )
Microplate spectrophotometer (Thermo Fisher Scientific, model: 1500 )
Analytical balance (Sartorius, model: CP225D )
Ultrapure water system (Pall, model: CascadA ZX )
Membrane filter system (EMD Millipore, USA)
Ultrasonic cell processor (Scientz Biotechnology, model: SCIENTZ-IID )
FPLC system (GE Healthcare, model: AKTA Purifier 100 )
Precision pH meter (Mettler Toledo, model: EL-20 )
Electrophoresis system (Bio-Rad Laboratories, model: Mini-Protean Tetra )
Decolorization shaker (Haimen Kylin-Bell Lab Instruments, model: TS-8 )
Gel imaging system (Kodak, model: Gel Logic 200 )
PCR system (Biometra, model: T-Gradient Thermoblock )
Software
ImageJ (version 1.8.0_77, NIH, USA)
Excel (version 2012, Microsoft, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, Q., Yu, L., Tan, X. and Liu, S. (2017). Expression and Purification of Cyanobacterial Circadian Clock Protein KaiC and Determination of Its Auto-phosphatase Activity. Bio-protocol 7(4): e2140. DOI: 10.21769/BioProtoc.2140.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,141 | https://bio-protocol.org/exchange/protocoldetail?id=2141&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Rice Root Organic Acid Efflux Measurement by Using Ion Chromatography
Chun-quan Zhu
Xiao-fang Zhu
Ren-fang Shen
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2141 Views: 8241
Edited by: Arsalan Daudi
Reviewed by: Wan-Jun Zhang
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Organic acids secreted from plant roots play important roles in various biological processes including nutrient acquisition, metal detoxification, and pathogen attraction. The secretion of organic acids may be affected by various conditions such as plant growth stage, nutrient deficiency, and abiotic stress. For example, when white lupin (Lupinus albus L.) is exposed to phosphorus (P)-deficient conditions, the secretion of citrate acid from its proteoid roots significantly increases (Neumann et al., 1999). This protocol describes a method for the collection and measurement of the efflux of organic acids (oxalate, malate, and citrate) from the roots of rice cultivar Nipponbare (‘Nip’) under different nitrogen forms (NH4+ and NO3-), together with different P supply (+P and -P) conditions.
Keywords: Organic acids Rice Collection Measurement Ion chromatography
Background
In addition to enzymatic methods (Delhaize et al., 1993) and high-performance liquid chromatography (HPLC) (Chen et al., 2013), ion chromatography is another widely used method for the determination of organic acids, which has previously been employed to detect the significant increase in oxalate content in taro root exudates during Al3+ stress (Ma and Miyasaka, 1998). Compared to ion chromatography, alternative methods have their own defects. For example, enzymatic methods require the use of enzymes that can easily undergo denaturation. Moreover, it is difficult to distinguish oxalate acid from Cl- peaks by HPLC. Here, we describe a method for analyzing organic acids secreted by rice roots using ion chromatography. This method could be used in the analysis of organic acids that are secreted by other hydroponically cultivated plants.
Materials and Reagents
0.2 µm syringe filter (Beyotime, catalog number: FF252 )
Rice seedlings
Nutrient solution
Amerlite IR-120B resin (H+ form) (Alfa Aesar, catalog number: L14285 )
Dowex 1 x 8 resin (100-200 mesh, formate form)
Distilled water
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 258148 )
Formic acid (HCOOH) (Sigma-Aldrich, catalog number: 695076 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 221465 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: 223506 )
Oxalate (Sigma-Aldrich, catalog number: 75688 )
Malate (Sigma-Aldrich, catalog number: M8304 )
Citrate (Sigma-Aldrich, catalog number: 251275 )
1 N HCl (see Recipes)
2 N HCl (see Recipes)
2 M HCOOH (see Recipes)
4 N NaOH (see Recipes)
0.5 mM CaCl2 (see Recipes)
Equipment
1.25 L black plastic pot (plastic pot must be opaque, if required, wrap it in black tape)
pH meter (Mettler Toledo, model: S40 / SG78 / SG23 / SG68 )
Cation exchange column (16 mm x 14 cm) (Bio-Rad Laboratories, model: 732-1010 )
Rotary evaporator (IKA, model: RV10 )
Ion chromatography (Thermo Fisher Scientific, Dionex, model: ICS 3000 System )
IonPac AS11 anion-exchange analytical column (4 x 250 mm)
Guard column (4 x 50 mm)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Zhu, C., Zhu, X. and Shen, R. (2017). Rice Root Organic Acid Efflux Measurement by Using Ion Chromatography. Bio-protocol 7(4): e2141. DOI: 10.21769/BioProtoc.2141.
Zhu, C. Q., Zhu, X. F., Hu, A. Y., Wang, C., Wang, B., Dong, X. Y. and Shen, R. F. (2016). Differential Effects of Nitrogen Forms on Cell Wall Phosphorus Remobilization Are Mediated by Nitric Oxide, Pectin Content, and Phosphate Transporter Expression. Plant Physiol 171(2): 1407-1417.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Other compound
Plant Science > Plant biochemistry > Other compound
Biochemistry > Other compound > Acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,142 | https://bio-protocol.org/exchange/protocoldetail?id=2142&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Endophytic Microbial Community DNA Extraction from the Plant Phyllosphere
CR Carlos A. Ruiz-Pérez
MZ María Mercedes Zambrano
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2142 Views: 10700
Reviewed by: Ramalingam Bethunaickan
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
The plant phyllosphere, which represents all plant parts that are above the ground, is considered one of the most extensive ecosystems to be colonized by microorganisms, both at the surface as epiphytes or as endophytes within the plant. These plant-associated microbial communities are reservoirs of microbial diversity and they can be important for plant health. The characterization of microbial communities in diverse plants, such as Espeletia plants that are endemic to the Paramo ecosystem in the Andes Mountains, can shed light regarding possible interactions among microorganisms and microbial functional properties. Obtaining DNA from plant endophytic microbial communities involves various steps to ensure that samples are free of contamination from microorganisms present on the plant surface (epiphytes). Plant leaves are first surface sterilized, cut into pieces, homogenized using glass beads, and then used for DNA extraction using a commercially available kit. DNA samples are then quantified and analyzed using Qubit® 2.0 for use in PCR amplification of 16S rRNA genes.
Keywords: Endophyte Phyllosphere Metagenomics Epiphyte 16S rRNA
Background
Extraction of endophytic DNA from plant samples has been done by several research groups and usually involves steps to minimize contamination from surface microbes. However, protocols must also be adapted to the plant material being studied and as such can incorporate different steps. Extraction of epiphyte DNA must also ensure that there is no contamination from endophytic microorganisms. The protocol described integrates elements from previous reports (Miles et al., 2012; Araujo et al., 2002), but was not identical given the characteristics of the plant material used. In this work we used leaves from Espeletia hartwegiana, a plant that is endemic to the Paramo ecosystem present in the Colombian Andean mountains. These leaves are characterized to be large and succulent with the presence of short hairs on the surface (pubescence) that require removal prior to leaf surface sterilization and DNA isolation. Here, although the pubescence is removed, the microorganisms associated with it are dislodged first to ensure a complete picture of the epiphyte community. In this case, sufficient DNA of good quality was recovered for PCR amplification and 16S rRNA gene analysis and for functional analysis using the GeoChip (Yan et al., 2015). Nonetheless, other downstream applications could require more DNA and hence more plant material.
Materials and Reagents
Gloves
1.5 ml sterile microcentrifuge tubes
10, 100, 1,000 micropipette tips
Sterile craft paper
Ziploc bags (ethanol rinsed)
Sterile swabs (preferably sponge top)
Plant leaves (Espeletia sp.) ~10 g (Maybe more depending on the downstream application). Leaves were collected 1-2 days prior to processing, transported on dry ice and stored in sterile plastic bags at 4 °C
Sterile dH2O
100% ethanol (Sigma-Aldrich, catalog number: E7023 )
5.25% sodium hypochlorite (Quidiscol Ltda, Bogotá, Colombia)
Power Soil DNA Isolation Kit (MO BIO Laboratories, catalog number: 12888-50 )
Sodium phosphate dibasic, Na2HPO4 (Sigma-Aldrich, catalog number: S3264 )
Malt extract solid medium (OXOID, catalog number: CM0059 )
Tris base (Promega, catalog number: H5133 )
EDTA (Sigma-Aldrich, catalog number: E9884 )
HCl (Mol Labs, catalog number: V4653 )
0.5 M NaH2PO4 (see Recipes)
NAP buffer (see Recipes)
Malt extract solid medium (see Recipes)
TE buffer (see Recipes)
Note: All reagents used have a specific manufacturer and catalog number. Nonetheless, the user can use any molecular-grade reagent for the protocol.
Equipment
Sterile 500-1,000 ml beakers, autoclaved
1-25 µl micropipette
10-100 µl micropipette
100-1,000 µl micropipette
Sterile razors
Vortex
Sterile tweezers
25 °C incubator
Sterile glass beads, autoclaved
Laminar flow hood, preferably a class II BSC to avoid contamination
Mini-Bead beater-96 (BioSpec Products)
Qubit® 2.0 fluorometer (Thermo Fisher Scientific, USA)
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ruiz-Pérez, C. A. and Zambrano, M. M. (2017). Endophytic Microbial Community DNA Extraction from the Plant Phyllosphere. Bio-protocol 7(4): e2142. DOI: 10.21769/BioProtoc.2142.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Endosymbiosis
Microbiology > Microbe-host interactions > Bacterium
Molecular Biology > DNA > DNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,143 | https://bio-protocol.org/exchange/protocoldetail?id=2143&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Analysis of Exosome Secretion Rates of Single Cells
YC Yu-Jui Chiu*
WC Wei Cai*
TL Tiffany Lee
JK Julia Kraimer
YL Yu-Hwa Lo
*Contributed equally to this work
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2143 Views: 11607
Edited by: Gal Haimovich
Reviewed by: Shalini Low-NamMarco Di Gioia
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
To study the inhomogeneity within a cell population including exosomes properties such as exosome secretion rate of cells and surface markers carried by exosomes, we need to quantify and characterize those exosomes secreted by each individual cell. Here we develop a method to collect and analyze exosomes secreted by an array of single cells using antibody-modified glass slides that are position-registered to each single cell. After each collection, antibody-conjugated quantum dots are used to label exosomes to allow counting and analysis of exosome surface proteins. Detailed studies of exosome properties related to cell behaviors such as responses to drugs and stress at single cell resolution can be found in the publication (Chiu et al., 2016).
Keywords: Single cell Exosome Single-cell assay Exosome secretion Exosome quantification Single cell arrays Single cell culture
Background
Exosomes have been found to play an essential role in tumorigenesis, cell-cell signaling, organotropic metastasis, drug resistance, and many crucial biological processes involving cell-cell communications. Most exosome isolation methods developed to date use ultracentrifugation at 100,000 x g (Théry et al., 2006) and require a large amount of samples. Combinations of microfluidics with immunological separation or physical trap have been reported (Liga et al., 2015) as simpler exosome isolation methods requiring a relatively small amount of sample. However, most microfluidic platforms have difficulties in integration of standard cell culture protocols, while cell culture in microfluidic environments can introduce new variables and unintended stresses to cells and change their behaviors and gene expressions. Above all, all existing approaches collect exosomes from cells without distinction, so it is extremely difficult to trace exosomes to the cells that secrete them. However, given the high diversity and inhomogeneity of biological samples, it is of great value to correlate the exosomes to the cell source. Furthermore, it is highly desirable to quantify the exosome analysis at a single cell level by finding the changes in exosome properties and secretion rates when cells are affected by stimuli, stresses and/or environmental changes. Here we provide a culture friendly, high-throughput, and versatile single-cell assay that enables quantitative analysis of exosomes secreted by individual cells.
Materials and Reagents
35 mm Petri dish (Corning, Falcon®, catalog number: 351008 )
Cover glass (Ted Pella, catalog number: 260364 )
Glass slides
Silicon wafer (4” test grade) (University Wafer, catalog number: 452 )
Acrylic (PMMA, 2 mm thick) (Sigma-Aldrich, catalog number: GF10188996 )
35 mm cell culture dish (Sigma-Aldrich, catalog number: D7804 )
Parafilm (Sigma-Aldrich, catalog number: P7793 )
Aluminum foil
0.22 µm filter
Cells
Note: Our protocol can be used for both adherent and non-adherent cells. For examples, MCF7, MB-MDA-231, MCF10A, Neuronspheres, etc.
Polydimethylsiloxane (PDMS) (Dow Corning, catalog number: SYLGARD® 184 Silicone Elastomer Kit )
Pure ethanol (Decon Labs, catalog number: V1001 )
(3-mercaptopropyl)trimethoxysilane (MPS) (Gelest, catalog number: 4420-74-0 )
Sulfo-GMBS, N-[γ-maleimidobutyryloxy]sulfosuccinimide ester (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 22324 )
Phosphate-buffered salines (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Monoclonal anti-human CD63 antibody (Ancell, catalog number: 215-820 )
Bovine serum albumin (BSA power) (Sigma-Aldrich, catalog number: A8531 )
Paraformaldehyde solution (4% in PBS) (Affymetrix, catalog number: 19943 1 LT )
Biotinylated anti-CD63 (Ancell, catalog number: 215-030 )
Qdot® incubation buffer (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: Q20001MP )
Quantum dots (Qdot® 545 ITKTM) streptavidin conjugate (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: Q10091MP )
Tris buffered saline with Tween® 20 (TBST-10x) (Cell Signaling Technology, catalog number: 9997 )
DI water
Blocking buffer (see Recipes)
Blocking buffer for Qdot (see Recipes)
1x TBST (see Recipes)
Equipment
CNC (Computer Numeric Control) micro milling machine (Minitech Machinery, model: Mini/Mill/1 )
Disco automatic dicing saw 3220 (Nano3, model: 3220)
Plasma Etch system (for cleaning) (Plasma Etch, model: PE-100 )
Soda Lime Silica glass Petri dish (Corning, catalog number: 70165-152 )
Standard biosafety cabinet
Shaker (VWR, model: VWR Mini shaker )
Oven
1 ml pipet
Microscope (KEYENCE, model: BZ-9000 , similar to BZ-X700 )
Centrifuge (Thermo Fisher Scientific, model: CL2 )
Tweezers
Cell counter
Notes
Equipment 1-3 can be found in core facility such as micro/nano fab. Please see Nano3 facility of UCSD as an example. Equipment 1 can also be found in most machine shop as a service.
Centrifuge is chosen to fit 35 mm dishes. If you have a centrifuge that suit 6-well plate, 35 mm dishes can be replaced with a 6-well plate.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chiu, Y., Cai, W., Lee, T., Kraimer, J. and Lo, Y. (2017). Quantitative Analysis of Exosome Secretion Rates of Single Cells. Bio-protocol 7(4): e2143. DOI: 10.21769/BioProtoc.2143.
Download Citation in RIS Format
Category
Cell Biology > Organelle isolation > Exosomes
Cell Biology > Single cell analysis > Microfluidics
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,144 | https://bio-protocol.org/exchange/protocoldetail?id=2144&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chromatographic Separation of the Codonocarpine Type Alkaloids from the Root Bark of Capparis decidua
Yvonne Forster
Abdul Ghaffar
Stefan Bienz
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2144 Views: 7494
Edited by: Arsalan Daudi
Reviewed by: Ming LuoMagdalena Migocka
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Various parts of the caper tree Capparis decidua have found application in traditional medicine. The isolation and structural elucidation of the codonocarpine type alkaloids contained in the root bark, however, is not trivial and has probably led to misinterpretation in the past. This protocol describes the extraction and chromatographic separation of the four major alkaloids of the root bark of Capparis decidua. The delivered samples of cadabicine, codonocarpine, isocodonocarpine and capparidisinine were suitable for their unambiguous structural elucidation by NMR, MS and MS/MS.
Keywords: Capparis decidua Capparaceae Spermidine alkaloid Cadabicine Codonocarpine Isocodonocarpine Capparidisinine Chromatographic separation
Background
The tree Capparis decidua is widely distributed in the arid regions of Africa, the Middle East and Southern Asia, where various parts of the plant are commonly used in local folk medicines for the treatment of various disorders. The root bark, for example, is applied as anthelmintic and purgative, and it has been shown that its alcoholic extract possesses significant antibacterial and antifungal activities (Singh et al., 2011; Singh and Singh, 2011; Tlili et al., 2011; Mohammed et al., 2015).
Ahmad et al. (1985; 1986; 1987; 1989; Arif, 1986) intensively studied the root bark extract of Capparis decidua and published several structures of codonocarpine type alkaloids. Some of these structures did not fit with our understanding of the biosynthesis of such alkaloids. Further, we were not convinced that the given analytic data and its interpretation gives unambiguous proof for the structural claims (Bienz et al., 2002). Therefore, we initiated our own investigation. We developed a protocol for the extraction and chromatographic separation of codonocarpine type alkaloids and could isolate three alkaloid fractions that allowed the identification and structural elucidation of the four major spermidine alkaloids of the root bark of Capparis decidua: cadabicine (1), codonocarpine (2), isocodonocarpine (3), and capparidisinine (4) (Figure 1) (Forster et al., 2016).
Figure 1. The four major codonocarpine type alkaloids found in the root bark of Capparis decidua. (1) Cadabicine; (2) Codonocarpine; (3) Isocodonocarpine; and (4) Capparidisinine.
The isolation and structure elucidation of alkaloids is not trivial. The class of alkaloids, defined as nitrogen containing organic compounds from natural sources with a most basic character, comprises more than 10,000 compounds. As the properties and structures of alkaloids differ strongly from compound to compound, there is no general way to isolate them. Nevertheless, most alkaloids exist naturally in their protonated form. Hence, the methanolic extraction of dried and crushed plant material is often applied. As alkaloids usually possess amino and other functional groups that could react with solvents and additives, as well as with CO2 or oxygen from air, the formation of artefacts is prevented as far as possible by the choice of appropriate conditions. In general, artefacts can be recognized by comparing the analytical data of the isolated fractions and the original sample. Therefore, some of the original sample should always be kept as reference material (Hesse, 2000).
Materials and Reagents
Cotton wool (e.g., Thomas Scientific, catalog number: 2904W25 )
Sea sand (cristobalite, Brenntag Schweizerhall AG) (e.g., Grogg Chemie, catalog number: G890 )
Round bottom test tubes, ca. 100 x 16 mm (Assistant, catalog number: 42775045 )
TLC plates (TLC Silica gel 60 F254 on aluminum 20 x 20 cm) (EMD Millipore, catalog number: 100390 )
Glass capillaries (MARCHEREY-NAGEL, catalog number: 814022 )
2 ml 9 mm ScreVial, clear glass 12 x 32 mm (Infochroma, catalog number: G004-HP-H )
9 mm screw cap with 1 mm pigment-free ms-pure PTFE/Silicone/PTFE-Septum (Infochroma, catalog number: G004-HP-CB-FKSKFK10 )
1.5 ml Eppendorf tubes (Eppendorf, catalog number: 0030120086 )
Plant material: Capparis decidua root bark (collected in Sahiwal, Pakistan and identified by M. Waris, Department of Cholistan Institute of Desert Studies, The Islamia University of Bahawalpur, Pakistan)
MeOH (methanol, technical grade, distilled prior to use) (Thommen Furler, catalog number: 203-VL54TE )
SiO2 (Merck silica gel 60 [40-63 μm]) (EMD Millipore, catalog number: 109385 )
Ammonium hydroxide (NH3, aqueous ammonia solution 25%, puriss p.a.) (Honeywell, catalog number: 30501 )
Chloroform (CHCl3, stabilized with EtOH) (Scharlab, catalog number: CL02181000 )
Dichloromethane (CH2Cl2, technical grade, distilled prior to use) (Thommen-Furler, catalog number: 739-VL54TE )
Diethylether (Et2O, puriss. p.a., stabilized with BTH, distilled from NaOH prior to use) (Honeywell, catalog number: 32203 )
Notes:
Pure ether is sensitive towards oxidation and can form explosive peroxides upon prolonged exposure to air and light. It therefore is usually stabilized with the antioxidant butylhydroxytoluene (BHT), which is removed upon distillation. Thus, distilled ether is again prone to form epoxides, and it is necessary to test your distilled ether for peroxides prior to its use if the solvent was exposed to air and light for several days.
To test for peroxides use: Quantofix® peroxides test sticks (Sigma-Aldrich, catalog number: Z101680 ).
Methylamine solution (MeNH2, 40 wt. %) (Sigma-Aldrich, catalog number: 426466 )
Hydrochloric acid (HCl, 37%) (for analysis, Merck) (EMD Millipore, catalog number: 100317 )
Acetonitrile (MeCN, LC-MS Ultra CHROMASOLV®) (Honeywell, catalog number: 14261 )
Formic acid (HCO2H, 99%, ULC/MS) (Biosolve, catalog number: 069141 )
2-propanol (LC-MS Ultra CHROMASOLV®) (Honeywell, catalog number: 650447 )
Sodium hydroxide solution (NaOH for HPCE, 0.1 N in H2O) (e.g., MSP KOFEL, catalog number: 5062-8575 )
H2PtCl6
KI
Ce(SO4)2
H2SO4
Schlittler reagent (see Recipes)
Ce(SO4)2 solution (see Recipes)
Equipment
Sharp axe (e.g., TRANSA, catalog number: 040929-001001 )
Capped fermentation tank (50 L, e.g., Braupartner, catalog number: 141-0 )
Filter strainer cloth (75 x 75 cm, e.g., Erwin Müller, catalog number: i10014278 )
Stainless steel spatula (e.g., Thomas Scientific, catalog number: 1232X12 )
Rotary evaporator (Büchi Rotavapor R-134 with Büchi Waterbath B-481) (Büchi, Flawil, Switzerland)
Glass funnels (e.g., Duran, catalog number: 21 351 23 )
Round bottom flasks of several sizes (5 ml, 10 ml, 25 ml, 50 ml, 250 ml, 1 L) (e.g., Schott, Germany)
Steel spring clips (e.g., Thomas Scientific)
NS 14.5 (e.g., Thomas Scientific, catalog number: 1178Z55 )
NS 29 (e.g., Thomas Scientific, catalog number: 1178Z57 )
Magnetic stir bars (e.g., Thomas Scientific, catalog number: 8608S78 )
Magnetic stirrer (Heidolph Instrument, catalog number: 505-30080-00 )
Glass bottle 1 L (e.g., Thomas Scientific, catalog number: 1228R95 )
Glass chromatography columns of different length and diameters with stopcock at the bottom and a ground socket joint at the top to fit a solvent reservoir (e.g., Neubert Glas, catalog number: 1196-29-20400 )
Glass beaker of several sizes (e.g., Duran, Germany)
A piece of vacuum hose (e.g., Thomas Scientific, catalog number: 9544T15 )
Solvent reservoirs: glass round bottom flasks of several sizes with oppositely attached ground cone and ground socket joints (e.g., Thomas Scientific, catalog number: 1197C03 )
Adaptors:
Ground cone joint NS 14.5 with hose barbe to tubing, bent (e.g., Thomas Scientific, catalog number: 1195C09 )
Ground cone joint NS 29 with hose barbe to tubing, bent (e.g., LabMarket, catalog number: 1681029 )
Hand pump (VWR, catalog number: 612-9952 )
125 ml Erlenmeyer flasks (e.g., Thomas Scientific, catalog number: 4907F23 )
Test tube racks (e.g., Thomas Scientific)
TLC chamber (screw cap glass jar, 250 ml)
UV lamp (254 nm), e.g., UV lamp 4, dual (Camag, model: 022.9160 )
High vacuum pump (Alcatel Pascal 2015 SD) (e.g., Ideal Vaccum Products, catalog number: P102310 )
CortecsTM UPLC® C18+, 1.6 μm, 2.1 x 150 mm (Waters, catalog number: 186007117 ), equipped with a CortecsTM UPLC® C18+ 1.6 μm, 2.1 x 5 mm VanGuardTM precolumn (Waters, catalog number: 186008713 )
AquityTM Ultra Performance LC (Waters, Milford MA, USA)
Bruker maXis Q-Tof HR-MS (Bruker Daltonics, Bremen, Germany)
Eppendorf refrigerated microcentrifuge (Eppendorf, model: 5417R )
MilliQ gradient apparatus (deionized water, for HPLC) (EMD Millipore, catalog number: Z00Q0V0WW )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Forster, Y., Ghaffar, A. and Bienz, S. (2017). Chromatographic Separation of the Codonocarpine Type Alkaloids from the Root Bark of Capparis decidua. Bio-protocol 7(4): e2144. DOI: 10.21769/BioProtoc.2144.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant physiology > Metabolism
Biochemistry > Other compound > Alkaloid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,145 | https://bio-protocol.org/exchange/protocoldetail?id=2145&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Automatic Quantification of the Number of Intracellular Compartments in Arabidopsis thaliana Root Cells
VB Vincent Bayle
Matthieu Pierre Platre
Yvon Jaillais
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2145 Views: 12315
Edited by: Tie Liu
Reviewed by: Amey G RedkarHonghong Wu
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
In the era of quantitative biology, it is increasingly required to quantify confocal microscopy images. If possible, quantification should be performed in an automatic way, in order to avoid bias from the experimenter, to allow the quantification of a large number of samples, and to increase reproducibility between laboratories. In this protocol, we describe procedures for automatic counting of the number of intracellular compartments in Arabidopsis root cells, which can be used for example to study endocytosis or secretory trafficking pathways and to compare membrane organization between different genotypes or treatments. While developed for Arabidopsis roots, this method can be used on other tissues, cell types and plant species.
Keywords: Arabidopsis Endocytosis Root Compartment Confocal analysis Image segmentation Spot detection
Background
Studies on plant intracellular trafficking have widely beneficiated from the identification and characterization of proteins that are localized to specific intracellular compartments. These proteins can serve in subsequent studies as compartment markers either using immunofluorescence when antibodies are available, or direct fusion with fluorescent proteins (Dettmer et al., 2006; Geldner et al., 2003; Jaillais et al., 2008; Jaillais et al., 2006). Typically, they can be used in co-localization experiments (Geldner et al., 2009; Simon et al., 2014), but also as reference points to characterize mutants, drugs or growth conditions that might affect intracellular trafficking pathways, such as exocytosis, endocytosis, autophagy, or secretory trafficking. The localization of these marker proteins may vary in different manner, including for example their number, size, shape, clustering or labeling intensity. For example, in root, the fungal toxin Brefeldin A (BFA), an inhibitor of protein recycling, degradation and secretion, induces the aggregation of multiple compartments in or around the so-called ‘BFA compartment’ (Geldner et al., 2003; Geldner et al., 2009). Wortmannin, an inhibitor of PI3 Kinase activity induces the fusion of late endosomal compartments (Jaillais et al., 2006; Tse et al., 2004), while concanamycin A induces TGN swelling (Dettmer et al., 2006). Accordingly similar effects on compartment numbers and/or morphology have been observed in trafficking mutants (Dettmer et al., 2006; Geldner et al., 2003; Jaillais et al., 2007; Sauer et al., 2013).
Automatic spot detection was spearheaded on leaf for the detection of endomembrane rearrangements induced by environmental changes such as dark, cold treatment or biotic stresses (Salomon et al., 2010). This technique was also applied to study the endocytosis of the FLAGELIN-INSENSITIVE2 (FLS2) receptor (Beck et al., 2012; Mbengue et al., 2016; Spallek et al., 2013). Here we described a protocol to computationally detect and count the number of intracellular compartments on Arabidopsis root image. This protocol relies on a macro that runs on the open source image analysis software ImageJ and that can work with a wide variety of images with different image-to-noise signals. In addition, it proposes two different modes of detection; a first one where the macro automatically finds the root area and another one that allows the selection of a user-defined region of interest (ROI). Finally, although this version of the macro is designed to count the number of spots, similar image segmentation can easily be used to measure spot size, to estimate signal intensity, to capture compartment morphology or to automatically quantify co-localization between two or more channels.
Equipment
Microscope: Plant imaging was performed on an inverted Zeiss microscope (Zeiss, model: AxioObserver Z1 ) equipped with a spinning disk module (Yokogawa, model: CSU-W1-T3 )
Camera: ProEM+ 1024B camera (Princeton Instrument, model: ProEM+ 1024B)
Objective: 63x Plan-Apochromat objective (numerical aperture 1.4, oil immersion).
Note: Images may be performed with any confocal microscope. We describe above the microscope setup used to take the sample images that can be downloaded below (see Software 7).
Software
ImageJ (http://imagej.nih.gov/ij/) (Schneider et al., 2012) (see Note 1)
Note: If link does not open, copy-paste the address in your browser.
SiCE spot detector Macro for ImageJ
Note: Download SiCE spot detector Macro for ImageJ. Go to http://www.ens-lyon.fr/RDP/SiCE/METHODS.html, right click on SiCE ‘SpotDetector.ijm’ and choose ‘save link as’. Use the following name to save the file: ‘SiCE SpotDetectorV3.ijm’.
Wavelet A Trou plugin for ImageJ (http://www.ens-lyon.fr/RDP/SiCE/METHODS_files/Wavelet_A_Trou.jar)
Note: If link does not open, copy-paste the address in your browser.
FeatureJ plugin for ImageJ (http://www.imagescience.org/meijering/software/featurej/)
Note: If link does not open, copy-paste the address in your browser.
XLstat (Addinsoft, https://www.xlstat.com).
R (The R foundation, https://www.r-project.org/), Excel (Microsoft, https://products.office.com/).
(Optional) Download template images (http://www.ens-lyon.fr/RDP/SiCE/METHODS) (see Note 2).
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bayle, V., Platre, M. P. and Jaillais, Y. (2017). Automatic Quantification of the Number of Intracellular Compartments in Arabidopsis thaliana Root Cells. Bio-protocol 7(4): e2145. DOI: 10.21769/BioProtoc.2145.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,146 | https://bio-protocol.org/exchange/protocoldetail?id=2146&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Direct Visualization and Quantification of the Actin Nucleation and Elongation Events in vitro by TIRF Microscopy
YJ Yuxiang Jiang
Shanjin Huang
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2146 Views: 8599
Edited by: Marisa Rosa
Reviewed by: Pablo Bolanos-VillegasStefanie Rosa
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Total internal reflection fluorescence (TIRF) microscopy is a powerful tool for visualizing the dynamics of actin filaments at single-filament resolution in vitro. Thanks to the development of various fluorescent probes, we can easily monitor all kinds of events associated with actin dynamics, including nucleation, elongation, bundling, fragmentation and monomer dissociation. Here we present a detailed protocol regarding the visualization and quantification of actin nucleation and filament elongation events by TIRF microscopy in vitro, which is based on the methods previously reported (Liu et al., 2015; Yang et al., 2011).
Keywords: Actin assembly Actin nucleation Actin filament elongation Single filament dynamics in vitro TIRF microscopy Oregon-green actin Profilin Formin
Background
The actin cytoskeleton undergoes constant assembly and disassembly that has been implicated in numerous physiological cellular processes, such as cell division, cell expansion, cytokinesis and maintenance of cell polarity. Understanding how actin dynamics are precisely regulated is a fundamental question in cell biology. Actin as the core component of the actin cytoskeleton can self-assemble into filamentous structure with the diameter of approximately 7 nm in the presence of potassium chloride, adenosine triphosphate, and magnesium. Within cells, however, the actin assembly and disassembly is tightly regulated by different actin-binding proteins (ABPs) to meet the demands of various physiological cellular processes. Reconstitution of how ABPs regulate actin assembly and disassembly as well as the formation of high-order actin structures in vitro may provide insights into the mechanism of action of actin during these physiological cellular processes. In order to achieve this, we need to establish assays to trace the actin assembly and disassembly reaction in vitro. The process of actin assembly and disassembly has been traced by the kinetic pyrenyl-actin assay. However, considering that it is a solution-based bulk assay, it is hard to determine the contribution of individual events to actin polymerization, such as actin nucleation and filament elongation events. Development of total internal reflection fluorescence microscopy (TIRF microscopy, or TIRFM) allows the direct visualization of the dynamics of individual actin filaments and quantification of the associated parameters. In addition, this assay requires the minimal amount of proteins compared to other assays.
Materials and Reagents
Cover glass (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3323 )
4 x 40 mm double-layer strips
Parafilm (Bemis, catalog number: PM996 )
Microscope slide (Sail brand, catalog number: 7105 )
Capillary paper
Oregon-green (OG) labeled actin (Scott et al., 2011)
Recombinant AtFormin5 and plant AtProfilin5 (Liu et al., 2015)
N-ethylmaleimide-myosin (Amann and Pollard, 2001)
Unlabeled rabbit muscle actin (Kuhn and Pollard, 2005)
EGTA (AMRESCO, catalog number: 0732 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2393 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P5405 )
Imidazole (EMD Millipore, catalog number: 814223 )
Tris base (Sigma-Aldrich, catalog number: T3253 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C5670 )
ATP (Sigma-Aldrich, catalog number: A6559 )
DTT (Sigma-Aldrich, catalog number: D0632 )
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: S2002 )
EDTA (AMRESCO, catalog number: 0322 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
Catalase from bovine liver (Sigma-Aldrich, catalog number: C9322 )
Glucose Oxidase from Aspergillus niger (Sigma-Aldrich, catalog number: G7141 )
Methylcellulose (Sigma-Aldrich, catalog number: M0262 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A1933 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
10x KMEI (see Recipes)
10x ME (see Recipes)
Buffer G (see Recipes)
1x TIRFM buffer (see Recipes)
HS-TBS (see Recipes)
HS-BSA (see Recipes)
LS-BSA (see Recipes)
Equipment
Alcohol burner
-80 °C freezer
Centrifuge
Spectrophotometer as an accessory in Infinite 200 PRO multimode reader (Tecan Trading)
Olympus IX81 microscope (Olympus, model: IX81) equipped with an inverted TIRF illumination system that has a 100x oil TIRF objective (1.49 numerical aperture)
Argon laser (488 nm excitation)
Photometrics cascade II 512 CCD camera (Photometrics, model: Photometrics cascade II 512 CCD camera)
Software
MicroManager software (https://micro-manager.org/)
ImageJ software (http://rsbweb.nih.gov/ij/; version 1.41)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jiang, Y. and Huang, S. (2017). Direct Visualization and Quantification of the Actin Nucleation and Elongation Events in vitro by TIRF Microscopy. Bio-protocol 7(5): e2146. DOI: 10.21769/BioProtoc.2146.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Labeling
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,147 | https://bio-protocol.org/exchange/protocoldetail?id=2147&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An HPLC-based Method to Quantify Coronatine Production by Bacteria
Shweta Panchal
ZB Zachary S. Breitbach
Maeli Melotto
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2147 Views: 8326
Edited by: Jyotiska Chaudhuri
Reviewed by: Honghong WuDe Michele Roberto
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Coronatine is a polyketide phytotoxin produced by several pathovars of the plant pathogenic bacterium Pseudomonas syringae. It is one of the most important virulence factors determining the success of bacterial pathogenesis in the plant at both epiphytic and endophytic stages of the disease cycle. This protocol describes an optimized procedure to culture bacterial cells for coronatine production and to quantify the amount of coronatine secreted in the culture medium using an HPLC-based method.
Keywords: Coronatine HPLC Pseudomonas syringae Plant pathogen Virulence factor
Background
Coronatine (COR), a potent bacterial phytotoxin, is a molecular mimic of the plant hormone jasmonoyl-L isoleucine (JA-Ile). As such, COR activates jasmonic acid (JA) signaling, induces JA-responsive genes, and antagonizes the action of the immune signal salicylic acid. COR consists of two components, coronafacic acid (CFA) and coronamic acid (CMA). The genes that encode for CMA and CFA biosynthesis are not constitutively expressed in the bacterium. Instead, these genes are induced on the plant leaf surface, in planta or in vitro when the bacterium is grown in inducing medium (Palmer and Bender, 1993; Panchal et al. 2016). This article describes a method adapted from Panchal et al. (2016) to determine the ability of bacteria to produce coronatine, which can be used as an indication of virulence.
Materials and Reagents
1.5 ml microfuge tubes (VWR, catalog number: 20170-650 )
Centrifuge tubes, polypropylene, sterile, 50 ml (Corning, Falcon®, catalog number: 352070 )
Micropipettes (Mettler-Toledo, Rainin, catalog number: KitPR-START )
Petri dishes, 100 x 15 mm (VWR, catalog number: 25384-088 )
Plastic bags
Square cuvette, 10 mm path length (Thermo Fisher Scientific, catalog number: 331709 )
Pasteur pipette (VWR, catalog number: 14673-010 )
Pseudomonas syringae bacterial culture (can be maintained in 25% glycerol at -80 °C)
Coronatine (Sigma-Aldrich, catalog number: C8115 )
Glycerol (VWR, BDH®, catalog number: BDH1172-1LP )
Sterile distilled ultrapure water
Trifluoroacetic acid (TFA) (Sigma-Aldrich, catalog number: 302031 )
Acetonitrile (Sigma-Aldrich, catalog number: 34998 )
Rifampicin
3 N HCl (VWR, BDH®, catalog number: BDH7375-1 )
Ethyl acetate (VWR, BDH®, catalog number: BDH1123-4LG )
Sodium hydroxide (NaOH) (Fisher Scientific, catalog number: S318-1 )
BCA Protein Assay Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23225 )
Tryptone (IBI Scientific, catalog number: 41116105 )
Yeast extract (U.S. Biotech Sources, BTS, catalog number: Y01PD-500 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-500 )
Bacteriological agar (IBI Scientific, catalog number: IB49171 )
Ammonium chloride (NH4Cl) (VWR, catalog number: 470300-196 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (VWR, catalog number: 97062-134 )
Potassium phosphate (KH2PO4) (VWR, catalog number: 97062-350 )
Potassium hydrogen phosphate trihydrate (K2HPO4·3H2O) (VWR, catalog number: ALFA33365.A1 )
Potassium nitrate (KNO3) (VWR, catalog number: 97065-038 )
Iron(III) chloride (FeCl3) (VWR, catalog number: 470301-584 )
Glucose (VWR, catalog number: 101094-092 )
Low-sodium Luria Bertani medium (see Recipes)
Liquid HSC medium (see Recipes)
Equipment
HPLC system: Agilent 1200 HPLC (Agilent Technologies, model: Agilent 1200 HPLC) equipped with quaternary pump, autosampler, thermostated column compartment, and a diode array
C8 column, 4.6 x 250 mm, 5 µm (ASTEC, Whippany, NJ, USA or equivalent)
Shaker incubator (Eppendorf, model: New BrunswickTM Innova® 42R )
Spectrophotometer (Thermo Fisher Scientific, Thermo Scientific, model: Spectronic 20D+ )
Microcentrifuge (Eppendorf, model: 5418 )
Water bath (Thermo Fisher Scientific, Thermo ScientificTM, model: Precision GP 2S )
Vortex (VWR, catalog number: 945300 )
Autoclave (VWR, catalog number: 97002-402 )
Laminar flow hood (ESCO, model: AC1-4E8 )
Centrifuge (Eppendorf, model: 5810 )
Synergy water purification system (EMD Millipore, catalog number: SYNS0HFWW )
Software
Chromatography data system software (Agilent Technologies, Palo Alto, CA)
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Panchal, S., Breitbach, Z. S. and Melotto, M. (2017). An HPLC-based Method to Quantify Coronatine Production by Bacteria. Bio-protocol 7(5): e2147. DOI: 10.21769/BioProtoc.2147.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Plant Science > Plant immunity > Host-microbe interactions
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,148 | https://bio-protocol.org/exchange/protocoldetail?id=2148&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Production of Guide RNAs in vitro and in vivo for CRISPR Using Ribozymes and RNA Polymerase II Promoters
TZ Tao Zhang*
YG Yangbin Gao*
RW Rongchen Wang
YZ Yunde Zhao
*Contributed equally to this work
Published: Vol 7, Iss 4, Feb 20, 2017
DOI: 10.21769/BioProtoc.2148 Views: 16913
Edited by: Rainer Melzer
Reviewed by: Diarmuid Seosamh Ó’Maoiléidigh
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
CRISPR/Cas9-mediated genome editing relies on a guide RNA (gRNA) molecule to generate sequence-specific DNA cleavage, which is a prerequisite for gene editing. Here we establish a method that enables production of gRNAs from any promoters, in any organisms, and in vitro (Gao and Zhao, 2014). This method also makes it feasible to conduct tissue/cell specific gene editing.
Keywords: Ribozyme CRISPR RNA polymerase II promoter Genome editing RNA transcription
Background
Almost all of the reported cases of CRISPR-mediated gene editing used promoters of small nuclear RNAs such as the U6 and U3 snRNA promoters to drive the production of gRNAs in vivo (Cong et al., 2013; Mali et al., 2013). However, the U6 and U3 promoters have several major limitations: 1) They are constitutively active and not tunable; 2) They lack cell/tissue specificities; 3) They have not been well defined in many organisms; 4) U6 requires a G and U3 requires an A for transcription initiation, thus limiting target selections; 5) They are not suitable for in vitro transcriptions because of the lack of commercial RNA polymerase III. Unfortunately, RNA polymerase II promoters, which constitute the majority of the characterized promoters, cannot be directly used for gRNA production in vivo because of the following reasons: 1) The primary transcripts of RNA polymerase II promoters undergo extensive processing such as 5’-end capping, 3’-end polyadenylation, and splicing out of the introns. Some of the modifications may render the designed gRNA non-functional. 2) The mature RNA molecules are transported into cytosol; thus they are physically separated from the intended targets that are located in the nucleus. That is why production of gRNA in vivo using U6 and U3 snRNA promoters has been the dominant method (Gao and Zhao, 2014; Yoshioka et al., 2015). In this protocol, we use a ribozyme-based strategy to overcome the aforementioned limitations of RNA polymerase III promoters, enabling gRNA production from any promoters and in any organisms. We design an artificial gene named RGR (Ribozyme-gRNA-Ribozyme) that, once transcribed, generates an RNA molecule with ribozyme sequences flanking both ends of the designed gRNA (Gao and Zhao, 2014). We show that the primary transcripts of RGR undergo self-catalyzed cleavage to precisely release the desired gRNA, which can efficiently guide sequence‐specific cleavage of DNA targets in vitro and in vivo (Gao and Zhao, 2014). RGR can be transcribed from any promoters and thus allows for cell‐and tissue‐specific genome editing if appropriate promoters are chosen.
Materials and Reagents
E. coli DH5a and Agrobacterium tumefaciens strain GV3101
pRS316-RGR-GFP plasmid (Addgene, catalog number: plasmid 51056 )
pHDE-35S-Cas9-mCherry-UBQ plasmid
Primers (Table S1)
Gibson assembly reagents
You can either purchase commercial kits from (New England Biolabs, catalog number: E5510S ), or prepare your own with the following individual reagents:
5x isothermal (ISO) reaction buffer (25% PEG-8000; 500 mM Tris-HCl, pH 7.5; 50 mM MgCl2; 50 mM DTT; 1 mM each of the 4 dNTPs; and 5 mM NAD)
T5 exonuclease (Epicentre, catalog number: T5E4111K )
Phusion DNA polymerase (New England Biolabs, catalog number: M0530 L)
Taq DNA ligase (New England Biolabs, catalog number: M0208L )
Phusion High-Fidelity PCR Kit (New England Biolabs, catalog number: E0553L )
LB medium
Appropriate antibiotics
QIAGEN Plasmid Mini Kit
MfeI (New England Biolabs, catalog number: R0589S )
10x CutSmart® buffer
T7, SP6 or T3 RNA polymerase with transcription buffer
For SP6/T7 (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM1320 )
For T3 (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM1316 )
5x transcription buffer
1 M DTT (Thermo Fisher Scientific, catalog number: P2325 )
20 U/µl RNase inhibitor (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: N8080119 )
10 mM NTP mix (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18109017 )
rNTPs
Inorganic pyrophosphatase
EDTA
12% denaturing urea polyacrylamide gels
Ethidium bromide
Equipment
37 °C water bath (Temperature-controlled water bath) (Bio-Rad Laboratories, catalog number: 1660524 )
Thermal cycler (Thermo Fisher Scientific, Applied BiosystemsTM, model: Applied Biosystems® 2720, catalog number: 4359659 )
DNA electrophoresis apparatus (Bio-Rad Laboratories, model: PowerPacTM Basic Power Supply, catalog number: 1645050EDU )
Microcentrifuges (Eppendorf, model: 5424 )
UV transilluminator (Bio-Rad Laboratories, model: UViewTM Mini Transilluminator, catalog number: 1660531 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > Mutagenesis
Plant Science > Plant transformation > Agrobacterium
Molecular Biology > RNA > RNA splicing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,149 | https://bio-protocol.org/exchange/protocoldetail?id=2149&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Acetyl Bromide Soluble Lignin (ABSL) Assay for Total Lignin Quantification from Plant Biomass
William J. Barnes
Charles T. Anderson
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2149 Views: 15977
Edited by: Samik Bhattacharya
Reviewed by: Rebecca Van Acker
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Lignin is the second most abundant biopolymer on Earth, providing plants with mechanical support in secondary cell walls and defense against abiotic and biotic stresses. However, lignin also acts as a barrier to biomass saccharification for biofuel generation (Carroll and Somerville, 2009; Zhao and Dixon, 2011; Wang et al., 2013). For these reasons, studying the properties of lignin is of great interest to researchers in agriculture and bioenergy fields. This protocol describes the acetyl bromide method of total lignin extraction and quantification, which is favored among other methods for its high recovery, consistency, and insensitivity to different tissue types (Johnson et al., 1961; Chang et al., 2008; Moreira-Vilar et al., 2014; Kapp et al., 2015). In brief, acetyl bromide digestion causes the formation of acetyl derivatives on free hydroxyl groups and bromide substitution of α-carbon hydroxyl groups on the lignin backbone to cause a complete solubilization of lignin, which can be quantified using known extinction coefficients and absorbance at 280 nm (Moreira-Vilar et al., 2014).
Keywords: Lignin Biochemical measurement Plant biomass Acetyl bromide Plant cell walls
Background
The acetyl bromide method for quantification of lignin from plant biomass has been used to accurately measure total lignin content for decades (Johnson et al., 1961). Recently, this method has gained support as an optimal procedure for lignin quantification, as opposed to the alternative thioglycolic acid and Klason lignin methods (Moreira-Vilar et al., 2014). Comparison of these three methods has empirically shown that the acetyl bromide method consistently results in the highest recovery of lignin, and is insensitive to tissue type, extent of lignification, and lignin composition (Moreira-Vilar et al., 2014). In our previous work (Kapp et al., 2015), we adapted the scale of the acetyl bromide assay to facilitate a rapid, small-scale determination of lignin that uses a small amount of alcohol insoluble residue (AIR) derived from Brachypodium distachyon, based on a protocol described in the ‘Microscale Method for Cuvettes’ method detailed by Chang et al. (2008). The protocol described below can be performed with standard laboratory equipment and requires 5-9 days total after harvesting plant material, which can be derived from a variety of tissues or developmental stages.
Materials and Reagents
Personal protective equipment (PPE; these should be worn at all times when dealing with concentrated acids and alkali. see Note 1)
Safety glasses
Lab coat
Gloves
Pipette tips
Pipette set
Ice bucket
2 ml Sarstedt tubes (SARSTEDT, catalog number: 72.694.007 )
Plant material or cell wall preparation of choice
Liquid nitrogen
Acetone, ≥ 99.5% (EMD Millipore, catalog number: AX0120 )
Lugol’s Iodine staining solution (Sigma-Aldrich, catalog number: 32922 )
1.5 N sodium hydroxide (NaOH, strong base), ≥ 97% (Fisher Scientific, catalog number: BP359-500 )
0.5 M hydroxylamine hydrochloride (strong reducing agent; store in Drierite container, make fresh in water), 98% (Sigma-Aldrich, catalog number: 255580 )
Chloroform, ≥ 99.5% (Sigma-Aldrich, catalog number: C2432 )
Methanol, ≥ 99.8% (Fisher Scientific, catalog number: A412P )
Deionized water
Ethanol, 100%, 200 proof (Decon Labs, catalog number: V1001 )
Acetyl bromide (strong acid, violently reacts with water; dilute in acetic acid), 99% (Sigma-Aldrich, catalog number: 135968 )
Glacial acetic acid, ≥ 99.7% (EMD Millipore, catalog number: AX0073 )
DMSO (Dimethyl sulfoxide), ≥ 99.9% (Sigma-Aldrich, catalog number: 276855 )
Chloroform-methanol mixture (see Recipes)
70% ethanol (see Recipes)
25% acetyl bromide (see Recipes)
90% DMSO (see Recipes)
Equipment
80 °C freezer
Wiley Mini-Mill (Thomas Scientific, catalog number: 3383L10 )
Cryogenic-compatible containers
CryoMill ball mill along with all sizes of steel balls, grinding jars, safety valves, and Autofill (Retsch, catalog numbers: 20.749.0001 ; 02.480.0002 )
Microcentrifuge capable of spinning at 10,000 x g (e.g., Eppendorf, catalog number: 5424 )
Chemical hood
Platform rocker (VWR, catalog number: 12620-906 )
10 ml glass graduated cylinder (Kimble Chase Life Science and Research Products, catalog number: 20024D-10 )
NanoDrop 2000C spectrophotometer, or other UV-Vis (Thermo Fisher Scientific, Thermo ScientificTM, model: ND-2000C-PC )
Quartz cuvette, 0.7 ml volume (Sigma-Aldrich, catalog number: Z600199 )
Pipette
Water bath or incubator capable of reaching 70 °C (e.g., VWR, catalog number: 89032-216 )
Analytical balance (Mettler Toledo, Excellence Series )
Vortex mixer (VWR, catalog number: 58816-123 )
Tissue lyophilizer (4.5 Liter Freeze Dry Freeze Dryer) (Labconco, catalog number: 7750020 )
Solid cap with PTFE Liner 15 mm, for 7 ml glass screw-cap vial (Sigma-Aldrich, catalog number: 27152 )
Optional: Glass beads (Kimble Chase Life Science and Research Products, catalog number: 13500-4 )
Optional: Reacti-Therm Heating and Stirring Module (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: TS-18823 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Barnes, W. J. and Anderson, C. T. (2017). Acetyl Bromide Soluble Lignin (ABSL) Assay for Total Lignin Quantification from Plant Biomass. Bio-protocol 7(5): e2149. DOI: 10.21769/BioProtoc.2149.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant metabolism > Other compound
Biochemistry > Other compound > Lignin
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
How to get the extinction coefficient?
1 Answer
7 Views
Jul 22, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,150 | https://bio-protocol.org/exchange/protocoldetail?id=2150&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Laser Scanning Confocal Microcopy for Arabidopsis Epidermal, Mesophyll, and Vascular Parenchyma Cells
CE Christian Elowsky*
YW Yashitola Wamboldt*
SM Sally Mackenzie
*Contributed equally to this work
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2150 Views: 13267
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Investigation of protein targeting to plastids in plants by confocal laser scanning microscopy (CLSM) can be complicated by numerous sources of artifact, ranging from misinterpretations from in vivo protein over-expression, false fluorescence in cells under stress, and organellar mis-identification. Our studies have focused on the plant-specific gene MSH1, which encodes a dual targeting protein that is regulated in its expression and resides within the nucleoid of a specialized plastid type (Virdi et al., 2016). Therefore, our methods have been optimized to study protein dual targeting to mitochondria and plastids, spatial and temporal regulation of protein expression, and sub-organellar localization, producing a protocol and set of experimental standards that others may find useful for such studies.
Keywords: Confocal Plastid Chloroplast GFP Localization Autofluorescence Organellar
Background
Protein targeting behavior in plants is influenced by amino-terminal presequences as well as internal sequence features that can influence suborganellar localization behaviors (Baginsky and Gruissem, 2004). Combined with promoter-driven spatial and temporal regulation in expression, a protein’s activity can be extremely precise and specialized by virtue of timing and location. In the case of MSH1, this nuclear-encoded, plant-specific protein is dual targeted to mitochondria and plastids (Xu et al., 2011). Promoter features direct its expression to reproductive, epidermal and vascular parenchyma cells (Virdi et al., 2016). Internal protein features direct its localization to the mitochondrial and plastid nucleoid, as well as to the plastid thylakoid membrane. Discovery of these unusual protein features was greatly facilitated by laser scanning confocal microscopy using methodologies described here. Much of this detail would have been overlooked using more traditional organellar subfractionation methodologies.
Materials and Reagents
5 ml tube
Needleless syringe
Double edge razor blades (Electron Microscopy Sciences, PersonnaTM, catalog number: 72000 )
Glass cover slips, No. 1.5 (VWR, catalog number: 16004-302 )
Dissecting needle or probe pin
Petri dish (VWR, catalog number: 25384-302 )
Centrifuge tube (VWR, catalog number: 89039-668 )
0.45 μm filter (VWR, catalog number: 28145-481 )
Disposable transfer pipette (Fisher Scientific, catalog number: 13-7117M )
Glass slides (VWR, catalog number: 48300-048 )
Arabidopsis leaf/flower/stem tissue (Ecotype Col-0, 6 weeks old plants)
Lurie broth
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
Incubation solution
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P3786 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Ammonium sulfate, (NH4)2SO4 (Sigma-Aldrich, catalog number: A4418 )
Sodium citrate dihydrate (Sigma-Aldrich, catalog number: C8532 )
Magnesium sulfate (MgSO4) (1 M stock solution) (Sigma-Aldrich, catalog number: M2643 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
MES (Sigma-Aldrich, catalog number: M2933 )
KOH or NaOH
Acetosyringone (3’,5’-dimethoxy-4’-hydroxyacetophenone) (Sigma-Aldrich, catalog number: D134406 )
MS medium basal salts (Sigma-Aldrich, catalog number: M5519 )
Cellulase ‘onozuka’ R-10 (Yakult Honsha, Tokyo, Japan)
Macerozyme R-10 (Yakult Honsha, Tokyo, Japan)
Mannitol (Sigma-Aldrich, catalog number: M1902 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C7902 )
BSA (optional) (Sigma-Aldrich, catalog number: A7906 )
Induction medium (see Recipes)
Infiltration medium (see Recipes)
Cellulase/macerozyme solution (see Recipes)
Washing and incubation solution (WI) (see Recipes)
Equipment
387/478/555 nm triple-bandpass filter excitation with a broad emission filter ~400-700 nm
LED illumination, 488 nm, 543 nm (Lumencor AURA light engine)
Incubator shaker
Platform shaker
Forceps (VWR, catalog number: 82027-440 ) or (Cole-Parmer Instrument, catalog number: EW-07287-09 )
90i upright compound microscope (Nikon Instruments)
10x Plan Apo 0.45NA (Nikon Instruments, model: OFN25 )
20x Plan Apo 0.75NA (Nikon Instruments, model: lambda )
60x Plan Apo VC water immersion lens 1.2NA (Nikon Instruments, model: MRD07602 )
Confocal laser scanning microscope (CLSM) (Nikon Instruments, model: A1+ )
Autoclave
Water bath
Vacuum desiccator
Software
NIS-Elements software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Elowsky, C., Wamboldt, Y. and Mackenzie, S. (2017). Laser Scanning Confocal Microcopy for Arabidopsis Epidermal, Mesophyll, and Vascular Parenchyma Cells. Bio-protocol 7(5): e2150. DOI: 10.21769/BioProtoc.2150.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,151 | https://bio-protocol.org/exchange/protocoldetail?id=2151&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extracellular Axon Stimulation
Carola Städele
Margaret Louise DeMaegd
Wolfgang Stein
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2151 Views: 11383
Edited by: Soyun Kim
Reviewed by: Antoine de MorreeZinan Zhou
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
This is a detailed protocol explaining how to perform extracellular axon stimulations as described in Städele and Stein, 2016. The ability to stimulate and record action potentials is essential to electrophysiological examinations of neuronal function. Extracellular stimulation of axons traveling in fiber bundles (nerves) is a classical technique in brain research and a fundamental tool in neurophysiology (Abbas and Miller, 2004; Barry, 2015; Basser and Roth, 2000; Cogan, 2008). It allows for activating action potentials in individual or multiple axons, controlling their firing frequency, provides information about the speed of neuronal communication, and neuron health and function.
Keywords: Action potentials Electrophysiology Neuron Threshold Artifact Anode Cathode
Background
Extracellular axon stimulation elicits action potentials (APs) without the need of introducing electrodes into neurons. This protocol describes cathodal stimulation, which uses the fact that the membrane potential of a neuron at rest is negative while the extracellular surrounding is positive in comparison. Two electrodes are needed: (1) a stimulation electrode (cathode) placed in close proximity to the axon, and (2) a reference electrode (anode) placed in the bath. When activated, the stimulation electrode adds electrons and thus negative charge to the outside of the axon. This makes the outside of the axon less positive and, as a consequence, decreases the potential difference between inside and outside of the neuron. The result is a local depolarization inside the axon. If sufficient in magnitude, this elicits an AP. The elicited AP originates close to the stimulation electrode and propagates bi-directionally along the axon.
The threshold current needed to elicit APs depends on several parameters, including (1) axon diameter (thicker axons are depolarized first), (2) the distance between stimulation electrode and axon, and (3) stimulation amplitude and duration. The duration must be limited to less than the duration of an AP to prevent the neuronal membrane from becoming refractory. Thus, short current pulses at threshold amplitude are typically used to elicit individual APs. Since thicker axons are recruited at lower stimulus amplitudes, extracellular stimulation works best if the axon of interest is the one with the largest diameter in the nerve. If smaller axons are targeted, larger stimulus amplitudes are required, which may activate larger axons first, in addition to the smaller axons of interest.
Materials and Reagents
Note: The materials and equipment listed refer to the equipment used in Städele and Stein (2016). The principles of retrograde extracellular axon stimulations are universal and the procedures can be easily adapted to other preparations. To reduce costs, comparable materials, equipment and software may be used that serve the same functions. For the general public or a teaching classroom, we suggest utilizing equipment from Backyard Brains (https://backyardbrains.com).
Syringe, filled with petroleum jelly for preparing extracellular recording and stimulation wells
For preparing syringes, the following materials will be needed:
Petroleum jelly (100% pure, pharmacy)
100 ml glass beaker (for melting petroleum jelly)
5 ml Luer lock syringe (e.g., BD, catalog number: 309603 )
Injection needle (20 G x 1.5”, e.g., Santa Cruz Biotechnology, catalog number: sc-359535 )
Sand paper (80 to 100 grit, hardware store)
Recording/stimulation electrodes
For preparing electrodes, the following materials will be needed:
Stainless steel wire, uncoated (A-M Systems, catalog number: 794800 )
Low-cost alternative: Minutien pins (see below) or sewing pins
Electrical wire, red and black PVC insulated (Southwire, model: 22 gauge stranded, catalog number: 57572444 , hardware store)
Wire stripper (hardware store)
Needle-nose pliers (hardware store)
Heat shrink tubing (hardware store)
Tin solder, 3/32 in. (Forney, catalog number: 38109 )
Petri dish lined with silicon elastomer (e.g., Sylgard 184, Sigma-Aldrich, catalog number: 761036 ; or Elastosil RT 601, Wacker Chemie, catalog number: 60063613 )
Minutien pins (Fine Science Tools, catalog number: 26002-10 )
Modeling clay (craft store)
Dissected nervous system
Note: We are using adult Jonah crabs (Cancer borealis), purchased from The Fresh Lobster Company (Gloucester, MA).
Physiological saline (see Recipes)
The recipe for C. borealis saline can be found in Table 1
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9625 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M9272 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C7902 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Trizma base (Sigma-Aldrich, catalog number: T1503 )
Maleic acid (Sigma-Aldrich, catalog number: M0375 )
Equipment
Heating plate (Thermo Fisher Scientific, Thermo ScientificTM, model: NuovaTM Stirring HotPlates, catalog number: SP18425Q )
Stereomicroscope (e.g., Leica Microsystems, model: MS5 )
Stimulator (A.M.P.I, model: Master8 Pulse Stimulator )
Low cost alternative: Pulse Pal V2 (Sanworks, catalog number: 1102 )
Amplifier (A-M Systems, model: Differential AC Amplifier 1700 , catalog number: 690000)
Low cost alternative: Spikerbox (Backyard Brains, model: Neuron SpikerBox )
Data acquisition board (CED, model: Power 1401-3A )
Low-cost alternative: by using the BYB Spike Recorder, data can be digitized by using the microphone jack and soundcard on a computer/laptop. A second low-cost alternative is Spikehound (http://spikehound.sourceforge.net), which also allows recording through the computer soundcard
Soldering station (Apex Tool, Weller, model: Station 50/60W 120 V WES51 , catalog number: WES51)
Voltmeter (FLIR Systems, Extech, model: EX330 , catalog number: 203489911)
Forceps (e.g., Fine Science Tools, model: Dumont #5, catalog number: 11251-10 )
Software
Recording software (Spike2 version 7.12, Cambridge Electronic Design Limited)
Low cost alternative: BYB Spike Recorder (freeware, available on https://backyardbrains.com/products/spikerecorder) or Spikehound (http://spikehound.sourceforge.net)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Städele, C., DeMaegd, M. L. and Stein, W. (2017). Extracellular Axon Stimulation. Bio-protocol 7(5): e2151. DOI: 10.21769/BioProtoc.2151.
Städele, C. and Stein, W. (2016). The site of spontaneous ectopic spike initiation facilitates signal integration in a sensory neuron. J Neurosci 36(25): 6718-6731.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,152 | https://bio-protocol.org/exchange/protocoldetail?id=2152&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Axonal Conduction Velocity Measurement
Margaret Louise DeMaegd
Carola Städele
Wolfgang Stein
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2152 Views: 10981
Edited by: Soyun Kim
Reviewed by: Manqi WangKae-Jiun Chang
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Action potential conduction velocity is the speed at which an action potential (AP) propagates along an axon. Measuring AP conduction velocity is instrumental in determining neuron health, function, and computational capability, as well as in determining short-term dynamics of neuronal communication and AP initiation (Ballo and Bucher, 2009; Bullock, 1951; Meeks and Mennerick, 2007; Rosenthal and Bezanilla, 2000; Städele and Stein, 2016; Swadlow and Waxman, 1976). Conduction velocity can be measured using extracellular recordings along the nerve through which the axon projects. Depending on the number of axons in the nerve, AP velocities of individual or many axons can be detected.
This protocol outlines how to measure AP conduction velocity of (A) stimulated APs and (B) spontaneously generated APs by using two spatially distant extracellular electrodes. Although an invertebrate nervous system is used here, the principles of this technique are universal and can be easily adjusted to other nervous system preparations (including vertebrates).
Keywords: Nervous system Action potential Propagation Extracellular stimulation Ectopic Nerve Spike timing Axon
Background
Long-distance communication in the nervous system is mediated by APs that travel along axons. The ionic currents that flow across the axon membrane when an AP is generated (Hodgkin and Huxley, 1952) can be detected even outside of the neuron, using extracellular recording electrodes. AP conduction velocities in different neurons are quite variable and range from 200 meters per second (447 miles per hour) to less than 0.1 meters per second (0.2 miles per hour) (Kress et al., 2008; Kusano, 1966). In order to understand why there are differences in conduction velocity, the passive (membrane) properties of the axon need to be taken into account. Some axons propagate information more rapidly than others because of differences in properties that affect the time constant (e.g., resistance and capacitance) and the length constant (e.g., axon diameter, membrane permeability, and degree of myelination). Especially in unmyelinated axons, conduction velocity largely depends on the axon diameter, which in turn is also correlated with the amplitude of the extracellular AP (Stein and Pearson, 1971). Consequently, determining AP conduction velocity provides more than just information about signal movement and timing. It can also be used to characterize changes in intrinsic axon properties.
Materials and Reagents
Note: The materials and equipment listed refer to the equipment used in Städele and Stein (2016). To reduce costs, comparable materials, equipment and software may be used that serve the same functions. For the general public or a teaching classroom we suggest utilizing equipment from Backyard Brains (http://backyardbrains.com).
Petri dish (100 x 15 mm, Fisher Scientific, catalog number: FB0875713 ) lined with silicon elastomer (e.g., Sylgard 184, Sigma-Aldrich, catalog number: 761036 ; or Elastosil RT 601, Wacker Chemie, catalog number: 60063613 )
Minutien pins (Fine Science Tools, catalog number: 26002-10 )
Modeling clay (craft store)
Syringe, filled with petroleum jelly (100% pure, pharmacy)
Recording/stimulation electrodes
Note: For details how to prepare the petroleum jelly filled syringe or recording/stimulating electrodes, see our companion protocol ‘Extracellular axon stimulation’ by Städele, C., DeMaegd, M. and Stein, W.
Dissected nervous system
Note: We are using adult Jonah crabs (Cancer borealis), purchased from The Fresh Lobster Company (Gloucester, MA).
Physiological saline (see Recipes)
The recipe for C. borealis saline can be found in Table 1
Sodium chloride, NaCl (Sigma-Aldrich, catalog number: S9625 )
Magnesium chloride hexahydrate, MgCl2·6H2O (Sigma-Aldrich, catalog number: M9272 )
Calcium chloride dihydrate, CaCl2·2H2O (Sigma-Aldrich, catalog number: C7902 )
Potassium chloride, KCl (Sigma-Aldrich, catalog number: P9541 )
Trizma base (Sigma-Aldrich, catalog number: T1503 )
Maleic acid (Sigma-Aldrich, catalog number: M0375 )
Equipment
Ruler or micrometer scale
Stereomicroscope (e.g., Leica Microsystems, model: MS5 )
Stimulator (A.M.P.I, model: Master 8 Pulse Stimulator )
Low-cost alternative: Pulse Pal V2 (Sanworks, catalog number: 1102 )
Amplifier (A-M Systems, model: Differential AC Amplifier 1700 , catalog number: 690000)
Low-cost alternative: Spikerbox (Backyard Brains, model: Neuron SpikerBox )
Data acquisition board (Cambridge Electronic Design Limited, model: Power 1401-3A )
Low-cost alternative: by using the BYB Spike Recorder, data can be digitized by using the microphone jack and soundcard on a computer/laptop. A second low-cost alternative is Spikehound (http://spikehound.sourceforge.net), which also allows recording through the computer soundcard.
Camera (e.g., AmScope, model: 3MP USB2.0 Microscope Digital Camera, catalog number MU300 )
Software
ImageJ (National Insitute of Health) or a comparable software
Recording software (Spike2 version 7.12, Cambridge Electronic Design Limited)
Low-cost alternative: BYB Spike Recorder (freeware, available on https://backyardbrains.com/products/spikerecorder) or Spike hound (http://spikehound.sourceforge.net)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
DeMaegd, M. L., Städele, C. and Stein, W. (2017). Axonal Conduction Velocity Measurement. Bio-protocol 7(5): e2152. DOI: 10.21769/BioProtoc.2152.
