id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
2,223 | https://bio-protocol.org/exchange/protocoldetail?id=2223&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of FNR-NrdI Interaction by Microscale Thermophoresis (MST)
IG Ingvild Gudim
ML Marie Lofstad
MH Marta Hammerstad
HH Hans-Petter Hersleth
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2223 Views: 11095
Edited by: Yanjie Li
Reviewed by: André Alex Grassmann
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
This protocol describes how to measure protein-protein interactions by microscale thermophoresis (MST) using the MonolithTM NT.115 instrument (NanoTemper). We have used the protocol to determine the binding affinities between three different flavodoxin reductases (FNRs) and a flavodoxin-like protein, NrdI, from Bacillus cereus (Lofstad et al., 2016). NrdI is essential in the activation of the manganese-bound form of the class Ib ribonucleotide reductase (RNR) system. RNRs, in turn, are the only source of the de novo synthesis of deoxyribonucleotides required for DNA replication and repair in all living organisms.
Keywords: MST Microscale thermophoresis Protein-protein interaction KD Binding constant
Background
Protein-protein interactions are often characterised in terms of the associated dissociation constant, KD. The binding constant can be established using a variety of techniques, such as isothermal calorimetry (ITC), NMR spectroscopy, and surface plasmon resonance (SPR). An alternative method is based on thermophoresis, a phenomenon where distinct molecules (such as a protein-protein complex versus individual proteins) respond differently to a temperature gradient (Duhr and Braun, 2006; Seidel et al., 2013). This method is rapid, no sample immobilisation is needed and the sample requirement is low. Briefly, one of the proteins is labelled with a fluorescent dye and kept at a constant, low concentration. A dilution series is set up, where the other protein is diluted up to 16 times, creating a vast concentration range. The two proteins are subsequently mixed and loaded into capillaries, which are scanned in the MonolithTM NT.115 instrument, developed and sold exclusively by NanoTemper. The samples are subjected to a temperature gradient, and the movement of the fluorescently labelled molecule is tracked. The difference in the fluorescence of the molecule at the initial temperature and at the new temperature is used to generate a binding curve as a function of the concentration of the unlabelled protein.
Materials and Reagents
Tubes
15 (VWR, catalog number: 525-0400 )
50 ml (VWR, catalog number: 525-0402 )
Pipette tips
0.1-10 μl (VWR, catalog number: 613-0735 )
1-200 μl (VWR, catalog number: 613-0740 )
100-1,250 μl (VWR, catalog number: 613-0739 )
0.2 μm filter (SARSTEDT, catalog number: 83.1826.001 )
Syringe, 50 ml (BD, catalog number: 300865 )
Protein 1 (here, NrdI, locus-tag: bc1353) and protein 2 (here, FNR1 bc0385, FNR2 bc4926, FNR3 bc1495)
MO-L001 MonolithTM Protein Labeling Kit RED-NHS (Amine Reactive) (NanoTemper) (contains NT-647-NHS dye [store at -20 °C]; spin column for buffer exchange [store at 4 °C]; gravity flow column for purification [store at 4 °C]; labeling buffer [store at 4 °C])
MO-K002 MonolithTM NT.115 Standard Treated Capillaries (NanoTemper) (contains MonolithTM NT.115 Standard Treated Capillaries [store at RT]; 10% Tween 20 [store at 4 °C]; Albumin fraction A [store at 4 °C]; MST buffer [store at -20 °C]; 200 μl vials)
DMSO (Sigma-Aldrich, catalog number: D4540 )
Liquid N2
HEPES (AppliChem, catalog number: A3724 )
Potassium chloride (KCl) (EMD Millipore, catalog number: 104936 )
Tween-20
Buffer A (see Recipes)
Equipment
Pipettes (various sizes)
Benchtop centrifuge
Vortex
MonolithTM NT.115 with Blue/Red filter (NanoTemper Technologies, model: MO-G008 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gudim, I., Lofstad, M., Hammerstad, M. and Hersleth, H. (2017). Measurement of FNR-NrdI Interaction by Microscale Thermophoresis (MST). Bio-protocol 7(8): e2223. DOI: 10.21769/BioProtoc.2223.
Download Citation in RIS Format
Category
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,224 | https://bio-protocol.org/exchange/protocoldetail?id=2224&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Analysis of Flow-regulated Ion Channels in Xenopus Oocytes
SS Shujie Shi
MC Marcelo D. Carattino
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2224 Views: 9210
Edited by: Neelanjan Bose
Reviewed by: Cheng-Hsun HoRia Sircar
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Mechanically-gated ion channels play key roles in mechanotransduction, a process that translates physical forces into biological signals. Epithelial and endothelial cells are exposed to laminar shear stress (LSS), a tangential force exerted by flowing fluids against the wall of vessels and epithelia. The protocol outlined herein has been used to examine the response of ion channels expressed in Xenopus oocytes to LSS (Hoger et al., 2002; Carattino et al., 2004; Shi et al., 2006). The Xenopus oocyte is a reliable system that allows for the expression and chemical modification of ion channels and regulatory proteins (George et al., 1989; Palmer et al., 1990; Sheng et al., 2001; Carattino et al., 2003). Therefore, this technique is suitable for studying the molecular mechanisms that allow flow-activated channels to respond to LSS.
Keywords: Flow Laminar shear stress Ion channels Xenopus oocytes Two-electrode voltage clamp Microinjection
Background
Epithelial cells that line the urinary tract and endothelial cells that line blood vessels are subjected to mechanical forces elicited by moving fluids. These forces are, laminar shear stress (LSS), a frictional force tangential to the wall of the tubular structures, and circumferential stretch, which is perpendicular to the direction of flow. Compelling evidence indicates that LSS is the main determinant for the physiological responses observed in response to flow changes in tubular structures of the kidney and blood vessels (Satlin et al., 2001; Liu et al., 2003; Weinbaum et al., 2010). In these settings, ion channels have an important role transmitting fluid shear stress into biological signals (Ranade et al., 2015). For instance, in the distal nephron of the kidney the rates of Na+ reabsorption and K+ secretion are positively modulated by luminal fluid flow. In this segment of the nephron, high tubular flow rates enhance the activity of the epithelial sodium channel (ENaC) (Satlin et al., 2001 and 2006; Morimoto et al., 2006). In the face of high luminal flow rates, the apical entry of Na+ mediated by ENaC and its electrogenic basolateral extrusion create an electrochemical gradient that favors the passive diffusion of cellular K+ into the luminal fluid through maxi-K channels (Woda et al., 2001; Satlin et al., 2006). Likewise, in the vasculature, where fluid shear stress is essential for normal physiological responses, ion channels have been proposed as mechanosensors that mediate endothelial flow signaling (Davies, 1995; Hoger et al., 2002; Wang et al., 2009; Guo et al., 2016).
The technique described in this protocol has been used to examine basic aspects of the regulation of ENaC by LSS as well as to gain understanding of the molecular mechanisms that allow this channel to respond to fluid flow (Carattino et al., 2004; 2005 and 2007; Morimoto et al., 2006). With this technique, we were able to characterize basic features of the response of ENaC to LSS, such as time-course of activation, strain dependence, temperature dependence, and voltage dependence (Carattino et al., 2004 and 2007). In addition, using ENaC mutant subunits that assemble to form channels that are either constitutively open (βS518K) or that can be locked in an open state by chemical modification (αS580C), we showed that fluid flow increases ENaC activity by changing the open probability of the channel (Carattino et al., 2004). This finding was later confirmed using single channel analysis (Althaus et al., 2007). Moreover, by combining the technique described herein and site-directed mutagenesis we were able to identify key structural elements in ENaC required for a response to LSS (Carattino et al., 2004 and 2005; Abi-Antoun et al., 2011; Shi et al., 2011; 2012a; 2012b and 2013). Recently, we employed this technique to examine the regulation of MEC-4 and MEC-10 by LSS. These channel forming subunits are members of the ENaC/degenerin family expressed in C. elegans that are required for gentle touch in worms (Driscoll and Chalfie, 1991; Shi et al., 2016). Other investigators have employed the technique describe here to study the response of K+ channels expressed in the vasculature to LSS (Hoger et al., 2002; Fronius et al., 2010). In summary, the technique described in this protocol is suitable to examine the molecular mechanisms by which fluid flow regulates the function of epithelial and endothelial ion channels.
Materials and Reagents
Oocyte injection Petri dish: a 10 cm diameter Petri dish (Fisher Scientific, FisherbrandTM, catalog number: FB0875713 ) with a polypropylene mesh of 60 μm opening size (Spectrum, catalog number: 146494 ) glued to the bottom
50 ml conical tubes (Corning, catalog number: 352098 )
15 ml conical tubes (Corning, catalog number: 352099 )
Plastic transfer pipettes (Fisher Scientific, FisherbrandTM, catalog number: 13-711-9CM )
Nuclease-free tubes (Eppendorf, catalog numbers: 022600001 and 022600028 )
Nuclease-free tips (Mettler-Toledo, Rainin, catalog numbers: 17002927 and 17002928 )
3.5 in. glass capillaries (Drummond Scientific, catalog number: 3-000-203-G/X )
Razor blade
Syringe 5 ml (BD, catalog number: 309603 )
Needles 25 G 1 1/2 (BD, catalog number: 305127 )
Parafilm (Bemis, catalog number: PM992 )
6-well tissue culture plate (Corning, catalog number: 3516 )
L-shaped capillary tube with an internal diameter of 1.8 mm (homemade)
Glass capillaries 1.5 mm diameter (WPI, catalog number: 1B150F-4 )
Tygon tubing 1/16 in ID 1/18 in OD (Fisher Scientific, FisherbrandTM, catalog number: 14-171-129 )
Frogs, Xenopus laevis (Nasco, Fort Atkinson, WI)
Tricaine methane sulfonate (MS-222) (Sigma-Aldrich, catalog number: C6885 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S6297 )
Collagenase type II (Sigma-Aldrich, catalog number: C6885 )
Soybean trypsin inhibitor (Sigma-Aldrich, catalog number: T9128 )
Commercial in vitro transcription kit (e.g., mMessage mMachine transcription kits from Ambion)
Nuclease free water (Thermo Fisher Scientific, AmbionTM, catalog number: AM9937 )
Mineral oil (Sigma-Aldrich, catalog number: M3516 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 30530 or S8045 )
Note: The product “ 30530 ” has been discontinued.
Calcium nitrate tetrahydrate, Ca(NO3)2·4H2O (Sigma-Aldrich, catalog number: C1396 )
Calcium chloride dehydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M2643 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P3786 )
Sodium penicillin/streptomycin sulfate (Thermo Fisher Scientific, GibcoTM, catalog number: 15140148 )
Gentamycin sulfate (Thermo Fisher Scientific, GibcoTM, catalog number: 15750078 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9647 )
Benzamil hydrochloride (Sigma-Aldrich, catalog number: B2417 ): a potent blocker of ENaC and degenerin channels
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8779 )
Note: This product has been discontinued.
Ca2+-free standard oocytes solution (SOS, see Recipes)
Modified Barth solution (MBS) (see Recipes)
Hypotonic solution (see Recipes)
Two-electrode voltage clamp recording solution (TEV) (see Recipes)
Benzamil working solution (see Recipes)
Equipment
Harvesting of ovaries from female Xenopus laevis
2-L glass beaker
Fine forceps for tissue collection (Roboz Surgical, catalog number: RS-5240 )
Fine scissors for tissue collection (Fine Science Tools, catalog number: 14060-09 )
Tissue forceps (Roboz Surgical, catalog number: RS-8162 )
Oocyte isolation and maintenance
Dumont size 4 forceps (Fine Science Tools, catalog number: 11241-30 )
Clay AdamsTM Nutator mixer (BD, catalog number: 421105 )
Oocytes transferring pipette: a polished glass Pasteur pipette (Fisher Scientific, FisherbrandTM, catalog number: 13-678-20 )
Pipette pump (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F378980000 )
B.O.D. low temperature refrigerated incubator (VWR)
Oocyte injection
Programmable nanoliter injector (Drummond Scientific, model: Nanoject III )
Steel base plate (WPI, catalog number: 5052 )
Magnetic holding stand (WPI, catalog number: M10 )
Three-axis manual micromanipulator (WPI, catalog number: M3301 )
Stereo microscope (Olympus, model: SZ61 )
Fiber optic illuminator and bifurcated light guide (WPI)
Micropipette pullers (NARISHIGE, model: PC10 )
Two-electrode voltage clamp
Steel base plate (WPI, catalog number: 5479 )
Steel base plate (WPI, catalog number: 5052 )
Magnetic holding devices, three (WPI, catalog number: M10 )
Three-axis manual micromanipulators, three (WPI, catalog number: M3301 )
Two-electrode voltage clamp amplifier (Molecular Devices, Axon Accessories, model: GeneClamp 500B )
Headstages (Molecular Devices, Axon Accessories, model: HS-2A )
Virtual ground bath clamp (Molecular Devices, Axon Accessories, model: VG-2A )
Pipette holders (Molecular Devices, model: HL-U )
Ag/AgCl pellets (2 mm diameter, 4 mm long) (WPI, catalog number: EP2 )
Digitizer (Molecular Devices, model: Digidata 1550B )
BNC cables (A-M systems)
Perfusion system (Warner Instruments, model: VC-6 )
Flow valve (Warner Instruments, model: FR-50 )
Vacuum attached waste bottle (Fisher Scientific, FisherbrandTM, catalog number: FB3002000 )
Oocyte chamber (20 mm diameter and 6 mm deep ring with glued glass bottom)
Silver wire AWG 26 for electrodes (WPI, catalog number: AGW1510 )
PC computer with Windows operating system
Software
pClamp 10 software (Molecular Devices)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Shi, S. and Carattino, M. D. (2017). Expression and Analysis of Flow-regulated Ion Channels in Xenopus Oocytes. Bio-protocol 7(8): e2224. DOI: 10.21769/BioProtoc.2224.
Shi, S., Luke, C. J., Miedel, M. T., Silverman, G. A. and Kleyman, T. R. (2016). Activation of the Caenorhabditis elegans degenerin channel by shear stress requires the MEC-10 subunit. J Biol Chem 291(27): 14012-14022.
Download Citation in RIS Format
Category
Molecular Biology > Protein > Ion channel signaling
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,225 | https://bio-protocol.org/exchange/protocoldetail?id=2225&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Time-lapse Observation of Chromosomes, Cytoskeletons and Cell Organelles during Male Meiotic Divisions in Drosophila
KT Karin Tanabe
RO Ryotaro Okazaki
KK Kana Kaizuka
YI Yoshihiro H. Inoue
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2225 Views: 8902
Edited by: Jihyun Kim
Reviewed by: Filipa Vaz
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
In this protocol, we provide an experimental procedure that perform time-lapse observation of intra-cellular structures such as chromosomes, cytoskeletons and cell organelles during meiotic cell divisions in Drosophila males. As primary spermatocyte is the largest dividing diploid cell in Drosophila, which is equivalent in size to mammalian cultured cells, one can observe dynamics of cellular components during division of the model cells more precisely. Using this protocol, we have showed that a microtubule-associated protein plays an essential role in microtubule dynamics and initiation of cleavage furrowing through interaction between microtubules and actomyosin filaments. We have also reported that nuclear membrane components are required for a formation and/or maintenance of the spindle envelope essential for cytokinesis in the Drosophila cells.
Keywords: Drosophila Male meiosis Time-lapse observation GFP-tagged protein Chromosome dynamics Microtubules Cytokinesis Mitochondria
Background
In Drosophila, good cultured cell lines that proliferate well in a standard culture condition are also available. However, their cell size, particularly cytoplasmic volume, is much smaller than that of mammalian cells. This compromises the examination of cellular components during cell division. Spermatocytes, on the other hand, achieve distinct cell growth before initiation of first meiotic division. The primary spermatocytes are the largest diploid cells among proliferative cells to appear in Drosophila development. Thus, one can easily perform detailed observation of cellular structures in dividing cells using optical microscopes. In Drosophila melanogaster, well-advanced and sophisticated genetic techniques are available (Ashburner et al., 2004). Meiotic defects in chromosome segregation and in cytokinesis appear in cellular organization of spermatids just after completion of 2nd meiotic division. By observation of such early spermatids, one can easily find out even subtle meiotic abnormalities (Giansanti et al., 2012; Inoue et al., 2012). Furthermore, if a loss of microtubule integrity or dynamics would have occurred in normal cultured cells, their cell cycle progression should be arrested before metaphase. Therefore, it is hard to examine how microtubules would influence later processes of cell divisions in the somatic cells. Spermatocytes, on the other hand, are less sensitive to microtubule abnormalities at microtubule assembly checkpoint before metaphase. One can, therefore, examine a role of microtubule-related genes in cytokinesis without arresting cell cycle. We and other groups have established systems to facilitate dynamics of chromosomes or microtubules by expression of proteins fused with GFP fluorescence tag (Clarkson and Saint, 1999; Inoue et al., 2004; Rebollo and Gonzalez, 2004; Kitazawa et al., 2012).
Previous protocols can trap the male meiotic cells in a narrow space sandwiched between a coverslip and a slide glass, ensured by a small cushion materials and observe chromosome segregation under an upright microscope (Savoian et al., 2000; Inoue et al., 2004; Savoian, 2015). These protocols allowed us to collect clear images of microtubules. However, a preparation that makes the cells flattened often prevents initiation and/or progression of cytokinesis. In addition, it was difficult to add drugs or inhibitors to the living cells while time-lapse observation.
Therefore, we have established a new method that allows us to observe a whole meiosis I from prophase I to end of cytokinesis in an open chamber under an inverted microscope. We can add drugs in the cell culture in any timing of the imaging. We also improved the protocol so that we can perform a simultaneous observation of chromosomes and other cellular components such as microtubules, actin filaments, endoplasmic reticulum, Golgi apparatuses or mitochondria during male meiosis I. It can be achieved by a simultaneous expression of proteins fused with different fluorescent tags showing spectrally separable colors. As most aspects of division process seen in Drosophila meiotic cells are shared among higher eukaryotes, this protocol should be useful for studying cell division processes of other organisms as well as Drosophila somatic cell mitosis.
Materials and Reagents
Cover slips (22 x 22 mm, No. 1, thickness 0.12-0.17 mm) (Matsunami Glass, catalog number: C022221 )
Note: It was argued that thorough cleaning steps of cover slips are required for maintenance of cell viability and for a success prolonged observation of living cells (Savoian, 2015). However, if these cover slips are used, any pretreatment is not basically necessary except a wipe with 70% ethanol just before using.
Plastic cover slip folder (76 x 26 mm)
Note: The folders were customized. It was 76 x 32 mm in length and width and 1.7 mm in thickness. There was a concavity (25 mm square) where the cover slip fell in the surface and a circular hole of 15 mm diameter in the center of the concavity) (see Figure 1).
Figure 1. A plastic cover slip holder. The holder should be set on the microscope stage. There was a concavity where the cover slip (22 x 22 mm) fell in the surface and a circular hole with 15 mm diameter in the center of the concavity.
10 x 10 mm open frame that had adhesives on the bottom side (Gene Frame 25 μm) (Thermo Fisher Scientific Co., Waltham, USA)
Plastic Petri dish (90 mm diameter) (AsOne, catalog number: 1-7484-01 )
Kim-wipe (KCWW, Kimberly-Clark)
bam-Gal4::vp16 (abbreviated as bam-Gal4) can be used as a Gal4 driver for testis-specific ectopic expression of fluorescence proteins (Kitazawa et al., 2012)
bam-Gal4::vp16 UAS-dir2 was used as a Gal4 driver for testis-specific depletion (Kitazawa et al., 2014)
P{His2AvT:Avic\GFP-S65T} (abbreviated as Histone2Av-GFP) can be used for expression of Histone 2Av fused with a GFP tag to visualize chromatin in living meiotic cells (Bloomington Drosophila Stock Center, catalog number: BL5941 )
P{Ubi-mRFP-βTub85D} (abbreviated as RFP-βTubulin) can be used for ubiquitous expression of β-tubulin fused with a mRFP tag to visualize microtubules in living meiotic cells (Kitazawa et al., 2014)
P{sqh-EYFP-Golgi} can be used for ubiquitous expression of Golgi components fused with a YFP tag to visualize Golgi apparatus in living meiotic cells (Bloomington Drosophila Stock Center, catalog number: BL7193 )
P{sqh-EYFP-ER} can be used for ubiquitous expression of ER components fused with a YFP tag to visualize endoplasmic reticulum in living meiotic cells (Bloomington Drosophila Stock Center, catalog number: BL7195 )
P{sqh-EYFP-Mito} can be used for ubiquitous expression of mitochondrial target sequences fused with a YFP tag to visualize mitochondria in living meiotic cells (Bloomington Drosophila Stock Center, catalog number: BL7194 )
P{UASp-GFP-Orbit}, P{UASp-mRFP-Orbit}, and P{UASp-Venus-Orbit} can be used for visualization of Orbit protein, an essential microtubule-associated protein. UAS-stocks that can induce Orbit proteins fused with three different fluorescent tags are available (Miyauchi et al., 2013)
P{UASp-mRFP-Actin5C} (Bloomington Drosophila Stock Center, catalog number: BL24777 ), P{UAS-GFP-Actin5C} (Bloomington Drosophila Stock Center, catalog number: BL9257 ) and P{UAS-CFP-Actin5C} (Miyauchi et al., 2013) can be used for ectopic expression of F-actin components fused with different tags to visualize F-actin in living meiotic cells
P{UAS-GFP-anillin} (Bloomington Drosophila Stock Center, catalog number: BL51348 ) and P{Ub-mRFP-anillin} (Bloomington Drosophila Stock Center, catalog number: BL52220 ) can be used for visualization of a contractile ring in a living meiotic cell (gifts from J.A. Brill, now available from Bloomington Drosophila Stock Center)
P{w[+mC]=sqh-GFP.RLC}3 can be used for ubiquitous expression of myosin light chain components fused with GFP tag to visualize MLC in living meiotic cells (a gift from R. Karess)
P{PTT-GA}Pdi[G00198], a protein trap stock expressing GFP-Protein disulfide isomerase for visualization of intracellular membranous structures (a gift from L. Cooley, now available from Bloomington Drosophila Stock Center as catalog number: BL6839 ). A protein stock expressing GFP-LamC for visualization of nuclear lamina (a gift from L. Wallrath)
P{UAS-PLCg-PH-GFP} for visualization of plasma membrane in male meiotic cells (a gift from J. A. Brill)
P{UAS-mRFP-Nup107.K} 7.1 for visualization of nuclear pore complex in nuclear envelope of male meiotic cells (a gift from V. Doyle, now available from Bloomington Drosophila Stock Center as catalog number: BL35516 )
P{UAS-GFP-Pav} and P{UAS-GFP-Polo} were used for visualization of a microtubule motor and an important cell division regulator in a living meiotic cell, respectively (gifts from D. Glover)
For RNAi experiments in male meiotic cells, UAS-RNAi stocks for ectopic expression of dsRNA for each protein were obtained from VDRC stock center and Bloomington stock center. P{UAS-GFP RNAi} (Bloomington Drosophila Stock Center, catalog number: BL9330 ) can be used as a negative control of RNAi experiments
Colchicine (50 μg/ml in BRB80 buffer) (≥ 95% colchicine) (Sigma-Aldrich, catalog number: C9754 )
Note: To examine requirement of microtubules for cellular dynamics, colchicine that is an inhibitor of microtubule polymerization was used. The BRB80 buffer containing colchicine was prepared before the dissection every time. The testes were dissected in the buffer containing colchicine and then, meiotic cells were spread under mineral oil.
Cytochalasin D (10 μg/ml in BRB80 buffer) (≥ 98% cytochalasin D) (Sigma-Aldrich, catalog number: C8273 )
Note: To examine requirement of F-actin for cellular dynamics, cytochalasin D that is an inhibitor of actin polymerization was used. The BRB80 buffer containing cytochalasin D was prepared before the dissection every time. The male flies were dissected to collect the testes in the buffer containing cytochalasin D and then, meiotic cells were spread under mineral oil.
Fetal calf serum (Thermo Fisher Scientific, GibcoTM, catalog number: 451456 or 10437 )
Note: The fetal calf serum can be kept at 4 °C for a month.
Mineral oil (Trinity Biotech, catalog number: 400-5-1000 )
Note: The mineral oil was replaced to a fresh one every time-lapse recording.
Brefeldin A (Cell Signaling, catalog number: 9972 ) or Exo1 (Sigma-Aldrich, catalog number: E8280 )
Note: To examine whether membrane trafficking mediated by COPI is required for cellular dynamics, each compound was used to inhibit αCOPI. They were directly added to the culture medium. The BRB80 buffer containing Brefeldin A or Exo1 was prepared before the dissection every time. The testis can be incubated in the culture medium for up to 14 h before isolation of spermatocytes.
PIPES (Dojindo Mecular Technologies, catalog number: 340-08255 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Nacalai Tesque, catalog number: 20908-65 )
Ethylene Glycol Bis (EGTA) (Nacalai Tesque, catalog number: 08907-42 )
Potassium chloride (KCl) (Wako Pure Chemical Industries, catalog number: 162-17942 )
Sodium chloride (NaCl) (Wako Pure Chemical Industries, catalog number: 191-01665 )
Sodium phosphate dibasic (Na2HPO4)
Potassium dihydrogen phosphate (KH2PO4)
M3 medium (Sigma-Aldrich, catalog number: S8398 )
BRB80 buffer (pH 6.8) (see Recipes)
Insect M3 medium (see Recipes)
Phosphate-buffered saline (PBS) (see Recipes)
Equipment
Super fine forceps (Fine Science Tools, model: Dumont #5 )
Dissection needles sharpened tungsten wire with 0.5 mm diameter
Inverted fluorescence microscope (Olympus, model: IX81 ) outfitted with excitation, emission filter wheels (Olympus, Tokyo, Japan)
Objectives; UPLFLN40XPH (NA=0.75), UPLSAPO60XO (NA=1.4), UPLSAPO100XO (NA=1.4) (Olympus, Tokyo, Japan)
Hg lump (Olympus, catalog number: USH-1030L )
Cooled CCD camera (Hamamatsu Photonics, model: C10600-10B )
Autoclave
Software
Metamorph software version 7.6 (Molecular Devices, Sunnyvale, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tanabe, K., Okazaki, R., Kaizuka, K. and Inoue, Y. H. (2017). Time-lapse Observation of Chromosomes, Cytoskeletons and Cell Organelles during Male Meiotic Divisions in Drosophila. Bio-protocol 7(8): e2225. DOI: 10.21769/BioProtoc.2225.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,226 | https://bio-protocol.org/exchange/protocoldetail?id=2226&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Stomatal Conductance in Rice
YW Yin Wang
TK Toshinori Kinoshita
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2226 Views: 12456
Edited by: Dennis Nürnberg
Reviewed by: Hideyuki TakahashiLaura Zanin
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Stomatal conductance, the reciprocal of stomatal resistance, represents the gas exchange ability of stomata. Generally, the stomatal conductance is higher when stomata open wider, and vice versa. In this protocol, we describe how to measure stomatal conductance in rice using Li-6400 (Licor, USA).
Keywords: Stomatal conductance Li-6400XT Rice Red light Blue light
Background
Stomata consist of a pair of guard cells and open in response to blue light as a signal. Using epidermal fragments from the kidney-shaped guard cells (found mainly in dicots), the blue light-induced stomatal opening can be observed readily under a microscope. However, direct measurement of the stomatal aperture from the dumbbell-shaped guard cells in monocots, such as rice, maize, wheat, and oats, is very difficult, due to their uneven leaf surface. Thus, a gas-exchange system is useful for the measurement of blue light-induced stomatal opening in the leaves of monocots.
Materials and Reagents
Rice (Oryza sativa) cultivar Nipponbare
Note: Rice (O. sativa) cultivar Nipponbare plants were grown at 28 °C under a photoperiod of 14 h light/10 h dark or in a greenhouse at room temperature (25-32 °C). Mature leaves, from 4-week-old plants, were used in gas-exchange measurements.
Equipment
Portable gas-exchange system, Li-6400XT (Licor, USA), with standard chamber
Licor gas-exchange systems, especially the Li-6400 and Li-6400XT, are used widely in photosynthesis and stomatal conductance measurements. The standard chamber, as a basic accessory for the Li-6400XT, is assembled with a high-precision temperature sensor and an internal light sensor (see Figure 1). Because stomatal conductance is a function of leaf temperature (von Caemmerer and Farquhar, 1981), precise control of the leaf temperature is important. Moreover, to induce specific stomatal blue light response, an internal light sensor to measure extra red light and blue light (for the light source see below) is needed. Therefore, the standard chamber, with a high precision temperature sensor and an internal light sensor, is suitable for this experiment.