Städele, C. and Stein, W. (2016). The site of spontaneous ectopic spike initiation facilitates signal integration in a sensory neuron. J Neurosci 36(25): 6718-6731.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Brain nerve
Cell Biology > Cell signaling > Intracellular Signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,153 | https://bio-protocol.org/exchange/protocoldetail?id=2153&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Olfactory Avoidance Test (Mouse)
HT Hiroo Takahashi
AT Akio Tsuboi
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2153 Views: 8469
Edited by: Soyun Kim
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
In mice, olfaction plays a pivotal role for the various behaviors, such as feeding, mating, nursing and avoidance. Behavioral tests that analyze abilities of odor detection and recognition using genetically modified mice reveal the contribution of target genes to the olfactory processing. Here, we describe the olfactory avoidance test to investigate the odor detection ability in mice.
Keywords: Olfaction Odor detection threshold Behavioral test Mouse Freezing Avoidance
Background
Olfactory system is a good model for studying the sensory processing in the brain. To characterize innate fear responses such as freezing and avoidance in genetically modified mice, the olfactory avoidance test was performed using a component of fox feces, TMT (2,5-dihydro-2,4,5-trimethylthiazoline; Kobayakawa et al., 2007). Furthermore, the olfactory avoidance using the different amounts of TMT was carried out to know the odor detection threshold in gene-knockout mice (Kaneko-Goto et al., 2013). Recently, we have reported that non-dihydrogenated TMT (nTMT: 2,4,5-trimethylthiazole) also induces similar freezing and avoidance responses (Takahashi et al., 2016). Here, we describe a method for the olfactory avoidance test with nTMT (commercially available) to explore the odor detection threshold in mice. This method has an advantage in the point using a simple device such as cage and filter paper, compare with that using an olfactometer.
Materials and Reagents
Latex gloves (NIPPON Genetics, catalog number: SLPF-M )
Filter paper (3 MM CHR) (GE Healthcare, catalog number: 3030-909 )
Paper towels (KCWW, Kimberly-Clark, catalog number: 47000 )
Laboratory-bred mice
Note: For the test, male mice should be used to avoid the effect of the estrous cycle. Mice are housed in groups 3-5 per cage, kept in a room with controlled temperature (~23 °C) and humidity under 12 h light/dark cycle (lights on at 8:30 AM) with ad libitum access to food and water.
2,4,5-trimethylthiazole (nTMT) (7.9 M) (Tokyo Chemical Industry, catalog number: T1068 )
Note: A component of fox feces, TMT (2,5-dihydro-2,4,5-trimethylthiazoline), is known to evoke innate fear responses in rodents (Kobayakawa et al., 2007; Kaneko-Goto et al., 2013). Non-dihydrogenated TMT (nTMT) also induces similar freezing and avoidance responses (Takahashi et al., 2016).
70% ethanol
Equipment
Test cage (31 x 21 x 12.5 cm) (one cage per one mouse)
Habituation cage with the same size as the test cage (four cages per one mouse)
Clear acrylic board (which can cover the roof of the test cage)
Video camera (Sony, catalog number: HDR-CX560V )
Note: The mouse behavior is recorded under the weak-light condition. This model (Sony Nightshot Camcorder) is equipped with infrared-mode.
Tripod for camera (SLIK, catalog number: F 740 )
Red light
Fume hood
Software
Microsoft Excel (Microsoft)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Takahashi, H. and Tsuboi, A. (2017). Olfactory Avoidance Test (Mouse). Bio-protocol 7(5): e2153. DOI: 10.21769/BioProtoc.2153.
Takahashi, H., Ogawa, Y., Yoshihara, S., Asahina, R., Kinoshita, M., Kitano, T., Kitsuki, M., Tatsumi, K., Okuda, M., Tatsumi, K., Wanaka, A., Hirai, H., Stern, P. L. and Tsuboi, A. (2016). A subtype of olfactory bulb interneurons is required for odor detection and discrimination behaviors. J Neurosci 36(31): 8210-8227.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,154 | https://bio-protocol.org/exchange/protocoldetail?id=2154&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Olfactory Habituation-dishabituation Test (Mouse)
HT Hiroo Takahashi
AT Akio Tsuboi
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2154 Views: 9519
Edited by: Soyun Kim
Reviewed by: Ehsan KheradpezhouhEdgar Soria-Gomez
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Olfaction plays a fundamental role in the various behaviors such as feeding, mating, nursing, and avoidance in mice. Behavioral tests that characterize abilities of odor detection and recognition using genetically modified mice reveal the contribution of target genes to the olfactory processing. Here, we describe the olfactory habituation-dishabituation test for investigating the odor detection threshold in mice.
Keywords: Olfaction Odor detection threshold Behavioral test Mouse Olfactometer
Background
Olfactory system is a good model for studying the sensory processing in the brain. To characterize abilities of odor detection in genetically modified mice, the olfactory habituation-dishabituation test was performed using either filter paper or cotton scented with a test odor (Kobayakawa et al., 2007; Ferquson et al., 2000). There is a natural tendency of mice preferentially exploring novelty such as a novel odor and a novel object (Bevins and Besheer, 2006). Therefore, there is no training in advance before starting these tests. However, it is difficult to constantly supply the test odor especially at lower concentrations (around the detection threshold), because the odor is diluted by diffusion during the test. Here, we describe a method for the olfactory habituation-dishabituation test using an olfactometer. This method has an advantage in the point that mice are exposed to the odor at a constant concentration during the test, compared with that using the filter paper (Takahashi et al., 2016).
Materials and Reagents
Latex gloves (NIPPON Genetics, catalog number: SLPF-M )
Paper towels (KCWW, Kimberly-Clark, catalog number: 47000 )
Filter tips
10 μl (FUKAEKASEI and WATSON, catalog number: 1252-207CS )
200 μl (FUKAEKASEI and WATSON, catalog number: 1252-703CS )
1,000 μl (FUKAEKASEI and WATSON, catalog number: 124-1000S )
Laboratory-bred mice
Note: Mice are housed in groups 3-5 per cage, kept in a room with controlled temperature (~23 °C) and humidity under 12 h light/dark cycle (lights on at 8:30 AM) with ad libitum access to food and water.
Eugenol (6.3 M) (Nacalai Tesque, catalog number: 15806-42 )
70% ethanol
Equipment
Olfactometer with two channels (Matsumi Kagaku Keisoku)
Gas cylinder (normal air)
Test cage (25 x 37 x 24 cm, polypropylene)
Clear acrylic board (which can cover the roof of the test cage)
Video camera (Sony, catalog number: HDR-CX560V )
Note: The mouse behavior is recorded under the weak-light condition. This model (Sony Nightshot Camcorder) is equipped with infrared-mode.
Tripod for camera
Note: The gas cylinder containing clean air is connected to the olfactometer. The olfactometer regulates the gas flow (0.5 L/min), and switches flow between clean air and air with an odor by passing the air through a bottle containing eugenol. The olfactometer, connected to the test cage (25 x 37 x 24 cm), can supply either the clean air or the odor through the gas port (0.5-mm diameter hole) on the wall (2-cm height). The roof of test cage is covered with clear acrylic board (Figure 1).
Figure 1. Apparatus of the olfactory habituation-dishabituation test
Software
Microsoft Excel (Microsoft)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Takahashi, H. and Tsuboi, A. (2017). Olfactory Habituation-dishabituation Test (Mouse). Bio-protocol 7(5): e2154. DOI: 10.21769/BioProtoc.2154.
Takahashi, H., Ogawa, Y., Yoshihara, S., Asahina, R., Kinoshita, M., Kitano, T., Kitsuki, M., Tatsumi, K., Okuda, M., Tatsumi, K., Wanaka, A., Hirai, H., Stern, P. L. and Tsuboi, A. (2016). A subtype of olfactory bulb interneurons is required for odor detection and discrimination behaviors. J Neurosci 36(31): 8210–8227.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,155 | https://bio-protocol.org/exchange/protocoldetail?id=2155&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ca2+ Measurements in Mammalian Cells with Aequorin-based Probes
AT Anna Tosatto
RR Rosario Rizzuto
CM Cristina Mammucari
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2155 Views: 7406
Edited by: Nicoletta Cordani
Reviewed by: Pia GiovannelliHsin-Yi Chang
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Aequorin is a Ca2+ sensitive photoprotein suitable to measure intracellular Ca2+ transients in mammalian cells. Thanks to recombinant cDNAs expression, aequorin can be specifically targeted to various subcellular compartments, thus allowing an accurate measurement of Ca2+ uptake and release of different intracellular organelles. Here, we describe how to use this probe to measure cytosolic Ca2+ levels and mitochondrial Ca2+ uptake in mammalian cells.
Keywords: Ca2+ Aequorin Probes Luminescence
Background
Aequorin is a 21 kDa photoprotein isolated from jellyfish Aequorea victoria that emits blue light in the presence of Ca2+. In its active form the photoprotein includes an apoprotein and a covalently bound prosthetic group, called coelenterazine. The apoprotein contains four helix-loop-helix ‘EF-hand’ domains, three of which are Ca2+-binding sites. These domains confer to the protein a particular globular structure forming the hydrophobic core cavity that accommodates the coelenterazine. When Ca2+ ions bind to the three high affinity EF-hand sites, coelenterazine is irreversibly oxidized to coelenteramide, with a concomitant release of CO2 and emission of light (Head et al., 2000).
Aequorin began to be widely used when the cDNA encoding the photoprotein was cloned, thus opening the way to recombinant expression. In particular, recombinant aequorin can be expressed not only in the cytoplasm, but also in single intracellular compartments by including specific targeting sequences in the engineered cDNAs (Hartl et al., 1989). To expand the range of Ca2+ sensitivity that can be monitored, point mutations in the EF-hand motives that lower the affinity for Ca2+ have been introduced (Granatiero et al., 2014a and 2014b). Reconstitution of an active recombinant aequorin in living cells is obtained by simple addition of coelenterazine into the medium. Coelenterazine is highly hydrophobic and permeates cell membranes of various cell types. Different coelenterazine analogues have been synthetized and are now commercially available.
Materials and Reagents
Round glass coverslips 12 mm (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 1014355112NR15 ) - sterile upon autoclave cycle
24-well plate (Corning, Costar®, catalog number: 3524 )
MDA-MB-231 cell line
MDA-MB-468 cell line
BT-549 cell line
Aequorin-expressing plasmids (Brini, 2008)
Gelatin
Collagen
Coelenterazine 0.5 mM stock solution, in methanol (IS Chemical Technology, catalog number: I14-2266 ) - aliquot in 50 μl aliquots. Store at -80 °C. Save it from light
Agonist (e.g., ATP, Histamine, Bradykinin, Caffeine, Carbachol, Glutamate)
Note: In this protocol example 100 µM ATP is used.
Milli-Q water
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P5405 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670 )
Potassium dihydrogen phosphate (KH2PO4) (Sigma-Aldrich, catalog number: NIST200B )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: M2773 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 71687 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: 449709 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
Digitonin (Sigma-Aldrich, catalog number: D5628 or D141 )
Krebs-Ringer modified buffer (KRB) (see Recipes)
Digitonin lysis solution (see Recipes)
Equipment
Windows-based computer
Perfusion chamber (Elettrofor)
Low noise photomultiplier (Hamamatsu Photonics K. K., model: H7360-01)
Peristaltic pump (Gilson’s MINIPULS® 3)
Water bath (temperature-controlled)
Photon-counting unit (Hamamatsu Photonics K. K., model: C8855-01 )
Note: Equipment is assembled as depicted in Figure 1.
Figure 1. Equipment. A. Fully equipped aequorinometer is composed of: (1) computer, (2) perfusion chamber, (3) photomultiplier, (4) peristaltic pump, (5) water bath, (6) photon-counting unit. B. During the experiment, the perfusion chamber is placed in close proximity to the photomultiplier, protected from light.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tosatto, A., Rizzuto, R. and Mammucari, C. (2017). Ca2+ Measurements in Mammalian Cells with Aequorin-based Probes. Bio-protocol 7(5): e2155. DOI: 10.21769/BioProtoc.2155.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Cancer therapy
Cell Biology > Organelle isolation > Mitochondria
Molecular Biology > RNA > Transfection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,156 | https://bio-protocol.org/exchange/protocoldetail?id=2156&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Synthesis Rate Assessment by Fluorescence Recovery after Photobleaching (FRAP)
NK Nikos Kourtis
Nektarios Tavernarakis
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2156 Views: 11872
Edited by: Jyotiska Chaudhuri
Reviewed by: Varpu Marjomaki
Original Research Article:
The authors used this protocol in Sep 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2012
Abstract
Currently available biochemical methods cannot be applied to monitor protein synthesis in specific cells or tissues, in live specimens. Here, we describe a non-invasive method for monitoring protein synthesis in single cells or tissues with intrinsically different translation rates, in live Caenorhabditis elegans animals.
Keywords: Caenorhabditis elegans FRAP Messenger RNA Protein synthesis Protein translation
Background
Proper regulation of protein synthesis is critical for cell homeostasis and growth. Deregulation of protein synthesis has been implicated in pathologies such as cancer and senescent decline (Bjornsti and Houghton, 2004; Syntichaki et al., 2007). Currently available biochemical methods for measuring general protein synthesis rate include metabolic labeling and polysomal profiling (Martin, 1998; Rennie et al., 1994). The applicability of these methodologies is limited due to poor intake and uncontrolled or unequal distribution of the label throughout the animal or tissue of interest. Also, these methods lack specificity and significant changes in specific cells or tissues of interest may be masked due to variability in intrinsic rates of translation of the bulk of the sample. In this protocol, we describe a method for monitoring protein synthesis rates in the nematode Caenorhabditis elegans, based on fluorescence recovery after photobleaching (FRAP). The experimental approach is based on the expression of fluorescent proteins, in cells and tissues of interest of transgenic animals. Fluorescence is then photobleached by irradiating cells, tissues or whole animals with a powerful light source. Recovery of fluorescence, indicative of new protein synthesis, is then monitored in cells or tissues of interest.
Materials and Reagents
Greiner Petri dishes (60 x 15 mm) (Greiner Bio One, catalog number: 628161 )
35 mm plates (Corning, catalog number: 430165 )
Microscope slides 75 x 25 x 1 mm (Marienfeld-Superior, catalog number: 10 006 12 )
Microscope cover glass 18 x 18 mm (Marienfeld-Superior, catalog number: 01 010 30 )
C. elegans strains (wild type [N2], ife-2[ok306], N2; Ex[pife-2GFP, pRF4], ife-2[ok306]; Ex[pife-2GFP, pRF4])
Escherichia coli OP50 strain (obtained from the Caenorhabditis Genetics Center)
Cycloheximide (Sigma-Aldrich, catalog number: C7698 )
Note: Cycloheximide has significant, toxic side effects.
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: 7778-77-0 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: 7758-11-4 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: 106404 )
Peptone (BD, Bacto, catalog number: 211677 )
Streptomycin (Sigma-Aldrich, catalog number: S6501 )
Agar (Sigma-Aldrich, catalog number: 05040 )
Cholesterol stock solution (SERVA Electrophoresis, catalog number: 17101.01 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Nystatin stock solution (Sigma-Aldrich, catalog number: N3503 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: 7558-79-4 )
Phosphate buffer (1 M; sterile, see Recipes)
Nematode growth medium (NGM) agar plates (see Recipes)
M9 buffer (see Recipes)
Equipment
Dissecting stereomicroscope (Nikon, model: SMZ645 )
UV crosslinker (VilberLourmat, model: BIO-LINK – BLX-E365 )
Epifluorescence microscope (ZEISS, model: Axioskop 2 Plus )
Standard equipment for preparing agar plates (autoclave, Petri dishes, etc.) (Sambrook and Russell, 2001)
Standard equipment for maintaining worms (platinum wire pick, incubators, etc.)
Note: For basic C. elegans culture, maintenance and manipulation techniques see refs (Epstein and Shakes, 1995; Lewis and Fleming, 1995; Hope, 1999; Strange, 2006). For information on C. elegans biology see refs (Wood, 1988; Epstein and Shakes, 1995; Riddle, 1997) and WormBook (http://www.wormbook.org/).
Software
Camera control and imaging software (Carl Zeiss, Axio Vision 3.1 software)
ImageJ image processing software (Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, http://rsb.info.nih.gov/ij/) (Abràmoff et al., 2004)
Microsoft Office 2011 Excel software package (Microsoft Corporation, Redmond, USA)
Prism software package (GraphPad Software Inc., San Diego, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kourtis, N. and Tavernarakis, N. (2017). Protein Synthesis Rate Assessment by Fluorescence Recovery after Photobleaching (FRAP). Bio-protocol 7(5): e2156. DOI: 10.21769/BioProtoc.2156.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling
Biochemistry > Protein > Synthesis
Biochemistry > Protein > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,157 | https://bio-protocol.org/exchange/protocoldetail?id=2157&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Polyethylene Glycol-mediated Transformation of Drechmeria coniospora
LH Le D. He
JE Jonathan J. Ewbank
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2157 Views: 8547
Edited by: Arsalan Daudi
Reviewed by: Michael TschernerAksiniya Asenova
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Drechmeria coniospora is a nematophagous fungus and potential biocontrol agent. It belongs to the Ascomycota. It is related to Hirsutella minnesotensis, another nematophagous fungus but, phylogenetically, it is currently closest to the truffle parasite Tolypocladium ophioglossoides. Together with its natural host, Caenorhabditis elegans, it is used to study host-pathogen interactions. Here, we report a polyethylene glycol-mediated transformation method (Turgeon et al., 2010; Ochman et al., 1988) for this fungus. The protocol can be used to generate both knock-in or knock-out strains (Lebrigand et al., 2016).
Keywords: Fungus Genetic engineering Nematophagous Pathogen Caenorhabditis elegans
Background
D. coniospora has been developed as a model pathogen for the study of innate immunity in C. elegans (Lebrigand et al., 2016 and references therein). D. coniospora grows slowly on standard growth media, rendering in vitro study difficult and making it hard to develop transformation methods. We report here a culture method that allows the rapid production of large quantities of D. coniospora, opening the way to its genetic modification. Polyethylene glycol-mediated transformation is probably the simplest method that has been broadly applied to modify fungi. We found that it can be used with D. coniospora, thus providing the first approach to modify its genome deliberately.
Materials and Reagents
Pasteur pipettes (VWR, catalog number: 6121701 )
Eppendorf tube 1.5 ml (Sigma-Aldrich, catalog: T9661 )
Petri dish (Greiner Bio one, catalog number: 633185 )
50 ml conical tube (Corning, Falcon®, catalog number: 352070 )
15 ml conical tube (Corning, Falcon®, catalog number: 352196 )
14 ml polystyrene round bottom tube (Corning, Falcon®, catalog number: 352051 )
Miracloth (EMD Millipore, catalog number: 475855 )
Syringe 25 ml (Terumo, catalog number: SS-20ES )
Acrodisc® syringe filters (Pall, catalog number: 4187 )
Aluminum foil (Fisher Scientific, catalog number: 01213102 )
Escherichia coli strain OP50
Caenorhabditis elegans strain N2
Drechmeria coniospora recipient strain ATCC 96282
pLH4237 plasmid DNA, contains a hygromycin B phosphotransferase::GFP chimeric gene driven by D. coniospora β-tubulin promoter (β-tubp::HPH::GFP, Lebrigand et al., 2016)
Ampicillin sodium salt (Sigma-Aldrich, catalog number: A9518 )
Gentamicin solution (Sigma-Aldrich, catalog number: G1272 )
Hygromycin B (Thermo Fisher scientific, GibcoTM, catalog number: 10687010 )
di-Potassium hydrogen orthophosphate, K2HPO4 (VWR, catalog number: 26931.263 )
Potassium dihydrogen phosphate, KH2PO4 (VWR, catalog number: 0781-1KG )
Bacto agar (BD, Bacto, catalog number: 214010 )
Bacto peptone (BD, Bacto, catalog number: 211677 )
Sodium chloride, NaCl (VWR, catalog number: 27810.295 )
Cholesterol (Sigma-Aldrich, catalog number: C3045 )
Ethanol (VWR, catalog number: 20821.321 )
Magnesium sulfate, MgSO4 (Sigma-Aldrich, catalog number: M7506 )
Calcium chloride, CaCl2 (Sigma-Aldrich, catalog number: C1016 )
Yeast extract (Douchefa Biochemie, catalog number: Y1333 )
D-sorbitol (Sigma-Aldrich, catalog number: S3889 )
Aurintricarboxylic acid, ATA (EMD Millipore, catalog number: 189400 )
Tris/HCl (Sigma-Aldrich, catalog number: T6666 )
Polyethylene glycol (PEG 3350) (Sigma-Aldrich, catalog number: P4338 )
Caylase C4 (CAYLA, catalog number: caseC4-5 ) Alternative can be lysing enzymes (Sigma-Aldrich, catalog number: L1412)
Note: The hyperlink for caseC4-5 is not available anymore. Alternative could be lysing enzyme, and we are still testing its efficiency in our lab.
Phosphate buffer (see Recipes)
Medium (see Recipes)
NGM-AG
NGMY
NGMY liquid
NGMS
15 mM ATA solution (see Recipes)
50 mM NaCl solution (see Recipes)
CaCl2 1700 (see Recipes)
Lysis buffer (see Recipes)
STC 1700 (see Recipes)
PEG 1700 (see Recipes)
Equipment
Stereomicroscope (Leica Microsystems, model: MZ16 F )
HERAsafe KS safety cabinet (Thermo Fisher Scientific, Thermo ScientificTM, model: HerasafeTM KS Class II , catalog number: 51022751)
Centrifuge (Eppendorf, catalog number: 5810 R )
Funnel
Spatula
Cloth-plugged 250 ml glass Erlenmeyer flask
Rotary shaker for culture flasks (Eppendorf, model: New Brunswick Scientific Innova 4080 )
Counting chambers (Burker, Tiefe 0.1000 m, 0.0025 mm2)
Balancer
Pipetman P1000
autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：He, L. D. and Ewbank, J. J. (2017). Polyethylene Glycol-mediated Transformation of Drechmeria coniospora. Bio-protocol 7(5): e2157. DOI: 10.21769/BioProtoc.2157.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Transformation
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,158 | https://bio-protocol.org/exchange/protocoldetail?id=2158&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Thinned-skulled Cranial Window Preparation (Mice)
LZ Lifeng Zhang
BL Bo Liang
YL Yun Li
DL Da-Ting Lin
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2158 Views: 7121
Edited by: Soyun Kim
Reviewed by: Marina AllerbornXi Feng
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Imaging structural plasticity or activity of neurons in the brain circuit will facilitate understanding the neural mechanisms underlying animal behavior. Here we describe a modified procedure, the polished and reinforced thinned-skull cranial window preparation, by which we can image dendrites and spines in mouse layer I cortex for weeks (Zhang et al., 2016). By this method, we also imaged the glioma initiation in the mouse cortex for two weeks in previous work (Zhang et al., 2012), which included the photographs and video for reference.
Keywords: Neuroscience Mouse brain in vivo imaging Cranial window Structural plasticity
Background
Three cranial window procedures are currently available for in vivo imaging, open-skull cranial window (Trachtenberg et al., 2002), thinned-skull cranial window (Yang et al., 2010) and polished and reinforced thinned-skull cranial window (Drew et al., 2010). Each protocol has both advantages and disadvantages. Open-skull has best optical imaging quality, unlimited repetitive imaging times and large field of view, but needs to wait for 2 weeks to recover from surgery and also has the inflammation and glia activation issue; Thinned-skull protocol has minimal disturbance from inflammation and glia activation on the brain, but has limited repetitive imaging times, only 2-5 times for a cranial window, small field of view(< 300 μm in diameter); Polished and reinforced thinned-skull method allows unlimited repetitive imaging, large field view(< 3 mm in diameter) and minimal disturbance, but the optical imaging quality decreases over time because of light diffusion and absorption at the interface with regenerated bone. Researcher may choose an appropriate protocol according to specific study.
Materials and Reagents
Small paper towel
Miniature blade (Surgistar, catalog number: 6900 )
Cotton swabs
#0 cover glass (3 mm diameter) (Warner Instruments)
Custom-made silicone whip (see Drew et al., 2010 supplemental)
Sodium chloride injection (USP)
Cyanoacrylate glue (Loctite)
Mouse, Thy1-YFPH, 6~12 weeks, male
Note: Younger mouse has faster bone regeneration, which may lead to shorter time window for high quality images.
Ketamine (diluted to 10 mg/ml)
Xylazine (diluted to 1.5 mg/ml)
Carprofen (diluted to 0.05 mg/ml)
Artificial tears ointment (Rugby Laboratories)
Saline
7.5% Betadine
70% alcohol
2% lidocaine
Diamond paste (3.5 micron diamond pastes) (Wicked Edge, catalog number: WE0535SP )
Tin oxide (Lortone, catalog number: 591-038 )
Liner Bond 2V (KURARAY, catalog number: 1921-KA )
Isofluorane (0.2%, 0.4 L/min)
Equipment
Heating blanket
Sterile glass beaker
Scissors
Thumb forceps
Small sterile drape or platform
Custom-made headpiece holder
High-speed micro drill (CellPoint Scientific, model: Ideal Micro Drill Kit )
0.5 mm-diameter diamond drill bit (Widget Supply, catalog number: D-CM13 )
Hex nut (Small Parts, catalog number: HNX-0090-C )
Dissecting microscope
Software
ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,159 | https://bio-protocol.org/exchange/protocoldetail?id=2159&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Next-generation Sequencing of the DNA Virome from Fecal Samples
Cynthia L. Monaco
Douglas S. Kwon
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2159 Views: 9853
Edited by: Yannick Debing
Reviewed by: Anca Flavia SavulescuYi Zhang
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Herein we describe a detailed protocol for DNA virome analysis of low input human stool samples (Monaco et al., 2016). This protocol is divided into four main steps: 1) stool samples are pulverized to evenly distribute microbial matter; 2) stool is enriched for virus-like particles and DNA is extracted by phenol-chloroform; 3) purified DNA is multiple-strand displacement amplified (MDA) and fragmented; and 4) libraries are constructed and sequenced using Illumina Miseq. Subsequent sequence analysis for viral sequence identification should be sensitive but stringent.
Keywords: Virome Viral microbiome Virus-like particles MDA Illumina Miseq
Background
The virome, a dynamic community of eukaryotic viruses, bacteriophages and endogenous retroviruses, represents a minimally characterized component of the human microbiome (Virgin, 2014). In fact, it is estimated that only 1% of the virome has been sequenced and annotated (Mokili et al., 2012). Next generation sequencing (NGS) enables examination of the entire virome, including unculturable viruses. Stool is a readily obtainable specimen type for study of the virome, and alterations in the fecal virome have been associated with a number of disease states (Handley et al., 2012; Norman et al., 2015; Monaco et al., 2016). The fecal virome is largely comprised of bacteriophages, which affect the gastrointestinal tract through alterations in bacterial functions and populations (Duerkop and Hooper, 2013; Reyes et al., 2013; Virgin, 2014). Enteric eukaryotic viruses, while less ubiquitous than bacteriophages, play a more direct role in gastrointestinal tract dysfunction by inducing gastroenteritis, enteritis and colitis. Despite the abundance of bacteriophages in fecal samples, only a few studies thus far have examined the contributions of fecal bacteriophages in human diseases. Inflammatory bowel disease has been associated with increased enteric bacteriophage richness (Norman et al., 2015). In contrast, profound immunosuppression from AIDS in a sub-Saharan cohort resulted in an expanded eukaryotic virome, but had minimal impact on bacteriophage populations (Monaco et al., 2016). More studies are needed to elucidate the role the fecal virome plays in disease states. A key roadblock to studying the stool virome is viral nucleic acid extraction and enrichment from fecal material. Several factors can contribute to difficulty in isolating viral sequences from fecal samples, chief among them the fact that viruses constitute a minority of fecal sample material. Additionally, dilution of feces in collection media (such as RNAlater RNA stabilization reagent) can further hamper the ability to find viral sequences. While many nucleic acid extraction protocols can be used for high input nucleic acid samples to enrich for viral nucleic acid, low input samples, such as those diluted in collection media, represent a challenge with virome studies. After comparison and optimization of several methods, the following protocol was identified as the most universally applicable for isolation of phage and DNA viral sequences from both low (Monaco et al., 2016) and high (Norman et al., 2015) input samples.
Materials and Reagents
Stool aliquoting and pulverization
Versi-dry sheets (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 74018-00 )
Large Kim-wipes (KCWW, Kimberly-Clark, catalog number: 34721 )
Extra heavy-duty aluminum foil (VWR, catalog number: 89107-734 )
Dry ice
Liquid nitrogen and a Dewar along with Styrofoam cup
Pre-labeled screw capped tubes (STARSTEDT) in a freezer box (4 pre-labeled tubes per sample)
Stool scrapers (autoclaved in sets of 6) (Fisher Scientific, catalog number: 21-401-25B )
Sterilization pouches (small)
Autoclave bags
Bleach (5.25% solution of sodium hypochlorite)
75% EtOH
Virus-like particle (vlp) preparation
Sterile 1.5 ml and 2.0 ml screw-cap tubes
1 ml luer-lok syringes (BD, catalog number: 309628 )
0.45 µm filters 13 mm diameter (EMD Millipore, catalog number: SLHV013SL )
0.22 µm filters 13 mm diameter (EMD Millipore, catalog number: SLGV013SL )
1 M Tris, pH 7.5 (Fisher Scientific, catalog number: MT-46-030-CM ) (Tris 1 M pH 7.5, DNase-, RNase-, protease-free [6 x 1 L bottles])
5 M NaCl (Promega, catalog number: V4221 ) (5 M NaCl 1 L bottle, DNase-, RNase-, protease-free; aliquoted in 1 ml aliquots and stored at -20 °C)
Saline magnesium (SM) buffer (Fisher Scientific, catalog number: 50-329-444 ) (SM buffer with gelatin pH 7.5, 100 ml)
10% SDS (diluted from 20% SDS stock [Thermo Fisher Scientific, AmbionTM, catalog number: AM9820 ] in RNase, DNase, Protease free H2O; aliquoted and stored at -20 °C)
Lysozyme (10 mg/ml) (EMD Millipore, catalog number: 71412 ) – aliquoted and stored at -20 °C
Turbo DNase I (2 U/µl) (Thermo Fisher Scientific, AmbionTM, catalog number: AM2238 )
BaseLine zero DNase (1 U/µl) (Epicentre, catalog number: DB0711K )
Chloroform (Fisher Scientific, catalog number: C298-500 )
Phenol:chloroform:isoamyl alcohol (25:24:1) pH 8.0 (Fisher Scientific, catalog number: BP1752I-100 )
QIAGEN DNeasy Blood and Tissue Kit (QIAGEN, catalog number: 69506 )
CTAB (Sigma-Aldrich, catalog number: 52365 )
CTAB/NaCl (see Recipes) [0.45 µm filtered + 0.22 µm filtered]
Library construction
GenomiPhi V2 DNA Amplification Kit (GE Healthcare, catalog number: 25-6600-31 )
Covaris microTUBE AFA fiber snap-cap 50 µl (Covaris, catalog number: 520045 )
NEBNext® UltraTM DNA Library Prep Kit for Illumina (New England Biolabs, catalog number: E7370L , 96 rxns)
NEBNext® Multiplex Oligos for Illumina®
Index Primers Set 1 (New England Biolabs, catalog number: E7335L )
Index Primers Set 2 (New England Biolabs, catalog number: E7500L )
AMPure XP beads (Beckman Coulter, catalog number: A63881 )
TE low EDTA
D1K reagents (Agilent Technologies, catalog number: 5067-5362 )
D1K screen tape for TapeStation (Agilent Technologies, catalog number: 5067-5361 )
Equipment
Biosafety hood
6 mortar/pestles, 100 ml capacity
Beaker
Microcentrifuge
PCR hood
-80 °C freezer
Covaris E210
PCR Thermocycler (Eppendorf)
NanoDrop Micro-Volume UV-Vis spectrophotometer
Agilent 2200 TapeStation (Agilent Technologies, model: 2200 TapeStation)
Loading tips for TapeStation (Agilent Technologies, catalog number: 5067-5153 )
DynamagTM-spin magnet (Thermo Fisher Scientific, catalog number: 12320D )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Monaco, C. L. and Kwon, D. S. (2017). Next-generation Sequencing of the DNA Virome from Fecal Samples. Bio-protocol 7(5): e2159. DOI: 10.21769/BioProtoc.2159.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > Genotyping
Systems Biology > Genomics > Sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
216 | https://bio-protocol.org/exchange/protocoldetail?id=216&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Survival Rate Assay
FL FengZhi Liu
Published: Vol 2, Iss 12, Jun 20, 2012
DOI: 10.21769/BioProtoc.216 Views: 16063
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
This protocol utilizes PicoGreen 96-well plate technology. This method is applied to estimate the sensitivity of different tumor cell lines to chemodrugs.
Materials and Reagents
10% FBS culture medium
Chemodrugs
PicoGreen (Life Technologies, Invitrogen™, catalog number: P7581 )
TryLE express (Trypsin) (Life Technologies, Gibco®, catalog number: 12605-010 )
Phosphate buffered saline (PBS)
Deionized water
Equipment
96-Well culture plate
TECAN Genios Instrument (PHENIX)
Incubator
Foil
Spectrophotometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, F. (2012). Cell Survival Rate Assay. Bio-protocol 2(12): e216. DOI: 10.21769/BioProtoc.216.
Download Citation in RIS Format
Category
Cancer Biology > Cell death > Cell biology assays
Cancer Biology > General technique > Drug discovery and analysis
Cell Biology > Cell viability > Cell death
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,160 | https://bio-protocol.org/exchange/protocoldetail?id=2160&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Outer Membrane Vesicles from Phytopathogenic Xanthomonas campestris pv. campestris
GM Gideon Mordukhovich
OB Ofir Bahar
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2160 Views: 11456
Edited by: Zhaohui Liu
Reviewed by: Emilie ViennoisMahmoud Kamal Ahmadi
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Gram-negative bacteria naturally release outer membrane vesicles (OMVs) to the surrounding environment. OMVs contribute to multiple processes, such as cell-cell communication, delivery of enzymes and toxins, resistance to environmental stresses and pathogenesis. Little is known about OMVs produced by plant-pathogenic bacteria, and their interactions with host plants. The protocol described below discusses the isolation process of OMVs from Xanthomonas campestris pv. campestris strain 33913, a bacterial pathogen of Crucifiers. Nevertheless, this protocol can be used and/or adapted for isolation of OMVs from other phytopathogenic bacteria to promote the study of OMVs in the context of plant-microbe interactions.
Keywords: OMVs Outer membrane vesicles Extracellular vesicles Isolation Purification Xanthomonas campestris pv. campestris Plant-microbe interactions
Background
Extracellular vesicle (EV) release is a process shared by many organisms from all domains of life. In Gram-negative bacteria, most EVs are a result of the outer membrane blebbing and eventually pinching off the bacterial cell wall, and are hence referred to as outer membrane vesicles (OMVs). The study of OMVs focuses on OMV biogenesis, cargo, functions and interactions with host organisms. To date, most of the study on OMVs focused on bacterial pathogens of humans and environmental bacteria, however very little research has been done on OMVs from phytopathogenic bacteria. The protocol described here was adapted from the protocol described by Chutkan et al. (2013) with slight modification, and presented here with the phytopathogen X. campestris pv. campestris. To our understanding this is the first, fully detailed, protocol for isolation of OMVs from phytopathogenic bacteria and we hope it could serve as a guiding protocol for other research groups interested in this topic.
Materials and Reagents
Sterile single-use inoculating loop
200 μl pipette tips (such as: Corning, Axygen®, catalog number: # T-200-C )
Parafilm (Bemis, catalog number: PM996 )
Syringe-mounted 0.45-µM filter (EMD Millipore, catalog number: SLHV033RS )
Polyethersulfone (PES) filter, 0.45-µM, Ø75-mM membrane diameter, with an attached 500-ml bottle. Operated by a vacuum pump (e.g., Guangzhou Jet Bio-Filtration, catalog number: FPE404500 )
1 ml and 10 ml sterile syringes (without needle)
1 ml syringes (such as: KDL Medical Product, catalog number [as written on the package]: 7290010993604)
10 ml syringes (such as: Medisposables, catalog number [as written on the package]: 9304-10/16933506093041 )
Sterile 15-ml Falcon tube (such as: SPL Life Sciences, catalog number: 50015 )
12 ml polypropylene/polyallomer ultracentrifuge tubes (such as: Beckman Coulter, catalog number: 331372 ) – make sure that they are fit for the ultracentrifuge’s speed
Syringe-mounted 0.22-µM filter (Axiva Sichem Biotech, catalog number: SFPV13 R )
Sterile 1.5-ml tube (1.7-ml clear tube) (Corning, Axygen®, catalog number: # MCT-175-C )
1 ml pipette tips (such as: Corning, Axygen®, catalog number: # T-1000-C )
Polystyrene (PS) aseptic Petri dishes, 90 x 15-mm (Miniplast Ein-Shemer, catalog number: 820-090-01-017 )
Xanthomonas strain in glycerol stock stored at -80 °C – for the preparation of this protocol we used X. campestris pv. campestris (Xcc) 33913, which was obtained from American Type Culture Collection (ATCC)
Difco nutrient agar (BD, catalog number: 21300 )
Note: It contains 3 g/L of beef extract, 5 g/L of peptone, and 15 g/L of agar, with a final pH of 6.8 ± 0.2 (as written on the powder’s container).
Cephalexin hydrate (Sigma-Aldrich, catalog number: C4895 ) – stock solution at concentration of 10 mg/ml
Sterile dH2O
10x phosphate buffered saline (PBS) buffer (optional) (such as: Sigma-Aldrich, catalog number: P5493 )
OptiPrep density gradient medium (Sigma-Aldrich, catalog number: D1556 )
‘Coomassie Plus – The Better Bradford Assay Kit’ (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23236 ) (optional)
Lipid dye FM4-64FX (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: F34653 ) (optional)
Materials and reagents required for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), as indicated in the following protocol (optional): http://www.bio-protocol.org/e80 (‘[Bio101] Laemmli-SDS-PAGE’)
Yeast extract powder (EMD Millipore, catalog number: 61931105001730 )
Bacto tryptone (BD, Bacto, catalog number: 211705 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: 7647-14-5 )
Sucrose crystallized (Duchefa Biochemie, catalog number: S0809 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (EMD Millipore, catalog number: 105886 )
NaOH or HCl (in order to adjust pH)
Peptone (EMD Millipore, catalog number: 61930705001730 )
L(+)-glutamic acid (Acros Organics, catalog number: 6106-04-3 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
YEB medium (see Recipes)
PSB medium (see Recipes)
OptiPrep diluent buffer (see Recipes)
Note: (optional) – not necessary for the vesicles’ isolation process.
Equipment
Biological hood
Temperature controlled incubator shaker (28 °C), with a capability to reach 200 RPM (such as: Thermo Fisher Scientific, Thermo ScientificTM, model: MaxQTM 6000 )
Two 2-L Erlenmeyer flasks
Cuvette
Polypropylene Copolymer (PPCO) 250-ml centrifuge bottles (such as: Thermo Fisher Scientific, Thermo ScientificTM, model: NalgeneTM PPCO Centrifuge Bottle ) – make sure that they are fit for the centrifuge’s speed
High-speed centrifuge (e.g., Beckman Coulter, model: Avanti J-E , catalog number: 369003; or Thermo Fisher Scientific, model: SorvallTM RC-6 , catalog number: 74804*) and 6 x 250-ml rotor (such as: Beckman Coulter, model: JLA-16.250 , catalog number: 363930, dual-locking lid; or Thermo Fisher Scientific, SorvallTM, model: SLA-1500 , catalog number: 46615* [old model]) at a speed of approx. 32,000 x g
Ultracentrifuge (e.g., Thermo Fisher Scientific, SorvallTM, model: Discovery 90SE , catalog number: 40130867*, Kendro Laboratory Products) and a 6 x 12-ml swinging bucket ultracentrifuge rotor such as: Thermo Fisher Scientific, SorvallTM, model: TH-641 , catalog number: 54295* (old model, Kendro Laboratory Products), or Thermo Fisher Scientific, Thermo ScientificTM, model: TH-641 , catalog number: 54295 (new model,) at a speed of approx. 175,000 x g
Autoclave
NanoSight device (Malvern) (optional)
Transmission electron microscopy (optional)
Equipment required for SDS-PAGE as indicated in the following protocol (optional): http://www.bio-protocol.org/e80 (‘[Bio101] Laemmli-SDS-PAGE’)
Notes
*Catalog number of an old model.
(optional) – not necessary for the vesicles’ isolation process.
Important note: the centrifuge speeds mentioned above, were calculated with Science Gateway's centrifuge rotor speed calculator (http://www.sciencegateway.org/tools/rotor.htm) – if the centrifuge/ultracentrifuge did not give such option.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mordukhovich, G. and Bahar, O. (2017). Isolation of Outer Membrane Vesicles from Phytopathogenic Xanthomonas campestris pv. campestris. Bio-protocol 7(5): e2160. DOI: 10.21769/BioProtoc.2160.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Organelle isolation
Microbiology > Microbe-host interactions > Bacterium
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,161 | https://bio-protocol.org/exchange/protocoldetail?id=2161&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Primary Culture of Adult Human Adipose-derived Stromal/Stem Cells
Robert B. Jones
Amy L. Strong
Jeffrey M. Gimble
Bruce A. Bunnell
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2161 Views: 13649
Reviewed by: Federica PisanoNingfei An
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Adipose-derived stromal/stem cells (ASCs) are multipotent cells that can be isolated from adipose tissue. Studies have shown that cells have the capacity to self-renew and differentiate into adipocyte, chondrocyte, myocyte, and osteoblast lineages. Thus, significant interest regarding their use for regenerative purposes to restore aging or damaged tissue has grown in recent decades. These cells have also been shown to immunomodulate the microenvironment and secrete abundant growth factors, which minimize inflammation and aid repair and regeneration. ASCs can be readily isolated from the stromal vascular fraction (SVF) of lipoaspirates. Given their ease of accessibility, bountiful source, and potential application in regenerative medicine and tissue engineering, there is growing interest in the characterization and utilization of ASCs. This protocol describes the isolation of ASCs from adult human adipose tissue as well as methods for culture maintenance including expansion and cryopreservation.
Keywords: Adipose-derived stem cells Adipose-derived stromal cells Cell isolation Primary cell culture Cell expansion Cryopreservation
Background
Adipose-derived stromal/stem cells (ASCs) demonstrate vast potential for the field of stem cells. Following the therapeutic marvel of hematopoietic stem cells transplantation, ASCs represent the future for stem cells due to their more freely accessible source – adipose tissue. The ability of ASCs to self-renew and differentiate into various tissue lineages including adipocyte, chondrocyte, myocyte, and osteoblast lineages, allows restoration of damaged tissue. Additionally, it is speculated that ASCs have the potential to replicate tissue in vitro. In vitro organs will allow more readily available assessment of novel pharmaceuticals and thus reduce drug production costs significantly. However, inconsistencies in the processes of isolation, maintenance, and cryopreservation, prohibit collective analysis of results from different laboratories worldwide. A standard protocol for isolation and culture of ASCs is necessary to ensure consistent data analysis.
Materials and Reagents
Stericup-GP 0.22 µm polyethersulfone 500 ml radio-sterilized vacuum filtration flask (EMD Millipore, catalog number: SCGPU05RE )
Centrifuge tubes:
15 ml (Corning, catalog number: 430790 )
50 ml (Corning, catalog number: 430828 )
Sterile disposable serologic pipets:
2 ml (Corning, Falcon®, catalog number: 357558 )
5 ml (Corning, Falcon®, catalog number: 357543 )
10 ml (Corning, Falcon®, catalog number: 357551 )
25 ml (Corning, Falcon®, catalog number: 357525 )
50 ml (Corning, Falcon®, catalog number: 357550 )
NuncTM 15 cm diameter, 145 cm2 culture area cell culture/Petri dishes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 168381 )
FisherbrandTM Premium microcentrifuge tubes: 1.5 ml (Fisher Scientific, catalog number: 05-408-129 )
Cryogenic vials, 1.2 ml (Corning, catalog number: 430487 )
TipOne RPT 10 µl ultra-low retention filter pipet tips, sterile (USA Scientific, catalog number: 1181-3810 )
ARTTM Barrier pipette 100 µl tips 100E low retention (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2065E-05 )
Human adipose tissue obtained from liposuction
1x phosphate-buffered saline (PBS) (GE Healthcare, HyCloneTM, catalog number: SH30256 )
Trypan blue solution, 0.4% (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Ethidium bromide
Acridine orange
0.25% trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200072 )
Isopropanol 95% (v/v)
Liquid nitrogen
Type I collagenase (Worthington Biochemical, catalog number: LS004196 )
Bovine serum albumin (BSA), fraction V (Sigma-Aldrich, catalog number: 10735078001 )
Calcium chloride (CaCl2), ≥ 96.0% anhydrous (Sigma-Aldrich, catalog number: C4901 )
Dulbecco’s modified Eagle medium (DMEM): Nutrient Mixture F-12 (DMEM/F-12) (Thermo Fisher Scientific, GibcoTM, catalog number: 11330032 )
α-minimal essential medium (α-MEM), no nucleosides (Thermo Fisher Scientific, GibcoTM, catalog number: 12561056 )
Fetal bovine serum (FBS), premium select (Atlanta Biologicals, catalog number: S11550 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
L-glutamine (200 mM) (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
DMSO
Digestion solution (see Recipes)
Resuspension solution (see Recipes)
Complete culture medium (CCM) (see Recipes)
Freezing medium (see Recipes)
Equipment
Precision scale
IsotempTM digital-control water bath (Fisher Scientific, model: 215 )
Sterile cell culture hood
Motorized pipette aid
Micropipettes: 10 µl, 200 µl, and 1,000 µl (Eppendorf, model: Research® plus )
Centrifuge (Eppendorf, model: 5810 R )
Cell culture incubator
Inverted routine light microscope (Nikon Instruments, model: Eclipse TS100 )
Hemocytometer
Nalgene® freezing container (Sigma-Aldrich, catalog number: C1562 )
Cryogenic storage dewar (Custom BioGenic Systems, model: 6001 Value Added Cryosystem Dewar )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jones, R. B., Strong, A. L., Gimble, J. M. and Bunnell, B. A. (2017). Isolation and Primary Culture of Adult Human Adipose-derived Stromal/Stem Cells. Bio-protocol 7(5): e2161. DOI: 10.21769/BioProtoc.2161.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Adipose Stem Cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,162 | https://bio-protocol.org/exchange/protocoldetail?id=2162&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transient Transfection-based Fusion Assay for Viral Proteins
MV Melina Vallbracht
CS Christina Schröter
BK Barbara G. Klupp
Thomas C. Mettenleiter
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2162 Views: 10864
Edited by: Yannick Debing
Reviewed by: Marielle CavroisBalasubramanian Venkatakrishnan
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Membrane fusion is vital for entry of enveloped viruses into host cells as well as for direct viral cell-to-cell spread. To understand the fusion mechanism in more detail, we use an infection free system whereby fusion can be induced by a minimal set of the alphaherpesvirus pseudorabies virus (PrV) glycoproteins gB, gH and gL. Here, we describe an optimized protocol of a transient transfection based fusion assay to quantify cell-cell fusion induced by the PrV glycoproteins.
Keywords: Herpesvirus Pseudorabies virus Membrane fusion Virus entry Glycoproteins gB gH/gL Transfection
Background
Membrane fusion is essential for entry and spread of enveloped viruses. Many enveloped viruses require only one or two viral proteins to mediate attachment to host cells and membrane fusion, and the molecular mechanisms are well understood (Harrison, 2015). In contrast, herpesviruses use a more complex mechanism requiring a receptor-binding protein and the core fusion machinery composed of gB and the heterodimeric gH/gL complex for infectious entry. The mechanism leading to fusion of herpesvirus envelopes with cellular membranes is only incompletely understood. Detailed knowledge of the molecular basis of herpesvirus entry and spread is important for efficient countermeasures against a variety of diseases. A better understanding is aided by studying the cell fusion activity of cells transiently expressing the relevant proteins. Different model systems, whereby fusion is induced with a minimal set of the core fusion machinery represented by glycoproteins gB and gH/gL and receptor-binding gD, in the absence of infection, have been developed, for example, for herpes simplex viruses type 1 and 2 (HSV-1 and 2 [Turner et al., 1998; Muggeridge, 2000; McShane and Longnecker, 2005]). Unlike HSV-1 and 2, PrV does not require signaling of gD for membrane fusion during direct cell-to-cell spread, reducing the number of relevant proteins to three (Schmidt et al., 1997). These systems are also used to quantify membrane fusion. However, the evaluation or quantitation of fusion activity, which is often based on counting the number of nuclei of a formed syncytium, is very time consuming. Our incentive to develop the present protocol was to improve the current protocol to facilitate and accelerate evaluation, and make results more robust and comparable by combining important factors like size and number of formed syncytia. Here, we describe an optimized protocol for an in vitro transient transfection based cell-cell fusion assay to quantify membrane fusion induced by the PrV glycoproteins gB and gH/gL (Schröter et al., 2015). However, we know that this assay also is functional with other fusion-active glycoproteins, not just those of pseudorabies virus.
Materials and Reagents
1.5 ml tubes (e.g., Fisher Scientific, catalog number: S348903 )
24-well cell culture plate (e.g., Corning, Costar®, catalog number: 3527 )
Pipette tips 10 µl (TipOne) (STARLAB INTERNATIONAL, catalog number: S1110-3000 )
Pipette tips 1 ml (Greiner Bio One International, catalog number: 740290 )
Pipette tips 100 µl (Greiner Bio One International, catalog number: 739290 )
pcDNA3 (Thermo Fisher Scientific, Invitrogen)
Note: pcDNA3 from Invitrogen is no longer available. Alternatively, pcDNA3.1(+) (Thermo Fisher Scientific, catalog number: V79020 ) can be used.
Rabbit kidney (RK13) cells (Collection of Cell Lines in Veterinary Medicine-RIE 109)
MEM Eagle (Hank’s salts and L-glutamine) (Sigma-Aldrich, catalog number: M4642 )
MEM (Earle’s salts) (Thermo Fisher Scientific, catalog number: 61100061 )
Sodium bicarbonate (NaHCO3) (Carl Roth, catalog number: 6885.1 )
NEA (nonessential amino acids) (Biochrom, catalog number: K 0293 )
Na-pyruvate (EMD Millipore, catalog number: 106619 )
Tris-HCl (pH 8.5)
Fetal bovine serum (FBS) (Biowest, catalog number: S181G )
Lipofectamine® 2000 reagent (Thermo Fisher Scientific, catalog number: 11668027 )
Opti-MEM® reduced serum medium (Thermo Fisher Scientific, catalog number: 31985062 )
Sodium chloride (NaCl) (Carl Roth, catalog number: 9265.1 )
Potassium chloride (KCl) (Carl Roth, catalog number: 5346.1 )
Dextrose (Sigma-Aldrich, catalog number: D9434 )
Trypsin (1:250) powder (Thermo Fisher Scientific, catalog number: 27250018 )
Ethylenediaminetetraacetic acid (EDTA) (SERVA Electrophoresis, catalog number: 11280.01 )
Paraformaldehyde (Carl Roth, catalog number: 0335.1 )
10% growth media (see Recipes)
3% paraformaldehyde (see Recipes)
10 mM Tris HCl (pH 8.5) (see Recipes)
Alsever’s-Trypsin Versen (ATV-) solution (see Recipes)
Note: Solutions and media #6, 11, 14, 15, 16, 21, 22, 23, 24 and 26 should be kept at 4 °C.
Equipment
T75 flask (e.g., Corning, catalog number: 430725U )
Incubator (e.g., Panasonic, Sanyo, model: MCO-19AIC or Fisher Scientific, catalog number: 12826756 )
Fluorescence microscope (e.g., Nikon Instruments, model: Eclipse Ti-S)
Super high pressure mercury lamp power supply (e.g., Nikon Instruments, model: C-SCH1 )
Light source (e.g., Nikon Instruments, model: LH-M100C-1 )
Vortexer (e.g., Fisher Scientific, catalog number: S96461A )
Laminar flow hood (Thermo Fisher Scientific, Thermo ScientificTM, model: Safe 2020 Class II , catalog number: 51026637)
Centrifuges for 1.5 ml tubes (e.g., Eppendorf, model: 5415 D )
Pipette controller (e.g., pipetboy acu 2, VWR, catalog number: 37001-856 )
Nanophotometer (e.g., VWR, IMPLEN, model: P330, catalog number: CA11027-294 )
Software
Computer running software NIS-Elements V 4.00.01 (Nikon, Düsseldorf, Germany)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > Virus
Microbiology > Microbe-host interactions > In vitro model
Biochemistry > Lipid > Lipid binding
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,163 | https://bio-protocol.org/exchange/protocoldetail?id=2163&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Knock-in Blunt Ligation Utilizing CRISPR/Cas9
JG Jonathan M. Geisinger
Michele P. Calos
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2163 Views: 9776
Edited by: Renate Weizbauer
Reviewed by: Annis Elizabeth RichardsonPriyanka Das
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
The incorporation of the CRISPR/Cas9 bacterial immune system into the genetic engineering toolbox has led to the development of several new methods for genome manipulation (Auer et al., 2014; Byrne et al., 2015). We took advantage of the ability of Cas9 to generate blunt-ended double-strand breaks (Jinek et al., 2012) to introduce exogenous DNA in a highly precise manner through the exploitation of non-homologous end-joining DNA repair machinery (Geisinger et al., 2016). This protocol has been successfully applied to traditional immortalized cell lines and human induced pluripotent stem cells. Here we present a generalized protocol for knock-in blunt ligation, using HEK293 cells as an example.
Keywords: CRISPR/Cas9 Genome engineering NHEJ Double-strand breaks Cell culture
Background
At the time we conceptualized knock-in blunt ligation (Geisinger et al., 2016), the vast majority of methods developed for use with CRISPR/Cas9 were focused on enhancing the efficiency of homologous recombination. However, there was one exception: a homology-independent, plasmid-based knock-in method developed in zebrafish (Auer et al., 2014). This method, like knock-in blunt ligation, relies on the machinery of canonical non-homologous end-joining to insert a linearized, blunt-ended, double-stranded DNA fragment into a genomic double-strand break with a high degree of precision and minimal loss of nucleotides. Both methods are similar to a method developed for zinc-finger nucleases and TALENs known as obligate ligation-gated recombination (ObLiGaRe; Maresca et al., 2013), which relied on the generation of compatible overhangs to facilitate insertion of target DNA into the genome. Both the Auer method and ObLiGaRe rely on delivery of a vector bearing the desired transgene construct, which could lead to incorporation of undesirable exogenous sequences. Because of the propensity of Staphylococcus pyogenes Cas9 to make blunt-ended double-strand breaks, we reasoned that exogenous sequence delivery in genome engineering experiments could be limited to solely the CRISPR/Cas9 expression vector and a PCR-generated amplicon of solely the sequence of interest. Thus, knock-in blunt cloning possesses the dual advantages of minimizing the introduction of exogenous sequences and its reliance on canonical non-homologous end-joining rather than homologous recombination. While the following protocol is specifically for human HEK293 cells, we note that this method is likely to be broadly applicable to eukaryotic cells.
Materials and Reagents
ChromaSpin+TE-1,000 chromatography columns (Takara Bio, Clontech, catalog number: 636079 )
Falcon® polystyrene 24-well tissue culture microplates (Corning, Falcon®, catalog number: 353226 )
Thin-walled PCR tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: AB1182 )
Falcon® test tube with cell strainer snap cap (Corning, Falcon®, catalog number: 352235 )
Falcon® polystyrene 96-well tissue culture microplates, flat bottom (Corning, Falcon®, catalog number: 353916 )
1.75 ml microcentrifuge tubes
Note: Manufacturer does not matter.
Optional: 10-cm tissue culture dishes (Corning, catalog number: 353003 )
A human cell line, such as HEK293
Avector that expresses the guide RNA or RNAs of interest and Cas9 (e.g., Addgene, catalog number: 42230 )
Double-stranded DNA template, preferably plasmid
DNA oligos containing three phosphorothioate bonds at the 5’ end of each oligo for PCR amplification of a template
A high-fidelity, blunt-end generating DNA polymerase: Phusion (New England Biolabs, catalog number: E0553S ) or Q5 (New England Biolabs, catalog number: M0491S ), with associated buffer, are the only acceptable polymerases for this protocol
10 mM dNTPs (New England Biolabs, catalog number: N0446S )
MinElute PCR Purification Kit (QIAGEN, catalog number: 28004 )
FastDigest DpnI (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FD1703 )
Nuclease-free water
A transfection reagent such as FuGENE® HD (Promega, catalog number: E2311 )
Opti-MEM I media (Thermo Fisher Scientific, GibcoTM, catalog number: 31985062 )
NucBlue® Fixed Cell Stain ReadyProbes® reagent (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: R37606 )
Phosphate buffered saline (PBS)
0.05% trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25300054 )
DMEM, high glucose (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
Fetal bovine serum (FBS)
0.5 M EDTA, pH 8.0 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575020 )
Growth media (see Recipes)
FACS media (see Recipes)
Equipment
PCR thermocycler (Bio-Rad Laboratories, catalog number: 1861096 )
Tissue culture hood, Type B2 biological safety cabinet (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: 1300 Series Class II )
Incubator (37 °C and 5% CO2) (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: Series 8000 )
Microcentrifuge (e.g., Eppendorf, model: 5424 )
FACSAria II cell sorter (BD)
Hemocytometer (Neubauer chamber) or equivalent method
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Geisinger, J. M. and Calos, M. P. (2017). Knock-in Blunt Ligation Utilizing CRISPR/Cas9. Bio-protocol 7(5): e2163. DOI: 10.21769/BioProtoc.2163.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > Mutagenesis
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,164 | https://bio-protocol.org/exchange/protocoldetail?id=2164&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chitin Extraction and Content Measurement in Magnaporthe oryzae
XL Xinyu Liu
Zhengguang Zhang
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2164 Views: 7977
Edited by: Zhaohui Liu
Reviewed by: Anna Дмитриевна Kozhevnikova
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Chitin is a linear polysaccharide composed of β (1→4)-linked N-acetylglucosamine (GlcNAc) residues. In fungi, chitin is an important component of the cell wall. Here, we provide a protocol to measure the chitin content of fungal cells using Magnaporthe oryzae as an example.
Keywords: Chitin Cell wall GlcNAc Pathogenicity Magnaporthe oryzae
Background
Chitin is an important component of the cell wall in fungal pathogens and is well known as a pathogen associated molecule pattern (PAMP). Determining the chitin content of a fungal species is important for studying fungal biology and host-pathogen interactions. The Morgan-Elson method based on colorimetric approach has been adapted in yeast to measure cellular chitin levels (Leloir and Cardini, 1953; Bulik et al., 2003; Baker et al., 2007). However, there is no specific protocol established for Magnaporthe oryzae, which is the causal agent of rice blast, the most important fungal disease in the world. Here, we describe a reliable and simple protocol which was modified from the Morgan-Elson method to test the chitin content of M. oryzae (Song et al., 2010).
Materials and Reagents
Microtube
Microtiter plates (Corning, Costar®, catalog number: 42592 )
Miracloth (EMD Millipore, catalog number: 475855 )
Cells of Magnaporthe oryzae
Potassium hydroxide (KOH) (Sangon Biotech, catalog number: A610441 )
10x phosphate buffered saline (PBS, 1.35 M NaCl, 47 mM KCl, 100 mM Na2HPO4, 20 mM NaH2PO4, pH = 7.4) (Beyotime, catalog number: ST476 )
Streptomyces plicatus chitinase (Sigma-Aldrich, catalog number: C6137 )
Sodium borate (Sangon Biotech, catalog number: A100390 )
GlcNAc (Sigma-Aldrich, catalog number: PHR1432-1G )
Sodium hydrogen (Na2HPO4) (Sangon Biotech, catalog number: A501727 )
Citric acid (Sangon Biotech, catalog number: A501702 )
p-dimethylaminobenzaldehyde (Sigma-Aldrich, catalog number: D2004 )
Hydrochloric acid (HCl)
Acetic acid (Sangon Biotech, catalog number: A501931 )
Biotin
Pyridoxin
Thiamine
Riboflavin
p-aminobenzoic acid
nicotinic acid
ZnSO4·7H2O
H3BO3
MnCl2·4H2O
FeSO4·7H2O
CoCl2·6H2O
CuSO4·5H2O
Na2MnO4·2H2O
Na4EDTA
NaNO3
KCl
MgSO4·7H2O
KH2PO4
D-glucose
Peptone
Yeast extract
Casamino acid
Agar
McIlvaine’s buffer (see Recipes)
Ehrlich’s solution (see Recipes)
Vitamin solution (see Recipes)
Trace elements (see Recipes)
20x nitrate salts (see Recipes)
CM medium (see Recipes)
Equipment
Freeze dryer (Marin Christ German)
Vortex mixer
Water bath (SHEL Lab, model: W6M-2 )
Centrifuge (Eppendorf centrifuge) (Eppendorf, model: 5418 )
Incubator shaker (Crystal Technology & Industries, model: IS-RSD3 )
pH/ATU electrode (Sartorius, German)
Microplate reader (Molecular Devices, model: VersaMax ELISA )
PCR instrument (Takara Bio, model: TP600 )
Eppendorf micropipette (1,000 μl, 100 μl, 10 μl)
Dark glass bottle
Software
SPSS 2.0 (Chicago, IL, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, X. and Zhang, Z. (2017). Chitin Extraction and Content Measurement in Magnaporthe oryzae. Bio-protocol 7(5): e2164. DOI: 10.21769/BioProtoc.2164.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Carbohydrate
Microbiology > Microbe-host interactions > Fungus
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,165 | https://bio-protocol.org/exchange/protocoldetail?id=2165&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Elemental Concentrations in Lichens Using ICP-AES/MS
Liang-Cheng Zhao
Li Wang
Yun-Jun Jiang
Yan-Qiao Hu
Chong-Ying Xu
LW Lei Wang
X Xing Li
LW Li Wei
Xiu-Ping Guo
Ai-Qin Liu
Hua-Jie Liu
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2165 Views: 9820
Edited by: Dennis Nürnberg
Reviewed by: Chong He
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Lichens are good biomonitors for air pollution because of their high enrichment capability of atmospheric chemical elements. To monitor atmospheric element deposition using lichens, it is important to obtain information on the multi-element concentrations in lichen thalli. Because of serious air pollution, elemental concentrations in thalli of lichens from North China (especially Inner Mongolia, Hebei, Shanxi and Henan province) are often higher than those from other regions, therefore highlighting the necessity to optimize ICP-AES/MS (Inductively coupled plasma-atomic emission spectroscopy/mass spectrometry) for analyzing lichen element content. Based on the high elemental concentrations in the lichen samples, and the differences in the sensitivity and detection limits between ICP-MS and ICP-AES, we propose a protocol for analyzing 31 elements in lichens using ICP-AES/MS. Twenty-two elements (Cd, Ce, Co, Cr, Cs, Cu, K, La, Mo, Na, Ni, Pb, Rb, Sb, Sc, Sm, Sr, Tb, Th, Tl, V and Zn) can be identified by using microwave digestion- ICP-MS, and 9 elements (Al, Ba, Ca, Fe, Mg, Mn, P, S and Ti) by using ashing-alkali fusion digestion- ICP-AES.
Keywords: Element content Heavy metal ICP-AES ICP-MS Lichens Microwave digestion Ashing-alkali fusion
Background
Lichens have been widely used in biomonitoring of air pollution in many regions of the world, including China that experiences heavy-metal atmospheric pollution in some areas. Recent studies found that the element concentrations in lichens from North China are higher than or at the upper range of the literature values from other regions (Liu et al., 2016a; 2016b and 2016c), due to the severe air pollution in this region.
Compared with other techniques (for example spectrophotometric methods, atomic absorption spectrometry and atomic fluorescence spectrometry), ICP-AES/MS is a multi-element analysis method involving simple procedure with relatively low detection limits. This method is widely used in the quantitative analysis of lichen elements outside China. However, to date, there have been no reports on the application of ICP-AES/MS to analyze elements in lichens of North China. Specific procedures for the sample preparation of the lichens are required due to the high loadings of elements with great variation in concentration. Therefore, to facilitate the biomonitoring of atmospheric elemental deposition with lichens in China, we propose a protocol for lichen elemental concentration analyses using ICP-AES/MS.
Materials and Reagents
Paper bags
10 mesh nylon standard inspection sieve (pore size 2 mm) (Shangyu Huafeng Hardware Instrument)
50 ml plastic centrifuge tube (SARSTEDT, catalog number: 62.559.001 )
National certified reference materials: GBW10010 (rice), GBW10014 (cabbage) and GBW10015 (spinach; All materials mentioned above were provided by the Institute of Geophysical and Geochemical Exploration, Chinese Academy of Geological Sciences). Lichen material IAEA-336 (International Atomic Energy Agency)
Lichens: Xanthoria mandschurica and Xanthoparmelia mexicana, collected from Taihang Mountains, Hebei Province, China
H2O2, > 30% (w/v) (Beijing Institute of Chemical Reagents, catalog number: 160215 )
103Rh: 1.00 mg/ml (GSB-G62037-90, National Analysis Center for Iron & Steel, Beijing, China)
HCl, 35-37% (w/v) (Beijing Institute of Chemical Reagents, catalog number: 160718 )
Standard stocking solutions: 1.00 mg/ml Al (GBW[E]086219), Ba (GBW[E]080243), Ca (GBW[E]080261), Cd (GBW08612), Ce (GSB04-1775), Co (GBW08613), Cr (G130008614), Cs (GSB04-1724), Cu (GSB04-1725), Fe (GBW08616), K (GBW[E]080125), La (GBW08651), Mg (GBW[E]080126), Mn (GSB04-1736), Mo (GBW[E]080218), Na (GBW[E]080127), Ni (GBW08618), P (GBW[E]080186), Pb (GBW08619), Rb (GSB04-2836), S (GBW[E]080266), Sb (GBW[E]080545), Sc (GBW[E]3141), Sm (GSB64-1778), Sr (GSB04-1754), Tb (GSB04-1781), Th (GBW[E]080174), Ti (GBW3041), Tl (GSBG62070-90), V (GBW[E]080243), and Zn (GBW[E]080607) (National Research Center for standard materials, Beijing, China)
Standard intermediate solutions (see Recipes; Table 8)
Standard working solutions (see Recipes; Table 8)
Equipment
Inductively coupled plasma mass spectrometer (ICP-MS) (Agilent Technologies, model: Agilent 7700X ICP-MS )
Inductively coupled plasma optical emission spectrometer (ICP-AES) (Varian, model: Varian Vista MPX )
Microwave digestion system (equipped with Teflon digestion vessels) (CEM Corporation, Matthews, model: MARS X-press )
Grinding mill equipped with Tungsten Carbide jars (Retsch, model: Retsch MM400 )
Stereo microscope (Motic, model: Motic SMZ-140 )
Muffle furnace (Yiheng, model: SX2-4-10TP )
Oven (50-120 °C)
Tweezers
50 ml volumetric flask
30 ml nickel crucible (Jiangsu Plaza Premium Electric Instrument, catalog number: 30 ml crucible )
Deionized water: resistivity ≥ 18.0 MΩ cm (Aquapro International, model: Aquaplore3 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhao, L., Wang, L., Jiang, Y., Hu, Y., Xu, C., Wang, L., Li, X., Wei, L., Guo, X., Liu, A. and Liu, H. (2017). Determination of Elemental Concentrations in Lichens Using ICP-AES/MS. Bio-protocol 7(5): e2165. DOI: 10.21769/BioProtoc.2165.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Biochemistry > Other compound > Elements
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,166 | https://bio-protocol.org/exchange/protocoldetail?id=2166&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Multiplexed GuideRNA-expression to Efficiently Mutagenize Multiple Loci in Arabidopsis by CRISPR-Cas9
JS Julia Schumacher
KK Kerstin Kaufmann
WY Wenhao Yan
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2166 Views: 11530
Edited by: Rainer Melzer
Reviewed by: Marta BjornsonMoritz BomerDaniel Savatin
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Since the discovery of the CRISPR (clustered regularly interspaced short palindromic repeats)-associated protein (Cas) as an efficient tool for genome editing in plants (Li et al., 2013; Shan et al., 2013; Nekrasov et al., 2013), a large variety of applications, such as gene knock-out, knock-in or transcriptional regulation, has been published. So far, the generation of multiple mutants in plants involved tedious crossing or mutagenesis followed by time-consuming screening of huge populations and the use of the Cas9-system appeared a promising method to overcome these issues. We designed a binary vector that combines both the coding sequence of the codon optimized Streptococcus pyogenes Cas9 nuclease under the control of the Arabidopsis thaliana UBIQUITIN10 (UBQ10)-promoter and guide RNA (gRNA) expression cassettes driven by the A. thaliana U6-promoter for efficient multiplex editing in Arabidopsis (Yan et al., 2016). Here, we describe a step-by-step protocol to cost-efficiently generate the binary vector containing multiple gRNAs and the Cas9 nuclease based on classic cloning procedure.
Keywords: CRISPR-Cas9 Multiplexing gRNA Gene editing Arabidopsis
Background
The RNA-guided Cas9-system is derived from the bacterial defense system against foreign DNA (Sorek et al., 2013). It has been recognized as a method of choice for genome editing because of its high efficiency, easy handling and possibility of multiplex editing. In general, the Cas9-gene editing system involves a single synthetic RNA molecule, the gRNA that directs the Cas9 protein to target the desired DNA site for genome modification or transcriptional control. The gRNA-Cas9 complex recognizes the targeted DNA by gRNA-DNA pairing and requires the presence of a protospacer-adjacent motif (PAM). The PAM is represented by the nucleotides NGG or less specific NAG (with N for any nucleotide) in the target site following the gRNA-DNA pairing region. Thus, the approximate 20 nucleotides long gRNA spacer sequence, i.e., the part of the gRNA sequence complementary to the DNA target site, determines the specificity of the complex. In this protocol, we describe the details to generate a binary vector that contains both the gRNA and the Cas9 coding sequence by classic cloning (Figure 1). As our vector system allows for subsequent addition of further gRNAs, it can be used for multiplex editing of the Arabidopsis genome and to obtain multiple, stably inherited alleles. Strong expression of the Cas9 protein and the gRNAs especially in proliferating tissues is achieved by the use of the A. thaliana UBQ10- and the U6-promoter, respectively. First mutations can be detected in the T1 generation, and T-DNA- and Cas9-free mutant plants may already be selected in the T2 generation. Besides the selection of the gRNA and the construction of the plasmid, we give an overview of efficient genotyping methods required for detection of small or large deletions.
Figure 1. Scheme of the cloning procedure described in the protocol. Only a series of restriction and ligation steps is required to obtain a plant transformation vector equipped with a set of AtU6-driven gRNAs and the Cas9 enzyme under the control of the UBQ10 promoter. Restriction enzyme cutting sites are displayed in italics. Arrows on vectors indicate primer binding sites. TDNA-R and TDNA-L point out T-DNA right and left borders, respectively. (B) and (P) indicate selection markers for selection in bacteria or plants, respectively.
Materials and Reagents
Note: The protocol described here is based on the RNA-guided Cas9 system which was published recently (Yan et al., 2016). Only classical cloning methods such as restriction enzyme digestion and cohesive end ligation are required to construct plasmids ready for plant transformation.
Consumables
200 µl PCR tubes (Kisker Biotech, catalog number: G003-SF )
or 96-well PCR plates (SARSTEDT, catalog number: 72.1978.202 )
StarSeal sealing tape (STARLAB, catalog number: E2796-9793 )
1.5 ml reaction tubes (SARSTEDT, catalog number: 72.690.001 )
Pipette tips
Scalpel
Petri dishes, round, 9.2 x 1.6 cm (SARSTEDT, catalog number: 82.1472.001 )
Petri dishes, square, 10 x 10 x 2 cm (SARSTEDT, catalog number: 82.9923.422 )
Cuvettes for electroporation, e.g., Gene Pulser® cuvette 0.1 cm (Bio-Rad Laboratories, catalog number: 1652089 )
5 ml glass pipette
MicroporeTM tape (VWR, catalog number: 115-8172 )
Note: Any appropriate consumable can be used.
Competent cells
One Shot® TOP10 chemically competent Escherichia coli (Thermo Fisher Scientific, InvitrogenTM, catalog number: C4040 )
Electro-competent Agrobacterium tumefaciens, strain pGV3101 (for preparation of electro-competent Agrobacteria, please see Mersereau et al., 1990)
Plant material
Arabidopsis thaliana Col-0
Plasmids
AtU6-26-V4 (3.5 kb, ampicillin resistance marker [AmpR], available on request)
UBQ10::pcoCas9p1300 (14.3 kb, kanamycin resistance marker [KanR] in bacteria, hygromycin or kanamycin resistance marker [HygR or KanR] in plants, available on request)
Optional: pGEM®-T easy (Promega, catalog number: A3600 )
Enzymes and buffers
Restriction
BpiI (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: ER1011 )
KpnI-HF (New England Biolabs, catalog number: R3142 )
XbaI (New England Biolabs, catalog number: R0145 )
SpeI-HF (New England Biolabs, catalog number: R3133 )
SbfI-HF (New England Biolabs, catalog number: R3642 )
Cutsmart® buffer (New England Biolabs, catalog number: B7204S , supplied with the enzyme)
Ligation
T4 DNA ligase (New England Biolabs, catalog number: M0202 )
T4 DNA ligase reaction buffer (New England Biolabs, catalog number: B0202S , supplied with the enzyme)
Genotyping (bacteria)
Green Taq DNA polymerase (GenScript, catalog number: E00043 )
10x Taq buffer (GenScript, catalog number: B0005 , supplied with the enzyme)
10 mM dNTPs (Carl Roth, catalog number: K039 )
Any DNA-loading dye, e.g., 6x gel loading dye, purple (New England Biolabs, catalog number: B7024 )
Any DNA-size standard, e.g., GeneRulerTM 1 kb Plus DNA ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SM1331 )
Agarose (Carl Roth, catalog number: 3810 )
10x TBE electrophoresis buffer (see Recipes)
Tris (Applichem, catalog number: A1379 )
Boric acid (Applichem, catalog number: 131015 )
EDTA (Applichem, catalog number: 131669 )
Deionized water (sterile)
Antibiotics (store stocks at -20 °C)
Ampicillin (Carl Roth, catalog number: K029 , stock 50 mg/ml in deionized water)
Kanamycin (Carl Roth, catalog number: T832 , stock 30 mg/ml in deionized water)
Rifampicin (Applichem, catalog number: A2220 , stock 25 mg/ml in DMSO)
Gentamycin (Carl Roth, catalog number: 0233 , stock 10 mg/ml in deionized water)
Hygromycin (Carl Roth, catalog number: CP13 , stock 10 mg/ml in deionized water)
Media (see Recipes)
YEB medium for Agrobacterium
Meat extract (Carl Roth, catalog number: 5770 )
Yeast extract (Carl Roth, catalog number: 2904 )
Peptone (Sigma-Aldrich, catalog number: 82303 )
Sucrose (Carl Roth, catalog number: 4621 )
Magnesium sulfate (MgSO4) (Carl Roth, catalog number: P027 )
Bacto-agar (Th. Geyer, CHEMSOLUTE®, catalog number: 9914-500G )
Sodium hydroxide (NaOH) (Merck, catalog number: 28245 )
YT medium for E. coli
Sodium chloride (NaCl) (Carl Roth, catalog number: 9265 )
Yeast extract (Carl Roth, catalog number: 2904)
Peptone (Sigma-Aldrich, catalog number: 82303)
Bacto-agar (Th. Geyer, CHEMSOLUTE®, catalog number: 9914-500G)
Sodium hydroxide (NaOH) (Merck, catalog number: 28245)
½ MS for Arabidopsis
MS + B5 Vitamins (Duchefa Biochemie, catalog number: M0231 )
Potassium hydroxide (KOH) (Merck Millipore, catalog number: 105033 )
DNA purification
Gel-purification, e.g., NucleoSpin® Gel and PCR clean-up (MACHEREY-NAGEL, catalog number: 740609 )
Plasmid isolation, e.g., NucleoSpin® Plasmid EasyPure (MACHEREY-NAGEL, catalog number: 740727 )
Silwet L-77 (Lehle seeds, catalog number: VIS-30 ) for plant transformation
Bleach (Carl Roth, catalog number: 9062 )
37% HCl (Merck Millipore, catalog number: 100317 )
Genotyping (plants)
Optional: Phire Plant Direct PCR Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: F-130WH )
Optional: T7 endonuclease I (New England Biolabs, catalog number: M0302 ) plus NEBuffer 2 (New England Biolabs, catalog number: B7002 ), 250 mM EDTA
Optional: pGEM®-T easy (Promega, catalog number: A3600)
Oligonucleotides (5’-3’), 10 pmol/µl
M13F_TGTAAAACGACGGCCAGT
M13R_CAGGAAACAGCTATGACC
K197 _CTGTTAATCAGAAAAACTCAG
Equipment
Note: No specific equipment is required. Any appropriate device can be used.
Computer with internet access
Thermocycler (e.g., Eppendorf, model: Mastercycler® nexus )
Thermoblock (e.g., Eppendorf, model: Thermomixer® comfort )
Plate incubators (28 °C, 37 °C)
Shakers (28 °C, 37 °C)
Horizontal gel-electrophoresis system (e.g., Bio-Rad Laboratories, model: Mini-Sub® Cell GT System )
UV transilluminator (e.g., Bio-Rad Laboratories, model: GelDocTM XR+ System )
Electroporator, (e.g., Bio-Rad Laboratories, model: MicroPulserTM Electroporator )
10 L desiccator
Fume hood
200 ml beaker
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Schumacher, J., Kaufmann, K. and Yan, W. (2017). Multiplexed GuideRNA-expression to Efficiently Mutagenize Multiple Loci in Arabidopsis by CRISPR-Cas9. Bio-protocol 7(5): e2166. DOI: 10.21769/BioProtoc.2166.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Agrobacterium
Plant Science > Plant developmental biology > General
Molecular Biology > DNA > DNA modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,167 | https://bio-protocol.org/exchange/protocoldetail?id=2167&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Surface Inoculation and Quantification of Pseudomonas syringae Population in the Arabidopsis Leaf Apoplast
CJ Cristián Jacob*
Shweta Panchal*
Maeli Melotto
*Contributed equally to this work
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2167 Views: 12992
Edited by: Jyotiska Chaudhuri
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Bacterial pathogens must enter the plant tissue in order to cause a successful infection. Foliar bacterial pathogens that are not able to directly penetrate the plant epidermis rely on wounds or natural openings to internalize leaves. This protocol describes a procedure to estimate the population size of Pseudomonas syringae in the leaf apoplast after surface inoculation of Arabidopsis rosettes.
Keywords: Leaf inoculation Stomatal defense Pseudomonas syringae Foliar internalization Apoplastic bacterial population
Background
Plant pathogenic bacteria causing foliar diseases may penetrate the leaf epidermis through wounds and natural openings such as stomata. Stomata are microscopic pores that mediate the regulation of transpiration and the exchange of gases between the plant and the atmosphere. Interestingly, we have demonstrated that bacteria can induce stomatal closure. This phenomenon is now recognized as stomatal defense, which hampers bacterial internalization into the leaf decreasing disease development (reviewed by Melotto et al., 2017, in press). Here, we describe a method adapted from Katagiri et al. (2002) and Panchal et al. (2016a and 2016b) to measure the total endophytic bacterial population of Pseudomonas syringae within Arabidopsis leaf tissue after surface inoculation. This procedure is useful to estimate bacterial penetration of leaves through stomata in a laboratory setting.
Materials and Reagents
3.5-inch square pots with holes (Hummert International, catalog number: 12-1300-1 )
Soil mix, SunGro Sunshine® #1 Mix (Crop Production Services, catalog number: 1000590701 ) or equivalent
Fine vermiculite (Growers Solution, catalog number: Vermiculite4cf )
48 inch x 100 ft Charcoal fiberglass screen (The Home Depot, catalog number: 3000016 )
15 ml and 50 ml centrifuge tubes
Plastic domes (Hummert International, catalog number: 65-6964-1 )
Sharpie markers, paper towels, Kimwipes, disposable gloves, rubber bands, forceps
Square Petri dishes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 240835 )
Micropipettes (Rainin Pipet-LiteTM)
1.5 ml microfuge tubes
Plastic pestles that fit 1.5 ml microfuge tubes (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: 19923-0001 )
Plastic trays without holes (Hummert International, catalog number: 65-6963-1 )
Microbreathe face mask (VWR, catalog number: 10833-224 )
Arabidopsis thaliana (L. Heyhn.) ecotype Columbia (Col-0, ABRC stock CS60000). Seeds can be stored at 4 °C and are viable for 3-4 years
Pseudomonas syringae bacterial culture (stored in 25% glycerol at -80 °C)
Gnatrol (Hummert International, catalog number: 01-2035-1 )
Arabidopsis controlled release fertilizer (LEHLE SEEDS, catalog number: PM-11 )
Appropriate antibiotic (e.g., Rifampicin)
MgCl2 solution
Glycerol (MP Biomedicals, catalog number: 151194 )
Silwet L-77 (LEHLE SEEDS, catalog number: VIS-30 )
Reagent alcohol (Sigma-Aldrich, catalog number: 793183 )
Sterile distilled water
Agarose (VWR, catalog number: 97062-250 )
Tryptone (IBI Scientific, catalog number: 41116105 )
Yeast extract (U.S.Biotech Sources, catalog number: Y01PD-500 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-500 )
Bacteriological agar (IBI Scientific, catalog number: IB49171 )
0.1% agarose (see Recipes)
Low-sodium Luria Bertani medium (see Recipes)
Equipment
1 ml micropipette
Refrigerator or a cold room
Plant growth chamber (Caron Products & Services, model: 6341-2 )
Shaker incubator (VWR, catalog number: 12620-946 )
Spectrophotometer (Thermo Fisher Scientific, model: Spectronic 20D+ or equivalent)
Centrifuge (Eppendorf, model: 5810 )
Handheld electric drill (BLACK + DECKER, catalog number: LDX120C )
Cork borer No. 2 (Cole-Parmer, catalog number: EW-06298-98 )
Digital hygrometer (VWR, catalog number: 35519-047 )
Quantum meter (Apogee, catalog number: BQM )
Vortex (BioExpress, GeneMate, catalog number: S-3200-1 )
Autoclave
laminar flow hood
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jacob, C., Panchal, S. and Melotto, M. (2017). Surface Inoculation and Quantification of Pseudomonas syringae Population in the Arabidopsis Leaf Apoplast. Bio-protocol 7(5): e2167. DOI: 10.21769/BioProtoc.2167.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Host-microbe interactions
Microbiology > Microbe-host interactions > Bacterium
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,168 | https://bio-protocol.org/exchange/protocoldetail?id=2168&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Reprogram Murine Epiblast Stem Cells by Epigenetic Inhibitors
HZ Hui Zhang
YD Yali Dou
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2168 Views: 6554
Edited by: Nicoletta Cordani
Reviewed by: Zhen Shi
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Pluripotent stem cells in the naïve state are highly useful in regenerative medicine and tissue engineering. A robust reprogramming of the primed murine Epiblast Stem Cells (EpiSCs) to naïve pluripotency is feasible via chemical-only approach. This protocol described a method to reprogram murine EpiSCs by MM-401 treatment, which blocks histone H3K4 methylation by MLL1/KMT2A.
Keywords: Naïve pluripotency EpiSCs MLL1 H3K4 methylation Chemical inhibitor
Background
Previous protocols on EpiSC reprogramming depended on the genetic manipulations of transcriptional factors or chemical inhibition of the signaling pathways, albeit with varying efficiency and duration. Based on a recent mechanistic study that links the MLL1 complex to the naïve state, this protocol provides a straightforward and robust method to restore naïve pluripotency from EpiSCs via targeting MLL1 mediated H3K4 methylation and subsequent transcription regulation. The reprogramming efficiency is significantly higher than previous published method, achieving 50% conversion rate in two weeks.
Materials and Reagents
Tissue culture plate, 24 well (Corning, Falcon®, catalog number: 353047 )
15 ml conical tube (Corning, Falcon®, catalog number: 352196 )
MEF feeder cells (University of Michigan, Transgenic Animal Model Core, https://www.med.umich.edu/tamc/list.html#reagents)
0.2% gelatin solution (Sigma-Aldrich, catalog number: G1890 )
PBS
Collagenase type IV (Thermo Fisher Scientific, GibcoTM, catalog number: 17104-019 )
0.05% trypsin (Thermo Fisher Scientific, GibcoTM, catalog number: 25300-054 )
The VectorTM alkaline phosphatase (AP) staining kit (Vector Laboratories, catalog number: SK-5100 )
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11995-065 )
Fetal bovine serum (FBS) (Atlas Biologicals, catalog number: F-0500-D )
L-glutamine (200 mM) (Thermo Fisher Scientific, GibcoTM, catalog number: 25030-081 )
100x non-essential amino acids (Thermo Fisher Scientific, GibcoTM, catalog number: 11140-050 )
100x sodium pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11360-070 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M7522 )
Note: This product has been discontinued.
KnockOutTM D-MEM (Thermo Fisher Scientific, GibcoTM, catalog number: 10829018 )
KnockOutTM serum replacement (KSR) (Thermo Fisher Scientific, GibcoTM, catalog number: 10828028 )
Glutamax (Thermo Fisher Scientific, GibcoTM, catalog number: 35050061 )
Fibroblast growth factor basic (FGF2), human recombinant (R&D Systems, catalog number: 233-FB )
ESGRO® leukemia inhibitory factor (LIF) (EMD Millipore, catalog number: ESG1107 )
MM-401
DMSO
Mouse embryonic fibroblasts (MEFs) culture medium (see Recipes)
EpiSCs culture medium (see Recipes)
Embryonic stem cells (ESCs) culture medium (see Recipes)
100 mM MM-401 (see Recipes)
MM-401 reversion medium (see Recipes)
MM-401 maintenance medium (see Recipes)
Equipment
1 ml pipette
Tissue culture incubator (IsotempTM Microbiological Incubator) (Fisher Scientific, model: Fisher ScientificTM IsotempcatalogTM Microbiological Incubator, catalog number: S28670 ), humidified, 37 °C and 5% CO2 in air
Stereomicroscope (Olympus, model: DP73 )
Centrifuge (Eppendorf, model: 5810 R ; Swing-bucket rotor: Eppendorf, model: A-4-81 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Pluripotent stem cell > Cell induction
Stem Cell > Embryonic stem cell > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,169 | https://bio-protocol.org/exchange/protocoldetail?id=2169&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Liposome Flotation Assays for Phosphoinositide-protein Interaction
HT Helene Tronchere
FB Frederic Boal
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2169 Views: 18045
Edited by: Andrea Puhar
Reviewed by: Daniel KrausVenkatasalam Shanmugabalaji
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
Phosphoinositides are rare membrane lipids involved in the control of the major cellular functions and signaling pathways. They are able to recruit specific effector proteins to the cytosolic face of plasma membrane and organelles to coordinate a vast variety of signaling and trafficking processes, as well to maintain specific identity of the different subcellular compartments (Di Paolo and De Camilli, 2006; Lemmon, 2003). Therefore, analysis of these effectors’ binding properties and specificity towards different phosphoinositides is crucial for the understanding of their cellular functions. This protocol describes a method to characterize the binding of proteins to different phosphoinositide-containing vesicles.
Keywords: Liposome flotation assay Phosphoinositides Protein-lipid interaction Unilamellar vesicles
Background
Several methods exist to analyze protein-phosphoinositide binding and the specificity towards the different members of the phosphoinositide family: lipid overlay, lipid flotation assay and surface plasma resonance (SPR). A Lipid flotation assay consists in the incubation of unilamellar vesicles with the protein of interest, and the subsequent flotation of the vesicles on a sucrose cushion, which will separate vesicle-bound proteins from unbound proteins and vesicles alone. Compared to the other methods a lipid flotation assay is i) technically easier and cheaper than SPR and ii) more specific and closer to physiological conditions, as it mimics the curvature of membranes, in contrast to protein-overlay assays, where lipids are dried on a flat nitrocellulose membrane. This protocol describes the binding of recombinant GST-tagged proteins to unilamellar vesicles of defined size and lipid composition, in particular regarding the specificity towards the different monophosphorylated phosphoinositides (PIP).
Materials and Reagents
Glass tubes, 12 x 75 mm (DUTSCHER SCIENTIFIC, catalog number: 110011 )
Tube, thickwall, polycarbonate, 1 ml, 11 x 34 mm (Beckman Coulter, catalog number: 343778 )
Stericup-GP sterile vacuum filter unit, polyethersulfone, 0.22 μm (EMD Millipore, catalog number: SCGPU10RE )
Mini Extruder Kit (mini-extruder, 2 Hamilton syringes, 0.1 μm polycarbonate membranes, filter supports, holder/heating block) (Avanti Polar Lipids, catalog number: 610000 )
1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (PC) (Avanti Polar Lipids, catalog number: 850457 )
1-palmitoyl-3-oleoyl-sn-glycero-2-phosphoethanolamine (PE) (Echelon, catalog number: L-2368 )
1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(carboxyfluorescein) (fluoPE) (Avanti Polar Lipids, catalog number: 810332 )
Phosphatidylinositol 3-phosphate diC16 (PI3P) (Echelon, catalog number: P3016 )
L-α-phosphatidylinositol-4-phosphate (PI4P) from porcine brain (Avanti Polar Lipids, catalog number: 840045 )
Phosphatidylinositol 5-phosphate diC16 (PI5P) (Echelon, catalog number: P5016 )
Liquid nitrogen
Chloroform/methanol (50/50, v/v)
PBS (w/o Ca/Mg) (Sigma-Aldrich, catalog number: D8537 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Anti-GST antibody (clone B-14) (Santa Cruz Biotechnology, catalog number: sc-138 )
Lipid stocks solutions (see Recipes)
60% and 25% sucrose solutions in PBS (see Recipes)
Equipment
Nitrogen evaporator (N-EVAP, Organomation, catalog number: 11250 )
Chemical hood
Standard heated water bath
Optima TLX ultracentrifuge (Beckman Coulter, model: OptimaTM TLX)
TLA100.2 rotor (Beckman Coulter, model: TLA100.2 rotor)
Note: This rotor is not available anymore from Beckman Coulter. Rotor TLA120.2 (Beckman Coulter, model: TLA120.2) can be used instead.
Portable UV lamp
SDS-PAGE running apparatus
Western blotting apparatus
Refractometer
Software
Image analysis software (e.g., ImageJ, NIH)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tronchere, H. and Boal, F. (2017). Liposome Flotation Assays for Phosphoinositide-protein Interaction. Bio-protocol 7(5): e2169. DOI: 10.21769/BioProtoc.2169.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Cell Biology > Cell signaling > Intracellular Signaling
Biochemistry > Lipid > Lipid-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
217 | https://bio-protocol.org/exchange/protocoldetail?id=217&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for knockdown of HuR with siRNA
FL FengZhi Liu
Published: May 20, 2012
DOI: 10.21769/BioProtoc.217 Views: 11952
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Through a base-pairing-dependent mechanism, 21-23 nucleotide (nt) siRNA binds to complementary target mRNA to inhibit translation.
Materials and Reagents
HuR-siRNA (Life Technologies, Ambion®, catalog number: 4390824 )
Control siRNA (Life Technologies, Ambion®, catalog number: Am4611 )
OPITMEM (Life Technologies, InvitrogenTM, catalog number: 3198 )
Oligofectamine (Life Technologies, InvitrogenTM, catalog number: 12252-011 )
Culture medium
Dulbecco's modified eagle medium (DMEM)
Water (RNase free)
Equipment
6-well plate
Flask T-75
Gloves
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, F. (2012). Protocol for knockdown of HuR with siRNA. Bio-101: e217. DOI: 10.21769/BioProtoc.217.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays > RNA
Molecular Biology > RNA > RNA interference
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,170 | https://bio-protocol.org/exchange/protocoldetail?id=2170&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In Gel Kinase Assay
Gaston A. Pizzio
Pedro L. Rodriguez
Published: Vol 7, Iss 5, Mar 5, 2017
DOI: 10.21769/BioProtoc.2170 Views: 14633
Edited by: Rainer Melzer
Reviewed by: Harrie van Erp
Original Research Article:
The authors used this protocol in Jun 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2012
Abstract
Proper spatiotemporal regulation of protein phosphorylation in cells and tissues is required for normal development and homeostasis. We present the protocol ‘In Gel Kinase Assay’, which is useful for protein kinase activity measurements from crude protein extracts. We have successfully used ‘In Gel Kinase Assay’ protocol to show that the Arabidopsis thaliana sextuple mutant in the PYRABACTIN RESISTANCE1/PYR1-LIKE/REGULATORY COMPONENTS OF ABA RECEPTORS (PYR/PYL/RCAR-ABA receptors; line pyr/pyl112458) is impaired in ABA-mediated activation of SnRK2.2, SnRK2.3 and OST1/SnRK2.6, as much as the triple mutant snrk2.2/2.3/2.6 (Gonzalez-Guzman et al., 2012).
Keywords: Kinases Phosphorylation in vivo Enzymatic activity SnRKs ABA Arabidopsis
Background
The phytohormone abscisic acid (ABA) is a key signal involved in plant growth and development as well as in plant response to abiotic and biotic stress. The ABA perception and signaling pathway is composed of PYRABACTIN RESISTANCE1/PYR1-LIKE/REGULATORY COMPONENTS OF ABA RECEPTORS (PYR/PYL/RCAR-ABA receptors), PP2Cs phosphatases and SnRK2s kinases (reviewed in Antoni et al., 2011). The module receptor-ABA-phosphatase controls the phosphorylation signaling cascades in a ligand-dependent manner through regulation of ABA-activated SnRK2s. In turn, SnRK2s kinases phosphorylate a myriad of effectors, both in the nucleus and in the cytoplasm, from transcription factors (e.g., ABFs) to ion channels (e.g., SLAC1). We show here the protocol ‘In Gel Kinase Assay’ in details. This protocol was developed for protein kinase activity measurement in plant tissues protein extracts as well as from purified recombinant kinases. In brief: an SDS-polyacrylamide gel is prepared containing the ∆C-ABF2 peptide (a specific SnRK2.2, SnRK2.3, OST1/SnRK2.6 kinase substrate). ∆C-ABF2 peptide is trapped in the SDS-polyacrylamide gel mesh and it does not migrate during electrophoresis. On the other hand, SDS-treated protein samples, without boiling and without any reducing agent (e.g., DTT or B-ME), are only partially denatured and can be re-naturalized in some degree after washing SDS out. Moreover, kinase activity at a high sensitive level can be measured using [Gamma-32p]ATP. In this way, together with the kinase activity value we also have the electrophoretic mobility value associated with the kinase activity. Using a plant crude protein extract, and after sample electrophoresis and in gel protein renaturalization step, we can measure specific SnRK2.2/2.3/2.6 (SnRK2s) kinase activity in gel. We have applied this protocol to characterize SnRK2s activity in a PYR/PYL/RCAR-ABA receptor sextuple mutant. We show that the sextuple mutant line pyr/pyl112458 is impaired in ABA-mediated activation of SnRK2s, as much as the triple mutant snrk2.2/2.3/2.6 in Arabidopsis thaliana (result published in Gonzalez-Guzman et al., 2012).
Materials and Reagents
Eppendorf and Falcon tubes (1.5 ml and 50 ml respectively; generic)
Pipettes and tips (generic)
Micropore tape (3M, catalog number: 1530-0 )
Sterile round Petri dishes (100 mm diameter x 20 mm height; generic: e.g., Greiner Bio One, catalog number: 664161 )
Extra thick blot filter paper, 7.5 x 10 cm (Bio-Rad Laboratories, catalog number: 1703965 )
Arabidopsis thaliana seeds: Col-0 (NASC, N1093), pyr/pyl112458 and snrk2.2/2.3/2.6 (Gonzalez-Guzman et al., 2012)
Optional: purified recombinant kinase OST1 (SnRK2.6-6his; homemade: Vlad et al., 2009 and 2012)
Sterile deionized water (generic)
Liquid N2 (generic)
Ice (generic)
ABA (+cis, trans-Abscisic acid) (BIOSYNTH, catalog number: A-0120 )
Bio-Rad Protein Assay Kit I (Bio-Rad Laboratories, catalog number: 5000001 )
Bio-SafeTM Coomassie Stain reagent (Bio-Rad Laboratories, catalog number: 1610786 )
∆C-ABF2 peptide (amino acids 1 to 173; 18.4 KD; homemade: Dupeux et al., 2011; Antoni et al., 2012)
Note: Commercially available alternative MBP (myelin basic protein) (Sigma-Aldrich, catalog number: M1891 ).
SDS-PAGE reagents (listed in He, 2011)
Ethanol (generic)
Polyethylene glycol sorbitan monolaurate (Tween-20) (Sigma-Aldrich, catalog number: P1379 )
Murashige and Skoog medium (MS) (PhytoTechnology Laboratories®, catalog number: M524 )
2-N-morpholino-ethane-sulfonic acid (MES) (Sigma-Aldrich, catalog number: M8250 )
Sucrose (VWR, BDH®, catalog number: BDH0308 )
Agar-agar (Sigma-Aldrich, catalog number: A1296 )
Potassium hydroxide (KOH) (Fisher Scientific, catalog number: P250 )
2-Amino-2-(hydroxymethyl)-1,3-propanediol (Tris-base) (Sigma-Aldrich, catalog number: 252859 )
HCl
4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid, N-(2-hydroxyethyl)piperazine-N’-(2-ethanesulfonic acid) (HEPES) (Sigma-Aldrich, catalog number: H3375 )
DL-dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 43815 )
EDTA (Sigma-Aldrich, catalog number: E5134 )
EGTA (Sigma-Aldrich, catalog number: E3889 )
Sodium fluoride (NaF) (Sigma-Aldrich, catalog number: S7920 )
Sodium orthovanadate (Na3VO4) (Sigma-Aldrich, catalog number: 450243 )
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Adenosine 5’-triphosphate disodium salt hydrate (ATP) (Sigma-Aldrich, catalog number: A1852 )
Glycerol 2-phosphate disodium salt hydrate (BGP) (Sigma-Aldrich, catalog number: G9422 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: S8830 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
2-(5-Bromo-2-pyridylazo)-5-(diethylamino) (Bromo-phenol-blue) (Sigma-Aldrich, catalog number: 180017 )
Polyethylene glycol tert-octylphenyl ether (Triton X-100) (Sigma-Aldrich, catalog number: T8787 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: 05470 )
[Gamma-32p]ATP, 10 μCi/ml - 3,000 Ci/mmol (PerkinElmer, catalog number: BLU502A )
Trichloroacetic acid (TCA) (Sigma-Aldrich, catalog number: T6399 )
Sodium pyrophosphate (Na2PPi) (Sigma-Aldrich, catalog number: 71501 )
Seed sterilization solution (see Recipes)
Solid MS (see Recipes)
Stock reagent (see Recipes)
1 M Tris-HCl (pH 6.8 and 7.5)
1 M HEPES-KOH (pH 7.5)
1 M DTT
0.5 M EGTA
0.5 M EDTA
1 M NaF
100 mM Na3VO4
100 mM PMSF
1 M MgCl2
100 mM ATP
Protein extraction buffer (see Recipes)
2x Laemli buffer (see Recipes)
Washing buffer (see Recipes)
Protein renaturalization buffer (see Recipes)
Cold reaction kinase buffer (see Recipes)
Hot reaction kinase buffer (see Recipes)
STOP-washing buffer (see Recipes)
Equipment
Radiation safety gears and personal protection (generic)
Pipette
Flow hood (generic: e.g., CLEATECH, catalog number: 1000-11-E )
Plant growth chamber (generic: e.g., BioChambers, model: FXC-9 )
Benchtop microcentrifuge (generic: e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM LegendTM Micro 17 , catalog number: 75002430)
SDS-PAGE system (Bio-Rad Laboratories, model: Mini-PROTEAN® Tetra Vertical Electrophoresis Cell )
Vacuum gel dryer (generic: e.g., Bio-Rad Laboratories, model: 583 Gel Dryers )
Phosphorimager screen and cassette (FUJIFILM)
Phosphorimager (FUJIFILM, model: FLA-5100 )
Autoclave (generic)
Mortar (100 mm diameter x 60 mm height; generic)
Spatula and forceps (generic)
Plastic incubation box (for Polyacrylamide gel incubation and washing; generic)
Stirring bars (50 mm long; generic)
Timer (generic)
Rotary shaker (generic)
Fridge (4 °C; generic)
Freezer (-20 °C and -80 °C; generic)
Magnetic stirrer (generic)
pH meter (generic: e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: Orion StarTM A111 )
Balance (generic: e.g., Sartorius, model: Cubis® Precision Balance )
Vortex (generic)
Spectrophotometer (generic: e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: EvolutionTM 300 )
Software
ImageJ (optional)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Pizzio, G. A. and Rodruiguez, P. L. (2017). In Gel Kinase Assay. Bio-protocol 7(5): e2170. DOI: 10.21769/BioProtoc.2170.
Gonzalez-Guzman, M., Pizzio, G. A., Antoni, R., Vera-Sirera, F., Merilo, E., Bassel, G. W., Fernandez, M. A., Holdsworth, M. J., Perez-Amador, M. A., Kollist, H. and Rodriguez, P. L. (2012). Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of stomatal aperture and transcriptional response to abscisic acid. Plant Cell 24(6): 2483-2496.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Activity
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,171 | https://bio-protocol.org/exchange/protocoldetail?id=2171&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pathogenicity Assay of Verticillium nonalfalfae on Hop Plants
Marko Flajšman*
Sebastjan Radišek*
Branka Javornik
*Contributed equally to this work
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2171 Views: 8871
Edited by: Zhaohui Liu
Reviewed by: Valeria LullaTimo Lehti
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Verticillium nonalfalfae is a soil-borne plant pathogen that infects its hosts through roots. It spreads in the plant’s xylem and causes wilt disease symptoms by secreting different virulence factors. Hop (Humulus lupulus) is a primary host of V. nonalfalfae, so it is used as a model plant for studying this phytopathogenic fungus. Artificial infections of hop plants and disease scoring are prerequisites for studying the pathogen’s virulence/pathogenicity and its interaction with hop plants. In this protocol, we describe the root dipping inoculation method for conducting pathogenicity assay of V. nonalfalfae on hop plants.
Keywords: Verticillium nonalfalfae Pathogenicity assay Hop Disease symptoms Plant-pathogen interactions
Background
Verticillium spp. infects more than 400 different host plants and every species has its own range of host. The primary host of V. nonalfalfae is hop. However, hop has several disadvantages for use as a test plant for pathogenicity assay; e.g., it is a perennial plant and needs to undergo a dormancy phase. Plants can therefore only be used for pathogenicity assay for a few months in the year, from late spring to late summer. Hop varieties are vegetatively propagated as softwood cuttings in a greenhouse or as dormant cuttings from rootstock. Seeds are obtained by crossing female and male plants and are used only for breeding purposes. The root dipping inoculation method has been widely used for pathogenicity assay of Verticillium spp. on other plant hosts, e.g., tomato (Fradin et al., 2009), N. benthamiana (Klosterman et al., 2011) and Arabidopsis thaliana (Ellendorff et al., 2009).
Materials and Reagents
Miracloth (EMD Millipore, catalog number: 475855-1R )
Petri dish (Golias, catalog number: PE01K )
Host plants (hop Humulus lupulus, susceptible cultivar ‘Celeia’)
Fungal conidia (Verticillium nonalfalfae; lethal pathotype PV1 [isolate T2]) (Radisek et al., 2006)
Fertilizer YaraKristalon yellow NPK 13-40-13 + ME [ME - trace elements: B - 0.025%; Cu * - 0.01%; Fe * - 0.07%; Mn * - 0.04%; Mo - 0.004%; Zn * - 0.025%; * - Chelate base] (Yara International ASA)
Fertilizer YaraKristalon special NPK 18-18-18 + ME [ME - trace elements: B - 0.025%; Cu * - 0.01%; Fe * - 0.07%; Mn * - 0.04%; Mo - 0.004%; Zn * - 0.025%; * - Chelate base] (Yara International ASA)
Growing medium
For fungus inoculum preparation: liquid GFM - general fungal medium (Kayser, 1992) (see Recipes)
For plants: soil substrate (soil substrate for growing plants)
For fungus re-isolation: potato dextrose agar + antibiotics (streptomycin sulphate, neomycin, chloramphenicol; each 100 mg/ml) = PDA + A plates (see Recipes)
Sterile distilled water (IDT, catalog number: 231-791-5 )
96% ethanol
Peptone (Sigma-Aldrich, catalog number: 73049-73-7 )
Yeast extract (AMRESCO, catalog number: J850 )
Glucose (Kemika, catalog number: 07051 )
Potassium nitrate (KNO3) (EMD Millipore, catalog number: 105063 )
Potato dextrose agar (Biolife, catalog number: 4019352 )
Streptomycin sulphate (Duchefa Biochemie, catalog number: S0148 )
Neomycin (Duchefa Biochemie, catalog number: M0135 )
Chloramphenicol (Sigma-Aldrich, catalog number: C0378 )
Equipment
500 ml Erlenmeyer flask (BRAND, catalog number: 92824 )
2 L plastic cup (BRAND, catalog number: 87822 )
Plastic pots 0.5 L
Rotary shaker (Infrost, catalog number: 29313 )
Growth chamber (Kambič Laboratory Equipment, model: RK-13300 )
Fluorescent grow lamp (Idealo, model: Osram Fluora L 58 W/77 )
Thoma counting chamber (BRAND, Wertheim, Germany)
Wooden sticks for hop’s bine support
Scalpel and tweezers
Light microscope (Nikon Instruments)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Flajšman, M., Radišek, S. and Javornik, B. (2017). Pathogenicity Assay of Verticillium nonalfalfae on Hop Plants. Bio-protocol 7(6): e2171. DOI: 10.21769/BioProtoc.2171.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > Fungus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,172 | https://bio-protocol.org/exchange/protocoldetail?id=2172&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Xylem Sap Extraction Method from Hop Plants
Marko Flajšman*
Stanislav Mandelc*
Sebastjan Radišek*
Branka Javornik
*Contributed equally to this work
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2172 Views: 11248
Edited by: Zhaohui Liu
Reviewed by: Joëlle SchlapferTimo Lehti
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Verticillium wilt is one of the most important diseases on hop that significantly influence continuation of production on affected areas. It is caused by the soil borne vascular pathogen Verticillium nonalfalfae, which infects plants through the roots and then advances through the vascular (xylem) system. During infection, V. nonalfalfae secretes many different virulence factors. Xylem sap of infected plants is therefore a rich source for investigating the molecules that are involved in molecular interactions of Verticillium – hop plants. This protocol provides instructions on how to infect hop plants with V. nonalfalfae artificially and how to obtain xylem sap from hop plants.
Keywords: Verticillium nonalfalfae Vascular pathogen Xylem sap Extraction method Molecular interactions
Background
Extraction of xylem sap from plants is mostly used for studies of xylem sap proteome and various methods have been used to extract sap from plant xylem tissues. Buhtz et al. (2004) used hand-held pipettes to collect xylem sap from cut plant stems for comparing xylem proteomes in different plants (broccoli, oilseed rape, pumpkin and cucumber). The same method was used for collecting xylem sap from Brassica napus (Kehr et al., 2005), Brassica oleracea (Ligat et al., 2011) and soybean (Subramanian et al., 2009). Alvarez et al. (2006) extracted the maize xylem sap proteome using ‘root pressure’, as described by Goodger et al. (2005). Dafoe and Constabel (2009) used a Tygon tube, which was fitted over the wood, to collect xylem sap from hybrid poplar and no additional pressure was applied. Information on the protein content of xylem sap is also available for apple, pear and peach (Biles and Abeles, 1991).
Because vascular plant fungal pathogens spread inside host plants through their xylem, this fluid is the most appropriate medium to search for in planta secreted virulence factors from the fungal pathogen. Rep et al. (2002) used a simple xylem sap extraction method by Satoh et al. (1992) whereby cut stems of Fusarium oxysporum f. sp. lycopersici-infected tomato were placed in a horizontal position and sap was dripped from the cut surface. A Scholander pressure chamber (Scholander et al., 1965) was used to obtain xylem sap from Verticillium longisporum-infected oilseed rape (Floerl et al., 2008).
It is hard to draw any conclusion as to which method works best for what kind of plant since no comparative studies have been performed on different methods on the same plant species. It appears that plant species with soft and juicy stems need no pressure added to obtain xylem sap and simple methods are efficient for xylem sap extraction. This may be related to the root pressure, which causes xylem sap to rise through a plant stem from the roots towards the leaves due to osmosis in the roots (Taiz and Zeiger, 2010). However, some species never generate any root pressure (Kramer and Boyer, 1995) so some external force (e.g., a pressure chamber) must be provided in order to extract xylem sap from such plants. So far, there is no specific extraction method available for collecting xylem sap from hop plant infected with Verticillium nonalfalfae. Hop plants have woody roots and exposure of roots to pressure causes no harm to root tissue and no contamination (e.g., with cytosol liquids, cell membranes and other parts). We therefore used a Scholander pressure chamber on hops. This is the first protocol for sampling xylem sap from hop plants.
Materials and Reagents
Miracloth (EMD Millipore, catalog number: 475855-1R )
Filter paper (LLG, catalog number: 9.045 840 )
Tape
Plastic bag
Sterile pipet tips
2 ml microtubes (BRAND, catalog number: 780550 )
Silicone tubing, plastic tubing, glass tubing, etc.
Petri dish (Golias, catalog number: PE01K )
Host plants (hop Humulus lupulus, susceptible cultivar ‘Celeia’ and resistant cultivar ‘Wye Target’)
Fungal conidia (Verticillium nonalfalfae; lethal pathotype PV1 [isolate T2]) (Radisek et al., 2006)
Fertilizer YaraKristalon yellow NPK 13-40-13 + ME [ME - trace elements: B - 0.025%; Cu * - 0.01%; Fe * - 0.07%; Mn * - 0.04%; Mo - 0.004%; Zn * - 0.025%; * - Chelate base] (Yara International ASA)
Fertilizer YaraKristalon special NPK 18-18-18 + ME [ME - trace elements: B - 0.025%; Cu * - 0.01%; Fe * - 0.07%; Mn * - 0.04%; Mo - 0.004%; Zn * - 0.025%; * - Chelate base] (Yara International ASA)
Growing medium:
For fungus inoculum preparation: liquid GFM – general fungal medium (Kayser, 1992) (see Recipes)
For plants: sterile soil substrate for growing plants
For fungus re-isolation: potato dextrose agar + antibiotics (streptomycin sulphate, neomycin, chloramphenicol; each 100 mg/ml) = PDA + A plates (see Recipes)
Streptomycin sulphate (Duchefa Biochemie, catalog number: S0148 )
Chloramphenicol (Sigma-Aldrich, catalog number: C0378 )
Sterile distilled water (IDT, catalog number: 231-791-5 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 )
96% ethanol
Peptone (Sigma-Aldrich, catalog number: 73049-73-7 )
Yeast extract (AMRESCO, catalog number: J850 )
Glucose (Kemika, catalog number: 07051 )
Potassium nitrate (KNO3) (EMD Millipore, catalog number: 105063 )
Potato dextrose agar (Biolife, catalog number: 4019352 )
Neomycin (Duchefa Biochemie, catalog number: M0135 )
Equipment
Plastic pots (1 L, 2 L)
500 ml Erlenmeyer flask (BRAND, catalog number: 92824 )
Rotary shaker (Infrost, catalog number: 29313 )
2 L plastic cup (BRAND, catalog number: 87822 )
Growth chamber (Kambič Laboratory Equipment, model: RK-13300 )
Fluorescent grow lamp (Idealo, model: Osram Fluora L 58 W/77 )
Thoma counting chamber (BRAND, Wertheim, Germany)
Wooden sticks for hop’s bine support
Scalpel and tweezers
Light microscope (Nikon Instruments)
Scholander pressure chamber (Soilmoisture Equipment, model: 3005 )
Polystyrene box with ice
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Flajšman, M., Mandelc, S., Radišek, S. and Javornik, B. (2017). Xylem Sap Extraction Method from Hop Plants. Bio-protocol 7(6): e2172. DOI: 10.21769/BioProtoc.2172.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant immunity > Host-microbe interactions
Microbiology > Microbe-host interactions > Fungus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,173 | https://bio-protocol.org/exchange/protocoldetail?id=2173&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Model of Reversible Intestinal Inflammation
CC Cheong KC Kwong Chung
JB Jennifer Brasseit
EA Esther Althaus-Steiner
SR Silvia Rihs
CM Christoph Mueller
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2173 Views: 10559
Edited by: Ivan Zanoni
Reviewed by: Alesssandro ArduiniMareta Ruseva
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Current therapies to treat inflammatory bowel disease by dampening excessive inflammatory immune responses have had limited success (Reinisch et al., 2011; Rutgeerts et al., 2005; Sandborn et al., 2012). To develop new therapeutic interventions, there is a need for better understanding of the mechanisms that are operative during mucosal healing (Pineton de Chambrun et al., 2010). To this end, a reversible model of colitis was developed in which colitis induced by adoptive transfer of naïve CD4+ CD45RBhi T cells in lymphopenic mice can be reversed through depletion of colitogenic CD4+ T cells (Brasseit et al., 2016).
Keywords: Colitis Remission Relapsing disease Mucosal healing
Background
Our understanding of the pathogenesis of inflammatory bowel disease (IBD), which is a chronic inflammatory disorder of the intestine, has been greatly improved with the development of animal models aiming to recapitulate human disease (Khanna et al., 2014). Despite the identification of a wide array of immunological targets, current therapies have had limited success in treating IBD and limited knowledge is available about the mechanisms that are induced in the establishment of long-term remission and the associated mucosal healing (D’Haens et al., 2014). A major limitation, so far, has been the lack of animal models in which remission can be reproducibly induced in animals with established disease. In models of infection induced intestinal inflammation, pro-inflammatory and anti-inflammatory mechanisms can be operative simultaneously, implying that dissecting the role of different immune pathways during resolution of inflammation may be a challenge (Endt et al., 2010; Sonnenberg et al., 2011). In dextran sodium sulfate (DSS) induced colitis, DSS can be easily administered in the drinking water to either induce acute or chronic intestinal inflammation and this is followed by treatment with normal drinking water to study resolution of colitis. However, the kinetics and severity of disease is highly dependent on numerous factors including differences in the dose of DSS used and critically on the amount of DSS consumed which is virtually impossible to normalize between different animals of the same cage (Chassaing et al., 2014; Perše and Cerar, 2012). Using the T cell transfer mediated colitis model, it was elegantly shown that intestinal inflammation can be reversed by the adoptive transfer of CD45RBlo regulatory T cells (Treg) in colitic animals, resulting in remission induction within 10-14 weeks post Treg transfer (Mottet et al., 2003). The kinetics of remission induction however varies depending on the expansion of transferred Treg and it can be difficult to synchronize the onset of remission between animals of same experimental group. To overcome the unpredictable timing and extent of remission induction, we developed a new mouse model of reversible intestinal inflammation in which intestinal inflammation (induced by the adoptive transfer of naïve CD45RBhi T cells in lymphopenic animals) can be reversed by depletion of colitogenic CD4+ T cells in mice with established disease, resulting in reproducible induction of remission from colitis (Brasseit et al., 2016).
Materials and Reagents
50 ml tube (SARSTEDT, catalog number: 62.547.254 )
5 ml Falcon polystyrene (PS) round bottom tube (Corning, Falcon®, catalog number: 352058 )
100 µm nylon cell strainer (Corning, catalog number: 431752 )
Glass slide Superfrost (Biosystems, catalog number: 85-0551-00 )
6-10 week old congenic CD90.1 or CD45.1 mice as donors (in-house bred mice on C57BL/6 background, initially purchased from THE JACKSON LABORATORY, USA)
Notes:
Congenic mice CD90.1 are used as donors to easily distinguish between donor (CD90.1) and recipient cells (CD90.2) but C57BL/6 mice can also be used as donors.
It is possible to use donor mice older than 10 weeks old but the frequency of naïve CD4+ CD45RBhi T cells is expected to decrease with age.
10-16 week old Helicobacter positive C57BL/6 Rag2-/- or Rag1-/- mice (initially purchased from THE JACKSON LABORATORY, USA) housed under specific pathogen-free (SPF) conditions as recipients with a minimum of 20 g body weight
Notes:
Helicobacter negative SPF Rag2-/- (or Rag1-/-) mice may also be used as recipients. However, the kinetics of colitis induction are delayed and the variation in disease activity may greatly vary at a given time post CD4 T cell-mediated colitis induction in those Helicobacter negative mice.
Positivity for the presence of Helicobacter can be assessed by PCR using genomic DNA extracted from fecal pellets as previously described by Brasseit et al., 2016.
We have not observed any differences in the kinetics of colitis induction between male and female recipients.
0.5 M EDTA (Sigma-Aldrich, catalog number: 27285 ), in sodium form
EasySepTM Mouse Streptavidin RapidSpheresTM Isolation Kit (STEMCELL Technologies, catalog number: 19860 )
InVivoMAb anti-mouse CD4 (Clone GK1.5) (BioxCell, catalog number: BE0003-1 )
Anti-mouse antibodies
Antibodies
Company
Catalog number
Clone
Dilution
B220 Biotin
BioLegend
103203
RA3-6B2
1:800
CDαBiotin
BioLegend
100703
53-6.7
1:200
CD45RB FITC
Affymetrix
11-0455-85
C363-16A
1:800
CD25 PE
BioLegend
102008
PC61
1:800
CD4 APC-Cy7
BioLegend
100526
RM4-5
1:800
Horse serum (HS) (Sigma-Aldrich, catalog number: H1270 )
Trypan blue solution (Sigma-Aldrich, catalog number: T8154 )
4% buffered formalin (EMD Millipore, catalog number: 100496 )
Ethanol (EMD Millipore, catalog number: 100983 )
Xylene (VWR, catalog number: 28975 )
Paraffin (Engelbrecht, catalog number: 17932 )
Mayer’s hemalum (Hematoxylin) solution (EMD Millipore, catalog number: 109249 )
Xylene based mounting medium Eukitt® (Sigma-Aldrich, catalog number: 03989 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: 106406 )
di-Sodium hydrogen phosphate dehydrate (Na2HPO4·2H2O) (EMD Millipore, catalog number: 106580 )
di-Potassium hydrogen phosphate trihydrate (K2HPO4·3H2O) (EMD Millipore, catalog number: 105099 )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: 31107 )
Potassium hydrogen carbonate (KHCO3) (EMD Millipore, catalog number: 104854 )
Eosin-Phloxine solution (VWR, catalog numbers: 341973R and 10047229 , respectively)
Glacial acetic acid (EMD Millipore, catalog number: 100063 )
Hydrochloric acid (EMD Millipore, catalog number: 100317 )
Phosphate-buffered saline (PBS) (see Recipes)
ACK red blood lysis buffer (see Recipes)
Eosin-Phloxine solution (see Recipes)
0.5% HCl-ethanol (see Recipes)
Equipment
Centrifuge
Neubauer chamber (Hemocytometer)
EasySepTM magnet (STEMCELL Technologies, catalog number: 18000 )
BD FACS ARIA III (BD, model: BD FACS ARIA III )
Tissue-Tek VIP 6 tissue processor (SAKURA, model: Tissue-Tek VIP 6 Vaccum Infiltration Processor )
Tissue-Tek®uni-cassette® (SAKURA, catalog number: 4172 )
Heating block
Dissection kit (forceps and scissors)
Cold plate (-10 °C)
Microtome (Leica Biosystems, Wetzlar, Germany)
Water bath
Pipette
CO2 chamber
Note: CO2 is used as an approved and recommended euthanasia method in accordance with the Swiss Federal and Cantonal animal experimental regulations.
Software
Graphpad Prism 6 (La Jolla, CA; https://www.graphpad.com/scientific-software/prism/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kwong Chung, C. K., Brasseit, J., Althaus-Steiner, E., Rihs, S. and Mueller, C. (2017). Mouse Model of Reversible Intestinal Inflammation. Bio-protocol 7(6): e2173. DOI: 10.21769/BioProtoc.2173.
Download Citation in RIS Format
Category
Immunology > Mucosal immunology > Digestive tract
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,174 | https://bio-protocol.org/exchange/protocoldetail?id=2174&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Caenorhabditis elegans Sleep during the Transition to Adulthood Using a Microfluidics-based System
HH Huiyan Huang
KS Komudi Singh
AH Anne C. Hart
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2174 Views: 8523
Edited by: Jyotiska Chaudhuri
Reviewed by: Prashanth Suravajhala
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
C. elegans sleep during development is regulated by genes and cellular mechanisms that are conserved across the animal kingdom (Singh et al., 2014; Trojanowski and Raizen, 2016). C. elegans developmental sleep is usually assessed during the transition to adulthood, a 2.6 h time interval called lethargus (Raizen et al., 2008; Singh et al., 2011). During lethargus, animals cycle between periods of immobility (sleep bouts) and periods of active locomotion (motion bouts). Sleep bouts resemble sleep in other species based on behavioral criteria, including cessation of feeding and locomotion, increased arousal threshold for response to sensory stimulation, rapid reversibility, and homeostatic response to sleep loss. Several assays have been developed to study sleep in C. elegans (Belfer et al., 2013; Bringmann, 2011; Nelson et al., 2013; Raizen et al., 2008). Here, we contribute a detailed protocol for assessment of C. elegans sleep during lethargus, which has been used successfully by many research groups, incorporating simple microfluidic chambers, a low cost camera with lighting system, and computational analysis based on image subtraction. We note that this system could be easily adapted to assess sleep in any small animal.
Keywords: C. elegans sleep Lethargus Microfluidic chambers Image subtraction Total sleep Lethargus duration Average bout duration Quiescence
Background
C. elegans sleep is often assessed based on the cessation of locomotion, which is a common characteristic of sleep across the animal kingdom. Due to the intermittent nature of sleep bouts during C. elegans developmental sleep, computer vision is generally used to track the activity of C. elegans during lethargus. Animals are constrained to a single focal plane to keep them in focus. Because C. elegans can be exhausted in liquid by prolonged swimming (Ghosh and Emmons, 2008), C. elegans sleep researchers rely almost exclusively on assay formats that enforce crawling, not swimming. Also, because food may dramatically alter behavior, C. elegans sleep studies are usually undertaken in the presence of bacterial food. There are two major assay formats: animals confined to larger spaces and tracked across multiple developmental stages (Belfer et al., 2013; Nelson et al., 2013; Raizen et al., 2008) or animals confined to small spaces and tracked for shorter time intervals (Bringmann, 2011; Singh et al., 2011). The original report of C. elegans sleep utilized the first assay format, which permitted detection of sleep during each larval lethargus as animals crawled on the surface of a culture dish. This required one camera per animal, which limited throughput (Raizen et al., 2008). More recent work generally uses small chambers arranged in tight groupings, which allows simultaneous tracking of multiple animals with one camera. Various small-chamber formats are available. An automated polydimethylsiloxane (PDMS) chamber system is available with 60 chambers, but this format requires high levels of consistency in chamber loading with media and seeding bacteria, which is best achieved with robotic systems (Nelson et al., 2013). As these systems are not widely available to academic labs, most groups use other assay formats. Very small chambers constructed from agarose hydrogels have also been used to constrain locomotion of L1 larvae and it is possible that these could be reformatted for use with older C. elegans larval stages (Bringmann, 2011). But, agarose hydrogels are not easily reusable and most C. elegans sleep research focuses on the last lethargus, during the transition to adulthood. Here, we describe in detail a tractable PDMS-based, small chamber assay system, which allows simultaneous tracking of up to 10 L4 to adult animals. This is a variation of an earlier 6-chamber format assay (Singh et al., 2011). The assay is based on reusable PDMS chips and requires a minimal space to track animals in the last larval lethargus. The small chamber assay format described here requires reagents and equipment that are readily available in most C. elegans laboratories and has been adapted by several groups beyond our own.
Materials and Reagents
1.5 ml Eppendorf tube
Glass slides (Fisher Scientific, catalog number: 12-550-343 )
Tape (e.g., FisherbrandTM 0.75 in. colored label tapes, Fisher Scientific, catalog number: 15-901-20A for white tapes)
100 mm Petri dishes (e.g., Sigma-Aldrich, catalog number: P5856 )
Cover slip, 25 x 25 mm, glass (VWR, catalog number: 48368084 )
15 ml Falcon tubes (Corning, catalog number: 352095 )
Parafilm (Bemis, catalog number: PM999 )
FisherbrandTM Pasteur pipette (Fisher Scientific, catalog number: 22-183624 ) with dropper bulb
Double sided tape (e.g., Scotch permanent double sided tape, Staples, catalog number: 504829 )
C. elegans strains: standard wild type laboratory strain, N2. Additional strains are also available at the Caenorhabditis Genetics Center (CGC, http://cbs.umn.edu/cgc)
Escherichia coli OP50 strain (available at the CGC)
Antibiotics-treated OP50 (made from E. coli, preparation procedure provided below)
Sylgard® 184 silicone elastomer kit (Dow Corning, catalog number: BCBI10824 )
Ethanol
LB agar (BD, catalog number: 240110 )
Kanamycin (Sigma-Aldrich, catalog number: K1876 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: BP358-212 )
BactoTM peptone (BD, BactoTM, catalog number: 211677 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Fisher Scientific, catalog number: BP213-1 )
Calcium chloride dihydrate (CaCl2·2H2O) (Fisher Scientific, catalog number: BP510-250 )
Cholesterol (Sigma-Aldrich, catalog number: C8667 )
Potassium phosphate buffer (pH 6)
BactoTM agar (BD, BactoTM, catalog number: 214010 )
Liquid nematode growth media (NGM) for re-suspending antibiotic-treated OP50 (see Recipes)
2% agar for sealing chambers (see Recipes)
Equipment
Microfluidic chamber chip (design and instructions provided)
Template mask/mold: http://www1.simtech.a-star.edu.sg/smf, http://www.flowjem.com
Oven
Spectrometer (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 Spectrophotometers , catalog number: ND-2000C)
Heating block (e.g., Benchmark two-block digital dry bath, Benchmark, catalog number: BSH1002 )
Centrifuge for 50 ml conical tubes (e.g., Eppendorf, model: 5810 R )
Tabletop centrifuge for 1.5 ml Eppendorf tubes (e.g., Eppendorf, model: 5424 )
Shaker (e.g., Eppendorf, New BrunswickTM, model: Innova® 44 , catalog number: M1282-0000)
Dissection scope (e.g., Zeiss, model: SteREO Discovery.V8 ) or other light source
Camera with time-lapse imaging software or custom script (at least 2MP, e.g., Zeiss AxioCam ICc3 [Zeiss, model: AxioCam ICc3 ] with ZEN software or less expensive cameras with custom imaging acquisition software you write or obtain)
Computer for image acquisition and analysis
Software
MATLAB (MathWorks, Inc.)
Open source software: Python 2.7.3 or up (but not Python 3), Numpy 1.6.2 or up, Scipy-0.10.1 or up, and Matplotlib-1.1.1 or up
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Huang, H., Singh, K. and Hart, A. C. (2017). Measuring Caenorhabditis elegans Sleep during the Transition to Adulthood Using a Microfluidics-based System. Bio-protocol 7(6): e2174. DOI: 10.21769/BioProtoc.2174.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling > Sleep
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,175 | https://bio-protocol.org/exchange/protocoldetail?id=2175&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Differential Salt Fractionation of Nuclei to Analyze Chromatin-associated Proteins from Cultured Mammalian Cells
CH Christin Herrmann
DA Daphne C. Avgousti
MW Matthew D. Weitzman
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2175 Views: 15327
Edited by: Andrea Puhar
Reviewed by: Tatsuki KunohDavid A. Cisneros
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Nucleosomes are the core units of cellular chromatin and are comprised of 147 base pairs (bp) of DNA wrapped around an octamer of histone proteins. Proteins such as chromatin remodelers, transcription factors, and DNA repair proteins interact dynamically with chromatin to regulate access to DNA, control gene transcription, and maintain genome integrity. The extent of association with chromatin changes rapidly in response to stresses, such as immune activation, oxidative stress, or viral infection, resulting in downstream effects on chromatin conformation and transcription of target genes. To elucidate changes in the composition of proteins associated with chromatin under different conditions, we adapted existing protocols to isolate nuclei and fractionate cellular chromatin using a gradient of salt concentrations. The presence of specific proteins in different salt fractions can be assessed by Western blotting or mass spectrometry, providing insight into the degree to which they are associated with chromatin.
Keywords: Chromatin Fractionation Salt gradient Virus Chromatin association Micrococcal nuclease
Background
Many chromatin-associated proteins are insoluble under low salt conditions because of their charged-based interaction with DNA or histones. Since salt disrupts charged-based protein-DNA and protein-protein interactions, chromatin-associated proteins become more soluble with increasing concentration of NaCl (Teves and Henikoff, 2012). Proteins strongly bound to DNA are expected to elute with high salt whereas loosely bound proteins, such as transcription factors, will elute with low salt. We are specifically interested in how virus infection alters the composition of factors associated with the cellular chromatin. Nuclear replicating viruses, such as adenovirus, herpes simplex virus, and Epstein-Barr virus, dramatically alter the appearance of the host chromatin during infection (Avgousti et al., 2016; Lam et al., 2010; Simpson-Holley et al., 2005; Chiu et al., 2013). We hypothesized that these changes in appearance are partly due to differences in protein composition of host chromatin. Changes in host chromatin could reflect antiviral defenses mounted by the cell or active manipulation by the virus. To compare association of proteins with chromatin in uninfected and infected cells we developed this protocol to fractionate nuclei using a salt gradient (Figure 1). In this protocol we isolate nuclei, digest the DNA down to mono-nucleosome length, and then wash the nuclei with increasing concentrations of salt, collecting each fraction for analysis by Western blotting. We recently used this protocol to elucidate changes to cellular chromatin during infection with adenovirus (Avgousti et al., 2016). We now present this protocol as a general approach to monitor association of proteins with chromatin under a wide range of perturbing conditions.
Figure 1. Schematic of nuclear fractionation and example Western blot. A. Roughly 4 x 107 cells are prepared per condition. B. Plasma membranes are permeabilized and nuclei are isolated either by sucrose cushion (step B1) or using a Dounce homogenizer (step B2). C. DNA is digested to mono-nucleosome length using MNase. Proteins loosely bound to chromatin elute during this step. D. The chromatin is further fractionated by washing the nuclei in buffers with increasing salt concentration. E. The DNA is isolated from nuclei to confirm digestion of the cellular genome to 150 bp fragments. F. The quality of fractionation is tested using SDS-PAGE and Western blot (WB) for control proteins (e.g., tubulin, histone H3). The grey colored supernatants (and the pellet in case of the nuclei) represent the samples used for Western blot analysis. G. Example Western blot analysis of chromatin fractionation. Tubulin is found only in the cytoplasmic fraction and is a suitable control to test the quality of nuclear isolation. Histone H3 is a component of cellular chromatin and only elutes from nuclei in buffers with high salt. HMGB1 is a highly mobile nuclear protein (Sapojnikova et al., 2005) and thus elutes during MNase digest and under lower salt conditions. Brd1 directly binds to histone tails (Sanchez et al., 2014) and elutes under high salt conditions.
Materials and Reagents
Note: Comparable reagents from different suppliers may be used for the protocol.
150 mm tissue culture dishes (Corning, Falcon®, catalog number: 353025 )
15 ml centrifuge tube (Corning, catalog number: 430790 )
5 ml pipettes (VWR, catalog number: 89130-908 )
Transfer pipette (Denville Scientific, catalog number: P7222 )
30 ml glass tube (Corning, Corex®, catalog number: 1-8445-30 )
Note: This product has been discontinued.