Light source
Light is provided via a fiber-optic illuminator with a halogen projector lamp (15 V/150 W; Philips, Netherlands) as the light source. A power supply (MORITEX, catalog number: MHAB-150W-100V ) was used to power the lamp. Red light (660 nm) and blue light (470 nm) are obtained with filters (#2-61 and #5-60, Corning, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, Y. and Kinoshita, T. (2017). Measurement of Stomatal Conductance in Rice. Bio-protocol 7(8): e2226. DOI: 10.21769/BioProtoc.2226.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Tissue analysis
Cell Biology > Tissue analysis > Physiology
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,227 | https://bio-protocol.org/exchange/protocoldetail?id=2227&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Rapid Isolation of Total Protein from Arabidopsis Pollen
MC Ming Chang
Shanjin Huang
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2227 Views: 9916
Edited by: Marisa Rosa
Reviewed by: Yuan ChenMohan TCIgor Cesarino
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Arabidopsis pollen is an excellent system for answering important biological questions about the establishment and maintenance of cellular polarity and polar cell growth, because these processes are amenable to the genetic and genomic approaches that are readily available in Arabidopsis. Given that proteins are the direct executors of a wide variety of cellular processes, it is important to rapidly and efficiently isolate total protein for various protein-based analyses, such as Western blotting, co-immunoprecipitation and mass spectrometry, among others. Here we present a protocol for rapid isolation of total protein from Arabidopsis pollen, which is adapted from our recently published paper (Chang and Huang, 2015).
Keywords: Arabidopsis thaliana Flower Pollen Protein isolation Western blot
Background
Pollen is a critical stage during the life cycle of sexually-reproducing plants. Pollen germination and subsequent tube growth provide the passage for two non-motile sperm cells to effect double fertilization in flowering plants. Pollen is routinely used as a model system to addressing fundamental cell biological questions, such as the establishment and maintenance of cell polarity and polar cell growth, as well as the structure and function of the actin cytoskeleton (Chen et al., 2009; Qu et al., 2015). Generally, pollen derived from lily and tobacco was widely used due to the large size of the grains, which makes them easy to collect and observe under the microscope. In contrast, Arabidopsis pollen is small and it is relatively difficult to collect a large amount of pollen to isolate a sufficient quantity of protein for downstream analyses such as Western blotting and mass spectrometry. Therefore, development of a protocol to rapidly isolate total protein from Arabidopsis pollen will facilitate related analyses.
Materials and Reagents
1.5 ml Eppendorf tubes (Fisher Scientific, FisherbrandTM, catalog number: 05-408-129 )
Pipette tips (USA Scientific, catalog numbers: 1112-1720 , 1110-1200 )
Arabidopsis plants (ecotype Col-0)
Ponceau S (Sigma-Aldrich, catalog number: P3504 )
Anti-α-tubulin (Beyotime Biotechnology, catalog number: AT819 )
Anti-actin (Abmart, catalog number: M20009 )
Anti-COXII (Agrisera, catalog number: AS04 053A )
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (AMRESCO, catalog number: 0511 )
K-acetate (Sinopharm Chemical Reagents, catalog number: 30154518 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma, catalog number: 63064 )
Tween 20 (AMRESCO, catalog number: 0777 )
Triton X-100 (Sigma-Aldrich, catalog number: V900502 )
Phenylmethanesulfonyl fluoride (PMSF) (EMD Millipore, catalog number: 52332 )
K-HEPES protein extraction buffer (see Recipes)
Equipment
Pestles (VWR, catalog number: 89093-446 )
Forceps (Shanghai Haiou)
Pipettes (VWR, catalog numbers: 89079-970 , 89079-974 )
Vortex (Corning, model: Corning® LSETM Vortex Mixer )
Centrifuge (Eppendorf, model: 5417 R )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chang, M. and Huang, S. (2017). Rapid Isolation of Total Protein from Arabidopsis Pollen. Bio-protocol 7(8): e2227. DOI: 10.21769/BioProtoc.2227.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,228 | https://bio-protocol.org/exchange/protocoldetail?id=2228&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phenotypic Profiling of Candida glabrata in Liquid Media
FI Fabian Istel
MT Miha Tome
SJ Sabrina Jenull
Karl Kuchler
Published: Apr 5, 2017
DOI: 10.21769/BioProtoc.2228 Views: 10094
Download PDF
Ask a question
Favorite
Cited by
Abstract
Here, we describe a method for a large-scale liquid screening approach in C. glabrata. This liquid media method offers several distinct advantages over solid media approaches. This includes growth measurement on a plate reader instead of comparing growth by eye-sight. Furthermore, the liquid method requires lower amounts of antifungals and offers a higher sensitivity. While this method has been optimized for C. glabrata it might be used for other Candida species and yeast-like fungi as well.
Keywords: Candida glabrata Liquid media screening Antifungals Large-scale screening Antifungal tolerance Antifungal resistance
Materials and Reagents
Filtered pipet tips 1, 250 µl XL (Starlab, TipOne®, catalog number: S1122-1830 )
Pin pad, 96 RePad (Singer Instruments, catalog number: RP-MP-2L )
Pipet tips 300 µl (Starlab, TipOne®, catalog number: S1110-8810 )
Filtered pipet tips 200 µl (Starlab, TipOne®, catalog number: S1120-8810 )
96-well plates (Starlab, CytoOne®, catalog number: CC7682-7596 ) (200 µl/well)
Aluminum foil, self-adhesive (Starlab, catalog number: E2796-9792 )
Breathable foil (Sigma-Aldrich, catalog number: Z380059 )
Petri dishes (92 mm) (SARSTEDT)
Gas-permeable material
Culture tube (for at least 5 ml of culture)
Strains to be screened
Examples: Deletion mutants of C. glabrata (Schwarzmüller et al., 2014) or clinical isolates of C. glabrata
Glycerol
Compound(s) used for the screening
Example: Fluconazole (Discovery Fine Chemicals, catalog number: 86386-73-4 )
Control strains (see the ‘Notes’ section for further details)
DMSO
(Optional) Ethanol
Sterile water (double distilled)
BactoTM peptone (BD, BactoTM, catalog number: 211820 )
BactoTM yeast extract (BD, BactoTM, catalog number: 212720 )
BactoTM agar (BD, BactoTM, catalog number: 214030 )
Glucose (Merck Millipore, catalog number: 108337 )
YPD media (yeast extract peptone dextrose) (see Recipes)
Solid YPD media (see Recipes)
Equipment
Yeast replica robot (Singer Instruments, model: RoToR HDA )
Plate reader (Victor3V) (PerkinElmer, model: Victor3V Multilabel Plate Reader)
Electronic pipette 1,200 µl (Gilson, model: Pipetman Concept, catalog number: F31015 )
Electronic pipette 5,000 µl (Gilson, model: Pipetman Concept, catalog number: F31016 )
Electronic pipette 12 x 300 µl (Gilson, model: Pipetman Concept, catalog number: F31044 )
Plate mixer (Eppendorf, model: MixMate® , catalog number: 5353000014)
Rotary shaker for culture flasks (Eppendorf, New BrunswickTM, model: Innova® 44 )
Incubator (Heraeus Instruments, catalog number: B6120 )
(Optional) 48-well replica stamp (V&P Scientific, catalog number: VP 408H )
(Optional) 96-well replica stamp (V&P Scientific, catalog number: VP 407 )
(Optional) Library copier (guide for stamps) (V&P Scientific, catalog number: VP 381 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Antimicrobial assay > Antifungal assay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,229 | https://bio-protocol.org/exchange/protocoldetail?id=2229&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of the Dot/Icm Type IV Secretion System Core Complex from Legionella pneumophila for Negative Stain Electron Microscopy Studies
Tomoko Kubori
HN Hiroki Nagai
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2229 Views: 7334
Reviewed by: Anastasia D Gazi
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Legionella possesses a pivotal secretion machinery to deliver virulence factors to eukaryotic host cells. In this protocol, we describe the procedure for isolation of the native core complex of the Dot/Icm type IV secretion system from L. pneumophila aiming to perform biochemical and transmission electron microscopy analyses.
Keywords: Legionella Type IV secretion Core complex Isolation Electron microscopy Bacteria Nanomachine Structure
Background
Legionella pneumophila is a Gram-negative bacterial pathogen that causes lung infection known as Legionnaires’ disease (Fields et al., 2002). L. pneumophila utilizes a type IV secretion system (T4SS) encoded by the dot/icm genes to transport about 300 bacterial proteins into the cytosol of their eukaryotic host to hijack cellular processes (Hubber and Roy, 2010). Composed of more than 20 proteins, the T4SS is a nanomachine built on the bacterial inner and outer membranes (Nagai and Kubori 2011; Kubori and Nagai 2016). The core complex of Dot/Icm T4SS is a biochemically stable part of the system and forms a transport conduit bridging the inner and outer membrane (Kubori et al. 2014). The core complex is composed of at least five proteins; three outer membrane-associated proteins, DotC, DotD and DotH, and two inner membrane proteins, DotF and DotG (Vincent et al., 2006). Based on the procedure for biochemical isolation of another bacterial nanomachine, the type III secretion system, from Salmonella typhimurium (Kubori et al., 1998; Marlovits et al., 2004), we modified the protocol to adapt it to the purification of the T4SS of L. pneumophla. In this protocol, we present the procedure to isolate the native core complex of the T4SS from detergent lysed wild-type L. pneumophila based on separation by ultracentrifugation. T4SS isolated using this procedure can be used to perform biochemical and transmission electron microscopy analyses described previously (Kubori et al., 2014).
Materials and Reagents
Sterile swabs
Sterile cell scrapers (IWAKI, catalog number: 9000-220 )
Sterile conical tubes (50 ml and 15 ml)
Sterile Petri dishes (100 mm in diameter)
Cuvettes for spectrophotometer (1.5 ml) (BOECO, catalog number: BRA 759017 )
Millex-GP filter units (EMD Millipore, catalog number: SLGP033RS )
Sterile 10 ml syringe (Terumo, catalog number: SS-10LZ )
Ultrafree MC filters (EMD Millipore, catalog number: UFC30GV00 )
Sterile pipets (10 ml) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 170356 )
L. pneumophila Lp01 strain (Philadelphia-1 rpslL hsdR) (Berger and Isberg, 1993)
cOmpleteTM protease inhibitor cocktail (Roche Diagnostics, catalog number: 11697498001 )
Sodium chloride (NaCl) (Nacarai Tesque, catalog number: 31320-05 )
12.5% precast polyacrylamide gels (ATTO, catalog number: e-PAGEL E-R12.5L ; or equivalent)
Glow-discharged carbon grids (Nisshin EM, catalog number: 649 )
Coomassie brilliant blue (CBB) stain One (Nacarai Tesque, catalog number: 04543-51 )
ACES (Sigma-Aldrich, catalog number: A3594 )
BactoTM yeast extract (BD, BactoTM, catalog number: 212750 )
MilliQ water
Activated charcoal (Sigma-Aldrich, catalog number: C5510 )
BactoTM agar (BD, BactoTM, catalog number: 214010 )
L-cysteine hydrochloride monohydrate (Nacarai Tesque, catalog number: 10313-55 )
Iron(III) nitrate enneahydrate, Fe(NO3)3·9H2O (Nacarai Tesque, catalog number: 19514-55 )
Tris(hydroxymethyl)aminomethane (Tris) (Nacarai Tesque, catalog number: 35434-21 )
Hydrochloric acid (HCl) (Nacarai Tesque, catalog number: 18321-05 )
Sucrose (Nacarai Tesque, catalog number: 30404-45 )
Phenylmethylsulfonyl fluoride (PMSF) (Nacarai Tesque, catalog number: 27327-94 )
Isopropanol (Sigma-Aldrich, catalog number: 190764 )
EDTA·2Na (Nacarai Tesque, catalog number: 15130-95 )
Sodium hydroxide (NaOH) (Nacarai Tesque, catalog number: 31511-05 )
Lysozyme (Wako Pure Chemical Industries, catalog number: 120-02674 )
Triton X-100 (Nacarai Tesque, catalog number: 35501-15 )
AG501-X8 Resin (Bio-Rad Laboratories, catalog number: 143-7425 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Nacarai Tesque, catalog number: 21003-75 )
DNase I (Sigma-Aldrich, catalog number: DN25 )
Potassium hydroxide (KOH) (Nacarai Tesque, catalog number: 28616-45 )
Uranyl acetate (UA) (Merck, catalog number: 8473 )
Phosphotungstic acid (PTA) (TAAB, catalog number: p013 )
CYE plate (see Recipes)
AYE medium (see Recipes)
Tris-Cl solution (pH 8.0) (see Recipes)
Sucrose solution (see Recipes)
PMSF stock solution (see Recipes)
EDTA stock solution (see Recipes)
Lysozyme solution (see Recipes)
Triton X-100 stock solution (see Recipes)
MgSO4 stock solution (see Recipes)
DNase I stock solution (see Recipes)
KOH solution (see Recipes)
NaOH stock solution (see Recipes)
TET solution (see Recipes)
PTA solution (see Recipes)
Uranyl acetate solution (see Recipes)
Equipment
Glass flasks (2 L)
37 °C shaking incubator
37 °C incubator
Spectrophotometer
Refrigerated centrifuge (KUBOTA, model: 7780 ; or equivalent models)
Rotor for centrifugation (KUBOTA, models: AG-5006 , AG-6512C )
Sterile centrifuge tubes (500 ml capacity, polypropylene or polycarbonate)
Sterile centrifuge tubes (50 ml capacity, polyallomer or polycarbonate)
Clean grass beakers (200 ml)
Magnetic stir bars
Magnetic stirrer
pH meter
Ultracentrifugation (Beckman Coulter, model: OptimaTM L-100 XP ; or equivalent models)
Rotor for ultracentrifugation (Beckman Coulter, model: Type 70Ti )
Tubes for ultracentrifugation (Beckman Coulter, catalog number: 355631 )
Microfuge (Eppendorf, model: 5415 R )
Glass beakers (1 L)
Autoclavable flasks (2 L)
Autoclave
Electrophoresis apparatus (ATTO, model: AE-6530 ; or equivalent model)
Electron microscope (JEOL, model: JEM-1011 )
ÄKTA purifier (GE Healthcare)
Superose 6 10/300 GL column (GE Healthcare, catalog number: 17517201 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Kubori, T. and Nagai, H. (2017). Isolation of the Dot/Icm Type IV Secretion System Core Complex from Legionella pneumophila for Negative Stain Electron Microscopy Studies. Bio-protocol 7(8): e2229. DOI: 10.21769/BioProtoc.2229.
Kubori, T., Koike, M., Bui, X. T., Higaki, S., Aizawa, S. and Nagai, H. (2014). Native structure of a type IV secretion system core complex essential for Legionella pathogenesis. Proc Natl Acad Sci U S A 111(32): 11804-11809.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
223 | https://bio-protocol.org/exchange/protocoldetail?id=223&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Liver Triglyceride Content
HJ Hani Jouihan
Published: Vol 2, Iss 13, Jul 5, 2012
DOI: 10.21769/BioProtoc.223 Views: 33270
Download PDF
Ask a question
Favorite
Cited by
Abstract
This assay is designed to measure relative lipid accumulation of experimental treatments compared to controls. The reagent measures the concentration of glycerol released after lysing the cells and hydrolyzing the triglyceride molecules. The triglyceride concentration can then be determined from the glycerol values.
Materials and Reagents
EtOH
KOH
MgCl2
Triglyceride (GPO Trinder) reagent A (Sigma-Aldrich, catalog number: 337-40A )
[Please note that this product has been replaced by free glycerol reagent (F6428) from Sigma]
Glycerol Standards (Sigma-Aldrich, catalog number: 339-11 or G7793 )
Ethanolic KOH (see Recipes)
Equipment
Microfuge tube
Glycerol
Microreader
Cuvette
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,230 | https://bio-protocol.org/exchange/protocoldetail?id=2230&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Hydrodynamic Radius of Proteins by Size Exclusion Chromatography
VV Valentina La Verde
PD Paola Dominici
AA Alessandra Astegno
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2230 Views: 32400
Edited by: Yanjie Li
Reviewed by: Wenrong HeMurugappan Sathappa
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Size exclusion chromatography (SEC) or gel filtration is a hydrodynamic technique that separates molecules in solution as a function of their size and shape. In the case of proteins, the hydrodynamic value that can be experimentally derived is the Stokes radius (Rs), which is the radius of a sphere with the same hydrodynamic properties (i.e., frictional coefficient) as the biomolecule. Determination of Rs by SEC has been widely used to monitor conformational changes induced by the binding of calcium (Ca2+) to many Ca2+-sensor proteins. For this class of proteins, SEC separation is based not just on the variation in protein size following Ca2+ binding, but likely arises from changes in the hydration shell structure.
This protocol aims to describe a gel filtration experiment on a prepacked column using a Fast Protein Liquid Chromatography (FPLC) system to determine the Rs of proteins with some indications that are specific for Ca2+ sensor proteins.
Keywords: Size exclusion chromatography Gel filtration Hydrodynamics Stokes radius Protein shape Protein size Conformational change Ca2+-sensor proteins
Background
Gel filtration separates molecules of different sizes and shapes based on their relative abilities to penetrate a bed of porous beads with well-defined pore sizes, which identifies the fractionation range. Molecules larger than the fractionation range, which are completely excluded from entering the pores, flow quickly through the column and elute first at the void volume (V0), which is the interstitial volume outside the support particles. Molecules smaller than the fractionation range, which are able to diffuse into the pores of the beads, have access to the total volume available to the mobile phase, therefore they move through the bed more slowly and elute last. Molecules with intermediate dimensions will be eluted with an elution volume (Ve) comprised between the void volume and the total volume available to the mobile phase (the smaller the molecule, the greater its access to the pores of the matrix, and thus the greater is its Ve).
The molecular weight of a protein can be determined by comparison of its elution volume parameter Kd, which represents the distribution of a given solute between the stationary and mobile phases (see Data analysis below), with those of different known calibration standards.
If the protein of interest has the same shape (generally globular) as the standard calibration proteins, the gel filtration experiment provides a good estimate of its molecular weight. However, because the shape of proteins can vary significantly and may be not known for an unknown protein, care must be taken in the determination of molecular size from elution volume. For example, a protein with an elongated shape could elute at a position that does not correspond to its dimension and which is significantly different from the position of a spherical protein having the same molecular weight. This is the case for some Ca2+ sensor proteins, e.g., calmodulins from different organisms (Sorensen and Shea, 1996; Sorensen et al., 2001; Astegno et al., 2014; Astegno et al., 2016; Vallone et al., 2016), which have anomalous migrations in gel filtration, resulting in a defined overestimation of the molecular weight due to their highly extended conformation. Thus, it is clear that in a gel filtration experiment the elution profile of proteins is closer to their Stokes radius (Rs) rather than to their molecular weight. Rs is a hydrodynamic value indicative of the apparent size of the dynamic solvated/hydrated protein.
For this reason, a SEC-based approach has been employed to resolve Ca2+-induced changes in the hydrated shape of Ca2+ sensor proteins by determination of their Rs in apo- and Ca2+-bound conditions. Ca2+ binding usually causes a decrease in the Rs (Sorensen and Shea, 1996; Sorensen et al., 2001; Astegno et al., 2016). The same SEC-based approach may be applicable to the detection of other protein-small molecule (e.g., other metals) interactions that cause changes in the structure of the protein to a less or more extended conformation (Asante-Appiah and Skalka, 1997; Bagai et al., 2007; De Angelis et al., 2010).
The values of Rs have been reported for a large number of proteins; in particular, some proteins are especially convenient for calibration of gel filtration columns (le Maire et al., 1986; Uversky, 1993) (Table 1). A gel filtration column can determine the hydrodynamic size, Rs, of a sample protein by comparison with the Rs of these water-soluble calibration proteins.
Table 1. Standards for calibrating analytical gel filtration
Materials and Reagents
0.22 µm syringe filters with low protein retention (Thermo Fischer Scientific, Thermo ScientificTM, catalog number: 42204-PV )
0.22 µm vacuum filtration unit (Sartorius, catalog number: 180C7-E )
Superdex 200 10/300 GL prepacked column (GE Healthcare, catalog number: 17517501 )
Superose 12 10/300 GL prepacked column (GE Healthcare, catalog number: 17-517-301 )
20% EtOH–minimum 1 L (Sigma-Aldrich, catalog number: 51976 )
MilliQ water–minimum 1 L
Protein markers:
Thyroglobulin (Sigma-Aldrich, catalog number: T9145 )
Apo-Ferritin (Sigma-Aldrich, catalog number: A3660 )
β-amylase (Sigma-Aldrich, catalog number: A8781 )
Catalase (Sigma-Aldrich, catalog number: C9322 )
Aldolase (Sigma-Aldrich, catalog number: A2714 )
Alcohol dehydrogenase (Sigma-Aldrich, catalog number: A8656 )
Albumin (Sigma-Aldrich, catalog number: A8531 )
Ovalbumin (Sigma-Aldrich, catalog number: A5503 )
Carbonic anhydrase (Sigma-Aldrich, catalog number: C7025 )
Myoglobin (Sigma-Aldrich, catalog number: M0630 )
Cytochrome c (Sigma-Aldrich, catalog number: C7150 )
Gel filtration Calibration Kits with an optimized range of proteins are also commercially available:
Gel Filtration Markers Kit for Protein Molecular Weights 29,000-700,000 Da (Sigma-Aldrich, catalog number: MWGF1000 )
Gel Filtration Markers Kit for Protein Molecular Weights 12,000-200,000 Da (Sigma-Aldrich, catalog number: MWGF200 )
Gel Filtration Markers Kit for Protein Molecular Weights 6,500-66,000 Da (Sigma-Aldrich, catalog number: MWGF70 )
Gel Filtration Calibration Kits
High molecular weight (GE Healthcare, catalog number: 28-4038-42 )
Low molecular weight (GE Healthcare, catalog number: 28-4038-41 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: 21097 )
Ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E4378 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 1.06462 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: H1758 )
DL-dithiothreitol, anhydrous (DTT) (Sigma-Aldrich, catalog number: D9779 )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: 31248 or P9333 )
Note: The product “ 31248 ” has been discontinued.
HEPES (Sigma-Aldrich, catalog number: H3375 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Acetone (Sigma-Aldrich, catalog number: 439126 )
Dextran blue (Sigma-Aldrich, catalog number: D4772 )
2 M CaCl2 (20 ml) (see Recipes)
0.1 M EGTA (100 ml, pH 8) (see Recipes)
0.1 M DTT (see Recipes)
Mobile phase (see Recipes)
5 mM Tris, 150 mM KCl, pH 7.5 (for calibration of Superose 12 column 10/300GL)
5 mM Tris, 150 mM KCl, 5 mM EGTA, 1 mM DTT pH 7.5
5 mM Tris, 150 mM KCl, 5 mM CaCl2, 1 mM DTT pH 7.5
50 mM HEPES, 150 mM NaCl, 0.1 mM DTT pH 7.5 (for calibration of Superdex 200 10/300 GL)
Total volume available to the mobile phase marker (see Recipes)
Void volume marker (see Recipes)
Protein calibration standards (see Recipes)
Protein sample (see Recipes)
Equipment
ÄKTA FPLC system (or similar liquid chromatography system, e.g., ÄKTA pure , ÄKTA prime plus , ÄKTA start ) including injector, one pump, UV-detector, Fraction collector (GE Healthcare, models: ÄKTA pure , ÄKTA prime plus , ÄKTA start )
Note: ÄKTA FPLC has been discontinued and replaced with ÄKTA pure .
Sample loop kit (GE Healthcare, catalog number: 18-0404-01 )
Hamilton syringe (500 µl) (Hamilton, catalog number: 81217 or Sigma-Aldrich, catalog number: S9266 )
Vacuum pump
Tabletop centrifuge (Eppendorf, model: 5424 R )
Software
UNICORNTM 4.0 control software for ÄKTA FPLC chromatography system (GE Healthcare)
Origin 8.0 (OriginLab Corporation, Northampton, MA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：La Verde, V., Dominici, P. and Astegno, A. (2017). Determination of Hydrodynamic Radius of Proteins by Size Exclusion Chromatography. Bio-protocol 7(8): e2230. DOI: 10.21769/BioProtoc.2230.
Download Citation in RIS Format
Category
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,231 | https://bio-protocol.org/exchange/protocoldetail?id=2231&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
The Object Context-place-location Paradigm for Testing Spatial Memory in Mice
Edith Lesburguères
Panayiotis Tsokas
TS Todd Charlton Sacktor
André Antonio Fenton
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2231 Views: 11643
Edited by: Xi Feng
Reviewed by: Edgar Soria-GomezSoyun Kim
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
This protocol was originally designed to examine long-term spatial memory in PKMζ knockout (i.e., PKMζ-null) mice (Tsokas et al., 2016). Our main goal was to test whether the ability of these animals to maintain previously acquired spatial information was sensitive to the type and complexity of the spatial information that needs to be remembered. Accordingly, we modified and combined into a single protocol, three novelty-preference tests, specifically the object-in-context, object-in-place and object-in-location tests, adapted from previous studies in rodents (Mumby et al., 2002; Langston and Wood, 2010; Barker and Warburton, 2011). During the training (learning) phase of the procedure, mice are repeatedly exposed to three different environments in which they learn the spatial arrangement of an environment-specific set of non-identical objects. After this learning phase is completed, each mouse receives three different memory tests configured as environment mismatches, in which the previously learned objects-in-space configurations have been modified from the original training situation. The mismatch tests differ in their cognitive demands due to the type of spatial association that is manipulated, specifically evaluating memory for object-context and object-place associations. During each memory test, the time differential spent exploring the novel (misplaced) and familiar objects is computed as an index of novelty discrimination. This index is the behavioral measure of memory recall of the previously acquired spatial associations.
Keywords: Space Novelty preference Discrimination memory Recognition memory Context
Background
The behavioral neuroscientist’s toolkit of laboratory rodent behaviors has needed to expand to both propel and keep up with the progress of the program to identify the molecular mechanisms of memory. The traditional approach has been to use reinforced behaviors to control learning and formation of memory and limit behavior to readily quantified endpoint measures. However, to meet the growing sophistication of the learning and memory field and to test the generality of the postulated mechanisms, the toolkit has needed to expand to multiple estimates of memory. It has been especially important to use memory assays that minimize the need for behavioral shaping (a form of learning itself) and the manipulation of other motivational factors, many of which potentially elicit stress and other potential confounds of the molecular basis of memory (Lesburguères et al., 2016).
Unlike behavioral paradigms that rely on conditioned responses, novelty-preference tasks exploit the rodent’s spontaneous exploratory behavior and its innate tendency to investigate instances of change (novelty) in a familiar environment (Steckler et al., 1998a). The basic reasoning is that memory for the familiar condition is estimated by the extent to which behavior differs in response to novelty. Accordingly, the fundamental principle of a novelty-preference memory paradigm is to experimentally create a ‘non-matching’ condition between the learning (or encoding) phase and the memory test, such that the animal will express its memory of the original learning experience by preferentially exploring the novel stimuli over the familiar ones.
Novelty-preference tasks are easy-to-use and offer a great versatility for investigating cognitive functions such as spatial memory in rodents (Kinnavane et al., 2015). The following protocol is inspired by previous studies that have used different spatial versions of the novelty-preference paradigm, specifically the object-in-place, object-in-context and object-location task variants (Mumby et al., 2002; Langston and Wood, 2010; Barker and Warburton, 2011). Typically, these task protocols consist of a short learning phase followed by a memory retention test, during which the original spatial configuration of the environment is modified in a specific way. In prior studies however, the different task variants have been presented separately, requiring independent groups of animals to be tested. In addition, the tests are often at short delays (minutes to hours) rather than days, as required to specifically evaluate mechanisms of long-term memory persistence. In the present experimental design each memory retention test is performed to evaluate memory lasting at least 24 h in the same animal and corresponds to a specific spatial manipulation of the original learning experience. Additionally, by varying the number of objects that are presented during the learning phase (i.e., 4 objects versus 2 objects), the following protocol allows direct manipulation of the amount of information to be remembered, not only the type of information.
Here we present the behavioral protocol that was recently used to assess the molecular mechanisms of 24-h long-term memory persistence using wild-type and PKMζ knockout mice (Tsokas et al., 2016). The protocol was sensitive enough to reveal that the molecular mechanisms that are crucial for object-in-place associations amongst four objects require the persistent kinase PKMζ, whereas non-PKMζ dependent mechanisms are sufficient for the maintenance of object-in-context associations and object-location associations involving two objects. A similar dissociation between the neural mechanisms that support object-in-place and object-in-context associations is also observed at the level of the dorsal hippocampus. In particular, permanent or temporary lesion of dorsal hippocampus is sufficient to impair acquisition of object-in-place associations but not object-in-context associations (Langston and Wood, 2010; reviewed by Langston et al., 2010), with a potentially greater role of the dentate gyrus-CA3 subcircuit (Lee et al., 2005). Object-in-context associations seem to critically depend on postrhinal cortex function (Norman and Eacott, 2005) whereas object-location associations tend to be sensitive to hippocampus manipulations (Hardt et al., 2010; Barker and Warburton, 2011). Although these dissociations suggest sharp dependencies of the cognitive function each test evaluates on distinct brain regions, the boundaries of these structure-function associations may not be definitive, because the consequences of the lesions depend on task parameters, including whether contextual cues are local or distal and whether the role of a structure is being evaluated by tests of memory acquisition and consolidation or tests of memory retention (reviewed by Langston et al., 2010). Indeed, recognition memory, a subset of which is assessed by the object context-place-location paradigm that we here describe, appears to be mediated by two extended networks of structures one including the hippocampus that is specialized for spatial recognition memory and the other including postrhinal cortex that is specialized for non-spatial/item recognition memory (reviewed by Steckler et al., 1998b).