1.7 ml microcentrifuge tubes (VWR, catalog number: 87003-294 )
Pipette tips
0.1-10 µl (Corning, catalog number: 4153 )
1-200 µl (Corning, catalog number: 4126 )
100-1,000 µl (Corning, catalog number: 4129 )
250 ml sterile disposable filter units with 0.2 µm PES membrane (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 568-0020 ) (used for Buffer I and Buffer II)
60 ml syringe (BD, catalog number: 309653 ) (used for Buffer IV.80, IV.150, IV.300 and IV.600)
25 mm syringe filter (Pall, catalog number: 4612 ) (used for Buffer IV.80, IV.150, IV.300 and IV.600)
A549 cells (ATCC, catalog number: CCL-185 )
Ham’s F-12K cell culture media (Thermo Fisher Scientific, GibcoTM, catalog number: 21127-022 )
Fetal bovine serum (FBS) (VWR, catalog number: 89510-182 )
Penicillin-streptomycin (Pen/Strep) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
Trypsin-EDTA (0.25%) (Thermo Fisher Scientific, GibcoTM, catalog number: 25200-056 )
Phosphate buffered saline (PBS) (Mediatech, catalog number: 21-030-CM )
Liquid nitrogen
NP-40/IGEPAL® CA-630 (Sigma-Aldrich, catalog number: I8896 ) (10% stock solution in H2O)
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 ) (0.1 M stock solution in isopropanol)
1,4-dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 10197777001 ) (1 M stock solution in HEPES buffer, pH 7.75)
Protease inhibitor cocktail (Roche Diagnostics, catalog number: 11697498001 ) (prepared as 50x stock solution in H2O according to manufacturer instructions)
Micrococcal nuclease (MNase) (Sigma-Aldrich, catalog number: N3755 ) (0.2 U/µl stock solution in H2O)
Ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E3889 ) (0.1 mM stock solution in H2O, pH = 10)
PCR purification kit (QIAGEN, catalog number: 28104 )
Orange G (Sigma-Aldrich, catalog number: O3756 ) (0.35% [w/v] orange G with 30% [w/v] sucrose in H2O for 6x stock solution)
100 bp DNA ladder (New England Biolabs, catalog number: N3231 )
Broad range protein ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 26623 )
GelRed nucleic acid gel stain (Biotum, catalog number: 41003 )
LDS sample buffer (4x) (Thermo Fisher Scientific, NovexTM, catalog number: NP0007 )
Sucrose (Fisher Scientific, catalog number: BP220-1 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 ) (1 M stock solution in H2O)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9625 ) (5 M stock solution in H2O)
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670 ) (1 M stock solution in H2O)
Trizma base (Sigma-Aldrich, catalog number: T1503 ) (1 M stock solution in H2O adjusted to pH 7.4 with HCl)
UltraPure agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500500 )
Hydrochloric acid 6.0 N solution (HCl) (Fisher Scientific, catalog number: MK-H168-4 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 ) (0.5 M stock solution in H2O)
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
HEPES (Sigma-Aldrich, catalog number: H3375 ) (1 M stock solution in H2O adjusted to pH 7.9 with NaOH)
Sodium hydroxide (NaOH) (AMRESCO, catalog number: M137 )
Buffer I.A and I.B (see Recipes)
Buffer II (see Recipes)
Buffer III.A and III.B (see Recipes)
Buffer IV.80, IV.150, IV.300 and IV.600 (see Recipes)
Hypotonic buffer (see Recipes)
Equipment
Note: Equipment with similar properties may be used for the protocol, however, we recommend using a specific kind of reusable centrifuge tubes (listed in 5) to ensure high quality isolation of nuclei.
CO2 incubator for cell culture (BINDER, catalog number: 9040-0082 )
Benchtop centrifuge (Beckman Coulter, model: Allegra X-14R )
Rotors for benchtop centrifuge (Beckman Coulter, models: SX4750 for tissue culture and FX6100 for 10,000 x g spins, or seminal rotors suitable for high speeds)
Adapters for FX6100 rotor (Beckman Coulter, catalog number: 392830 )
30 ml reusable centrifuge tubes (Sigma-Aldrich, catalog number: T2793 )
Tabletop centrifuge 5424 R (Eppendorf, model: 5424 R )
1 ml tissue grinder (Dounce homogenizer) with tight fitting pestle (Ace Glass Incorporated, catalog number: 8343-01 )
Water bath (Fisher Scientific, model: IsotempTM Digital-Control Water Baths Model 215 , catalog number: 15-462-15Q)
Tube rotator (VWR, catalog number: 10136-084 )
Pipettes
1-10 µl (Gilson, catalog number: F144055P )
2-20 µl (Gilson, catalog number: F144056M )
20-200 µl (Gilson, catalog number: F144058M )
100-1,000 µl (Gilson, catalog number: F144059M )
Agarose gel electrophoresis systems (Thermo Fisher Scientific, Thermo ScientificTM, model: Owl EasyCast B1A system )
Fluorescence and chemiluminescence gel imaging system (Syngene, model: G: BOX Chemi XT4 )
Heat block (Fisher Scientific, model: IsotempTM Digital Dry Baths/Block Heaters , catalog number: 88-860-022)
Protein electrophoresis apparatus (Bio-Rad Laboratories, model: Mini-PROTEAN® Tetra Vertical Electrophoresis Cell for Mini Precast Gels , catalog number: 1658005)
Western blot apparatus (Thermo Fisher Scientific, model: SureLockTM Mini-Cell Electrophoresis System )
Software
ImageJ (freely available from National Institutes of Health, https://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Herrmann, C., Avgousti, D. C. and Weitzman, M. D. (2017). Differential Salt Fractionation of Nuclei to Analyze Chromatin-associated Proteins from Cultured Mammalian Cells. Bio-protocol 7(6): e2175. DOI: 10.21769/BioProtoc.2175.
Download Citation in RIS Format
Category
Immunology > Host defense > General
Cancer Biology > Cancer biochemistry > Protein
Cell Biology > Organelle isolation > Nuclei
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,176 | https://bio-protocol.org/exchange/protocoldetail?id=2176&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Ribosomal Particles from the Unicellular Cyanobacterium Synechocystis sp. PCC 6803
CG Carla V. Galmozzi
M M. Isabel Muro-Pastor
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2176 Views: 7951
Edited by: Dennis Nürnberg
Reviewed by: Aksiniya AsenovaManuel Miras Marin
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Isolation of ribosomal particles is an essential step in the study of ribosomal components as well as in the analysis of trans-acting factors that interact with the ribosome to regulate protein synthesis and modulate the expression profile of the cell in response to different environmental conditions. In this protocol, we describe a procedure for the isolation of 70S ribosomes from the unicellular cyanobacterium Synechocystis sp. PCC 6803 (hereafter Synechocystis). We have successfully used this protocol in our study of the cyanobacterial ribosomal-associated protein LrtA, which is a homologue of bacterial HPF (hibernation promoting factor) (Galmozzi et al., 2016).
Keywords: Ribosome Sucrose gradients Synechocystis Cyanobacteria Photosynthetic prokaryotes
Background
Few biochemical studies have been reported for cyanobacterial ribosomes. Anabaena variabilis strain M3 (PCC 7118, ATCC 27892) 70S ribosomal particles have been isolated by differential centrifugation and then, ribosomal proteins were analysed by two-dimensional electrophoresis (Sato et al., 1998). Ribosomes have also been prepared from Synechococcus sp. PCC 6301 cells using a protocol combining differential centrifugation and sucrose step gradients (Sugita et al., 2000). Fractionation of cell extracts by differential centrifugation has also been employed in the preparation of ribosomal samples for the development of an in vitro translation system in different Synechococcus strains (Mutsuda and Sugiura, 2006). The method described here for Synechocystis, based on the one described for Synechococcus (Sugita et al., 2000), allows purification of ribosomal particles using ultracentrifugation of linear sucrose gradients.
Materials and Reagents
Centrifuge tubes, polypropylene 15 ml (Beckman Coulter, catalog number: 342082 )
1.5 ml microcentrifuge tubes (Microtubes) (Corning, Axygen®, catalog number: MCT-150-C )
1.5 ml polystyrene spectrophotometer cuvettes (KARTELL SPA CIA DELLE INDUSTRIE, catalog number: 1938 )
Ultracentrifuge thin-wall polyallomer tubes 13.2 ml (Beckman Coulter, catalog number: 331372 )
0.45 μm Millipore filter (MILLEX-HV PVDF) (EMD Millipore, catalog number: SLHV033RS )
Alumina type A-5 (Sigma-Aldrich, catalog number: A2039 )
Note: This product has been discontinued.
Micropipette tips (200 μl) (Daslab, catalog number: 162001X )
Micropipette tips (1,000 μl) (Daslab, catalog number: 162222X )
Silicone tubing (VWR, catalog number: 228-0713 )
Synechocystis sp. PCC 6803 cells (Pasteur Culture Collection of Cyanobacteria)
Milli-Q water
Distilled water
Sodium nitrate (NaNO3) (AppliChem, catalog number: 141702 )
Sodium bicarbonate (NaHCO3) (AppliChem, catalog number: 141638 )
Potassium phosphate dibasic (K2HPO4) (AppliChem, catalog number: 141512 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Duchefa Biochemie, catalog number: M0513 )
Citric acid monohydrate (C6H8O7·H2O) (EMD Millipore, catalog number: 100244 )
EDTA-Na2 (Duchefa Biochemie, catalog number: E0511 )
Calcium chloride dihydrate (CaCl2·2H2O) (Merck, catalog number: 2382 )
Citrate Fe-NH4 (Sigma-Aldrich, catalog number: F5879 )
Sodium phosphate (Na2CO3) (Merck, catalog number: 6392 )
Boric acid (H3BO3) (EMD Millipore, catalog number: 100165 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (EMD Millipore, catalog number: 1059270 )
Sodium molybdate dehydrate (Na2MoO4·2H2O) (Merck, catalog number: 6521 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Merck, catalog number: 8883 )
Cobalt nitrate hexahydrate (Co(NO3)2·6H2O) (AppliChem, catalog number: 131258 )
Copper (II) sulfate pentahydrate (CuSO4·5H2O) (EMD Millipore, catalog number: 102790 )
Tris ultrapure (Duchefa Biochemie, catalog number: T1501 )
Ammonium chloride (NH4Cl) (EMD Millipore, catalog number: 101145 )
Magnesium acetate (Sigma-Aldrich, catalog number: M5661 )
β-mercaptoethanol (EMD Millipore, catalog number: 805740 )
Glycerol (AppliChem, catalog number: 131339 )
Liquid nitrogen
Trichloracetic acid (TCA) (EMD Millipore, catalog number: 100807 ) (only for Western)
Acetone (EMD Millipore, catalog number: 100014 ) (only for Western)
Ammonium chloride (EMD Millipore, catalog number: 101145 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Hydrochloric acid fuming 47% (EMD Millipore, catalog number: 100317 )
Methanol extra pure (Scharlau, catalog number: ME0301005P )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A4503 )
Protein assay dye reagent concentrate (Bio-Rad Laboratories, catalog number: 5000006 )
BG11 growth medium (see Recipes)
Extraction buffer (see Recipes)
Sucrose buffer 1 (see Recipes)
Sucrose buffer 2 (see Recipes)
60% (w/v) sucrose (see Recipes)
100% (w/v) TCA solution (see Recipes)
80% (v/v) glycerol (see Recipes)
Equipment
Fluorescent lamps
Erlenmeyer flask 250 ml (Duran Group, catalog number: 21 771 36 )
Flasks and magnetic stirrer for preparation of solutions
Orbital shaker (IKA, model: KS501 )
Roux culture bottle 1 L (Sigma-Aldrich, catalog number: CLS12901L )
Glass bottles 5 L (Iso bottle blue cap 5,000 ml) (Kavalierglass, Simax, catalog number: CFB020 )
Balances (Sartorius, catalog number: TE1502S and Precisa, model: XT120A )
pH meter (HACH LANGE SPAIN, CRISON, model: BASIC 20 )
Flow meters (ABB, model: A6200 )
Compressed air pump
Centrifuge (Beckman Coulter, model: Avanti J-25 )
Rigid polypropylene tube (Fisher Scientific, catalog number: 11723904 )
Fixed angle rotor (Beckman Coulter, model: JLA-16.250 , catalog number: 363934)
Centrifuge bottles polypropylene 250 ml (Beckman Coulter, catalog number: 356011 )
Porcelain mortar and pestle (10 cm Ø) (Fisher Scientific, catalog number: S337621 )
Sterilization oven (JP SELECTA, catalog number: 2000381 )
Autoclave (SANYO Labo Autoclave) (Panasonic Biomedical, model: MLS-3020U )
Automatic micropipettes
Vortex Mixer (Heidolph Instruments, model: Heidolph Reax 2000 )
UV-VIS spectrophotometer (Thermo Electron, model: BioMate 5 )
Fixed angle rotor (Beckman Coulter, model: JA-25.15 )
Gradient maker (Hoefer, catalog number: SG15 )
Peristaltic pump (Pharmacia Biotech, model: Pump P-1 )
Magnetic plate stirrer (Cole-Parmer, catalog number: EW-04807-45 )
Ultracentrifuge (Beckman Coulter, model: XL-80 )
Swinging-bucket rotor (Beckman Coulter, model: SW 41 Ti )
ISCO UA-6 detector UV/VIS (Density Gradient Fractionator, Teledyne Isco, catalog number: 67-9000-176 ) with TRISTM pump (Teledyne Isco)
Microcentrifuge (Eppendorf, model: 5424/5415 R )
Thermoblock (Eppendorf Thermomixer compact) (only for Western)
Metal connectors (Parker-Legris, catalog number: 0180 04 00 )
CO2 cylinder containers
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Galmozzi, C. V. and Muro-Pastor, M. I. (2017). Isolation of Ribosomal Particles from the Unicellular Cyanobacterium Synechocystis sp. PCC 6803. Bio-protocol 7(6): e2176. DOI: 10.21769/BioProtoc.2176.
Galmozzi, C. V., Florencio, F. J. and Muro-Pastor, M. I. (2016). The cyanobacterial ribosomal-associated protein LrtA is involved in post-stress survival in Synechocystis sp. PCC 6803. PLoS One 11(7): e0159346.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial biochemistry > RNA
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,177 | https://bio-protocol.org/exchange/protocoldetail?id=2177&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of the Predatory Capability of Bdellovibrio bacteriovorus HD100
CH Cristina Herencias
MP M. Auxiliadora Prieto
VM Virginia Martínez
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2177 Views: 10574
Edited by: Dennis Nürnberg
Reviewed by: Amit Dey
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Bdellovibrio bacteriovorus HD100 is an obligate predator that preys upon a wide variety of Gram negative bacteria. The biphasic growth cycle of Bdellovibrio includes a free-swimming attack phase and an intraperiplasmic growth phase, where the predator replicates its DNA and grows using the prey as a source of nutrients, finally dividing into individual cells (Sockett, 2009). Due to its obligatory predatory lifestyle, manipulation of Bdellovibrio requires two-member culturing techniques using selected prey microorganisms (Lambert et al., 2003). In this protocol, we describe a detailed workflow to grow and quantify B. bacteriovorus HD100 and its predatory ability, to easily carry out these laborious and time-consuming techniques.
Keywords: Bdellovibrio bacteriovorus Predatory bacteria Predatory quantification
Background
In the last years, Bdellovibrio has attracted the interest of the scientific community and several applications have been developed, such as evolution studies (Davidov and Jurkevitch, 2009), identification of new biocatalysts (Martínez et al., 2012), therapeutic applications (Atterbury et al., 2011), or biotechnological applications using Bdellovibrio as a lytic agent for the recovery of value added intracellular bioproducts (Martínez et al., 2016). Due to the growing interest in Bdellovibrio, different indirect methods to quantify this predatory bacterium have been developed (Mahmoud et al., 2007; Lambert and Sockett, 2008; Van Essche et al., 2009). However, direct quantification of Bdellovibrio via double-layer method is still necessary to thoroughly characterize Bdellovibrio predatory capability. Here, we describe a well-established, reliable, and broadly used method that allows Bdellovibrio cell number quantification in predatory co-cultures.
Materials and Reagents
0.45 µm sterilization filter (Sartorius, catalog number: 16555-K )
0.22 µm sterilization filter (Sartorius, catalog number: 16532-K )
10-ml glass test tubes (Fisher Scientific, catalog number: 15175134 )
Glass microscope slides (76 x 26 mm) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 10143562BEF ) (see Note 1)
Glass microscope coverslips (22 x 22 mm) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3306 )
10 ml syringe (BD, catalog number: 307736 )
Bdellovibrio bacteriovorus HD100 (ATCC, catalog number: 15356 ) (Stolp and Starr, 1963)
Pseudomonas putida KT2440 (ATCC, catalog number: 47054 ) (Nelson et al., 2002)
Glycerol (EMD Millipore, catalog number: 104094 )
Bacto tryptone (BD, BactoTM, catalog number: 211705 )
Yeast extract (Conda, catalog number: 1702 )
Sodium chlorice (NaCl) (EMD Millipore, catalog number: 106404 )
Sodium hydroxide (NaOH) pellets for analysis (EMD Millipore, catalog number: 106498 )
Agar (BD, BactoTM, catalog number: 214010 )
Nutrient broth (NB) (BD, DifcoTM, catalog number: 234000 )
Calcium chloride dihydrate (CaCl2·2H2O) (EMD Millipore, catalog number: 102382 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (EMD Millipore, catalog number: 105833 )
HEPES buffer (Sigma-Aldrich, catalog number: H3375 )
Lysogeny broth (LB) medium (1 L, pH 7.5) (see Recipes)
LB, 1.5% (w/v) agar (see Recipes)
NB medium (1 L) (see Recipes)
CaCl2 and MgCl2 salts (see Recipes)
Diluted nutrient broth (DNB) medium (1 L, pH 7.4) (see Recipes)
DNB, 0.7% (w/v) agar (see Recipes)
DNB, 1.5% (w/v) agar (see Recipes)
HEPES buffer (see Recipes)
Equipment
Centrifuge (Eppendorf, model: 5810 R )
100 ml flasks
30 °C chamber (JP Select, catalog number: 001257 )
30 °C shaking incubator (250 rpm) (Eppendorf, New BrunswickTM, model: Innova® 44 )
Water bath (JP Select, catalog number: 6000138 )
Phase contrast microscopy (Nikon Instruments, model: OPTIFHOT-2 ) (Note 1)
Spectrophotometer (Shimadzu, model: UV-260 )
Leica DFC345 FX camera (Leica Microsystems, model: DFC345 FX )
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial cell biology > Cell viability
Cell Biology > Cell viability > Predation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,178 | https://bio-protocol.org/exchange/protocoldetail?id=2178&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of RNA-induced PKR Activation in vitro
Kobe C. Yuen
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2178 Views: 7544
Edited by: Antoine de Morree
Reviewed by: Qiangjun Zhou
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Protein kinase R (PKR) is one of the key RNA-activated sensors for innate immunity. PKR is activated by pathogenic or aberrant RNAs such as short double-stranded RNAs or those with imperfect secondary structures, as well as a reduction in the amount and number of RNA modifications. Activation of PKR may be an underlying mechanism for the pathogenesis of human diseases. In this protocol, I describe a method for studying levels of RNA-induced PKR activation in vitro.
Keywords: PKR Stress response Innate immunity Aberrant RNA
Background
PKR is one of four mammalian kinases that phosphorylate eukaryotic initiation factor 2-α subunit (eIF2α) in response to stress signals. PKR is activated mainly in response to viral infection (Holcik and Sonenberg, 2005). PKR is a key component of innate immunity that recognizes and binds to pathogenic RNAs. The interaction of RNAs with PKR promotes and stabilizes its dimerization. PKR then undergoes auto-phosphorylation and subsequently phosphorylates eIF2α to shut off general translation, while activating the downstream signaling cascade including the increased translation of the ATF4 stress response transcription factor (Hinnebusch, 2005).
PKR is known to be activated by short double-stranded RNAs (Manche et al., 1992; Zheng and Bevilacqua, 2004) as well as RNAs with some imperfect secondary structures such as hairpin loops (Bevilacqua et al., 1998). In addition, defects in RNA biogenesis, including lower levels of m6A modification, lead to a stress response via the activation of PKR (Nallagatla and Bevilacqua, 2008). Reduced levels of m6A modification followed by the activation of the PKR-mediated stress response may serve as an underlying molecular etiology of human diseases such as Cornelia de Lange syndrome (Yuen et al., 2016). The method described in this protocol allows us to study the stress response triggered by foreign or aberrant RNAs by examining their effect on the activation of PKR in vitro.
Materials and Reagents
35 mm TC-treated culture dish (Corning, catalog number: 430165 )
Razor blades
Protein purification column (Kimble Chase Life Science and Research Products, catalog number: 420400-1010 )
Pipette tips (VWR, catalog number: 53508-794 )
50 ml tube (Corning, catalog number: 430290 )
VWR 10 ml serological pipet (VWR, catalog number: 89130-888 )
Parafilm M (Bemis, catalog number: PM996 )
Immobilon-P polyvinylidene difluoride membrane (EMD Millipore, catalog number: IPVH00010 )
Dialysis tube (Sigma-Aldrich, catalog number: D6191 )
Dialysis tube clip (Sigma-Aldrich, catalog number: Z371092 )
Dialysis tubing (Sigma-Aldrich, catalog number: D9652 )
pGEM®-T Easy vector systems (Promega, catalog number: A1360 )
One Shot TOP10 competent cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: C404003 )
pET-28a(+) plasmid (EMD Millipore, catalog number: 69864 )
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
FBS (Thermo Fisher Scientific, GibcoTM, catalog number: 10437028 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
TRIzol reagent (Thermo Fisher Scientific, AmbionTM, catalog number: 15596026 )
Chloroform, biotechnology grade (VWR, catalog number: 97064-678 )
2-propanol, biotechnology grade (VWR, catalog number: 97065-048 )
Ethanol, absolute (Sigma-Aldrich, catalog number: E7023 )
DEPC-treated water (Thermo Fisher Scientific, InvitrogenTM, catalog number: 750023 )
5x iScript cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708890 )
Nuclease-free water (New England Biolabs, catalog number: B1500 )
PCR primers (IDT)
Phusion high-fidelity DNA polymerase (New England Biolabs, catalog number: M0530 )
dNTP (New England Biolabs, catalog number: N0447 )
Taq DNA polymerase (New England Biolabs, catalog number: M0273 )
Magnesium chloride (MgCl2) solution (New England Biolabs, catalog number: B9021 )
dATP (100 mM) (New England Biolabs, catalog number: N0440S )
T4 DNA ligase (New England Biolabs, catalog number: M0202 )
X-Gal (β-galactoside) (Promega, catalog number: V3941 )
SOC medium (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15544034 )
LB plate (Thermo Fisher Scientific, GibcoTM, catalog number: 10855021 )
Ampicillin (Sigma-Aldrich, catalog number: A9393 )
NEBuffer 3.1 (New England Biolabs, catalog number: B7203S )
SalI restriction enzyme (New England Biolabs, catalog number: R0138 )
NotI restriction enzyme (New England Biolabs, catalog number: R0189 )
Qiagen QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28706 )
T4 DNA ligase buffer (New England Biolabs, catalog number: B0202S )
IPTG (Sigma-Aldrich, catalog number: I6758 )
Liquid nitrogen (Midwest Liquid Nitrogen Service)
Lysozyme (Sigma-Aldrich, catalog number: L6876 )
RNase A (Sigma-Aldrich, catalog number: R4642 )
DNase I (New England Biolabs, catalog number: M0303 )
LDS loading buffer (4x) (Thermo Fisher Scientific, NovesTM, catalog number: NP0007 )
Ni-NTA agarose (QIAGEN, catalog number: 30230 )
Qubit Protein Assay (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: Q33211 )
λ-PPase (New England Biolabs, catalog number: P0753 )
Phosphatase reaction buffer (New England Biolabs, catalog number: B6022S )
Sodium orthovanadate (Sigma-Aldrich, catalog number: S6508 )
Poly I:C (Sigma-Aldrich, catalog number: P1530 )
NuPAGE 4-12% Bis-Tris protein gel (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0322BOX )
Silver staining kit (Thermo Fisher Scientific, NovesTM, catalog number: LC6100 )
1% bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9418 )
PKR primary antibody (Santa Cruz Biotechnology, catalog number: sc-6282 )
Phosphorylated-PKR primary antibody (Abcam, catalog number: ab32036 )
Peroxidase-conjugated secondary antibody (Thermo Fisher Scientific, InvitrogenTM, catalog number: 31460 )
ECL reagents (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 32132 )
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S8282 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Imidazole (Sigma-Aldrich, catalog number: I5513 )
PMSF (Sigma-Aldrich, catalog number: P7626 )
Protease inhibitor (Roche Diagnostics, catalog number: 11697498001 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S8045 )
Tris (pH 7.6) (VWR, catalog number: 97061-260 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Magnesium chloride (MgCl2) powder (Sigma-Aldrich, catalog number: M8266 )
Glycerol (VWR, BDH®, catalog number: BDH1172-1LP )
EDTA (Sigma-Aldrich, catalog number: E6758 )
DTT (Sigma-Aldrich, catalog number: D0632 )
HEPES (pH 7.5) (Sigma-Aldrich, catalog number: H3375 )
ATP (New England Biolabs, catalog number: P0756 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Tween-20 (Sigma-Aldrich, catalog number: P9416 )
E. coli lysis buffer (see Recipes)
Protein purification wash buffer (see Recipes)
Protein purification elution buffer (see Recipes)
Protein storage buffer (see Recipes)
Phosphatase reaction buffer (see Recipes)
PKR activation buffer (see Recipes)
TE buffer (10x) (see Recipes)
Tween-20 phosphate buffered saline (pH 7.2) (see Recipes)
Equipment
Cell culture incubator (Panasonic Biomedical, model: MCO-230AIC )
Pipette (VWR, catalog number: 89079-970 )
Centrifuge (Eppendorf, model: 5424 )
Qubit 3.0 Fluorometer (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q33216 )
PCR machine (Bio-Rad Laboratories, model: S1000TM Thermal Cycler , catalog number: 1852148)
Vortex (VWR, catalog number: 97043-562 )
Sonicator (Branson, model: Digital Sonifier 450 or from Fisher Scientific, catalog number: 15-338-553)
600 ml beaker (VWR, catalog number: 10754-956 )
Typhoon scanner (GE Healthcare, model: Amersham Molecular Dynamics Typhoon 9410 or from GMI, catalog number: 8149-30-9410)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yuen, K. C. (2017). Measurement of RNA-induced PKR Activation in vitro. Bio-protocol 7(6): e2178. DOI: 10.21769/BioProtoc.2178.
Download Citation in RIS Format
Category
Biochemistry > Protein > Activity
Biochemistry > RNA > RNA-protein interaction
Molecular Biology > Protein > Dephosphorylation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,179 | https://bio-protocol.org/exchange/protocoldetail?id=2179&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Analysis of Carotenoids from Escherichia coli in Color Complementation Assays
Andreas Blatt
Martin Lohr
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2179 Views: 11386
Edited by: Tie Liu
Reviewed by: Baohua LiBin Tian
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
A common method to investigate the function of genes putatively involved in carotenoid biosynthesis is the so called color complementation assay in Escherichia coli (see, e.g., Cunningham and Gantt, 2007). In this assay, the gene under investigation is expressed in E. coli strains genetically engineered to synthesize potential carotenoid substrates, followed by analysis of the pigment changes in the carotenogenic bacteria via high-performance liquid chromatography (HPLC). Two crucial steps in this method are (i) the quantitative extraction of the carotenoids out of E. coli and (ii) the reproducible and complete separation of the pigments by HPLC.
Here, we present a protocol for the extraction and analysis of carotenoids with a broad range of polarities from carotenogenic E. coli. The solvent mixture used for extraction keeps both the lipophilic carotenes and the more polar xanthophylls in solution and is compatible with the eluent gradient of the subsequent HPLC analysis. The C30-column used is particularly suitable for the separation of various cis-isomers of carotenoids, but also for separation of stereoisomers such as α- and β-carotene or lutein and zeaxanthin.
Keywords: Carotenoid biosynthesis Color complementation E. coli Pigment extraction Carotenes Xanthophylls HPLC C30-column
Materials and Reagents
50 ml screwcap polypropylene (PP) tubes, sterile, pyrogen-free (SARSTEDT, catalog number: 62.547.254 )
15 ml screwcap PP tubes, sterile (SARSTEDT, catalog number: 62.554.502 )
Escherichia coli, strain depending on the plasmids used (see Notes)
Methanol HPLC grade (EMD Millipore, catalog number: 106018 )
Acetone p.a. grade or higher (EMD Millipore, catalog number: 100014 )
Dichloromethane p.a. grade or higher (Fisher Scientific, catalog number: 10626642 )
ddH2O
Ammonium acetate p.a. grade (EMD Millipore, catalog number: 101116 )
Acetonitrile HPLC grade (EMD Millipore, catalog number: 113358 )
Ethyl acetate HPLC grade (Merck Millipore, catalog number: 113353 )
Lysogeny broth medium (Carl Roth, catalog number: X968.3 )
Eluents (see Recipes)
Eluent A
Eluent B
Eluent C
Equipment
For pigment extraction:
Photometer (Eppendorf, model: Bio Photometer 6131 )
Vortexer (Scientific Industries, model: G-560E )
Ultrasonic bath (Elma Schmidbauer, model: Transsonic T 460 , or BANDELIN electronic, model: Sonorex TK52 ) (see Notes)
Centrifuge (Beckman Coulter, model: Avanti J-25 )
Centrifuge rotor for 50 ml tubes (Beckman Coulter, model: JA25.50 ) with round bottom adapters for 15 ml tubes (Corning, model: 8441 )
For HPLC analysis:
HPLC system with quaternary pump, in-line degasser, thermostatted autosampler, column heater and photodiode-array (PDA) detector (Waters, models: 2795 Separation Module and 2996 photodiode-array detector )
C30-Column 250 x 4.6 mm (5.0 µm, 250 x 4.6 mm) (Bischoff, model: ProntoSIL 200-5-C30 , catalog number: 2546H300PS050)
Guard column 20 x 4.0 mm (5.0 µm, 20 x 4.0 mm) (Bischoff, model: ProntoSIL 200-5-C30 , catalog number: 6302H300PS050) connected to column by guard cartridge holder (Bischoff, catalog number: 1502 0508 )
Software
HPLC-Software (Waters: Empower Pro)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Blatt, A. and Lohr, M. (2017). Extraction and Analysis of Carotenoids from Escherichia coli in Color Complementation Assays. Bio-protocol 7(6): e2179. DOI: 10.21769/BioProtoc.2179.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
218 | https://bio-protocol.org/exchange/protocoldetail?id=218&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNP-IP (Original Method): Obtaining Majority RNA from RNA Binding Protein in the Nucleus
FL FengZhi Liu
Published: May 20, 2012
DOI: 10.21769/BioProtoc.218 Views: 19148
Download PDF
Ask a question
Favorite
Cited by
Abstract
Post-transcriptional regulation of gene expression is a ribonucleoprotein (RNP)-driven process, which involves RNA binding proteins (RBPs) and noncoding RNAs that regulate splicing, nuclear export, subcellular localization, mRNA stability and translation. mRNAs encoding proteins that function in a particular cell process or pathway can be found within a unique mRNP complex, which consists of mRNA and RNP. This provides valuable information regarding not only known components of a particular process or pathway, but importantly, leads to the identification of novel components representing potential therapeutic targets and biomarkers. In addition to those targets identified by pathway expansion, the specific RBPs (RNA binding proteina) regulating RNA functions may be potential therapeutic targets in their own right. RNP-IP is a technology that allows the isolation and identification of mRNAs, microRNAs and protein components of RNP complexes from cell extracts using antibodies to RBPs. Once purified, the RNAs present in the complex are analyzed to identify the target mRNAs using various molecular biology tools such as RT-PCR, gene expression analysis based on microarray technology (Chip analysis), or sequencing. Using this method, more RNA that is present in the nucleus can be obtained.
Materials and Reagents
Normal Rabbit IgG
High-salt solution
RIP-certified antibody (NBL, catalog number depends on what do you want to target)
Protease inhibitor (Molecular Biology)
Aprotinin
Leupeptin
Phenylmethylsulfonyl fluoride (PMSF)
RNase inhibitor (Life Technologies, Invitrogen™, catalog number: 10777-019 )
Dithiothreitol (DTT) (reducing agent)
Protein A beads (GE Healthcare Dharmacon, catalog number: 17-0780-01 ) or Protein G beads (Thermo Fisher Scientific, catalog number: 22852 )
Ethanol (Molecular Biology)
2-Propanol (Molecular Biology)
Nuclease-free PBS
Isotype control IgG (if necessary)
Kit components (see Recipes)
Commercial reagent (see Recipes)
Buffer preparation (see Recipes)
Wash buffer (see Recipes)
Precaution: Additional buffer preparation (see Recipes)
Preparation of antibody-immobilized protein A or protein G agarose beads-RNP complex
Equipment
Microcentrifuge capable of 15,000 x g
Microcentrifuge tube (1.5 ml or 2 ml) (Nuclease-free) (recommendation; use low-adhesion tube for RIP-Assay)
Centrifuge capable of 2,000 x g
Centrifuge tube (15 ml or 50 ml)
Pipette (5 ml, 10 ml, 25 ml) (nuclease-free)
Pipette tip (10 μl, 20-100 μl , 200 μl , and 1,000 μl) (nuclease-free) (recommendation; use low-adhesion pipette tip for RIP-Assay)
Ultra low temperature freezer (-80 °C)
Freezer (below -20 °C)
End-over-end rotator
Vortex mixer
Gloves
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > RNA > RNA-protein interaction
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,180 | https://bio-protocol.org/exchange/protocoldetail?id=2180&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ribosomal RNA N-glycosylase Activity Assay of Ribosome-inactivating Proteins
Rosario Iglesias
Lucía Citores
José M. Ferreras
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2180 Views: 11144
Edited by: Zhaohui Liu
Reviewed by: Tzvetina BrumbarovaFeng Li
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Ribosome-inactivating proteins (RIPs) are enzymes that irreversibly inactivate ribosomes as a consequence of their N-glycosylase (EC 3.2.2.22) activity. The enzyme cleaves the N-glycosidic bond between the adenine No. 4324 from the 28S rRNA and its ribose in rat ribosomes (or the equivalent adenine in sensitive ribosomes from other organisms). This adenine is located in the α-sarcin-ricin loop (SRL) that is crucial for anchoring the elongation factor (EF) G and EF2 on the ribosome during mRNA-tRNA translocation in prokaryotes and eukaryotes, respectively. RIPs have been isolated mainly from plants and examples of these proteins are ricin or Pokeweed Antiviral Protein (PAP). These proteins, either alone or as a part of immunotoxins, are useful tools for cancer therapy. The following protocol describes a method to detect the RNA fragment released when the RIP-treated apurinic RNA from rabbit reticulocyte lysate is incubated in the presence of acid aniline by electrophoresis on polyacrylamide gels. The fragment released (Endo’s fragment) is diagnostic of the action of RIPs.
Keywords: Ribosome-inactivating protein (RIP) rRNA N-glycosylase Protein synthesis (inhibition) Sarcin-ricin loop Polynucleotide:adenosine glycosylase Ricin Pokeweed Antiviral Protein (PAP) Beetin 27
Background
N-glycosylase activity of RIPs on the eukaryotic 28S rRNA was first described by Endo and Tsurugi for ricin (Endo and Tsurugi, 1988) in rat ribosomes; subsequently it was shown that some RIPs can also depurinate ribosomes from plants, bacteria and fungi. The result of this effect, upon treatment with aniline, is the release of an RNA fragment of between 240 and 500 nucleotides (depending on species) from the rRNA of the large subunit (Figure 1). Most RIPs depurinate ribosomes at one site (the adenine 4,324), whereas other RIPs such as saporins, PAP-R and trichokirin depurinate the rRNA at multiple sites. The protocol described here uses rabbit reticulocyte lysate, a eukaryotic cell-free model system very sensitive to the action of RIPs, which shows high rates of depurination for most RIPs. This allows obtaining a large amount of fragment which facilitates its detection by electrophoresis. In this procedure we use denaturing polyacrylamide minigels which require small quantities of sample and have higher resolution than the agarose gels when staining with fluorescent dyes.
Figure 1. Sarcin Ricin Loop of the large rRNA from rat, yeast and Escherichia coli. The sequences (accession numbers NR_046246, J01355 and AB035926) were downloaded from the NCBI sequence database (http://www.ncbi.nlm.nih.gov/nucleotide/). The adenine released by the RIP action (boldfaced), the site of splitting by either the aniline or α-sarcin (arrows) and the size of the generated fragment are also indicated. Partial sequence of rabbit 28S rRNA (AF460236) indicates that rat and rabbit share the same SRL sequence.
Materials and Reagents
Note: All the reagents used in preparing buffers should be of molecular biology grade purity (RNase, DNase-free). Water and solutions should be autoclaved at 120 °C for 15 min (except of aniline and ethanol).
Disposable gloves
Pipettes and tips (either RNase, DNase-free or autoclaved)
Eppendorf tubes (1.5 ml polypropylene microcentrifuge tubes, either RNase, DNase-free or autoclaved)
Paper towels
Corning 50 ml PP centrifuge tubes (Corning, catalog number: 430291 )
Pasteur pipettes
Cotton swabs
Rabbit reticulocyte lysate, untreated with micrococcal nuclease, either obtained as indicated by Pelham and Jackson (1976) or purchased from a biochemical supplier (for example: Promega, catalog number: L4151 )
RIP either obtained as indicated by Barbieri et al. (2001) or purchased from a biochemical supplier (for example Ricin A chain: Sigma-Aldrich, catalog number: L9514 )
Crushed ice
Phenol/TRIS saturated sol., for molecular biology, stabilized, DNAse, RNAase and Protease free (ACROS Organics, catalog number: 327125000 )
Ethanol absolute (EMD Millipore, catalog number: 100983 )
Deionized, RNase and DNase-free water
Note: For example, Millipore Elix 5 (UV) water autoclaved 120 °C 15 min.
Aniline (Sigma-Aldrich, catalog number: 242284 )
Urea (Thermo Fisher Scientific, Affymetrix, catalog number: 75826 )
Ammonium persulfate (Sigma-Aldrich, catalog number: A3678 )
N,N,N’,N’-tetramethylethylenediamine (TEMED) (Sigma-Aldrich, catalog number: T9281 )
Acrylamide bis-acrylamide 19:1, 40% (w/v) solution (Thermo Fisher Scientific, Affymetrix, catalog number: 75848 )
Either ethidium bromide (Sigma-Aldrich, catalog number: E7637 ) or GelRed (Biotium, catalog number: 41003 )
EDTA·2H2O
NaOH pellets
Hydrochloric acid (HCl) (EMD Millipore, catalog number: 100317 )
Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, Affymetrix, catalog number: 75819 )
Sodium acetate trihydrate (EMD Millipore, catalog number: 106267 )
Glacial acetic acid (EMD Millipore, catalog number: 100063 )
Diethyl pyrocarbonate (Sigma-Aldrich, catalog number: D5758 )
Diethyl ether (EMD Millipore, catalog number: 100921 )
Trimethylol aminomethane (Tris base) (Fisher Scientific, catalog number: BP154-1 )
Boric acid (Sigma-Aldrich, catalog number: B6768 )
Sucrose (Sigma-Aldrich, catalog number: 84097 )
RNA markers (Roche Diagnostics, catalog number: 1062 638 )
Note: This product has been discontinued. Can be replaced by Low Range ssRNA Ladder (New England Biolabs, catalog number: N0364S )
Bromophenol blue (Bio-Rad Laboratories, catalog number: 161-0404 )
0.5 M EDTA (pH 8.0) (see Recipes)
50 mM Tris/0.5% SDS (pH 7.8) (see Recipes)
3 M sodium acetate (pH 5.2) (see Recipes)
70% ethanol (see Recipes)
2 M aniline (pH 4.5) (see Recipes)
Water saturated ether (see Recipes)
10x TBE buffer (see Recipes)
2x gel loading buffer (see Recipes)
Equipment
Deep freezer (-80 °C freezer) (Thermo Fisher Scientific, Thermo ScientificTM, model: TSE Series , catalog number: TSE400SSV)
Fume hood (BURDINOLA, model: V21-Space BAJA ST 1500 )
Two microcentrifuges (DJB Labcare, model: Heraeus Biofuge Pico , catalog number: 75003235), one of them kept at 4 °C
30 °C water bath (JP SELECTA, catalog number: 6000140 )
Vortex mixer for test tubes (IKA, catalog number: 0003617000 )
BECKMAN DU-640 spectrophotometer (Beckman Coulter, model: DU-640 )
Quartz cuvette (Hellma Analytics, model: 104-QS , catalog number: 104-10-40)
Polyacrylamide gel electrophoresis system (GE Healthcare, catalog number: 80-6418-77 )
Power supply (GE Healthcare, catalog number: 18-1130-01 )
Molecular Imager® Gel DocTM XR+ System with Image LabTM Software (Bio-Rad Laboratories, catalog number: 1708195 )
Gel staining tray
Magnetic stirrer
Autoclave (JP SELECTA, catalog number: 4002516 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Iglesias, R., Citores, L. and Ferreras, J. M. (2017). Ribosomal RNA N-glycosylase Activity Assay of Ribosome-inactivating Proteins. Bio-protocol 7(6): e2180. DOI: 10.21769/BioProtoc.2180.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > Protein
Plant Science > Plant biochemistry > Protein
Molecular Biology > Protein > Anti-microbial analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,181 | https://bio-protocol.org/exchange/protocoldetail?id=2181&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In silico Analysis and Site-directed Mutagenesis of Promoters
Salah Boudjadi
Jean-Francois Beaulieu
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2181 Views: 9835
Edited by: HongLok Lung
Reviewed by: Raghuveer Kavarthapu
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
In normal as in cancerous cells, gene expression is tightly regulated by transcription factors, which are responsible for up- or down-regulation of thousands of targets involved in different cell processes. Transcription factors can directly regulate the expression of genes by binding to specific DNA sequences known as response elements. Identification of these response elements is important to characterize targets of transcription factors in order to understand their contribution to gene regulation. Here, we describe In silico analysis coupled to selected mutagenesis and promoter gene reporter assay procedures to identify and analyze response elements in the proximal promoter sequence of genes.
Keywords: Site-directed mutagenesis in silico analysis Gene expression Promoter gene-reporter assay Response elements Transcription factors
Background
The impact of a transcription factor on global gene expression can be studied through its knockdown using shRNA or CRISPR-Cas9 methods followed by microarray analysis which can provide significant data on hundreds of dysregulated genes. This analysis, although very useful, lacks information about the direct control of the dysregulated genes. To further investigate these genes, In silico analysis using bioinformatics provides additional information to identify direct targets of the transcription factor studied. Additionally, the functionality of these response elements can be analyzed using site-directed mutagenesis and promoter-gene-reporter assays. We have shown recently that the oncogenic transcription factor MYC (Cellular Myelocytomatosis Oncogene) controls the expression of the ITGA1 (integrin alpha 1 subunit) gene in colorectal cancer, and that their expression correlates in 72% of colorectal tumors. This protocol describes a procedure for the analysis of the ITGA1 promoter and the identification of response elements for the MYC oncogene. The latter is known to be a member of the MYC/MAX/MAD network. Interactions between these factors lead to gene activation or repression depending on upstream signalization and cell condition.
Materials and Reagents
1.5 ml tubes
10 cm dish
12-well plates (Corning, Falcon®, catalog number: 353043 )
White 96-well assay plate (Corning, catalog number: 3912 )
Ice
HEK293T cells (ATCC, catalog number: CRL-3216 ) at low passage
DH5α competent cells
Primers (Sequences of the oligonucleotide primers used for the site directed mutagenesis):
Forward 5’-CGACTTCACGGTGAATTTGGACAATCCGCAGGGGATGGAAGG-3’
Reverse 5’-CCTTCCATCCCCTGCGGATTGTCCAAATTCACCGTGAAGTCG-3’
The promoter of interest, as for example here, the ITGA1 proximal promoter sequence inserted in the pLightSwitch_prom plasmid vector (SwitchGear Genomics, catalog number: S706788 )
Plasmid constructs carrying the activator or repressor to be characterized, as for example here: pcDNA-Empty vector, pcDNA-MYC and pCMV-MAD, as described in Ni et al., 2005
The pGL4.13 plasmid (luc2/SV40) as a control of transfection efficiency
GeneArt Site-Directed Mutagenesis Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: A13282 )
DNase and RNase free water
Distilled water
0.5 M EDTA, pH 8
SOC medium
LB agar plates
Trypan blue
Effectene transfection reagent (QIAGEN, catalog number: 301425 )
PBS
DMEM medium (Thermo Fisher Scientific, GibcoTM, catalog number: 11995073 )
Fetal bovine serum (FBS) (BOLLE COMMUNICATION, WISENT, catalog number: 080-150 )
GlutaMAX (Thermo Fisher Scientific, GibcoTM, catalog number: 35050061 )
HEPES (BOLLE COMMUNICATION, WISENT, catalog number: 330-050-EL )
Dual Luciferase Reporter Assay System (Promega, catalog number: E1980 )
Luciferase Assay substrate
Luciferase Assay buffer
DMEM culture medium for HEK293T cells (see Recipes)
LAR II solution (see Recipes)
1x Stop & Glo (see Recipes)
Equipment
Orion Microplate Luminometer (Berthold, Bad Wildbad, Germany)
MyCycler Personal Thermal Cycler for PCR reactions (Bio-Rad Laboratories)
Water bath
Cell culture incubator
Software
MatInspector web based software. Genomatix (Munich, Germany)
https://www.genomatix.de/online_help/help_matinspector/matinspector_help.html
Blast Global Align
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&PROG_DEF=blastn&BLAST_PROG_DEF=blastn&BLAST_SPEC=GlobalAln&LINK_LOC=BlastHomeLink
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Boudjadi, S. and Beaulieu, J. (2017). In silico Analysis and Site-directed Mutagenesis of Promoters. Bio-protocol 7(6): e2181. DOI: 10.21769/BioProtoc.2181.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,182 | https://bio-protocol.org/exchange/protocoldetail?id=2182&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Adoptive Transfer of Lung Antigen Presenting Cells
XZ Xiaofeng Zhou
BM Bethany B Moore
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2182 Views: 9936
Edited by: Ivan Zanoni
Reviewed by: Kathrin Sutter
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Our protocol describes adoptive transfer of antigen presenting cells (APCs) isolated from the lungs by enzymatic digestion and magnetic enrichment. This protocol can be used to study APC functions and trafficking.
Keywords: Lung antigen presenting cells Dendritic cells Macrophages Adoptive transfer Enzymatic digestion Magnetic cell isolation Intravenous injection
Background
Lung APCs, including macrophages and dendritic cells (DCs), play a critical role in sensing invading pathogens, priming T cell responses and controlling tolerogenic responses. Lung DCs are the most potent professional APCs, including conventional DCs (cDCs) and plasmacytoid DCs (pDCs) during steady-state, and newly recruited monocyte-derived DCs (moDCs) upon inflammation (Kopf et al., 2015). Lung resident macrophages, including alveolar macrophages, interstitial macrophages and bronchial macrophages, are less potent in presenting antigens.
All macrophages and cDCs express high levels of CD11c on their cell surface, while pDCs express intermediate levels of CD11c (Becher et al., 2014). Thus, CD11c magnetic microbeads can be used to isolate mouse lung macrophages and cDCs. We developed a protocol of isolating lung APCs from normal mice and then adoptively transferring them to syngeneic bone marrow transplanted mice. We used this protocol to determine whether normal lung APCs are sufficient to restore T helper cell polarization in response to herpesvirus infection post-transplant (Zhou et al., 2016).
Materials and Reagents
PrecisionGlide needles 23 G (BD, catalog number: 305111 )
PrecisionGlide 26 G (BD, catalog number: 305193 )
60 x 15 mm Petri dish (Corning, Falcon®, catalog number: 351007 )
50 ml flip-top conical centrifuge tubes (Thermo Fisher Scientific, catalog number: 362696 )
10 ml Luer slip tip syringe (Fisher Scientific, catalog number: 14-841-55 )
Razor blade
Tissue culture plates
100 µm nylon screen (Nylon Mesh Lab Pack) (Sefar, catalog number: 7050-1220-000-20 )
MACS LS column (Miltenyi Biotec, catalog number: 130-042-401 )
15 ml conical centrifuge tubes (Corning, Falcon®, catalog number: 352097 )
1 ml slip tip syringe (BD, catalog number: 309659 )
0.22 µm filter (Millipore Express PLUS 0.22 µm PES) (EMD Millipore, catalog number: SCGPU01RE )
Pipette tips
Latex gloves
Syringe tip caps (BD, catalog number: 305819 )
Mice
70% ethanol
Phosphate buffered saline (PBS, pH 7.4) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Heat-inactivated fetal bovine serum (Mediatech, catalog number: 35-010-CV )
Penicillin-streptomycin 100x (Mediatech, catalog number: 30-002-CI )
L-glutamine 100x, 200 mM (Thermo Fisher Scientific, GibcoTM, 25030-018 )
Amphotericin B (Thermo Fisher Scientific, GibcoTM, catalog number: 15290018 )
Dulbecco’s modified Eagle’s medium (DMEM) (Lonza, catalog number: 12-604F )
Collagenase A (Roche Diagnostics, catalog number: 10103578001 )
DNase I (Sigma-Aldrich, catalog number: D4263 )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: 254134 )
Potassium bicarbonate (KHCO3) (Sigma-Aldrich, catalog number: 431583 )
EDTA, 0.5 M (Lonza, catalog number: 51201 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3912 )
Percoll (Sigma-Aldrich, catalog number: P1644 )
Mouse CD11c MicroBeads UltraPure (Miltenyi Biotec, catalog number: 130-108-338 )
Trypan blue solution, 0.4% (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Complete media (see Recipes)
Collagenase digest solution (see Recipes)
RBC lysis buffer (see Recipes)
Serum free media (see Recipes)
MACS buffer (see Recipes)
Equipment
CO2 tank
Scissors
Forceps
Water bath
Cell culture incubator
Rocker
Refrigerated Swing bucket centrifuge (Beckman Coulter, model: Allegra X-12R )
Vortex
Hemocytometer
Mouse restrainer
Heat lamp
Pipette
Compound microscope
MACS separator (Miltenyi Biotec)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell function > Macrophage
Cell Biology > Cell Transplantation > Immune cell adoptive transfer
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,183 | https://bio-protocol.org/exchange/protocoldetail?id=2183&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Assay to Assess Efficacy of Potential Antiviral Compounds against Enterovirus D68
Liang Sun
LD Leen Delang
C Carmen Mirabelli
Johan Neyts
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2183 Views: 9185
Edited by: Yannick Debing
Reviewed by: Kristin ShinglerCristina SuárezNoam Vardi
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
In 2014 enterovirus D68 (EV-D68) caused the largest outbreak in the United States since the discovery of the virus. Distinct from before, the 2014 infections were associated with more severe respiratory disease and occasional neurological complications. So far, there are no available vaccines or antivirals for the prophylaxis or treatment of EV-D68 infections. In order to evaluate the antiviral activity of potential inhibitors of EV-D68 replication, a cell-based cytopathic effect (CPE) reduction assay was developed (Sun et al., 2015).
Keywords: Enterovirus D68 Antiviral assay CPE MTS/PMS solution Cell culture
Background
As a re-emerging pathogen, antiviral compounds targeting EV-D68 were rarely reported before. It is urgently needed to establish and develop antiviral methods to combat the potential EV-D68 epidemic. Here, we report a detailed protocol which can be used to identify selective anti-EV-D68 compounds. To screen and identify potential antiviral compounds, the MTS-based CPE reduction assay is reproducible, easy-to-use and time-saving method which is widely used. This method relies on the ability of a compound to inhibit EV-D68-induced reduction of CPE. When a compound actively inhibits the replication of EV-D68, the virus-induced CPE will be reduced or absent. As a consequence, the metabolically active cells are able to convert a yellow tetrazolium salt substrate (MTS/PMS) to a brown-colored formazan product. When a compound does not have antiviral effects, the host cells die of virus-induced CPE, which will lack metabolic activity, and the yellow substrate remains un-metabolized. The colorimetric conversion is quantitative, as an EC50 can be calculated from the data generated by this assay.
Materials and Reagents
Centrifuge tube, 14 ml (Corning, Falcon®, catalog number: 352059 )
1.5 ml Eppendorf Snap-Cap microcentrifuge tubes (VWR, catalog number: 21008-959 )
4 ml Screw neck vials, amber glass (VWR, catalog number: 548-0052 )
Transparent 96-well (flat-bottom) tissue culture plates (Corning, Falcon®, catalog number: 353072 )
Tissue culture flasks, 150 cm2 (TPP, catalog number: 90856 )
Pipette tips (10 µl, 100 µl, 1,000 µl)
Disposable serological pipets (5 ml, 10 ml and 25 ml)
Reagent reservoir, 25 ml (Biotix, catalog number: SR-0025-5SWM )
Nalgene rapid-flow sterile disposable filter units with SFCA membrane (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 156-4020 )
Hela Rh cell line (a Hela subclone, highly susceptible and permissible to rhinovirus-induced CPE, a gift from Janssen Pharmaceutica, Belgium) (Lacroix et al., 2014)
All EV-68 strains were cultivated on HeLa Rh cells and stored at -80 °C
EV-D68 strains (742, 947, 2042, 1348, 2284 and 670) were isolated from the Netherlands (a kind of gift from Adam Meijer, Diagnostics and Screening National Institute for Public Health and the Environment [RIVM], Bilthoven)
EV-D68 strains (US/KY/14-18953, US/IL/14-18952 and US/MO14-18947) – these strains were originally obtained from BEI Resources
Note: The lysate of all virus strains were used for antiviral assay, and virus titer was measured by endpoint titration assay.
Dulbecco’s phosphate-buffered saline (DPBS), no calcium, no magnesium (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 )
0.05% trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25300054 )
Minimum essential media (MEM) Rega-3 (Thermo Fisher Scientific, GibcoTM, catalog number: 19993013 )
Potential antiviral compounds
SG85*
Pleconaril*
Vapendavir*
Pirodavir*
Rupintrivir*
Enviroxime*
Favipiravir*
Note: All *compounds were dissolved in DMSO at a concentration of 10 mg/ml and stored in screw neck vials at 4 or -20 °C.
Fetal bovine serum (GE Healthcare, HycloneTM, catalog number: SH30084.03 )
L-glutamine 200 mM (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Sodium bicarbonate 7.5% solution (Thermo Fisher Scientific, GibcoTM, catalog number: 25080060 )
Minimum essential media (MEM), no glutamine, no phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 51200038 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
CellTiter 96® AQueous MTS reagent powder (Promega, catalog number: G1111 )
HCl
Dimethyl sulfoxide (VWR, catalog number: 67-68-5 )
Growth culture medium (see Recipes)
Assay medium (see Recipes)
MTS/PMS solution (see Recipes)
Equipment
Pipette controller, PIPETBOY acu2 (VWR, catalog number: 612-0927 )
Multichannel pipette, 10-100 µl (Eppendorf)
Incubator at 37 °C (and 35 °C ) and 5% CO2 (Binder)
Mid bench centrifuge (Sigma Laborzentrifugen, mode: 4K15C )
MoxiTM Z Mini Automated Cell Counter (ORFLO Technologies, catalog number: MXZ001 )
SpectraMax 190 microplate reader (Molecular Devices, model: SpectraMax 190 )
pH bench meter (Xylem Analytics, WTW, model: inoLab® 9310 IDS )
Inverted microscope (Motic, model: AE21 )
Safety cabinet (Telstar)
Software
GraphPad Prism
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sun, L., Delang, L., Mirabelli, C. and Neyts, J. (2017). In vitro Assay to Assess Efficacy of Potential Antiviral Compounds against Enterovirus D68. Bio-protocol 7(6): e2183. DOI: 10.21769/BioProtoc.2183.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Antiviral assay
Cell Biology > Cell-based analysis > Viral infection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,184 | https://bio-protocol.org/exchange/protocoldetail?id=2184&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Dipeptidylpeptidase Activity in vitro and in vivo
Rosa Barreira da Silva
Molly A. Ingersoll
Matthew L. Albert
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2184 Views: 8057
Edited by: Ivan Zanoni
Reviewed by: Meenal SinhaYang Fu
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Dipeptidylpeptidases (DPPs) are serine proteases, which cleave small proteins and peptides possessing a proline or an alanine in the second position of their N-terminus. Among the members of this family, dipeptidylpeptidase 4 (DPP4) is constitutively expressed in the extracellular space. DPP4 is found at the surface of many hematopoietic and non-hematopoietic cells and is also present in many biological fluids in a bioactive soluble form. DPP4 expression is modulated by inflammation, and measurements of its activity have been used as biomarker for disease. Here, we describe a method to evaluate the enzymatic activity of DPP4 in vitro and in vivo.
Keywords: Dipeptidylpeptidase 4 Enzyme Tumor Plasma DPP4 inhibitor
Background
The magnitude of the enzymatic activity of DPPs can be an indicator of inflammation; and an important pharmacodynamics parameter for usage of DPP4 inhibitors. Here, we report details for the usage of a commercially available kit to evaluate DPP-enzymatic activity in vitro; and provide details on the generation of biological samples tested. Furthermore, we describe how this method can be used for evaluation of DPP activity in vivo.
Materials and Reagents
96 well plates, U bottom (Fisher Scientific, catalog number: 12-565-500 )
Luminometer 96 well plates (Promega, catalog number: Z3291 )
2 ml Eppendorf tube (Fisher Scientific, catalog number: 05-402-7 )
1 ml syringe (BD, catalog number: 309659 )
20 G (0.9 x 25 mm) needle (BD, catalog number: 305175 )
Luciferase-expressing transgenic mouse such as the FVB-Tg(CAG-luc,-GFP)L2G85Chco/J mouse (THE JACKSON LABORATORIES, catalog number: 008450 )
Biologic samples such as mouse plasma/serum or organ homogenates/supernatants (see Notes)
DPPIV-GloTM Protease Assay (Promega, catalog number: G8351 )
1x PBS (Thermo Fisher Scientific, GibcoTM catalog number: 14190144 )
Recombinant human DPP4 (R&D Systems, catalog number: 1180-SE-010 )
Prionex (Sigma-Aldrich, catalog number: G0411 )
DPP4 inhibitor (such as K579, Sigma-Aldrich, catalog number: D3572 )
Ethanol
Equipment
Luminometer, with plate reader (such as Promega, model: GloMax® 96 Microplate Luminometer )
Multichannel pipet
XENOGEN (PerkinElmer, model: IVIS system )
Precision scale (such as Veritas Analytical Balance, AFFORDABLE SCALES AND BALANCES, model: M124A )
Sterile stainless steel bead 5 mm (QIAGEN, catalog number: 69989 )
TissueLyser II (QIAGEN, catalog number: 85300 )
Tabletop microcentrifuge (such as Eppendorf, model: 5417 R )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Barreira da Silva, R., Ingersoll, M. A. and Albert, M. L. (2017). Measurement of Dipeptidylpeptidase Activity in vitro and in vivo. Bio-protocol 7(6): e2184. DOI: 10.21769/BioProtoc.2184.
Download Citation in RIS Format
Category
Immunology > Immune cell function > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,185 | https://bio-protocol.org/exchange/protocoldetail?id=2185&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse CD8+ T Cell Migration in vitro and CXCR3 Internalization Assays
Rosa Barreira da Silva
Matthew L. Albert
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2185 Views: 16601
Edited by: Ivan Zanoni
Reviewed by: Meenal SinhaYang Fu
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Chemokines are molecules that regulate the positioning of cells during homeostasis and inflammation. CXCL10 is an interferon-induced chemokine that attracts cells that express the chemokine receptor CXCR3 on their surface. CXCL10 expression is often induced upon inflammation and guides lymphocytes, such as T and NK cells, into the injured tissues. Notably, CXCL10 binding to CXCR3 induces receptor internalization and, therefore, low CXCR3 levels in cells positive for CXCR3 expression can be indicative of chemokine signaling.
Here, we describe an in vitro method to evaluate the ability of murine CD8+ T cells to migrate towards recombinant murine CXCL10; and a flow cytometry assay to measure CXCR3 expression levels at the surface of T cells, after exposure to different doses of chemokine.
Keywords: Chemokines Lymphocytes Migration Transwell Receptor-internalization
Background
Chemokine-mediated T cell trafficking is an important process during homeostasis and inflammation. Activated CD8+ T cells express chemokine receptors, such as CXCR3, allowing them to migrate towards the chemokines CXCL9, 10 and 11, often upregulated at the injured tissue. The evaluation of molecular cues that modulate T cell migration is important to understand the biology behind their functions but the complex mechanisms operating in vivo are sometimes hard to deconvolve. Here, we provide detailed information on an in vitro method to evaluate chemokine functions on CD8+ T cells, focusing on CXCL10-mediated chemo-attraction and CXCR3 internalization. We use antigen-specific transgenic CD8+ T cells that can be easily expanded and activated in vitro, therefore providing enough number of phenotypically identical lymphocytes (e.g., high chemokine-receptor expression on their surface), required to perform an assay using enough replicates for biologically significant observations and statistical analysis. The cells used per assay originate from one single animal, therefore accounting for reduction of animal usage. This assay is combined with flow cytometry analysis, permitting simultaneous evaluation of 1) number of migrating CD8+ T cells; and 2) phenotypic characterization of chemokine receptor levels on their surface.
Materials and Reagents
6 well plate (Fisher Scientific, catalog number: 08-772-33 )
Sterile pipettes
5 ml (Corning, catalog number: 4051 )
10 ml (Corning, catalog number: 4101 )
25 ml (Corning, catalog number: 4251 )
70 μm cell strainer (Corning, catalog number: 431751 )
5 ml syringes, without needle (BD, catalog number: 309646 )
Sterile conical tubes
15 ml (Corning, catalog number: 352099 )
50 ml (Corning, catalog number: 352098 )
24 well plate (Corning, catalog number: 353226 )
Corning® HTS Transwell® 96 well permeable supports, 5.0 μm pore size (Corning, catalog number: 3387 )
96 well plates, U bottom (Fisher Scientific, catalog number: 12-565-500 )
1.5 ml Eppendorf tubes (Fisher Scientific, catalog number: 05-408-129 )
Flow cytometry tubes (Round-Bottom Polystyrene Tubes, Corning, catalog number: 352052 )
CD8+ T cell TCR transgenic mouse, such as OT-1 (C57BL/6-Tg[TcraTcrb]1100Mjb/J, THE JACKSON LABORATORIES, catalog number: 003831 ) or Pmel-1 (B6.Cg-Thy1a/Cy Tg[TcraTcrb]8Rest/J, THE JACKSON LABORATORIES, catalog number: 005023 ) mouse (age 8-12 weeks)
TCR-specific peptide
If using OT-1 cells – SIINFEKL (AnaSpect, catalog number: AS-60193-1 )
If using Pmel-1 cells – human gp100 (AnaSpec, catalog number: AS-62589 )
1x PBS (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 )
Recombinant human IL-2 (Miltenyi Biotec, catalog number: 130-097-742 )
Recombinant murine CXCL10 (Peprotech, catalog number: 250-16 )
AccuCheck Counting Beads reagent (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: PCB100 )
RPMI 1640 (Thermo Fisher Scientific, GibcoTM, catalog number: 11875093 )
Fetal bovine serum (Seradigm, catalog number: 1500-100 )
Non-essential amino acids (Thermo Fisher Scientific, GibcoTM, catalog number: 11140-050 )
Sodium pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11360-070 )
HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630-080 )
Beta-mercaptoethanol (Thermo Fisher Scientific, GibcoTM, catalog number: 21985-023 )
Gentamycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15710-064 )
Hank’s balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14025092 )
Protease-free BSA (GE Healthcare, catalog number: SH30574.02 )
Mouse CD16/CD32 Fc Blocking antibodies (BD, catalog number: 553142 )
LIVE/DEAD® Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: L34957 ). Reconstitute each vial with 50 μl of DMSO provided with the kit
Pacific Blue-conjugated anti-mouse CD3 (clone 145-2C11) (BioLegend, catalog number: 100334 )
APC-conjugated CD8 (clone 53-6.7) (BD, catalog number: 553035 )
PE-conjugated CXCR3 (clone CXCR3-173) (BioLegend, catalog number: 126506 )
R10 media (see Recipes)
Migration media (see Recipes)
Blocking buffer (see Recipes)
Staining mix (see Recipes)
Equipment
Sterile dissection tools such as small scissors and tweezers (tools can be purchased from Carolina or Sigma, for example)
Bench-top refrigerated centrifuge (such as Thermo Fisher Scientific, Thermo ScientificTM, model: Thermo ScientificTM SorvallTM LegendTM X1 )
Incubator (37 °C, 5% CO2, 95% humidity, such as Thermo Fisher Scientific, Thermo ScientificTM, model: Forma Steri-Cycle CO2 incubator )
Tissue culture hood (Biosafety cabinet, such as The Baker Company, model: SterilGARD e3 )
Bench-top orbital shaker (such as Thermo Fisher Scientific, model: Thermo Barnstead 4625 Titer Plate Shaker , catalog number: THERMO BARNSTEAD 4625 TITER PLATE SHAKER-1478)
Optical microscope (such as Leica, model: DM IL LED )
Neubauer cell counting chamber (such as InCyto, catalog number: DHC-N01 )
Flow cytometer (such as the BD, model: LSRFortessa )
Software
Flow cytometer software: DIVA
Computer analysis software: FlowJo (Treestar)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Barreira da Silva, R. and Albert, M. L. (2017). Mouse CD8+ T Cell Migration in vitro and CXCR3 Internalization Assays. Bio-protocol 7(6): e2185. DOI: 10.21769/BioProtoc.2185.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,186 | https://bio-protocol.org/exchange/protocoldetail?id=2186&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chase Assay of Protein Stability in Haloferax volcanii
Xian Fu
Julie A. Maupin-Furlow
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2186 Views: 6454
Edited by: Yanjie Li
Reviewed by: Lyu XiaomeiHonghong Wu
Original Research Article:
The authors used this protocol in May/Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May/Jun 2016
Abstract
Highly regulated and targeted protein degradation plays a fundamental role in almost all cellular processes. Determination of the protein half-life by the chase assay serves as a powerful and popular strategy to compare the protein stability and study proteolysis pathways in cells. Here, we describe a chase assay in Haloferax volcanii, a halophilic archaeon as the model organism.
Keywords: Archaea Ubiquitin-proteasome system Targeted proteolysis SAMP Chase assay
Background
In eukaryotes, the ubiquitin proteasome system plays a major role in highly selective and targeted proteolysis (Glickman and Ciechanover, 2002). Recent evidence shows that small archaeal ubiquitin-like modifier proteins or SAMPs also function in targeting proteins for destruction by proteasomes (Maupin-Furlow, 2014; Anjum et al., 2015; Fu et al., 2016). Measurement of the protein half-life in vivo provides a direct way to study the proteolysis pathway. Cycloheximide chase and pulse-chase assays are commonly used to monitor the degradation of the targeted protein in eukaryotes (Zhou, 2004). The former method is utilized to determine the half-life of all cellular proteins after inhibition of translation elongation by cycloheximide; whereas, the pulse-chase assay measures the turnover of newly synthesized (pulse-labeled) proteins without interfering the normal cell growth. Compared with the eukaryotic system, a rapid and simple method to determine the half-life of a given protein in archaea is not well established. Therefore, we developed a protocol to measure the protein stability in vivo for the salt-loving archaeon Haloferax volcanii. Inhibitors of translation (anisomycin) and transcription (actinomycin D) are utilized to minimize the synthesis of new protein in this archaeon. TBP2, a TATA-binding protein (TBP) modified by ubiquitin-like isopeptide bonds in Haloferax volcanii, serves as the model protein substrate in this study.
Materials and Reagents
Sterilized wooden stick
Parafilm
Zip-lock plastic bags
13 x 100 mm2 culture tubes (Fisher Scientific, catalog number: 14-961-27 )
1.5 ml microcentrifuge tube (Fisher Scientific, catalog number: 02-681-320 )
Polyvinylidene difluoride (PVDF) membrane (GE Healthcare, catalog number: 10600023 )
X-ray film (RPI, catalog number: 248300 )
2.0 ml microcentrifuge tube (Fisher Scientific, catalog number: 02-681-321 )
Disposable plastic cuvettes (Fisher Scientific, catalog number: 149-551-27 )
Gloves (Fisher Scientific, catalog number: 19-130-1597C )
Rack LTS tips
‘P20’ 2-20 µl (Mettler-Toledo, Rainin, catalog number: 17001865 )
‘P200’ 20-200 µl (Mettler-Toledo, Rainin, catalog number: 17001863 )
‘P1000’ 100-1,000 µl (Mettler-Toledo, Rainin, catalog number: 17001864 )
Sterile polystyrene disposable serological 10 ml pipets with magnifier stripe (Fisher Scientific, catalog number: 13-678-11E )
Nalgene rapid-flow sterile disposable bottle top 0.2 µm filters with surfactant-free cellulose acetate (SFCA) membrane (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 290-3320 )
Haloferax volcanii cells (parent and ubiquitin-like proteasome system mutants) carrying the reporter plasmid pJAM2201 encoding Flag-SAMP2 and TBP2-StrepII under control of the P2rrnA constitutive promoter. Plasmid pJAM202c served as the empty vector control. Please refer to strain and plasmid information published as Table S2 in (Fu et al., 2016)
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Agar (Sigma-Aldrich, catalog number: A7002 )
Novobiocin (Sigma-Aldrich, catalog number: N1628 )
Actinomycin D (Sigma-Aldrich, catalog number: A1410 )
Anisomycin (Sigma-Aldrich, catalog number: A9789 )
Acetone (Sigma-Aldrich, catalog number: 650501 )
Methanol (Fisher Scientific, catalog number: A413 )
CDP-Star (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: T2304 )
Coomassie brilliant blue R-250 staining solution (Bio-Rad Laboratories, catalog number: 1610436 )
Antibodies
Anti-StrepII polyclonal antibody (in mouse) (QIAGEN, catalog number: 34850 )
Goat anti-mouse IgG (whole molecule)-alkaline phosphatase-linked antibody (Sigma-Aldrich, catalog number: A5153 )
Alkaline phosphatase-linked anti-Flag M2 monoclonal antibody (Sigma-Aldrich, catalog number: A9469 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S642-12 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Fisher Scientific, catalog number: M35-12 )
Potassium sulfate (K2SO4) (Fisher Scientific, catalog number: P304-3 )
Calcium chloride dihydrate (CaCl2·2H2O) (Fisher Scientific, catalog number: C79-500 )
Tryptone (BD, BactoTM, catalog number: 211705 )
Yeast extract (BD, BBL, catalog number: 211929 )
Deionized H2O
Sodium hydroxide (NaOH) (Fisher Scientific, catalog number: BP359-212 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Fisher Scientific, catalog number: M63-3 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: P217-3 )
Tris-base (Fisher Scientific, catalog number: BP152-1 )
Sodium dodecyl sulfate (SDS) (Fisher Scientific, catalog number: BP166-500 )
Glycine (Bio-Rad Laboratories, catalog number: 1610718 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Bromophenol blue (Sigma-Aldrich, catalog number: B5525 )
Acrylamide (30%) (Fisher Scientific, catalog number: EC890450ML )
ATCC974 medium (see Recipes)
Concentrated salt water (SW) stock solution at 30% (w/v) (see Recipes)
2x SDS reducing buffer (see Recipes)
Equipment
Incubator and shaker (42 °C) (Eppendorf, New Brunswick Scientific)
SmartSpec Plus spectrophotometer (Bio-Rad Laboratories, catalog number: 1702525 )
Note: This product has been discontinued.
Centrifuge (Eppendorf, model: 5418 )
Basic power supply (Bio-Rad Laboratories, catalog number: 1645050 )
Refrigerator (4 °C) (Frigidare)
Ultra-low temperature freezer (-80 °C) (Eppendorf, New BrunswickTM, model: C660-86 )
Vortex mixer (Thermolyne, model: 37600 )
Chemical fume hood (Siemens, catalog number: 537-473 )
Pipettes (2-20 µl, 20-200 µl, 100-1,000 µl) (Rainin type LTS)
pH meter (Corning, model: 320 )
Scanner (Epson, model: 3170 Photo )
Autoclave (Consolidated Sterilizer Systems, model: SR-24C-PB )
Mini trans-blot module (Bio-Rad Laboratories, catalog number: 1703935EDU )
Gel electrophoresis chamber (Bio-Rad Laboratories, catalog number: 1658005 )
Konica X-ray film processor (Konica Minolta, model: QX60A )
Electrophoresis systems autoradiography cassette (Fisher Scientific, FisherBiotech, model: FBXC810 )
Siemens Vantage Reverse Osmosis Systems (M21 series, Siemens, model: M21R004EA ) with EVOQUA filters (Siemens, model: C1207098 ) and Atlantic Ultraviolet Germicidal UV Equipment (Siemens, model: MP49 ) (water purification system used for generating deionized water)
Software
ImageJ (imagej.net/Particle_Analysis)
Microsoft Excel (Microsoft Office 365 ProPlus)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fu, X. and Maupin-Furlow, J. A. (2017). Chase Assay of Protein Stability in Haloferax volcanii. Bio-protocol 7(6): e2186. DOI: 10.21769/BioProtoc.2186.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Degradation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,187 | https://bio-protocol.org/exchange/protocoldetail?id=2187&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
MHC Class II Tetramer Labeling of Human Primary CD4+ T Cells from HIV Infected Patients
MG Moran Galperin
DB Daniela Benati
MC Mathieu Claireaux
MM Madhura Mukhopadhyay
LC Lisa A. Chakrabarti
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2187 Views: 9959
Edited by: Jia Li
Reviewed by: Guangzhi Zhang
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Major Histocompatibility Complex (MHC) tetramers have been used for two decades to detect, isolate and characterize T cells specific for various pathogens and tumor antigens. In the context of Human Immunodeficiency Virus (HIV) infection, antigen-specific CD8+ T cells have been extensively studied ex vivo, as they can be readily detected by HIV peptide-loaded MHC class I tetramers. In contrast, the detection of HIV-specific CD4+ T cells has proven more challenging, due to the intrinsically lower clonal expansion rates of CD4+ T cells, and to the preferential depletion of HIV-specific CD4+ T cells in the course of HIV infection.
In the following protocol, we describe a simple method that facilitates the identification of CD4+ T cells specific for an HIV-1 capsid epitope using peptide-loaded MHC class II tetramers. Tetramer labeled CD4+ T cells can be analyzed for their cell surface phenotype and/or FACS-sorted for further downstream applications. A key point for successful detection of specific CD4+ T cells ex vivo is the choice of a peptide/MHC II combination that results in high-affinity T Cell Receptor (TCR) binding (Benati et al., 2016). A second key point for reliable detection of MHC II tetramer-positive cells is the systematic use of a control tetramer loaded with an irrelevant peptide, with the sample and control tubes being processed in identical conditions.
Keywords: Major histocompatibility complex class II Tetramer T cell receptor CD4+ T cell HIV
Background
Rare HIV-specific MHC II tetramer-positive cells have been detected in purified CD4+ T cells, after magnetic enrichment of tetramer-PE labeled cells with anti-PE microbeads (Seth et al., 2005). We found that with validated peptide/MHC II tetramer combinations, a simpler protocol based on direct tetramer labeling of 5 x 106 patient Peripheral Blood Mononuclear Cells (PBMC), followed by acquisition of all events on a flow cytometer, resulted in reliable detection of HIV-specific CD4+ T cells. Exclusion of irrelevant cells (CD14+, CD20+, CD8+) and dead cells (Fixable Viability dye+) through an appropriate gating strategy improved labeling specificity.
Materials and Reagents
Falcon® round-bottom 5 ml polypropylene tubes (Corning, Falcon®, catalog number: 352063 )
Falcon® round-bottom 5 ml polystyrene tubes with a 35 µm Cell-Strainer cap (Corning, Falcon®, catalog number: 352235 )
APC-conjugated antigen-loaded MHC II tetramers can be obtained through the NIH Tetramer Core Facility, Emory University, USA. The tetramers are provided at a concentration in the 1-1.5 mg/ml range, in aliquots of 200 µl
APC-conjugated MHC II tetramers loaded with an irrelevant peptide (usually the CLIP peptide: PVSKMRMATPLLMQA can be obtained through the NIH Tetramer Core Facility, Emory University, USA)
Mouse-anti-human CD3 APC-eFluor® 780 (clone UCHT1) (Affymetrix, eBioscience, catalog number: 47-0038-42 )
Mouse-anti-human CD4 BD HorizonTM PE-CF594 (clone RPA-T4) (BD, BD Biosciences, catalog number: 562281 )
Mouse-anti-human CD8 Brilliant Violet 785TM (clone RPA-T8) (BioLegend, catalog number: 301045 )
Mouse-anti-human CD14 VioGreen® (clone TÜK4) (Miltenyi Biotec, catalog number: 130-096-875 )
Mouse-anti-human CD20 VioGreen® (clone LT20) (Miltenyi Biotec, catalog number: 130-096-904 )
Fixable Viability Dye eFluor 506® (Affymetrix, eBioscience, catalog number: 65-0866-14 )
16% paraformaldehyde (PFA) solution (Electron Microscopy Sciences, catalog number: 15710 )
Phosphate buffered saline (PBS), pH 7.4 (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
RPMI 1604 GlutaMAX ITM (Thermo Fisher Scientific, GibcoTM, catalog number: 61870044 )
HyCloneTM fetal bovine serum (FBS) (South America), research grade (GE Healthcare, catalog number: SV30160.03 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
1 M HEPES buffer (Dominique Dutscher SAS, catalog number: P05-01100P )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3912 )
Sodium azide (NaN3) 5% (w/v) (VWR, BDH®, catalog number: BDH7465-2 )
Human AB serum (PAN-Biotech, catalog number: P30-2901 )
Complete RPMI (see Recipes)
FACS buffer (see Recipes)
Tetramer labeling buffer (see Recipes)
FACS sorting buffer (see Recipes)
Equipment
Benchtop centrifuge (Thermo Fisher Scientific, model: SorvallTM LegendTM XTR )
Benchtop microcentrifuge (Eppendorf, model: 5254 R )
BD LSRFortessaTM cell analyzer (BD, BD Biosciences, model: BD LSRFortessaTM Cell Analyzer )
BD FACSAria IITM flow cytometer (BD, BD Biosciences, model: BD FACSAria IITM Cell Sorter )
Software
FACSDivaTM version 8.0 (BD)
FlowJoTM version 10.2 (FlowJo, LLC)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Galperin, M., Benati, D., Claireaux, M., Mukhopadhyay, M. and Chakrabarti, L. A. (2017). MHC Class II Tetramer Labeling of Human Primary CD4+ T Cells from HIV Infected Patients. Bio-protocol 7(6): e2187. DOI: 10.21769/BioProtoc.2187.
Download Citation in RIS Format
Category
Immunology > Immune cell staining > Flow cytometry
Cell Biology > Cell staining > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,188 | https://bio-protocol.org/exchange/protocoldetail?id=2188&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assays for the Detection of Rubber Oxygenase Activities
Wolf Röther
JB Jakob Birke
DJ Dieter Jendrossek
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2188 Views: 7499
Edited by: Yanjie Li
Reviewed by: Agnès Groisillier
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Microbial biodegradation of rubber relies on extracellular rubber oxygenases that catalyze the oxidative cleavage of the double bond of the polyisoprene backbone into oligo-isoprenoids. This protocol describes the determination of rubber oxygenase activities by an online measurement of molecular oxygen consumption via a non-invasive fluorescence-based assay. The produced oligo-isoprenoid cleavage products with terminal keto- and aldehyde-groups are identified qualitatively and quantitatively by HPLC. Our method allows for the characterization of homologue rubber oxygenases, and can likely be adapted to assay other oxygenases consuming dioxygen. Here we describe the determination of rubber oxygenase activities at the examples of the so far two known types of rubber oxygenases, namely rubber oxygenase A (RoxA) and latex clearing protein (Lcp).
Keywords: Latex clearing protein (Lcp) Rubber oxygenase Dioxygenase Polyisoprene Rubber Oxygen monitoring
Background
Oxygen is a key element in aerobic metabolism and is essential for the catabolism of hydrocarbons. Therefore the quick and accurate measurement of oxygen concentrations in solutions is of interest to monitor oxygen-dependent processes in biotechnology or reactions in biochemistry. Usually a Clark electrode is employed for these purposes. In many cases, however, the use of a Clark electrode is limited due to the necessity of a direct contact of the electrode with the analyte. Some examples comprise turbid solutions in monitoring fermentation processes or complex matrices like colloid latex emulsions as investigated by our research group. Another important aspect distinguishing this protocol from other oxygen detection assays is the very small amount of only 500 µl sample volume required for the in vitro assay. This protocol allows for the rapid and reproducible determination of the oxygen concentration of latex emulsions but likely is transferable to many other applications. In this non-invasive assay, a small sensor spot with a diameter of only ~4 mm is placed in the reaction vessel (cuvette) and comes into contact with the analyte. The sensor spot is excited by light that is emitted by the transmitter unit and guided to the sensor spot via a light conducting cable. The emitted fluorescence light is quenched by dioxygen and the signal intensity is proportional to the concentration of dioxygen. Since oxygen is the co-substrate of polyisoprene cleavage by rubber oxygenases, the activity of the enzymes can be calculated by determination of the oxygen consumption. The second assay describes the extraction of enzyme-produced oligo-isoprenoids with ethyl acetate and their qualitative and quantitative determination by high pressure liquid chromatography (HPLC). For information on the biochemical and molecular biological properties of rubber oxygenases we refer to the following references for RoxA enzymes (Braaz et al., 2004 and 2005; Schmitt et al., 2010; Birke et al., 2012 and 2013; Seidel et al., 2013) and for Lcp (Hiessl et al., 2014; Birke and Jendrossek, 2014; Birke et al., 2015; Watcharakul et al., 2016; Röther et al., 2016).
Materials and Reagents
Duct tape (e.g., Tesa, extra Power universal)
50 ml Falcon tubes (e.g., SARSTEDT, catalog number: 62.559.001 )
15 ml Falcon tubes (e.g., SARSTEDT, catalog number: 62.554.502 )
2 ml reaction tubes (e.g., SARSTEDT, catalog number: 72.695.500 )
0.3 ml limited volume inserts (e.g., Brown, catalog number: 155650 )
Hot glue
Silicone Compound (e.g., RS Components, catalog number: 692-542 )
1.5 ml tubes (e.g., SARSTEDT, catalog number: 72.690.001 )
Protein determination assay (e.g., Pierce BCA Kit, Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23225 )
Latex milk, 60%, low ammonia (e.g., Weber&Schaer, Hamburg, catalog number: RSS LA )
Purified rubber oxygenases, Lcp or RoxA of known concentration
Methanol for HPLC (e.g., VWR, catalog number: 20864.320 )
Ethyl acetate (e.g., Carl Roth, catalog number: 7338 )
Nitrogen gas
Monopotassium phosphate (KH2PO4) (e.g., Carl Roth, catalog number: 3904 )
Dipotassium phosphate (K2HPO4) (e.g., Carl Roth, catalog number: 6875 )
Nonidet P-40 (e.g., Sigma-Aldrich, catalog number: 74385 )
Sodium phosphate buffer (KP), e.g., 100 mM, pH 7 (see Recipes)
Nonidet P-40 solution (see Recipes)
Natural rubber latex (see Recipes)
Diluted colloidal latex buffer (see Recipes)
Equipment
Oxy-4-mini transmitter (PreSens, catalog number: 200000767 )
Sharp scissors
Absorption cells (cuvettes), semi-micro, light path 10 mm, volume 1,400 µl, optical special glass, 4 pieces (e.g., Hellma analytics, catalog number: 114-10-20 )
Cuvette rack 16 x 1 cm (e.g., Carl Roth, catalog number: CNP5.1 )
Oxygen Sensor Spots, SP-PSt3-NAU-D5-YOP (PreSens, catalog number: 200000023 )
3 mm power drill
Light conducting cable (2.5 m, 4 pieces, POF-L2.5-1SMA) (PreSens, catalog number: 200000241 ; designated in the manual as ‘polymer optical fiber’)
Cryo storage box (e.g., Greiner Bio one International, catalog number: 802 202 )
Magnetic micro stirrer 5 x 2 mm, 4 pieces (e.g., Carl Roth, catalog number: 0955.2 )
Centrifuge (e.g., Eppendorf, model: 5417 C)
Autoclave
Heat-stable container
Pipette
Beaker
HPLC (e.g., Agilent Technologies, model: Agilent 1100 series; DAAD detector at 210 nm)
LiChrospher 100 RP-8 5 µm endcapped HPLC column (e.g., Trentec, catalog number: 124LP-85ER used in this assay; or alternatively EMD Millipore, catalog number: 150827 )
HPLC glass vial (e.g., Brown, catalog number: 155710 )
Fume cabinet
Laboratory thermometer (e.g., VOLTCRAFT, model: DET1R )
Software
Oxy4 V2 (Presens, Regensburg, Germany)
Excel (Microsoft, Redmont, USA)
Chem Station for LC 3D systems (Agilent Technologies, Waldbronn, Germany)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Röther, W., Birke, J. and Jendrossek, D. (2017). Assays for the Detection of Rubber Oxygenase Activities. Bio-protocol 7(6): e2188. DOI: 10.21769/BioProtoc.2188.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Biochemistry > Other compound > Oxygen
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,189 | https://bio-protocol.org/exchange/protocoldetail?id=2189&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Wheat Root-dip Inoculation with Fusarium graminearum and Assessment of Root Rot Disease Severity
Qing Wang
Sven Gottwald
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2189 Views: 10279
Edited by: Zhaohui Liu
Reviewed by: Swetha Reddy
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Fusarium graminearum is one of the most common and potent fungal pathogens of wheat (Triticum aestivum) and other cereals, known for causing devastating yield losses and mycotoxin contaminations of food and feed. The pathogen is mainly considered as a paradigm for the floral disease Fusarium head blight, while its ability to colonize wheat plants via root infection has been examined recently. F. graminearum has a unique infection strategy which comprises complex, specialized structures and processes. Root colonisation negatively affects plant development and leads to systemic plant invasion by tissue-adapted fungal strategies. The pathosystem wheat root - F. graminearum makes available an array of research areas, such as (i) the relatively unknown root interactions with a necrotrophic pathogen; (ii) genes and pathways contributing to (overall) Fusarium resistance; (iii) induced systemic (whole-plant) resistance; (iv) pathogenic strategies in a variety of host tissues; and (v) age-related changes in the single-genotype responses to seedling and adult plant (root/spike) infection. The presented Fusarium root rot bioassay allows for efficient infection of wheat roots, evaluation of disease severity and progress as well as statistical analysis of disease dynamics.
Keywords: Fusarium root rot Fusarium graminearum Root inoculation Disease severity assessment qPCR-based diagnosis Repeated measures ANOVA Host-pathogen interaction Wheat
Background
The Fusarium root rot (FRR) bioassay uses root-dipping for inoculation in combination with different measurements of disease severity parameter. This protocol is principally also applicable to investigations of other root-fungus interactions. The presented root-dip inoculation proved to be an effective and reliable method to investigate wheat root-Fusariuminteractions (phenotypically and histologically) and to screen wheat genotypes for their response to root infection (Wang et al., 2015). Using the described protocol, genetic, molecular, and metabolomic aspects of the FRR disease have meanwhile been examined with reliable results in terms of biological repetitions and consistent observations across different research approaches. This corresponds with observations made in a study on the Verticillium wilt disease, which characterised root-dipping as superior to the pot immersion or soil infestation method in terms of effectiveness and reliability (Trapero et al., 2013). Growing wheat seedlings in F. graminearum contaminated (root zone) soil led to FRR-genotype responses similar to root dip inoculation (Wang et al., 2015), but the infection conditions are comparatively less controlled in terms of root specificity and time of infection. This might be a restriction for investigations that require time-based analyses. The use of Petri dishes to germinate and inoculate roots via mycelial agar plugs is a method that has been applied to F. culmorum infection in wheat seedlings (Beccari et al., 2011). However, in comparison to root dip inoculation, this method is not applicable to adult plant root infection, as was done in our lab to study plant age-related effects on FRR disease progress and wheat responses.
In the described protocol, disease severity can be assessed by percentage reductions of diseased root biomass, root and shoot length as well as by rates of visible root necrosis. FRR significantly inhibits root biomass production of wheat seedlings and adult plants (Wang et al., 2015), which can be measured by quantitative real-time PCR (qPCR). Disease severity and progress in terms of fungal growth can be monitored by measuring the relative amount of F. graminearum DNA in the host tissue by qPCR. This also enables detection and monitoring of infection during or in case of symptom-free disease periods. The F. graminearum spread into the lower stem internode is a crucial event as it initiates the colonisation of upper stem internodes, leaves, further tillers and even spikes (Wang et al., 2015) and can be readily evaluated by appearance time and rate of visual necrosis. For the FRR disease progress over time, a good agreement was found between the quantified relative F. graminearum biomass in roots and the measured impacts on seedling growth or the rated visible symptoms (Wang et al., 2015). Briefly, seedlings with the lowest level of F. graminearum accumulation measured displayed relative minor root necrosis and reductions in root biomass and length, while relatively moderate and maximum levels of pathogen accumulation each led to correspondingly moderated and maximum disease impacts and symptoms. Finally, Fusarium resistance is quantitative or partial. Therefore, the combination of classical, subjective tools such as symptom rating with the sensitive, non-subjective qPCR diagnosis of pathogen and/or root biomass proved to be advantageous, in terms of an improved assessment of disease dynamics and genotype performances.
Materials and Reagents
Parafilm
Cheese cloth
Fine sand (washed and sieved), obtained from construction or agricultural market, autoclaved at 120 °C for 30 min
Aluminium foil
Polystyrene disk (thickness 10 mm)
F. graminearum isolate ‘IFA 65’ (University of Natural Resources and Applied Life Sciences, Department for Agrobiotechnology, Vienna, Austria)
Synthetic nutrient agar medium ‘Spezieller Nährstoffarmer Agar (SNA)’ (Leslie and Summerell, 2006)
Tween-20 (Carl Roth, catalog number: 9127 )
MENNO Florades (MENNO CHEMIE Norderstedt)
Sodium hypochlorite solution (Carl Roth, catalog number: 9062 )
Wuxal Super (Manna, Düsseldorf)
Liquid nitrogen
Potato dextrose broth (PDB) (Sigma-Aldrich, catalog number: P6685 )
FastStart Universal SYBR Green Master (Roche Molecular Systems, catalog number: 04913850001 or 04913914001 )
Potassium dihydrogen phosphate (KH2PO4)
Potassium nitrate (KNO3)
Magnesium chloride heptahydrate (MgSO4·7H2O)
Potassium chloride (KCl)
Glucose
Sucrose
Agar
Synthetic nutrient deficient agar (SNA) (see Recipes)
Equipment
Climate chamber with 20 °C under cool-white and near-UV light illumination for preparation of fungal culture
Haemocytometer
Light microscope (Zeiss)
Magnetic stirrer
Climate chamber with a 16 h photoperiod of 22 °C/18 °C day/night and 60% humidity for plant cultivation
Flat tray
Rotary shaker
Pot (7.5 x 7.5 x 8.0 cm)
NanoDrop ND 1000 (Thermo Fisher Scientific, model: NanoDrop ND 1000 )
ABI Step One Plus real-time PCR system (Applied Biosystems)
Software
PSS 20 (IBM SPSS Statistics 20; IBM Corp., USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, Q. and Gottwald, S. (2017). Wheat Root-dip Inoculation with Fusarium graminearum and Assessment of Root Rot Disease Severity. Bio-protocol 7(6): e2189. DOI: 10.21769/BioProtoc.2189.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Fungus
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
219 | https://bio-protocol.org/exchange/protocoldetail?id=219&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNP-IP (Modified Method)-Getting Majority of RNA from RNA Binding Protein in Cytoplasm
FL FengZhi Liu
Published: Vol 2, Iss 13, Jul 5, 2012
DOI: 10.21769/BioProtoc.219 Views: 15910
Download PDF
Ask a question
Favorite
Cited by
Abstract
Post-transcriptional regulation of gene expression is a ribonucleoprotein (RNP)-driven process, which involves RNA binding proteins (RBPs) and noncoding RNAs that regulate splicing, nuclear export, subcellular localization, mRNA stability and translation. mRNAs encoding proteins that function in a particular cell process or pathway can be found within a unique mRNP complex, which consists of mRNA and RNP. This provides valuable information regarding not only known components of a particular process or pathway, but importantly, leads to the identification of novel components representing potential therapeutic targets and biomarkers. In addition to those targets identified by pathway expansion, the specific RBPs (RNA binding proteina) regulating RNA functions may be potential therapeutic targets in their own right. RNP-IP is a technology that allows the isolation and identification of mRNAs, microRNAs and protein components of RNP complexes from cell extracts using antibodies to RBPs. Once purified, the RNAs present in the complex are analyzed to identify the target mRNAs using various molecular biology tools such as RT-PCR, gene expression analysis based on microarray technology (chip analysis), or sequencing. Using this modified method will get more RNA existing in cytoplasm. This method does not require a pre-clear step and getting the supernatant for western blot is different from the original method.
Materials and Reagents
Normal rabbit IgG
RIP-certified antibody (NBL, catalog number depends on what do you want to target)
NaCl
MgCl2
Nonidet P40
NaoAc
Protein A beads (GE Healthcare Dharmacon, catalog number: 17-0780-01 ) or Protein G beads (Thermo Fisher Scientific, catalog number: 22852 )
Ethanol (molecular biology grade)
2-Propanol (Molecular Biology)
Nuclease-free PBS
Nuclease-free water
Isotype control IgG (if necessary)
Digitornin
Aprotinin (final concentration 10 μg/ml)
Leupeptin (5 μg/ml)
Phenylmethylsulfonyl fluoride (PMSF) (final concentration 0.5 mM)
RNase inhibitor (Life Technologies, Invitrogen™, catalog number: 10777-019 )
Dithiothreitol (DTT) (reducing agent)
Lysis buffer (see Recipes)
Wash buffer (NT2) (see Recipes)
Precaution: Additional buffer preparation (see Recipes)
Equipment
Microcentrifuge capable of 15,000 x g
Microcentrifuge tube (1.5 ml or 2 ml) (nuclease-free) (recommendation; use low-adhesion tube for RIP-Assay)
Centrifuge capable of 2,000 x g
Centrifuge tube (15 ml or 50 ml)
Pipette (5 ml, 10 ml, 25 ml) (nuclease-free)
Pipette tip (10 μl, 20-100 μl , 200 μl , and 1,000 μl) (nuclease-free) (recommendation; use low-adhesion pipette tip for RIP-Assay)
Ultra low temperature freezer (-80 °C)
Freezer (below -20 °C)
End-over-end rotator
Vortex mixer
Gloves
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > RNA > RNA-protein interaction
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,190 | https://bio-protocol.org/exchange/protocoldetail?id=2190&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction, Purification and Quantification of Diffusible Signal Factor Family Quorum-sensing Signal Molecules in Xanthomonas oryzae pv. oryzae
Lian Zhou
XW Xing-Yu Wang
WZ Wei Zhang
SS Shuang Sun
Ya-Wen He
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2190 Views: 10184
Edited by: Zhaohui Liu
Reviewed by: Sadri ZnaidiManuela Roggiani
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Bacteria use quorum-sensing (QS) systems to monitor and regulate their population density. Bacterial QS involves small molecules that act as signals for bacterial communication. Many Gram-negative bacterial pathogens use a class of widely conserved molecules, called diffusible signal factor (DSF) family QS signals. The measurement of DSF family signal molecules is essential for understanding DSF metabolic pathways, signaling networks, as well as regulatory roles. Here, we describe a method for the extraction of DSF family signal molecules from Xanthomonas oryzae pv. oryzae (Xoo) cell pellets and Xoo culture supernatant. We determined the levels of DSF family signals using ultra-performance liquid chromatographic system (UPLC) coupled with accurate mass time-of-flight mass spectrometer (TOF-MS). With the aid of UPLC/MS system, the detection limit of DSF was as low as 1 µM, which greatly improves the ability to detect DSF DSF family signal molecules in bacterial cultures and reaction mixtures.
Keywords: Quorum sensing (QS) Diffusible signal factor (DSF) Xanthomonas oryzae pv. oryzae Ultraperformance liquid chromatographic system (UPLC) Mass spectrometry (MS) Purification Quantification
Background
Xanthomonas oryzae pv. oryzae (Xoo) is a causal agent of bacterial blight disease of rice, and produces multiple DSF family QS signals, including cis-11-methy-dodecenoic acid (DSF), cis-2-dodecenoic acid (BDSF), cis-10-methyl-2-dodecenoic acid (IDSF) and cis,cis-11-methyldodeca-2,5-dienoic acid (CDSF), to regulate virulence factor production (Figure 1). The biosynthesis, perception, and turnover of DSF family signals require components of the rpf (regulation of pathogenicity factors) cluster in Xoo. RpfF is a key DSF biosynthase with both acyl-ACP thioesterase and dehydratase activity. The two-component system, comprising the sensor kinase RpfC and the response regulator RpfG, plays an essential role in the perception and transduction of DSF family signals. RpfB has recently been characterized as a fatty acyl-CoA ligase (FCL), which functions in DSF family signal turnover in Xanthomonas (Wang et al., 2016; Zhou et al., 2015b). Deletion of rpfB in Xoo strain PXO99A leads to an over-production of DSF and BDSF and reduced production of extracellular polysaccharide (EPS), extracellular amylase activity. Moreover, attenuated pathogenicity has also been observed (Wang et al., 2016). Therefore, the RpfB-dependent DSF family signal turnover system is considered a naturally occurring signal turnover system in Xanthomonas. Detection and quantification of DSF family signals are very important in understanding the mechanisms of the DSF signaling system. As a result, detection methods for these signals have improved over the past few years. Initially, DSF detection relied on genetically engineered DSF biosensor-based detection systems (Slater et al., 2000; Wang et al., 2004), which provide an indirect way to analyze the activity of DSF family signals without differentiating structurally similar members of this group. Later, a detection method based on high-performance liquid chromatography (HPLC) was developed, which allowed a direct quantification of production levels of DSF family signal molecules by Xanthomonas (Wang et al., 2004; He et al., 2010; Zhou et al., 2015a). Recently, this HPLC-based method was further improved by using ultra performance liquid chromatographic system/ mass spectrometry (UPLC/MS),which offers better sensitivity and accuracy in the measurement of DSF family signals produced by Xoo, which will be presented in detail in this protocol (Zhou et al., 2015b; Wang et al., 2016).
Figure 1. Chromatogram of ethyl acetate extract of the culture supernatant of the DSF hyper-production mutant ΔrpfCΔrpfB of Xoo strain PXO99A. A. Four molecules of the DSF family QS signals are detected in the supernatant of ΔrpfCΔrpfB in nutrient broth. Among them, DSF and BDSF are the predominant signal molecules. B. The chemical structure of the four DSF family signal molecules.
Materials and Reagents
Pipette tips
2-100 μl (Eppendorf, catalog number: 0030000.870 )
50-1,000 μl (Eppendorf, catalog number: 0030000.919 )
1-10 ml (Eppendorf, catalog number: 0030000.765 )
2.0 ml microtubes (Corning, Axygen®, catalog number: MCT-200-C )
pH test strips (0.0-6.0 pH) (Sigma-Aldrich, catalog number: P4661 )
1.5 ml microtubes (Corning, Axygen®, catalog number: MCT-150-C )
50 ml centrifuge tube (Corning, catalog number: 430829 )
Acrodisc® MS syringe filters (0.2 µm, 13 mm, WWPTFE membrane) (Pall, catalog number: MS-3301 )
BD Tuberculin syringe with detachable needle (1 ml, 27 G x 1/2 in.) (BD, catalog number: 309623 )
1.5 ml Semi-micro cuvette (AS ONE, catalog number: 1-2855-02 )
HPLC screw cap vials (Agilent Technologies, catalog number: 5182-0714 )
400 µl polypropylene flat bottom insert (Agilent Technologies, catalog number: 5183-2087 )
Zorbax Eclipse XDB-C18 reverse phase column (Analytical, 4.6 x 150 mm, 5-micron) (Agilent Technologies, catalog number: 993967-902 )
Sterile Petri dishes (90 mm) (Sartorius, catalog number: 14-555-735 )
Xoo strain ΔrpfB, the rpfB deletion mutant of Xoo strain PXO99A, which overproduces DSF family signal molecules (Wang et al., 2016)
Cephalexin (Sigma-Aldrich, catalog number: 1099008 )
DSF (cis-11-methy-dodecenoic acid) (HPLC grade, purity ≥ 90.0%) (Sigma-Aldrich, catalog number: 42052 )
BDSF (cis-2-dodecenoic acid) (HPLC grade, purity ≥ 90.0%) (Sigma-Aldrich, catalog number: 49619 )
6 N hydrochloric acid solution (HCl) (Sigma-Aldrich, catalog number: 13-1686 )
Ethyl acetate (ACS reagent grade, purity ≥ 99.5%) (Sigma-Aldrich, catalog number: 676810 )
Methanol (HPLC grade) (Fisher Scientific, catalog number: A452-4 )
Phosphate buffered saline (PBS, pH 7.4) (Sigma-Aldrich, catalog number: P5368 )
Glycerol (Sigma-Aldrich, catalog number: 49781 )
Bacto peptone (BD, BactoTM, catalog number: 211677 )
Bacto beef extract (BD, BactoTM, catalog number: 211520 )
Sucrose (VetecTM reagent grade) (Sigma-Aldrich, catalog number: V900116 )
BBL yeast extract (BD, BBL, catalog number: 211931 )
NaOH
Agar (BD, catalog number: 281230 )
Sodium acetate (ACS reagent grade, purity ≥ 99.0%) (Sigma-Aldrich, catalog number: 791741 )
Acetic acid (ACS reagent grade, purity ≥ 99.7%) (Sigma-Aldrich, catalog number: 695092 )
Sterile deionized H2O
Glycerol stock (see Recipes)
Nutrient broth (NB, see Recipes)
Nutrient agar (NA, see Recipes)
0.2 M sodium acetate solution (pH 8.0) (see Recipes)
0.2 M acetic acid solution (pH 2.7) (see Recipes)
0.2 M sodium acetate buffer (pH 3.8) (see Recipes)
Cephalexin stock solution (20 mg/ml, see Recipes)
Equipment
Corning® glass Erlenmeyer flasks with screw cap
50 ml (Corning, catalog number: 4985-50 )
250 ml (Corning, catalog number: 4985-250 )
MaxQTM 6000 Incubated/Refrigerated shaker (Thermo Fisher Scientific, Thermo ScientificTM, model: MaxQTM 6000 , catalog number: SHKE6000-8CE)
UV-visible spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: BioMateTM 3S )
Microcentrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM LegendTM Micro 17R )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM MultifugeTM X1R )
Vortex mixer (VWR, catalog number: 10153-840 )
CentriVap benchtop concentrator with glass lid (Labconco, catalog number: 7810040 )
Pipettes
10-100 μl (Eppendorf, catalog number: 3120000046 )
100-1,000 μl (Eppendorf, catalog number: 3120000062 )
1-10 ml (Eppendorf, catalog number: 3120000089 )
Fume hood
Refrigerator (MEILING BIOLOGY & MEDICAL, model: DW-YL270 )
VibracellTM High Intensity Ultrasonic Liquid Processors (Sonics & Materials, model: VCX 500 ) connected with a Tapered Microtip probe (tip diameter: 3 mm) (Sonics & Materials, catalog number: 630-0422 )
Digital precise water bath (DAIHAN Scientific, model: WB-6 )
Pear shaped glass flask, Ts 29/38, 100 ml (Tokyo Rikakikai, EYELA, catalog number: 116150 )
UPLC/MS system
Ultra-performance liquid chromatographic system (UPLC) (Agilent Technologies, model: Agilent 1290 Infinity LC ) coupled with an accurate mass time-of-flight (TOF) MS (Agilent Technologies, model: Agilent 6230 Accurate-Mass TOF MS ) equipped with an Agilent Jet Stream (AJS) electrospray ionization (ESI) source
Diode array detector (Agilent Technologies, model: G4212A )
pH meter (Mettler Toledo, model: FE20 )
Diaphragm vacuum pump (Labconco, catalog number: 7393001 )
Rotary evaporator (Tokyo Rikakikai, EYELA, model: N-1100 )
Circulation cooling-water system (Tokyo Rikakikai, EYELA, model: CCA-1111 )
Autoclave (Panasonic Healthcare, model: MLS-3781L )
Software
Agilent MassHunter Workstation Data Acquisition Software (revision B.04)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhou, L., Wang, X., Zhang, W., Sun, S. and He, Y. (2017). Extraction, Purification and Quantification of Diffusible Signal Factor Family Quorum-sensing Signal Molecules in Xanthomonas oryzae pv. oryzae. Bio-protocol 7(6): e2190. DOI: 10.21769/BioProtoc.2190.
Download Citation in RIS Format
Category
Microbiology > Microbial biofilm > Quorum sensing factor
Plant Science > Plant immunity > Host-microbe interactions
Biochemistry > Other compound > Acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,191 | https://bio-protocol.org/exchange/protocoldetail?id=2191&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Rubisco Extraction and Purification from Diatoms
Jodi N. Young
AH Ana M. C. Heureux
RR Rosalind E. M. Rickaby
FM François M. M. Morel
SW Spencer M. Whitney
RS Robert E. Sharwood
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2191 Views: 10590
Edited by: Scott A M McAdam
Reviewed by: Agnieszka Zienkiewicz
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
This protocol describes a method to extract ribulose-1,5-bisphosphate carboxylase oxygenase (Rubisco) from diatoms (Bacillariophyta) to determine catalytic performance. This protocol has been adapted from use in cyanobacteria and higher plants (Andrews, 1988; Whitney and Sharwood, 2007). First part (steps A1-A3) of the extraction provides a crude extract of Rubisco that is sufficient for carboxylation assays to measure the Michaelis constant for CO2 (KC) and the catalytic turnover rate (kcatc). However, the further purification steps outlined (steps B1-B4) are needed for measurements of Rubisco CO2/O2 Specificity (SC/O, [Kane et al., 1994]).
Keywords: Rubisco Diatoms Extraction Phytoplankton Carbon fixation
Background
Ribulose-1,5-bisphosphate carboxylase oxygenase (Rubisco, EC 4.1.1.39) catalyzes the first step in the photosynthetic assimilation of CO2 and thus plays a fundamental role in photosynthesis and the global carbon cycle. Rubisco has been isolated from a wide range of organisms, from archaea, bacteria, algae to plants, and displays a diverse range of kinetics between organisms (Galmes et al., 2014; Tcherkez et al., 2006; Whitney et al., 2011). Knowledge of Rubisco kinetics is a key component for understanding how photosynthesis and thus the biological sink of carbon will respond to rising anthropogenic CO2. Diatoms are a group of unicellular algae responsible for ~20% of global photosynthesis (Falkowski and Raven, 2007) but as yet have been relatively poorly studied in terms of their Rubisco kinetics.
Isolation and purification of Rubisco is required before kinetic assays can be undertaken. Due to differences in cell structure and organic composition between organisms, the method for the purification of viable Rubisco enzyme needs to be continually optimized. This protocol describes a method to extract and purify Rubisco using size exclusion chromatography from diatoms in preparation for kinetic assays. The method is similar to Whitney and Sharwood (2007), used for the purification of Rubisco overexpressed in E. coli, in that a French press is used to mechanically rupture cells. The French press is necessary to obtain sufficient cell lysis as diatoms are unicellular with silica frustules, unlike plant tissue in which sufficient lysis is easily achieved by homogenizing frozen leaf tissue in a mortar and pestle. Furthermore, due to the low in vivo concentrations of Rubisco in diatoms (Losh et al., 2013), large diatom culture volumes concentrated via centrifugation, are needed to obtain enough biomass compared to plant tissue and E. coli lines with overexpressed Rubisco.
Materials and Reagents
15 ml centrifuge tubes with conical bottoms
50 ml centrifuge tubes with conical bottoms
500 ml centrifuge tubes with conical bottoms
1.5 ml microcentrifuge tubes
1 ml syringe
1 ml Bio-Scale mini Macro-Prep high Q ion exchange column (Bio-Rad Laboratories, catalog number: 7324120 )
Amicon Ultra-4 centrifugal filter (30,000 NMWL) (EMD Millipore, catalog number: UFC803024 )
Amicon Ultra-100 centrifugal filter (100,000 NWML) (EMD Millipore, catalog number: UFC910024 )
Diatoms
Liquid nitrogen
Polyvinylpolypyrrolidone (PVPP; insoluble) (Sigma-Aldrich, catalog number: 77627 )
Additional materials To test for Rubisco activity (Optional):
Labelled CO2 (as NaH14CO3) (5 mCi) (PerkinElmer, catalog number: NEC086H005MC )
Ribulose-1,5-bisphosphate (RuBP; synthesized, purified and stored anaerobically as described in Kane et al., 1998)
Acetic acid (Sigma-Aldrich, catalog number: A9967 or 27225 )
Note: The product acetic acid ( A9967 ) has been discontinued.
Methanol (Sigma-Aldrich, catalog number: M1770 or 494437 )
Note: The product Methanol ( M1770 ) has been discontinued.
Soluble protein (as determined by Bradford assay) (Coomassie Plus Assay Kit) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23236 )
Additional materials to test for protein using Native and SDS-PAGE (Optional):
Gel code blue stain (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 24590 )
4-12% Tris-glycine mini gels (Thermo Fisher Scientific, InvitrogenTM, catalog number: XV04120PK20 )
4-12% Bis-Tris gels (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0321PK2 )
SDS reducing buffer for SDS-PAGE (see Recipes)
TBS buffer for SDS-PAGE (see Recipes)
AttoPhos reagent (Astral Scientific, Gymea, NSW, Australia)
Antisera raised against the large subunit holoenzyme of Rubisco in Phaeodactylum tricornutum
Alkaline Phosphatase conjugated secondary antibody
4-(2-hydroxyethyl)-1-piperazinepropanesulfonic acid (EPPS) (Sigma-Aldrich, catalog number: E9502 )
Ethylenediaminetetraacetic acid disodium salt (EDTA) (Sigma-Aldrich, catalog number: E5134 )
Dithiothreitol (Sigma-Aldrich, catalog number: D0632 )
Plant protease inhibitor cocktail (Sigma-Aldrich, catalog number: P9599 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Triethanolamine (Sigma-Aldrich, catalog number: 90279 )
Magnesium acetate (Sigma-Aldrich, catalog number: M5661 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Extraction buffer (see Recipes)
Column buffer (see Recipes)
Column elution buffer (see Recipes)
Specificity (SC/O) buffer (see Recipes)
Note: All chemicals are of A.C.S. grade.
Equipment
French pressure cell press (Thermo Fisher Scientific, model: FA-078 )
Coulter Counter Z Series (Beckman Coulter, model: Z Series Coulter Counter )
Centrifuge (large volumes [1 L] at 2,000 x g, small volumes [< 15 ml] at 17, 600 x g, 4 °C)
Fume hood
Superdex 200 (GE Healthcare, catalog number: 17517501 )
FPLC (Äkta Pure 25) setup at 4 °C for size-exclusion chromatography using Superdex 200/30 (GE Healthcare, model: Äkta Pure 25 )
To confirm purification and activity of Rubisco:
Protein transfer apparatus and immunoblot imagining equipment – to check abundance and purity of extracted Rubisco
Radioisotope laboratory and associated septum capped vials and syringes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Young, J. N., Heureux, A. M. C., Rickaby, R. E. M., Morel, F. M. M., Whitney, S. M. and Sharwood, R. E. (2017). Rubisco Extraction and Purification from Diatoms. Bio-protocol 7(6): e2191. DOI: 10.21769/BioProtoc.2191.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Photosynthesis
Biochemistry > Other compound > Chlorophyll
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,192 | https://bio-protocol.org/exchange/protocoldetail?id=2192&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Polysome Analysis
Dipak Kumar Poria
Partho Sarothi Ray
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2192 Views: 19634
Edited by: HongLok Lung
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Polysome analysis is a method to separate mRNAs from a cell into actively translating and non-translating fractions depending on their association with polysomes. By this protocol, cell lysates are fractionated by sucrose density gradient ultracentrifugation. Free mRNA fraction and various ribosomal fractions, such as 40S, 60S, monosomes and polysomes are collected by fractionation. Association of particular mRNAs with these fractions is detected by reverse transcription – PCR to investigate the translational state of the mRNA.
Keywords: Translation Ribosome fractionation Polysome mRNA Sucrose density gradient Ultracentrifugation
Background
The cellular mRNAs are distributed into an actively translating and a non-translating pool at any point of time and can dynamically redistribute between these pools in response to various stimuli. The actively translating mRNAs have a higher number of ribosomes associated with them and the number of ribosome associated with an mRNA is a measure of the translation state of the mRNA. Therefore on fractionating the ribosomes from a cell, actively translating mRNAs will be found in the polysomal fraction whereas non-translating/poorly-translating mRNAs will be either found in the free mRNA fraction or associated with 40S ribosomal subunits. Polysome analysis is therefore a method to separate mRNAs from a cell into actively translating and non-translating fractions depending on their association with polysomes (Ray et al., 2009; Poria et al., 2016). Association of individual mRNAs with translating/non-translating fractions can be detected by RT-PCR, whereas the entire translation or non-translating pool of mRNAs can be identified by RNA sequencing or microarray analysis.
Materials and Reagents
Ultracentrifuge tube for SW41Ti (Seton Scientific, catalog number: 7030 )
Permanent ink marker
10 ml syringe with wide gauge luer lock cannula (Vita Needles, gauge 14)
10 cm dish (Eppendorf, catalog number: 0030702115 )
1.5 ml tube (RNase and DNase free) (Corning, Axygen®, catalog number: MCT-150-C or equivalent)
MCF7 human breast carcinoma cell line (ATCC, catalog number: HTB22 )
Cycloheximide (CHX) (AMRESCO, catalog number: 94271 )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
DEPC treated water (AMRESCO, catalog number: E174 )
Citrate saturated phenol (pH 4.5) (Sigma-Aldrich, catalog number: P4682 )
Chloroform (Sigma-Aldrich, catalog number: C2432 )
75% ethanol
Nuclease free water
Oligo dT primer
dNTP mix
5x RT buffer
Dithiothreitol (DTT) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0861 )
RNase inhibitor (Thermo Fisher Scientific, catalog number: EO0381 )
cDNA synthesis reagents (Thermo Fisher Scientific, InvitrogenTM, catalog number: 28025013 )
10x PCR buffer (with 15 mM MgCl2)
10 µM forward primer for gene of interest/control gene
10 µM reverse primer for gene of interest/control gene
PCR reagents (New England Biolabs, catalog number: M0273L )
Sucrose (RNase and DNase free) (AMRESCO, catalog number: 0335 )
Potassium chloride (KCl) (AMRESCO, catalog number: 0395 )
Magnesium chloride (MgCl2) (AMRESCO, catalog number: 0288 )
HEPES (pH 7.4) (Thermo Fisher Scientific, Affymetrix, catalog number: 16926 )
IGEPAL CA-360 detergent (Sigma-Aldrich, catalog number: I3021 )
Protease inhibitor cocktail (AMRESCO, catalog number: M250 )
10% sucrose solution (for 8 ml) (see Recipes)
50% sucrose solution (for 8 ml) (see Recipes)
Polysome lysis buffer (see Recipes)
Equipment
Gradient Station or any equivalent gradient fractionators (Biocomp, catalog number: 153-002 )
Tube holder
Ultra-centrifuge (Beckman Coulter, model: Optima L-70 or equivalent)
Rotor SW41Ti (Beckman Coulter, catalog number: 331362 )
200 µl pipette
Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 )
Fraction collector (Gilson, model: FC203B )
UV monitor (Bio-Rad Laboratories, model: EM1-EconoTM )
Balance
Vortex
Software
Gradient Master software (included with the Gradient Station)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Poria, D. K. and Ray, P. S. (2017). Polysome Analysis. Bio-protocol 7(6): e2192. DOI: 10.21769/BioProtoc.2192.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Protein
Biochemistry > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
How to fractionate after ultracentrifugation if there is not a fraction collection?
1 Answer
19 Views
Aug 3, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,193 | https://bio-protocol.org/exchange/protocoldetail?id=2193&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA-protein UV-crosslinking Assay
Dipak Kumar Poria
Partho Sarothi Ray
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2193 Views: 15898
Edited by: HongLok Lung
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
RNA-protein interactions play a crucial role in every aspect of RNA metabolism, and also plays a major role in post-transcriptional gene regulation. RNA-binding proteins have been implicated in viral gene expression (Ray and Das, 2002) and microRNA-mediated gene regulation (Poria et al., 2016). Here we have described the protocol which (1) covalently links transiently interacting RNA-protein complexes by UV crosslinking, (2) removes the unprotected RNA by RNase digestion and (3) detects the RNA-protein complexes by SDS-PAGE analysis. This protocol provides a rapid and reliable means to directly assay RNA-protein interactions and their kinetics using purified proteins and also help in identifying novel RNA-protein interactions
Keywords: RNA-protein interaction UV-crosslinking RNA-binding proteins
Background
RNA-protein interactions are mediated by transient non-covalent interactions such as electrostatic interactions and hydrogen bonds between specific residues in RNA and protein molecules. Short wave UV radiation can induce covalent bond formation between two closely placed aromatic rings. Aromatic ring structures are found in several amino acids in proteins and in nitrogenous bases in nucleic acids. Therefore, UV irradiation is used to covalently link RNA and interacting proteins, whereby the RNA-protein complex can be further analysed by SDS-Polyacrylamide gel electrophoresis. This protocol describes a simple and rapid assay system that can assay RNA-protein interactions and their binding kinetics in vitro. Also, mass spectrometric analysis of the fluorescently-labeled RNA-protein complexes obtained by this method can lead to identification of novel RNA-protein interactions.
Materials and Reagents
1.5 ml RNase, DNase free microcentrifuge tube (Corning, Axygen®, catalog number: MCT-150-C or equivalent)
96-well round-bottomed plate (Greiner Bio one International, catalog number: 650101 )
Agarose (Lonza, catalog number: 50004 )
Transcription Kit (MAXIscript® Kit) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM1312 or any equivalent)
10 µCi/µl α-P32 UTP (BRIT, catalog number: PLC 108 or PerkinElmer, catalog number: BLU007H250UC ) (Alternatively, Cy5-UTP can be used to generate fluorescently labelled RNA [GE Healthcare, catalog number: PA55026 ])
DNase I (optional) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EN0521 )
100% ethanol (EMD Millipore, catalog number: 100983 )
Nuclease free water
Ammonium acetate (Thermo Fisher Scientific, Affymetrix, catalog number: 75901 )
Glycerol (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15514 )
Urea-polyacrylamide gel
Yeast tRNA (Sigma-Aldrich, catalog number: R8759 )
RNase inhibitor (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EO0381 )
RNase A (Sigma-Aldrich, catalog number: R6513 )
10% SOD-PAGE
Pre-stained protein markers or radiolabeled protein markers
HEPES (pH 7.4) (Thermo Fisher Scientific, Affymetrix, catalog number: 16926 )
Potassium chloride (KCl) (AMRESCO, catalog number: 0395 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (AMRESCO, catalog number: 0288 )
Dithiothreitol (DTT) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0861 )
EDTA (AMRESCO, catalog number: 0105 )
ATP (Sigma-Aldrich, catalog number: A8937 )
SDS
Tris-Cl (pH 6.8)
Bromophenol blue
2x RNA binding buffer (see Recipes)
2x denaturing protein loading buffer (see Recipes)
Equipment
Refrigerated centrifuge (Eppendorf, model: 5418 R )
UV cross-linker or UV torch with 254 nm wavelength UV (UVP, model: CL1000 )
Vertical gel electrophoretic system (Bio-Rad Laboratories, model: Mini-PROTEAN Tetra Cell , catalog number: 1658000EDU)
Scintillation counter (Hidex, model: Triathler or any equivalent model)
Phosphorimager (GE Healthcare, model: Typhoon Trio or any equivalent model)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Poria, D. K. and Ray, P. S. (2017). RNA-protein UV-crosslinking Assay. Bio-protocol 7(6): e2193. DOI: 10.21769/BioProtoc.2193.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Protein
Molecular Biology > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,194 | https://bio-protocol.org/exchange/protocoldetail?id=2194&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Adeno-associated Virus Rep DNA Binding Using Fluorescence Anisotropy
FZ Francisco Zarate-Perez
VS Vishaka Santosh
Martino Bardelli
LA Leticia Agundez
RL R. Michael Linden
EH Els Henckaerts
CE Carlos R. Escalante
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2194 Views: 6796
Edited by: Yannick Debing
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Quantitative measurement of proteins binding to DNA is a requisite to fully characterize the structural determinants of complex formation necessary to understand the DNA transactions that regulate cellular processes. Here we describe a detailed protocol to measure binding affinity of the adeno-associated virus (AAV) Rep68 protein for the integration site AAVS1 using fluorescent anisotropy. This protocol can be used to measure the binding constants of any DNA binding protein provided the substrate DNA is fluorescently labeled.
Keywords: Adeno-associated virus Rep proteins Fluorescence Anisotropy Protein-DNA binding
Background
Fluorescence polarization anisotropy has become one of the most popular methods to measure the interaction of proteins with a large variety of ligands including small molecules, nucleic acids, peptides and other proteins. The method is quick, inexpensive and can be modified to be used in plate readers equipped with fluorescence detectors. The technique is based on the principle that when a fluorescent molecule is excited with plane polarized light, the emitted light remains polarized in the same plane if the molecule is stationary or if it rotates slowly. In contrast, if the molecule rotates rapidly (due to small size), the light is emitted in a different plane. These changes can be quantified by the normalized differences in parallel and perpendicular intensities. Polarization is defined as P = (I= - I⊥)/(I= + I⊥), where I= is the parallel intensity and I⊥ is the perpendicular intensity. An alternative way is to define the anisotropy, A = (I= - I⊥)/(I= + 2I⊥). Both parameters can be used interchangeably to describe the changes in polarization. Thus, when a small fluorescent DNA molecule binds a protein, the larger complex will rotate more slowly than the DNA molecule, changing the plane of the polarized light and increasing the anisotropy value. We have used this technique to measure the binding affinity of AAV Rep68 for different DNA substrates (Yoon-Robarts et al., 2004; Musayev et al., 2015; Bardelli et al., 2016). The non-structural AAV Rep proteins carry out most of the DNA transactions that are required to complete the virus life cycle. These include DNA replication, transcriptional regulation, site-specific integration and packaging of DNA into preformed capsids (Im and Muzyczka, 1990; Weitzman et al., 1994; Wonderling et al., 1995). The large AAV Rep proteins (Rep78/Rep68) contain an N-terminal origin binding domain (OBD) that specifically binds the Rep binding sites (RBS) and displays nuclease activity (Hickman et al., 2004; Musayev et al., 2015). The RBS sites consist of two or more 5’-GCTC-3’ repeats and are found at the viral origin of replication, in several promoters and at the AAVS1 integration site (Weitzman et al., 1994; McCarty et al., 1994). In addition, a C-terminus SF3 helicase domain is required for high affinity binding and DNA unwinding (James et al., 2003; Mansilla-Soto et al., 2009).The protocol described here can be modified to fit any protein-DNA system or any other instrument such as plate readers.
Materials and Reagents
Pipette tips
15 ml conical tubes (USA scientific, catalog number: 1475-1611 )
Black 1.5 ml Eppendorf tubes (Argos Technologies, catalog number: T7456-001 )
16 gauge needle (BD, catalog number: 305197 )
Fluorescein labeled AAVS1 sense DNA strand with the following sequence:
5’-TGGCGGCGGTTGGGGCTCGGCGCTCGCTCGCTCGCTGGGCG-3’
AAVS1 anti-sense strand with the sequence: 5’-CGCCCAGCGAGCGAGCGA GCGCCGAGCCCCAACCGCCGCCA-3’
Note: DNA can be synthesized using any synthesis facility such as IDT services at a 100 nanomole scale. The sense strand can be labeled at the 5’ end with fluorescein (6-FAM).
Purified recombinant AAV Rep68 protein was expressed in E.coli and purified using Ni-NTA affinity column followed by a gel filtration column as described previously (Musayev et al., 2015)
Sodium hydroxide (NaOH)
Sodium chloride (NaCl) (Fisher Scientific, catalog number: BP358 )
2-Amino-2-(hydroxymethyl)propane-1,3-diol (Tris) (Sigma-Aldrich, catalog number: T1503 )
Ethylendiaminetetraacetic acid (EDTA) (Gold Bio, catalog number: E-210-1 )
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gold Bio, catalog number: H-401-500 )
Tris(2-carboxyethyl)phosphine (TCEP) (Gold Bio, catalog number: TECP )
Double distilled water
Q1 buffer (see Recipes)
Q2 buffer (see Recipes)
TES buffer (see Recipes)
Binding buffer (see Recipes)
Equipment
Pipettes
MonoQ anion-exchange column (GE Healthcare, catalog number: 17-5166-01 )
HiTrap 5 ml desalting column (GE Healthcare, catalog number: 11-0003-29 )
GE Healthcare AKTA purifier
Labconco Freezone 2/5 Benchtop lyophilizer
Thermo Scientific NanoDrop ND-2000c spectrophotometer (Thermo Fisher Scientific, model: NanoDropTM 2000/2000c )
Denville IncuBlock heating block
ISS PC1 fluorimeter (ISS, model: PC1TM )
Software
Microsoft Excel
GraphPad Prism 7TM
Vinci Instrument control and data acquisition software from ISS
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zarate-Perez, F., Santosh, V., Bardelli, M., Agundez, L., Linden, R. M., Henckaerts, E. and Escalante, C. R. (2017). Determination of Adeno-associated Virus Rep DNA Binding Using Fluorescence Anisotropy. Bio-protocol 7(6): e2194. DOI: 10.21769/BioProtoc.2194.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Biochemistry > Protein > Activity
Molecular Biology > Protein > Protein-DNA binding
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,195 | https://bio-protocol.org/exchange/protocoldetail?id=2195&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
3D Stroma Invasion Assay
YC Yvette May Coulson-Thomas
Vivien Jane Coulson-Thomas
Published: Vol 7, Iss 6, Mar 20, 2017
DOI: 10.21769/BioProtoc.2195 Views: 8257
Edited by: HongLok Lung
Original Research Article:
The authors used this protocol in Nov 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2011
Abstract
We have developed a 3D co-culture system composed of fibroblasts and colorectal cancer cells that enables us to study the desmoplastic reaction. This method also enables us to study the influence of the desmoplastic reaction on the migration of colorectal cancer cells through the surrounding stroma. This protocol has been previously published (Coulson-Thomas et al., 2011) and is described here in more detail.
Keywords: 3D culture Fibroblasts Cancer cells Desmoplastic reaction Cancer cell invasion Stromagenic system
Background
The progression of cancer relies on intricate cross-talk between the cancer cells and surrounding cells, such as fibroblasts, inflammatory cells and endothelial cells, which form the cancer microenvironment. Fibroblasts are the major extracellular matrix producing cells and are responsible for the structural formation of tissues. Fibroblasts surrounding tumors are ‘activated’ by cancer cells into tumor-associated fibroblasts (TAFs) and play key roles in tumorigenesis and metastasis. In some cancers, TAFs up-regulate extracellular matrix expression producing an unorganized matrix, consisting mainly of collagen fibers and proteoglycans, which affects cancer cell proliferation, migration and spread. This is called the desmoplastic reaction, and during cancer cell growth different tumors may exhibit various grades of desmoplasia.
Materials and Reagents
NuncTM Lab-TekTM II Chamber SlideTM System with 2 wells (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 154461 )
NuncTM cell culture dishes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 172931 )
Cotton swabs
Human colorectal fibroblasts CCD-112CoN (ATCC, catalog number: CRL-1541 )
Caco-2 and HCT 166 cancer cell lines isolated from primary colorectal tumors (ATCC, catalog numbers: HTB-37 and CCL-247 )
pEGFP-N1 (TaKaRa Bio, Clontech)
DMEM culture medium (Thermo Fisher Scientific, GibcoTM)
RPMI culture medium (Thermo Fisher Scientific, GibcoTM)
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM)
L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25-030-081 )
Penicillin/streptomycin (Thermo Fisher Scientific, InvitrogenTM)
L-ascorbic acid (Sigma-Aldrich, catalog number: A4403 )
Collagen I
Anti-fibronectin (BD transduction laboratories)
FuGENE® HD transfection reagent (Promega, catalog number: E2311 )
Trypsin/EDTA (Thermo Fisher Scientific, GibcoTM)
Paraformaldehyde, aqueous solution - 16% (Electron Microscopy Sciences, catalog number: 15700 )
Complete media for Caco-2 and HCT 166 cells (see Recipes)
Complete media for fibroblasts (see Recipes)
Media for maintaining 3D cultures (see Recipes)
Equipment
Ultra-fine forceps with a straight tip (Fine Science tools, catalog number: 11399-80 )
CO2 cell culture incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: HeracellTM 150i , catalog number: 51026280)
Table top centrifuge (Eppendorf, model: 5702 RH )
Vi-CELL XR cell counter (Beckman Coulter)
Biological safety cabinets (Thermo Fisher Scientific, Thermo ScientificTM, model: Safe 2020 Class II , catalog number: 51026639)
Scanning confocal inverted microscope (Zeiss, model: LSM 510 )
Time-lapse confocal microscope (Zeiss, model: LSM 710 )
Software
Java ImageJ and the Zen Imaging software from Zeiss
Excel (Microsoft)
GraphPad Prism (GraphPad Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Coulson-Thomas, Y. M. and Coulson-Thomas, V. J. (2017). 3D Stroma Invasion Assay. Bio-protocol 7(6): e2195. DOI: 10.21769/BioProtoc.2195.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Tumor microenvironment
Cancer Biology > Cancer biochemistry > Protein
Cell Biology > Cell-based analysis > Extracellular microenvironment
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,196 | https://bio-protocol.org/exchange/protocoldetail?id=2196&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Heparan Sulfate Identification and Characterisation: Method I. Heparan Sulfate Identification by NMR Analysis
SC Susan M. Carnachan
SH Simon F.R. Hinkley
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2196 Views: 7813
Edited by: Vivien Jane Coulson-Thomas
Reviewed by: Masahiro Morita
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
Heparin and heparan sulfate (HS) may be purified from complex biological matrices and are often isolated in sub-milligram quantities but not unequivocally identified by spectroscopic means. This protocol details a methodology to rapidly assess the gross compositional features and approximate purity of HS by 1H nuclear magnetic resonance. A complimentary method for identification and characterisation of heparan sulfate can be found at Carnachan and Hinkley (2017).
Keywords: Heparan sulfate Glycosaminoglycan’s Chemical characterization NMR
Background
A number of methods exist for the analysis of heparin and HS. This protocol aims to provide a reproducible and widely applicable method for the rapid identification of heparin/HS by nuclear magnetic resonance (NMR). Small samples (~0.3 mg) can be readily assessed in a non-destructive manner to ascertain an approximate purity that identifies other common contaminants found in biological samples when purifying heparin-like molecules. The procedures described herein are intended to provide a stepwise protocol suitable for a laboratory inexperienced in glycosaminoglycan (GAG) analysis.
Materials and Reagents
Microcentrifuge tubes (1.5 ml) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3456 )
5 mm NMR tubes (Norell, catalog number: XR-55TM-7 )
Chondroitin sulfate A (from bovine trachea) (Sigma-Aldrich, catalog number: C8529 )
Dermatan sulfate (Sigma-Aldrich, catalog number: C3788 )
Chondroitin sulfate C (from shark cartilage, contains ~10% chondroitin sulfate A) (Sigma-Aldrich, catalog number: C4384 )
Heparan sulfate (from porcine mucosa) (Celsus Laboratories, catalog number: HO-03103 )
Heparin (from porcine mucosa) (New Zealand Pharmaceuticals, batch number: 5108356 )
Heparanoid (from porcine mucosa) (New Zealand Pharmaceuticals, batch number: BX-090-010 )
Deuterium oxide (99.9 atom%) (Cambridge Isotope Laboratories, catalog number: DLM-4-100 )
Tert-butanol (t-BuOH, ACS reagent) (Sigma-Aldrich, catalog number: 360538 )
Equipment
NMR spectrometer (Bruker, model: Bruker Avance DPX-500 )
Freeze drier (Eyela, model: FD-1 )
Pipettors (0.5-10 μl, 20-200 μl and 100-1,000 μl) (Eppendorf)
Software
Software Topspin 2.6
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Carnachan, S. M. and Hinkley, S. F. R. (2017). Heparan Sulfate Identification and Characterisation: Method I. Heparan Sulfate Identification by NMR Analysis. Bio-protocol 7(7): e2196. DOI: 10.21769/BioProtoc.2196.
Download Citation in RIS Format
Category
Biochemistry > Carbohydrate > Disaccharide
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,197 | https://bio-protocol.org/exchange/protocoldetail?id=2197&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Heparan Sulfate Identification and Characterisation: Method II. Enzymatic Depolymerisation and SAX-HPLC Analysis to Determine Disaccharide Composition
SC Susan M. Carnachan
SH Simon F.R. Hinkley
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2197 Views: 8684
Edited by: Vivien Jane Coulson-Thomas
Reviewed by: Masahiro Morita
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
Heparan sulfate (HS) is purified from complex matrices and often not fully characterised to validate its assignment. The characterisation of heparins and heparan sulfates through enzymatic depolymerisation and subsequent strong anion-exchange high performance liquid chromatography (SAX-HPLC) analysis and quantitation of the resulting disaccharides is a critical tool for assessing the structural composition of this class of compound. This protocol details a methodology to reproducibly determine the disaccharide composition of heparan sulfate by enzymatic depolymerisation and SAX-HPLC analysis. A complementary method for identification and characterisation of heparan sulfate can be found at Carnachan and Hinkley (2017).