Materials and Reagents
3 open boxes (31 x 31 x 19 cm, L x W x H). They are large, solid-bottom, polysulfone cages purchased from Thoren Caging Systems (Hazelton, PA)
3 different sets of laminate sheets displaying patterns of black shapes on white background (see Figure 1).
10 non-identical objects
Note: We used a combination of plastic toys (PetCo®, USA), flasks and jars that differ in shape and/or materials that are difficult to chew, such as strong natural rubber, Pyrex®, polypropylene, and aluminum. These are the objects that the mice will explore. Each object was unique but had approximately equal size, and they were tall enough to prevent the mice from climbing on the objects. The footprint dimension was approximately 6 cm and the height was 17 cm. The objects must be removable and should be easily washed (see Figure 1)
Wild-type male adult (4-month old) mice (C57BL6/J, THE JACKSON LABORATORY)
Notes:
In the original publication of this protocol, we have also used adult mutant male mice from the PKMζ knockout mouse line, (PKMζ-null, originally described in Lee et al., 2013) which were bred from breeders provided by Robert O. Messing (University of Texas, Austin, TX).
Mice were housed individually, in an environment with controlled temperature (23 °C) and humidity, under a 12-12 h light-dark cycle with ad libitum access to food and water. All behavioral procedures were conducted during the 7 AM-7 PM light phase of the cycle. While it was not tested, training and testing with a reverse light cycle should have no impact on the behavioral outcomes, as long as the housing and training conditions are consistent. Mice were housed individually in dual cages (2 individual compartments per cage; 1 Wild Type and 1 Knockout per cage). The mutant animals were bred in our facility, and the genotype is known when the animals are weaned. Other mice in the study were housed individually because they were implanted with intracerebral injection cannulae or microelectrode arrays that can be damaged by another mouse. Consequently, we opted for individual housing to ensure similar housing conditions between all animals. Alternative housing, such as in pairs, might be preferable when practical.
Water and 70% EtOH
Equipment
Apparatus
The experiments are conducted in the 3 open plastic boxes, customized with different patterns in order to make 3 distinct contexts (A, B and C). For each context, 3 of the 4 inside walls are covered by laminate paper sheets displaying a specific pattern with a strong contrast so that the contexts can be easy to discriminate for the mice. We created walls with a repeating pattern of a black shape on white background (either stripes or dots, see Figure 1) for two of the contexts, and used an all white laminate for the third context. The fourth wall is always left transparent and in the south position, to provide an orientation cue in each context. Each box is placed at the center of the experimental room on an elevated support.
Figure 1. Example of the three different training contexts A, B and C with their specific set of objects. Upper panel: three of four walls are covered with a specific visual pattern. The fourth wall at the south is always left clear. Lower panel: the objects are non-identical and each context contains a unique set of objects. Note that the bright lighting as captured in these pictures is only for illustration, lighting should be dim, to be optimally comfortable for the mice and allow them to see and discriminate the objects. A 10-15 lux light intensity is recommended.
Objects
The objects (4 objects/context for A and B, 2 objects for context C) are fixed on the floor with removable adhesive putty such that their edges are 5 cm away from the walls. The precise position of each object is always the same (see Notes for additional comments). To ensure that the objects are repositioned in the same configuration after cleaning between trials, we recommend marking the position on the bottom of both the objects and the box.
Overhead camera (Firefly USB 2.0 camera, FLIR Integrated Imaging Solutions, catalog number: FMVU-03MTM-CS ), equipped with ½” 4-12 mm CCTV Lens (TAMRON, catalog number: 12VM412ASIR ) and software (Tracker, Bio-Signal Group, Acton, MA) for digital video tracking of the mouse’s position and recording the overall behavior on video
Tracking system
We used a PC-controlled video tracking system (Tracker, Bio-Signal Group, Acton, MA) to accurately detect the position of the animal in each context during the behavioral sessions and to record its exploratory behavior for offline analysis. The position of the mouse was taken to be the centroid of its image in each 1/30 sec video frame.
Procedure
One week prior to the behavioral experiments, each day, all animals are familiarized to the transportation procedure from the housing location to the experimental room. The animals are also handled in the experimental room by the experimenter to habituate them to the procedure.
Each day, mice are placed in the experimental room 30 min before the beginning of the behavioral experiments for acclimation.
The duration of the entire behavioral procedure is about 9 consecutive days. As depicted below in Figure 2, each mouse is trained and tested in the object-context-place tasks first, followed by the object-location task. Each task procedure consists of three phases: pre-training, training and retention test.
Figure 2. Experimental design of the object context-place-location paradigm
Day 1: Pretraining in contexts A and B
Animals are habituated to contexts A and B. They explore each box for 10 min with no objects present. Each pretraining session is separated by a 1-h inter-trial interval. The pretraining session starts immediately after the animal has been placed, by hand, at the center of the box, its nose facing the south wall.
Between each pretraining session, the boxes and objects are cleaned with water followed by 70% EtOH, which is allowed to dry. This is done to prevent build up of olfactory cues.
At the end of the 10 min of exploration the animal is removed from the context and returned to its home cage.
Note: The order of context exposures is counterbalanced between animals within each experimental group, which was genotype in the case of Tsokas et al. (2016).
From Day 2 to Day 4: Training in contexts A and B
The mice are allowed to explore contexts A and B, each during two 5-min trials/day, separated by a 1-h inter-trial interval. These trials allow the mice to learn the spatial arrangement of the four objects that are associated with each context.
Note: The order of each context exploration is counterbalanced between training days and between animals within each experimental group (Table 1).
Table 1. Example of counterbalancing the order of context exploration (i.e., Contexts A vs. B) between training days and the order within each experimental group (i.e., Wild Type vs. PKMζ-null in the original study)
Day 5: Retention test #1
Mice are given a first memory retention test that is either an object/context or an object/place mismatch test. In the object/context mismatch test, two of the four objects that had only been encountered in one context are placed in the second context, whereas in the object/place mismatch test two objects from one four-object configuration are place-permuted in the same context they had previously been encountered. The animal is allowed to explore for 3 min. The 3-min duration of the retention test session has been carefully validated. After 3 min the mice become familiar with the novel object configuration and so spatial novelty triggered by the object permutation is no longer detected by the animal. The mice will subsequently explore all the objects equally, whether or not there is a mismatch.
Day 5: Re-exposure
The same day, an hour after the memory retention test, the mice receive an additional training session (5-min exploration twice in each context A and B) in order to minimize the potential effects of learning the mismatch object-space associations that might have been induced by the retention test.
Day 6: Retention test #2
Mice are given a second 3-min memory retention test, either an object/context or an object/place mismatch test, whichever test was not administered on Day 5.
Note: The order of the retention tests on Days 5 and 6, the objects and the places that are permuted, are counterbalanced between animals within each experimental group (Figure 3).
Figure 3. Counterbalancing Object and/or Place permutations and Retention Test order. A. Examples of spatial-object counterbalancing by making object pair permutations in the Object/Place and Object/Context mismatch tests. Because each subject can have an idiosyncratic preference or dislike for a particular object and/or context, it is important to counterbalance the object-context presentations amongst the subjects within each group during memory tests. There are a very large number of permutations possible. Consider randomizing the objects within a context by exchanging pairs of objects along the horizontal, vertical and two diagonals to generate six unique patterns of permutations and exchanging half of the objects from each context, which will generate 12 object-context arrangements. The six examples of objects permutations represented above from the initial training configuration (the training configuration is displayed as a-b-c-d) in Context A are b-a-c-d (horizontal), a-d-c-b (vertical), a-c-b-d (diagonal); they illustrate counterbalancing of the spatial manipulations for the Object/Place mismatch test. Configurations e-f-c-d (horizontal), a-f-c-h (vertical), a-f-g-d (diagonal) illustrate examples of counterbalancing spatial manipulations for the Object/Context mismatch test. B. Example of counterbalancing the order of the retention tests on Days 5 and 6 (i.e., Object/Place vs. Object/Context mismatch tests) and the type of object permutations between animals within each experimental group (e.g., Wild Type vs. PKMζ-null).
Day 7: Pretraining in context C
Mice are habituated to explore a new context, context C, for 10 min.
Day 8: Training in context C
Mice are allowed to explore context C for three sessions of five minutes separated by 1-h inter-trial interval, to learn the spatial configuration of two new objects in a novel environment.
Day 9: Retention test #3
Mice are given a 3-min retention trial consisting of an object/location mismatch test, in which the location of one object is changed.
Note: The relocated object and its relative relocation in the context are also counterbalanced between animals within each experimental group.
Behavioral measures of memory performance
Each video is analyzed offline to manually score the time the mouse is engaged in exploration of an object for each of the retention tests. Object exploration is defined as the nose of the animal being oriented toward the object at a distance of < 2 cm. Each video is therefore replayed in the Tracker software using a 2 cm wide annular mask around each object to define the object exploratory area. Within this area, animal’s activity such as sniffing or touching the object with paws is counted as object exploratory activity only if the animal’s nose is orientated toward the object (see Notes). Measuring object exploration is performed by an experimenter who is blind to the animal’s experimental group and whether the objects have been changed. Memory performance in the three different memory tests are quantified and analyzed using a discrimination index calculated as the absolute difference in time spent exploring the changed (i.e., incorrect, misplaced or relocated) objects and the unchanged objects divided by the total time spent exploring all the objects. As such, the index takes into account individual differences in the total amount of exploration. Good memory retention corresponds to a positive discrimination index, which reflects that the animal was spending more time exploring the incorrect (object/context mismatch), displaced (object/place mismatch) or relocated (object/location mismatch) objects than the objects that had remained unchanged (Figure 4).
Figure 4. Representative data of behavioral performance. Data can be represented as separate dot plots for each test, depicting the distribution of individual memory performance within each group (e.g., Wild type vs. PKMζ-null). Black bars: Mean ± SEM. The graph is adapted from the data in Tsokas et al., 2016.
Data analysis
Memory performance is analyzed using a one-way ANOVA with repeated measures. The individual effects of the Independent Factor (Group) and the Within-Subjects Factor (Retention test), as well as the Interaction and post-hoc tests are considered significant at an alpha level of 0.05.
Notes
To make each to-be-explored object unique and identifiable, we recommend using a variety of shapes and type of materials. The choice of the set of objects should be validated prior to the experiment by testing each configuration set with mice in a pilot study to avoid obviously biased preference to investigate one object over the others.
Animals should not be able to climb the objects, because it would affect the measurement accuracy of the exploratory activity.
The lighting of the objects should be homogenous to avoid creating shadows at the corners of the experimental box. Dark corners are typically preferred by mice and the object-biased presence of preferred places could therefore induce a place preference that could interfere with the overall exploratory activity of the animals.
A quiet, dimly lit (10-15 lux) experimental room is the preferred environment for spontaneous exploratory behavior in mice.
At the end of each day of the behavioral experiment, animals are all left undisturbed for one hour before they are transported back to the animal housing facility.
All behavioral sessions are recorded using the video-tracking system. Whereas the object exploratory activity is a behavioral measure that could only be assessed with the objects present in a given context (during training and memory retention tests), general locomotor activity measures and animal tracking are performed during the pretraining session on Day 1 to assess group differences in locomotion and general exploratory activity, differences of which can bias assessment of novelty preference on the retention tests.
Acknowledgments
This behavioral protocol was originally used in Tsokas et al., 2016. This work was supported by NIH grants R21NS091830 and R01MH099128 (AAF) and R37MH057068, R01MH53576, R01DA034970, and the Lightfighter Trust (TCS).
References
Barker, G. R. I. and Warburton, E. C. (2011). When is the hippocampus involved in recognition memory? J Neurosci 31(29): 10721-10731.
Hardt, O., Migues, P. V., Hastings, M., Wong, J. and Nader, K. (2010). PKMζ maintains 1‐day‐and 6‐day‐old long‐term object location but not object identity memory in dorsal hippocampus. Hippocampus 20(6): 691-695.
Kinnavane, L., Albasser, M. M. and Aggleton, J. P. (2015). Advances in the behavioural testing and network imaging of rodent recognition memory. Behav Brain Res 285: 67-78.
Langston, R. F., Stevenson, C. H., Wilson, C. L., Saunders, I. and Wood, E. R. (2010). The role of hippocampal subregions in memory for stimulus associations. Behav Brain Res 215:275-291.
Langston, R. F. and Wood, E. R. (2010). Associative recognition and the hippocampus: differential effects of hippocampal lesions on object-place, object-context and object-place-context memory. Hippocampus 20(10): 1139-1153.
Lee, A. M., Kanter, B. R., Wang, D., Lim, J. P., Zou, M. E., Qiu, C., McMahon, T., Dadgar, J., Fischbach-Weiss, S. C. and Messing, R. O. (2013). Prkcz null mice show normal learning and memory. Nature 493(7432): 416-419.
Lee, I., Hunsaker, M. R. and Kesner, R. P. (2005). The role of hippocampal subregions in detecting spatial novelty. Behav Neurosci 119:145-153.
Lesburguères, E., Sparks, F. T., O’Reilly, K. C. and Fenton, A. A. (2016). Active place avoidance is no more stressful than unreinforced exploration of a familiar environment. Hippocampus 26(12): 1481-1485.
Mumby, D. G., Gaskin, S., Glenn, M. J., Schramek, T. E. and Lehmann, H. (2002). Hippocampal damage and exploratory preferences in rats: memory for objects, places, and contexts. Learn Mem 9(2): 49-57.
Norman, G. and Eacott, M. J. (2005). Dissociable effects of lesions to the perirhinal cortex and the postrhinal cortex on memory for context and objects in rats. Behav Neurosci 119:557-566.
Steckler, T., Drinkenburg, W. H., Sahgal, A. and Aggleton, J. P. (1998a). Recognition memory in rats--I. Concepts and classification. Prog Neurobiol 54(3): 289-311.
Steckler T, Drinkenburg, W. H., Sahgal, A. and Aggleton, J. P. (1998b). Recognition memory in rats--II. Neuroanatomical substrates. Prog Neurobiol 54:313-332.
Tsokas, P., Hsieh, C., Yao, Y., Lesburgueres, E., Wallace, E. J., Tcherepanov, A., Jothianandan, D., Hartley, B. R., Pan, L., Rivard, B., Farese, R. V., Sajan, M. P., Bergold, P. J., Hernandez, A. I., Cottrell, J. E., Shouval, H. Z., Fenton, A. A. and Sacktor, T. C. (2016). Compensation for PKMζ in long-term potentiation and spatial long-term memory in mutant mice. Elife 5: e14846.
Copyright: Lesburguères et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lesburguères, E., Tsokas, P., Sacktor, T. C. and Fenton, A. A. (2017). The Object Context-place-location Paradigm for Testing Spatial Memory in Mice. Bio-protocol 7(8): e2231. DOI: 10.21769/BioProtoc.2231.
Tsokas, P., Hsieh, C., Yao, Y., Lesburgueres, E., Wallace, E. J., Tcherepanov, A., Jothianandan, D., Hartley, B. R., Pan, L., Rivard, B., Farese, R. V., Sajan, M. P., Bergold, P. J., Hernandez, A. I., Cottrell, J. E., Shouval, H. Z., Fenton, A. A. and Sacktor, T. C. (2016). Compensation for PKMζ in long-term potentiation and spatial long-term memory in mutant mice. Elife 5: e14846.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,232 | https://bio-protocol.org/exchange/protocoldetail?id=2232&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNase Sensitivity Screening for Nuclear Bodies with RNA Scaffolds in Mammalian Cells
TM Taro Mannen
TH Tetsuro Hirose
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2232 Views: 9487
Edited by: Gal Haimovich
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
The mammalian cell nucleus is highly organized and contains membraneless nuclear bodies (NBs) characterized by distinct resident factors. The NBs are thought to serve as sites for biogenesis and storage of certain RNA and protein factors as well as assembly of ribonucleoprotein complexes. Some NBs are formed with architectural RNAs (arcRNAs) as their structural scaffolds and additional NBs likely remain unidentified in mammalian cells. Here, we describe an experimental protocol to search for new NBs built on certain arcRNAs. RNase-sensitive NBs were identified by monitoring nuclear foci visualized by tagging thousands of human cDNA products.
Keywords: Nuclear bodies Architectural RNA RNase Human full-length cDNA library Venus tag Subcellular localization
Background
The mammalian cell nucleus is highly organized and composed of multiple distinct substructures called nuclear bodies (NBs). So far ~15 NBs have been identified as subnuclear membraneless granular structures containing various proteins and RNA factors, many of which function as sites of biogenesis, maturation, storage, and sequestration of specific RNAs, proteins, and/or ribonucleoprotein (RNP) complexes (Mao et al., 2011; Sleeman and Trinkle-Mulcahy, 2014) (Table 1).
Table 1. Nuclear bodies in mammalian cells
Some NBs are constructed on specific long noncoding RNAs (lncRNAs) called architectural RNAs (arcRNAs), which are defined as structural core of NBs (Chujo et al., 2016). The arcRNA-dependent NBs are composed of numerous RNA-binding proteins that interact with the arcRNAs. The most remarkable example is the paraspeckle, which is composed of several characteristic RNA-binding proteins (Fox et al., 2002; Prasanth et al., 2005). RNase treatment disintegrates the paraspeckle structure (Fox et al., 2005). Nuclear paraspeckle assembly transcript 1 (NEAT1), a lncRNA, localizes exclusively to paraspeckles and acts as an arcRNA of these massive RNP complexes (Chen and Carmichael, 2009; Clemson et al., 2009; Sasaki et al., 2009; Sunwoo et al., 2009).
Presently, two lncRNAs are classified as arcRNAs in addition to NEAT1, namely, intergenic spacer lncRNAs for nucleolar detention center (Audas et al., 2012) and human satellite III lncRNA for nuclear stress body (Biamonti and Vourc’h, 2010) (Table 1). It is expected that additional arcRNAs remain to be characterized in mammalian cells. Here, we describe a novel method called ‘RNase sensitivity screening’ to identify novel arcRNA-dependent NBs by screening for nuclear foci whose structures are disintegrated by RNase treatment. This method employed a Venus-tagged human full-length (FLJ) cDNA library (32,651 clones), which was originally constructed during the NEDO full-length human cDNA sequencing project in Japan (FLJ-PJ), and obtained 571 cDNA clones whose products (463 proteins) localize in certain nuclear foci (Hirose and Goshima, 2015; Naganuma et al., 2012). We explored whether the respective nuclear focus was abolished or diffused upon RNase treatment after cell permeabilization to select candidate RNase-sensitive nuclear foci that potentially contain arcRNAs (Figure 1). We identified 32 Venus-tagged proteins that required RNA for their localization in distinct nuclear foci (Mannen et al., 2016). Immunostaining of the corresponding endogenous proteins confirmed that the Sam68 nuclear body (SNB) was an RNase-sensitive NB. In the following protocol, we describe the detailed procedure of the RNase sensitivity screening. This protocol is for screening for RNase-sensitive NBs under normal conditions in HeLa cells, but it should be applicable to other cell lines under various conditions.
Figure 1. Outline of RNase sensitivity screening of NBs. Venus-tagged human FLJ cDNA clones were transfected into HeLa cells. cDNA clones whose products localized to certain nuclear foci were selected (571 clones). Subsequently, the RNase sensitivity of the nuclear foci labeled by Venus was investigated (32 clones). To this end, the cells were permeabilized with 2% Tween 20, followed by treatment with an RNase mixture. Bar = 10 μm.
Materials and Reagents
Note: Prepare all solutions using ultrapure water (prepared by purifying deionized water to attain a sensitivity of 18.2 MΩ cm at 25 °C) and analytical grade reagents.
Preparation of collagen IV-coated plate
Pipette tips (Labcon, catalog number: 1030-260-000 )
96-well glass bottom microplate (IWAKI, catalog number: 12-017-006 )
Sodium hydroxide (NaOH) (Wako Pure Chemical Industries, catalog number: 190-14565 )
Phosphate Buffered Salts (PBS) (Takara Bio, catalog number: T900 )
Hydrochloric acid (HCl) (Wako Pure Chemical Industries, catalog number: 080-01066 )
Type IV collagen solution (Life Laboratory Company, catalog number: LL-10043 )
Collagen solution (see Note 1; see Recipes)
Cell culture
HeLa (Human cervical cancer) cells (see Note 2)
10 cm dish
MEM medium (Thermo Fisher Scientific, GibcoTM, catalog number: 11095080 ) (see Note 3)
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 26140079 )
Trypsin-EDTA (Nacalai Tesque, catalog number: 32778-34 )
Administration of plasmids with transfection reagent
96-well U-bottom plate (Corning, Falcon®, catalog number: 351177 )
Venus-tagged human FLJ cDNA clone plasmids expressing proteins localized to certain nuclear foci (see Note 4)
TransIT-LT1 reagent (Mirus Bio, catalog number: MIR2300 )
Opti-MEM I reduced serum medium (Thermo Fisher Scientific, GibcoTM, catalog number: 31985070 )
RNase treatment
96-well plate sealing film (Thermo Fisher Scientific, InvitrogenTM, catalog number: 12261012 )
0.45 μm filter
RiboShredder RNase Blend (Epicentre, catalog number: RS12500 )
Polyoxyethylene sorbitan monolaurate (Tween 20) (Nacalai Tesque, catalog number: 28353-85 )
2-Amino-2-hydroxymethyl-1,3-propanediol (Tris) (Wako Pure Chemical Industries, catalog number: 011-20095 )
Magnesium chloride (MgCl2) (Nacalai Tesque, catalog number: 20909-55 )
Ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) (Nacalai Tesque, catalog number: 08907-42 )
cOmplete, EDTA-free protease inhibitor cocktail (Roche Diagnostics, catalog number: 11873580001 )
Paraformaldehyde (PFA) (EMD Millipore, catalog number: 1.04005.1000 )
DAPI (Sigma-Aldrich, catalog number: D9542 )
Pyronin Y (Sigma-Aldrich, catalog number: P9172 )
1 M Tris-HCl, pH 7.4 (see Recipes)
Permeabilization buffer (see Recipes)
4% PFA (see Note 5; see Recipes)
DAPI solution (see Recipes)
Pyronin Y solution (see Recipes)
Equipment
Multichannel pipette L8 x 200 (Gilson, catalog number: FA10011 )
Water bath (Fine, catalog number: FWB-21B )
Centrifuge (KUBOTA, catalog number: 040-000 )
Hemocytometer (SANSYO, SLGC, catalog number: A103 )
Reservoir (BM Equipment, catalog number: BM-0850-2 )
Carbon dioxide (CO2) incubator (SANYO, catalog number: MCO-18AIC UV )
IN Cell Analyzer 1000 (GE Healthcare, model: IN Cell Analyzer 1000 ) equipped with a Plan Fluor ELWD 40x/0.6 objective lens (Nikon Instruments, model: CFI Plan Fluor 40x ). Excitation filters for DAPI (D360/40x) and Venus (S475/20x) and emission filters for DAPI (HQ460/40M) and Venus (HD535/50M) were used. Acquisition and processing of the images were done using IN Cell Analyzer 1000 Software (GE Healthcare, version 3.0)
Software
IN Cell Analyzer 1000 Software (GE Healthcare, version 3.0)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Mannen, T. and Hirose, T. (2017). RNase Sensitivity Screening for Nuclear Bodies with RNA Scaffolds in Mammalian Cells. Bio-protocol 7(8): e2232. DOI: 10.21769/BioProtoc.2232.
Mannen, T., Yamashita, S., Tomita, K., Goshima, N. and Hirose, T. (2016). The Sam68 nuclear body is composed of two RNase-sensitive substructures joined by the adaptor HNRNPL. J Cell Biol 214(1): 45-59.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fixed-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,233 | https://bio-protocol.org/exchange/protocoldetail?id=2233&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Melanoma Stem Cell Sphere Formation Assay
Alessandra Tuccitto
VB Valeria Beretta
FR Francesca Rini
CC Chiara Castelli
MP Michela Perego
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2233 Views: 13737
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
Self-renewal is the ability of cells to replicate themselves at every cell cycle. Throughout self-renewal in normal tissue homeostasis, stem cell number is maintained constant throughout life. Cancer stem cells (CSCs) share this ability with normal tissue stem cells and the sphere formation assay (SFA) is the gold standard assay to assess stem cells (or cancer stem cells) self-renewal potential in vitro. When single cells are plated at low density in stem cell culture medium, only the cells endowed with self-renewal are able to grow in tridimensional clusters usually named spheres. In the recent years, SFA has also been used also to test the effect of several drugs, chemical and natural compounds or microenviromental components on stem cells self-renewal capacity. Here we will illustrate a detailed protocol to assess self-renewal of human melanoma stem cells, growing as melanospheres.
Keywords: Melanoma Cancer stem cells Melanospheres Self-renewal Stem cell medium
Background
Cancer stem cells (CSCs) were first found in acute myeloma leukemia (Lapidot et al., 1994) and then were identified in many solid tumors including melanoma. CSCs are defined as cells strongly endowed with self-renewal and tumor initiating capacity, being able to regenerate the whole tumor heterogeneity in vivo. CSCs can be isolated from the tumor mass with different approaches based on phenotypic characteristic or biological properties, then their properties have to be tested in vitro (self-renewal) and in vivo (tumorigenic potential). Melanoma CSCs were isolated using a combination of cell surface markers, (Fang et al., 2005; Monzani et al., 2007; Schatton et al., 2008; Boiko et al., 2010; Boonyaratanakornkit et al., 2010) or through culture in specific stem cell media (Perego et al., 2010; Santini et al., 2012). To validate melanoma CSC self-renewal, and to study the effect of tumor microenvironmental factors on it (Tuccitto et al., 2016), we used the sphere formation assay (SFA) in vitro. Melanoma CSCs are plated at low density in stem cell culture medium and they grow in anchorage-independent, three-dimensional spherical structures, called melanospheres (tumorspheres, in general). Spheres forming efficiency is directly proportional to the number of melanoma CSCs present in the culture (one CSC corresponds to one melanosphere), thus giving a direct quantification of CSC amount in culture. This relatively simple method is useful to study the ability of any exogenous factors (growth factors, cytokines and chemokines, drugs) in perturbing CSC self-renewal (Tsuyada et al., 2012; Tuccitto et al., 2016). Here we provide detailed information about the SFA protocol we optimized in our laboratory for melanoma SFA.
Materials and Reagents
Cell culture flask, area 150 cm2 (Corning, catalog number: 430823 )
15 ml Falcon tube (Greiner Bio One International, catalog number: 188261 )
Micropipette P200 tips (Corning, catalog number: 4823 )
24-wells plates flat bottom (Corning, Costar®, catalog number: 3527 )
70 μm cell strainer (Corning, Falcon®, catalog number: 352350 )
15 ml polystyrene serological pipets (Corning, Falcon®, catalog number: 357551 )
Melanospheres are obtained as described by Perego et al., starting from cell suspension obtained from melanoma surgical specimens or from previously established melanoma cell lines after culturing in stem cell medium (SCM) (Perego et al., 2010)
RPMI
10% FBS
Trypan blue solution, 0.4% (Sigma-Aldrich, catalog number: T8154 )
SCM (see Recipes)
DMEM:F-12, 1:1 mixture’ (Lonza, catalog number: BE12-719F )
Epidermal growth factor (EGF) (PeproTech, catalog number: AF-100-15 )
Basic fibroblast growth factor (bFGF) (PeproTech, catalog number: 100-18B )
D-glucose (Sigma-Aldrich, catalog number: G7021 )
Insulin (Sigma-Aldrich, catalog number: I6634 )
Putrescine dihydrochloride (Sigma-Aldrich, catalog number: P5780 )
Sodium selenite (Sigma-Aldrich, catalog number: S9133 )
Progesterone (Sigma-Aldrich, catalog number: P6149 )
Transferrin (Sigma-Aldrich, catalog number: T8158 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S8761 )
1x phosphate buffered saline (PBS) (Lonza, catalog number: 17-516 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A1933 )
HEPES buffer (Lonza, catalog number: BE17-737 )
L-glutamine (Lonza, catalog number: BE17-605E )
Penicillin-streptomycin (Lonza, catalog number: 17-602E )
Equipment
Automatic pipettor (PBI, catalog number: 857075 )
Tissue culture incubator with CO2 input (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Series II 3110 )
Centrifuge (Eppendorf, catalog number: 5810 )
Hemocytometer (Marienfeld-Superior, Bürker, catalog number: 0640211 )
Optical microscope (Carl Zeiss, model: Axiovert 25 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tuccitto, A., Beretta, V., Rini, F., Castelli, C. and Perego, M. (2017). Melanoma Stem Cell Sphere Formation Assay. Bio-protocol 7(8): e2233. DOI: 10.21769/BioProtoc.2233.
Download Citation in RIS Format
Category
Cancer Biology > Cancer stem cell > Cell biology assays
Stem Cell > Adult stem cell > Cancer stem cell
Cell Biology > Cell-based analysis > Non-adherent culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,234 | https://bio-protocol.org/exchange/protocoldetail?id=2234&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression, Purification and Crystallisation of the Adenosine A2A Receptor Bound to an Engineered Mini G Protein
Byron Carpenter
Christopher G. Tate
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2234 Views: 10530
Edited by: Arsalan Daudi
Reviewed by: Adam IdoineYoko Eguchi
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
G protein-coupled receptors (GPCRs) promote cytoplasmic signalling by activating heterotrimeric G proteins in response to extracellular stimuli such as light, hormones and nucleosides. Structure determination of GPCR–G protein complexes is central to understanding the precise mechanism of signal transduction. However, these complexes are challenging targets for structural studies due to their conformationally dynamic and inherently transient nature. We recently developed an engineered G protein, mini-Gs, which addressed these problems and allowed the formation of a stable GPCR–G protein complex. Mini-Gs facilitated the structure determination of the human adenosine A2A receptor (A2AR) in its G protein-bound conformation at 3.4 Å resolution. Here, we describe a step by step protocol for the expression and purification of A2AR, and crystallisation of the A2AR–mini-Gs complex.
Keywords: Adenosine A2A receptor A2AR Active state GPCR G protein-coupled receptor Mini G protein Mini-Gs G protein complex
Background
We recently developed an engineered minimal G protein, mini-Gs (Carpenter and Tate, 2016), which facilitated the structure determination of the human adenosine A2A receptor (A2AR) in its active state (Carpenter et al., 2016). Mini-Gs stabilises the active conformation of A2AR sufficiently to allow crystallization of the complex by vapour diffusion in the detergent octylthioglucoside. Here, we describe a detailed protocol for the expression and purification of A2AR, which is adapted from a previously described method developed in our laboratory (Lebon et al., 2011a and 2011b; Tate and Lebon, 2015). We also describe a step by step procedure for the preparation and crystallisation of the A2AR–mini-Gs complex, earlier described in Carpenter et al. (2016). Expression and purification of mini-Gs is described in a companion manuscript (Carpenter and Tate, 2017).
Materials and Reagents
Serological pipette
Pipette tips (STARLAB INTERNATION)
Plastic spatula
50 ml tubes (SARSTEDT, catalog number: 62.547.254 )
15 ml tubes (SARSTEDT, catalog number: 62.554.002 )
5 ml tubes (Eppendorf, catalog number: 0030119401 )
1.5 ml tubes (SARSTEDT, catalog number: 72.690.001 )
0.5 ml tubes (SARSTEDT, catalog number: 72.699 )
Steritop 0.22 μm filter unit (EMD Millipore, catalog number: SCGPT01RE )
Amicon Ultra-15 concentrator 50 kDa cut-off (EMD Millipore, catalog number: UFC905024 )
Plastic column (e.g., empty PD-10 column) (GE Healthcare, catalog number: 17043501 )
PD-10 desalting column (GE Healthcare, catalog number: 17085101 )
Amicon Ultra-4 concentrator 50 kDa cut-off (EMD Millipore, catalog number: UFC805024 )
MRC 96-well 2-drop crystallization plates (Molecular Dimensions, catalog number: MD11-00-100 )
Ni2+-NTA Superflow 5 ml prepacked column (QIAGEN, catalog number: 30760 )
Superdex 200 GL 10/300 gel filtration column (GE Healthcare, catalog number: 17517501 )
Trichoplusia ni (T. ni) insect cell line (Expression Systems, catalog number: 94-002F )
pBacPAK8 plasmid (Takara Bio, Clontech, catalog number: PT1262-5 )
flashBAC ULTRA DNA (Oxford Expression Technologies, catalog number: 100300 )
ESF921 insect cell media (Expression Systems, catalog number: 96-001-01 )
Fetal bovine serum (Sigma-Aldrich, catalog number: F9665 )
cOmplete, EDTA-free protease inhibitor tablets (Roche Diagnostics, catalog number: 11873580001 )
PMSF (Sigma-Aldrich, catalog number: P7626 )
Liquid nitrogen
NECA (Sigma-Aldrich, catalog number: E2387 )
Imidazole (Sigma-Aldrich, catalog number: 56748 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: 10598630 )
n-Decyl β-maltoside (DM) detergent (Anatrace, catalog number: D322 )
TEV protease (produced in-house)
Ni2+-NTA agarose (QIAGEN, catalog number: 30210 )
Magnesium chloride (MgCl2) (Fisher Scientific, catalog number: BP214-500 )
Apyrase (Sigma-Aldrich, catalog number: A6535 )
Sodium acetate (Fisher Scientific, catalog number: 10794761 )
MemGoldTM crystallisation screen (Molecular Dimensions, catalog number: MD1-39 )
PEG 2000 (Sigma-Aldrich, catalog number: 81221 )
Note: This product has been discontinued.
PEG 2000 MME (Sigma-Aldrich, catalog number: 81321 )
Note: This product has been discontinued.
PEG 400 (Hampton Research, catalog number: HR2-603 )
Glycerol (VWR, catalog number: 24388.320 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
EDTA
Absolute ethanol (VWR, catalog number: 20821.330 )
DMSO (Sigma-Aldrich, catalog number: D2650 )
n-Octyl-β-D-thioglucoside (OTG) detergent (Glycon, catalog number: D20014 )
Precision Plus SDS-PAGE molecular weight standards (Bio-Rad Laboratories, catalog number: 161-0373 )
4-20% Tris-glycine SDS-PAGE gels (Fisher Scientific, catalog number: EC60255BOX )
Buffer A (see Recipes)
PMSF stock solution (see Recipes)
NECA stock solution (see Recipes)
DM stock solution (see Recipes)
Buffer B (see Recipes)
Buffer C (see Recipes)
Buffer D (see Recipes)
Buffer E (see Recipes)
OTG stock solution (see Recipes)
Apyrase stock solution (see Recipes)
Buffer F (see Recipes)
Equipment
Pipettes (STARLAB INTERNATION)
Optimum GrowthTM 5 L flask (Thompson Instrument Company, catalog number: 931116 )
Shaker incubator (Infors, model: Multitron Standard )
High speed centrifuge (e.g., Beckman Coulter, model: Avanti J-26XP , catalog number: 393124)
Type 45 Ti (Ti45) ultracentrifuge rotor (Beckman Coulter, catalog number: 339160 )
Type 45 Ti (Ti45) ultracentrifuge bottle assembly (Beckman Coulter, catalog number: 355622 )
Water bath (Julabo)
ULTRA-TURRAX T25 homogeniser (IKA, model: ULTRA-TURRAX T25 Homogeniser )
Magnetic stirring bar
Type 70 Ti (Ti70) ultracentrifuge rotor (Beckman Coulter, catalog number: 337922 )
Type 70 Ti (Ti70) ultracentrifuge bottle assembly (Beckman Coulter, catalog number: 355618 )
Peristaltic pump (e.g., GE Healthcare, model: Pump P-1, catalog number: 18-1110-91 )
Refrigerated benchtop centrifuge (e.g., Eppendorf, catalog number: 5430 R )
Roller mixer (IKA, model: ROLLER 6 digital , catalog number: 0004011000)
TLA55 benchtop ultracentrifuge rotor (Beckman Coulter, catalog number: 366725 )
Optima L100 XP preparative ultracentrifuge (Beckman Coulter, model: OptimaTM L-100 XP )
Optima MAX benchtop ultracentrifuge (Beckman Coulter, model: OptimaTM MAX )
Refrigerated microcentrifuge (e.g., Eppendorf, catalog number: 5418 R )
Rotor capable of spinning 1 L bottles (e.g., JLA-8.1000) (Beckman Coulter, catalog number: 363688 )
ÄKTA Purifier chromatography system (GE Healthcare, model: ÄKTA Purifier )
Mosquito® Crystal protein crystallisation robot (TTP Labtech, model: mosquito® Crystal )
Software
UNICORN (GE Healthcare)
Graphical software (e.g., Prism 7) (GraphPad)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Carpenter, B. and Tate, C. G. (2017). Expression, Purification and Crystallisation of the Adenosine A2A Receptor Bound to an Engineered Mini G Protein. Bio-protocol 7(8): e2234. DOI: 10.21769/BioProtoc.2234.
Download Citation in RIS Format
Category
Biochemistry > Protein > Isolation and purification
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,235 | https://bio-protocol.org/exchange/protocoldetail?id=2235&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Purification of Mini G Proteins from Escherichia coli
Byron Carpenter
Christopher G. Tate
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2235 Views: 11875
Edited by: Arsalan Daudi
Reviewed by: Shyam Solanki
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Heterotrimeric G proteins modulate intracellular signalling by transducing information from cell surface G protein-coupled receptors (GPCRs) to cytoplasmic effector proteins. Structural and functional characterisation of GPCR–G protein complexes is important to fully decipher the mechanism of signal transduction. However, native G proteins are unstable and conformationally dynamic when coupled to a receptor. We therefore developed an engineered minimal G protein, mini-Gs, which formed a stable complex with GPCRs, and facilitated the crystallisation and structure determination of the human adenosine A2A receptor (A2AR) in its active conformation. Mini G proteins are potentially useful tools in a variety of applications, including characterising GPCR pharmacology, binding affinity and kinetic experiments, agonist drug discovery, and structure determination of GPCR–G protein complexes. Here, we describe a detailed protocol for the expression and purification of mini-Gs.
Keywords: Complex Engineered G protein G protein-coupled receptor GPCR Mini G protein Mini-Gs
Background
We recently reported the development of an engineered minimal G protein, mini-Gs (Carpenter and Tate, 2016), which facilitated the crystallisation of the human adenosine A2A receptor (A2AR) in its active conformation (Carpenter et al., 2016; Carpenter and Tate, 2017). Unlike heterotrimeric G proteins, which require expression in eukaryotic systems, mini-Gs is highly expressed in Escherichia coli (E. coli) and can be easily purified with a yield of 50-100 mg of mini-Gs per liter of culture. Here, we describe a step by step protocol, earlier described in Carpenter and Tate (2016), that can be used for the expression and purification of any of the mini G protein constructs described previously (Carpenter et al., 2016; Carpenter and Tate, 2016). Since mini-Gs construct 393 is well suited to most applications (see Carpenter and Tate, 2016), it will be used as an example herein.
Materials and Reagents
Steritop 0.22 μm filter unit (EMD Millipore, catalog number: SCGPT01RE )
50 ml tubes (SARSTEDT, catalog number: 62.547.254 )
15 ml tubes (SARSTEDT, catalog number: 62.554.002 )
2 ml tubes (Eppendorf, catalog number: 0030120094 )
1.5 ml tubes (SARSTEDT, catalog number: 72.690.001 )
0.5 ml tubes (SARSTEDT, catalog number: 72.699 )
Pipette tips (STARLAB INTERNATIONAL)
Plastic column (e.g., empty PD-10 column) (GE Healthcare, catalog number: 17043501 )
HisTrap Fast Flow 5 ml prepacked columns (GE Healthcare, catalog number: 17-5255-01 )
Amicon Ultra-15 concentrator 10 kDa cut-off (EMD Millipore, catalog number: UFC901024 )
HiLoad 26/600 Superdex 200 PG gel filtration column (GE Healthcare, catalog number: 28989336 )
SnakeSkin Dialysis Tubing 10 kDa cut-off (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 68100 )
E. coli strain BL21-CodonPlus(DE3)-RIL (Agilent Technologies, catalog number: 230245 )
pET15b plasmid (EMD Millipore, catalog number: 69661 )
Ampicillin (Melford Laboratories, catalog number: A0104 )
Chloramphenicol (MP Biomedicals, catalog number: 0219032125 )
Glucose (Formedium, catalog number: GLU03 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (VWR, catalog number: 25165.260 )
IPTG (Melford Laboratories, catalog number: MB1008 )
Liquid nitrogen
TEV protease (produced in-house)
cOmplete, EDTA-free protease inhibitor tablets (Roche Diagnostics, catalog number: 11873580001 )
Lysozyme (Sigma-Aldrich, catalog number: L6876 )
Imidazole (Sigma-Aldrich, catalog number: 56748 )
Ni2+-NTA agarose (QIAGEN, catalog number: 30210 )
Gel filtration marker kit (Sigma-Aldrich, catalog number: MWGF200 )
TCEP (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 77720 )
Tryptone (Melford Laboratories, catalog number: GT1332 )
Yeast extract (Melford Laboratories, catalog number: GY1333 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: 10598630 )
Agar
Terrific Broth (TB) (Melford Laboratories, catalog number: GT1702 )
Glycerol (VWR, catalog number: 24388.320 )
PMSF (Sigma-Aldrich, catalog number: P7626 )
Absolute ethanol (VWR, catalog number: 20821.330 )
Pepstatin-A (Sigma-Aldrich, catalog number: P4265 )
DMSO (Sigma-Aldrich, catalog number: D2650 )
Leupeptin (Sigma-Aldrich, catalog number: L2884 )
DNase I (Sigma-Aldrich, catalog number: DN25 )
DTT (Melford Laboratories, catalog number: MB1015 )
GDP (Sigma-Aldrich, catalog number: G7127 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Magnesium chloride (MgCl2) (Fisher Scientific, catalog number: BP214-500 )
Precision Plus SDS-PAGE molecular weight standards (Bio-Rad Laboratories, catalog number: 161-0373 )
4-20% Tris-Glycine SDS-PAGE gels (Fisher Scientific, catalog number: EC60255BOX )
TYE agar plates (see Recipes)
Luria Bertani (LB) media (see Recipes)
Terrific Broth (TB) media (see Recipes)
PMSF stock solution (see Recipes)
Pepstatin-A stock solution (see Recipes)
Leupeptin stock solution (see Recipes)
DNase I stock solution (see Recipes)
Lysozyme stock solution (see Recipes)
DTT stock solution (see Recipes)
GDP stock solution (see Recipes)
Buffer A (see Recipes)
Buffer B (see Recipes)
Buffer C (see Recipes)
Buffer D (see Recipes)
Buffer E (see Recipes)
Equipment
2 L Erlenmeyer flasks (e.g., Corning, catalog number: 4980-2L )
High speed centrifuge (e.g., Beckman Coulter, model: Avanti J-26XP , catalog number: 393124)
Magnetic stirring bar
Shaker incubator (Infors, model: Multitron Standard )
Pipettes (STARLAB INTERNATIONAL)
Sonicator equipped with 13 mm probe (e.g., Sonics Vibra-Cell) (Sonics, model: VCX 130 )
Rotor capable of spinning 250 ml bottles (e.g., Beckman Coulter JLA-16.250) (Beckman Coulter, catalog number: 363934 )
Peristaltic pump (e.g., GE Healthcare, model: Pump P-1, catalog number: 18-1110-91 )
NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 )
UV/VIS spectrophotometer
Roller mixer (IKA, model: ROLLER 6 digital , catalog number: 0004011000)
Rotor capable of spinning 1 L bottles (e.g., Beckman Coulter JLA-8.1000) (Beckman Coulter, catalog number: 363688 )
Refrigerated benchtop centrifuge (e.g., Eppendorf, catalog number: 5430 R )
Refrigerated microcentrifuge (e.g., Eppendorf, catalog number: 5418 R )
ÄKTA Purifier chromatography system (GE Healthcare, model: ÄKTA Purifier )
Software
UNICORN (GE Healthcare)
Graphical software (e.g., Prism 7) (GraphPad), or free alternatives (e.g., R Bioconductor packages) (Bioconductor)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Carpenter, B. and Tate, C. G. (2017). Expression and Purification of Mini G Proteins from Escherichia coli. Bio-protocol 7(8): e2235. DOI: 10.21769/BioProtoc.2235.
Download Citation in RIS Format
Category
Biochemistry > Protein > Isolation and purification
Biochemistry > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,236 | https://bio-protocol.org/exchange/protocoldetail?id=2236&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Reversible Cryo-arrests of Living Cells to Pause Molecular Movements for High-resolution Imaging
Jan Huebinger*
MM Martin E. Masip*
JC Jens Christmann*
Frank Wehner
PB Philippe I. H. Bastiaens
*Contributed equally to this work
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2236 Views: 7513
Edited by: Vivien Jane Coulson-Thomas
Reviewed by: Federica Pisano
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Fluorescence live-cell imaging by single molecule localization microscopy (SMLM) or fluorescence lifetime imaging microscopy (FLIM) in principle allows for the spatio-temporal observation of molecular patterns in individual, living cells. However, the dynamics of molecules within cells hamper their precise observation. We present here a detailed protocol for consecutive cycles of reversible cryo-arrest of living cells on a microscope that allows for a precise determination of the evolution of molecular patterns within individual living cells. The usefulness of this approach has been demonstrated by observing ligand-induced clustering of receptor tyrosine kinases as well as their activity patterns by SMLM and FLIM (Masip et al., 2016).
Keywords: Cryo-arrest Fixation Superresolution Single molecule localization FLIM
Background
Understanding molecular processes in cells, e.g., the ligand-induced response of receptor-tyrosine kinases (RTKs), requires the precise spatio-temporal observation of molecular patterns. Due to variance in cellular states, this response needs to be monitored in individual cells rather than in cell populations (Snijder and Pelkmans, 2011). Using SMLM, individual molecules can be localized with high precision (Betzig et al., 2006). This allows, for instance, extracting information about the clustering of RTKs in the plasma membrane. Complementarily, confocal FLIM can unveil how molecules react as an ensemble within a diffraction-limited volume element. This can reveal interaction patterns of RTKs with downstream molecules, phosphorylation patterns as well as activity patterns by the use of conformational sensors (Offterdinger et al., 2004; Sabet et al., 2015). However, the acquisition time in FLIM and SMLM is in the order of minutes. Because many molecular arrangements in living cells–including those of RTKs–evolve on a much faster time scale, confocal FLIM images get blurred and spatial resolution is reduced severely (Masip et al., 2016). In SMLM, molecules are localized successively in consecutive frames. Performing these measurements on dynamic molecules in living cells will lead to a falsified image of localizations since molecules diffuse to different positions in the course of data acquisition. For instance, the epidermal growth factor receptor (EGFR) moves on average with a diffusion constant of 2-5 10-2 μm2/sec in the 2D environment of the membrane (Orr et al., 2005; Xiao et al., 2008). To allow for long acquisition times, irreversible chemical fixation with aldehydes is typically used. Yet, the use of chemical fixation agents is inefficient in immobilizing membranes and can lead to protein extraction or artificial clustering (Saffarian et al., 2007; Tanaka et al., 2010; Schnell et al., 2012). Further, the lethal fixation disrupts the out-of-equilibrium physiological state and prohibits the observation of the evolution of molecular patterns within an individual cell. We have therefore developed a reversible cryo-arrest that halts molecular movements for high-resolution imaging, yet maintains cells in a viable state. Upon cooling, the concentration of cryoprotective dimethyl sulfoxide (DMSO) is increased stepwise (Masip et al., 2016). This precludes the formation of ice crystals that can be lethal to cells while scattering light and altering cellular structure by displacing organic material (Dubochet et al., 1988 and 2012; Huebinger et al., 2016). At the same time, adding DMSO at low temperatures greatly reduces its toxicity (Farrant, 1965). A further advantage of the cryo-approach is that fluorophores become less reactive in the excited state, resulting in the emission of more photons before bleaching as well as a lowered production of cytotoxic radicals (Kaufmann et al., 2014), which can severely damage cells during acquisition at physiological temperatures (Wäldchen et al., 2015).
Materials and Reagents
10 μm thick double-sided adhesive tape (D80 19 x 50 mm) (Modulor, catalog number: 0332054 )
Cover slides 21 x 26 mm (No.1) (Thermo Fisher scientific, Thermo scientificTM, catalog number: BBAD02100260#A* )
6-well plates for cell culture (SARSTEDT, catalog number: 83.3920 )
15-ml reaction tubes (e.g., SARSTEDT, catalog number: 62.554.502 )
200-μl pipette tips (e.g., Greiner Bio One International, catalog number: 739290 )
Silicon tube
Flexible silicon tubes (inner diameter [i.d.] 2 mm; outer diameter [o.d.] 4 mm and i.d. 1.5 mm; o.d. 3 mm) (e.g., VWR, catalog numbers: 228-0704 and 228-0702 )
Cell line of interest and suitable cell culture medium
Note: The protocol has so far been tested for the adherently growing cell lines HeLa (ATCC, catalog number: CCL-2 ), MDCK (ATCC, catalog number: CCL-34 ), COS-7 (ATCC, catalog number: CRL-1651 ), MCF7 cells (ATCC, catalog number: HTB-22 ) and HCT116 (ATCC, catalog number: CCL-2 47). Other cell lines may be used after proper testing for the reversibility of the cryo-arrest.
Ethanol, absolute (e.g., Fisher Scientific, catalog number: 10342652 )
Sterile water (sterilized by filtration)
DMSO (min 99%) (e.g., Serva Electrophoresis, catalog number: 20385 )
Liquid nitrogen
Immersion oil (e.g., Olympus, catalog number: IMMOIL-F30CC )
Transfection reagents and plasmid expressing fluorescent proteins of interest or cell lines stably expressing a fluorescent protein of interest. The protocol has been successfully used for confocal FLIM with a conformational activity sensor for EphrinA2 and EGFR tagged to mCitrine in combination with a phosphotyrosine binding domain tagged to mCherry. Single molecule localization has been performed with EGFR-mEos2 and with Vinculin tagged to a SNAP-Tag and labelled with SNAP-Cell TMR-star (New England Biolabs, catalog number: S9105S ). Requests about these plasmids can be addressed to the corresponding author
HEPES or phosphate buffered imaging medium without phenol red (e.g., DMEM, PAN-Biotech, catalog number: P04-01163 )
10% fetal bovine serum (FBS) (PAN-Biotech, catalog number: P30-1505 )
Streptomycin/penicillin (PAN-Biotech, catalog number: P06-07100 )
L-glutamine (200 mM) (PAN-Biotech, catalog number: P04-80100 )
1% nonessential amino acids (PAN-Biotech, catalog number: P08-32100 )
Different DMSO solutions (see Recipes)
Cell culture medium (see Recipes)
Equipment
Scalpel
Laminar flow hood
Incubator (e.g., Nuaire, model: NU-5510/E )
Fine forceps (e.g., Electron Microscopy Sciences, catalog number: 0203-7-PO )
Anodized (black) aluminum flow-through chamber (custom-built; see Figure 1)
Note: Anodizing the aluminum reduces its corrosion and thereby solvation of aluminum ions, which might otherwise influence cellular reactions. Anodizing with black color reduces reflection of light, which might interfere with the microscopic imaging.
Figure 1. Design of the flow-through chamber. Photographic representation (A, B) and technical drawings (C-E) of the self-built flow-through chamber made out of aluminum. A. Top view on the flow through chamber with pipette tips inserted into the in- and outlet (1) and a drill hole (2; depth: 15 mm; diameter: 1 mm) for the insertion of a thermocouple. B. Bottom view with the cover slide glued to the flow-through chamber (3); C. Top view of the flow-through chamber; D. Side view section through the flow-through chamber (section a:a in C); E. Detail of the side view section (detail b in D). All dimensions in c-e are in mm.
Polyvinyl chloride (PVC) insert for the microscope table (custom-built; see Figure 2), with 2 threaded holes to fix the stage using a metal clamp (see Figure 3B)
Figure 2. Technical, drawings of the PVC-insert for the microscope stage. The technical drawings show a mounting that fits into Scan IM stages (Märzhäuser Wetzlar GmbH & Co. KG, Wetzlar, Germany). A. Bottom view; B. Side view section (a:a in A); C. Side view detail of the central part (b in B). All dimensions are in mm.
Low-pressure syringe pump with a computer interface (Cetoni, model: neMESYS low pressure syringe pump )
Cryo-stage with temperature control (Linkam Scientific, model: MDS600 , other models with similar cooling heads may also work)
Thermocouple (e.g., PTFE-insulated type T with 0.08 mm wires; Omega Engineering, Deckenpfronn, Germany) with a data acquisition device connected to a computer for continuous temperature recording (e.g., OMEGA Engineering, model: OMB-DAQ-2408-2AO )
For confocal FLIM: Confocal laser scanning microscope equipped with a time correlated single photon counting unit and a ps-pulsed laser (e.g., PicoQuant, model: MicroTime 200 )
For SMLM: Microscope equipped with sensitive cameras (EMCCD or sCMOS) as well as lasers with adequate wavelength and power to image, switch on and bleach fluorophores
Inverted microscope (Olympus, model: IX-81 )
Figure 3. Cryo-stage mounted on a microscope. Photographic representation of the cryo-stage mounted on an inverted microscope ( IX-81 ; Olympus GmbH, Hamburg, Germany). A. Overview of the cryo-stage with peripheral instruments on the microscope. 1: Liquid nitrogen pump with control unit (Note: This should normally be disconnected from the optical table, since it may cause vibrations of the sample); 2: 15-ml tubes with medium of different DMSO-concentrations, inlet tube of the low-pressure syringe pump is inserted via a lid with a hole; 3: Low-pressure syringe pump; 4: Data acquisition device for thermocouple; 5: Central part of the cryo-stage as detailed in (B); 6: Liquid nitrogen reservoir. B. Detailed image of the central part of the microscope. 1: Tube connected to nitrogen pump; 2: Metal clamp to fix the stage to the PVC-insert; 3: Thermocouple to measure the temperature inside the silver block; 4: Medium inlet connected to the low pressure syringe pump; 5: Aluminum flow-through chamber (compare Figure 1); 6: PVC-insert for microscope stage (compare Figure 2); 7: Tube connected to the nitrogen reservoir; 8: Temperature controlled silver block with electrical counter heater; 9: Medium outlet tube; 10: Thermocouple to measure temperature of the aluminum block.
Software
ThunderSTORM Plugin (Ovesny, Bioinformatics, 2014)
ImageJ (Rasband, ImageJ, National Institutes of Health, Bethesda, Maryland, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Huebinger, J., Masip, M. E., Christmann, J., Wehner, F. and Bastiaens, P. I. H. (2017). Reversible Cryo-arrests of Living Cells to Pause Molecular Movements for High-resolution Imaging. Bio-protocol 7(8): e2236. DOI: 10.21769/BioProtoc.2236.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Live-cell imaging
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,237 | https://bio-protocol.org/exchange/protocoldetail?id=2237&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Evaluation of Muscle Performance in Mice by Treadmill Exhaustion Test and Whole-limb Grip Strength Assay
BC Beatriz Castro
SK Shihuan Kuang
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2237 Views: 15770
Edited by: Antoine de Morree
Reviewed by: Xiaoyi Zheng
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
In vivo muscle function testing has become of great interest as primary phenotypic analysis of muscle performance. This protocol provides detailed procedures to perform the treadmill exhaustion test and the whole-limb grip strength assay, two methods commonly used in the neuromuscular research field.
Keywords: Exhaustion test Grip strength Mice Muscle Treadmill
Background
Muscle diseases usually lead to alterations in skeletal muscle function. Non-invasive in vivo tests that can evaluate muscle performance are therefore of considerable value as primary phenotypic screening. Here, we describe how to perform the treadmill exhaustion test, which evaluates exercise capacity and endurance, and the limb grip strength assay, which measures muscular strength. In the treadmill exhaustion test, the mice are forced to run to exhaustion over a conveyor belt with gradually increasing speed. The limb grip strength assay uses a horizontal grip–that is grasped by the mouse–to measure the maximum force that is required to make the mouse release it. These tests can be easily customized to evaluate muscle performance under different situations, such as after therapeutic interventions or regeneration (Benchaouir et al., 2007; Puzzo et al., 2016), or to study the potential roles of specific genes on muscle physiopathology (Waning et al., 2015; Bi et al., 2016; Yue et al., 2016).
Materials and Reagents
Record sheet
Appropriate mouse strain and housing facility
Ethanol (70%), or disinfectant wipes, mild solution of detergent and water
Equipment
Treadmill exhaustion test
Timer
Plastic tray
Treadmill system: Exer 3/6 treadmill and treadmill controller (Columbus Instruments, model: Exer 3/6 ) (Figure 1)
Computer and software provided by the manufacturer
Figure 1. Treadmill system and components
Whole-limb grip strength assay
Grip strength meter (Columbus Instruments, model: 1027SM Grip Strength Meter with Single Sensor ). The apparatus includes a grid that is connected to a force transducer, a digital display (AMETEK, Chatillon, model: DFE2-002 ), and a base that elevates it (Figure 2)
Scale
Figure 2. Grip strength meter
Software
Treadmill software (Columbus Instruments, OH, USA)
Procedure
Treadmill exhaustion test
Training
Set the treadmill to desired angle of inclination or declination. In this instrument the angle of inclination is set by the location of the spring pin in holes of the inclination rod. Uphill inclinations (slopes of 10%) are commonly used for this test (Bi et al., 2016; Nie et al., 2016; Yue et al., 2016). Uphill running involves concentric muscle contraction and increases the muscle work for the animals as compared with running on a flat surface, leading to faster exhaustion. Downhill running may also be used to examine eccentric muscle contraction.