Keywords: Heparan sulfate Glycosaminoglycan’s Chemical characterization Enzymatic depolymerisation HPLC
Background
A number of methods exist for the structural analysis of heparin and HS. This protocol aims to provide an optimised methodology for the enzymatic depolymerisation of heparin and HS and the analysis and quantification of the disaccharides produced therein. Very few published analyses consider all aspects of the gross composition including the extent of depolymerisation in conjunction with the disaccharide composition obtained (Skidmore et al., 2006 and 2010; Carnachan et al., 2016). This is particularly worrisome when the sample is subsequently utilised in a biological assay that is invariably dose-dependent. The enzymatic procedure described herein is the culmination of a detailed study investigating the conditions necessary for optimal enzyme activity and HS depolymerisation (Carnachan et al., 2016). This procedure is intended to provide a stepwise protocol suitable for a laboratory inexperienced in glycosaminoglycan (GAG) analysis.
Materials and Reagents
Microcentrifuge tubes (1.5 ml) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3456 )
Syringe filters (0.22 μm) (hydrophilic PTFE) (MicroScience Hydraflow, catalog number: MS SF13HY022 )
Glass HPLC vials (2 ml) (Thermo Fisher Scientific, catalog number: THC11090500 )
Septum lids (Thermo Fisher Scientific, catalog number: THC11090500 )
Heparan sulfate (from porcine mucosa) (Celsus Laboratories, catalog number: HO-03103 )
Heparin lyase I (heparinase I or heparitinase III, EC 4.2.2.7, [0.5 IU]) (IBEX Technologies, catalog number: 50-010 )
Heparin lyase II (heparinase II or heparitinase II, no EC number assigned, [0.5 IU]) (IBEX Technologies, catalog number: 50-011 )
Heparin lyase III (heparinase III or heparitinase I, EC 4.2.2.8, [0.5 IU]) (IBEX Technologies, catalog number: 50-012 )
Heparin disaccharide standards produced by the action of bacterial heparinase on high grade porcine heparin (Iduron, catalog numbers: HD001 - HD008 and HD010 - HD013 )
Water (distilled) (Sartorius arium® pro UV ultrafiltered; > 18.5 MΩ)
Bovine serum albumin (BSA) (Thermo Fisher Scientific, GibcoTM, catalog number: 30060727 )
Na2HPO4·H2O (EMD Millipore, catalog number: 106586 )
NaOAc (ACS) (EMD Millipore, catalog number: 1062680250 )
CaOAc·xH2O (Sigma-Aldrich, catalog number: 25011 )
Sodium chloride (NaCl) (99.99%) (EMD Millipore, Suprapur®, catalog number: 1.06406 )
Hydrochloric acid (HCl) (37%) (EMD Millipore, catalog number: 100317 ) and NaOH (Sigma-Aldrich, catalog number: S8045 ) made up to 1 N aqueous solutions for adjusting pH
Phosphoric acid (85%) (Sigma-Aldrich, catalog number: 79606 )
Enzyme storage buffer (see Recipes)
Digestion media (see Recipes)
Mobile phases for HPLC analysis (see Recipes)
Equipment
High performance liquid chromatography (HPLC) machine (Infinity with multiple wavelength detector) (Agilent Technologies, model: 1260 )
Strong anion-exchange HPLC column (4 x 250 mm) (ProPacTM PA1, Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 039658 ) with guard column (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 039657 )
Pipettors (0.5-10 μl, 20-200 μl and 100-1,000 μl) (Eppendorf)
Incubator (BINDER, model: KBF-115 )
Rotator (Cole-Parmer, Stuart, model: SB3 )
Centrifuge (Eppendorf, model: Minispin® plus , catalog number: 5453000011)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Carnachan, S. M. and Hinkley, S. F. R. (2017). Heparan Sulfate Identification and Characterisation: Method II. Enzymatic Depolymerisation and SAX-HPLC Analysis to Determine Disaccharide Composition. Bio-protocol 7(7): e2197. DOI: 10.21769/BioProtoc.2197.
Download Citation in RIS Format
Category
Biochemistry > Carbohydrate > Disaccharide
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,198 | https://bio-protocol.org/exchange/protocoldetail?id=2198&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA Strand Displacement Assay for Hepatitis E Virus Helicase
VN Vidya P. Nair
MS Milan Surjit
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2198 Views: 7613
Edited by: Yannick Debing
Reviewed by: Vamseedhar RayaproluDavid Paul
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
The hepatitis E virus (HEV) helicase uses ATP to unwind the RNA duplexes. This is an essential step for viral replication. This protocol aims to measure the double strand RNA unwinding activity of the HEV helicase.
Keywords: Hepatitis E virus RNA virus Helicase Helicase assay Viral replication Nonradioactive helicase assay
Background
The RNA unwinding activity of HEV helicase has been measured using radiolabeled double stranded RNA (dsRNA, Karpe et al., 2010). We have established a non-radioactive assay protocol for measuring the dsRNA unwinding activity of the HEV helicase. This assay utilizes a fluorescently tagged RNA to measure the activity of the HEV helicase protein purified from human hepatoma cell, thus eliminating the need to handle radioactive material.
Materials and Reagents
1.5 ml microcentrifuge tube
60 mm plates
1.6 ml RNase free microcentrifuge tube
PVDF (Polyvinylidene fluoride) membrane (Pall, catalog number: BSP0149 )
Mammalian expression plasmids (details in Nair et al., 2016):
pCDNA5 Helicase-flag [HEV helicase sequence was PCR amplified using primers: pCDNA5 HEL-flag FP, pCDNA5 HEL-flag RP; digested with HindIII and ligated into pCDNA5 vector digested with HindIII and EcoRV]
pUNO ORF2-flag [ORF2 with C-terminal Flag tag was PCR amplified with primers: pUNO ORF2-flag FP, pUNO ORF2-flag RP; digested with BglII and ligated into pUNO vector digested with NheI [blunted] and BamHI]
Huh7 human hepatoma cells (obtained from Dr. C. M. Rice; Blight et al., 2000)
RNA oligos: HRNA1 5’-UUUUUUUUUUUUCGCUGAUGUCGCCUGG-3’ and HRNA2 5’-[6FAM] CCAGGCGACAUCAGCG-3’ (Sigma-Aldrich, USA)
Nuclease-free water (Thermo Fisher Scientific, AmbionTM, catalog number: AM9937 )
Ethidium bromide solution (Sigma-Aldrich, catalog number: E1510 )
Glycogen (Sigma-Aldrich, catalog number: G0885 )
Ethanol (EMD Millipore, catalog number: 100983 )
Lipofectamine 2000 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668019 )
DMEM
10% fetal bovine serum (FBS)
Phosphate-buffered saline (PBS) (Bio Basic, catalog number: PD0100 )
Flag M2 agarose resin (Sigma-Aldrich, catalog number: A2220 )
Flag peptide (Sigma-Aldrich, catalog number: F4799 )
DEPC-treated water (Thermo Fisher Scientific, AmbionTM, catalog number: AM9922 )
Octa-probe antibody (Santa Cruz Biotechnology, catalog number: sc-807 )
Skimmed milk (Sigma-Aldrich, catalog number: 70166 )
Note: This product has been discontinued.
Anti-rabbit IgG Horseradish peroxidase(HRPO) (Santa Cruz Biotechnology, catalog number: sc-2004 )
Clarity Western ECL blotting substrate (Bio-Rad Laboratories, catalog number: 1705061 )
Silver stain kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 24612 )
Bradford assay reagent (Bio-Rad Laboratories, catalog number: 5000002 )
RNAsin
ATP
Proteinase K (Sigma-Aldrich, catalog number: P2308 )
Glycogen (Sigma-Aldrich, catalog number: G0885 )
Tris (Sigma-Aldrich, catalog number: T6066 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Ammonium acetate (Sigma-Aldrich, catalog number: A1542 )
SDS (Sigma-Aldrich, catalog number: L3771 )
Ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’,-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: 03777 )
Triton X-100 (Sigma-Aldrich, catalog number: 93418 )
Note: This product has been discontinued.
Sodium pyrophosphate tetrabasic decahydrate (Na4P2O4·10H2O) (Sigma-Aldrich, catalog number: S6422 )
β-glycerol phosphate (Sigma-Aldrich, catalog number: 50020 )
Sodium orthovanadate (Na3VO4) (Sigma-Aldrich, catalog number: S6508 )
Protease inhibitor cocktail tablet (Roche Diagnostics, catalog number: 04693132001 )
HEPES (Sigma-Aldrich, catalog number: H8651 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
BSA
DL-dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
Tween 20
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Xylene cyanol FF (Sigma-Aldrich, catalog number: X4126 )
Annealing buffer (see Recipes)
Soaking buffer (see Recipes)
IP buffer (see Recipes)
Strand displacement buffer (see Recipes)
5x termination buffer (see Recipes)
2x proteinase K buffer (see Recipes)
Phosphate buffered saline with 0.1% Tween 20 (PBST) (see Recipes)
50 mg/ml proteinase K (see Recipes)
10 mg/ml glycogen (see Recipes)
RNA loading dye (see Recipes)
Equipment
Vertical electrophoresis mini apparatus
Gel documentation system (Bio-Rad Laboratories, model: ChemiDocTM MP )
NanoDrop (Thermo Fischer Scientific, USA)
Heat block
Water bath
Refrigerated table top centrifuge
-80 °C deep freezer
Flip flop rocker
5% CO2 incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Nair, V. P. and Surjit, M. (2017). RNA Strand Displacement Assay for Hepatitis E Virus Helicase. Bio-protocol 7(7): e2198. DOI: 10.21769/BioProtoc.2198.
Nair, V. P., Anang, S., Subramani, C., Madhvi, A., Bakshi, K., Srivastava, A., Shalimar, Nayak, B., Ct, R. K. and Surjit, M. (2016). Endoplasmic reticulum stress induced synthesis of a novel viral factor mediates efficient replication of genotype-1 hepatitis E virus. PLoS Pathog 12(4): e1005521.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > RNA
Biochemistry > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,199 | https://bio-protocol.org/exchange/protocoldetail?id=2199&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA-dependent RNA Polymerase Assay for Hepatitis E Virus
VN Vidya P. Nair
SA Saumya Anang
AS Akriti Srivastava
MS Milan Surjit
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2199 Views: 10221
Edited by: Yannick Debing
Reviewed by: Vamseedhar RayaproluDavid Paul
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
RNA-dependent RNA polymerase (RdRp) is essential for the replication of viral RNA for RNA viruses. It synthesizes the complementary strand of viral genomic RNA, which is used subsequently as a template to generate more copies of viral genome. This assay measures activity of the hepatitis E virus (HEV) RdRp. In contrast to protocols available to assay the RdRp activity of many other viruses, this assay utilizes DIG-11-UTP as a nonradioactive alternative to 32P-UTP, thereby increasing the convenience of performing the assay.
Keywords: Hepatitis E virus RNA virus RdRp RdRp assay Viral replication Nonradioactive RdRp assay
Background
No assay was available to measure the activity of HEV RdRp. RdRp activity has been measured in few other viruses such as hepatitis C virus using a radiolabeled nucleotide (Behrens et al., 1996). We have adapted the protocol described by Behrens et al. (1996) and modified it to establish a non-radioactive assay protocol, which is dependent on incorporation of DIG-11-UTP into the antisense RNA strand as a measure of the activity of HEV RdRp. This assay utilizes an in vitro synthesized viral RNA fragment as a template to measure the activity of HEV RdRp protein purified from human hepatoma cells using a chemiluminescence-based strategy.
Materials and Reagents
60 mm plates
1.6 ml RNase free microcentrifuge tube
PVDF (Polyvinylidene fluoride) membrane (Pall, catalog number: BSP0149 )
Nylon membrane (Pall, catalog number: 60207 )
Whatman filter paper (Sigma-Aldrich, catalog number: WHA10426972 )
Cling film wrap/plastic food wrap (available in general stores/supermarkets)
Blotting paper (Praveen Scientific, catalog number: PSC 006 )
Note: It is general blotting paper, used in labs in routine application, similar to but cheaper than Whatman filter paper.
Mammalian expression plasmids (pUNO RdRp-flag [RdRp sequence with C-terminal flag tag was PCR amplified, digested with AgeI, NheI and ligated into pUNO vector digested with same], pUNO ORF2-flag [ORF2 with C-terminal flag tag was PCR amplified with primers: pUNO ORF2-flag FP, pUNO ORF2-flag RP; digested with BglII and ligated into pUNO vector digested with NheI [blunted] and BamHI); Nair et al. [2016])
Huh7 (human hepatoma cells, obtained from Dr. C. M. Rice; Blight et al. [2000])
pSKHEV2 RdRp template (pSK HRt) plasmid (Genbank No. AF444002.1, Emerson et al., 2004)
Lipofectamine 2000 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668019 )
DMEM
10% fetal bovine serum (FBS)
Phosphate-buffered saline (PBS) (Bio Basic, catalog number: PD0100 )
Flag M2 agarose resin (Sigma-Aldrich, catalog number: A2220 )
Flag peptide (Sigma-Aldrich, catalog number: F4799 )
Octa-probe antibody (Santa Cruz Biotechnology, catalog number: sc-807 )
Skimmed milk powder (Sigma-Aldrich, catalog number: 70166 )
Note: This product has been discontinued.
Anti-rabbit IgG Horseradish peroxidase(HRPO) (Santa Cruz Biotechnology, catalog number: sc-2004 )
Clarity Western ECL blotting substrate (Bio-Rad Laboratories, catalog number: 1705061 )
Silver stain kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 24612 )
Bradford assay reagent (Bio-Rad Laboratories, catalog number: 5000002 )
StuI, NheI and Tth111I restriction enzymes
BglII (New England Biolabs, catalog number: R0144L )
PCR purification kit (Agilent Technologies, catalog number: 400771 )
mMessage mMachine T7 kit (Thermo Fisher Scientific, AmbionTM, catalog number: AM1344 )
RNAsin
ATP
CTP
GTP
UTP
DIG-UTP
Actinomycin D (Sigma-Aldrich, catalog number: A1410 )
DMSO
RNase A
Proteinase K (Sigma-Aldrich, catalog number: P2308 )
Glycogen (Sigma-Aldrich, catalog number: G0885 )
Ethanol (EMD Millipore, catalog number: 100983 )
Nuclease free water (Thermo Fisher Scientific, AmbionTM, catalog number: AM9937 )
Agarose (Bio Basic, catalog number: AB0014 )
DEPC-treated water (Thermo Fisher Scientific, AmbionTM, catalog number: AM9922 )
37% formaldehyde (Sigma-Aldrich, catalog number: F8775 )
Formamide (Sigma-Aldrich, catalog number: F9037 )
Gel loading dye
Millennium marker (Thermo Fisher Scientific, AmbionTM, catalog number: AM7151 )
Ethidium bromide (Sigma-Aldrich, catalog number: E1510 )
DIG Northern Starter Kit (Roche Diagnostics, catalog number: 12039672910 )
Tris (Sigma-Aldrich, catalog number: T6066 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’,-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: 03777 )
Triton X-100 (Sigma-Aldrich, catalog number: 93418 )
Note: This product has been discontinued.
Sodium pyrophosphate tetrabasic decahydrate (Na4P2O4·10H2O) (Sigma-Aldrich, catalog number: S6422 )
β-glycerol phosphate (Sigma-Aldrich, catalog number: 50020 )
Sodium orthovanadate (Na3VO4) (Sigma-Aldrich, catalog number: S6508 )
Protease inhibitor cocktail (Roche Diagnostics, catalog number: 04693132001 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
DL-dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
SDS
MOPS (Sigma-Aldrich, catalog number: M5162 )
Sodium acetate (Sigma-Aldrich, catalog number: S2889 )
Maleic acid (Sigma-Aldrich, catalog number: M0375 )
Tween 20 (Sigma-Aldrich, catalog number: P9416 )
Tri-sodium citrate dihydrate (Himedia, catalog number: RM1415 )
IP (Immunoprecipitation) buffer (see Recipes)
5x assay buffer (see Recipes)
2x proteinase K buffer (see Recipes)
10x MOPS (pH 7.0) (see Recipes)
20x SSC buffer (see Recipes)
Maleic acid buffer (pH 7.5) (see Recipes)
1x blocking solution (see Recipes)
Washing buffer (pH 7.5) (see Recipes)
Detection buffer (pH 9.5) (see Recipes)
Phosphate buffered saline with 0.1% Tween 20 (PBST, see Recipes)
Equipment
5% CO2 incubator
Centrifuge
Flip-flop rocker
Gel documentation system (Bio-Rad Laboratories, model: ChemiDocTM MP )
Chemical fume hood
Conical flask
Standard horizontal agarose gel electrophoresis apparatus
Rectangular glass tray
Glass plates
Glass jar
UV cross linker (UVP, model: CL-1000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Nair, V. P., Anang, S., Srivastava, A. and Surjit, M. (2017). RNA-dependent RNA Polymerase Assay for Hepatitis E Virus. Bio-protocol 7(7): e2199. DOI: 10.21769/BioProtoc.2199.
Nair, V. P., Anang, S., Subramani, C., Madhvi, A., Bakshi, K., Srivastava, A., Shalimar, Nayak, B., Ct, R. K. and Surjit, M. (2016). Endoplasmic reticulum stress induced synthesis of a novel viral factor mediates efficient replication of genotype-1 hepatitis E virus. PLoS Pathog 12(4): e1005521.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > RNA
Biochemistry > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
22 | https://bio-protocol.org/exchange/protocoldetail?id=22&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Injecting Zebrafish Embryos
LJ Lili Jing
Published: Jan 20, 2011
DOI: 10.21769/BioProtoc.22 Views: 19429
Download PDF
Ask a question
Favorite
Cited by
Abstract
Zebrafish is convenient for transient genetic manipulations such as morpholino-mediated gene knockdown, DNA/mRNA-based genetic overexpression. These genetic approaches do not involve the challenge of making transgenic animals, and their effect can last up to a week. This protocol describes the detailed steps of injecting to zebrafish embryos.
Materials and Reagents
Zebrafish
Oil
Zebrafish mating boxes (Aquatics)
Mineral oil (Sigma-Aldrich, catalog number: M5904 )
Equipment
Bench
Forceps
Injection
Micrometer slide
Micropipette puller (Sutter instrument)
Microinjection system Pico-injector (Harvard Apparatus)
Benchtop microscope (Leica Microsystems)
Micrometer slide (3B Scientific)
Glass capillary tubing (Thermo Fisher Scientific)
Benchtop microcentrifuge (Biotool)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
220 | https://bio-protocol.org/exchange/protocoldetail?id=220&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Soft–Agar colony Formation Assay
FL FengZhi Liu
Published: Vol 2, Iss 13, Jul 5, 2012
DOI: 10.21769/BioProtoc.220 Views: 64005
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Any anchorage–independent growth of tumor cells is estimated by a soft–agar colony formation assay. This protocol provides a general workflow for establishing a soft-agar colony formation assay.
Materials and Reagents
Agarose-LE (Guidechem, catalog number: 9012-36-6 )
DMEM (Life Technologies, Gibco®, catalog number: 11995 )
Crystal violet (Matheson Coleman & BEL: catalog number: B278 )
Fetal bovine serum (FBS) (Life Technologies, Invitrogen™, catalog number: 20140-079 )
Phosphate buffered saline (PBS) (Life Technologies, Gibco®, catalog number: 14040 )
Agar
Ethanol
Culture media (see Recipes)
Equipment
60 mm culture dishes (Thermo Fisher Scientific, catalog number: 353002 )
Water bath
Incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, F. (2012). Soft–Agar colony Formation Assay. Bio-protocol 2(13): e220. DOI: 10.21769/BioProtoc.220.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,200 | https://bio-protocol.org/exchange/protocoldetail?id=2200&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Behavioral Individuality in the Acoustic Startle Behavior in Zebrafish
CP Carlos Pantoja*
AH Adam Hoagland*
EC Elizabeth Carroll
DS David Schoppik
EI Ehud Y. Isacoff
*Contributed equally to this work
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2200 Views: 9129
Edited by: Soyun Kim
Reviewed by: Zinan ZhouMasahiro Morita
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
The objective of this protocol is to provide a detailed description for the construction and use of a behavioral apparatus, the zBox, for high-throughput behavioral measurements in larval zebrafish (Danio rerio). The zBox is used to measure behavior in multiple individuals simultaneously. Individual fish are housed in wells of multi-well plates and receive acoustic/vibration stimuli with simultaneous recording of behavior. Automated analysis of behavioral movies is performed with MATLAB scripts. This protocol was adapted from two of our previously published papers (Levitz et al., 2013; Pantoja et al., 2016). The zBox provides an easy to setup flexible platform for behavioral experiments in zebrafish larvae.
Keywords: Zebrafish Behavior Individuality Neuromodulation High-throughput Startle Larvae
Background
Behavioral differences between individuals in a population are ubiquitous and likely play a role in adaptation to varying selective pressures during evolution. However, variation in behavior among individuals is often ignored when the quantitation of the behavior of groups is presented as means and associated dispersions. In this protocol, we describe an approach to characterize individuality in the habituation of the acoustic startle behavior at the population level in zebrafish (Danio rerio) larvae. Our approach and set-up can be easily adapted to studies of individuality in other zebrafish larval behaviors.
Materials and Reagents
Petri dishes
Pipette tip
48-well multi-well plate
Zebrafish embryos
Instant ocean sea salt mix (Spectrum Brands, catalog number: SS15-10 )
DI H2O
E3 medium (see Recipes)
Equipment
P1000 PIPETMAN pipettor
Stir plate
zBox parts list (Table 1)
Table 1. ZBox parts list
Manufacturer/Item description
Part number
Quantity
Newegg - Computer
Minimum requirements: PC, 8 GB RAM, 2 GHz processor
1
PCIe Firewire 800 card
9SIA24G28M5974
1
National Instruments (DAQ)
NI PCI-6229
779068-01
1
RC68-68 Cable (1 m)
192061-01
2
CB-68LP - Unshielded
777145-01
2
McMaster Carr (Structural external)
80/20 1”x1” framing 96”
47065T123
4
80/20 corners
47065T177
20
80/20 nuts 80x
47065T147
12
Black PVC, 48”x48”x.
84775K942
1
236” (back)Black PVC 36”x48”x.236
84775K742
3
sides and top Super Adhesive Hook
94985K614
10ft
Loop
9489K874
10ft
Loctite Black Silicone sealant
74945A81
1
Black gaffer’s tape
7612A94
1
Right angle 80/20
47065T223
2
80/20 fastener
47065T139
2
Acrylic cement
7528A13
1
PTFE tape
4591K11
1
General Purpose Epoxy
Permatex 84101
1
Nylon 6/6 Thumb Screw
96295A336
1
Thorlabs (Structural internal)
Breadboard 24”x36”
MB2436
1
XT66 Rail
XT66-500
1
XT66 Dovetail
XT66DP-500
1
XT66 Dovetail clamp 40 mm
XT66C2
2
XT66 right angle cross piece
XT66CB
1
XT66 base plate
XT66P1
1
XT66 pivot platform
XT66RC
2
Plate holder
FP01
2
10” mounting post
P10
1
Pedestal Base adapter
PB4
1
Clamping fork
PF175
1
Post mounting clamp
C1501
1
Blackout fabric
BK5
1
Right angle plate
AP90
1
Edmund Optics
101 x 127 mm, 45 Degree AOI, Hot Mirror
43-958
2
Pike F-245 2/3” CCD camera
59-221
1
Pike Tripod adapter
59-227
Plastic IR filter
43-949
1
Navitar
50MM F/2.8 TELECENTRIC LENS
TC-5028
1
Unibrain (1394store.com)
1m (15 ft) IEEE-1394b 9p to 9p screw lock cable
1
Digi-Key Electronics
100Kohm resistor
CMF100KHFCT-ND
4
2-pin recipient
A99613-ND
10
2-pin socket
A99620-ND
20
2-pin header
A30770-ND
10
Yellow LEDs
C503B-AAN-CY0B0251-ND
48
IR LEDs
475-2919-ND
48
White LEDs
C503C-WAS-CBADA151-ND
48
Blue LEDs
C503B-BAN-CY0C0461-ND
48
1ohm resistor
P1.0W-2BK-ND
3
270 ohm resistor
PPC270W-1CT-ND
16
390 ohm resistor
PPC390W-1CT-ND
6
Diode
1N914B-ND
2
12 V power supply
EPS377-ND
1
24 V power supply
EPS357-ND
1
LEDsupply
BuckPuck DC LED Drivers
0302x-D-x-xxxx
1
Machine shop (plastics)
Custom plastic fabrication
1
Whatman (GE) plates
Multi-well plate of desired well number
Visaton (speakers)
8006
2
Pyle Audio (amplifier)
PyleHome PCA1
1
60 Watt incandescent bulb
1
Simple designs home (lamp)
LD1003-WHT
1
Notes: Assembly of zBox (see Figures 1-7):
Use epoxy to adhere the two side walls into the grooves on the back panel (Figure 2).
The screw holes in the LED platforms need to be drilled for 4-40 threads (Figure 3).
Use the plastic thumbscrews to mount the 2 LED platforms (one for the imaging IR LEDs and one for LEDs for use in optogenetic experiments) to the slots in the side walls (Figure 4).
LED arrays can be wired in 8 x 6 or 12 x 10 arrays depending on the desired amount of light. Due to perspective, the IR imaging LEDs are best arranged so that the arrays extend to the sides of the LED platform. Thus, given the distance from the plate, the IR LEDs can evenly light the extent of the multiwell plate.
The BuckPack LED driver can be wired to power the LED arrays and be switched using TTL pulses from the DAQ
The multiwell plate platform should be able to slide into the grooves on the side walls.
Screw speakers to side of multiwell platform (Figures 4-6).
Use diffuser paper to assure that IR light is evenly distributed throughout wells.
Mount camera to P10 posts. XT66 rails should be constructed to hold IR mirrors (Figure 7).
Figure 1. zBox plans
Figure 2. Slide side walls into back panel grooves and epoxy in place
Figure 3. Use thumb screws to mount LED platforms into side wall slots
Figure 4. Insert multi-well plate platform into top grooves of side walls
Figure 5. Detailed view of eaker mounting
Figure 6. Completed zBox
Figure 7. Camera mounting
Software
Matlab2014a or later with Imaging Processing and Data Acquisition toolboxes installed
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Pantoja, C., Hoagland, A., Carroll, E., Schoppik, D. and Isacoff, E. Y. (2017). Measuring Behavioral Individuality in the Acoustic Startle Behavior in Zebrafish. Bio-protocol 7(7): e2200. DOI: 10.21769/BioProtoc.2200.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,201 | https://bio-protocol.org/exchange/protocoldetail?id=2201&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Analysis of Proteoglycans and Glycosaminoglycans from Archaeological Bones and Teeth
YC Yvette May Coulson-Thomas
Vivien Jane Coulson-Thomas
AN Andrew L. Norton
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2201 Views: 7186
Edited by: Yanjie Li
Reviewed by: Li TangFilipa Vaz
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
We have developed methods for isolating proteoglycans and glycosaminoglycans from archaeological bones and teeth. These methods have been previously published (Coulson-Thomas et al., 2015) and are described here in more detail. In the case of glycosaminoglycans, the method was a previously described method (Nader et al., 1999) which we optimized for archeological samples.
Keywords: Proteoglycans Glycosaminoglycans Archaeological bones Archaeological teeth Isolation
Background
Bone tissue consists mainly of a mineral component (hydroxyapatite) and an organic matrix comprised of collagens, non-collagenous proteins and proteoglycans (PGs). As a result of binding tightly to hydroxyapatite, extracellular matrix proteins and PGs are protected from the destructive effects of temperature and chemical agents after death. However, to date only DNA and proteins had been successfully extracted from archaeological skeletons, and we therefore developed methods for isolating PGs and glycosaminoglycan (GAG) chains from archaeological bones and teeth. PGs and GAGs play a major role in bone morphogenesis, homeostasis and degenerative bone disease, and the analysis of these molecules from archaeological skeletons would unveil valuable paleontological information.
Materials and Reagents
Face masks, gloves and clean laboratory coats
Safety glasses
Autoclaved sandpaper (medium sheet - 100)
Autoclaved cheesecloth
Autoclaved A4 paper
Autoclaved pipette tips
0.1-10 μl (Eppendorf, catalog number: 022491300 )
2-200 μl (Eppendorf, catalog number: 022491334 )
50-1,000 μl (Eppendorf, catalog number: 022491351 )
DNA grade 15 ml tubes
Amicon® Ultra-15 centrifugal filter unit (3K pore size) (EMD Millipore, catalog number: UFC900308 )
Poly-Prep® chromatography column (Bio-Rad Laboratories, catalog number: 7311550 )
50 ml tubes
Parafilm
Guanidine hydrochloride (Sigma-Aldrich, catalog number: 177253 or G4505 )
Note: The product “ 177253 ” has been discontinued.
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S8282 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: RES20908-A7 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E9884 )
Autoclaved MilliQ water
cOmplete proteinase inhibitor cocktail EDTA-free (Roche Diagnostics, catalog number: 05056489001 )
Urea (Sigma-Aldrich, catalog number: U5378 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Sodium acetate (CH3COONa) (Sigma-Aldrich, catalog number: S2889 )
Maxatase (Biocon Laboratories, São Paulo, Brazil)
Trichloroacetic acid (Sigma-Aldrich, catalog number: T6399 )
Methanol (Sigma-Aldrich, catalog number: 34860 )
Standard chondroitin sulfate (extracted from shark cartilage) (Sigma-Aldrich, catalog number: C4384 )
Standard dermatan sulfate (Sigma-Aldrich, catalog number: 1171455 )
Standard heparan sulfate (extracted from bovine kidney) (Sigma-Aldrich, catalog number: H7640 )
Standard hyaluronic acid (extracted from human umbilical cord) (Sigma-Aldrich, catalog number: H1751 )
Note: This product has been discontinued.
Low-mr agarose (Bio-Rad Laboratories, catalog number: 1620100 )
Tris(hydroxymethyl)aminomethane (Tris) (Sigma-Aldrich, catalog number: 252859 )
Tween 20 (Bio-Rad Laboratories, catalog number: 1706531 )
EDTA III (Sigma-Aldrich, catalog number: EDFS )
Sodium azide (Merck, catalog number: 106688 )
Bovine serum albumin (Sigma-Aldrich, catalog number: A9418 )
Sodium hypochlorite solution (see Recipes)
Maxatase solution (see Recipes)
Blocking buffer (see Recipes)
Equipment
Pipettes
0.5-10 μl (Eppendorf, catalog number: 4920000024 )
2-20 μl (Eppendorf, catalog number: 4920000040 )
20-200 μl (Eppendorf, catalog number: 4920000067 )
100-1,000 μl (Eppendorf, catalog number: 4920000083 )
Autoclave
Drill (DRAPER TOOLS, catalog number: 79340 )
Note: It is used with sterilized mounted grinding stones (cylindrical and large cone shaped for bones, and tree and large cone shaped for teeth) (immersed in sodium hypochlorite solution for 15 min, dried and autoclaved).
Tube rotator
SpeedVac concentrator (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: SavantTM SC210 P1 SpeedVacTM , catalog number: SC210P1-115)
Water bath
Fume hood
Ice maker
Microcentrifuge, capable of reaching up to 16,000 x g
Centrifuge, capable of reaching up to 2,000 x g
Vortex mixer
Laboratory oven
Quick Scan 2000 densitometer (Helena Laboratories, model: QuickScan 2000 )
Elisa ELX 800 Wallac Victor2 1420 Multilabel Counter (PerkinElmer, model: Elisa ELX 800 Wallac Victor2 1420 )
Magnetic stirrer
Software
Windows-based Quick Scan 2000 software (Helena Laboratories)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Coulson-Thomas, Y. M., Coulson-Thomas, V. J. and Norton, A. L. (2017). Isolation and Analysis of Proteoglycans and Glycosaminoglycans from Archaeological Bones and Teeth. Bio-protocol 7(7): e2201. DOI: 10.21769/BioProtoc.2201.
Coulson-Thomas, Y. M., Coulson-Thomas, V. J., Norton, A. L., Gesteira, T. F., Cavalheiro, R. P., Meneghetti, M. C., Martins, J. R., Dixon, R. A. and Nader, H. B. (2015). The identification of proteoglycans and glycosaminoglycans in archaeological human bones and teeth. PLoS One 10(6): e0131105.
Download Citation in RIS Format
Category
Biochemistry > Other compound > Proteoglycan
Biochemistry > Other compound > Glycosaminoglycan
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,202 | https://bio-protocol.org/exchange/protocoldetail?id=2202&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analyses of Root-secreted Acid Phosphatase Activity in Arabidopsis
LW Liangsheng Wang
Dong Liu
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2202 Views: 11330
Edited by: Marisa Rosa
Reviewed by: Ning Liu
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Induction and secretion of acid phosphatase (APase) is a universal adaptive response of higher plants to low-phosphate stress (Tran et al., 2010). The intracellular APases are likely involved in the remobilization and recycling of phosphate (Pi) from intracellular Pi reserves, whereas the extracellular or secreted APases are believed to release Pi from organophosphate compounds in the rhizosphere. The phosphate starvation-induced secreted APases can be released into the rhizosphere or retained on root surfaces (root-associated APases). In this article, we describe the protocols for analyzing root-secreted APase activity in the model plant Arabidopsis thaliana (Arabidopsis). In Arabidopsis, the activity of both root-associated APases and APases that are released into the rhizosphere can be quantified based on their ability to cleave a synthesized substrate, para-nitrophenyl-phosphate (pNPP), which releases a yellow product, para-nitrophenol (pNP) (Wang et al., 2011 and 2104). The root-associated APase activity can also be directly visualized by applying a chromogenic substrate, 5-bromo-4-chloro-3-indolyl-phosphate (BCIP), to the root surface (Lloyd et al., 2001; Tomscha et al., 2004; Wang et al., 2011 and 2014) whereas the isozymes of APases that are released into rhizosphere can be profiled using an in-gel assay (Trull and Deikman, 1998; Tomscha et al., 2004; Wang et al., 2011 and 2014). The protocol for analysis of intracellular APase activity in Arabidopsis has been previously described (Vicki and William, 2013).
Keywords: Arabidopsis thaliana Phosphate starvation Secretion Acid phosphatase Phosphatase activity Isozyme Histochemical staining Quantitative analysis
Background
Phosphate (Pi) is the major form of phosphorus that plants take up through their root systems, and Pi levels in most soils are low, resulting in Pi starvation. To cope with this nutritional stress, plants trigger an array of adaptive responses that increase their survival and growth. Induction and secretion of APases is a hallmark Pi starvation response that has been documented in a variety of plant species (Tran et al., 2010), and root-secreted APase activity has been widely used as a diagnostic tool to evaluate the magnitude of plant responses to Pi starvation. In this article, we provide three protocols for assay of root-secreted APase activity. An assay using pNPP as a substrate is the most commonly used method to quantify APase activity. A BCIP staining assay provides a simple, one-step method for the histochemical detection of APase activity on the root surface. Neither of these methods, however, can reveal the number of APase isoforms that contribute to the observed activity. A third method (in-gel assay), which combines electrophoresis, protein renaturation, and conversion of a substrate into a red-brown product, can reveal the diverse compositions of APase isoforms in different samples, and can therefore provide additional information about root-secreted APases.
Materials and Reagents
9-cm-diameter Petri dish
Surgical blade (Swann Morton Surgical Scalpel Blade No. 20)
1.7 ml and 2 ml Eppendorf tubes
Dialysis tubing (Sigma-Aldrich, catalog number: D9777 )
50 ml Falcon tube
Whatman #1 filter paper (GE Healthcare, catalog number: 1001-125 )
Pipette tips
Arabidopsis seeds
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
30% acrylamide/Bis solution (Solarbio, catalog number: A1010 )
TEMED (Sigma-Aldrich, catalog number: T22500 )
Agar (Sigma-Aldrich, catalog number: A1296 )
Bovine serum albumin (BSA)*
95% ethanol*
Ammonium persulfate (NH4)2S2O8*
Sodium hypochlorite solution (NaClO)*
Sodium hydroxide (NaOH)*
Sodium acetate (NaAc)*
Phosphoric acid (H3PO4)*
Hydrochloric acid (HCl)*
Ammonium nitrate (NH4NO3)*
Potassium nitrate (KNO3)*
Calcium chloride (CaCl2)*
Magnesium sulfate (MgSO4)*
Potassium dihydrogen phosphate (KH2PO4)*
Potassium sulfate (K2SO4)*
Potassiu iodide (KI)*
Orthoboric acid (H3BO3)*
Manganese sulfate (MnSO4)*
Zinc sulfate (ZnSO4)*
Sodium molybdate (Na2MoO4)*
Cobalt(II) chloride (CoCl2)*
Copper sulfate (CuSO4)*
Fe-EDTA*
Myo Inositol*
Nicotinic acid*
Pyridoxine HCl*
Thiamine HCl*
Glycine*
Sucrose*
Bromophenol blue*
Coomassie Brilliant Blue G-250*
MES (AMRESCO, catalog number: E169 )
β-naphthyl acid phosphate (Sigma-Aldrich, catalog number: N7375 )
Fast Black K (Sigma-Aldrich, catalog number: F7253 )
pNPP (Sigma-Aldrich, catalog number: P4744 )
BCIP (Gold Bio, catalog number: B-500-10 )
Tris base (NOVON SCIENTIFIC, catalog number: ZZ02531 )
DTT (Sigma-Aldrich, catalog number: DTT-RO )
SDS (AMRESCO, catalog number: 0227 )
DMSO (AMRESCO, catalog number: 0231 )
PMSF (Sigma-Aldrich, catalog number: 52332 )
Liquid nitrogen
Murashige and Skoog (MS) medium (P+ and P- MS medium) (see Recipes, Murashige and Skoog, 1962)
APase activity profiling detection buffer, pH 4.9 (see Recipes)
Reaction buffer, pH 4.9 (see Recipes)
pNPP solution (1.0 mg/ml) (see Recipes)
BCIP stock solution (100x) (see Recipes)
Bradford solution (see Recipes)
5x protein loading buffer (see Recipes)
*Note: Similar reagents from any qualified company are suitable for this experiment.
Equipment
Pipettes
Forceps (Fisher Scientific, catalog number: 22-327379 )
Spectrophotometer (WPA, Biowave)
250 ml Erlenmeyer (conical) flask
Orbital shaker (Qilinbeier, model: TS-1 )
Freeze dryer (Beijing Songyuanhuaxing, model: LGJ-10 )
Microfuge (Eppendorf, model: 5415 D )
Microwave oven
Small mortar and pestle
Water bath (Shanghai Yiheng, model: DK-8D )**
Analytical balance (Mettler Toledo, model: PB153-L)**
pH meter (Mettler Toledo, model: FE20 )**
Mini-PROTEAN® Tetra Vertical Electrophoresis Cell (Bio-Rad Laboratories, model: Mini-PROTEAN® Tetra Vertical Electrophoresis Cell , catalog number: 1658004)
**Note: Similar equipment from any qualified company is suitable for this experiment.
Software
SPSS Statistics
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Wang, L. and Liu, D. (2017). Analyses of Root-secreted Acid Phosphatase Activity in Arabidopsis. Bio-protocol 7(7): e2202. DOI: 10.21769/BioProtoc.2202.
Wang, L., Li, Z., Qian, W., Guo, W., Gao, X., Huang, L., Wang, H., Zhu, H., Wu, J. W., Wang, D. and Liu, D. (2011). The Arabidopsis purple acid phosphatase AtPAP10 is predominantly associated with the root surface and plays an important role in plant tolerance to phosphate limitation. Plant Physiol 157(3): 1283-1299.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,203 | https://bio-protocol.org/exchange/protocoldetail?id=2203&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Testing Depression in Mice: a Chronic Social Defeat Stress Model
HK Hee-Dae Kim
TC Tanessa Call
SC Samantha Carotenuto
RJ Ross Johnson
DF Deveroux Ferguson
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2203 Views: 21323
Edited by: Soyun Kim
Reviewed by: Alexandra Gros
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
A vast challenge within neuropsychiatric research has been the development of animal models that accurately reflect symptoms associated with affective disorders. An ethologically valid model that has been shown to be effective in studying depression is the chronic social defeat stress model. In this model, C57BL/6J mice are subjected to chronic social defeat stress induced by CD-1 aggressor mice for 10 consecutive days. Discussed here is a protocol describing the screening process of the CD-1 aggressor mice, the confrontations between the C57BL/6J and CD-1 aggressor mice, and analysis of social avoidance scores as an indication of depression-like behaviors.
Keywords: Social defeat Depression Chronic stress Social interaction Mouse model
Background
Depressive disorders are recurring and life-threatening conditions that affect approximately 120 million people worldwide. Of significant interest within the field of neuropsychiatric research is the development of valid animal models for depression to aid the understanding of the neurobiological and molecular mechanisms underlying depressive disorders. Various models of chronic stress have been used to induce symptoms in mice that are relevant to depression, among those are chronic unpredictable stress, foot-shock stress, immobilization stress followed by measurements of anhedonia or despair-like behaviors (e.g., sucrose preference test, forced swim test and tail suspension test), but they are not well validated as models of human depression (Krishnan and Nestler, 2011). Currently, chronic social defeat stress has been widely accepted as a well-validated model for depression, because of its reliability and reproducibility (Berton et al., 2006; Krishnan et al., 2007; Golden et al., 2011; Krishnan and Nestler, 2011; Russo and Nestler, 2013). The social defeat paradigm has been validated as a good model of human depression because of following reasons: 1) The depression phenotypes of susceptible mice (social avoidance, anhedonia, metabolic changes, etc.) are reversed by chronic treatment of anti-depressant drugs but not by acute administration. 2) Social defeat stress produces both a susceptible and resilient phenotype and this can be used to explain individual differences of human stress susceptibility in depression pathophysiology. 3) The susceptible phenotypes induced by social defeat stress are long lasting with concomitant genetic and epigenetic changes in the brain reward circuitry.
Materials and Reagents
C57BL/6J (THE JACKSON LABORATORY): 7-8 weeks old mice are used in social defeat (6-7 weeks mice are ordered for a week acclimation period in the vivarium)
Note: Mice are housed in standard cages with 4 to 5 mice per cage.
CD-1 mice (Charles River): Retired male breeder mice were 4-6 months of age and singly housed in standard mouse cages
Note: Social defeat paradigms use a consistent subordination of subject mice as a social stressor and a forced subordination strategy is employed in this protocol with the most widely used strains, C57BL/6J: CD-1 pair.
Cleaning solution (for cleaning arena and custom Plexiglas social interaction arena/divider in between trials): 0.5% hydrogen peroxide
Equipment
Clear rat cages (disposable rat cage with bedding) (Innovive, catalog number: RS1-H-C8 )
Standard water bottle (mouse water bottle) (Innovive, catalog number: M-WB-300 )
Water bottle stopper with sipper tube (Neoprene stopper, size: #8.5; Ancare, 1” bend tubes – open tip) (Ancare, catalog number: OT-199 - 3” )
Cylinder (custom made, plastic holder for additional water spout; Figure 2B)
Divider (custom made, clear perforated Plexiglas plate; Figure 2B)
Removable enclosure (custom made, clear Plexiglas, top and bottom sides are open; Figure 3B)
Stopwatch
Open field chamber (custom made, 44 [w] x 44 [d] x 30 [h] cm)
Video tracking system for social interaction test (e.g., Noldus Information Technology, model: EthoVision system , CCD camera & computer)
Software
Tracking software: EthoVision XT (Noldus Information Technology)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Kim, H., Call, T., Carotenuto, S., Johnson, R. and Ferguson, D. (2017). Testing Depression in Mice: a Chronic Social Defeat Stress Model. Bio-protocol 7(7): e2203. DOI: 10.21769/BioProtoc.2203.
Kim, H. D., Hesterman, J., Call, T., Magazu, S., Keeley, E., Armenta, K., Kronman, H., Neve, R. L., Nestler, E. J. and Ferguson, D. (2016). SIRT1 mediates depression-like behaviors in the nucleus accumbens. J Neurosci 36(32): 8441-8452.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,204 | https://bio-protocol.org/exchange/protocoldetail?id=2204&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Secretion of Adipsin as an Assay to Measure Flux from the Endoplasmic Reticulum (ER)
AB Alexandria Brumfield
NC Natasha Chaudhary
TM Timothy E. McGraw
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2204 Views: 7071
Edited by: Ralph Bottcher
Reviewed by: Mirko Messamarzia Di DI DONATO
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
In this protocol we describe a quantitative biochemical assay to assess the efficiency of endoplasmic reticulum (ER) to Golgi protein transport in adipocytes (Bruno et al., 2016). The assay takes advantage of the fact that adipocytes secrete various bioactive proteins, known as adipokines. As a measure of ER to Golgi flux we determine the rate of bulk secretion of the adipokine adipsin post washout of Brefeldin A (BFA) treatment using immunoblotting. Because BFA treatment results in an accumulation of adipsin in the ER, the exit of adipsin from the ER upon BFA washout is synchronized across cells and experimental conditions. Thus, using this simple assay one can robustly determine if perturbations, such as knocking down a protein, have an effect on ER to Golgi protein transport.
Keywords: ER secretion Secretory pathway Adipocytes Adipsin Brefeldin A
Background
Newly synthesized proteins destined to be secreted from the cell traffic through the secretory pathway to the plasma membrane (PM). The secretory route includes transport from the ER to the Golgi, across the Golgi stacks, and movement from the trans Golgi network (TGN) to the PM. Each of these transport steps provides nodes for regulation of secretion. While most cells are capable of secreting proteins, certain specialized cell types are professional secreters of specific proteins. Adipocytes, for example, secrete hormones, called adipokines that affect the energy metabolism of various organs. To better understand the molecular underpinnings of adipokine secretion, we have developed an assay to study the transport of adipsin, an adipokine, from the ER to the Golgi of cultured adipocytes. A traditional and commonly used method of studying ER to Golgi transport is to monitor the exit of the temperature sensitive vesicular stomatitis virus G protein ts045 fused to GFP (VSVG-GFP) from the ER (Presley et al., 1997). An advantage of using the adipsin secretion assay to study ER to Golgi transport in adipocytes is that the flux of an endogenous protein from the ER is monitored rather than an ectopically-expressed reporter protein.
Materials and Reagents
24-well cell culture plates (Corning, Falcon®, catalog number: 353226 )
10 cm dish
1.5 ml microcentrifuge tubes
Pipette tips
26 G ½ needles (BD, catalog number: 305111 )
Cell scrapers (Corning, Falcon®, catalog number: 353085 )
3T3-L1 fibroblast cells (ATCC, Clone-173 )
DMEM/10% FBS (see Recipes)
Dulbecco’s modified Eagle medium (DMEM) powder high glucose (Thermo Fisher Scientific, GibcoTM, catalog number: 12100046 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 26140095 )
Penicillin-streptomycin (5,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15070063 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S6297 )
Brefeldin A (BFA) (5 μg/ml, prepared in M-199 media) (Cell Signaling, catalog number: 9972 )
M-199 protein free media (Sigma-Aldrich, catalog number: M4530 )
Acetone (cooled at -20 °C) (Sigma-Aldrich, catalog number: 320110 )
Laemmli sample buffer (LSB) (2x, dilute in water for 1x) (Sigma-Aldrich, catalog number: S3401 )
Trichloroacetic acid (TCA) (chilled on ice) (Sigma-Aldrich, catalog number: T0699 )
10x stock solution of phosphate-buffer saline (PBS) (see Recipes)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9625 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P4504 )
Sodium phosphate dibasic heptahydrate (Na2HPO4·7H2O) (Sigma-Aldrich, catalog number: S9390 )
Monopotassium phosphate (KH2PO4) (Sigma-Aldrich, catalog number: P0662 )
1x stock solution of phosphate-buffer saline (PBS) (see Recipes)
Polyacrylamide gels (10%) (home-made) (see Recipes)
30% Acrylamide/Bis solution 37.5:1 (Bio-Rad Laboratories, catalog number: 1610158 )
Tris (Sigma-Aldrich, catalog number: T6066 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L4509 )
Ammonium persulfate (APS) (Sigma-Aldrich, catalog number: A3678 )
Tetramethylethylenediamine (TEMED) (Sigma-Aldrich, catalog number: T9281 )
Non-fat powdered milk (LabScientific, catalog number: M-0842 )
Tween-20 (Sigma-Aldrich, catalog number: P1379 )
Goat anti-adipsin antibody (Santa Cruz Biotechnology, catalog number: sc-12402 )
HRP conjugated Donkey anti-Goat secondary antibody (Santa Cruz Biotechnology, catalog number: sc-2020 )
10x running buffer & transfer buffer for Western blotting (see Recipes)
Glycine (Sigma-Aldrich, catalog number: G8898 )
Tris
Sodium dodecyl sulfate (SDS)
Ethanol (EtOH) (Decon Labs, catalog number: V1016 )
Equipment
Pipettes
Incubator at 37 °C/5% CO2
Microcentrifuge at 4 °C (Thermo Fisher Scientific, model: HeraeusTM BiofugeTM StratosTM Centrifuge Series , catalog number: 75003236)
Heat block at 95 °C
Aspirator
Western blotting equipment
Mini Trans-Blot Cell and PowerPac Basic Power Supply (Bio-Rad Laboratories, catalog number: 1703989 )
Nitrocellulose membrane (Nitrobind, 0.45 μm) (VWR, catalog number: 490007-490 )
Blotting paper (VWR, catalog number: 28298-030 )
Software
ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Brumfield, A., Chaudhary, N. and McGraw, T. E. (2017). Secretion of Adipsin as an Assay to Measure Flux from the Endoplasmic Reticulum (ER). Bio-protocol 7(7): e2204. DOI: 10.21769/BioProtoc.2204.
Bruno, J., Brumfield, A., Chaudhary, N., Iaea, D. and McGraw T. E. (2016). SEC16A is a RAB10 effector required for insulin-stimulated GLUT4 trafficking in adipocytes. J Cell Biol 214: 61-76.
Download Citation in RIS Format
Category
Biochemistry > Protein > Quantification
Cell Biology > Cell-based analysis > Transport
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,205 | https://bio-protocol.org/exchange/protocoldetail?id=2205&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo Live Imaging of Calcium Waves and Other Cellular Processes during Fertilization in Caenorhabditis elegans
Jun Takayama
MF Masashi Fujita
Shuichi Onami
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2205 Views: 9499
Edited by: Neelanjan Bose
Reviewed by: Manish ChamoliAdler R. Dillman
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Fertilization calcium waves are a conserved trigger for animal development; however, genetic analysis of these waves has been limited due to the difficulty of imaging in vivo fertilization. Here we describe a protocol to image calcium dynamics during in vivo fertilization in the genetic animal model Caenorhabditis elegans. This protocol consists of germline microinjection of a chemical calcium indicator, worm immobilization, live imaging, and image processing that quantifies the calcium fluorescence in the oocyte region moving in the field-of-view during ovulation. This imaging protocol can also be used to image other cellular processes during in vivo fertilization in C. elegans, such as membrane fusion and cytoskeletal dynamics.
Keywords: Fertilization Fertilization calcium waves Calcium waves Caenorhabditis elegans Live imaging Calcium imaging Image processing
Background
Fertilization calcium waves play a pivotal role in egg activation and have been analyzed in various organisms by using in vitro fertilization systems. The nematode Caenorhabditis elegans is amenable to imaging in vivo fertilization because of its translucent body. The fertilization calcium imaging in C. elegans by using a chemical calcium indicator is reported in Samuel et al. (2001). We describe here a protocol modified from the imaging method by applying high-speed spinning disk confocal microscopy and image processing methods that segment the fertilized oocyte region moving in the field-of-view during ovulation. This protocol enables a precise quantitative description of the temporal dynamics of the calcium waves and genetic analysis of the wave pattern.
Materials and Reagents
Glass capillary with filament (NARISHIGE, catalog number: GDC-1 )
24 x 55 mm cover glass (Matsunami Glass, catalog number: C024551 )
76 x 26 mm glass slide (Matsunami Glass, catalog number: S011110 )
18 x 18 mm cover glass (thickness 0.16-0.19 mm; No. 1S/No. 1.5) (Matsunami Glass, special order product)
Micro spatula (e.g., AS ONE, catalog number: 6-524-01 )
1.5-ml brown tubes (e.g., FUKAEKASEI, WATSON, catalog number: 131-915BR )
Aluminum foil (e.g., UACJ Foil Corporation)
Syringe-driven membrane filter (EMD Millipore, catalog number: SLGS033SS )
19 (W) x 0.18 (T) mm vinyl tape (3M, catalog number: 35-WHITE-3/4 )
Lint-free wipe (KCWW, Kimwipes, catalog number: S-200 )
Dark chamber (e.g., Ina-optika, model: FB-35BL )
Note: We make a rectangular hole of approximately 7 x 10.5 cm in the inner lid.
N2 wild-type C. elegans
Agarose gel pad for microinjection
Agarose-LE, Classic Type (Nacalai Tesque, catalog number: 01157-66 )
Or agarose (Thermo Fisher Scientific, Invitrogen, catalog number: 15510-027 )
Note: This product has been discontinued.
Liquid paraffin (Wako Pure Chemical Industries, catalog number: 164-00476 )
0.10-µm polystyrene microsphere suspension (Polysciences, catalog number: 00876-15 )
Notes:
Prepare approximately 500-µl aliquots in 1.5-ml tubes
Store at 4 °C
Serotonin hydrochloride (Sigma-Aldrich, catalog number: H9523 )
Calcium Green-1 dextran, potassium salt, 10,000 MW, anionic (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C3713 )
Nuclease-free water (Promega, catalog number: P1193 )
Potassium dihydrogen phosphate (KH2PO4) (Wako Pure Chemical Industries, catalog number: 169-04245 )
Disodium hydrogenphosphate (Na2HPO4) (Wako Pure Chemical Industries, catalog number: 197-02865 )
Sodium chloride (NaCl) (Wako Pure Chemical Industries, catalog number: 191-01665 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Wako Pure Chemical Industries, catalog number: 131-00405 )
NuSieve GTG agarose (Lonza, catalog number: 50080 )
Vaseline (white petrolatum) (Kozakai Pharmaceutical)
Lanolin (Sigma-Aldrich, catalog number: L7387 )
Paraffin pellets (e.g., Seiwa)
D(+)-glucose (Wako Pure Chemical Industries, catalog number: 041-00595 )
Note: This product has been discontinued.
0.2% BSA-fluorescein solution (dissolved in nuclease-free water)
Note: Prepare immediately before use.
2.0% gelatin solution
BSA-fluorescein (Thermo Fisher Scientific, Molecular ProbesTM, catalog-number: A23015 )
100 µM Calcium Green-1 dextran solution (see Recipes)
Sterilized 1 M MgSO4 solution (see Recipes)
M9 buffer (see Recipes)
10% NuSieve GTG agarose/M9 pad (see Recipes)
VALAP (see Recipes)
Injection recovery solution (see Recipes)
20 mg/ml serotonin hydrochloride/M9 buffer (see Recipes)
Fluorescence reference slide (see Recipes)
Equipment
Needle puller (NARISHIGE, model: PC-10 )
Microinjector (Eppendorf, model: FemtoJet® Microinjector )
Inverted microscope with manipulator (e.g., Leica Microsystems, model: DMIRB ; NARISHIGE models: MMO-220A , MO-202U , MN-4 )
Hot plate (e.g., IKA, catalog number: C-MAG HP7 )
Microwave oven (e.g., Panasonic, model: NE-EH212 )
Note: This product has been discontinued.
Microscope (e.g., Leica Microsystems, model: DMRE; Nikon Instruments, model: Ti-E )
50-ml screw-cap glass bottle (e.g., AS ONE, catalog number: 1-4568-01 )
100-ml beaker (e.g., ASAHI Glass, AGC, catalog number: 1000BK100 )
50-ml beaker (e.g., ASAHI Glass, AGC, catalog number: 1000BK50 )
Diamond pen (e.g., Ogura Jewel Industry, model: D-point pen )
High-magnification water-immersion objective lens (e.g., Leica Microsystems, model: HCX PL Apo 63x/1.20 W corr .; Nikon Instruments, model: Plan Apo VC 60XA/1.20 W )
Spinning disk confocal unit (Yokogawa Electric, model: CSU-X1 )
EM-CCD camera (Andor Technology, model: iXon DU-897 )
Ar/Kr laser (IDEX, Melles Griot, model: 643-YB-A01 )
Filter/shutter controller (Ludl Electronic Products, model: Mac 6000 , catalog numbers: 73006081, 73006042, 73006001)
488-nm laser line filter (IDEX, Semrock, catalog number: LL01-488 )
Dichroic mirror (IDEX, Semrock, catalog number: Di01-T488 )
Long-pass barrier filter (IDEX, Semrock, catalog number: BLP01-488R )
Windows 7 computer for image acquisition
Mac computer for image processing (e.g., ver. 10.6.8 or later)
Interactive pen display (Wacom, model: Cintiq 21UX )
Software
ImageJ (ver. 1.49v or later) (https://imagej.nih.gov/ij/download.html)
Image-acquisition software (e.g., Andor Technology, iQ [ver. 1.10.3 or later] or iQ2 [ver. 2.9.1 or later])
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Takayama, J., Fujita, M. and Onami, S. (2017). In vivo Live Imaging of Calcium Waves and Other Cellular Processes during Fertilization in Caenorhabditis elegans. Bio-protocol 7(7): e2205. DOI: 10.21769/BioProtoc.2205.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Live-cell imaging
Developmental Biology > Cell growth and fate > Oocyte
Cell Biology > Cell-based analysis > Ion analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,206 | https://bio-protocol.org/exchange/protocoldetail?id=2206&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of the Galactanase Activity of the GanB Galactanase Protein from Bacillus subtilis
HW Hildegard Watzlawick
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2206 Views: 8068
Edited by: Valentine V Trotter
Reviewed by: Petru-Iulian Trasnea
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
The activity of the endo-β-1,4-galactanase GanB from B. subtilis on the high molecular weight β-1,4-galactan was determined quantitatively by the measurement of the increase of the reducing power or with the dyed substrate Azo-galactan. The generated degradation products were analyzed using thinlayer-chromatography (TLC) or high-performance anion-exchange chromatography (HPAEC).
Keywords: Galactanase-assay Endo-β-galactanase Galactan AZCL-galactan GanB from Bacillus subtilis Galacto-oligosaccharides
Background
Bacillus subtilis possesses comprehensive systems for the utilization of plant cell wall polysaccharides including the gene cluster ganSPQAB which encodes galactan utilization elements (Watzlawick et al., 2016). Galactans are high molecular weight galacto-saccharides and are found as side chains of rhamnogalacturonan type I in pectin. Its degradation is carried out by endo-beta1,4 galactanases (EC 3.2.1.89). The utilization of galactan by B. subtilis involves the extracellular galactanase GanB, cleaving the high molecular galactan inside the chain and resulting short oligomers that enter the cell wall to get there further degraded. The ganB gene from B. subtilis was cloned and expressed in E.coli (Watzlawick et al., 2016) and the enzymatic properties of the purified His-tagged mature protein were characterized by galactanase assays.
Materials and Reagents
Eppendorf tubes 1.5 ml
TLC-plate: Silica Gel 60 F254 (Merck Millipore, Darmstadt, Germany)
Sodium acetate trihydrate (Carl Roth, catalog number: 6779 )
Galactan from lupin (Arabinofuranosidase treated lupin pectic galactan, Gal:Ara:Rha:Xyl: GalUA = 91:2:1.8:0.2:5.0) (Megazyme, catalog number: P-GALLU )
β-1,4-galactobiose (Sigma-Aldrich, catalog number: G9662 )
D-(+)-galactose (Sigma-Aldrich, catalog number: G5388 )
3,5-dinitrosalicylic acid (Sigma-Aldrich, catalog number: D0550 )
Potassium-sodium-tartrate tetrahydrate (Carl Roth, catalog number: 8087 )
Sodium sulfite (Carl Roth, catalog number: P033 )
Sodium hydroxide 50% (Carl Roth, catalog number: 8655 )
AZCL-galactan: Azurine-crosslinked-potato (AZCL) galactan (which has been purified from potato fibre and treated to remove most of the arabino- furanosyl residues) (Sigma-Aldrich, catalog number: 38127 )
Note: This product has been discontinued.
Ammonium heptamolybdate tetrahydrate (Carl Roth, catalog number: 7311 )
Cerium sulfate tetrahydrate (Carl Roth, catalog number: P014 )
Sulfuric acid (H2SO4)
Potassium-phosphate dibasic (KH2PO4) (Carl Roth, catalog number: P018 )
di-Potassium hydrogen phosphate (K2HPO4) (Carl Roth, catalog number: P749 )
Note: Prepare a 0.1 M solution in pure H2O and use it for preparation of the potassium phosphate buffer described in Recipes section.
Sodium borate decahydrate (Sigma-Aldrich, catalog number: G5388 )
Sulfuric acid 95% (Carl Roth, catalog number: HN62 )
Acetone (Carl Roth, catalog number: 9372 )
Milli-Q pure H2O
Purified recombinant His6-tagged GanB (see Recipes)
Note: This protein was produced in E. coli JM109 harboring the plasmid pHWG1119 after induction with rhamnose as described by (Watzlawick et al., 2016). Crude extracts were purified by immobilized-metal affinity chromatography using TALON® Metal Affinity resins (Clontech Laboratories, USA) according to the supplier’s instruction. Fractions of the purified proteins were combined and the imidazole was removed with NAP10 columns (GE Healthcare, Munich, Germany) equilibrated with 0.1 M KPP.
Lupin-galactan (see Recipes)
DNS-reagent (see Recipes)
AZCL-galactan (see Recipes)
TLC developing reagent (see Recipes)
Potassium phosphate buffer (KPP), 0.1 M (see Recipes)
0.4 M sodium borate solution (see Recipes)
0.3 M sodium acetate, pH 5.2 (see Recipes)
TLC mobile phase solution (see Recipes)
HPAEC isocratic mobile phase (see Recipes)
Equipment
Pipette P2 , P20 , P200 , P1000 (Gilson Pipetman classic)
Vortex Minishaker (Heidolph Instrument, model: Heidolph Reax 2000 )
Centrifuge (Eppendorf, model: 5415 D )
Thermomixer compact (Eppendorf)
Blow-dryer
HPLC apparatus: The HPLC apparatus consists of a pump (220, Bischoff, Leonberg, Germany) and an ESA Coulochem II electrochemical detector (Bischoff, Leonberg, Germany) with an analytical cell (5040, ESA Coulochem II, Bischoff)
HPLC-column (Thermo Fisher Scientific, model: DionexTM CarboPacTM PA1 )
TLC-chamber (size: 12 x 12 x 7 cm) (Desaga, Heidelberg, Germany)
Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: GENESYSTM 10 Vis )
pH meter (Metteler Toledo, model: FE20 ATC FiveEasyTM )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Watzlawick, H. (2017). Measurement of the Galactanase Activity of the GanB Galactanase Protein from Bacillus subtilis. Bio-protocol 7(7): e2206. DOI: 10.21769/BioProtoc.2206.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial biochemistry > Carbohydrate
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,207 | https://bio-protocol.org/exchange/protocoldetail?id=2207&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Nitroxide Labeling of Proteins and the Determination of Paramagnetic Relaxation Derived Distance Restraints for NMR Studies
MS Megan Sjodt
RC Robert T. Clubb
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2207 Views: 11369
Edited by: Marc-Antoine Sani
Reviewed by: Ashish Sethi
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Site-specific attachment of paramagnetic spin labels to biomolecules causes distance-dependent line-broadening effects, which can be exploited to study the structure and dynamics of these molecules in solution. This protocol describes how to attach nitroxide spin labels to proteins and how to collect and analyze NMR data using these labeled samples. We also explain how to derive distance restraints for paramagnetic relaxation enhancement nuclear magnetic resonance (PRE-NMR) studies.
Keywords: Paramagnetic relaxation enhancement Large protein NMR Nuclear magnetic resonance spectroscopy Nitroxide spin label Distance restraints
Background
This protocol describes how to attach nitroxide spin labels to proteins and how the modified proteins can be employed to derive distance restraints using paramagnetic relaxation enhancement nuclear magnetic resonance (PRE-NMR) methods. Site-specific attachment of paramagnetic spin labels to proteins enhances the transverse relaxation rates of nearby nuclei leading to line-broadening effects that can be used to derive distance restraints (Battiste and Wagner, 2000; Iwahara et al., 2004; Clore and Iwahara, 2009). PRE-derived distance restraints have been used to characterize the structures of various molecules, including amongst others membrane proteins (Roosild et al., 2005), multi-domain proteins displaying inter-domain dynamics (Sjodt et al., 2016), single domain proteins (Battiste and Wagner, 2000), protein-DNA complexes (Clore and Iwahara, 2009), transient protein-protein interactions (Tang et al., 2007; Villareal et al., 2011), and intrinsically disordered proteins (Bertoncini et al., 2005). Two approaches are generally used to obtain PRE-derived distance restraints using proteins that are labeled with paramagnetic probes. The first method quantitatively measures the probe’s effects on the transverse relaxation rates of nearby protein nuclei by determining Γ2 (described in detail by Iwahara and Clore) (Iwahara et al., 2004; Clore and Iwahara, 2009). The second method is less quantitative, but in practice it is easier to implement. It was originally employed by Battiste and Wagner, and measures the probe’s effects by comparing cross-peak intensity ratios in diamagnetic- and paramagnetic-spectra of the labeled protein (Battiste and Wagner, 2000). The nitroxide spin label MTSL is frequently used as a paramagnetic probe in PRE-NMR studies of proteins because it is readily attached via a disulfide bond to cysteine residues, and also relatively small, inexpensive, and commercially available. The aim of this protocol is to describe how to attach MTSL nitroxide spin labels to proteins and how to derive PRE-distance restraints following the approach described by Battiste and Wagner (2000).
Materials and Reagents
Amber vial
Desalting spin column, for example, a ZebaTM spin desalting column, 7k MWCO, 2 ml (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 89889 )
15 ml conical test tube
Aluminum foil
A centrifugal filter, such as Amicon Ultra-15 centrifugal filter (EMD Millipore, catalog number: UFC900308 )
Standard 5 mm NMR tube (SP Industries, catalog number: 535-PP-7 )
2D [1H-15N]-HSQC spectrum of the native protein acquired using standard methods (Cavanagh et al., 1995)
Dithiothreitol (DTT); > 99% purity (Gold Bio, catalog number: DTT50 )
Deuterium oxide (D2O); ≥ 99.8% purity (Sigma-Aldrich, catalog number: 617385 )
Tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl); ≥ 99% purity (Fisher Scientific, catalog number: BP153 )
Sodium chloride (NaCl); ≥ 99% purity (Fisher Scientific, catalog number: S271 )
S-(1-oxyl-2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl (MTSL) methanesulfonothioate (Toronto Research Chemicals, catalog number: O875000 )
Acetonitrile; ≥ 99.9% purity (Fisher Scientific, catalog number: A996 )
Sodium phosphate monobasic (NaH2PO4); ≥ 98% purity (Fisher Scientific, catalog number: S369 )
Sodium azide; ≥ 99% purity (Fisher Scientific, catalog number: S227I )
Sodium ascorbate; ≥ 98% purity (Sigma-Aldrich, catalog number: A7631 )
Labeling buffer (see Recipes)
200 mM MTSL stock solution (see Recipes)
Example NMR buffer (see Recipes)
250 mM sodium ascorbate stock solution (see Recipes)
Note: These reagents were used to obtain the PRE data according to Sjodt et al., 2016. However, other brands of these materials may be used if necessary.
Equipment
Centrifuge (Beckman Coulter, model: Allegra X-14R )
SX4750A swinging bucket rotor (Beckman Coulter, model: SX4750A ARIESTM Roter )
MALDI-TOF mass spectrometer (Thermo Fisher Scientific, Applied BiosystemsTM, model: Voyager-DE-STR )
Note: This product has been discontinued. Examples of other MALDI-TOF instruments include Shimadzu, model: AXIMA Assurance Linear MALDI-TOF ; Bruker, model: microflex LT/SH .
NMR experiments system
Note: NMR experiments used in this protocol are part of the Bruker standard pulse sequence library and were performed on Bruker Avance spectrometers equipped with triple-resonance cryogenic probes (Bruker Corporation).
Software
NMRPipe (Delaglio et al., 1995)
https://www.ibbr.umd.edu/nmrpipe/install.html
Bruker TopSpinTM
https://www.bruker.com/nc/service/support-upgrades/software-downloads/nmr/free-topspin-processing/download-page.html
Sparky (Goddard and Kneller, 2008)
https://www.cgl.ucsf.edu/home/sparky/
Microsoft Excel
https://products.office.com/en-us/excel
XPLOR-NIH (Schwieters et al., 2003)
https://nmr.cit.nih.gov/xplor-nih/
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sjodt, M. and Clubb, R. T. (2017). Nitroxide Labeling of Proteins and the Determination of Paramagnetic Relaxation Derived Distance Restraints for NMR Studies. Bio-protocol 7(7): e2207. DOI: 10.21769/BioProtoc.2207.
Download Citation in RIS Format
Category
Biochemistry > Protein > Labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,208 | https://bio-protocol.org/exchange/protocoldetail?id=2208&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
ARP2/3 Phosphorylation Assay in the Presence of Recombinant Bacterial Effectors
Céline Michard
LL Lawrence L. LeClaire
PD Patricia Doublet
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2208 Views: 7865
Reviewed by: Yurong XieTatsuki Kunoh
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
The Actin-Related Protein 2/3 (ARP2/3) complex is an actin nucleator that generates a branched actin network in mammalian cells. In addition to binding nucleation promoting factors, LeClaire et al. demonstrated that its phosphorylation state is essential key for its activity (LeClaire et al., 2008). In cells, the ARP2/3 complex is phosphorylated on threonine and tyrosine residues of the ARP2, ARP3, and ARPC1 subunits (Vadlamudi et al., 2004; LeClaire et al., 2008; Narayanan et al., 2011; LeClaire et al., 2015). In particular, phosphorylation of threonine 237 and 238 of the ARP2 subunit is necessary to allow a change in the ARP2/3 complex structure to its active conformation (Narayanan et al., 2011; LeClaire et al., 2015). While important for many functions in eukaryotic cells, ARP2/3 complex activity also benefits several cellular pathogens (Haglund and Welch, 2011; Welch and Way, 2013). Recently, we demonstrated that the bacterial pathogen, Legionella pneumophila, manipulates ARP2/3 complex phosphorylation state using a bacterial protein kinase injected in host cell cytoplasm (Michard et al., 2015). Here, we describe how to test the ability of a bacterial protein kinase or another protein kinase to phosphorylate the ARP2/3 complex in an in vitro context. First, the ARP2/3 complex and the bacterial protein kinase are produced and purified. Then, the purified proteins are incubated in the presence of ATP, and the ARP2/3 phosphorylation level is analyzed by Western blot.
Keywords: in vitro phosphorylation assay Protein kinase ARP2/3 complex Protein purification Western blot analysis
Background
The ARP2/3 complex is phosphorylated on threonine and tyrosine residues (LeClaire et al., 2008). Four phosphorylation sites on the ARPC1 and ARP2 subunits of ARP2/3 complex are currently known: the threonine 21 of ARPC1, threonines 237/238 and tyrosine 202 of ARP2, each demonstrating an important role for ARP2/3 function (Vadlamudi et al., 2004; LeClaire et al., 2008; Narayanan et al., 2011). A recent study by our laboratory demonstrated that the Legionella kinase 2 (LegK2), an effector serine/threonine protein kinase of Legionella pneumophila, modifies the threonine phosphorylation state of ARPC1B and ARP3 subunits of ARP2/3 complex. ARP2/3 complex phosphorylation inactivates and blocks actin polymerization on the bacterial vacuole, preventing the degradation of bacteria by the endocytic pathway (Michard et al., 2015). This protocol describes an in vitro phosphorylation assay routinely used in our laboratory to test a potential substrate of protein kinases as subunits of the ARP2/3 complex. The protocol can be also adapted to assay other substrates as needed.
Materials and Reagents
Overproduction and extraction of bacterial protein kinase
50 ml conical tubes (Greiner Bio One International, catalog number: 227261 )
Sterile culture tubes (SARSTEDT, catalog number: 62.515.006 )
Sterilization filters (0.22 µm) (Dutscher Scientific, catalog number: 51732 )
Spectrophotometer cuvette (Dutscher Scientific, catalog number: 030101 )
Escherichia coli BL21 (pREP4-groESL) (Amrein et al., 1995)
pGEX-6P-3 (Smith and Johnson, 1988)/pGEX-protein kinase
Prechilled dH2O
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 )
LB medium (Lennox) (Carl Roth, catalog number: X964 )
Ampicillin (Carl Roth, catalog number: K029 )
Kanamycin (Sigma-Aldrich, catalog number: K4000 )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Carl Roth, catalog number: 2316 )
Sodium chloride (NaCl) (Carl Roth, catalog number: 3957 )
Potassium chloride (KCl)
Sodium phosphate dibasic (Na2HPO4)
Potassium phosphate monobasic (KH2PO4)
LB medium + ampicillin + kanamycin
LB medium (see Recipes)
100 µg/ml ampicillin (see Recipes)
25 µg/ml kanamycin (see Recipes)
0.1 M IPTG (see Recipes)
1x phosphate-buffered saline (PBS) (see Recipes)
Purification of bacterial protein kinase
Microtubes
1.5 ml (SARSTEDT, catalog number: 72.690.001 )
2 ml (SARSTEDT, catalog number: 72.694.006 )
Polypropylene columns 1 ml (QIAGEN, catalog number: 34924 )
Spectra/Por® dialysis membrane MWCO: 3.5-5 kD (Biotech CE Trial Kit) (Spectrum, catalog number: 131201T ), stored at 4 °C in humid atmosphere
Protino Glutathione agarose-4B (Macherey-Nagel, catalog number: 745500.10 ), stored at 4 °C
Glycerol (Carl Roth, catalog number: 3783 )
Tris(hydroxymethyl)aminomethane (Tris) (Carl Roth, catalog number: 5429 )
Glutathione (Sigma-Aldrich, catalog number: G4251 )
Sodium chloride (NaCl) (Carl Roth, catalog number: 3957 )
1x PBS (see Recipes)
GST elution buffer (see Recipes)
Dialysis buffer (see Recipes)
Purification of ARP2/3 complex
Polypropylene columns 1 ml (QIAGEN, catalog number: 34924 )
PD-10 columns (GE Healthcare, catalog number: 17085101 )
Actin-depleted cellular lysates prepared from Acanthamoeba castellanii (Zuchero, 2007)
Liquid nitrogen (liquid N2)
Tris (Fisher Scientific, catalog number: BP152-5 )
Magnesium chloride (MgCl2) (Fisher Scientific, catalog number: BP214-500 )
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Fisher Scientific, catalog number: BP2939100 )
Dithiothreitol (DTT) (Fisher Scientific, catalog number: BP172-5 )
Glycerol (Fisher Scientific, catalog number: P2294 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: P217-500 )
Adenosine triphosphate (ATP) (Fisher Scientific, catalog number: BP413-25 )
N-WASP VCA-coupled-CH-Sepharose (Zuchero, 2007)
Phenyl Sepharose (Sigma-Aldrich, catalog number: P2459 )
Buffer A (see Recipes)
ARP2/3 elution buffer (see Recipes)
ARP2/3 storage buffer (see Recipes)
Dephosphorylation of ARP2/3 complex
Microtubes (1.5 ml)
3,500 MWCO Mini dialysis units (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 69550 )
2 mM Tris, pH 8.0 (Fisher Scientific, catalog number: BP152-5 )
Antarctic phosphatase (New England Biolabs, catalog number: M0289 )
N-WASP VCA-coupled Sepharose (Zuchero, 2007)
Tris (Fisher Scientific, catalog number: BP152-5 )
dH2O
Magnesium chloride hexahydrate (MgCl2) (Fisher Scientific, catalog number: BP214-500 )
Zinc chloride (ZnCl2) (Sigma Aldrich, catalog number: Z3500 )*
5x HipH buffer (see Recipes)
Buffer A (see Recipes)
ARP2/3 elution buffer (see Recipes)
In vitro phosphorylation assays
Microtubes (1.5 ml) (SARSTEDT, catalog number: 72.690.001 )
Purified bacterial kinase and its catalytic variant
Purified and purified/dephosphorylated ARP2/3 complex
Tris (Carl Roth, catalog number: 5429 )
Manganese chloride (MnCl2) (Fisher Scientific, catalog number: M87-100 )
DTT (Carl Roth, catalog number: 6908 )
ATP (Sigma-Aldrich, catalog number: A5394 )*
dH2O
Magnesium chloride hexahydrate (MgCl2) (Carl Roth, catalog number: 2189 )
Zinc chloride (ZnCl2) (Sigma-Aldrich, catalog number: 211273 )
Sodium dodecyl sulfate (SDS) (Carl Roth, catalog number: 2326 )
Glycerol (Carl Roth, catalog number: 3783 )
Bromophenol blue (Sigma-Aldrich, catalog number: B6131 )*
β-mercaptoethanol (Sigma-Aldrich, catalog number: O34461-100 )
Antarctic phosphatase (New England Biolabs, catalog number: M0289 )
10x phosphorylation buffer (see Recipes)
ATP solution at 0.5 mg.ml-1 (see Recipes)
5x Laemmli loading buffer (see Recipes)
5x HipH buffer (see Recipes)
Detection of phosphorylation level with Western Blot
Square Petri dish (Greiner Bio One International, catalog number: 688162 )
Whatman 3 MM CHR paper (GE Healthcare, catalog number: 3030-917 )
Nitrocellulose membrane Optitran BA-S85 reinforced NC (GE Healthcare, catalog number: 10439194 )
50 ml conical tubes
Parafilm
Plastic wrap
Page RulerTM prestained protein ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 26616 )
Monoclonal mouse anti-phosphothreonine antibody, Clone PTR-8 (Sigma-Aldrich, catalog number: P6623 )
Goat anti-mouse IgG peroxidase antibody (Sigma-Aldrich, catalog number: A0168 )
Super Signal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 34080 )
Rotiphorese Gel 30 (30% acrylamide, 0.8% bisacrylamide) (Carl Roth, catalog number: 3029 )
Tris (Carl Roth, catalog number: 5429 )
dH2O
SDS (Carl Roth, catalog number: 2326 )
Ammonium persulfate (APS) (Carl Roth, catalog number: 9592 )
Tetramethylethylenediamine (TEMED) (Carl Roth, catalog number: 2367 )
Glycine (Carl Roth, catalog number: 0079 )
Glacial acetic acid
Ethanol
Coomassie Brilliant Blue R-250 (MP Biomedicals, catalog number: 1-800-854-0530 or MP Biomedicals, catalog number: 02190682 )
Methanol
6-aminohexanoic acid
Sodium chloride (NaCl) (Carl Roth, catalog number: 3957 )
Bovine serum albumin (BSA) (Carl Roth, catalog number: T844 )
Tween 20 (VWR, BDH®, catalog number: 663684B )
Anti-phosphotyrosine antibody (EMD Millipore, catalog number: AB1607 )
Migration buffer (see Recipes)
12% SDS-PAGE gels (see Recipes)
Staining solution (see Recipes)
Destaining solution (see Recipes)
Assembly for the semi-dry transfer
a.Transfer solution 1 (see Recipes)
b.Transfer solution 2 (see Recipes)
c.Transfer solution 3 (see Recipes)
Tris-buffered saline (TBS) (see Recipes)
TBS-5% BSA (see Recipes)
TBS-0.1% Tween 20 (see Recipes)
Anti-phosphothreonine antibodies solution (see Recipes)
Anti-mouse-peroxydase antibodies solution (see Recipes)
*Note: These products have been discontinued.
Equipment
Shaker/incubator at 37 °C and 20 °C for tubes and 500 ml Erlenmeyer flask
Autoclave
Ultrospec 10-cell density meter (GE Healthcare, Amersham Biosciences, model: Ultrospec® 10 )
Centrifuges for conical and microtubes at 4 °C
French pressure cell press (American instrument company)
Tubes rotator for conical and microtubes
Support of purification columns
NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 )
Freezer -80 °C
Lab water bath at 37 °C and 30 °C
Dry block heater at 100 °C
HoeferTM Dual Gel Caster system (GE Healthcare, Amersham Biosciences, model: Dual Gel Caster )
Electrophoresis power supply
Semi-dry blotter (C.B.S Scientific, catalog number: EBU-4000 ) with GD3000 D generator (Sebia)
ChemiStart 5000 (Fisher Bioblock Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Michard, C., LeClaire, L. L. and Doublet, P. (2017). ARP2/3 Phosphorylation Assay in the Presence of Recombinant Bacterial Effectors. Bio-protocol 7(7): e2208. DOI: 10.21769/BioProtoc.2208.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Cell Biology > Cell movement > Cell motility
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,209 | https://bio-protocol.org/exchange/protocoldetail?id=2209&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Use of Geminivirus for Delivery of CRISPR/Cas9 Components to Tobacco by Agro-infiltration
Kangquan Yin
TH Ting Han
Yule Liu
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2209 Views: 14465
Edited by: Rainer Melzer
Reviewed by: Kaisa Kajala
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
CRISPR/Cas9 system is a recently developed genome editing tool, and its power has been demonstrated in many organisms, including some plant species (Wang et al., 2016). In eukaryotes, the Cas9/gRNA complexes target genome sites specifically and cleave them to produce double-strand breaks (DSBs), which can be repaired by non-homologous end joining (NHEJ) pathway (Wang et al., 2016). Since NHEJ is error prone, mutations are thus generated. In plants, delivery of genome editing reagents is still challenging. In this protocol, we detail the procedure of a virus-based gRNA delivery system for CRISPR/Cas9 mediated plant genome editing (VIGE). This method offers a rapid and efficient way to deliver gRNA into plant cells, especially for those that are recalcitrant to transformation with Agrobacterium.
Keywords: CRISPR Cas9 Geminivirus VIGE Genome editing Tobacco
Background
Genome editing technologies based on viruses have been reported using deconstructed DNA viruses and an RNA virus (Baltes et al., 2014; Ali et al., 2015). Recently, we used a full geminivirus - Cabbage Leaf Curl virus (CaLCuV) (a bipartite begomovirus which infects a wide range of members of the Brassicaceae, including cauliflower) for highly efficient genome editing in one of its hosts, Nicotiana benthamiana, for the first time (Yin et al., 2015).
Materials and Reagents
1-ml syringe
0.22-μm filter
Wild type N. benthamiana plants; six to eight-leaf stage transgenic N. benthamiana plants stably expressing oCas9 (Arabidopsis codon optimized Cas9) - KQ334 plant
Agrobacterium tumefaciens strain GV3101, E. coli DH5α, E. coli DB3.1 (for propagating vectors pJG081)
The following plasmids are required: pJG081, pKQ334 (Yin et al., 2015), pT-U6p-scaffold-U6t (Yin et al., 2015), pCAMBIA1301, pCAMBIA2300 (www.cambia.org), pCVA (Tang et al., 2010), pCVB (Tang et al., 2010), and pMD18-T vector (Takara Bio, catalog number: D101A)
Notes:
To generate a construct for constitutive expression of oCas9, oCas9 is PCR amplified and subsequently cloned into pJG081 by ligation independent cloning (LIC) technique (Aslanidis and de Jong, 1990) to generate pKQ334.
pKQ334 is then used to transform N. benthamiana to generate Cas9 transgenic plant - KQ334 plant. pKQ334 can also be used in transient expression of Cas9 in N. benthamiana.
The pT-U6p-scaffold-U6t is used to generate p-T-U6p-gRNA-scaffold containing gRNA of the target gene by PCR mutagenesis.
pCVA and pCVB are CaLCuV-based T-DNA vectors. pCVA is used to generate pCVA-gRNA or pCVA-scaffold. pCVB is used in combination with pCVA or its derivatives to generate CaLCuV. pMD18-T vector is used to clone PCR amplicons.
These vectors can be obtained by contacting Dr. Yule Liu.
Primers (Table 1)
Table 1. Primers used in this protocol
TransStart FastPfu DNA polymerase (Beijing TransGen Biotech, catalog number: AP221 )
Restriction enzymes (New England Biolabs, stored at -20 °C)
DpnI (New England Biolabs, catalog number: R0176 )
ApaI (New England Biolabs, catalog number: R0114 )
SacI (New England Biolabs, catalog number: R0156 )
PstI (New England Biolabs, catalog number: R3140S )
KpnI (New England Biolabs, catalog number: R3142S )
XbaI (New England Biolabs, catalog number: R0145S )
MlyI (New England Biolabs, catalog number: R0610 )
10x Cutsmart buffer
Antibiotics
Ampicillin (AMRESCO, catalog number: 0339 )
Kanamycin (AMRESCO, catalog number: 0408 )
Rifampicin (Sigma-Aldrich, catalog number: R3501 )
TIANprep Mini Plasmid Kit (TIANGEN Biotech, catalog number: DP103 ) for plasmid DNA extraction
Ethanol (Beijing Chemical Factory, catalog number: B0301002 )
T4 DNA polymerase (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EP0062 )
dATP (Takara Bio, catalog number: 4026 )
Chloroform (Sigma-Aldrich, catalog number: 1601383 )
Phenol (Sigma-Aldrich, catalog number: P4557 )
3 M NaAc (Biovision, catalog number: 2118 )
dTTP (Takara Bio, catalog number: 4029 )
DNA Purification Kit (BioMED, catalog number: DH103-01 )
T4 DNA ligase (Takara Bio, catalog number: 2011A )
Tryptone (BD, BactoTM, catalog number: 211705 )
Yeast extract (BD, BactoTM, catalog number: 212750 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 31434 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M7304 )
MES (Sigma-Aldrich, catalog number: M3671 )
Potassium hydroxide (KOH)
Acetosyringone (Solarbio, catalog number: A8110-1 )
DMSO
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S3139 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Sodium phosphate monobasic (NaH2PO4) (AMRESCO, catalog number: 0571 )
Sodium phosphate dibasic (Na2HPO4) (AMRESCO, catalog number: 0404 )
Sodium phosphate monobasic monohydrate (NaH2PO4·H2O)
Sodium phosphate dibasic heptahydrate (Na2HPO4·7H2O)
X-gluc (AMRESCO, catalog number: 0919 )
Methanol (Beijing Chemical Factory, catalog number: B0301005 )
Potassium ferricyanide (AMRESCO, catalog number: 0713 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
PEG 8000 (Sigma-Aldrich, catalog number: 89510 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (AMRESCO, catalog number: 0288 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: 63068 )
MES (Sigma-Aldrich, catalog number: M3671 )
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
EasyTaq DNA polymerase (Beijing TransGen Biotech, catalog number: AP111 )
DNAsecure Plant Kit (TIANGEN Biotech, catalog number: DP320 ) for genomic DNA extraction
Luria-Bertani medium (see Recipes)
MgCl2 (1 M stock) (see Recipes)
MES (0.5 M stock) (see Recipes)
Acetosyringone (1 M stock) (see Recipes)
Infiltration buffer (see Recipes)
2x phosphate buffer (pH 7) (see Recipes)
X-gluc substrate solution (see Recipes)
PEG-MgCl2 solution (see Recipes)
Equipment
Microcentrifuge (Eppendorf)
PCR cycler (Bio-Rad Laboratories)
37 °C and 28 °C incubator; 37 °C and 28 °C shaker
NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, model: NanoDrop 1000 ) (for measuring the concentration of the DNA)
Electrophoresis apparatus (Junyi, Beijing)
Vacuum apparatus (WILMAD-LABGLASS)
Glass/plastic beaker
Autoclave
Software
ImageJ (https://imagej.nih.gov/ij)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yin, K., Han, T. and Liu, Y. (2017). Use of Geminivirus for Delivery of CRISPR/Cas9 Components to Tobacco by Agro-infiltration. Bio-protocol 7(7): e2209. DOI: 10.21769/BioProtoc.2209.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Agrobacterium
Molecular Biology > DNA > Transformation
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
221 | https://bio-protocol.org/exchange/protocoldetail?id=221&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Murine xenograft model
FL FengZhi Liu
Published: Jun 5, 2012
DOI: 10.21769/BioProtoc.221 Views: 21937
Download PDF
Ask a question
Favorite
Cited by
Abstract
This experiment is used to test the efficacies of chemo treatments or gene therapy in an in vivo system. In this protocol, the mouse xenograft model is used.
Materials and Reagents
Severe combined immunodeficiency (SCID) mice
NaCl
Pluronic acid
Phosphate buffered saline (PBS)
HBSS solution
Equipment
1 ml syringe with 22-24 gauge of needls
Bioluminescent imaging instrument (in university core facility)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > General technique > Animal models
Cancer Biology > General technique > Drug discovery and analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,210 | https://bio-protocol.org/exchange/protocoldetail?id=2210&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Gliding Assay to Analyze Microtubule-based Motor Protein Dynamics
AS Albert Shim
Gin Tezuka
LK Luke Kupcha
Li Tao
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2210 Views: 13319
Edited by: Jyotiska Chaudhuri
Reviewed by: Tamara VellosilloJason A. Neidleman
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
The purpose of this protocol is to provide an updated method of performing microtubule gliding assays and visualizing it using fluorescence microscopy.
Keywords: Gliding assay Mitotic motor in vitro motility Polarity-marked microtubules Glass chamber
Background
Mitotic spindles are protein machinery that dominate mitosis. The mitotic spindle utilizes microtubule-based motor proteins to organize itself, and exert forces to drive cell division. Microtubule-based motor proteins produce mechanical work using energy derived from ATP hydrolysis (Coppin et al., 1997). Motor proteins translocate microtubules in a unidirectional manner. The behavior of motility can be observed by in vitro gliding assay (Tao and Scholey, 2010), in which the motors are affixed onto a glass surface and supplied with microtubules and ATP. The motility of the motor proteins can then be studied using fluorescence microscopy and the details of their dynamic behavior can be observed in real time. This updated protocol will allow analysis of microtubule-based motor protein function with the use of in vitro microtubule gliding assays (Tao et al., 2006 and 2016).
Materials and Reagents
Pipette tips (Corning, catalog number: 4860 )
Centrifuge tubes (Corning, catalog number: 430290 )
Thickwall polycarbonate tubes (Beckman Coulter, catalog number: 343775 )
Coverslips (Sigma-Aldrich, catalog number: Z692263 )
Microscope slides (Fisher Scientific, catalog number: S17466A )
Coverslips (Fisher Scientific, catalog number: S175211A )
Guanosine-5’-[(α,β)-methyleno]triphosphate (GMPCPP) (10 mM) (Jena Bioscience, catalog number: NU-405S )
Tubulin (CYTOSKELETON, catalog number: TL238A )
Rhodamine tubulin (CYTOSKELETON, catalog number: TL590M )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D9779 )
N-ethylmaleimide (Sigma-Aldrich, catalog number: E3876 )
Guanosine 5’-triphosphate (GTP) (Sigma-Aldrich, catalog number: G8877 )
Hydrogen chloride (HCl) (Sigma-Aldrich, catalog number: 295426 )
Casein (Sigma-Aldrich, catalog number: C7078 )
ATP (Sigma-Aldrich, catalog number: A6419 )
Paclitaxel (Taxol) (Sigma-Aldrich, catalog number: T7402 )
Piperazine-N,N’-bis(2-ethanesulfonic acid) (PIPES) (Sigma-Aldrich, catalog number: P6757 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M4880 )
EGTA (Sigma-Aldrich, catalog number: E3889 )
Tris base (Sigma-Aldrich, catalog number: T1503 )
Potassium chloride (KCl) (Sigma-Aldrich: P5405 )
Protease inhibitors:
Aprotinin (Sigma-Aldrich, catalog number: A3428 )
Benzamidine (Sigma-Aldrich, catalog number: B6505 or 12072 )
Note: The product “ B6505 ” has been discontinued.
Pepstatin A (Sigma-Aldrich, catalog number: P5318 )
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Leupeptin (Sigma-Aldrich, catalog number: L2884 )
Soybean trypsin inhibitor (SBTI) (Sigma-Aldrich, catalog number: T6522 )
Tert-Amyl methyl ether (TAME) (Sigma-Aldrich, catalog number: 283096 )
Catalase (Sigma-Aldrich, catalog number: C1345 )
Glucose oxidase (Sigma-Aldrich, catalog number: C6766 or G7141 )
Note: The product “ C6766 ” has been discontinued.
Glucose (Sigma-Aldrich, catalog number: D9434 )
Phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: P5368 )
BRB80 buffer solution (see Recipes)
Buffer L (see Recipes)
Anti-fade solution (see Recipes)
Equipment
Micropipette
2-20 μl (Sigma-Aldrich, catalog number: Z717304 )
10-100 μl (Sigma-Aldrich, catalog number: Z717312 )
Ultra-centrifuge (Beckman Coulter, model: TLA-100 )
NanoDrop (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 )
Fluorescence microscope (Nikon Instruments, model: Eclipse E600 )
Water bath (Thermo Fisher Scientific, model: PrecisionTM General Purpose Baths , catalog number: TSGP02)
Software
ImageJ (Version 1.51J, https://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Shim, A., Tezuka, G., Kupcha, L. and Tao, L. (2017). Gliding Assay to Analyze Microtubule-based Motor Protein Dynamics. Bio-protocol 7(7): e2210. DOI: 10.21769/BioProtoc.2210.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fluorescence
Biochemistry > Protein > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,211 | https://bio-protocol.org/exchange/protocoldetail?id=2211&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Robust Generation of Knock-in Cell Lines Using CRISPR-Cas9 and rAAV-assisted Repair Template Delivery
GV Giel Vandemoortele
DS Delphine De Sutter
SE Sven Eyckerman
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2211 Views: 21493
Edited by: Longping Victor Tse
Reviewed by: Rajesh B. Thippeshappa
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
The programmable Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated nuclease 9 (Cas9) technology revolutionized genome editing by providing an efficient way to cut the genome at a desired location (Ledford, 2015). In mammalian cells, DNA lesions trigger the error-prone non-homologous end joining (NHEJ) DNA repair mechanism. However, in presence of a DNA repair template, Homology-Directed Repair (HDR) can occur leading to precise repair of the lesion site. This last process can be exploited to enable precise knock-in changes by introducing the desired genomic alteration on the repair template. In this protocol we describe the delivery of long repair templates (> 200 nucleotides) using recombinant Adeno Associated Virus (rAAV) for CRISPR-Cas9-based knock-in of a C-terminal tag sequence in a human cell line.
Keywords: CRISPR-Cas9 Recombinant adeno-associated virus (rAAV) Genome engineering Epitope tagging
Background
Despite numerous reports on knock-out model systems generated by CRISPR-Cas9, knock-in reports are still lagging behind. Because of the many applications, generating knock-in cell lines remains an obvious goal of genome editing. The introduction of knock-in alterations generally relies on the presence of a repair template DNA and activation of the HDR repair mechanism after a site-specific double strand (ds)DNA break is introduced in the genome close to the site of alteration. Different templates can be delivered to the repair machinery ranging from a classical linearized vector containing extensive homology regions and an optional selection cassette, to single strand (ss)DNA oligonucleotides of about 200 nucleotides (Chen et al., 2011). Although ssDNA oligonucleotides are a popular tool, they can only be used to introduce small alterations such as mutations or epitope tags because of DNA synthesis limitations. In addition, the lack of a selection cassette requires robust screening strategies to identify correct clones as no selective pressure is applied on the HDR process. Successful use of integration-deficient rAAV for homologous recombination was already shown before the availability of tailored nucleases (Khan et al., 2011). Both its efficient delivery and ssDNA genome make rAAV a powerful tool to deliver donor repair templates for homologous recombination. Moreover, the secondary structures at the end of the ssDNA molecule block exonuclease activity and stabilize the donor DNA. Even without the use of specific nucleases, knock-in efficiencies of up to 0.7% were obtained in fibroblasts cells (Russell and Hirata, 1998), which was further increased by introducing selection cassettes.
By combining CRISPR-Cas9 with rAAV-mediated repair template delivery, knock-in cell lines can be generated in a robust manner with efficiencies well beyond 50% when selection cassettes are used. This protocol describes the complete procedure for epitope tagging of a gene of choice in the HCT116 colon carcinoma cell line using CRISPR-Cas9 and rAAV. A timeline for the complete experimental procedure is shown in Figure 1.
Figure 1. Timeline for the generation of a knock-in cell line using CRISPR-Cas9 and rAAV-assisted repair template delivery. Dotted timespans indicate periods of incubation or expansion, requiring limited to no hands-on time.
Materials and Reagents
T25 cell culture treated flasks with filter caps (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 136196 )
Eppendorf Safe-Lock microcentrifuge tubes (Eppendorf, catalog number: 022363204 )
5Prime Phase Lock gel tubes heavy 2 ml (Quantabio, catalog number: 2302830 )
T75 cell culture treated flasks with filter caps (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 178905 )
Greiner 50 ml centrifuge tubes (Greiner Bio One International, catalog number: 227261 )
Greiner cell scrapers (Greiner Bio One International, catalog number: 541081 )
24-well cell culture-treated multidish (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 142475 )
96-well microplates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 156545 )
96-well PCR plate (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: AB0700 )
6-well cell culture-treated multidish (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 140675 )
Aluminium foil tape (3M, catalog number: 425DWB )
Illustra Microspin S-400 HR columns (GE Healthcare, catalog number: 27-5140-01 )
Immobilon-FL PVDF transfer membrane (EMD Millipore, catalog number: IPFL00010 )
Whatman 3 MM chr cellulose blotting sheets (GE Healthcare, catalog number: 3030-917 )
0.22 µm filter (EMD Millipore, catalog number: SLGV033RS )
AAV-293 cell line (Agilent Technologies, catalog number: 240073 )
HCT 116 cell line (ATCC, catalog number: CCL-247 )
Cas9 D10A nickase mutant (nCas9) (Addgene, catalog numbers: 48140 and 62987 )
pAav-MCS-PQS1-3xFLAG or pAav-MCS-PQS2-3xHA (Addgene, catalog numbers: 84883 and 84917 respectively)
pDG rAAV packaging plasmid (PlasmidFactory, catalog number: PF421 )
Wild-type Cas9 expression vectors (Cas9) (Addgene, catalog numbers: 48138 and 62988 )
Competent bacterial cells of choice (e.g., TOP10 or DH5α)
Surveyor Mutation Detection Kit (Integrated DNA Technologies, catalog number: 706025 )
UltraPure phenol:chloroform:isoamyl alcohol (25:24:1, v/v) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15593031 )
Sodium chloride (NaCl) molecular biology grade (EMD Millipore, catalog number: 567441 )
2-propanol (Sigma-Aldrich, catalog number: 278475 )
Ethanol (EMD Millipore, catalog number: 100983 )
AccuPrime Pfx DNA polymerase (Thermo Fisher Scientific, InvitrogenTM, catalog number: 12344-024 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: 449709 )
DMEM, high glucose GlutaMAX medium (Thermo Fisher Scientific, GibcoTM, catalog number: 31966047 )
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Benzonase nuclease (Sigma-Aldrich, catalog number: E1014 )
AAV-purification Vira Kit 3-use (Virapur, catalog number: 003063 )
AAV helper-free system (Agilent Technologies, catalog number: 240071 )
McCoy’s 5A medium, modified (Thermo Fisher Scientific, GibcoTM, catalog number: 16600082 )
Opti-MEM I reduced serum medium, GlutaMAX supplement (Thermo Fisher Scientific, GibcoTM, catalog number: 51985026 )
Fugene HD transfection reagent (Promega, catalog number: E2311 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10500064 )
Trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25300096 )
Puromycin (Sigma-Aldrich, catalog number: P8833 )
Crystal violet solution (Sigma-Aldrich, catalog number: HT90132 )
Geneticin/G418 (Thermo Fisher Scientific, GibcoTM, catalog number: 11811031 )
GoTaq G2 Hot Start polymerase (Promega, catalog number: M7405 )
dNTP 100 mM PCR grade (Agilent Technologies, catalog number: 200415 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D2650 )
TAT-Cre recombinase (Excellgen, catalog number: EG-1001 )
NucleoSpin Gel and PCR Clean-up Kit (Machery-Nagel, catalog number: 740609 )
Random Primer DNA Labeling Kit (Takara Bio, catalog number: 6045 )
[α-32P] dCTP, 50 µCi (PerkinElmer, catalog number: BLU013H250UC )
Exo-free Klenow enzyme (New England Biolabs, catalog number: M0212S )
SuRE/Cut buffer H (Roche Diagnostics, catalog number: 11417991001 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A4503 )
EcoRI 40 U/µl (Roche Diagnostics, catalog number: 10200310001 )
Nytran SuPerCharge TurboBlotter Kit (Sigma-Aldrich, catalog number: Z613924 )
Note: This product has been discontinued.
PerfectHyb plus hybridization buffer (Sigma-Aldrich, catalog number: H7033 )
4-12% criterion XT Bis-Tris protein gel 18 well, 30 µl (Bio-Rad Laboratories, catalog number: 3450124 )
Mouse monoclonal anti-FLAG M2 antibody (Sigma-Aldrich, catalog numbers: F3165 )
Or rat monoclonal anti-HA high affinity (Roche Diagnostics, catalog number: 11867423001 )
Zero Blunt PCR Cloning Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: K270020 )
NucleoSpin Plasmid EasyPure (Machery-Nagel, catalog number: 740727 )
Tris ultra-pure grade (MP Biomedicals, catalog number: 02103133 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E5134 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: 436143 )
Proteinase K from Tritirachium album > 800 U/ml (Sigma-Aldrich, catalog number: P4850 )
HEPES (Sigma-Aldrich, catalog number: H4034 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: 255793 )
Direct lysis reagent (cell) (VIAGEN BIOTECH, catalog number: 301-C )
CHAPS hydrate (Sigma-Aldrich, catalog number: C5070 )
cOmplete protease inhibitor (Roche Diagnostics, catalog number: 11697498001 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 30721 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 221465 )
Sodium citrate tribasic dehydrate [HOC(COONa)(CH2COONa)2·2H2O] (Sigma-Aldrich, catalog number: C8532 )
SmartLadder (Eurogentec, catalog number: MW-1700-10 )
Phase Lock lysis buffer (see Recipes)
TE-buffer (see Recipes)
2x HEBS (HEPES-buffered saline) (see Recipes)
rAAV cell lysis buffer (see Recipes)
Direct PCR lysis buffer (see Recipes)
CHAPS lysis buffer (see Recipes)
Depurination buffer (see Recipes)
Denaturation buffer (see Recipes)
Neutralization buffer (see Recipes)
20x SSC (see Recipes)
Wash buffer 1 (see Recipes)
Wash buffer 2 (see Recipes)
Wash buffer 3 (see Recipes)
Equipment
BSL2 cell culture facilities
Thermoshaker
Vortex (e.g., IKA, model: MS2 minishaker )
Inverted microscope for cell culture use (e.g., Carl Zeiss, model: Axiovert 25 )
Non-circulating water bath
250 ml sterile storage bottle (Corning, catalog number: 430281 )
Thermal cycler instrument (e.g., Bio-Rad Laboratories, model: T100TM Thermal Cycler , catalog number: 1861096)
Western blotting equipment, e.g.,
Criterion vertical electrophoresis cell (Bio-Rad Laboratories, catalog number: 1656001 )
Criterion blotter with plate electrodes (Bio-Rad Laboratories, catalog number: 1704070 )
GS gene linker UV chamber (Bio-Rad Laboratories, model: GS Gene LinkerTM UV Chamber )
Phosphor imager device (e.g., GE Healthcare, model: Typhoon 9200 )
Required facilities and procedures (e.g., waste disposal procedures) should be in place for using radioactively labeled nucleotides ([α-32P] dCTP)
Tabletop centrifuge (Eppendorf, model: 5430 R )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Vandemoortele, G., De Sutter, D. and Eyckerman, S. (2017). Robust Generation of Knock-in Cell Lines Using CRISPR-Cas9 and rAAV-assisted Repair Template Delivery. Bio-protocol 7(7): e2211. DOI: 10.21769/BioProtoc.2211.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Mutagenesis
Molecular Biology > DNA > DNA recombination
Cell Biology > Cell engineering > CRISPR-cas9
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,212 | https://bio-protocol.org/exchange/protocoldetail?id=2212&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Co-culture Model for Determining the Target Specificity of the de novo Generated Retinal Ganglion Cells
PT Pooja Teotia
MH Matthew J. Van Hook
IA Iqbal Ahmad
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2212 Views: 8491
Reviewed by: Letizia De Chiara
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
In glaucoma, the output neurons of the retina, the retinal ganglion cells (RGCs), progressively degenerate, leading to irreversible blindness (Ahram et al., 2015). The ex vivo stem cell method to replace degenerated RGCs remains a potentially viable approach (Levin et al., 2004). However, the success of the approach depends upon the ability of the de novo generated RGCs to connect over the long distance with specific targets in the central visual pathway. Here, we describe a protocol to examine the target specificity of the de novo generated RGCs using a co-culture approach where the RGCs neurites are allowed to choose between specific (superior colliculus; SC) and non-specific (inferior colliculus; IC) tectal targets.
Keywords: Glaucoma Human induced pluripotent stem cells Retinal ganglion cells Superior colliculus Target specificity
Background
Glaucoma is one of the most prevalent causes of irreversible blindness worldwide (Tham et al., 2014). It is characterized by a progressive degeneration of RGCs, the main output neurons of the retina, which connects with the brain for visual perception. Unfortunately, there is no treatment currently available to address RGCs degeneration. The management approaches, whether surgical, pharmacological or neuro-protective do not reverse the degenerative changes (Danesh-Meyer, 2011). Given this intractable situation, stem cell therapy has emerged as a potentially viable approach to replace dead RGCs. The success of this approach requires, 1) directed differentiation of functional and non-tumorigenic RGCs from pluripotent stem cells and 2) target specificity of the de novo generated RGCs. Our lab has recently demonstrated a chemically defined method that allows directed differentiation of RGCs from embryonic stem (ES)/induced pluripotent stem (iPS) cells by recapitulating developmental mechanism (Teotia et al., 2016). The resulting RGCs are stable, functional, and non-tumorigenic. However, the success of the de novo generated cells in the ex vivo stem cell approach to glaucomatous RGC degeneration depends upon their axons ability to find proper targets in the central visual pathways. When transplanted, axons of RGCs must navigate within the retina to exit as optic nerve, decide to cross or not to cross at the optic chiasm, and reach specific targets for establishing retinotopic connections. We have demonstrated that ES/iPS cell-derived RGCs possess target specificity. Here, we describe in detail a co-culture experimental paradigm to test the target specificity of the de novo generated RGCs.
Materials and Reagents
100-mm Petri dishes (SARSTEDT, catalog number: 83.1802 )
Kimtech science Kim-wipes (KCWW, Kimberly-Clark, catalog number: 34120 )
Double-edge stainless steel razor blades (Personna, catalog number: MPPB-100 )
Whatman filter paper, round (Sigma-Aldrich, catalog number: WHA10539028 )
Plastic pipette tips
200 μl tips (Fisher Scientific, FisherbrandTM, catalog number: 02-707-452 )
1 ml tips (Molecular Bio products, catalog number: 3580 )
Tape
12 mm round coverslips (Fisher Scientific, FisherbrandTM, catalog number: 12-545-80 )
Tissue culture plates, 24-well (Corning, Falcon®, catalog number: 353047 )
12-well plate
27 G1/4 gauge needles (BD, catalog number: 305136 )
Sprague-Dawley rats at postnatal day 1/3 (Charles river laboratories)
Ice and ice bucket
Hank’s balanced salt solution (HBSS), Ca2+/Mg2+ free (Mediatech, catalog number: 21-021-CV )
70% ethanol (Sigma-Aldrich, catalog number: 459844 )
4% to 7% low melting point agarose (45 to 50 °C) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16520-100 )
Poly D-lysine (Sigma-Aldrich, catalog number: P7886 )
Ultrapure Laminin, mouse (Corning, catalog number: 354239 )
DMEM/F12 media (Thermo Fisher Scientific, GibcoTM, catalog number: 11320033 )
CFDA SE (carboxyfluorescein diacetate succinimidyl ester) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: V12883 )
Vacuum grease
Ames’ Medium (Sigma-Aldrich, catalog number: A1420 )
Toxin tetrodotoxin (TTX) (Tocris Bioscience, catalog number: 1078 )
Lucifer yellow CH dipotassium salt (2 mg/ml) (Sigma-Aldrich, catalog number: L0144 )
Alexa Fluor 568 Hydrazide (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: A10437 )
Sodium chloride (NaCl)
Potassium chloride (KCl)
Sodium phosphate dibasic (Na2HPO4)
Potassium dihydrogen phosphate (KH2PO4)
KCH3SO4
Magnesium chloride (MgCl2)
Calcium chloride (CaCl2)
HEPES
Glucose
EGTA
MgATP
Na2GTP
hiPSC-RGCs specific media as described previously (Teotia et al., 2016)
Phosphate buffer saline (PBS), Ca2+/Mg2+ free (see Recipes)
Intracellular solution (see Recipes)
Equipment
Stereo zoom microscope (Leica Microsystems, model: MZ6 )
Stoelting tissue slicer/chopper (Stoelting)
Sterile biosafety hood (Thermo Fisher Scientific, Forma Scientific, model: Class IIA/B3 Biological safety cabinet)
Dissection hood (Thermo Fisher Scientific, Forma Scientific, Horizontal laminar flow hood)
Micro-dissecting scissors (Roboz, catalog number: RS-5611 )
Tissue forceps (Teeth less) (Harvard apparatus, catalog number: 72-6685 )
Bone rongeur (Roboz, catalog number: RS-8340 )
Beakers (100 ml) (Corning, PYTEX®, catalog number: 1000-100 )
Metal spatula
Vernier micrometer
Water bath set at 37 °C (Thermo Fisher Scientific, Fisher Scientific)
Fine and soft paintbrushes (Colour Shaper, catalog number: 11901 )
-80 °C freezer
Tissue culture hood
Tissue culture incubator set at 37 °C, 5% CO2 (Sanyo)
Standard fluorescein isothiocyanate (FITC) filter sets
Cell scraper
Centrifuge (IEC, model: Centra GP8R )
Fluorescent microscope (Olympus, model: 1X70 )
Recording chamber
Micromanipulator
Patch pipettes with tips of ~1 micron, fabricated out of thin-walled borosilicate glass capillaries (World Precision Instruments, catalog number: TW120F-4 ) using a pipette puller (i.e., NARISHIGE, model: PC-10 or Sutter Instrument, model: P-97 ) and with resistances of 5-10 MΩ
Patch clamp amplifier (Axon Multiclamp, Molecular Devices)
Autoclave
Software
Axiovision 4.8 software
ImageJ (NIH)
GraphPad Prism (Graphpad, La Jolla CA)
Windows Excel (Microsoft, Redmond, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Teotia, P., Van Hook, M. J. and Ahmad, I. (2017). A Co-culture Model for Determining the Target Specificity of the de novo Generated Retinal Ganglion Cells. Bio-protocol 7(7): e2212. DOI: 10.21769/BioProtoc.2212.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Neural stem cell
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,213 | https://bio-protocol.org/exchange/protocoldetail?id=2213&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Detection of Neutrophil Traps and Post-attack Cell Wall Changes in Candida Hyphae
AH Alex Hopke
Robert T. Wheeler
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2213 Views: 9099
Edited by: Alka Mehra
Reviewed by: Saskia F. ErttmannSadri Znaidi
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
In this protocol we describe how to visualize neutrophil extracellular traps (NETs) and fungal cell wall changes in the context of the coculture of mouse neutrophils with fungal hyphae of Candida albicans. These protocols are easily adjusted to test a wide array of hypotheses related to the impact of immune cells on fungi and the cell wall, making them promising tools for exploring host-pathogen interactions during fungal infection.
Keywords: Fungi C. albicans NETs Host-pathogen interactions Cell wall sDectin-1-Fc
Background
C. albicans is a polymorphic opportunistic yeast and neutrophils are immune cells critical for defense against this and other fungal pathogens (Brown et al., 2012; Lionakis and Netea, 2013). NETs are a potential defense mechanism that can be deployed against pathogens and it has been suggested that they are preferentially deployed against microbial cells such as C. albicans hyphae that are too large to phagocytose (Urban et al., 2006; Bruns et al., 2010; Branzk et al., 2014; Rohm et al., 2014). NETs have been shown to contain a number of components including myeloperoxidase, extracellular DNA and citrullinated histones (Amulic et al., 2012; Branzk and Papayannopoulos, 2013). For positive identification of NETs, the standard in both in vitro and in vivo experiments includes staining for and demonstrating the colocalization of these markers. While the exact contribution of NETs to defense against C. albicans infection is not well understood, our group has demonstrated they can provoke stress responses and cell wall rearrangement in C. albicans hyphae. Specifically, NET attack results in greater chitin deposition and β-glucan exposure as shown schematically in Figure 1. These polysaccharides normally lie underneath the mannan layer, and their exposure can change immune recognition (Perez-Garcia et al., 2011). The basic assays described here were used extensively to probe this subject by our group (Hopke et al., 2016). While outlined here for the purpose of detecting NETs and fungal cell wall changes, this protocol is easily tweaked to leverage many combinations of chemical inhibitors, transgenic or knockout fungal strains or mouse neutrophils and other staining targets to test a wide array of hypotheses (Hopke et al., 2016). This protocol therefore represents a promising method to further elucidate the impact immune cells have on the C. albicans cell wall, its stress response and the importance of altered epitope exposure to host defense against fungal infection.
Figure 1. Schematic of cell wall organization pre- and post-neutrophil attack. Under homeostatic conditions, hyphal cell wall is composed of three main polysaccharide components (mannan, β-glucan and chitin) but most chitin and β-glucan are inaccessible for recognition because it lies beneath the mannan layer. Post-attack there is loss of cell wall mannoprotein and increased levels of chitin. These changes lead to greater surface recognition of β-glucan and perhaps also chitin.
Materials and Reagents
Protective gloves and lab coat
Flint glass culture tubes 16 x 150 mm (VWR, catalog number: 60825-435 )
50 ml conical tubes (Corning, Falcon®, catalog number: 352098 )
Fisherbrand 100 x 20 mm Petri dishes (Fisher Scientific, catalog number: FB0875711Z )
10 ml syringe (BD, catalog number: 301604 )
25 G 5/8 needle (BD, catalog number: 305122 )
70 µm cell strainers (Corning, Falcon®, catalog number: 352350 )
1.7 ml microcentrifuge tubes
Plain microscope slides (VWR, catalog number: 48300-025 )
Kim-KapTM Disposable closures; 16 mm (Kimble Chase Life Science and Research Products, catalog number: 7366316 )
Miltenyi columns (Miltenyi Biotec, catalog number: 130-021-101 )
WT-FarRed670 strain of C. albicans (Hopke et al., 2016)
WT-GFP strain (Wheeler et al., 2008)
C57BL/6J mice, female 6-10 weeks old (THE JACKSON LABORATORIES, catalog number: 000664 )
Glycerol (EMD Millipore, catalog number: GX0185-5 )
Anti-Ly6G biotin antibody (Thermo Fisher Scientific, eBioscience, catalog number: 13-5931-85 )
Anti-biotin magnetic beads (Miltenyi Biotec, catalog number: 130-090-485 )
Trypan blue (Lonza, catalog number: 17-942E )
FluoReporter® Cell-Surface Biotinylation Kit (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: F20650 )
Alexa Fluor 647 conjugated streptavidin (Jackson ImmunoResearch, catalog number: 016-600-084 )
Anti-myeloperoxidase (MPO) (R&D Systems, catalog number: AF3667 )
Anti-histone H3 (citrulline R2+R8+R17) (Abcam, catalog number: ab5103 )
Sytox Green (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: S7020 )
Calcofluor white/Fluorescent brightener 28 (Sigma-Aldrich, catalog number: F3543 )
Donkey anti-goat IgG Cy3 (Jackson ImmunoResearch, catalog number: 705-165-147 )
Donkey anti-rabbit IgG Cy3 (Jackson ImmunoResearch, catalog number: 711-165-152 )
sDectin-1-Fc (produced in house according to [Graham et al., 2006])
Donkey anti-human IgG Cy3 (Jackson ImmunoResearch, catalog number: 709-165-149 )
Nail polish
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-3 )
Sodium phosphate, dibasic anhydrous (Na2HPO4) (Fisher Scientific, catalog number: S374-500 )
Potassium phosphate, monobasic anhydrous (KH2PO4) (Fisher Scientific, catalog number: P285-500 )
Sodium carbonate (Na2CO3) (Sigma-Aldrich, catalog number: S7795 )
BD Bacto peptone (BD, BactoTM, catalog number: 211677 )
BD Bacto yeast extract (BD, BactoTM, catalog number: 212750 )
Dextrose (Fisher Scientific, catalog number: D-163 )
BD Bacto agar (BD, BactoTM, catalog number: 214014 )
Heat inactivated fetal bovine serum (Thermo Fisher Scientific, GibcoTM, catalog number: 10082147 )
Probumin® bovine serum albumin diagnostic grade powder (EMD Millipore, catalog number: 820451 )
RPMI, with 25 mM HEPES and L-glutamine (Lonza, catalog number: 12-115F )
Ammonium chloride (NH4Cl) (EMD Millipore, catalog number: AX12701 )
Crystal violet (Sigma-Aldrich, catalog number: C0775 )
Acetic acid (Fisher Scientific, catalog number: A38-212 )
Tris base (AMRESCO, catalog number: 0497 )
Hydrochloric acid (HCl) (Fisher Scientific, catalog number: A144-500 )
PBS, pH 7.2 (see Recipes)
PBS + Na2CO3, pH 8 (see Recipes)
YPD broth (see Recipes)
PBS + 5% FBS (see Recipes)
PBS + 2% FBS (see Recipes)
PBS + 2% BSA (see Recipes)
RPMI + 5% FBS (see Recipes)
Tris-HCl, pH 8.0 (see Recipes)
TAC buffer (see Recipes)
Turks solution (see Recipes)
Equipment
Roller drum (Eppendorf, New Brunswick Scientific) and incubators (VWR)
Hemacytometer for cell counting (Hausser Scientific, catalog number: 1492 )
Spectrophotometer (Eppendorf; Biophotometer)
Centrifuge with adaptors for 15 and 50 ml conical tubes (Thermo Fisher Scientific, model: SorvallTM LegendTM RT )
AutoMACs separation system (Miltenyi Biotec, model: autoMACS® Pro Separator )
Zeiss Axiovision fluorescence microscope (Zeiss; custom build)
Dissection kit (VWR, catalog number: 631-0616 )
pH meter (Fisher Scientific, model: accumetTM Excel XL15 )
Microcentrifuge for 1.7 ml tubes (Eppendorf, model: 5424 )
Autoclave
500 ml bottle (VWR, catalog number: 89000-233 )
Water bath
Software
AxioVision Rel48 software (Zeiss: https://www.zeiss.com/microscopy/us/downloads/axiovision-downloads.html)
Photoshop (Adobe Systems, San Jose, CA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Hopke, A. and Wheeler, R. T. (2017). In vitro Detection of Neutrophil Traps and Post-attack Cell Wall Changes in Candida Hyphae. Bio-protocol 7(7): e2213. DOI: 10.21769/BioProtoc.2213.
Hopke, A., Nicke, N., Hidu, E. E., Degani, G., Popolo, L. and Wheeler, R. T. (2016). Neutrophil attack triggers extracellular trap-dependent candida cell wall remodeling and altered immune recognition. PLoS Pathog 12(5): e1005644.
Download Citation in RIS Format
Category
Immunology > Immune cell imaging > Confocal microscopy
Microbiology > Microbe-host interactions > Fungus
Cell Biology > Cell staining > Cell wall
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,214 | https://bio-protocol.org/exchange/protocoldetail?id=2214&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification of N-coronafacoyl Phytotoxins from Streptomyces scabies
Luke Bown
Dawn R. D. Bignell
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2214 Views: 7563
Edited by: Valentine V Trotter
Reviewed by: Rosario Gomez-Garcia
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
This procedure is used for large-scale purification of N-coronafacoyl phytotoxins that are produced by the potato common scab pathogen Streptomyces scabies. The procedure employs organic extraction of S. scabies culture supernatants under alternating basic and acidic conditions in order to preferentially isolate the phytotoxin - containing carboxylic acid fraction of the supernatant. Preparative thin layer chromatography and semi-preparative reverse phase - high performance liquid chromatography are then used to further purify the individual N-coronafacoyl phytotoxins of interest.
Keywords: Streptomyces Plant pathogen Common scab N-coronafacoyl-L-isoleucine Phytotoxin Thin layer chromatography High performance liquid chromatography
Background
Potato common scab is an economically important crop disease that is caused by Gram-positive, filamentous, soil bacteria from the genus Streptomyces. The first described and best characterized scab - causing Streptomyces spp. is Streptomyces scabies (syn. S. scabiei), which has a worldwide distribution (Bignell et al., 2010). Current control practices for common scab disease management include crop rotation, irrigation and soil fumigation; however, these strategies often fail, produce inconsistent results or are environmental unfriendly (Dees and Wanner, 2012). In order to develop better control strategies for the disease, we must first understand the molecular mechanisms used by S. scabies to infect the plant and to induce disease symptoms. Research has shown that the ability of S. scabies to cause disease is due to the production of virulence factors that play different roles during the infection process. Among the known or potential virulence factors that are produced by S. scabies is a family of plant toxins referred to as the N-coronafacoyl phytotoxins (also known as the COR-like metabolites), which resemble the plant hormone jasmonic acid and may function to suppress the plant immune response during pathogen infection (Bignell et al., 2010; Fyans et al., 2015). The primary coronafacoyl phytotoxin produced by S. scabies is N-coronafacoyl-L-isoleucine (CFA-L-Ile; Figure 1), which consists of the polyketide metabolite coronafacic acid linked via an amide bond to L-isoleucine. In addition, other N-coronafacoyl phytotoxins containing different isoleucine isomers or different amino acids (e.g., valine) can be produced in minor amounts (Fyans et al., 2015; Bown et al., 2016).
Figure 1. Structure of N-coronafacoyl-L-isoleucine (CFA-L-Ile) produced by Streptomyces scabies
The protocol described here was developed to isolate and purify N-coronafacoyl phytotoxins and their biosynthetic intermediates from large-scale cultures of S. scabies for purposes of structural and functional characterization. Previously, Fyans et al. (2015) described a protocol that was based in part on a published procedure for the isolation of the related N-coronafacoyl phytotoxin coronatine (COR) from cultures of the Gram-negative plant pathogenic bacterium Pseudomonas syringae (Palmer and Bender, 1993). As outlined by Fyans et al. (2015), strains of S. scabies are cultured in a soy flour mannitol broth (SFMB) medium, which promotes the production of the coronafacoyl phytotoxins, and then the culture supernatants are subjected to a two-step extraction with organic solvent under basic and acidic conditions in order to selectively isolate the phytotoxin - containing carboxylic acid fraction of the culture supernatants. The phytotoxins are then further purified using a combination of preparative thin layer chromatography (TLC) and semi-preparative reverse phase - high performance liquid chromatography (RP - HPLC). More recently, we described a modified version of this protocol in which we incorporated additional extraction steps using an aqueous solution of potassium bicarbonate (Bown et al., 2016). This modification was based on the procedure described by Mitchell and Frey (1986) for the isolation of P. syringae N-coronafacoyl phytotoxins, and we found that the incorporation of the additional extraction steps significantly improved the purity of the final S. scabies phytotoxin preparations. Moreover, we modified the organic solvent for the N-coronafacoyl phytotoxins by the addition of a small amount of acid, which significantly improved the solubility and yield of the purified phytotoxins for downstream structural and functional studies.
Here, we present the detailed step-by-step protocol for how we currently purify the S. scabies N-coronafacoyl phytotoxins in our laboratory.
Materials and Reagents
pH test strips (VWR, BDH®, catalog number: BDH35309.606 )
Hydrophilic polypropylene membrane filters, 47 mm diameter, 0.45 μm pore size (Pall, catalog number: 66548 )
FisherbrandTM class B clear glass threaded vials with closures attached, 3.7 ml (Fisher Scientific, catalog number: 03-338A )
Slip tip syringes, 1 ml (BD, catalog number: 309659 )
PTFE membrane filters, 0.2 μm pore size, 6 mm diameter (VWR, catalog number: 28145-491 )
WhatmanTM filter discs, 12.5 cm (Sigma-Aldrich, catalog number: WHA1113125 )
Conical centrifuge tubes, 50 ml (Corning, Falcon®, catalog number: 352098 )
Silica gel GF preparative TLC plates with pre-adsorbent zone, 20 x 20 cm, 1,000 μm (Analtech/iChromatography, catalog number: P32013 )
DMSO mycelial freezer stock of S. scabies (Fyans et al., 2015)
BactoTM tryptic soy broth medium (BD, BactoTM, catalog number: 211825 )
Sodium hydroxide (NaOH) (Fisher Scientific, catalog number: BP359-212 )
Chloroform, ACS grade (VWR, BDH®, catalog number: BDH1109 )
Hydrochloric acid (HCl), ACS grade (Avantor® Performance Materials, catalog number: 638801 )
Sodium sulfate anhydrous (Na2SO4), ACS grade (Fisher Scientific, catalog number: S421-500 )
Ethylene glycol (VWR, BDH®, catalog number: BDH1125 )
Potassium bicarbonate (KHCO3), ACS grade (Sigma-Aldrich, catalog number: 237205 )
Methanol (MeOH), HPLC grade (Sigma-Aldrich, catalog number: 34860 )
Formic acid, reagent grade (Sigma-Aldrich, catalog number: F0507 )
HiPerSolv CHROMANOR® Acetonitrile (ACN) for HPLC (VWR, BDH®, catalog number: BDH83639.400 )
Soy flour, defatted (MP Biomedicals, catalog number: 960024 )
D-mannitol (AMRESCO, catalog number: 0122 )
Ethyl acetate, ACS grade (Sigma-Aldrich, catalog number: 319902 )
2-propanol, HPLC grade (Fisher Scientific, catalog number: A451SK-4 )
Acetic acid, ACS grade (Sigma-Aldrich, catalog number: 695092 )
Water, HPLC grade (EMD Millipore, catalog number: WX0008-1 )
Soy flour mannitol broth (SFMB) medium (see Recipes)
Preparative TLC mobile phase (see Recipes)
Equipment
Glass Erlenmeyer flask, 125 ml (Corning, PYREX®, catalog number: C4980125 )
Glass Erlenmeyer flask, 4 L (Corning, PYREX®, catalog number: C49804L )
Glass filter holder assembly with funnel, fritted base, stopper and clamp, 47 mm (EMD Millipore, catalog number: XX1004700 )
NalgeneTM PPCO centrifuge bottles with sealing closure, 250 ml (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 31410250 )
SorvalTM ST 16R benchtop refrigerated centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: SorvalTM ST 16R , catalog number: BCT25)
Innova® 42R refrigerated incubator shaker, orbit diameter 1.9 cm (Eppendorf, New BrunswickTM, model: Innova® 42R , catalog number: M1335-004)
2 L plastic container
NalgeneTM TeflonTM FEP separatory funnel with closure, 2 L (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4301-2000 )
IKA® rotary evaporator system (IKA®, model: RV 10 digital V )
VWR® refrigerated circulating bath with programmable temperature controller (VWR, model: VWR® Refrigerated Circulating Baths , catalog number: 89202-982)
KIMAX® Squibb separatory funnel with PTFE stopcock and glass stopper, 125 ml (Kimble Chase Life Science and Research Products, catalog number: 29048F-125 )
DryFast diaphragm vacuum pump (Welch Vacuum – Gardner Denver, catalog number: 2044 )
Biohit mLINE® single-channel mechanical pipettor, 2-20 μl (VWR, catalog number: 47745-545 )
Aldrich® rectangular TLC developing tank (Sigma-Aldrich, model: Z126195 )
UV lamp with portable cabinet (Analtech/iChromatography, catalog number: A93-04 )
Metal spatula
Thermo ScientificTM dry block heater (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88-860-021 )
ZORBAX StableBond 80Å C18 semi-preparative HPLC column, 9.4 x 250 mm, 5 μm (Agilent Technologies, catalog number: 880975-202 )
Chemical safety hood
KIMAX® graduated filtering flask, 1 L (Kimble Chase Life Science and Research Products, catalog number: 27060-1000 )
GeneMate vortex mixer (VWR, catalog number: 490000-094 )
Agilent 1260 Infinity analytical-scale LC purification system with quaternary pump, autosampler, diode array detector and fraction collector (Agilent Technologies, model: 1260 Infinity )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bown, L. and Bignell, D. R. D. (2017). Purification of N-coronafacoyl Phytotoxins from Streptomyces scabies. Bio-protocol 7(7): e2214. DOI: 10.21769/BioProtoc.2214.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Biochemistry > Other compound > Phytotoxin
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,215 | https://bio-protocol.org/exchange/protocoldetail?id=2215&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo Mitophagy Monitoring in Caenorhabditis elegans to Determine Mitochondrial Homeostasis
Konstantinos Palikaras
Nektarios Tavernarakis
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2215 Views: 10123
Edited by: Jyotiska Chaudhuri
Reviewed by: Pia Giovannelli
Original Research Article:
The authors used this protocol in Nov 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2013
Abstract
Perturbation of mitochondrial function is a major hallmark of several pathological conditions and ageing, underlining the essential role of fine-tuned mitochondrial activity (Lopez-Otin et al., 2013). Mitochondrial selective autophagy, known as mitophagy, mediates the removal of dysfunctional and/or superfluous organelles, preserving cellular and organismal homeostasis (Palikaras and Tavernarakis, 2014; Pickrell and Youle, 2015; Scheibye-Knudsen et al., 2015). In this protocol, we describe a method for assessing mitophagy in the nematode Caenorhabditis elegans.
Keywords: Ageing Autophagosome Autophagy Caenorhabditis elegans Lysosomes Mitochondria Mitophagy mtRosella
Background
Mitochondria are characterized as cellular powerhouses of eukaryotic cells, since they are the major energy providers through oxidative phosphorylation (OXPHOS) and ATP generation. Moreover, their pivotal role in cellular homeostasis is highlighted by their contribution in the regulation of several fundamental cellular processes including calcium buffering, metabolite synthesis and apoptosis, among others. Deregulation of mitochondrial function is associated with the onset of several pathological conditions including ageing and age-related neurodegenerative diseases (Vafai and Mootha, 2012; Palikaras and Tavernarakis, 2014). Thus, eukaryotic organisms have evolved several complex and highly specialized molecular pathways to guard energy homeostasis (Pickrell and Youle, 2015; Scheibye-Knudsen et al., 2015). Mitophagy is a selective type of autophagy promoting the elimination of impaired mitochondria, and the major degradation pathway by which cells regulate mitochondrial content in response to intracellular and environmental signals (Palikaras et al., 2015; Schiavi et al., 2015; Fang et al., 2016). In this protocol, we describe two methods for monitoring mitophagy in C. elegans. We developed two composites, in vivo imaging systems to asses mitophagy based, first, on the Rosella biosensor (Rosado et al., 2008), which combines a fast-maturing pH-insensitive DsRed fused to a pH-sensitive GFP variant, and second, on a custom, dual-fluorescence reporter system that involves a mitochondria-targeted GFP, together with the autophagosomal marker LGG-1/LC3 fused to DsRed. These protocols facilitate non-invasive monitoring of mitophagy in live specimens.