Place a plastic tray underneath the instrument to collect feces and urine that could be produced during the test.
Insert the lane dividers into the slots of the treadmill.
Switch on the treadmill controller.
Adjust the electric shock frequency and intensity (Figure 3A). In this apparatus, the electric stimuli are pulses (200 msec/pulse) of electric current with adjustable pulse repetition rate (1, 2 or 3 times per second, Hz) and intensity (suggested: 3 Hz, 1.22 mA; respectively).
Place the mice on the treadmill belt and cover with the lid.
Turn the shock grids on for each line by setting each toggle switch toward the grids (the stimulus indicator will begin to flash).
Adjust the belt speed to 10 m/min using the ‘speed’ knob located in the treadmill controller. Set the ‘treadmill belt’ toggle switch to ‘run’ (Figure 3B).
Figure 3. Electric shock stimulus (A) and speed (B) adjustment using the treadmill controller
Start a timer. Allow mice to run for 5 min.
After this time, set the ‘treadmill belt’ toggle back to ‘stop’.
Disable the shock stimulus for all lanes.
Remove animals and return each mouse to its cage.
Clean the treadmill belt and grid with 70% ethanol and repeat steps A1f to A1l if additional mice have to be trained.
Turn off the machine.
Wash the feces collecting tray and the lane dividers.
Repeat the training session during 3 consecutive days prior to the test.
Test
Perform the steps A1a through A1e of the previous section.
Turn on the computer and start the treadmill software. Setup a new experiment as follows:
Select ‘Experiment >> Run’ from the main menu.
Click the ‘Profile Mode’ tab at the top of the window.
Use the computer mouse to select the text boxes and enter the corresponding parameters (see Table 1, Figure 4A). In this test, the speed is initially set at 10 m/min for 5 min, and it is increased 2 m/min every 2 min up to a maximum speed of 46 m/min is reached (Bi et al., 2016).
Figure 4. Treadmill Software. A. Creating a profile. A Treadmill exercise profile is created by selecting the text (white) boxes with the computer mouse and manually entering the corresponding parameters; more steps are added by clicking ‘add period’. This profile can be saved and used later to test other mice. To do this, click ‘Load’ in the profile mode screen and select the saved file. B. Running the experiment. A graphical representation is automatically generated to show the relative speed and time of the entire profile. The vertical red bar in the graph points out the current position, while an arrow within the step column of the profile table marks the step currently in use. Step time: informs about the time remaining within the current step; Spd (m/m): reports the current speed of the treadmill belt; Dist Tr (m): reports the total distance the treadmill belt has moved.
Table 1. Treadmill exhaustion test steps
Set the ‘Treadmill belt’ toggle switch to ‘Run’ and enable the electric shock.
Click the ‘Start’ button. A ‘Save Experiment Data File’ window will open (save as a .csv file).
Load the mice into separate lanes on the treadmill belt and then click ‘OK’.
Run the experiment until the mice are exhausted or the maximal speed is achieved.
When a mouse becomes exhausted, write down the time, speed, and distance that are displayed at that moment on the screen (see Figure 4B) and turn off the shock grid for its lane. Remove the mouse from the treadmill.
There are different ways to define exhaustion and the same criteria must be used throughout the experiment. For example, the exhaustion may be defined as the inability of the animal to run on the treadmill for 10 sec despite mechanical prodding (Bi et al., 2016; Yue et al., 2016).
When no mice remain on the treadmill or the maximal speed is reached, stop the experiment and turn off the shock grids.
To test additional mice clean the treadmill and grid with 70% alcohol and repeat the described procedure. (Click ‘Load’ in the profile mode screen and select the saved file generated previously in order not to have to enter again all the data manually, then click ‘Start’). Each mouse is tested one time the day after the last training session. We recommend to use at least five animals to ensure high statistical power. Due to potential variances in the sex, age, and genetic background of mice, calculation of the number of animals required for this test should be performed by a power analysis.
Whole-limb grip strength assay
Place the mice in the testing room for 10 min to acclimate (leave the room during this time).
Put the force meter on a firm, flat surface.
Connect the grid to the digital force gauge and clean it with 70% ethanol or disinfectant wipe.
Set up the grip strength meter (GSM):
Turn on the GSM.
Push the bottom under the ‘Mode’ option to select the Peak Tension (T-PK) mode (this displays the peak force applied to the GSM as a result of pulling away from the GSM). Press ‘Home’ to return to the main screen.
Press the ‘Units’ bottom to select the units of force (e.g., Newton, N)
Press ‘Zero’ to tare the GSM.
Testing animals (Figure 5):
Remove the mouse to be tested from the cage and place it over the top of the grid. Allow the mouse to grasp the grid with all four paws.
The mouse can be held by the base of the tail alone or together with the scruff of the neck when positioning on the grid, be aware of doing it smoothly without pressing down upon the grid.
Keeping the torso of the mouse parallel with the grid, pull gently the animal backwards away from the grid by the tail (pulling along the axis of the GSM). The speed has to be slow enough to let the mouse to develop a resistance against the pulling force.
Record the number (peak force) that is displayed on the screen of the GSM once the mouse releases the grid.
Figure 5. Whole-limbs grip strength measurement
Weigh the mouse.
Return the mouse to its cage.
Clean the grid with 70% ethanol.
Tare (zero) the GSM and proceed with the next subject. Each mouse should be tested several times (3-5 times) with at least 1 min resting period between each test.
Data analysis
Treadmill exhaustion test
Exercise capacity is commonly evaluated by comparison of both speed and distance values between the animals of interest and their controls, and plotted on a bar graph (Bi et al., 2016).
Other parameters such as work and power can additionally be used (Nie et al., 2016). Work and power are calculated as follows:
Work (J) = body mass (kg) x gravity (9.81 m/sec2) x vertical speed (m/sec x angle) x time (sec)
Power (W) = work (J)/time (sec)
Whole-limb grip strength assay
The average force (gripping strength) is used for comparison between experimental groups. Sometimes force measurements are not accurate since the animals can release very quickly without exert any resistance or they can have grasp problems. Therefore, it is recommended to use the mean of the best recorded values for data analysis. The results are plotted on a bar graph (Figures 6 and 7A).
Figure 6. Gripping strength measurement result of limbs from MLC-N1ICD mice and littermate controls. Each mouse was tested three times (n = 3). The average strength was defined as gripping strength. Statistical analysis was conducted with Student’s t-test with two-tail distribution. **P < 0.01. Bar graphs indicate mean SEM (Adapted from Bi et al., 2016).
It is also common to use the ‘normalized grip force’ for data analysis. This value is obtained by dividing the grip strength mean value with the body weight of each mouse (Figure 7B).
Figure 7. Graphical representation of Force (A) and Normalized force (B) of 3-month old mutant mice versus littermate controls. Each mouse was tested four times. Data are presented as means ± SE (n = 7).
Notes
General
Environmental variables such as light, noise, humidity or temperature, as well as testing time (morning/afternoon) should be kept constant and at appropriate levels for the animals.
Treadmill exhaustion test
Training sessions facilitate the animals to become familiar with the apparatus and the test conditions, minimizing the psychological stress and increasing their performance in the task. We recommend using an acclimatizing period of 3 to 10 days. Longer training periods could reduce the willingness of the mice to perform the task and blunt the physiological, molecular and biochemical responses to exercise.
Parameters such as the speed or the duration of the test can be manipulated, resulting in different protocols depending on the objectives to be reached. For example, the effects of aerobic exercise can be evaluated by exercising the animals for 60 min at 14 m/min on a 10% grade, 5 day/week, for 6 weeks (Nie et al., 2016). The modification on the angle of the treadmill would enable the study of the outcomes of uphill (incline-slope, concentric) and downhill (decline-slope, eccentric) running.
Because this test is a form of forced exercise, it usually requires aversive stimuli to keep the animal running. Here, we used electric shock as a noxious stimuli, but different methods (e.g., air puffs or gently encouragement them by using a tongue depressor) can be used. Also, it is important to consider that genetic background, strains, clinical condition, and other intrinsic variables may influence the sensitivity and response of the animal to the stimulus, requiring and adjustment of the intensity of the stimulus.
Physical exercise can exacerbate the clinical condition of some animal models–like mdx mice–especially during the test, where the animals are exposed to high speeds for long periods of time. Animal models with a weak physical condition may require milder test conditions (using lower uphill slopes and reducing the rate of speed increments, for example).
Whole-limb grip strength assay
Besides environmental factors, it is also important to keep the same operator for all experimental groups under study in order to decrease inter-subject variability (preferably in a blinded fashion).
Check the toes of the mice to make sure there are no visible wounds on them before test.
This grip test is used to measure the muscle strength of combined forelimbs and hind limbs. The same procedure can be used to test the forelimbs strength alone, allowing the mouse to grasp the grid only with the forelimbs.
Acknowledgments
This protocol has been adapted from our previous work published in Elife (Bi et al., 2016) and Cell Reports (Yue et al., 2016) and partially supported by a grant from United States National Institutes of Health to SK (1R01AR071649). Beatriz Castro acknowledges support from the Alfonso Martin Escudero Foundation.
References
Benchaouir, R., Meregalli, M., Farini, A., D'Antona, G., Belicchi, M., Goyenvalle, A., Battistelli, M., Bresolin, N., Bottinelli, R., Garcia, L. and Torrente, Y. (2007). Restoration of human dystrophin following transplantation of exon-skipping-engineered DMD patient stem cells into dystrophic mice. Cell Stem Cell 1(6): 646-657.
Bi, P., Yue, F., Sato, Y., Wirbisky, S., Liu, W., Shan, T., Wen, Y., Zhou, D., Freeman, J. and Kuang, S. (2016). Stage-specific effects of Notch activation during skeletal myogenesis. Elife 5.
Nie, Y., Sato, Y., Wang, C., Yue, F., Kuang, S. and Gavin, T. P. (2016). Impaired exercise tolerance, mitochondrial biogenesis, and muscle fiber maintenance in miR-133a-deficient mice. FASEB J 30(11): 3745-3758.
Puzzo, D., Raiteri, R., Castaldo, C., Capasso, R., Pagano, E., Tedesco, M., Gulisano, W., Drozd, L., Lippiello, P., Palmeri, A., Scotto, P. and Miniaci, M. C. (2016). CL316,243, a β3-adrenergic receptor agonist, induces muscle hypertrophy and increased strength. Sci Rep 5: 37504.
Waning, D. L., Mohammad, K. S., Reiken, S., Xie, W., Andersson, D. C., John, S., Chiechi, A., Wright, L. E., Umanskaya, A., Niewolna, M., Trivedi, T., Charkhzarrin, S., Khatiwada, P., Wronska, A., Haynes, A., Benassi, M. S., Witzmann, F. A., Zhen, G., Wang, X., Cao, X., Roodman, G. D., Marks, A. R. and Guise, T. A. (2015). Excess TGF-β mediates muscle weakness associated with bone metastases in mice. Nat Med 21(11): 1262-1271.
Yue, F., Bi, P., Wang, C., Li, J., Liu, X. and Kuang, S. (2016). Conditional loss of pten in myogenic progenitors leads to postnatal skeletal muscle hypertrophy but age-dependent exhaustion of satellite cells. Cell Rep 17(9): 2340-2353.
Copyright: Castro and Kuang. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Castro, B. and Kuang, S. (2017). Evaluation of Muscle Performance in Mice by Treadmill Exhaustion Test and Whole-limb Grip Strength Assay. Bio-protocol 7(8): e2237. DOI: 10.21769/BioProtoc.2237.
Bi, P., Yue, F., Sato, Y., Wirbisky, S., Liu, W., Shan, T., Wen, Y., Zhou, D., Freeman, J. and Kuang, S. (2016). Stage-specific effects of Notch activation during skeletal myogenesis. Elife 5.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,238 | https://bio-protocol.org/exchange/protocoldetail?id=2238&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Affinity Purification of the RNA Degradation Complex, the Exosome, from HEK-293 Cells
MD Michal Domanski
John LaCava
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2238 Views: 8245
Edited by: Gal Haimovich
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
The RNA exosome complex plays a central role in RNA processing and regulated turnover. Present both in cytoplasm and nucleus, the exosome functions through associations with ribonucleases and various adapter proteins (reviewed in [Kilchert et al., 2016]). The following protocol describes an approach to purify RNA exosome complexes from HEK-293 cells, making use of inducible ectopic expression, affinity capture, and rate-zonal centrifugation. The obtained RNA exosomes have been used successfully for proteomic, structural, and enzymatic studies (Domanski et al., 2016).
Keywords: RNA exosome EXOSC10 Cryomilling HEK-293 suspension culture Affinity capture Rate-zonal centrifugation
Background
In our previous work, we established an isogenic HEK-293 cell line expressing C-terminally 3xFLAG-tagged exosome component EXOSC10 (RRP6) under the control of a tetracycline-inducible CMV promotor (HEK-293 Flp-In T-REx – Thermo Fisher Scientific). This system permitted us to express the tagged EXOSC10 protein at a level comparable to the endogenous WT protein, and to explore exosome purification protocols using a magnetic anti-FLAG affinity medium and protein extracts derived from cryomilled cell powder (Domanski et al., 2012). Further exploring the protein extraction conditions used, we developed a protocol permitting the retention of DIS3 (RRP44) within affinity captured exosomes, which has otherwise proven difficult (Hakhverdyan et al., 2015). Building on these studies, we further purified RNA exosomes, +/- DIS3, by rate-zonal centrifugation using glycerol density gradients (Domanski et al., 2016). Although the presence of the detergent CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) in the protein extract enhanced the yield of DIS3 co-purifying with affinity captured exosomes, the interaction was subsequently lost during sedimentation in a glycerol density gradient. To counteract this, the crosslinker DTSSP [3,3’-dithiobis(sulfosuccinimidyl propionate)] was employed. The treatment enabled the retention of DIS3 within exosomes during sedimentation, but negatively affected DIS3 enzymatic functions. The peak fractions from DIS3 +/- exosome fractions both contained apparent exoribonucleolytic activities consistent with EXOSC10-derived distributive 3’-5’ hydrolysis. Apparent structural differences between samples that retained DIS3 (DTSSP-treated) and those that did not could be observed by negative stain electron microscopy. The protocol presented here will enable users to obtain endogenously assembled RNA exosome fractions suitable for additional analytical methods including in vitro biochemistry, enzymology, and electron microscopy. Note that many aspects of this protocol can be easily adapted, e.g., to use (1) different affinity tags and expression contexts, or (2) antibodies against the endogenous protein (LaCava et al., 2015).
Materials and Reagents
Note: Catalog numbers are given for most of the reagents listed below; an equivalent quality reagent from an alternative supplier can typically be substituted with comparable results. Standard materials and reagents for mammalian cell culture are required and are not all explicitly listed below.
Pipette tips
Nunclon cell culture 245 mm (500 cm2) square dish (Sigma-Aldrich, catalog number: D8679 )
Nunclon 175 cm2 cell culture flask (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 156502 )
15” cell scraper (Fisher Scientific, catalog number: 08-100-242 )
50 ml polypropylene conical tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339652 )
20 ml Luer-lock syringe (BD, catalog number: 302830 )
Parafilm (Sigma-Aldrich, catalog number: P7793 )
Syringe end caps (Bio-Rad Laboratories, catalog number: 7311660EDU )
2 ml microcentrifuge tubes (e.g., Eppendorf, catalog number: 022363344 )
0.45 μm polyethersulfone (PES) sterile syringe filters (VWR, catalog number: 28145-505 )
5 ml Ultracentrifuge tubes (Seton Scientific, catalog number: 7022 )
Note: If you will use the BioComp Instruments Piston Gradient Fractionator to recover fractions of purified exosomes (see Equipment), we recommend you obtain these tubes from BioComp because they are tolerance tested for compatibility.
HEK-293 Flp-In T-REx EXOSC10-3xFLAG cells ([Domanski et al., 2016]; available upon request)
DMEM, high glucose, GlutaMAX (Thermo Fisher Scientific, catalog number: 31966047 )
Fetal bovine serum (FBS), tetracycline-free
Note: Numerous suppliers can provide this. Many suppliers carry FBS products not labelled as tetracycline-free, but consulting the product specification sheet for a given lot may reveal that tetracycline has been tested for and found to be absent. In our hands, the performance of such lots has been identical to ‘certified’ tetracycline-free FBS.
100x penicillin-streptomycin (P/S) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Trypsin-EDTA, 0.05% (Thermo Fisher Scientific, GibcoTM, catalog number: 25300054 )
Tetracycline (Sigma-Aldrich, catalog number: 87128 )
Note: Prepare a stock solution of 10 mg/ml in ethanol and store at -20 °C. The working solution is 5 μg/ml–for the induction add 1 μl per 1 ml cell culture medium. Doxycycline can also be used.
Phosphate-buffered saline (PBS), pH 7.4 (Thermo Fisher Scientific, catalog number: 10010023 )
100x L-glutamine (200 mM) (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
TrypLE dissociation reagent (Thermo Fisher Scientific, GibcoTM, catalog number: 12605010 )
Phenol red solution, 0.5% (Sigma-Aldrich, catalog number: P0290 )
Liquid nitrogen (LN2)
Freestyle 293 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 12338026 )
3 M ammonium sulfate in 0.1 M sodium phosphate buffer pH 7.4
Bovine serum albumin (BSA) (New England Biolabs, catalog number: B9000S )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid (HEPES) (Sigma-Aldrich, catalog number: 54457 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 71687 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 320331 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Protease inhibitor cocktail, EDTA-free (Roche Diagnostics, catalog number: 11873580001 )
CHAPS (Sigma-Aldrich, catalog number: C5070 )
Anti-FLAG M2 antibody (Sigma-Aldrich, catalog number: F3165 or F1804 )
Dynabeads M-270 epoxy (Thermo Fisher Scientific, InvitrogenTM, catalog number: 14302D )
0.1 M sodium phosphate buffer pH 7.4
Tris base (Sigma-Aldrich, catalog number: 93362 )
3xFLAG peptide (Sigma-Aldrich, catalog number: F4799 ) reconstituted at 5 mg/ml in TBS (50 mM Tris-HCl pH 7.4, 150 mM NaCl). Aliquots should be stored at -20 °C
DTSSP (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 21578 )
4x LDS (lithium dodecyl sulfate) sample loading buffer (Thermo Fisher Scientific, NovexTM, catalog number: NP0007 )
10x sample reducing agent (Thermo Fisher Scientific, NovexTM, catalog number: NP0004 ); or 500 mM dithiothreitol (DTT)
4-12% Bis-Tris 26-well midi gels (Thermo Fisher Scientific, InvitrogenTM, catalog number: WG1403BOX )
20x MOPS (3-morpholinopropane-1-sulfonic acid) gel running buffer (Thermo Fisher Scientific, NovexTM, catalog number: NP0001 )
SilverQuest Silver Staining Kit (Thermo Fisher Scientific, NovexTM, catalog number: LC6070 )
Sypro ruby protein gel stain (Sigma-Aldrich, catalog number: S4942 )
Anti-EXOSC10 antibody (Abcam, catalog number: ab95028 )
Anti-SKIV2L2 antibody (Abcam, catalog number: ab70552 )
Anti-EXOSC3 antibody (Proteintech, catalog number: 15062-1-AP )
ExoI extraction solution (see Recipes)
ExoII extraction solution (see Recipes)
Gradient solution – ‘light’ (see Recipes)
Gradient solution – ‘heavy’ (see Recipes)
Equipment
Note: Catalog numbers are given for most of the equipment listed below; instruments from alternative manufacturers may be substituted provided equivalent functionality.
Pipettes
Balance
CO2 incubator for mammalian cell culture
Refrigerated microcentrifuge (capable of reaching 20,000 x g)
New Brunswick Innova 2000 platform shaker (Eppendorf, New BrunswickTM, model: Innova® 2000 , catalog number: M1190-0002)
Note: Any shaker installed in a mammalian cell culture incubator must be able to tolerate continuous high humidity (~90% relative humidity).
250 ml plastic beaker
Hemocytometer
1 L square PYREX bottles (Corning, PYREX®, catalog number: 1396-1L )
Milling balls, stainless steel, 20 mm (Retsch, catalog number: 05.368.0062 )
50 ml stainless steel milling jar (Retsch, catalog number: 01.462.0149 )
Metal spatula
Planetary Ball Mill PM 100 (Retsch, model: PM 100 , catalog number: 20.540.0001)
Thermomixer (Eppendorf, model: Thermomixer® R , catalog number: 5355000.011; or equivalent)
Vortex mixer equipped with head for multiple 1.5/2.0 ml tubes (Thermo Fisher Scientific, Fisher Scientific, model: Fisher ScientificTM Vortex Mixer , catalog number: 02-215-386)
Neodymium magnet microfuge tube rack (Thermo Fisher Scientific, catalog number: 12321D )
Ultracentrifuge compatible with either of the rotors listed below (Beckman Coulter), e.g., Optima L or Optima MAX series (Beckman Coulter, model: Optima L or Optima MAX series )
SW 55 Ti or MLS-50 rotor (Beckman Coulter, model: SW 55 Ti or MLS-50 )
Microtip sonicator (e.g., Qsonica, model: Q700 ) equipped with a low intensity 1/16” microtip probe (Qsonica, catalog number: 4717)
Gradient fractionator and accessories for SW 55 Ti (BioComp Instruments, catalog number: 152-001 )
Gradient master and accessories for SW 55 Ti (BioComp Instruments, catalog number: 107-201M )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Domanski, M. and LaCava, J. (2017). Affinity Purification of the RNA Degradation Complex, the Exosome, from HEK-293 Cells. Bio-protocol 7(8): e2238. DOI: 10.21769/BioProtoc.2238.
Download Citation in RIS Format
Category
Biochemistry > Protein > Isolation and purification
Molecular Biology > RNA > RNA degradation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,239 | https://bio-protocol.org/exchange/protocoldetail?id=2239&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA Degradation Assay Using RNA Exosome Complexes, Affinity-purified from HEK-293 Cells
MD Michal Domanski
John LaCava
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2239 Views: 8670
Edited by: Gal Haimovich
Reviewed by: Antoine de MorreeVaibhav B Shah
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
The RNA exosome complex plays a central role in RNA processing and regulated turnover. Present both in cytoplasm and nucleus, the exosome functions through associations with ribonucleases and various adapter proteins (reviewed in [Kilchert et al., 2016]). The RNA exosome-associated EXOSC10 protein is a distributive, 3’-5’ exoribonuclease. The following protocol describes an approach to monitor the ribonucleolytic activity of affinity-purified EXOSC10-containing RNA exosomes, originating from HEK-293 cells, as reported in (Domanski et al., 2016) and further detailed in the companion bio-protocol to this one (Domanski and LaCava, 2017).
Keywords: RNA exosome EXOSC10 Affinity capture RNA degradation Ribonuclease
Background
In our previous work, we established an isogenic HEK-293 cell line expressing C-terminally 3xFLAG-tagged exosome component EXOSC10 (RRP6), under the control of a tetracycline-inducible CMV promoter (HEK-293 Flp-In T-REx – Thermo Fisher Scientific). This system permitted us to express the tagged EXOSC10 protein at a level comparable to the endogenous WT protein, and to explore exosome purification protocols using a magnetic anti-FLAG affinity medium and protein extracts derived from cryomilled cell powder (Domanski et al., 2012). Building on this, we developed protocols for further purifying RNA exosomes by rate-zonal centrifugation, using glycerol density gradients, and assaying their ribonuclease (RNase) activity (Domanski et al., 2016). EXOSC10-containing exosome fractions exhibited apparent exoribonucleolytic activity, consistent with distributive 3’-5’ hydrolysis; the same assay permitted the detection and monitoring of the processive RNase activity of affinity purified DIS3-3xFLAG ([Wasmuth and Lima, 2012] and references therein). The protocol presented here describes the RNase assay. Although this protocol presumes glycerol gradient purified EXOSC10-3xFLAG-containing exosomes as the point of entry into the assay (Domanski and LaCava, 2017), the method should be applicable to any sufficiently pure and concentrated samples.
Materials and Reagents
Note: Catalog numbers are given for most of the reagents listed below; an equivalent quality reagent from an alternative supplier can typically be substituted with comparable results. Due to the potential for artifacts introduced by contaminating RNases, care should be taken to follow best practices, such as the use of RNase-free solutions and reagents and/or using DEPC-treatment where appropriate (Farrell, 2010). Standard materials and reagents for urea-polyacrylamide gel electrophoresis are required; we use the National Diagnostics system but such gels can be prepared using standard methods (Sambrook and Russell, 2006).
Pipette tips
1.5 ml microcentrifuge tubes (e.g., Eppendorf, catalog number: 022363204 )
10-well Gel Combs, 1.5 mm (Thermo Fisher Scientific, NovexTM, catalog number: NC3510 )
Empty Gel Cassettes, mini, 1.5 mm (Thermo Fisher Scientific, NovexTM, catalog number: NC2015 )
Syringe with a bent needle (to wash the residual urea out of the gel wells before sample loading)
HEK-293 Flp-In T-REx EXOSC10-3xFLAG cells ([Domanski et al., 2016]; available upon request) Parental HEK-293 Flp-In T-REx cell line (Thermo Fisher Scientific, InvitrogenTM, catalog number: R78007 )
Nuclease-free water (Thermo Fisher Scientific, AmbionTM, catalog number: AM9932 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid (HEPES) (Sigma-Aldrich, catalog number: 54457 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Anti-FLAG M2 (Sigma-Aldrich, catalog number: F3165 ) antibody conjugated Dynabeads M-270 Epoxy (Thermo Fisher Scientific, InvitrogenTM, catalog number: 14302D ) (Domanski and LaCava, 2017)
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 43815 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
RNA substrate with 6-carboxyfluorescein (6-FAM) at the 5’-end (Reconstitute in 10 mM HEPES ~pH 7-7.5, at 0.5 nmol/µl. Store aliquots at -80 °C)
Generic substrate: 5’-(6-FAM)-CCUAU UCUAU AGUGU CACCU AAAUG CUAGA GCU modC(2’-O-Me)-3’
Blocked substrate: 5’-(6-FAM)-CCUAU UCUAU AGUGU CACCU AAAUG CUAGA GCU modC(2’-O-Me, 3’-PO4)-3’
Note: Both substrates were ordered from the Integrated DNA Technologies at 100 nmole scale, purified by RNase-free HPLC.
RNasin® ribonuclease inhibitors (Promega, catalog number: N2515 )
Formamide (Sigma-Aldrich, catalog number: 47671 )
DNA loading dye (Thermo Fisher Scientific, catalog number: R0611 )
Note: This consists of 10 mM Tris-HCl (pH 7.6), 0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glycerol, 60 mM EDTA–and so, can be prepared rather than purchased.
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Tris base (Sigma-Aldrich, catalog number: 93362 )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: B7901 )
N,N,N’,N’-tetramethylethylenediamine (TEMED) (Sigma-Aldrich, catalog number: T7024 )
Ammonium persulfate (APS) (Sigma-Aldrich, catalog number: A3678 )
Note: Prepare 10% solution in H2O and store at 4 °C for several weeks.
UreaGel 29:1 Denaturing Gel System (National Diagnostics, catalog number: EC-829 )
Recapture solution (see Recipes)
Wash solution (see Recipes)
2x reaction solution (see Recipes)
2x RNA loading solution (see Recipes)
1x TBE (5x or 10x stock can be prepared) (see Recipes)
Equipment
Note: Standard equipment for urea-polyacrylamide gel electrophoresis is required, as well as an imager capable of fluorescein detection (absorption λmax = 494 nm, emission λmax = 518 nm).
Pipettes
Vortexer
Benchtop mini-centrifuge
Neodymium magnet microfuge tube rack (Thermo Fisher Scientific, catalog number: 12321D )
Thermomixer (e.g., Eppendorf, model: ThermoMixer® F , catalog number: 5355000.011; or equivalent)
XCell SureLock Mini (Thermo Fisher Scientific, model: SureLock® Mini-Cell , catalog number: EI0001)
Electrophoresis power supply
Imager with blue light (460 nm) epi-illumination and a Y515-Di (long-pass) filter–i.e., SYBR green settings. E.g., Fujifilm LAS-3000 series or newer (Fujifilm, model: LAS-3000 Series ; or equivalent)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Domanski, M. and LaCava, J. (2017). RNA Degradation Assay Using RNA Exosome Complexes, Affinity-purified from HEK-293 Cells. Bio-protocol 7(8): e2239. DOI: 10.21769/BioProtoc.2239.