Materials and Reagents
Greiner Petri dishes (60 x 15 mm) (Greiner Bio One International, catalog number: 628161 )
Microscope slides 75 x 25 x 1 mm (Marienfeld-Superior, catalog number: 10 006 12 )
Microscope cover glass 18 x 18 mm (Marienfeld-Superior, catalog number: 01 010 30 )
Use the following transgenic nematodes to monitor mitophagy: IR1631: N2;Ex003 [pmyo-3TOMM-20::Rosella; pRF4], R1284: N2;Is [pmyo-3mtGFP];Ex011 [plgg-1DsRed::LGG-1; pmyo-2GFP])
Escherichia coli OP50 strain (obtained from the Caenorhabditis Genetics Center)
70% of EtOH
Potassium dihydrogen phosphate (KH2PO4) (EMD Millipore, catalog number: 104873 )
di-Potassium hydrogen phosphate (K2HPO4) (EMD Millipore, catalog number: 137010 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: 106404 )
Peptone (BD, BactoTM, catalog number: 211677 )
Streptomycin (Sigma-Aldrich, catalog number: S6501 )
Agar (Sigma-Aldrich, catalog number: 05040 )
Cholesterol stock solution (SERVA Electrophoresis, catalog number: 17101.01 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Nystatin stock solution (Sigma-Aldrich, catalog number: N3503 )
di-Sodium hydrogen phosphate (Na2HPO4) (EMD Millipore, catalog number: 106586 )
Levamisole (Sigma-Aldrich, catalog number: L9756 )
Paraquat (Sigma-Aldrich, catalog number: 856177 )
Carbonyl cyanide m-chlorophenylhydrazone (CCCP) (Sigma-Aldrich, catalog number: C2759 )
Dimethyl sulfoxide cell culture grade BC (DMSO) (AppliChem, catalog number: A3672,0250 )
Phosphate buffer (1 M; sterile, see Recipes)
Nematode growth medium (NGM) agar plates (see Recipes)
M9 buffer (see Recipes)
Levamisole (0.5 M, see Recipes)
M9-levamisole solution (20 mM solution, see Recipes)
Paraquat (0.5 M, see Recipes)
Carbonyl cyanide m-chlorophenylhydrazone (49 mM; CCCP, see Recipes)
Equipment
UV crosslinker (Vilber Lourmat, model: BIO-LINK – BLX-E365 )
Zeiss AxioImager Z2 epifluorescence microscope (Zeiss, model: Zeiss AxioImager Z2 )
Olympus DP71 CCD camera (Olympus, model: Olympus DP71 )
Zeiss AxioObserver Z1 confocal microscope (Zeiss, model: Zeiss AxioObserver Z1 )
Dissecting stereomicroscope (Olympus, model: SMZ645 )
Incubators for stable temperature (AQUA®LYTIC incubator 20 °C)
Software
Olympus CELL-A software
Zeiss ZEN 2012 software
Image J (https://imagej.nih.gov/ij/)
Microsoft Office 2011 Excel (Microsoft Corporation, Redmond, USA)
GraphPad Prism software package (GraphPad Software Inc., San Diego, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Palikaras, K. and Tavernarakis, N. (2017). In vivo Mitophagy Monitoring in Caenorhabditis elegans to Determine Mitochondrial Homeostasis. Bio-protocol 7(7): e2215. DOI: 10.21769/BioProtoc.2215.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling > Energy homeostasis
Developmental Biology > Cell signaling > Mitophagy
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,216 | https://bio-protocol.org/exchange/protocoldetail?id=2216&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Exosomes from Semen for in vitro Uptake and HIV-1 Infection Assays
MM Marisa N. Madison
JW Jennifer L. Welch
Chioma M. Okeoma
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2216 Views: 11169
Edited by: Andrea Introini
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Exosomes are membranous extracellular nanovesicles of endocytic origin. Exosomes are known to carry host and pathogen-derived genomic, proteomic, lipidomic cargos and other extraneous molecules. Exosomes are secreted by diverse cell types into the extracellular milieu and are subsequently internalized by recipient neighboring or distal cells. Upon internalization, exosomes condition recipient cells by donating their cargos and/or activating various signal transduction pathways, consequently regulating physiological and pathophysiological processes. Exosomes facilitate intercellular communication, modulate cellular phenotype, and regulate microbial pathogenesis. We have previously shown that semen exosomes (SE) inhibit HIV-1 replication in various cell types. Here, we describe detailed protocols for characterizing SE. This protocol can be adapted or modified and used for evaluation of other extracellular vesicles of interest.
Keywords: Semen Exosomes Extracellular Vesicles Prostasomes HIV
Background
Exosomes are membranous nanovesicles originating as a result of inward budding of endosomal membranes within the late endosomal compartment of a multitude of cell types (Simons and Raposo, 2009). Exosomes are released by many cell types (Iglesias et al., 2012) into the extracellular milieu and are found in biological fluids including blood (Kaur et al., 2014) urine (Li et al., 2013) saliva (Madison et al., 2015) and breast milk (Madison et al., 2014; Naslund et al., 2014). Human semen contains a heterogenous population of nanovesicles (Madison et al., 2014; Madison et al., 2015) produced by tissues of the male genital tract including prostate secretory acinar cells (Sahlen et al., 2002) and epididymal epithelial cells (Frenette et al., 2010) as well as cells of the vasa deferentia, testes, and the vesicular glands (Renneberg et al., 1997; Sullivan et al., 2005). The variability in the cells that secret exosomes is reflected in the composition and function of exosomes. Thus, exosomal cargo composition and function are regulated by many factors including the type and condition of the originating cell (Raposo and Stoorvogel, 2013), cellular environment, and for in vivo derived exosomes; the condition of the donor (Welch et al., 2017). Released exosomes when taken up by target cells transfer their cargo, including proteins (Iglesias et al., 2012; Charrier et al., 2014), miRNA (Shtam et al., 2013; Ong et al., 2014), and mRNA (Tomasoni et al., 2013; Madison et al., 2014; Madison et al., 2015) to the target cells. As a result, exosomes are known to be involved in modulation of host immune response (Kaur et al., 2014; Vojtech et al., 2014), and regulation of microbial pathogenesis (Li et al., 2013; Arenaccio et al., 2014; Madison et al., 2014; Naslund et al., 2014; Vojtech et al., 2014; Madison et al., 2015).
While progress has been made in the field of exosome biology, many protocols are contradictory in the most effective and efficient method of characterizing exosomes (Taylor and Shah, 2015). Here, we provide a detailed protocol for evaluating the function and physical properties of semen exosomes (Madison et al., 2014; Madison et al., 2015). This protocol lays the groundwork for evaluating other functional activities of semen exosomes, and for evaluating exosomes from other sources.
Materials and Reagents
Pipette tips (any brand)
15 polypropylene conical plastic tubes (DOT SCIENTIFIC, PerformR®, catalog number: 416-PG )
50 ml polypropylene conical plastic tubes (DOT SCIENTIFIC, PerformR®, catalog number: 451-PG )
12 well tissue culture plate (CELLTREAT Scientific Products, catalog number: 229112 )
5 ml polystyrene round-bottom tubes (Corning, Falcon®, catalog number: 352052 )
Microscope coverslip, 18 mm (Fisher Scientific, FisherbrandTM, catalog number: 12-545-100 )
Coverslips (VWR, catalog number: 48382-041 )
Microscope slides (Fisher Scientific, catalog number: 22-034-486 )
1.7 m microcentrifuge tube (DOT SCIENTIFIC, catalog number: RN1700-GMT )
96 well solid white flat-bottom polystyrene microplates (Corning, catalog number: 3917 )
96 well tissue culture plate (CELLTREAT Scientific Products, catalog number: 229196 )
Disposable cuvettes (Eppendorf, catalog number: Z605050 )
1 ml disposable syringes (BD, catalog number: 309659 )
96 well tissue culture dishes
U937 human monocytic cell line
TZM-bl human vaginal epithelial cell line
Jurkat human T lymphocyte cell line
V428 (HPV-16 E6/E7 transformed human vaginal epithelial cell line)
VK2 (HPV-16 E6/E7 transformed human vaginal epithelial cell line)
Human semen
Cell-free HIV-1 virus stock, replication competent
ExoQuick (System Biosciences)
Phosphate buffered saline, DPBS 1x; without CaCl2 and MgCl2 (Thermo Fisher Scientific, GibcoTM)
Liposomes (Lipofectamine 2000) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668019 )
PKH67Green fluorescent kit (Sigma-Aldrich, catalog number: MINI67 )
PKH26Red fluorescent kit (Sigma-Aldrich, catalog number: MINI26 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM)
Quick Start Bradford Protein Assay Kit 1 (Bio-Rad Laboratories, catalog number: 500-0201 )
Roswell Park Memorial Institute (RPMI) 1640 (Thermo Fisher Scientific, GibcoTM)
Penicillin/streptomycin (Thermo Fisher Scientific, GibcoTM)
Sodium pyruvate (Thermo Fisher Scientific, GibcoTM)
L-glutamine (Thermo Fisher Scientific, GibcoTM)
Keratinocyte serum free media (KSFM) (Thermo Fisher Scientific)
Human recombinant Epidermal Growth Factor 1-53 (Thermo Fisher Scientific)
Bovine pituitary extract (BPE) (Thermo Fisher Scientific)
0.25% trypsin-EDTA, phenol red dissociation reagent (Thermo Fisher Scientific, GibcoTM, catalog number: 25200-056 )
Collagen, type 1 from rat tail (Sigma-Aldrich, catalog number: C3867 )
Paraformaldehyde (2%) (Fisher Scientific, catalog number: T353-500 )
Vectashield antifade reagent with DAPI (Vector Laboratories, catalog number: H-1200 )
Exosome-human CD63 Isolation/Detection (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10606D )
Albumin, bovine fraction V (BSA) (RPI, catalog number: A30075-100.0 )
Anti-human CD63-FITC (BioLegend, catalog number: 353005 )
Aldehyde/Sulfate latex beads (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: A37301 )
MHC-II monoclonal antibody
Isotype control antibody (mouse IgG1)
Glycine (RPI, catalog number: G36050-500.0 )
Anti-human CD63-PE (BioLegend, catalog number: 353003 )
Triton-X-100 (Sigma-Aldrich, catalog number: X100 )
Acetylthiocholine chloride (Sigma-Aldrich, catalog number: A5626 )
5,5’-Dithiobis 2-nitrobenzoic acid (Sigma-Aldrich, catalog number: D8130 )
Sodium carbonate, anhydrous (RPI, catalog number: S25025-500.0 )
NuPAGE LDS sample buffer (4x) (Thermo Fisher Scientific, NovexTM, catalog number: NP0008 )
NuPAGETM NovexTM 4-12% Bis-Tris Protein Gels, 1.5 mm, 10-well (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0335PK2 )
NuPAGE MOPS SDS running buffer (20x) (Thermo Fisher Scientific, NovexTM, catalog number: NP0001 )
Pierce Silver Stain Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 24612 )
RNeasy Mini Kit (QIAGEN, catalog number: 74104 )
RNase-Free DNase Set (QIAGEN, catalog number: 79254 )
High-capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4368814 )
QuantiFast SYBR Green PCR Kit (QIAGEN, catalog number: 204054 )
Agarose (RPI, catalog number: A20090 )
Ethidium bromide solution (Bio-Rad Laboratories, catalog number: 1610433 )
1x TAE buffer
Steady-Glo (Promega, catalog number: E2510 )
NuPAGE sample reducing agent (10x) (Thermo Fisher Scientific, NovexTM, catalog number: NP0004 )
MES (Sigma-Aldrich, catalog number: M2933 )
1 N NaOH (Avantor Performance Materials®, J.T.Baker®, catalog number: 563502 )
Distilled water (any brand)
Exosome-depleted FBS (Thermo Fisher Scientific, GibcoTM, catalog number: 26140079 )
MTT reagent (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: M6494 )
Nonidet P-40 substitute (RPI, catalog number: N59000 )
Hydrochloric acid (HCl), ACS reagent, 37% (Sigma-Aldrich, catalog number: 258148 )
Isopropanol (Fisher Scientific, catalog number: A416-4 )
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM)
Exosome-depleted FBS (see Recipes)
Lysing sample buffer for protein footprint (see Recipes)
Storage buffer (see Recipes)
MES buffer (see Recipes)
FACS wash buffer (see Recipes)
MTT reagent (see Recipes)
MTT solvent (see Recipes)
Equipment
Pipettes (any brand)
Sterile tweezers (any brand)
Centrifuge (Eppendorf, model: 5415 D)
Ultracentrifuge (Beckman Coulter, model: Optima L-90K )
SW40Ti rotor (Beckman Coulter, catalog number: 331362 )
Polyallomer centrifuge tubes 14 x 89 mm for SW41Ti rotor (Beckman Coulter, catalog number: 344059 )
37 °C, 5% CO2 cell culture incubator (NuAire, model: NU-5510 )
FACSCalibur flow cytometer (BD) (see Notes for laser and filter specifications)
FACSVerse flow cytometer (BD) (see Notes for laser and filter specifications)
FACSAria flow cytometer (BD) (see Notes for laser and filter specifications)
Laser scanning confocal microscope (Nikon Instruments, model: Eclipse TE2000 )
Magnetic separator for 1.7 ml tubes
Rotating mixer
Microplate reader (Tecan Trading, model: Infinite® M200 Pro )
DynaPro Nanostar (Wyatt Technologies, model: DynaPro Nanostar )
NanoSight LM10 (Malvern Instruments, model: NanoSight LM10 )
NanoDrop spectrophotometer (Thermo Fisher Scientific)
SW60 Ti rotor (Beckman Coulter, catalog number: 335649 )
Polyallomer centrifuge tubes 11 x 60 mm for SW60Ti rotor (Beckman Coulter, catalog number: 355636 )
7500 fast real-time PCR system (Thermo Fisher Scientific, model: 7500 Fast Real-time PCR System )
Luminometer (BioTek Instruments, model: Synergy H1 Hybrid Reader )
Laminar flow hood
SW32 Ti rotor (Beckman Coulter, model: 369650 )
Polyallomer centrifuge tubes 25 x 89 mm for SW32Ti rotor (Beckman Coulter, catalog number: 344058 )
pH meter (any brand)
Gel running tank(Thermo Fisher Scientific, NovexTM, model: XCell SureLock® Mini-Cell , catalog number: EI0001)
Sephacryl S300-HR 16/60 gel filtration prepacked column (GE Healthcare catalog number: 17-1167-01 )
BioLogic DuoFlow Workstation (Bio-Rad Laboratories)
BioLogic BioFrac fraction collector (Bio-Rad Laboratories)
Gel electrophoresis horizontal apparatus (Bio-Rad Laboratories, model: Wide Mini-Sub Cell GT Cell, catalog number: 1704468EDU )
Dry Block Heater for microcentrifuge tubes (Thermo Fisher Scientific)
Software
FlowJo analysis software (TreeStar)
BioLogic DuoFlow software version 5.3 (Bio-Rad Laboratories)
Dynamics software (Wyatt Technology)
NTA software (Malvern Instruments)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Madison, M. N., Welch, J. L. and Okeoma, C. M. (2017). Isolation of Exosomes from Semen for in vitro Uptake and HIV-1 Infection Assays. Bio-protocol 7(7): e2216. DOI: 10.21769/BioProtoc.2216.
Download Citation in RIS Format
Category
Immunology > Host defense > Human
Microbiology > Microbe-host interactions > In vitro model
Cell Biology > Organelle isolation > Exosomes
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,217 | https://bio-protocol.org/exchange/protocoldetail?id=2217&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Microtubule Bundling Assay under Physiological Conditions
ZG Zach Geisterfer
Gin Tezuka
Li Tao
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2217 Views: 8529
Edited by: Jyotiska Chaudhuri
Reviewed by: Rebecca Van AckerElizabeth Libby
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Kinesins play a role in organizing the mitotic spindle through the crosslinking of microtubules (MTs), made possible through binding sites at opposite ends of the holoenzyme. Here, we developed a method to test kinesin MT crosslinking action under physiological conditions.
Keywords: in vitro bundling assay Fluorescence microtubules Kinesin motors DEAE-Dextran coated glass chamber Physiological [ATP]
Background
Microtubule-based motor proteins are important as they use the chemical energy from ATP to generate force to translocate microtubules (MTs) vectorially. Of these MT based motor proteins, the superfamily known as kinesins, are responsible for directional transport and movement along microtubules. Some kinesins have MT-binding sites at both ends of the holoenzyme, so they can crosslink MTs into bundles under physiological ATP conditions (Tao et al., 2006). Due to this bundling activity, they have important roles in organizing and maintaining the mitotic spindle, whose action depends upon the polarity patterns of its microtubules (van den Wildenberg et al., 2008). Previous bundling assays didn’t include ATP, or used a non-hydrolysable ATP analog, which could generate artificial results. Here we developed a method using physiological ATP conditions. By purifying these full-length motor proteins, it has allowed us to determine their crosslinking activity under physiological conditions.
Materials and Reagents
Microcentrifuge tubes (1.5 ml) (Sigma-Aldrich, catalog number: Z336769 )
Aluminum foil
Double sided tape
Coverslip, No. 1.5-22 x 22 mm (Sigma-Aldrich, catalog number: Z692263 )
Microscope slides (AmScope, catalog number: BS-50P )
Kimwipe (Sigma-Aldrich, catalog number: Z188956 )
Pipette tips (Corning, catalog number: 4860 )
Tubulin (CYTOSKELETON, catalog number: MT001-A )
Glycerol (Sigma-Aldrich, catalog number: G2025 )
Rhodamine tubulin (CYTOSKELETON, catalog number: TL590M-A )
GTP (Sigma-Aldrich, catalog number: G8877 )
Hydrochloric acid (HCl [37%, v/v]) (Sigma-Aldrich, catalog number: 320331 )
Full-length kinesin motor proteins are expressed and purified from baculoviral expression system
ATP (Sigma-Aldrich, catalog number: A6419 )
Piperazine-N,N’-bis(2-ethanesulfonic acid) (PIPES) (Sigma-Aldrich, catalog number: P6757 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M4880 )
EGTA (Sigma-Aldrich, catalog number: 03777 )
Potassium hydroxide (KOH)
Paclitaxel (Sigma-Aldrich, catalog number: T7402 )
DMSO (Sigma-Aldrich, catalog number: D2650 )
DEAE-dextran (Sigma-Aldrich, catalog number: 30461 )
Tris base (Sigma-Aldrich, catalog number: T1503 )
Potassium chloride (KCl) (Sigma-Aldrich: P5405 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
Protease inhibitors
Aprotinin (Sigma-Aldrich, catalog number: A3428 )
Benzamidine (Sigma-Aldrich, catalog number: B6505 or 12072 )
Note: The product “ B6505 ” has been discontinued.
Pepstatin A (Sigma-Aldrich, catalog number: P5318 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Leupeptin (Sigma-Aldrich, catalog number: L2884 )
Soy Bean Trypsin inhibitor (SBTI) (Sigma-Aldrich, catalog number: T6522 )
tert-Amyl methyl ether (TAME) (Sigma-Aldrich, catalog number: 283096 )
Catalase (Sigma-Aldrich, catalog number: C1345 )
Glucose oxidase (Sigma-Aldrich, catalog number: C6766 or G7141 )
Note: The product “ C6766 ” has been discontinued.
Glucose (Sigma-Aldrich, catalog number: G7021 or D9434 )
10x phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: P5493 )
BRB80 (see Recipes)
1 µM, 10 µM, and 100 µM taxol (see Recipes)
DEAE-dextran (see Recipes)
Buffer T (see Recipes)
Antifade (see Recipes)
Equipment
Nichipet EX-Plus II pipette 2-20 μl (Nichiryo, catalog number: 00-NPLO2-20 )
Nichipet EX-Plus II pipette 10-100 μl (Nichiryo, catalog number: 00-NPLO2-100 )
Water bath, from ambient to 100 °C (Thermo Fisher Scientific, Thermo ScientificTM, model: PrecisionTM General Purpose Baths , catalog number: TSGP02)
Flow chamber (see Procedure)
Inverted fluorescence microscope (12-volt 100-watt tungsten-halide lamp, excitation wavelength, 547 nm; emission wavelength, 576 nm, in conjunction with a 570 nm dichroic mirror, objective: CFI Plan Fluor 100x oil) (Nikon Instruments, model: Eclipse E600 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Geisterfer, Z., Tezuka, G. and Tao, L. (2017). In vitro Microtubule Bundling Assay under Physiological Conditions. Bio-protocol 7(7): e2217. DOI: 10.21769/BioProtoc.2217.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fluorescence
Biochemistry > Protein > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,218 | https://bio-protocol.org/exchange/protocoldetail?id=2218&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessment of Murine Retinal Function by Electroretinography
GB Gillie Benchorin
MC Melissa A. Calton
MB Marielle O. Beaulieu
DV Douglas Vollrath
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2218 Views: 16390
Edited by: Jyotiska Chaudhuri
Reviewed by: Pascal Fossat Clara Lubeseder-Martellato
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
The electroretinogram (ERG) is a sensitive and noninvasive method for testing retinal function. In this protocol, we describe a method for performing ERGs in mice. Contact lenses on the mouse cornea measure the electrical response to a light stimulus of photoreceptors and downstream retinal cells, and the collected data are analyzed to evaluate retinal function.
Keywords: Electroretinogram (ERG) Mice Retinal degeneration Photoreceptors
Background
Electroretinograms (ERGs) are used by researchers and clinicians to test retinal function by measuring the electrical response of retinal cells to a light stimulus. The ERG is a useful tool for measuring retinal responses in mice due to its high level of sensitivity and noninvasive nature, and can be utilized to assess eye disease and retinal degeneration (Duncan et al., 2003; Phillips et al., 2010; Zhao et al., 2011; Vollrath et al., 2015). In mouse genetic retinal disease models, ERGs can be used to assess retinal degeneration at multiple time points as the disease progresses (Duncan et al., 2003). For studies evaluating the effect of drug treatment on the mouse eye, retinal function can be assessed before and after treatment in the same eye (Zhao et al., 2011). In the following protocol we describe a method for measuring the functional response of photoreceptors and downstream retinal cells in mice that builds on a previously published approach (Phillips et al., 2010). The protocol can be readily applied to animals three weeks of age and older.
ERGs can be used to measure the electrical response to light flashes in either dark-adapted (scotopic) or light-adapted (photopic) mice. In scotopic ERGs, mice are presented with low intensity light flashes to induce rod activation, so the function of rod photoreceptor and downstream retinal cells can be examined (Fu, 2010). A prolonged period of dark-adaptation is critical to achieve maximal rod sensitivity, and to keep cone stimulation minimal (Pepperberg, 2003). In photopic ERGs, mice are presented with high intensity light flashes after a period of light stimulation. Under these conditions, there is high cone activation and the rod response is suppressed. Therefore, photopic ERGs can be used to measure the function of cone photoreceptors and downstream retinal cells (Fu, 2010).
This method of performing ERGs allows for the calculation of amplitude and time-to-peak of two major waves, the a-wave and b-wave. The a-wave is a measure of the initial response of photoreceptors to a brief flash of light (Brown, 1968; Perlman, 2015). The b-wave is a measure of the response of downstream retinal neurons, including bipolar cells, to photoreceptor stimulation (Brown, 1968; Perlman, 2015). Loss of amplitude in either the a-wave or b-wave may be attributed to a number of retinal dystrophies (Creel, 2015), while ‘supernormal’ waves with increased amplitude have been attributed to cone dystrophies (Phillips et al., 2010).
Materials and Reagents
Absorbent pads (Bound Tree Medical, catalog number: 111-16650 )
Syringes and needles (BD, catalog number: 329461 )
Spray/squirt water bottle (Qorpak, catalog number: PLC-03431 )
Cotton swabs (Uline, catalog number: S18985PK )
Two 29 gauge, 12 mm needle electrodes for ground and reference (The Electrode Store, catalog number: GRD-SAF )
Mice
Ketamine hydrochloride (NADA: 045-290)/xylazine hydrochloride (NADA: 139-236) cocktail (80 mg/kg/13 mg/kg)
1% atropine sulfate ophthalmic solution (NDC: 24208-750-60)
2.5% phenylephrine hydrochloride ophthalmic solution (NDC: 17478-200-12)
0.5% proparacaine hydrochloride (NDC: 24208-730-06)
Hydrating eye ointment (Refresh Tears; Allergan, NDC: 0023-0798)
2.5% hypromellose (NDC: 17238-610-15)
70% ethanol
Equipment
Dark room
Red filter (ROSCO, catalog number: Roscolux Supergel R27 Medium Red)
Black electrical tape (3M, catalog number: 06132 )
Surgical tape (3M, catalog number: 15270 )
Ganzfeld ColorDome (Diagnosys, catalog number: D125 ) or similar
Espion visual electrophysiology system (Diagnosys, catalog number: D315 ) or similar
Two Bayer-Mittag contact lens electrodes (Mt Sinai, Phil Cook) (Bayer et al., 2001)
Forceps (Fine Scientific Tools, catalog number: 11295-00 )
Elevated mouse platform (Foam or plastic can be used to fit space and size requirements)
Non-electric heating pad (Braintree Scientific, catalog number: DPIP )
Clean mouse cage
Optional: opaque box (Rubbermaid Commercial Products, catalog number: 9S31 ), blackout cloth (Thorlabs, catalog number: BK5 ), red light headlamp (Princeton Tec, model: Sync headlamp ), red light desk lamp (AstroGizmos, catalog number: DSKLMP22 ), lux meter (Fisher Scientific, catalog number: 06-662-63 )
Software
Data analysis software such as Microsoft Excel (v 14.7.1) or GraphPad Prism (v 7.0)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Benchorin, G., Calton, M. A., Beaulieu, M. O. and Vollrath, D. (2017). Assessment of Murine Retinal Function by Electroretinography. Bio-protocol 7(7): e2218. DOI: 10.21769/BioProtoc.2218.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling > Electrical response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,219 | https://bio-protocol.org/exchange/protocoldetail?id=2219&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Mononuclear Cell Populations from Ovarian Carcinoma Ascites
Christina Wefers
GB Ghaith Bakdash
Meritxell Moreno Martin
TB Tjitske Duiveman-de Boer
Ruurd Torensma
LM Leon F.A.G. Massuger
IV I. Jolanda M. de Vries
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2219 Views: 10138
Edited by: Lee-Hwa Tai
Reviewed by: Jalaj GuptaRalph Bottcher
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Ovarian cancer is one of the most fatal tumors in women. Due to a lack of symptoms and adequate screening methods, patients are diagnosed at advanced stages with extensive tumor burden (Jelovac and Armstrong, 2011). Interestingly, ovarian cancer metastasis is generally found within the peritoneal cavity rather than other tissues (Lengyel, 2010; Tan et al., 2006). The reason behind this tissue tropism of the peritoneal cavity remains elusive. A prominent feature of this selectivity is ascites, the accumulation of fluid within the peritoneal cavity, containing, amongst others, immune cells, tumor cells and various soluble factors that can be involved in the progression of ovarian cancer (Kipps et al., 2013). The protocol described here is used to isolate mononuclear cells from ascites to study the functionality of the immune system within the peritoneal cavity.
Keywords: Ovarian cancer Ascites Fluorescent activated cell sorting Mononuclear cells Dendritic cells Monocytes Myeloid-derived suppressive cells BDCA1+CD14+ cells
Background
Gradient centrifugation using LymphoprepTM is a standard protocol to isolate peripheral blood mononuclear cells (PBMCs). We slightly adjusted the protocol, regarding the sample preparation and amount of washing steps, in order to isolate mononuclear cells from ascites.
Materials and Reagents
50 ml tubes (Greiner Bio One International, catalog number: 227261 )
Cell strainer 100 μm (Corning, Falcon®, catalog number: 352360 )
5 ml pipette (VWR, catalog number: VWR612-3702 )
10 ml pipette (VWR, catalog number: VWR612-3700 )
25 ml pipette (VWR, catalog number: VWR612-3697 )
225 ml tubes (Corning, Falcon®, catalog number: 352075 )
5 ml polypropylene round-bottom tube (Corning, Falcon®, catalog number: 352063 )
Pre-separation filter 30 μm (Miltenyi Biotec, catalog number: 130-041-407 )
Türk’s solution (EMD Millipore, catalog number: 1092770100 )
LymphoprepTM (Alere Technologies, Axis-Shield, catalog number: 1114547 )
Trypan blue stain (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
FcR blocking reagent (Miltenyi Biotec, catalog number: 120-000-442 )
Antibodies
Anti-CD45-V450 (BD, BD Biosciences, catalog number: 560367 )
Anti-CD19-FITC (Dako Cytomation, catalog number: F0768 )
Anti-CD20-FITC (BD, BD Biosciences, catalog number: 345792 )
Anti-CD56-FITC (BD, BD Biosciences, catalog number: 345811 )
Anti-CD1c-PE (BDCA1) (Miltenyi Biotec, catalog number: 130-090-508 )
Anti-CD14-PerCP (BD, BD Biosciences, catalog number: 345786 )
Anti-HLA-DR-PE-Cy7 (BD, BD Biosciences, catalog number: 335830 )
Anti-CD4-APC-Cy7 (BD, BD Biosciences, catalog number: 557871 )
Anti-CD3-BV510 (BD, BD Biosciences, catalog number: 563109 )
Ethylenediaminetetraacetic acid (EDTA) (EMD Millipore, catalog number: 1084211000 )
Bovine serum albumin (BSA) (Roche Diagnostics, catalog number: 10735108001 )
Phosphate-buffered saline (PBS) (Braun Melsungen, catalog number: 362 3140 )
X-VIVO 15 (Lonza, catalog number: BE02-060Q )
Antibiotic/Antimycotic (AA) (Thermo Fisher Scientific, GibcoTM, catalog number: 15240062 )
Human serum (HS) (Bloodbank Rivierenland)
0.5 M EDTA (see Recipes)
10% BSA (see Recipes)
Diluting buffer (see Recipes)
Wash buffer (see Recipes)
Staining buffer (see Recipes)
Medium (see Recipes)
Equipment
Centrifuge (Hettich Instruments, model: Rotanta 460R )
Cell sorter (BD, model: FACS Aria II)
Magnetic stirrer (Heidolph instruments, model: MR Hei-Mix S )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wefers, C., Bakdash, G., Moreno Martin, M., Duiveman-de Boer, T., Torensma, R., Massuger, L. F. and de Vries, I. J. M. (2017). Isolation of Mononuclear Cell Populations from Ovarian Carcinoma Ascites. Bio-protocol 7(7): e2219. DOI: 10.21769/BioProtoc.2219.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > Cell isolation
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
222 | https://bio-protocol.org/exchange/protocoldetail?id=222&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Iron - Prussian Blue Reaction - Mallory’s Method
HJ Hani Jouihan
Published: Vol 2, Iss 13, Jul 5, 2012
DOI: 10.21769/BioProtoc.222 Views: 25961
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Purpose: To demonstrate ferric iron in tissue sections. Small amounts of iron are found normally in spleen and bone marrow. Excessive amounts are present in hemochromatosis, with deposits found in the liver and pancreas, hemosiderosis, with deposits in the liver, spleen, and lymph nodes.
Principle: The reaction occurs with the treatment of sections in acid solutions of ferrocyanides. Any ferric ion (+3) in the tissue combines with the ferrocyanide and results in the formation of a bright blue pigment called 'Prussian blue" or ferric ferrocyanide.
Materials and Reagents
Control: A known positive control tissue (such as spleen)
Formalin
EtOH
Hydrochloric acid
Aluminum sulfate
Histoclear reagent
Mounting solution
Fixative (see Recipes)
5 % potassium Ferrocyanide (see Recipes)
5% hydrochloric acid (see Recipes)
Nuclear-fast red (Kernechtrot) (see Recipes)
Working solution (see Recipes)
Equipment
Microwave oven
Acid-cleaned glassware
Non-metallic forceps.
Gloves, goggles and lab coat
Fume hood
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jouihan, H. (2012). Iron - Prussian Blue Reaction - Mallory’s Method. Bio-protocol 2(13): e222. DOI: 10.21769/BioProtoc.222.
Download Citation in RIS Format
Category
Cell Biology > Tissue analysis > Tissue staining
Cell Biology > Cell staining > Iron
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,220 | https://bio-protocol.org/exchange/protocoldetail?id=2220&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Screening for Novel Endogenous Inflammatory Stimuli Using the Secreted Embryonic Alkaline Phosphatase NF-κB Reporter Assay
LZ Lorena Zuliani-Alvarez
Anna M. Piccinini
KM Kim S Midwood
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2220 Views: 9526
Edited by: Nicoletta Cordani
Reviewed by: Patrick Ovando-RocheHui Zhu
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
An immune response can be activated by pathogenic stimuli, as well as endogenous danger signals, triggering the activation of pattern recognition receptors and initiating signalling cascades that lead to inflammation. This method uses THP1-BlueTM cells, a human monocytic cell line which contains an embryonic alkaline phosphatase reporter gene allowing the detection of NF-κB-induced transcriptional activation. We validated this protocol by assessing NF-κB activation after stimulation of toll-like receptor 4 (TLR4) by two different agonists: lipopolysaccharide (LPS), derived from the cell wall of Gram negative bacteria, and tenascin-C, an extracellular matrix protein whose expression is induced upon tissue injury. We then used this protocol to screen for potential new endogenous TLR4 agonists, but this method can also be used as a quick, economical and reliable means to assay the activity of other inflammatory stimuli resulting in TLR-dependent NF-κB activation.
Keywords: Innate immunity TLR4 Tenascin-C LPS THP1-BlueTM cells NF-κB reporter
Background
The immune system has evolved to recognize not only pathogenic stimuli such as bacterial components and viral nucleic acids, but also endogenous danger signals including proteins secreted from necrotic cells or expressed upon tissue damage. Both types of stimuli are sensed by pattern recognition receptors, initiating signalling cascades that trigger inflammatory responses. Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) is a transcription factor essential for the activation of the immune response to infection and tissue damage. NF-κB has an important role in the expression of a wide range of inflammatory mediators following pattern recognition receptor activation, including cytokines (such as tumour necrosis factor α [TNFα], interleukin-6 and interleukin-1), chemokines (e.g., interleukin-8 or CXCL1), proteases, growth factors and MHC-related molecules, among others. To assess the activation of this pathway downstream of TLR4, we used the commercially available cell line THP1-BlueTM NF-κB (Invivogen). These cells are stably transfected with a construct containing a secreted embryonic alkaline phosphatase (SEAP) gene induced by the NF-κB transcription factor. The construct contains an interferon-β minimal promoter fused to five copies of the NF-κB consensus transcriptional response element and three copies of the c-Rel binding site, which drives the expression of the reporter gene. After cell stimulation with pathogenic or endogenous stimuli, NF-κB activation leads to the secretion of SEAP, which is then quantified using the colorimetric reagent QUANTI-BlueTM. This is a quick and reliable method to assess activation of NF-κB downstream of toll-like receptors, as the amount of SEAP in the media correlates with the triggering of this signalling pathway. However, this is an engineered cell line that does not express a full complement of inflammatory effector molecules (see Note 5), and so whilst useful in screening for NF-κB activation, data should always be confirmed in additional experimental systems, for example in primary macrophages, or in vivo.
Materials and Reagents
Pipette tips
20 µl (StarLabs, TipOne®, catalog number: S1110-3800 )
200 µl (StarLabs, TipOne®, catalog number: S1111-0806 )
1,000 µl (StarLabs, TipOne®, catalog number: S1111-6801 )
Corning 15 ml PP centrifuge sterile tubes (Corning, catalog number: 430791 )
Cell culture flask 75 cm2 (VWR, catalog number: 734-0012 )
96 well plate flat-bottom (VWR, catalog number: 734-0023 )
THP1-BlueTM NF-κB cells (InvivoGen, catalog number: thp-nfkb )
Positive control: LPS from E. coli, Serotype EH100 (Ra) (TLRgradeTM) (Enzo life sciences, catalog number: ALX-581-010-L002 )
Test inflammatory stimulus: for example recombinant tenascin-C protein or the fibrinogen like globe domain (FBG) of tenascin-C protein (synthesized as described in Midwood et al., 2009)
Roswell Park Memorial Institute (RPMI) 1640 with L-glutamine (Lonza, catalog number: BE12-702F )
Fetal bovine serum (FBS), Qualified, heat inactivated (Thermo Fisher Scientific, GibcoTM, catalog number: 10500064 )
Penicillin/streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
NormocinTM (InvivoGen, catalog number: ant-nr-1 )
Blasticidin HCl (Thermo Fisher Scientific, GibcoTM, catalog number: R21001 )
QUANTI-BlueTM (InvivoGen, catalog number: rep-qb1 )
ThP1 media without blasticidin (see Recipes)
ThP1 media with blasticidin (see Recipes)
QUANTI-BlueTM solution (see Recipes)
Equipment
P20, P200 and P1000 pipettes
37 °C water bath
Hemocytometer
CO2 incubator
FluoStar Omega plate reader
Centrifuge (Thermo Fisher Scientific, model: HeraeusTM MAgefugeTM 16 )
Rotor (Thermo Fisher Scientific, Thermo ScientificTM, model: TX-400 4 x 400 mL Swinging Bucket Rotor , catalog number: 75003629)
Software
Graph Pad Prism
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Host defense > Human
Immunology > Immune cell function > Macrophage
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,221 | https://bio-protocol.org/exchange/protocoldetail?id=2221&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Forest GPP Calculation Using Sap Flow and Water Use Efficiency Measurements
FT Fyodor Tatarinov
ER Eyal Rotenberg
DY Dan Yakir
TK Tamir Klein
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2221 Views: 8185
Edited by: Arsalan Daudi
Reviewed by: Marisa RosaSamik Bhattacharya
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
This is a protocol to evaluate gross primary productivity (GPP) of a forest stand based on the measurements of tree’s sap flow (SF), 13C derived water use efficiency (WUE), and meteorological (met) data. GPP was calculated from WUE and stomatal conductance (gs), the later obtained from SF up-scaled from sampled trees to stand level on a daily time-scale and met data. WUE is obtained from 13C measurements in dated tree-ring wood and/or foliage samples. This protocol is based on the recently published study of Klein et al., 2016.
Keywords: Trees Ecosystem carbon flux Transpiration Stable isotopes
Background
Forests play a major role in the terrestrial carbon cycle through CO2 assimilation and respiration, as well as on the Earth climate by influencing atmosphere CO2 concentration (Luyssaert et al., 2007; Bonan, 2008; Canadell and Raupach, 2008; Reichstein et al., 2013). Gross primary productivity (GPP), plants’ carbon uptake through photosynthesis, is the ultimate source of organic material in land biosphere in general and in food production in particular.
GPP at the ecosystem scale is mainly derived using the eddy covariance (EC) technique, as the difference between EC-measured net ecosystem CO2 exchange (NEE) and the daily inferred ecosystem respiration (Re). The latter one is obtained by extrapolating measured night-time NEE, which equals to ecosystem respiration, Re, to daytime based on empirical equations of Re response to temperature and soil humidity (Aubinet et al., 2000; Baldocchi, 2003; Reichstein et al., 2005; Grunzweig et al., 2009). However, the EC approach has several limitations and uncertainties. Its application is limited to relatively large homogeneous and flat terrains. EC technique is critically dependent on factors such as the system deployment in field (e.g., height above the canopy), on atmospheric conditions (e.g., turbulence conditions, advections) (Aubinet et al., 2000), on corrections applied to data processing programs and algorithms. A common way to assess EC measurements reliability is through the evaluation of the ‘energy closure’ over the measured ecosystem. This test indicates in most sites an energy gap of 20% or more (Foken, 2008). Empirical extrapolation of the night-time NEE measurement to approximate daytime Re has by itself significant uncertainties (e.g., Van Gorsel et al., 2009). NEE measurements provide a whole ecosystem flux only, thus explicit carbon uptake by trees cannot be distinguished from others ecosystem layers. EC measurements are also relatively expensive.
The current protocol describes an alternative method for calculation of forest trees GPP based on measurements of air temperature and humidity, trees’ sap flow (SF) rate and intrinsic water use efficiency (WUEi, the ratio A/gs), where A is the rate of photosynthetic CO2 assimilation and gs is stomatal conductance. This protocol is based on the recently published study of Klein et al., 2016. WUEi is a parameter characterizing plant species, with a seasonal variation (Seibt et al., 2008; Klein et al., 2013 and 2016). It can be calculated from the carbon isotope ratio (δ13C) in the assimilated carbon of plant tissues (Farquhar and Richards, 1984). This is combined with sap flow measurements, which can be obtained easier and at a lower cost than EC measurements, and often have less spatial limitations (independent on ecosystem footprint, topography, homogeneity, etc.), and enable GPP estimation in complex ecosystems. The method is applicable to calculate GPP of woody vegetation and can be considered as total ecosystem GPP if the contribution of understory layer to the total ecosystem GPP can be neglected (e.g., dry environments) or independently assessed. Note that using this approach can also be applied to archived SF and 13C data to reconstruct past variations in GPP, as long as these data are available.
Materials and Reagents
Forest or woody stand, which can be assumed to be homogenous to facilitate scaling up to stand level
Note: If stand is composed of considerably different plots and species, the method can be applied separately for each plot. The measurements are conducted on living trees. No reagents are used in this procedure.
Equipment
Tape measure of 2-3 m or caliper for tree diameter at breast height (approximately at 1.3 m, DBH, cm) distribution measurements
A total station theodolite or at least 30-50 m long tape-measure and compass for establishing a sample plot(s) with known area in order to get stand density
Sap flow sensors of any suitable type (e.g., EMS Brno, model: THB sensors ; or ICT International, model: HFD8-100 ; or UP, model: TDP sensors , etc.)
Note: The type of sensors depends on tree diameter, financial possibilities, power supply options etc. The most simple, TDP sensors can be manufactured in the institute workshop (see description, e.g., in Lu et al., 2004).
Dendrometers of any type for obtaining of seasonal DBH growth curve (e.g., EMS Brno, model: DRL26C or Natkon, model: Point Dendrometers [Oetwil am See, Switzerland])
Thermometer and air moisture meter or automatic meteorological station for continuous data recording
Datalogger for storing sap flow and met’ data (if no own logger is provided by SF and met’ sensors suppliers), e.g., (Campbell Scientific, model: CR1000 ). Most of factory-made sap flow sensors are supplied with own loggers (e.g., EMS Brno, Czech Republic)
Incremental borer. Short, 5.15’’ borers would usually fit for obtaining wood formed in the recent decade or period of interest
Equipment for tree rings analysis
Note: Best would be professional dendrometry desk station. Microtome can also help for intra-annual slicing. But the wider the tree-rings are, the easier it is to slice them with scalpel alone.
Laboratory for δ13C analysis
Note: This can be done in house isotope ratio mass spectrometry, or by commercial IRMS service labs.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tatarinov, F., Rotenberg, E., Yakir, D. and Klein, T. (2017). Forest GPP Calculation Using Sap Flow and Water Use Efficiency Measurements. Bio-protocol 7(8): e2221. DOI: 10.21769/BioProtoc.2221.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,222 | https://bio-protocol.org/exchange/protocoldetail?id=2222&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Efficient Generation of Multi-gene Knockout Cell Lines and Patient-derived Xenografts Using Multi-colored Lenti-CRISPR-Cas9
LB Lena Behrmann*
Scott McComb*
JA Júlia Aguadé-Gorgorió
YH Yun Huang
MH Mario Hermann
PP Pawel Pelczar
AA Adriano Aguzzi
JB Jean-Pierre Bourquin
Beat C. Bornhauser
*Contributed equally to this work
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2222 Views: 19061
Edited by: Gal Haimovich
Reviewed by: Annis Elizabeth Richardson
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
CRISPR-Cas9 based knockout strategies are increasingly used to analyze gene function. However, redundancies and overlapping functions in biological signaling pathways can call for generating multi-gene knockout cells, which remains a relatively laborious process. Here we detail the application of multi-color LentiCRISPR vectors to simultaneously generate single and multiple knockouts in human cells. We provide a complete protocol, including guide RNA design, LentiCRISPR cloning, viral production and transduction, as well as strategies for sorting and screening knockout cells. The validity of the process is demonstrated by the simultaneous deletion of up to four programmed cell death mediators in leukemic cell lines and patient-derived acute lymphoblastic leukemia xenografts, in which single cell cloning is not feasible. This protocol enables any lab with access to basic cellular biology equipment, a biosafety level 2 facility and fluorescence-activated cell sorting capabilities to generate single and multi-gene knockout cell lines or primary cells efficiently within one month.
Keywords: CRISPR Cas9 Multiple gene knockout Lentivirus Primary human leukemia Xenograft sgRNA design
Background
Starting with curious initial observations of genetic elements known as clustered regularly interspaced short palindromic repeats (CRISPRs) within bacterial genomes (Ishino et al., 1987; Mojica et al., 2000) and subsequent gene editing in mammalian cells (Cong et al., 2013; Mali et al., 2013), CRISPR-Cas9 has become the cutting edge option for inexpensive and efficient gene editing. With successful application in cellular systems ranging from tobacco plant cells to zebrafish and primary human cells (Hsu et al., 2014), CRISPR-Cas9 can be directed by design of a short 20 nucleotide RNA sequence to create targeted DNA double strand breaks (DSB) within large genomes (Park et al., 2016). After DSBs occur, cells can initiate repair either through high fidelity homologous recombination (HR) or error-prone non-homologous end joining (NHEJ), often leading to small insertion and deletion (indel) mutations resulting in gene knockout (Gaj et al., 2013; Bétermier et al., 2014) (Figure 1).
Figure 1. Principle of genome editing by CRISPR Cas9. The principle of a gene knockout by CRISPR-Cas9 is shown exemplarily for the RIP1 sequence. A. Single guided RNA (sgRNA) consists of the target sequence specific crRNA (CRISPR RNA) and the constant tracrRNA (trans-activating crRNA) (Jinek et al., 2012). crRNA is binding to the genomic DNA adjacent to the PAM motif and tracrRNA guides the Cas9 enzyme to the locus. B. Cas9 mediated DNA double strand breaks (DSB) activate non-homologous end joining (NHEJ). C. Imprecise DSB repair leads to gain or loss of nucleotides (indels) with a two-thirds chance of causing frameshift mutations that may result in the generation of premature stop codons.
A number of different strategies have emerged to deliver Cas9 protein and targeting RNA into cells, including electroporation or transfection of Cas9/sgRNA ribonucleoprotein complexes, mRNA, plasmid or lentiviral vectors carrying sgRNA and Cas9 payloads (Sander and Joung, 2014; Shalem et al., 2014). Previously these LentiCRISPR plasmids carried a resistance gene to allow selection of cells with constitutive expression of the machinery necessary for CRISPR-Cas9-directed gene disruption.
As shown in our recent publication (McComb et al., 2016), we have adapted the LentiCRISPR protocol for directed disruption of several genes simultaneously in cell lines and primary leukemia cells based on selection by fluorescence combined with fluorescence-activated cell sorting (FACS). By swapping the puromycin resistance gene for fluorescent protein markers (EGFP, mCherry, tagBFP, or RFP657), up to four genes can be simultaneously targeted for CRISPR-Cas9-mediated gene disruption. Fluorescence-activated cell sorting enables isolation of cell lines or primary human cells bearing sgRNAs targeting one to four genes in one single experimental step. Our multi-color LentiCRISPR technique thus allows the simultaneous generation of knockout cells bearing anywhere between one and four gene knockouts, allowing rapid testing of gene-gene interaction within a set of genes of interest. The backbone vectors with the four different fluorescence markers as well as the herein described target constructs including cloning information have been deposited at Addgene.
Here we provide a complete step-by-step guide protocol to generate single and multi-gene knockout cells by multicolor LentiCRISPR (see Figure 2 for schematic overview).
Figure 2. Schematic overview of the procedure to generate multicolor LentiCRISPR knockout cell lines and patient derived xenografts
Development of the protocol
To study the regulation of cell death in leukemia, we developed multi-color LentiCRISPR as a tool to target proteins essential for two divergent pathways of programmed cell death, apoptosis and necroptosis (McComb et al., 2016). Efficient deletion of the respective targets, like RIP1, RIP3, MLKL, FADD and CASP8, was demonstrated by Western blot analysis of protein in targeted compartments (see Data analysis). Through simultaneous gene disruption, we showed that it is necessary to inactivate both apoptosis and necroptosis within leukemic cell lines and patient-derived xenografts in order to render cells resistant to SMAC mimetics, a specific class of chemotherapeutic compounds targeting the inhibitor of apoptosis proteins, IAPs. These data provide convincing evidence that both apoptosis and necroptosis can independently kill leukemia cells in vivo, and are a strong proof of concept for the multicolor LentiCRISPR technique as a means to investigate gene redundancy.
Experimental design
sgRNA design and preparation. We first describe a fast and easy way to design and clone sgRNAs for any target gene with a single pot reaction for restriction and ligation (Figure 3). We have had good success utilizing the CRISPR design online tool (http://cripr.mit.edu) from the Massachusetts Institute of Technology, developed by the lab of Feng Zhang to predict binding sites for Cas9 with minimal risk of off-target activity (Hsu et al., 2013). Alternative sgRNA prediction software (such as http://crispor.tefor.net/) can also be used to provide in silico prediction of sgRNA-specific cleavage activity based on a number of different algorithms. However, we still recommend the design of three sgRNAs per target gene and assessing their gene knockout activity in cell lines before moving on to more challenging applications. Strategies targeting only the 5’ exon of candidate genes might induce in-frame mutations that can retain the full protein functionality. A recent publication showed that targeting particular exonic regions with key functional protein domains increases the chance of null mutations without a full protein knockout (Shi et al., 2015). For this reason, we suggest spreading sgRNA candidates among different exons to increase the probability of achieving a potent gene deletion.
Figure 3. Principle of primer design and cloning for LentiCRISPR-Cas9 mediated gene knockout. Primer design is shown exemplarily for RIP1. A. From the genomic sequence the target locus for CRISPR editing was chosen and screened by http://crispr.mit.edu for sgRNA binding sites. B. After choosing a guide by score and location, complement primer sequence can be generated. C and D. For ligation into the Esp3I restriction site of the pLentiCRISPR plasmid sticky ends (CACC/CAAA) and the U6 transcriptional start site (TSS), (G) has to be added to the oligonucleotide sequence. U6, RNA Pol III promoter; EFS, EF1 short promoter.
Lentiviral production and infection. This protocol makes use of multicolor LentiCRISPR plasmids cloned from one-vector LentiCRISPR system developed by the Zhang lab (Shalem et al., 2014). Protocol conditions have been optimized for the transduction of acute lymphoblastic leukemia (ALL) cell lines and patient derived xenograft ALL cells from previously published protocols (Tiscornia et al., 2006; Kutner et al., 2009; Weber et al., 2012). Optimized conditions are recommended for every cell line or patient-derived sample. Here, we describe the production of lentiviral particles with the VSV-G envelope, because it is known for its high titers and broad tropism. Depending on the target cells the pseudotyping can be exchanged. For murine applications, the exchange to a mouse ecotropic envelope protein enhances safety and enables the use of the lentiviral vectors under biosafety level 1 conditions.
Analysis of knockout efficiency
After purification of cells transduced with Cas9/sgRNA targeted against a gene of interest, it is straightforward to confirm knockout at protein level (measurement via flow cytometry, ELISA or Western blot). Thus it is essential that a specific antibody for your protein of interest is available (see Figure 4 for further discussion and considerations for single cell cloning). Regardless of the viral transduction efficiency and the gene-editing efficacy of the selected sgRNA/CRISPR-Cas9 construct, DNA mutations do not invariantly lead to a loss of protein. Based on the triplet coding sequences the ratio of a frameshift after NHEJ is 2:1 resulting in possible indels without frameshift. Depending on the location of indel formation, this may also lead to unpredictable effects on mRNA or protein stability. Thus, we do not recommend knockout confirmation at DNA or RNA level by sequencing or SURVEYOR nuclease assay since this does not confirm the loss of the protein expression and function. Lesions can lead to a loss of amino acids and a change in protein functionality, but can also result in a slightly impaired protein with a near wild type function. Depending on the target gene a functional assay can be performed (i.e., enzyme activity) or cellular localization can be visualized (i.e., for nuclear receptors) but we recommend performing Western blots or ELISA to quantify protein level.
Limitations of the technique
Lentiviral vector efficiently delivers the CRISPR machinery to a wide range of cell lines and primary cells. However, as with any viral approach, there is a risk of insertional mutagenesis, although this can be minimized by transducing cells at a low multiplicity of infection (MOI) to limit the number of integration events. Constitutive expression of Cas9/sgRNA may also lead to accumulation of mutations at off-target sites, stressing the need for good sgRNA design to limit off-target binding.
Efficiency of knockouts using LentiCRISPR can vary significantly depending on the specific genes targeted, especially for targets that confer a selective advantage/disadvantage to knockout cells. It might thus be a benefit to utilize an inducible CRISPR plasmid for such applications. In this case, Cas9 or sgRNA expression would be controllable in vitro and in vivo by administration of i.e., doxycycline.
Our strategy also depends on the reliability of the detection of reporter fluorescence. There is some evidence for silencing of expression over time for fluorescent proteins of the GFP family when expressed from lentiviral vectors. The populations should therefore be continuously monitored for expression. While lentiviral delivery has been proven to be very efficient in many different cellular systems, transduction efficiency heavily depends on the size of the delivered plasmids (Canté-Barrett et al., 2016). The large size of the LentiCRISPR vector is known to lead to low viral titers, nonetheless, viral concentration and other optimizations in the protocol below have allowed us to successfully apply these vectors in hard to transduce leukemic cell lines and primary cells.
Figure 4. Considerations for single cell cloning. We recommend single cell cloning if a clonal cell population with a constant genetic background is desired for long term experimentation. Here we present a Western blot confirmation of the knockout of RIP1 in either (A) double sorted or (B) single cell cloned Jurkat cells. Irrespective the purity of the sorted cell population, a minor RIP1 signal remains in the double sorted population, whereas in single cell clones a pure knockout can be achieved. Proteins were detected with mouse anti-RIP1 (1:1,000) and goat anti-mouse-HRP (1:5,000).
Materials and Reagents
Filtered sterile pipette tips
10 µl (STARLAB INTERNATION, catalog number: S1121-3810 )
200 µl (STARLAB INTERNATION, catalog number: S1120-8810 )
1,000 µl (STARLAB INTERNATION, catalog number: S1126-7810 )
TC plate
6 well (SARSTEDT, catalog number: 83.3920 )
24 well (SARSTEDT, catalog number: 83.3922 )
96 well R (SARSTEDT, catalog number: 83.3925 )
Filters: Filtropur S
0.22 µm (SARSTEDT, catalog number: 83.1826.102 )
0.45 µm (SARSTEDT, catalog number: 83.1826 )
Serological pipettes
5 ml (SARSTEDT, catalog number: 86.1253.001 )
10 ml (SARSTEDT, catalog number: 86.1254.001 )
25 ml (SARSTEDT, catalog number: 86.1685.001 )
Amicon Ultra-15 centrifugal filter units (EMD Millipore, catalog number: UFC900308 )
Tube
15 ml (SARSTEDT, catalog number: 62.554.502 )
50 ml (SARSTEDT, catalog number: 62.547.254 )
13 ml for bacteria culture (SARSTEDT, catalog number: 62.515.006 )
SafeSeal tubes 1.5 ml (SARSTEDT, catalog number: 72.706 )
Nitrocellulose membranes (Trans-Blot Turbo transfer pack) (Bio-Rad Laboratories, catalog number: 170-4159 )
Disposable syringe 10 ml (CODAN, catalog number: 62.6616 )
Injectomat syringe 50 ml (Fresenius Kabi, catalog number: 9000711 )
Petri dishes (92 x 16 mm) for LB plates (SARSTEDT, catalog number: 82.1472.001 )
Round-bottom tube, 5 ml (Corning, Falcon®, catalog number: 352052 )
Round-bottom tube with cell strainer cap, 5 ml (Corning, Falcon®, catalog number: 352235 )
TC flask T175, vent. cap (SARSTEDT, catalog number: 83.3912.002 )
Microvette 100 LH, Lithium-Heparin (SARSTEDT, catalog number: 20.1282 )
NSG (NOD.Cg-Prkdcscid IL2rgtm1Wjl/SzJ) mice (RRID:IMSR_ARC:NSG), age ~4-6 weeks
Caution: Institutional animal care guidelines must be followed. Here the animal experiments were approved by the veterinary office and the ethics commission of the Canton of Zurich, Switzerland.
HEK293T cells (ATCC, catalog number: CRL-3216 )
Note: Cells should be growing actively in culture with DMEM medium with 10% (v/v) FBS. Cells should be maintained between 10-90% confluence, splitting at least twice per week.
Target cells
Note: Cells should be growing in healthy culture with appropriate medium. For most ALL cell lines RPMI with 10% (v/v) FBS is suitable. Primary cells should be thawed a day before transduction.
Caution: Primary human cells have to be considered potentially hazardous. Primary derived xenografts were obtained from human ALL samples recovered from cryopreserved bone marrow aspirates. Here patients were enrolled in the ALL-BFM 2000 and ALL-BFM 2009 studies. Informed consent was given in accordance with the Declaration of Helsinki and approval was granted by the Ethics Commission of the Kanton Zurich.
One Shot TOP10 Chemically Competent E. coli (Thermo Fisher Scientific, InvitrogenTM, catalog number: C404010 or equivalent)
CRISPR target plasmid with BsmBI (Esp3I) insert site, e.g.,
pLentiCRISPR-EGFP (Addgene, catalog number: 75159 )
RFP657 (Addgene, catalog number: 75162 )
BFP (Addgene, catalog number: 75160 )
mCherry (Addgene, catalog number: 75161 )
psPAX2 plasmid (Addgene, catalog number: 12260 )
p.CMV.VSV.G plasmid (Addgene, catalog number: 8454 )
Caution: It may cause an allergic skin reaction or asthma symptoms.
Oligonucleotides 100 µM, standard synthesis, desalted purification (for example sequences see Table 1)
Table 1. Sequences of oligonucleotides for pLentiCRISPR cloning
Tango buffer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: BY5 )
T4 DNA ligase (New England Biolabs, catalog number: M0202M ) make aliquots of T4 DNA ligase buffer and use only freshly thawed aliquots for reaction
Esp3I restriction enzyme (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: ER0451 )
Note: NOT NEB BsmBI, BsmBI requires 55 °C for efficient cleavage – not compatible with this protocol.
SOC medium (Sigma-Aldrich, catalog number: S1797 or equivalent)
Ampicillin (Sigma-Aldrich, catalog number: A9518 or equivalent)
RED Taq Ready Mix PCR Reaction mix (Sigma-Aldrich, catalog number: R2523 or equivalent)
Mini- and Midi-plasmid Preparation Kit (QIAGEN, catalog number: 27106 or equivalent)
Tris-acetate-EDTA buffer (TAE, 25x) (Thermo Fisher Scientific, AmbionTM, catalog number: AM9870 or equivalent)
Polyethylenimin (PEI transfection reagent) (Sigma-Aldrich, catalog number: 408727 )
Note: You must test your preparation of PEI prior to use to establish the concentration, which is necessary to get the best transduction efficiency. We generally use ~20 µg/ml final concentration.
Caution: It is toxic if swallowed.
ProFection Mammalian Transfection System (Promega, catalog number: E1200 )
Chloroquine diphosphate salt (Sigma-Aldrich, catalog number: C6628 or equivalent)
Caution: It is harmful if swallowed.
Calcium chloride (CaCl2)
HBS
Polybrene (hexadimethrine bromide) (Sigma-Aldrich, catalog number: H9268 ) stock solution 8 mg/ml in ddH2O
Caution: It is harmful if swallowed.
Dulbecco’s phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: D1408 or equivalent)
Trypsin (0.05% in PBS) with EDTA (BioConcept, catalog number: 5-51F00-I or equivalent)
Formalin (4% formaldehyde) (Formafix, catalog number: 01-1010 )
Polyethylene glycol (PEG 6000) (Sigma-Aldrich, catalog number: 81253 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 or equivalent)
RetroNectin Recombinant Human Fibronectin Fragment (Takara Bio, Clontech, catalog number: T100B )
Note: Prepare Retronectin according to manufacturer’s protocol, aliquot and store at -20 °C. Retronectin can be reused up to 4 times without quality decrease.
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9418 or equivalent)
Hank’s balanced salt solution (HBSS) (Thermo Fisher Scientific, catalog number: 14170088 or equivalent)
HEPES, 1 M (Thermo Fisher Scientific, catalog number: 15630056 or equivalent)
Caution: It can cause skin irritation and serious eye irritation.
Flow cytometry antibody (PE-Cy7 anti-human CD19) (BioLegend, catalog number: 302216 , RRID:AB_314246)
NuPage MES SDS 20x running buffer (Thermo Fisher Scientific, NovexTM, catalog number: NP0002-02 ) dilute 1:20 with ddH2O for final concentration
Pageruler Prestained Protein ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 26616 or equivalent)
Precast gels (Criterion XT 4-12% Bis-Tris 1.0 mm gels)
18 well (Bio-Rad Laboratories, catalog number: 3450124 )
26 well (Bio-Rad Laboratories, catalog number: 3450125 )
Nonfat-dried milk (Sigma-Aldrich, catalog number: M7409 or equivalent)
Note: Prepare 5% (w/v) working solution in 1x TBS-T. Prepare fresh and store at 4 °C for short term.
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: S2002 or equivalent)
Caution: It is fatal if swallowed or in contact with skin. May cause damage to organs if swallowed. Very toxic to aquatic life.
Secondary HRP-conjugated antibody
Western blot primary antibodies
Mouse anti-RIP1 (BD, BD Biosciences, catalog number: 551042 , RRID:AB_394015)
Rabbit anti-FADD (Cell Signaling Technology, catalog number: 2782 , RRID:AB_2100484)
Mouse anti-Tubulin (Sigma-Aldrich, catalog number: T9026 , RRID:AB_477593)
Rat anti-MLKL (EMD Millipore, catalog number: MABC604 )
Mouse anti-CASP8 (Cell Signaling Technology, catalog number: 9746 , RRID:AB_2068482)
Rabbit anti-RIP3 (Abnova, catalog number: PAB0287 , RRID:AB_1019004)
Western blot secondary antibodies conjugated to horseradish peroxidase
Goat anti-mouse (Cell Signaling Technology, catalog number: 7076 , RRID:AB_330924)
Goat anti-rabbit (Cell Signaling Technology, catalog number: 7074 , RRID:AB_10697506)
Goat anti-rat (Cell Signaling Technology, catalog number: 7077 , RRID:AB_10694715)
Baytril, Bayer, 0.5 ml in 250 ml autoclaved drinking water (stock 2.5%)
Gene Ruler 1 kb Plus DNA ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SM1331 or equivalent)
GelRed, 10,000x (Biotium, catalog number: 41003 )
Note: GelRed is superior to ethidium bromide by having low toxicity and high sensitivity.
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 221465 or equivalent)
Caution: It is dangerous. Causes severe skin burns and eye damage.
SuperSignal® West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 34096 )
Benzonase Nuclease (Sigma-Aldrich)
Bacto tryptone (BD, BactoTM, catalog number: 211705 or equivalent)
Yeast extract (BD, BactoTM, catalog number: 212750 or equivalent)
Agar (BD, BactoTM, catalog number: 214010 or equivalent)
Agarose (Eurogentec, catalog number: EP-0010-05 or equivalent)
DMEM medium (Sigma-Aldrich, catalog number: D5546 or equivalent)
Fetal calf serum (FCS) (Sigma-Aldrich, catalog number: 12133C or equivalent)
L-glutamine, 200 mM (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 or equivalent)
Sodium pyruvate, 100 mM (Thermo Fisher Scientific, GibcoTM, catalog number: 11360070 or equivalent)
RPMI medium (Sigma-Aldrich, catalog number: R8758 or equivalent)
Penicillin-streptomycin (Pen/Strep) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 or equivalent)
FBS
Dimethylsulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 or equivalent)
Trizma HCl (Sigma-Aldrich, catalog number: T5941 or equivalent)
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 or equivalent)
Caution: It is harmful if swallowed and toxic in contact with skin. Flammable solid. Can cause eye and skin irritation and may cause respiratory irritation.
Bromophenol blue (Bio-Rad Laboratories, catalog number: 161-0404 or equivalent)
Glycerol (Sigma-Aldrich, catalog number: G5516 or equivalent)
2-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 or equivalent)
Caution: It is toxic if swallowed or if inhaled. Fatal in contact with skin. Causes skin irritations and eye damage.
Ammonium chloride (NH4Cl) (Carl Roth, catalog number: K298.1 or equivalent)
Caution: It is harmful if swallowed. It causes serious eye irritation.
Potassium chlorate (KClO3) (EMD Millipore, catalog number: 104854 or equivalent)
Caution: It is dangerous and harmful if swallowed or inhaled. May cause fire, is a strong oxidizer.
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) (Sigma-Aldrich, catalog number: E5134 or equivalent), prepare 0.5 M stock solution with ddH2O and pH 8.0 with NaOH
Caution: It is harmful if inhaled.
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 or equivalent)
Trizma base (Sigma-Aldrich, catalog number: 93352 or equivalent)
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: H1758 or equivalent)
Caution: It is toxic if inhaled. Causes severe skin burns and eye damage.
Tween 20 (Sigma-Aldrich, catalog number: P9416 or equivalent)
Ponceau S (Sigma-Aldrich, catalog number: P3504 )
Acetic acid (Sigma-Aldrich, catalog number: A6283 or equivalent)
Caution: It is flammable and causes severe skin burns and eye damage.
LB agar plates Combine (see Recipes)
LB medium Combine (see Recipes)
DMEM complete (see Recipes)
RPMI medium (see Recipes)
Freezing medium (see Recipes)
3x SDS lysis buffer (see Recipes)
1x SDS loading buffer (see Recipes)
Red blood lysis buffer (RBC buffer) (see Recipes)
10x TBS (see Recipes)
1x TBS-T (see Recipes)
Ponceau S solution (see Recipes)
SDS Glycine stripping buffer (see Recipes)
Equipment
Pipettes (Gilson)
Pipetus pipetting aid (Hirschmann Laborgeräte)
Shaker (Thomas Scientific, model: Rocker Gyratory Lab Scale TSSL3, catalog number: 51900-27 )
Thermocycler
Microbiological incubator with 37 °C, atmospheric CO2 (Thermo Fisher Scientific, Heraeus)
HeraCell 150 incubator with 37 °C, 5% CO2 (Thermo Fisher Scientific, model: HeraCell 150 incubator )
MUPID-One electrophoresis system (LABGENE Scientific, model: MUPID-One electrophoresis system )
Bench-top centrifuge (Eppendorf, model: 5417 C )
Nalgene Oak Ridge centrifuge tube (Lab Depot, catalog number: 21009-386-PK )
Note: These tubes are appropriate for ultracentrifugation and can’t be exchanged by standard tubes.
Water bath (Thermo Fisher Scientific)
Thermomixer comfort (Eppendorf)
Vortex mixer Vortex-Genie 2 (Scientific Industries, model: Vortex-Genie 2 )
FACSARIA III flow cytometry sorter (BD, model: FACSAria III )
FACS Canto II flow cytometer (BD, BD Biosciences, model: FACSCANTO II )
Gel documentation (Syngene)
Heraeus Multifuge 3S (Thermo Fisher Scientific, model: HeraeusTM MultifugeTM 3S )
Laminar flow hood for sterile tissue culture, biosafety level 2 approved (Thermo Fisher Scientific)
Mastercycler nexus (Eppendorf)
Mr. Frosty freezing container (Thermo Fisher Scientific)
Neubauer chamber (BRAND)
TransBlot Turbo transfer system (Bio-Rad Laboratories, model: Trans-Blot® TurboTM transfer system )
Western blot chamber (Criterion Cell) and PowerPac basic power supply (Bio-Rad Laboratories)
Spatula
Software
A Plasmid Editor (http://biologylabs.utah.edu/jorgensen/wayned/ape/) (Optional)
Oligonucleotide Properties Calculator (http://biotools.nubic.northwestern.edu) (Optional)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Behrmann, L., McComb, S., Aguadé-Gorgorió, J., Huang, Y., Hermann, M., Pelczar, P., Aguzzi, A., Bourquin, J. P. and Bornhauser, B. C. (2017). Efficient Generation of Multi-gene Knockout Cell Lines and Patient-derived Xenografts Using Multi-colored Lenti-CRISPR-Cas9. Bio-protocol 7(7): e2222. DOI: 10.21769/BioProtoc.2222.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Mutagenesis
Cell Biology > Cell isolation and culture > Cell isolation
Cell Biology > Cell engineering > CRISPR-cas9
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.