Download Citation in RIS Format
Category
Molecular Biology > RNA > RNA degradation
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
224 | https://bio-protocol.org/exchange/protocoldetail?id=224&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Socially Transmitted Food Preference (STFP) Task Protocol
RC Robert E. Clark
Published: Vol 2, Iss 11, Jun 5, 2012
DOI: 10.21769/BioProtoc.224 Views: 9980
Original Research Article:
The authors used this protocol in Jun 2002
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2002
Abstract
Temporally-graded retrograde amnesia (TGRA) refers to a phenomenon of premorbid memory loss whereby information acquired recently is more impaired than information acquired more remotely. Studies of human amnesia have illuminated this phenomenon (Hodges, 1994; Squire and Alvarez, 1995), but such studies necessarily rely on retrospective methods and imperfect tests. Studies in experimental animals have the advantage that retrograde amnesia can be studied prospectively, the locus and extent of brain lesions can be determined accurately, and the timing and strength of original learning can be precisely controlled. The socially transmitted food preference (STFP) task has been one of the most productive rodent behavioral tasks to study TGRA (Clark et al., 2002).
Materials and Reagents
Rats
Cinnamon
Cocoa
Ethanol
Powder
Flavored rat chow meal (see Recipes)
Equipment
Glass jars and the jar holders
Fisher Scientific scale
Feeding apparatus
Cages
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Clark, R. E. (2012). Socially Transmitted Food Preference (STFP) Task Protocol. Bio-protocol 2(11): e224. DOI: 10.21769/BioProtoc.224.
Clark, R. E., Broadbent, N. J., Zola, S. M. and Squire, L. R. (2002).Anterograde amnesia and temporally graded retrograde amnesia for a nonspatial memory task after lesions of hippocampus and subiculum. J Neurosci 22(11): 4663-4669.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,240 | https://bio-protocol.org/exchange/protocoldetail?id=2240&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Single Molecule RNA FISH in Arabidopsis Root Cells
Susan Duncan
TO Tjelvar S. G. Olsson
MH Matthew Hartley
CD Caroline Dean
SR Stefanie Rosa
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2240 Views: 14532
Edited by: Gal Haimovich
Reviewed by: Anca Flavia Savulescu
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
Methods that allow the study of gene expression regulation are continually advancing. Here, we present an in situ hybridization protocol capable of detecting individual mRNA molecules in plant root cells, thus permitting the accurate quantification and localization of mRNA within fixed samples (Duncan et al., 2016; Rosa et al., 2016). This single molecule RNA fluorescence in situ hybridization (smFISH) uses multiple single-labelled oligonucleotide probes to bind target RNAs and generate diffraction-limited signals that can be detected using a wide-field fluorescence microscope. We adapted a recent version of this method that uses 48 fluorescently labeled DNA oligonucleotides (20 mers) to hybridize to different portions of each transcript (Raj et al., 2008). This approach is simple to implement and has the advantage that it can be readily applied to any genetic background.
Keywords: Single RNA molecules Fluorescent in situ hybridization Gene expression Arabidopsis Transcription
Background
While single molecule FISH has been developed to quantitatively measure mRNAs at the single cell level for cultured cells, tissue sections and whole-mount invertebrate organisms, this method was not optimized for use in single cells in plants. Fluorescence imaging in plants is considerably challenging due to endogenous autofluorescence of plant tissues. Here, we report a method to detect single RNA molecules in plants. We describe the detection and automated counting of single transcripts within cells of fixed Arabidopsis root squashes. This method generates isolated cells and single-cell layers, which together with the use of red and far-red dyes maximizes signal-to-noise ratio limiting background noise.
Materials and Reagents
1.5 ml microcentrifuge tube
Sterile SterilinTM 10 cm square Petri dishes for plant growth media (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 109 )
22 x 22 mm No. 1 glass coverslips (VWR, catalog number: 631-0124 )
Poly-L-Lysine slides (Sigma-Aldrich, catalog number: P0425 )
Razor blades (Agar Scientific, catalog number: AGT586 )
Parafilm M® sealing film (Bemis, catalog number: PM992 )
Hybridization chamber
Note: Although these are available commercially (Corning, catalog number: 2551 ) we used 10 cm square Petri dishes covered externally with a layer of black insulation tape (RS Components, catalog number: 494-405 ). A double layer of tissue (KCWW, Kimberly-Clark, catalog number: 7557 ) was then placed in the base and saturated with sterile water before slides were placed on top of a single layer of Parafilm (see Figure 1).
Figure 1. Illustration of the hybridization chambers used for smFISH experiments
Low stender-form preparation dishes (VWR, catalog number: 470144-866 ; or similar rimmed glass dish)
Arabidopsis thaliana roots
Sodium hypochlorite (NaClO) (VWR, BDH®, catalog number: CABDH7038-4L )
Sucrose (Sigma-Aldrich, catalog number: S9378-1KG )
Phytagel (Sigma-Aldrich, catalog number: P8169 )
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
Nuclease-free phosphate buffered saline solution (PBS, 10x) pH 7.4 (Thermo Fisher Scientific, AmbionTM, catalog number: AM9624 )
Liquid nitrogen
Ethanol suitable for molecular biology
Nuclease-free 20x saline-sodium citrate (20x SSC) (Thermo Fisher Scientific, AmbionTM, catalog number: AM9763 )
Clear nail varnish (Electron Microscopy Sciences, catalog number: 72180 ; or similar)
Dextran sulphate (Sigma-Aldrich, catalog number: RES2029D )
Custom RNA FISH Stellaris® probe sets
We used the online Stellaris Probe Designer to design our smFISH probe sets: https://www.biosearchtech.com/support/education/stellaris-rna-fish. We used a default masking level 2 to avoid general problematic RNA sequences and selected the maximum number of 48 probes, an oligo length of 20 nt and 2 nt minimum spacing between probes.
We also performed TAIR BLAST searches (https://www.arabidopsis.org/Blast/index.jsp) for each probe sequence and considered the results collectively to ensure target specificity. We found Quasar 570 and Quasar 670 dyes equally suitable for imaging RNA in Arabidopsis root cells, however we were unable to detect RNA labelled with Fluorescein modified probes.
Murashige & Skoog basal medium with vitamins (any equivalent source would be suitable) (PhytoTechnology Laboratories®, catalog number: M519 )
Nuclease-free Tris-EDTA buffer solution (10 mM Tris-HCl, 1 mM EDTA pH 8) (Sigma-Aldrich, catalog number: 93283 )
DAPI (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D1306 )
Glucose (Sigma-Aldrich, catalog number: 158968-500G )
Tris HCl buffer 1 M pH 8, nuclease-free (Thermo Fisher Scientific, AmbionTM, catalog number: AM9855G )
Glucose oxidase (Sigma-Aldrich, catalog number: G0543 )
Bovine liver catalase (Sigma-Aldrich, catalog number: C3155 )
Deionized formamide (Sigma-Aldrich, catalog number: F9037 )
1 N HCl (Sigma-Aldrich, catalog number: 71763 )
10% (v/v) bleach (Vortex 5-10% sodium hypochlorite, Procter & Gamble, UK) diluted in dH2O
TE buffer (10 nM Tris-HCl, 1 mM EDTA, pH 8.0)
Nuclease-free water - not DEPC treated (QIAGEN, catalog number: 129117 )
Murashige and Skoog medium (see Recipes)
Wash buffer (see Recipes)
Hybridization solution (see Recipes)
DAPI solution (see Recipes)
Anti-fade GLOX buffer (minus enzymes) (see Recipes)
Anti-fade GLOX buffer (containing enzymes) (see Recipes)
Equipment
Forceps (Fisher Scientific, S MurrayTM, catalog number: E017/01 ; or similar)
Coplin jar (Sigma-Aldrich, catalog number: S6016 ; or similar)
Plant growth chamber (Panasonic Healthcare, Sanyo, catalog number: MLR-352H-PE ; or similar)
Fume cupboard (Labconco, catalog number: 2247300 ; or similar)
Laminar flow cabinet (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraguardTM ECO Clean Bench Floor Stands , catalog number: 50109313; or similar)
Laboratory oven (Cole-Palmer, catalog number: WZ-52412-83 ; or similar)
Orbital shaker (Cole-Palmer, catalog number: WZ-51700-13 ; or similar)
Wide-field fluorescence microscope
Note: We used an Andor iXon EM-CCD camera (Andor, model: iXon EMCCD Camera ) fitted to a Zeiss, Elyra PS-1 (Zeiss, model: Elyra PS.1 ), however similar images have also been obtained using a standard CCD camera optimized for low light level imaging.
A high numerical aperture (> 1.3) and 60 or 100x oil-immersion objective
Strong light source, such as a mercury or metal-halide lamp (Xenon or LEDs are typically not bright enough)
Filter sets appropriate for the fluorophores
Software
ImageJ software: http://rsbweb.nih.gov/ij/index.html (Schindelin et al., 2015)
FISHcount: https://github.com/JIC-CSB/FISHcount
Graphpad Prism Software or MS Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Duncan, S., Olsson, T. S. G., Hartley, M., Dean, C. and Rosa, S. (2017). Single Molecule RNA FISH in Arabidopsis Root Cells. Bio-protocol 7(8): e2240. DOI: 10.21769/BioProtoc.2240.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,241 | https://bio-protocol.org/exchange/protocoldetail?id=2241&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Primary Astrocyte Culture Derived from Human Glioblastoma Multiforme Specimen
MH Mansoureh Hashemi
MH Mahmoudreza Hadjighassem
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2241 Views: 10493
Edited by: Oneil G. Bhalala
Reviewed by: Sébastien GillotinEmmanuelle Berret
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
Glioblastoma multiforme (GBM) is a grade 4 astrocytoma tumor in central nervous system. Astrocytes can be isolated from human GBM. Study of astrocytes can provide insights about the formation, progression and recurrence of glioblastoma. For using isolated astrocytes, new studies can be designed in the fields of pharmacology, neuroscience and neurosurgery for glioblastoma treatment. This protocol describes the details for preparing high purity primary astrocytes from human GBM. Tumor tissue is disrupted using mechanical dissociation and chemical digestion in this protocol. 2 weeks after plating the cell suspension in culture, primary astrocytes are available for further subculturing and immunocytochemistry of S100-beta antigen.
Keywords: Glioblastoma multiforme Astrocyte S100-beta antigen Primary cell culture Malignant brain tumor Astrocytoma tumor
Background
Astrocytes are glial cells that provide structural and nutritional support for brain neurons. The cell cycle of astrocytes seems to be disrupted in astrocytoma brain tumors. The World Health Organisation (WHO) has classified astrocytomas into four grades according to their malignancy. Glioblastoma multiforme (GBM, grade IV) is the most malignant form of astrocytoma. Glioblastoma is characterized by the invasive cells with the rapid proliferation rate and angiogenesis. Prognosis is poor for patients with glioblastoma. Current therapeutic approaches including surgery, chemo-therapy and radiation don’t have good effects on the treatment of suffering patients. Median survival time for patients is about one year after treatment (Stuup et al., 2005; Wen and Kesari, 2008). So many researchers focus on the study of evaluating the physiological function and apoptosis of glioblastoma cells in order to detect more effective treatment methods. Here we present a method for isolation of high purity primary astrocyte from human glioblastoma specimen without fibroblast contamination (Hashemi et al., 2016).
Materials and Reagents
15 ml centrifuge tubes (Corning, Falcon®, catalog number: 352096 )
Petri dish culture (Nest Biotechnology, catalog number: 704001 )
No. 10 scalpel blade surgical tool (BD, catalog number: 371610 )
Cell strainer sieve (Corning, Falcon®, catalog number: 352340 )
50 ml centrifuge tubes (Corning, Falcon®, catalog number: 352070 )
T25 flask culture (Nest Biotechnology, catalog number: 707003 )
1 ml microtube (Nest Biotechnology, catalog number: 613111 )
24-well plates of polystyrene with high clarity (Nest Biotechnology, catalog number: 702001 )
5 ml pipette (Nest Biotechnology, catalog number: 326001 )
Glioblastoma multiforme sample (Human)
Hanks’ balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 24020117 )
Antibiotic-antimycotic (Thermo Fisher Scientific, GibcoTM, catalog number: 15240062 )
0.25% trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Trypan blue solution 0.4% (Sigma-Aldrich, catalog number: T8154 )
Primary antibody of rabbit anti-S100-beta (Sigma-Aldrich, catalog number: S2644 )
Primary antibody of rabbit anti-fibronectin (Abcam, catalog number: ab23751 )
FITC-conjugated goat anti-rabbit (Abcam, catalog number: ab6717 )
Dulbecco’s modified Eagle medium/F12 (DMEM/F12) (Thermo Fisher Scientific, GibcoTM, catalog number: 31331028 )
Phosphate buffer saline (PBS) (tablet) (Thermo Fisher Scientific, GibcoTM, catalog number: 18912014 )
Paraformaldehyde (powder) (Sigma-Aldrich, catalog number: P6148 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Bovine serum albumin (powder) (Sigma-Aldrich, catalog number: A2058 )
Culture medium (see Recipes)
Phosphate buffer saline (PBS) (see Recipes)
4% paraformaldehyde (see Recipes)
0.2% Triton X-100 (see Recipes)
10% bovine serum albumin (see Recipes)
Equipment
Ventilation hood (VISION SCIENTIFIC, model: VS-7120LV )
37 °C water bath (Memmert, model: WNB14 )
Centrifuge machine (Hettich Lab Technology, model: Universal 320R )
Hemocytometer (Sigma-Aldrich, catalog number: Z359629 )
CO2 cell culture incubator (Memmert, model: INC108 T2T3 )
Inverted fluorescence microscope (Optika, model: XDS-2FL )
Small forceps surgical tools (Fine Science Tools, catalog number: 11050-10 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hashemi, M. and Hadjighassem, M. (2017). Preparation of Primary Astrocyte Culture Derived from Human Glioblastoma Multiforme Specimen. Bio-protocol 7(8): e2241. DOI: 10.21769/BioProtoc.2241.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Brain tumor
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,242 | https://bio-protocol.org/exchange/protocoldetail?id=2242&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Lentiviral Barcode Labeling and Transplantation of Fetal Liver Hematopoietic Stem and Progenitor Cells
TK Trine A. Kristiansen
A Alexander Doyle
JY Joan Yuan
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2242 Views: 8813
Edited by: Ivan Zanoni
Reviewed by: Anupam Jhingran
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Cellular barcoding enables the dissection of clonal dynamics in heterogeneous cell populations through single cell lineage tracing. The labeling of hematopoietic stem and progenitor cells (HSPCs) with unique and heritable DNA barcodes, makes it possible to resolve donor cell heterogeneity in terms of differentiation potential and lineage bias at the single cell level, through subsequent transplantation and high-throughput sequencing. Furthermore, cellular barcoding allows for bona fide hematopoietic stem cells (HSCs) to be defined based on functional rather than immunophenotypic parameters.
This protocol describes the work flow of lentiviral cellular barcoding, tracking 14.5 days post coitum (d.p.c.) fetal liver (FL) Lineage-Sca+cKit+ (LSK) HSPCs following long-term reconstitution (Figure 1) (Kristiansen et al., 2016), but can be adapted to the cell type or time frame of choice.
Figure 1. Summary of experimental workflow (Naik et al., 2013)
Keywords: Cellular barcoding Lentiviral transduction Fetal liver Hematopoietic stem and progenitor cells Single cell lineage tracing Transplantation
Background
The cellular barcoding technique was initially established to resolve single cell dynamics upon transplantation of hematopoietic cells in vivo and has in recent years contributed significantly to our appreciation of the functional heterogeneity within blood cell populations in a transplantation setting (Schepers et al., 2008; Gerrits et al., 2010; Lu et al., 2011; Naik et al., 2013; Verovskaya et al., 2013; Kristiansen et al., 2016). The generation and characterization of lentiviral barcode libraries, the importance of library complexity as well as the associated analytical challenges have been carefully reviewed (Bystrykh et al., 2014; Naik et al., 2014; Bystrykh and Belderbosv, 2016) and need to be considered before starting this protocol to ensure proper experimental design. The current protocol pertains our adaptation of the technology as seen in our recent article (Kristiansen et al., 2016), to trace the long-term reconstitution capacity of FL derived HSPCs.
Materials and Reagents
96-well non-treated plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 260836 )
Tissue paper (KCWW, Kimberly-Clark, catalog number: 75512 )
Autoclaved 1.5 ml Eppendorf tubes (Fisher Scientific, FisherbrandTM, catalog number: 05-408-129 )
50 ml tubes (Corning, Falcon®, catalog number: 352070 )
1 ml pipette tips (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2179-05-HR )
Cell strainers, 40 µm (Corning, catalog number: 431750 )
60 mm Petri-dishes (Corning, catalog number: 430166 )
Cup filters, 50 µm (BD, BD Biosciences, catalog number: 340630 )
1 ml syringe with 29 gauge ½ inch needle (Terumo Medical, catalog number: BS-N1H2913 )
FACS tubes (Corning, Falcon®, catalog number: 352058 )
Mice: Males and females of appropriate experimental genotypes for timed pregnancies
Recipient mice of the appropriate experimental genotype
One mouse of the appropriate experimental genotype for support bone marrow cells
Note: This protocol was optimized using C57BL/6 mice. An example of animal usage is shown for a litter of 6 pups (Figure 2). If desired, donor derived cells can be distinguished from support and recipient derived cells using congenic mouse strains. However, this is not necessary since barcoded donor cells can be distinguished based on lentiviral GFP expression.
Optional: We recommend 2 recipients for each biological replicate containing HSPCs pooled from 3 pups (Figure 2), see discussion (Notes).
Virus: Concentrated lentiviral supernatants containing barcode library
Retronectin (Takara Bio, Clontech, catalog number: T100A )
Sterile PBS (GE Healthcare, catalog number: SH30028.02 )
Antibodies
Ter119 biotin (Biolegend, catalog number: 116204 )
Ter119 PE-Cy5 (Biolegend, catalog number: 116210 )
CD3 PE-Cy5 (Biolegend, catalog number: 100310 )
Gr1 PE-Cy5 (Biolegend, catalog number: 108410 )
B220 PE-Cy5 (Biolegend, catalog number: 103210 )
Sca1 PE-Cy7 (Biolegend, catalog number: 108114 )
c-kit APC (Biolegend, catalog number: 105812 )
StemSpanTM SFEM (SFEM) (STEMCELL Technologies, catalog number: 09650 )
Penicillin/Streptomycin (P/S) solution (Nordic Biolabs, catalog number: SV30010 )
Cytokines
SCF (PreproTech, catalog number: 250-03 )
FLT3 (PreproTech, catalog number: 300-19 )
IL3 (PreproTech, catalog number: 213-13 )
IL6 (PreproTech, catalog number: 216-16 )
IL7 (PreproTech, catalog number: 217-17 )
Trypan blue (Sigma-Aldrich, catalog number: T6146 )
Anti-Biotin MicroBeads (Miltenyi Biotec, catalog number: 130-090-485 )
7AAD (Sigma-Aldrich, catalog number: A9400 )
10% bovine serum albumin (BSA) in Iscove’s MDM (STEMCELL Technologies, catalog number: 09300 )
Ciprofloxacin, 250 mg/tablet (Teva Pharmaceutical Industries, catalog number: 01 16 40 )
Agencourt AMPure XP beads (Beckman Coulter, catalog number: A63880 )
Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, catalog number: Q32854 )
High Fidelity Taq polymerase (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11304011 )
High Sensitivity DNA Bioanalyzer Kit (Agilent Technologies, catalog number: 5067-4626 )
BSA ≥ 98% (Sigma-Aldrich, catalog number: A9647 )
EDTA (Sigma-Aldrich, catalog number: E5134 )
HBSS without MgCl2 (Thermo Fisher Scientific, GibcoTM, catalog number: 14175053 )
Sodium chloride (NaCl)
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: 74255 )
Proteinase K
Staining buffer (see Recipes)
Lysis buffer (see Recipes)
Equipment
Dissection tools: fine tipped tweezers and scissors for FL dissection
Pestle and mortar
Pipette
Centrifuge with temperature control (for 50 and 15 ml tubes) (Sigma Laborzentrifugen, model: 3-18K , catalog number: 10290)
Centrifuge with temperature control (for Eppendorf tubes) (Beckman Coulter, model: Microfuge® 20R centrifuge , catalog number: B31607)
MACS columns (Miltenyi Biotec, catalog number: 130-042-401 )
MACS separator magnet (Miltenyi Biotec, model: QuadroMACSTM separator , catalog number: 130-090-976)
Small animal heat lamp
Cell culture room and equipment certified for lentivirus work
Agilent 2100 Bioanalyzer Instrument (Agilent Technologies, model: 2100 Bioanalyzer Instrument )
Qubit Fluorometer
DynaMag 96 well plate magnet (Thermo Fisher Scientific, catalog number: 12331D )
BD FACS Aria III (BD, model: FACS Aria III) or comparable sorter
Deep sequencing facility and reagents (e.g., Illumina MiSeq system [Illumina, model: MiSeq system ] with MiSeq Reagent Kit v3 150-cycle or the Ion PGM System [Thermo Fisher Scientific, model: Ion PGM System ] with Ion 314 Chip Kit v2)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kristiansen, T. A., Doyle, A. and Yuan, J. (2017). Lentiviral Barcode Labeling and Transplantation of Fetal Liver Hematopoietic Stem and Progenitor Cells. Bio-protocol 7(8): e2242. DOI: 10.21769/BioProtoc.2242.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Cell Biology > Cell engineering > Barcoding
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,243 | https://bio-protocol.org/exchange/protocoldetail?id=2243&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Growth Assay for the Stem Parasitic Plants of the Genus Cuscuta
V Volker Hegenauer
Max Welz
MK Max Körner
MA Markus Albert
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2243 Views: 11188
Edited by: Andrea Puhar
Reviewed by: Sollapura J. Vishwanath
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Cuscuta spp. are widespread obligate holoparasitic plants with a broad host spectrum. Rootless Cuscuta penetrates host stems with so called haustoria to form a direct connection to the host vascular tissue (Dawson et al., 1994; Lanini and Kogan, 2005; Kaiser et al., 2015). This connection allows a steady uptake of water, assimilates and essential nutrients from the host plant and therefore enables Cuscuta growth and proliferation. To quantify the parasites’ ability to grow on potential host plants one can use the quantitative growth assay (Hegenauer et al., 2016) described herein, which exclusively utilizes fresh weight measurement as readout.
Keywords: Cuscuta reflexa Dodder Growth assay Haustoria Holoparasitic plant
Background
In research fields of plant-pathogen resistance, either in basic research or in economic plant breeding, it is unavoidable to have an assay to quantify resistance against pathogen infection. To quantify the resistance/susceptibility of different plants against Cuscuta infections the simplest way is to measure the gain of biomass of Cuscuta growing on a plant of interest. This is a reliable method since Cuscuta is a holoparasite and its gain of biomass is completely depending on its ability to successfully infect another plant. Thus, unsuccessful infection of a plant leads to a decrease in biomass and subsequently the death of the parasite Cuscuta.
Materials and Reagents
Gloves and lab suit (Cuscuta sap causes stains on skin and clothes)
Mature Cuscuta (e.g., Cuscuta reflexa; see Note 1 for cultivation)
Putative host plants
Equipment
Weighing machine/balance (mass range between 0.01-100 g)
Wooden planting rods (bamboo; diameter appropriate to the particular host plants stem diameter), available in gardening shops
Scissor to cut Cuscuta shoots
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hegenauer, V., Welz, M., Körner, M. and Albert, M. (2017). Growth Assay for the Stem Parasitic Plants of the Genus Cuscuta. Bio-protocol 7(8): e2243. DOI: 10.21769/BioProtoc.2243.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease symptom
Plant Science > Plant immunity > Disease bioassay
Cell Biology > Tissue analysis > Macroscopic observation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,244 | https://bio-protocol.org/exchange/protocoldetail?id=2244&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Physical Removal of the Midbody Remnant from Polarised Epithelial Cells Using Take-Up by Suction Pressure (TUSP)
MB Miguel Bernabé-Rubio
DG David C. Gershlick
Miguel A. Alonso
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2244 Views: 8124
Edited by: Andrea Puhar
Reviewed by: Jingli CaoThirupugal Govindarajan
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
In polarised epithelial cells the midbody forms at the apical cell surface during cytokinesis. Once severed, the midbody is inherited by one of the daughter cells remaining tethered to the apical plasma membrane where it participates in non-cytokinetic processes, such as primary ciliogenesis. Here, we describe a novel method to physically remove the midbody remnant from cells and assess the possible effects caused by its loss (Bernabé-Rubio et al., 2016).
Keywords: Epithelial cells Midbody remnant Primary cilium Suction pressure Patch-clamp equipment
Background
The midbody or the Flemming body is the central part of the intercellular bridge formed between daughter cells during the final stages of mitosis. The abscission on either side of the bridge by the endosomal sorting complexes required for transport (ESCRT) machinery, results in the physical separation of the two daughter cells (Green et al., 2012). In addition to its known function in the regulation of mitosis, recent studies have begun to elucidate post-mitotic roles for the midbody. Due to its role in the initiation of lumen formation in kidney cells, the midbody has been postulated to serve as a polarity cue (Li et al., 2014). More recently, it has been demonstrated that the midbody remnant is directly involved in primary ciliogenesis by polarised Madin-Darby canine kidney (MDCK) cells (Bernabé-Rubio et al., 2016). It has been also found to have a role in formation of the dorsoventral axis during the development of Caenorhabditis elegans (Singh and Pohl, 2014), and in defining cell fate and differentiation (Kuo et al., 2011). Previous studies have used laser ablation to impair the function of the midbody remnant. When performed in cultured cell lines, however, laser ablation can result in cell death due to damage of the plasma membrane and proximal cytosolic elements. Accordingly, we have designed a gentle procedure, which we have called ‘take-up by suction pressure’ (TUSP). TUSP allows non-deleterious midbody remnant removal from the cell surface of epithelial cells. The fundamental principle is based on using a fine-aperture glass pipette attached to patch-clamp apparatus to physically remove the midbody with applied negative pressure (Figure 1).
Figure 1. Diagram of the TUSP procedure. A. An apical intercellular bridge forms during cytokinesis in polarised epithelial cells. B. After abscission, one of the daughter cells inherits the midbody as a remnant, which will be positioned over the apical cell surface. C-E. By using a glass pipette connected to path-clamp apparatus, the midbody remnant can be removed from cells if suction pressure is applied.
Materials and Reagents
12 mm glass coverslips #1 (VWR, catalog number: 631-0713 )
Gridded coverslips (optional) (Electron Microscopy Sciences, catalog number: 72265-12 )
Falcon 24-well plates (Corning, catalog number: 353047 )
Permanent marker (Faber-Castell Multimark 1523) (CultPens, catalog number: FC19628 )
1 mL syringe (BD, catalog number: 303172 )
25 G 1 ½ needle (BD, catalog number: 305127 )
Epithelial Madin-Darby canine kidney (MDCK II) from ATCC (ATCC, catalog number: CRL2936 )
DNA construct expressing a fluorescent midbody localised protein (e.g., Cherry-tubulin, Addgene, catalog number: 49149 )
Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich, catalog number: D5796 )
Fetal bovine serum (Sigma-Aldrich, catalog number: F7524 )
Penicillin-streptomycin solution (Sigma-Aldrich, catalog number: P4333 )
Lipofectamine 2000 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668027 )
Hank’s balanced salt solution (HBSS) without phenol red (Sigma-Aldrich, catalog number: H8264 )
1 M HEPES solution (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
Equipment
Autoclave
Tweezers (Fine Science Tools, catalog number: 11251-20 )
LSM 710 confocal microscope (ZEISS, model: LSM 710 ) or any other inverted confocal microscope with 25x and 40x oil objectives and a numerical aperture of 0.8 and 1.3, respectively
Patch clamp equipment (Axon Instruments)
Microscope BX51 (Olympus, model: BX51 )
Borosilicate glass with filament for pipette fabrication. Outer diameter: 1.5 mm, inner diameter: 0.86 mm, 10 cm length (Linton Instrumentation, catalog number: BF150-86-10 )
CO2 cell culture incubator (Thermo Electron Corporation)
P-97 Flaming/Brown micropipette puller (Sutter Instruments, model: P-97 )
Sutter MP-225 motorised micromanipulators (Sutter Instruments, model: MP-225 )
Software
ImageJ (https://imagej.nih.gov/ij, National Institutes of Health)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Developmental Biology > Morphogenesis > Cell structure
Cell Biology > Organelle isolation > Midbody
Cell Biology > Cell structure > Cell surface
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,245 | https://bio-protocol.org/exchange/protocoldetail?id=2245&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Automated Tracking of Root for Confocal Time-lapse Imaging of Cellular Processes
Mehdi Doumane*
CL Claire Lionnet*
VB Vincent Bayle
Yvon Jaillais
MC Marie-Cécile Caillaud
*Contributed equally to this work
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2245 Views: 10157
Edited by: Tie Liu
Reviewed by: Shahin S. AliIsabelle Colas
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Here we describe a protocol that enables to automatically perform time-lapse imaging of growing root tips for several hours. Plants roots expressing fluorescent proteins or stained with dyes are imaged while they grow using automatic movement of the microscope stage that compensates for root growth and allows to follow a given region of the root over time. The protocol makes possible the image acquisition of multiple growing root tips, therefore increasing the number of recorded mitotic events in a given experiment. The protocol also allows the visualization of more than one fluorescent protein or dye simultaneously, using multiple channel acquisition. We particularly focus on imaging of cytokinesis in Arabidopsis root tip meristem, but this protocol is also suitable to follow root hair growth, pollen tube growth, and other regions of root over time, in various plant species. It may as well be amenable to automatically track non-plant structures with an apical growth.
Keywords: Cell division Mitosis Cytokinesis Root Microscopy Tracking Arabidopsis Phosphoinositide
Background
Cytokinesis is the last step of cell division, when the mother cell cytoplasm is partitioned between two daughter cells (Lipka et al., 2015). In plants, it is achieved through the centrifugal expansion of a cell plate in the division plane, which eventually becomes the newly synthetized cell wall between the cells that underwent mitosis (Buschmann and Zachgo, 2016; Müller and Jürgens, 2016). Plant cells, being embedded in a stiff cell wall, cannot migrate. Orientation of cell division together with elongation is therefore critical for organ morphogenesis. Root meristems are a good model to study cell division because they are easily amenable to microscopy techniques without the need of dissection. However, roots undergoing cell division grow in length, and therefore require manual adjustment of the observation field over time. This protocol allows easy time-lapse imaging of cytokinesis, and of other cellular processes.
Materials and Reagents
12-well microplates (Corning, Costar®, catalog number: 3513 )
Microscope slides 76 x 26 x 1.1 mm (RS Components, catalog number: ISO 8037 )
Microscope coverslips 22 x 60 mm (Thermo Fisher Scientific, Menzel-Gläser, catalog number: 630-2102 )
Observation chambers, Lab-Tek II Chambered Coverglass W/Cover #1.5 Borosilicate (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 155360 )
Strait scalpel blades (e.g., Swann Morton, straights mounted BS EN 27740 blades)
Arabidopsis thaliana, 4 to 7 days-old seedlings of wild-type genotype, or expressing membrane and/or cell plate-localized fluorescent fusion proteins (e.g., 2xp35S::MP:YFP in Col-0, where MP is a myristoylation and palmitoylation signal sequence [Martinière et al., 2012; Simon et al., 2016]). Seedling can be grown vertically in squared plates (90 x 90 x 15) or round plates to get intact growing roots
Murashige and Skoog (MS) medium (Sigma-Aldrich, catalog number: M5519 )
Agar (Sigma-Aldrich, catalog number: A7921-1KG )
FM4-64 (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: T-3166 )
Suitable fluorescent dyes (alternative) or fluorescent proteins for registration
Plasma membrane or cell wall dyes such as FM4-64 or propidium iodide (Sigma-Aldrich, catalog number: P4864 )
Nuclei dyes such as Hoechst (Thermo Fisher Scientific, InvitrogenTM, catalog number: H21486 )
Note: The registration step consists in analysing two successive images and superimposing them using relative position registration (thereafter called registration). For this registration purpose, ImageJ needs to find common features in both images. It is therefore required to have in one of the channel imaged a fluorescent staining that is relatively stable over time. This will allow the imageJ plugin Turboreg to compare two successive images and accommodate the displacement (see Note 1). As stable fluorescent marker with easily recognizable features, we successfully used: 1) plasma membrane localised fluorescent proteins such as myristoylated and palmitoylated YFP (Martinière et al., 2012; Simon et al., 2016), or vital plasma membrane dyes such as FM4-64 (alternatively, other dyes such as propidium iodide [Sigma-Aldrich, catalog number: P4864 ] can be used), and 2) nucleus localised fluorescent proteins such as H2B-RFP (Federici et al., 2012; Larrieu et al., 2015), or vital nuclei dyes such as Hoechst (Thermo Fisher Scientific, InvitrogenTM, catalog number: H21486 ). However, any other fluorescent protein or dye might be used, providing that it labels stable structure(s) over time and is photostable during the time-lapse acquisition (see Note 2).
Equipment
Inverted confocal microscope (e.g., Carl Zeiss, model: AxioObserver Z1 ), equipped with a spinning disk module (e.g., Yokogawa Electric, model: CSU-W1 [T3 model])
Metamorph and ImageJ software on the computer connected to the microscope
20 °C plant growth chamber with 24 h daylight (e.g., SANYO Electric, model: MLR-351 )
Small tweezers (e.g., straight fine tweezers)
Sterile hood
Software
ImageJ (https://imagej.nih.gov/ij/; Schneider et al., 2012; this protocol was tested with version 1.49p but should be compatible with newer versions) with the plugins Turboreg (P. Thévenaz, http://bigwww.epfl.ch/thevenaz/turboreg/) and Stackreg (P. Thévenaz, http://bigwww.epfl.ch/thevenaz/stackreg/) installed are required. Fiji (http://fiji.sc/; Schindelin et al., 2012) could be used instead of ImageJ because it bundles the required plugins. To add the plugins, simply download them and copy them in ImageJ/plugins folder.
Download the three files (CL_ini-Pos-Ch-finished.JNL; CL_ini-Pos-Ch.JNL; CL-root-track-MM_63multiD.ijm) attached as a zip file (named Files_BioProtocol_Doumane, as well available at this url http://www.ens-lyon.fr/RDP/SiCE/METHODS.html) and extract them in the folder C:\MM\app\mmproc\journal\root-tracking\. The ImageJ macro file CL-root-track-MM_63multiD.ijm should be edited according to the calibration of the objective used. Open the file in ImageJ (use the menu Open>File...), search for the line with ‘objective’, and replace the number 0.2063 with the real size of the pixel in microns, on this line and the next one (when using our 63x objective, 1 pixel is 0.2063 microns wide; Figure 1; Note 5). Save the file. Install the macro by selecting it in Plugins > Macro > Install. CL-root-track-MM_63multiD should appear in the Plugins > Macros > lower panel (using a 63x objective).
Figure 1. Macro file .ijm in the Fiji editor. Replace the number 0.2063 (here in lines 81 and 82) by the real size of the pixel (in microns) on your microscope, with the objective that will be used.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Doumane, M., Lionnet, C., Bayle, V., Jaillais, Y. and Caillaud, M. (2017). Automated Tracking of Root for Confocal Time-lapse Imaging of Cellular Processes. Bio-protocol 7(8): e2245. DOI: 10.21769/BioProtoc.2245.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > Morphogenesis
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,246 | https://bio-protocol.org/exchange/protocoldetail?id=2246&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Virtual Screening of Transmembrane Serine Protease Inhibitors
AP Antti Poso*
TT Topi Tervonen*
JK Juha Klefström*
*Contributed equally to this work
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2246 Views: 8524
Edited by: HongLok Lung
Reviewed by: Shyam SrivatsTim Andrew Davies SmithVanesa Olivares-Illana
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
The human family of type II transmembrane serine proteases includes 17 members. The defining features of these proteases are an N-terminal transmembrane domain and a C-terminal serine protease of the chymotrypsin (S1) fold, separated from each other by a variable stem region. Recently accumulated evidence suggests a critical role for these proteases in development of cancer and metastatic capacity. Both the cancer relevance and the accessibility of the extracellularly oriented catalytic domain for therapeutic and imaging agents have fueled drug discovery interest in the type II class of transmembrane serine proteases. Typically, the initial hit discovery processes aim to identify molecules with verifiable activity at the drug target and with sufficient drug-like characters. We present here protocols for structure-based virtual screening of candidate ligands for transmembrane serine protease hepsin. The methods describe use of the 3D structure of the catalytic site of hepsin for molecular docking with ZINC, which is a molecular database of > 30 million purchasable compounds. Small candidate subsets were experimentally tested with demonstrable hits, which provided meaningful cues of the ligand structures for further lead development.
Keywords: Molecular modeling Small-molecules Molecular docking Cancer Drug discovery
Background
Controlled proteolytic activity plays a fundamental role in cellular processes and signaling, as evidenced by the presence of proteases in all organisms, including viruses, prokaryotes and eukaryotes. Not surprisingly, aberrantly regulated protease activity is causal to wide variety of human pathologies such as cardiovascular and inflammatory diseases, osteoporosis, neurological disorders and cancer (Turk, 2006; Bachovchin and Cravatt, 2012). In particular, development of primary cancer and metastatic capacity has been linked to several different classes of proteases including matrix metalloproteinases (MMPs), cysteine proteases (cathepsins) and membrane-associated serine proteases (Lopez-Otin and Matrisian, 2007). Recent clinical, genetic and functional data, suggesting a critical role for membrane-associated serine proteases in solid cancers, including cancer of prostate, ovarian and breast, have prompted new interest in the development of small molecule serine protease inhibitors for the treatment of cancer. Hepsin is a type II transmembrane serine protease and an attractive target for serine protease drug development due to frequent hepsin overexpression in common solid cancers, such as prostate and breast cancer, confinement of its overexpression on the membranes of cancer cells and due to positioning of the catalytic domain to the extracellular, i.e., more reachable, side of the cells (Antalis et al., 2010).
We describe here protocols for structure-based virtual screening of serine protease inhibitors using the catalytic site of hepsin for docking with drug-like subset of ZINC database. On the basis of virtual screening results, altogether 24 candidate compounds were purchased for further biochemical validation. Cell-free ELISA-based fluorogenic enzymatic assay using recombinant hepsin and fluorogenic peptide substrate Boc-Gln-Arg-Arg-AMC (BACHEM) was used for experimental validation and 30% inhibition of peptidolytic activity was set as threshold. Cut-off value was based on a notion that with the initial high micromolar concentration of compounds more than 30% inhibition would be required to determine reasonable IC50 value (Goswami et al., 2015; Tervonen et al., 2016) (Figures 1A and 1B). With these criteria, 3 out of 24 tested compounds showed inhibition potency (Tervonen et al., 2016). In conclusion, even though structure-based virtual screening is often considered as a complementary drug screening approach, the protocols reported here allowed us to demonstrate the feasibility and provided meaningful structural scaffolds for further development of specific serine protease inhibitors. However, it is important to stress that virtual screening hits typically do not demonstrate high potency, which is also true to the present screen. High-affinity ligands typically become available only after skillful medicinal chemistry optimization of selected hit structures.
Figure 1. Schematic figure illustrating the workflow. A. Virtual screening (compound) library is prepared and the target protein structure analyzed and prepared. The virtual screening is carried out by docking (Glide SP/XP) and the putative binders are validated by in vitro biochemical assays. B. Examples of candidate ligands (a-d).
The virtual screening protocol presented here is a modified version from the original protocols described in our recent research paper (Tervonen et al., 2016). The modifications make the protocol fully compatible with the most updated versions of ZINC database and Schrödinger software. While the current virtual screening protocol is tailored for users of Schrödinger software and ZINC database, the protocol is versatile and also compatible with other molecular modeling packages. However, implementation of the present virtual screening protocol with other modeling packages would require a careful platform-specific validation of the docking settings. As a guidance, we provide a general overview of the validation procedures used in the present screen.
Materials and Reagents
ViewPlate-96 black assay plates (PerkinElmer, catalog number: 6005225 )
Recombinant human hepsin protein (R&D Systems, catalog number: 4776-SE-010 )
DMSO (Sigma-Aldrich, catalog number: D8418 )
Fluorogenic peptide substrate Boc-Gln-Arg-Arg-AMC (Bachem, catalog number: I-1655.0025 )
Small-molecule compounds were purchased either from Asinex Corporation (Winston-Salem, NC, http://www.asinex.com) or MolPort (Riga, Latvia, https://www.molport.com/shop/index)
WX-UK1 was a kind gift from Dr. Ramachandra (Aurigene Discovery Technologies Limited, Bangalore, India), however, it is also commercially available (for example, AURUM Pharmatech, catalog number: Z-3200 )
Trizma base (Tris) (Sigma-Aldrich catalog number: T1503 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: 499609 )
Brij-35 (Brij L23 30% solution in H2O) (Sigma-Aldrich, catalog number: B4184 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 31434-M )
Activation buffer for recombinant human hepsin protein (see Recipes)
Assay buffer for recombinant human hepsin protein (see Recipes)
Equipment
ELISA plate reader FLUOstar Omega (BMG LABTECH, model: FLUOstar Omega )
Computer hardware provided by CSC - IT Center for Science Ltd (Espoo, Finland)
HP Proliant SL230s (Hewlett Packard Development Company, model: SL230s )
Intel Xeon E5-2670 2.6GHz processors (100 cores with 16 GB memory per core) (Intel Corporation, model: E5-2670 )
Software
Modeling software
Schrödinger Suite (Schrödinger, LLC, New York, NY) with Protein Preparation Wizard (Sastry et al., 2013), LigPrep, MacroModel and Glide (Friesner et al., 2004 and 2006; Halgren et al., 2004) modules, and a protocol version 2016-2 (https://www.schrodinger.com/suites/small-molecule-drug-discovery-suite)
Databases
Screening and validation: ZINC database (downloadable via http://zinc15.docking.org/). ZINC database includes over 100 million purchasable compounds in 3D formats (Sterling and Irwin, 2015)
Protein structure database (http://www.rcsb.org/pdb/home/home.do)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Poso, A., Tervonen, T. and Klefström, J. (2017). Virtual Screening of Transmembrane Serine Protease Inhibitors. Bio-protocol 7(8): e2246. DOI: 10.21769/BioProtoc.2246.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,247 | https://bio-protocol.org/exchange/protocoldetail?id=2247&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mimicking Angiogenesis in vitro: Three-dimensional Co-culture of Vascular Endothelial Cells and Perivascular Cells in Collagen Type I Gels
MA Markus Auler
LP Lena Pitzler
EP Ernst Pöschl
ZZ Zhigang Zhou
BB Bent Brachvogel
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2247 Views: 17368
Reviewed by: Joseph C. Chen
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Angiogenesis defines the process of formation of new vascular structures form existing blood vessels, involved during development, repair processes like wound healing but also linked to pathological changes. During angiogenic processes, endothelial cells build a vascular network and recruit perivascular cells to form mature, stable vessels. Endothelial cells and perivascular cells secret and assemble a vascular basement membrane and interact via close cell-cell contacts. To mimic these processes in vitro we have developed a versatile three-dimensional culture system where perivascular cells (PVC) are co-cultured with human umbilical cord vascular endothelial cells (HUVEC) in a collagen type I gel. This co-culture system can be used to determine biochemical and cellular processes during neoangiogenic events with a wide range of analyses options.
Keywords: Endothelial cells Perivascular cells Pericytes Angiogenesis Co-culture Collagen gel
Background
The coordinated interaction between endothelial and perivascular cells is essential to form a stable vascular network according to the local needs within a given tissue. Multiple molecular components contribute to the interactions but are still poorly understood. Various growth factors are needed to attract endothelial cells to sites of low oxygen concentrations and build new vessels that are then covered by perivascular cells. Both cell types interact to secrete a specialized extracellular matrix and stabilize the newly formed vessels. In the past multiple assays have been established to analyze vascular cell interaction and vessel-like network formation on two-dimensional matrigel substrates, but those are limited in providing information about initial steps of endothelial-perivascular cell interaction and vascular basement membrane formation in a three-dimensional microenvironment. In addition, well characterized perivascular cell suitable for culture experiments were missing.
We have previously isolated cells with perivascular characteristics, as they express pericyte-specific markers, produce and secrete extracellular matrix proteins and stimulate angiogenic processes in vivo (Brachvogel et al., 2005 and 2007). These cells were used to establish a co-culture system with human umbilical vein endothelial cells and study critical steps in neoangiogenesis upon interaction of the two cell types in a three-dimensional microenvironment (Pitzler et al., 2016; Zhou et al., 2016).
The co-cultures showed a superior activity to promote the formation endothelial tube formation and stabilization by perivascular cell recruitment and basement membrane formation. The culture system allows to monitor migration and interaction of vascular cells by time-lapse microscopy and to study the deposition of basement membrane protein by immunofluorescence analysis. To quantify and isolate endothelial and perivascular cells from co-cultures immunomagnetic or flow cytometry sorting approaches can be used and cell type-specific global changes in mRNA and miRNA expression can be analyzed by subjecting isolated RNA from the separated cell populations to microarray analysis or RNA sequencing. Moreover, the effects of anti- and pro-angiogenic substances on endothelial-perivascular cell interaction can be analyzed in vitro. Hence, the three-dimensional culture protocol allows to study cellular, biochemical and transcriptional events during neoangiogenesis and to characterize the pro- and anti-angiogenetic effects of molecules on endothelial perivascular cell interaction ex vivo.
Materials and Reagents
15 ml tubes (Greiner Bio One International, catalog number: 188271 )
100 mm TC-treated cell culture dish (Corning, Falcon®, catalog number: 353003 )
1.5 ml tubes (SARSTEDT, catalog number: 72.690.001 )
24-well-plate (Corning, Costar®, catalog number: 3524 )
T75-flask (VWR, catalog number: 734-0050 )
48-well-plate (Corning, Costar®, catalog number: 3548 )
10 ml syringe (BD, catalog number: 309604 )
Sterile syringe filter with a 0.22 µm pore size (EMD Millipore, catalog number: SLGP033RB )
Disposable HSW FINE-JECT® needles (Henke Sass Wolf, catalog number: 4710004012 )
Pipettes Gilson (10 µl, 20 µl, 100 µl, 1,000 µl, 5 ml)
Macro pipet tips (VWR, catalog number: 89368-994 )
Microscope cover glasses: squares (Fisher Scientific, catalog number: S175222 )
Adhesion slides, Menzel Gläser, SuperFrost® Plus (VWR, catalog number: 631-9483 )
HUVEC (human umbilical cord vascular endothelial cell) (Lonza, catalog number: CC-2519 or self-isolation of HUVECs according to Baudin et al., 2007)
Isolated perivascular cells/pericytes (PVC) (see Note 1)
AnxA5-LacZ mice (Anxa5tm1Epo) (Brachvogel et al., 2003)
Collagenase type II (Worthington Biochemical, catalog number: LS004176 )
DNase I recombinant (Roche Diagnostics, catalog number: 04536282001 )
Fluorescein-di-(β-D-galactopyranoside) (FDG) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: F1179 )
Propidium iodide (PI) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: P3566 )
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 31966021 )
Fetal calf serum (FCS) (Biochrom, catalog number: S 0115 )
Penicillin-streptomycin (P/S) (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Gelatin from porcine skin (Sigma-Aldrich, catalog number: G2500 )
Sodium bicarbonate (NaHCO3) (EMD Millipore, catalog number: 1.6329.1000 )
Rat tail type I collagen solution (Corning, catalog number: 354236 )
Sodium hydroxide (NaOH) (VWR, catalog number: 28244.295 )
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 18912014 )
Trypsin/EDTA (Biochrom, catalog number: L 2153 )
Endothelial growth medium 2 (EGM2) (PromoCell, catalog number: C-22111 )
Recombinant VEGF-A/Vascular endothelial growth factor (Biomol, catalog number: 94900 )
Recombinant PDGF/Platelet-derived growth factor-BB (Biomol, catalog number: 94968 )
Ascorbic acid phosphate (Sigma-Aldrich, catalog number: A8960-5G )
Methanol (VWR, catalog number: 20903.461 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418-100ML )
Tween-20 (Sigma-Aldrich, catalog number: P1379-500ML )
Bovine serum albumin (BSA) (SERVA Electrophoresis, catalog number: 11930.03 )
Anti-human CD31 (BD, BD Biosciences, catalog number: 555444 )
Anti-NG2-proteoglycan (EMD Millipore, catalog number: AB5320 )
Donkey-anti-rat Ig, Cy2 conjugated (Jackson ImmunoResearch, catalog number: 712-225-150 )
Donkey, anti-rabbit Ig, Cy2 conjugated (Jackson ImmunoResearch, catalog number: 711-225-152 )
Donkey, anti-rabbit Ig, Cy5 conjugated (Jackson ImmunoResearch, catalog number: 711-175-152 )
Donkey, anti-goat Ig, Cy2 conjugated (Jackson ImmunoResearch, catalog number: 705-225-147 )
Mounting solution
CFSE (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C1157 )
SNARF-1 (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: S22801 )
MCDB-131 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 10372019 )
Basic fibroblast growth factor (bFGF) (ReliaTech, catalog number: 300-003 )
Epidermal growth factor (EGF) (Biomol, catalog number: 97052 )
Insulin solution human (Sigma-Aldrich, catalog number: I9278 )
Heparin
Hydrocortisone
10x DMEM, 10x Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, catalog number: D2429-100ML )
Sodium pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11360070 )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: 1064041000 )
Autoclaved distilled H2O
Proliferation medium (see Recipes)
PVC culture medium (see Recipes)
HUVEC culture medium (see Recipes)
2x medium-mix (see Recipes)
Collagen solution (see Recipes)
Tris-buffered saline (TBS) (see Recipes)
Equipment
Centrifuge (Eppendorf, model: 5415 R )
Hemocytometer (LO-Laboroptik, model: Neubauer-Improved )
CO2 cell incubator (Heraeus)
Centrifuge Labofuge (Heraeus Sepatech, model: Labofuge GL )
Autoclave
SteREO Lumar.V12 (Zeiss, model: SteREO Lumar.V12 )
Axiovert 40 CFL (Zeiss, model: Axiovert 40 CFL )
Axioplan 2 (Zeiss, model: Axioplan 2 )
Water bath (Köttermann)
Vortex mixer (Scientific Industries)
Inverted microscope Eclipse TE2000-U (Nikon Instruments, model: Eclipse TE2000-U )
Fluorescence-activated cell sorting (MoFlow, Cytomation)
Biosafety cabinet LaminAir HB 2448 (Heraeus, model: LaminAir HB 2448 )
Software
ImageJ (Fiji)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Auler, M., Pitzler, L., Pöschl, E., Zhou, Z. and Brachvogel, B. (2017). Mimicking Angiogenesis in vitro: Three-dimensional Co-culture of Vascular Endothelial Cells and Perivascular Cells in Collagen Type I Gels. Bio-protocol 7(8): e2247. DOI: 10.21769/BioProtoc.2247.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Endothelial stem/progenitor cell
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,248 | https://bio-protocol.org/exchange/protocoldetail?id=2248&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation, Culturing, and Differentiation of Primary Myoblasts from Skeletal Muscle of Adult Mice
LH Lubna Hindi
JM Joseph D. McMillan
DA Dil Afroze
SH Sajedah M. Hindi
Ashok Kumar
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2248 Views: 25655
Edited by: Antoine de Morree
Reviewed by: Xiaoyi ZhengRakesh Bam
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Myogenesis is a multi-step process that leads to the formation of skeletal muscle during embryonic development and repair of injured myofibers. In this process, myoblasts are the main effector cell type which fuse with each other or to injured myofibers leading to the formation of new myofibers or regeneration of skeletal muscle in adults. Many steps of myogenesis can be recapitulated through in vitro differentiation of myoblasts into myotubes. Most laboratories use immortalized myogenic cells lines that also differentiate into myotubes. Although these cell lines have been found quite useful to delineating the regulatory mechanisms of myogenesis, they often show a great degree of variability depending on the origin of the cells and culture conditions. Primary myoblasts have been suggested as the most physiologically relevant model for studying myogenesis in vitro. However, due to their low abundance in adult skeletal muscle, isolation of primary myoblasts is technically challenging. In this article, we describe an improved protocol for the isolation of primary myoblasts from adult skeletal muscle of mice. We also describe methods for their culturing and differentiation into myotubes.
Keywords: Myoblast Skeletal muscle Myogenesis MyoD Pax7 Myogenin Myogenic differentiation Hind limb muscle
Background
Myogenesis is a complex and highly orchestrated process that involves the determination of multipotential mesodermal cells to give rise to myoblasts, exit of myoblasts from the cell cycle, and their eventual differentiation into skeletal muscle fibers. Myogenesis is regulated by the sequential expression of myogenic regulatory factors (MRFs), a group of basic helix-loop-helix transcription factors that include Myf-5, MyoD, myogenin, and MRF4. Myf-5 and MyoD are the primary MRFs required for the formation, proliferation, and survival of myoblasts, whereas other MRFs such as myogenin and MRF-4 act late during myogenesis, activating gene expression of contractile proteins and other structural and metabolic proteins (Buckingham et al., 2003; Bentzinger et al., 2012).
Myogenesis is also regulated by a number of transcription factors and several noncoding RNAs, which act at specific steps including commitment of progenitor (satellite) cells to myogenic lineage and myoblast proliferation, differentiation, and fusion (Yin et al., 2013; Simionescu-Bankston and Kumar, 2016). Initial experiments for studying the role of various regulatory proteins in myogenesis are performed using cultured myoblasts. There are several myoblastic cell lines (e.g., C2C12, L6, BC3H1, and MM14) that differentiate into myotubes upon incubation in differentiation medium. These cell lines have also been used to establish myotube cultures to investigate the effects of various molecules on myotube growth and atrophy. However, there is often some degree of variability in results potentially due to the origin of cells, culture conditions, and passage number. The use of primary myoblasts is highly recommended because they are devoid of the side-effects characteristic of the immortalization process and their physiological relevance to the living organisms. Primary myoblasts can be isolated from the skeletal muscle of neonatal or adult mice. However, the process of isolation of myoblasts from neonatal muscle is more complex because it also requires Percoll density gradient centrifugation (Dogra et al., 2006). Some investigators also use fluorescence-activated cell sorting (FACS) approach to isolate primary myoblasts from digested muscle tissues especially to study regulation of quiescence and activation of these cells. However, FACS sorting is an expensive approach which requires several negative and positive selection antibodies and a cell sorter machine. Moreover, the yield of myoblasts is generally low and there are always chances of contamination during isolation of purified myoblasts by FACS technique. In our laboratory, we have adapted and standardized a previously published protocol (Rando and Blau, 1994) for the isolation of myoblasts from skeletal muscle of adult mice. This protocol is highly efficient for the generation of a large amount of purified myoblasts from skeletal muscle of adult mice (Ogura et al., 2015; Hindi and Kumar, 2016). The purity of the myoblasts can be assayed by immunostaining of the cells for Pax7 and MyoD proteins which are expressed in undifferentiated myoblasts. Moreover, primary myoblasts isolated using this protocol efficiently differentiate into multinucleated myotubes on incubation in differentiation medium and myotubes can be readily visualized by phase contrast microscopy or after immunostaining for myosin heavy chain (MyHC), a protein expressed in differentiated muscle cells (Hindi et al., 2014; Bohnert et al., 2016). Finally, like myogenic cell lines, the purified primary myoblasts can be stored in liquid nitrogen or -80 °C for unlimited time and can be regrown whenever required.
Materials and Reagents
Sterilization pouches (Fisher Scientific, catalog number: 01-812-51 )
100 x 20 mm-Petri dishes (Corning, catalog number: 430167 )
6-well plates (Corning, Falcon®, catalog number: 353046 )
1.5 ml Eppendorf tubes (USA Scientific, catalog number: 1615-5510 )
0.22 μm filter (EMD Millipore, catalog number: SLGP033RS )
15 ml sterile tubes (VWR, catalog number: 89004-368 )
1 ml pipette tip
Parafilm
10 ml serological pipette (Santa Cruz Biotechnology, catalog number: sc-200281 )
70 µm strainer (Fisher Scientific, catalog number: 22-363-548 )
50 ml sterile tubes (VWR, catalog number: 89004-364 )
30 µm filters (Milteny Biotech, catalog number: 130-041-407 )
0.45 μm filter (EMD Millipore, catalog number: SLHV033RS )
24-well plates (Corning, Falcon®, catalog number: 353047 )
Slip-tip syringe (BD, catalog number: 302833 )
Sterile cell scraper (Corning, Falcon®, catalog number: 353085 )
Adult mice (Mus musculus; 6-8-weeks old) (see Notes 7 and 8)
2,2,2-tribromoethanol (Avertin) (Sigma-Aldrich, catalog number: T48402 )
0.25% trypsin-ethylenediaminetetraacetic acid (EDTA) (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Primary antibody anti-Pax7 (mouse) (Developmental Studies Hybridoma Bank, catalog number: Pax7 )
Primary antibody anti-MyoD (rabbit) (Santa Cruz Biotechnology, catalog number: sc-304 )
Primary antibody anti-MyHC (mouse) (Developmental Studies Hybridoma Bank, catalog number: MF-20 )
Secondary antibody goat anti-rabbit Alexa Fluor® 488 conjugate (Thermo Fisher Scientific, Invitrogen, catalog number: A-11034 )
Secondary antibody goat anti-mouse Alexa Fluor® 568 conjugate (Thermo Fisher Scientific, Invitrogen, catalog number: A-11004 )
100% ethanol (Decon Labs, catalog number: 2701 )
Matrigel (Corning, catalog number: 354234 )
Dulbecco’s modified Eagle’s medium (DMEM) high glucose, pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11995065 )
Collagenase II (Worthington Biochemical, catalog number: LS004176 )
Ultra-pureTM water (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977015 )
Penicillin-streptomycin (Pen/Strep) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (HEPES) (1 M) (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437028 )
Recombinant human fibroblast growth factor-basic (bFGF) (PeproTech, catalog number: 100-18B )
Tris base (Fisher Scientific, catalog number: BP152-5 )
F-10 Nutrient mixture (Thermo Fisher Scientific, GibcoTM, catalog number: 11550043 )
Dulbecco’s modified Eagle’s medium (DMEM) (ATCC, catalog number: 30-2002 )
Horse serum (Thermo Fisher Scientific, GibcoTM, catalog number: 26050088 )
Dimethyl sulfoxide (DMSO) (Fisher Scientific, catalog number: BP231-100 )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: P6148 )
100% Triton X-100 (Fisher Scientific, catalog number: BP151-500 )
4’,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich, catalog number: D8417 )
70% ethanol (see Recipes)
10% Matrigel (see Recipes)
Collagenase II (see Recipes)
Digestion medium (see Recipes)
Collection/washing/mincing solution (see Recipes)
Neutralization/isolation media (see Recipes)
Basic fibroblast growth factor (bFGF) (see Recipes)
Myoblast growth medium (MGM) (see Recipes)
Post isolation washing medium (see Recipes)
Differentiation medium (DM) (see Recipes)
Freezing medium (see Recipes)
4% paraformaldehyde (PFA) (see Recipes)
0.3% Triton X-100 (see Recipes)
10% Triton X-100 (see Recipes)
Blocking solution (see Recipes)
DAPI (see Recipes)
Equipment
Autoclave
Dissection tools: Sterilized/autoclaved scissors and forceps
Biosafety cabinet (Thermo Fisher Scientific, Thermo ScientificTM, model: 1300 Series Class II , Type A2)
Bench top centrifuge for 1.5 ml Eppendorf tubes (Eppendorf, model: 5424/5424 R )
Bench top centrifuge for 15 ml and 50 ml tubes (Eppendorf, model: 5702/5702 R/5702 RH )
Heated incubator shaker (Eppendorf, New BrunswickTM, model: Excella E24 )
CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3578 )
Microscope (Nikon Instruments, model: Eclipse TE2000 )
Water bath (Thermo Fisher Scientific, model: Model 215 , catalog number: 15-462-15Q)
500 ml bottle
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hindi, L., McMillan, J. D., Afroze, D., Hindi, S. M. and Kumar, A. (2017). Isolation, Culturing, and Differentiation of Primary Myoblasts from Skeletal Muscle of Adult Mice. Bio-protocol 7(9): e2248. DOI: 10.21769/BioProtoc.2248.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Stem Cell > Adult stem cell > Muscle stem cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,249 | https://bio-protocol.org/exchange/protocoldetail?id=2249&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Explant Methodology for Analyzing Neuroblast Migration
KD Kirsty J. Dixon
AT Alisa Turbic
AT Ann M. Turnley
DL Daniel J. Liebl
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2249 Views: 9033
Reviewed by: Khyati Hitesh Shah
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
The subventricular zone (SVZ) in the mammalian forebrain contains stem/progenitor cells that migrate through the rostral migratory stream (RMS) to the olfactory bulb throughout adulthood. SVZ-derived explant cultures provide a convenient method to assess factors regulating the intermediary stage of neural stem/progenitor cell migration. Here, we describe the isolation of SVZ-derived RMS explants from the neonatal mouse brain, and the conditions required to culture and evaluate their migration.
Keywords: Neuroblasts Neural stem cells SVZ-derived explants Rostral migratory stream Matrigel in vitro
Background
The adult mammalian forebrain contains a neurogenic niche that lies alongside the lateral ventricle in rodents and humans alike, and is aptly named the subventricular zone (SVZ). In rodents, the SVZ is a thin ‘wedge’ of cells, covering the entire wall of the lateral ventricle (Mirzadeh et al., 2010; Paez-Gonzalez et al., 2014; Dixon et al., 2016). Within the SVZ the slow-dividing astrocyte-like type B cells differentiate into rapidly dividing type C neural progenitor cells (also known as transit amplifying cells) that give rise to doublecortin-positive type A neuroblasts, although oligodendrocytes and astrocytes are also capable of being produced (Garcia-Verdugo et al., 1998; Tavazoie et al., 2008; Rikani et al., 2013). In rodents, there are an estimated 10,000 to 30,000 neuroblasts produced daily. These neuroblasts form chains as they migrate through the rostral migratory stream (RMS) to the olfactory bulb (Lois and Alvarez-Buylla, 1994; Sun et al., 2010). Ablation studies suggest it takes approximately 2 days for fast dividing type C neural progenitor cells to populate the SVZ, and an additional 2.5 days for neuroblasts to appear (Doetsch et al., 1999). A small percentage of these neuroblasts are capable of migrating ectopically out of the RMS into surrounding tissues in naïve mice; however, this phenomenon is drastically increased following brain injury (Dixon et al., 2016). The ability of neuroblasts to redirect their migratory routes towards damaged tissues has been shown to have beneficial effects on brain recovery (Li et al., 2010; Dixon et al., 2015), which can occur as early as 3 days post-injury (Ramaswamy et al., 2005; Dixon et al., 2016).
The self-renewal capacity of stem cells in culture was first identified in 1992 by Reynolds and Weiss (Reynolds and Weiss, 1992). The authors used fine dissection to harvest a small piece of the adult mouse striatum, before trypsinizing, dissociating and culturing. This original protocol, and subsequent variations, are now widely used to grow neurospheres or monolayer cultures to assess factors regulating stem cell survival, proliferation and/or differentiation into neurons (Theus et al., 2012). These culturing systems rely on the presence of growth factors (i.e., fibroblast and epidermal growth factors) to maintain proliferative states, whereas the withdrawal of these factors induces rapid differentiation into mature neurons. Unfortunately, these conditions limit the ability to analyze factors that regulate type A neuroblasts, a transient stage between the stem cell and neuron. To counteract this limitation; pieces of SVZ-derived tissue can be harvested and cultured as explants in a Matrigel containing laminin and collagen, which maintains the neural stem cells in their neuroblast state, allowing them to migrate (Ward and Rao, 2005; Dixon et al., 2016). Furthermore, neuroblast migration from cultured SVZ explants has similar characteristics to those observed in the RMS. Here, we describe an RMS explant methodology, modified from Ward and colleague (Leong et al., 2011), used to study chain migration of SVZ-derived neuroblasts.
Materials and Reagents
35 mm cell culture dishes with 4 internal wells, each with a diameter of 10 mm (Greiner Bio One International, catalog number: 627170 )
10 cm cell culture dishes (Corning, catalog number: 353003 )
Pre-chilled (-20 °C) tissue culture pipette filter tips
10 µl tips (Corning, Axygen®, catalog number: TF-300-R-S )
200 µl tips (Corning, Axygen®, catalog number: TF-200-R-S )
1,000 µl tips (Corning, Axygen®, catalog number: TF-1000-R-S )
5 ml serological pipettes and pipette-boy (VWR, catalog number: 612-3702 )
1.5 ml Eppendorf microcentrifuge tubes (VWR, catalog number: 211-0007 )
3.2 ml disposable transfer pipette (Thermo Fisher Scientific, catalog number: BER202-1S )
1 ml insulin syringe with detachable needle (BD, catalog number: 329651 )
Ice tray and ice as available
Small biohazard bags as available
Marker pen (e.g., Sharpie) for labelling cell culture plates
1-2 postnatal day old C57Bl/6 wildtype mice (Animal Resources Centre, Australia) or from local animal supplier
Absolute ethanol (Sigma-Aldrich, catalog number: 24102 )
Hanks balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14170112 )
Growth factor reduced Matrigel (Corning, catalog number: 356230 )
Neurobasal medium (Thermo Fisher Scientific, GibcoTM, catalog number: 21103049 )
B27 supplement x50 (Thermo Fisher Scientific, GibcoTM, catalog number: 17504044 )
200 mM glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Penicillin/streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Recombinant murine fibroblast growth factor (FGF) basic 1 mg/ml (PeproTech, catalog number: 450-33 )
Recombinant murine epidermal growth factor (EGF) 1 mg/ml (PeproTech, catalog number: 315-09 )
Paraformaldehyde (Sigma-Aldrich, catalog number: 158127 )
Sodium phosphate dibasic (Na2HPO4) (Chem Supply, catalog number: SA026 )
Sodium dihydrogen phosphate monohydrate (NaH2PO4·H2O) (Chem Supply, catalog number: SO03310500 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S5881 )
DAPI (Thermo Fisher Scientific, GibcoTM, catalog number: D1306 )
Donkey serum (Sigma Aldrich, catalog number: D9663 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Goat anti-doublecortin (DCX) antibody (Santa Cruz Biotechnology, catalog number: sc-8066 or sc-271390 )
Note: The authors used sc-8066 , this antibody has been discontinued. A suggested alternative from Santa Cruz Biotechnology is sc-271390 .
Cy3-conjugated donkey anti-goat antibody (Jackson ImmunoResearch, catalog number: 705-165-147 )
80% ethanol solution (see Recipes)
Complete neurobasal medium (see Recipes)
Complete Matrigel (see Recipes)
0.1 M phosphate buffered saline (PBS) (see Recipes)
4% paraformaldehyde (PFA) (see Recipes)
PBS containing DAPI (see Recipes)
Blocking buffer (see Recipes)
Primary antibody (see Recipes)
Secondary antibody (see Recipes)
Equipment
Pipettes
20 µl pipette (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4642050 )
200 µl pipette (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4642080 )
1,000 µl pipette (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4642090 )
Biosafety cabinet, any brand/model
Bottles, sterile glass or plastic, any brand, for tissue culture medium storage
Millipore StericupTM sterile vacuum filter units (EMD Millipore, catalog number: SCGPU01RE )
Dissection microscope (Olympus, or similar) with lamp (or cold light source)
Dissecting scissors, 12.5 cm long, straight (Coherent Scientific, catalog number: 15922 )
Iris scissors 10 cm long, 30° angle, supercut (Coherent Scientific, catalog number: 500046 )
Dressing forceps, 15.5 cm long (Coherent Scientific, catalog number: 500363 )
2 x Dumont forceps #3, 12 cm long, 0.08 x 0.04 mm tips (Coherent Scientific, catalog number: 500337 )
Dissecting spatula, 140 mm long, 3 wide mm blade (World Precision Instruments, catalog number: 501772 )
Scalpel handle No. 3 with scalpel blade No. 15 (Coherent Scientific , catalog numbers: 500236 and 500242 )
Dumont forceps #5, 11 cm long, 0.06 x 0.01 mm tips (Coherent Scientific, catalog number: 14095 )
Humidified tissue culture incubator (5% CO2, 37 °C), any brand/model
Refrigerator (4 °C), any brand/model
Freezer (-20 °C), any brand/model
Inverted fluorescent microscope and digital camera (Olympus, model: IX81 or similar)
Software
Axiovision software v4.1 (Zeiss, Thornwood, NY) or similar
GraphPad Prism (v4.03)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Dixon, K. J., Turbic, A., Turnley, A. M. and Liebl, D. J. (2017). Explant Methodology for Analyzing Neuroblast Migration. Bio-protocol 7(9): e2249. DOI: 10.21769/BioProtoc.2249.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Neural stem cell
Cell Biology > Cell movement > Cell migration
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
225 | https://bio-protocol.org/exchange/protocoldetail?id=225&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Mouse Bone Marrow-Derived Macrophages (BM-MFs)
Ivan Zanoni
RO Renato Ostuni
FG Francesca Granucci
Published: Vol 2, Iss 12, Jun 20, 2012
DOI: 10.21769/BioProtoc.225 Views: 19453
Original Research Article:
The authors used this protocol in Jul 2009
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2009
Abstract
Generating mouse macrophages from bone-marrow progenitor cells is a useful tool to study biological functions of mouse macrophages. Macrophages are one of the major populations of phagocytes and play many different roles during inflammatory process initiation and termination.
Keywords: Phagocytes Macrophages In vitro M-CSF
Materials and Reagents
M-CSF-transduced L929 cells
HI FBS (EuroClone, catalog number: EC S0180L )
L-Glutamine (EuroClone, catalog number: EC B3000D )
Penicillin/streptomycin (EuroClone, catalog number: EC B3001D )
IMDM (EuroClone, catalog number: EC B2072L )
Beta-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
M-CSF-transduced L929 growth supernatant
Phosphate buffered saline (PBS) (EuroClone, catalog number: ECM9605AX )
BMMFs culture medium/ conditioned medium (see Recipes)
Equipment
Centrifuges
70 μm-wide cut-off cell strainer
Non-treated cell culture plates
Incubator (37 °C and 5% CO2)
Fluorescence activated cell sortor (FACS)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell isolation > Macrophage
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,250 | https://bio-protocol.org/exchange/protocoldetail?id=2250&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunoprecipitation of Cell Surface Proteins from Gram-negative Bacteria
CC Carlos Eduardo Pouey Cunha*
JN Jane Newcombe*
OD Odir Antonio Dellagostin
JM Johnjoe McFadden
*Contributed equally to this work
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2250 Views: 8294
Edited by: Valentine V Trotter
Reviewed by: Christian Roth
Original Research Article:
The authors used this protocol in 14-Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
14-Oct 2013
Abstract
The meningococcus (Neisseria meningitidis) remains an important threat to human healthworldwide. This Gram-negative bacterium causes elevated disabilities and mortality in infectedindividuals. Despite several available vaccines, currently there is no universal vaccine against allcirculating meningococcal strains (Vogel et al., 2013). Herein, we describe a new protocol that iscapable of identifying only cell surface exposed proteins that play a role in immunity, providing thisresearch field with a more straightforward approach to identify novel vaccine targets. Even though N. meningitidis is used as a model in the protocol herein described, this protocol can be used for anyGram-negative bacteria provided modifications and optimizations are carried out to adapt it to differentbacterial and disease characteristics (e.g., membrane fragility, growth methods, serum antibody levels,etc.).
Keywords: Gram-negative Immunoproteome Immunoprecipitation Cell surface antigen Outermembrane protein Exposed antigen
Background
Attempts to develop novel vaccines against N. meningitidis often rely on 2D SDS-PAGE (two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and Western blotfollowed by MS (mass spectrometry) (Wheeler et al., 2007). However, such approach employs wholecell lysate, identifying a plethora of proteins that do not have vaccine potential (Mendum et al., 2009).We therefore aimed at developing a method capable of identifying only cell surface exposed proteinsthat might play important role in immunity. Briefly, our protocol consists in growing the pathogen ofinterest, immunoprecipitating surface antigens with sera of immune individuals, and identifyingimmunoprecipitated proteins by liquid chromatography-tandem mass spectrometry. We were able toidentify 23 meningococcal surface antigens using this new protocol, some of which are components ofcommercially available vaccines (Newcombe et al., 2014). We also have adapted this protocol to otherGram-negative bacteria and have obtained promising results: we identified previously describedsurface-exposed proteins, many of which have already been tested as vaccine or diagnostic testcandidates. These results show this is a robust technique that can be applied to a diverse range ofGram-negative bacteria and capable of yielding high-quality results that can be further exploited by amyriad of applications (e.g., vaccines, diagnosis, etc.).
Materials and Reagents
Disposable Petri dishes (Cromwell Group, catalog number: STS3855002B )
L-shaped cell spreaders (Fisher Scientific, catalog number: 14-665-231 )
Disposable inoculating loop (Sigma-Aldrich, catalog number: I8388 )
1.5 ml microcentrifuge tubes (Corning, Axygen®, catalog number: MCT-150-C )
Protein LoBind tube (Eppendorf, catalog number: 022431102 )
20 ml plastic universals (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 128BFS )
Plastic sealable bags (Fisher Scientific, catalog number: 10366984)
Manufacturer: MINIGRIP, catalog number: BAJ-340-091N .
PierceTM spin columns (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 69725 )
Disposable sterile scalpel No. 10 (WMS, catalog number: W259 )
10 µl Filter tips (STARLAB INTERNATIONAL, TipOne®, catalog number: S1121-3810 )
20 µl Filter tips (STARLAB INTERNATIONAL, TipOne®, catalog number: S1120-1810 )
200 µl Filter tips (STARLAB INTERNATIONAL, TipOne®, catalog number: S1120-8810 )
1,000 µl Filter tips (STARLAB INTERNATIONAL, TipOne®, catalog number: S1122-1830 )
Neisseria meningitidis (strains L9153 and MC58, Public Health England)
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010001 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9418 )
Human serum (Sigma-Aldrich, catalog number: H6914 )
Disease state serum (acquisition of this varies and depends on the pathogen being investigated)
PierceTM Protein A/G UltraLinkTM Resin (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 53132 )
SeeBlue® protein marker (Thermo Fisher Scientific, NovexTM, catalog number: LC5925 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 43815 )
Iodoacetamide (Sigma-Aldrich, catalog number: I6125 )
InvitrogenTM NovexTM NuPAGETM 10x sample reducing agent (Thermo Fisher Scientific, NovexTM, catalog number: NP0004 )
InvitrogenTM NovexTM NuPAGETM 4x LDS loading buffer (Thermo Fisher Scientific, NovexTM, catalog number: NP0007 )
InvitrogenTM NovexTM NuPAGETM 12% Bis-Tris 1 mm–10 wells (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0341BOX )
InvitrogenTM NovexTM NuPAGETM MOPS running buffer 20x (Thermo Fisher Scientific, NovexTM, catalog number: NP000102 )
SimplyBlueTM Safe Stain (Thermo Fisher Scientific, NovexTM, catalog number: LC6060 )
Acetonitrile for HPLC-MS (Fisher Scientific, catalog number: 10616653 )
Ammonium bicarbonate (Sigma-Aldrich, catalog number: 09830 )
Trypsin Gold, mass spectrometry grade (Promega, catalog number: V5280 )
Columbia blood agar base (Oxoid, catalog number: CM0331 )
Horse blood, defibrinated (Oxoid, catalog number: SR0050 )
Tris base (Roche Diagnostics, catalog number: 10708976001 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9625 )
EDTA (Sigma-Aldrich, catalog number: E6758 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Sodium deoxycholate (Sigma-Aldrich, catalog number: 30970 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Formic acid LC/MS (Fisher Scientific, catalog number: A117-50 )
Water for HPLC-MS (Fisher Scientific, catalog number: 10777404 )
Methanol (Sigma-Aldrich, catalog number: 179957-1L )
Acetic acid (Sigma-Aldrich, catalog number: A6283 )
CAB medium (see Recipes)
PBS plus 1% BSA (see Recipes)
Solubilization buffer (see Recipes)
1% SDS (see Recipes)
1 M dithiothreitol stock solution (see Recipes)
1 M Iodoacetamide (see Recipes)
25 mM ammonium bicarbonate (see Recipes)
Acetonitrile (50% v/v) in 25 mM ammonium bicarbonate (see Recipes)
Acetonitrile (50% v/v) (see Recipes)
Solvent A for HPLC (see Recipes)
Solvent B for HPLC (see Recipes)
0.1% formic acid/50% acetonitrile solution (see Recipes)
Equipment
Gilson Pipette Pipetman Classic P2 (Gilson, catalog number: F144801 )
Gilson Pipette Pipetman Classic P20 (Gilson, catalog number: F123600 )
Gilson Pipette Pipetman Classic P200 (Gilson, catalog number: F123601 )
Gilson Pipette Pipetman Classic P1000 (Gilson, catalog number: F123602 )
Eppendorf® Micro centrifuge 5415R (Eppendorf, model: 5415 R )
BOD low temperature refrigerated incubator (VWR, model: BOD Incubator 2005 , catalog number: 35960-056)
CO2 incubator (LEEC, model: Culture Safe Precision 190D )
Stuart Gyratory rocker (Cole-Parmer, Stuart, model: SSL3 )
Vortex Mixer SA8 (Cole-Parmer, Stuart, model: SA8 )
Ultrasonic bath (Fisher Scientific, model: FisherbrandTM S-Series , catalog number: 10611983)
Ultimate 3000 nano HPLC system (Thermo Fisher Scientific, Thermo ScientificTM, model: UltiMateTM 3000 RSL Cnano System )
AcclaimTM C-18 PepmapTM column (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 164569 )
QSTAR® XL hybrid LC/MS/MS system (Applied Biosystems, model: QSTAR® XL Hybrid LC/MS/MS System )
Eppendorf MixMateTM (Fisher Scientific, catalog number: 21-379-00)
Manufacture: Eppendorf, catalog number: 022674200 .
Eppendorf ThermoStat Plus interchangeable block heater (Eppendorf, model: ThermoStat Plus , catalog number: 022670204)
Eppendorf VacufugeTM concentrator (Eppendorf, model: VacufugeTM Concentrator , catalog number: 022820001)
Heraeus Tube roller Spiramix (Fisher Scientific, catalog number: 10600653)
Manufacturer: Thermo Fisher Scientific, Thermo ScientificTM, catalog number: DS507 .
Fume hood
Software
Chromeleon v6.8 or later (Dionex, Thermo Fisher Scientific)
Analyst QS 1.1 (Applied Biosystems)
Mascot v2.2.04 or later (Matrix Science, London)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：da Cunha, C. E. P., Newcombe, J., Dellagostin, O. A. and McFadden, J. (2017). Immunoprecipitation of Cell Surface Proteins from Gram-negative Bacteria. Bio-protocol 7(9): e2250. DOI: 10.21769/BioProtoc.2250.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,251 | https://bio-protocol.org/exchange/protocoldetail?id=2251&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Olfactory Cued Learning Paradigm
Gary Liu
CM Cynthia K. McClard*
Burak Tepe*
Jessica Swanson
BP Brandon Pekarek
SP Sugi Panneerselvam
Benjamin R. Arenkiel
*Contributed equally to this work
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2251 Views: 7718
Edited by: Xi Feng
Reviewed by: Adler R. DillmanManuel Sarmiento
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Sensory stimulation leads to structural changes within the CNS (Central Nervous System), thus providing the fundamental mechanism for learning and memory. The olfactory circuit offers a unique model for studying experience-dependent plasticity, partly due to a continuous supply of integrating adult born neurons. Our lab has recently implemented an olfactory cued learning paradigm in which specific odor pairs are coupled to either a reward or punishment to study downstream circuit changes. The following protocol outlines the basic set up for our learning paradigm. Here, we describe the equipment setup, programming of software, and method of behavioral training.
Keywords: Olfactory Circuit Learning Synaptic Plasticity Go/No-Go Behavior
Background
The adult brain features ongoing experience-dependent structural changes. Within the rodent olfactory bulb (OB) where odor information is first processed, a continuous supply of adult born interneurons (granule cells) either integrates into the olfactory circuitry or undergoes apoptosis (Petreanu and Alvarez-Buylla, 2002; Carleton et al., 2003; Lledo et al., 2006; Sakamoto et al., 2014). This choice between survival or death is greatly influenced by sensory stimulus and olfactory cued learning (Rochefort et al., 2002; Alonso et al., 2006). Moreover, younger granule cells also undergo experience-dependent synaptic changes within a critical time window (Yamaguchi and Mori, 2005). To examine how sensory experience affects synaptic plasticity in OB circuits, our lab has successfully implemented a Go/No-Go olfactory cued learning task (Huang et al., 2016; Quast et al., 2016). Mice are trained to associate a ‘Go Odor’ with a water reward and a separate ‘No-Go Odor’ with a punishment (trial timeout) (Figure 1). Upon completion of training, mice will be able to distinguish the two odors by performing the associated task with greater than 85% accuracy (Supplemental Video 1).
Figure 1. Go/No-Go task. Trained, water-deprived mice will first poke their nose into the central odor port to initiate odor delivery. Subsequently, either a Go or No-Go odor is delivered at random. If the Go Odor is delivered, trained mice will move to either of the two side ports to collect the water reward. If the No-Go odor is delivered, trained mice will refrain from seeking water and re-poke into the odor port.
Materials and Reagents
Distinct pair of odorants selected by experimenter to represent the ‘Go’ or S+ stimulus and ‘No-Go’ or S- stimulus. Example: 1-butanol and propionic acid (Sigma-Aldrich, catalog numbers: 437603 and 402907 , respectively)–diluted to 10% in mineral oil (Alfa Aesar, catalog number: 31911 ) (500 µl odorant in 5 ml of mineral oil)
Qorpak borosilicate glass vial with Green Polypropylene Hole Cap (Qorpak, catalog number: GLC-01016 )
Nalgene silicone tubing (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 8600-0030 )
BD PrecisionGlideTM 18 gauge beveled needles (BD, catalog number: 305196 )
Adult mice (> 6 weeks old, our lab uses on average 12 to 19 weeks old mice with average body weights of 19 g for females and 23 g for males)
Equipment
Extra Wide Modular Test Chamber-Mouse (Med Associates, catalog number: ENV-307W )
Stainless Steel Grid Floor (Med Associates, catalog number: ENV-307W-GFW )
Illuminated Nose Poke Response for Wide Mouse Modular Chamber (Med Associates, catalog number: ENV-313W ) (x2)
Two Channel Olfactory Stimulus (Med Associates, catalog number: ENV-275 )
Illuminated Nose Poke Response with Olfactory Ports for Mouse (Med Associates, catalog number: ENV-375W-NPP )
Stand Alone USB Interface, 4 In/8 out Compatible with 32bit OS only (Med Associates, catalog number: DIG-703A-USB )
Standard desktop computer with Windows 2000, XP, Vista, or 7 operating system
VWR flow meter, Acrylic (VWR, catalog number: 97004-952 )
Figure 2. Go/No-Go equipment. The behavior system contains 6 key components: Behavior chamber, water reservoirs, air adjustment, USB interface system, odor delivery module, and a personalized computer (A). Room air is first relayed from the air adjustment to the input air manifold and subsequently diverged to the two odor-containing glass vials and the center valve (B). Odorized air outputs are controlled by two solenoids (C), which can be programmed by the Schedule Manager software. An odor intake line, a vacuum line, and two water dispensers are connected to the behavior chamber (D). Each odor vial is paired with its own two silicone tubes fitted with 18 gauge needles to prevent contamination of odors (E).
Software
MED-PC IV behavioral software suite (Med Associates, SOF-735)
Note: This version of the software has now been replaced with Med-PC V.
MPC2XL-Data Transfer Utility for all MED-PC Users (Med Associates, SOF-731), required for data reformatting to Excel
Schedule Manager Software (Med Associates, catalog number: DIG-703A-USB), required for programming training stages
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Liu, G., McClard, C., Tepe, B., Swanson, J., Pekarek, B., Panneerselvam, S. and Arenkiel, B. R. (2017). Olfactory Cued Learning Paradigm. Bio-protocol 7(9): e2251. DOI: 10.21769/BioProtoc.2251.
Huang, L., Ung, K., Garcia, I., Quast, K. B., Cordiner, K., Saggau, P. and Arenkiel, B. R. (2016). Task learning promotes plasticity of interneuron connectivity maps in the olfactory bulb. J Neurosci 36(34): 8856-8871.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,252 | https://bio-protocol.org/exchange/protocoldetail?id=2252&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Peripheral Nerve Injury: a Mouse Model of Neuropathic Pain
TM Takahiro Masuda
YK Yuta Kohro
KI Kazuhide Inoue
MT Makoto Tsuda
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2252 Views: 11544
Edited by: Andrea Puhar
Reviewed by: Hélène M. Léger
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Neuropathic pain is one of the highly debilitating chronic pain conditions, for which, currently, there is no therapeutic treatment. In order to reveal the underlying mechanism for neuropathic pain, various animal models have been established (Burma et al., 2016). This protocol describes how to prepare spinal nerve injury model (Kim and Chung, 1992; Rigaud et al., 2008; Masuda et al., 2016), one of the most frequently-used and highly reproducible models in which multiple alterations occur both in the peripheral and central nervous system.
Keywords: Neuropathic pain Nerve injury Spinal cord Mouse Dorsal root ganglion (DRG) Allodynia
Background
Revealing the underlying mechanism of neuropathic pain is necessary to develop effective therapy for its optimal management. Therefore, various animal models for neuropathic pain have been developed. In particularly, rodent models have been frequently used because they are highly reproducible and exhibit pain hypersensitivity that is also observed in patients with neuropathic pain. In this protocol, we describe how to prepare the mouse spinal nerve injury model.
Materials and Reagents
5-0 silk suture (Alfresa Pharma, catalog number: GA05SW )
Sterile scalpel blades (FATHER Safety Razor, catalog number: No.10 )
Wild-type C57BL/6 mice (6-15 weeks old) (Japan Clea)
Isoflurane (Mylan)
75 % ethanol (Takasugi Pharmaceutical)
Equipment
Electric clippers (Daito Electric Machine Industry, catalog number: 605AD , Special C)
Note: This product has been discontinued.
Agricola retractor (Fine Science Tools, catalog number: 17005-04 )
Forceps (NATSUME SEISAKUSHO, catalog number: A-14 )
Vannas spring scissors (Fine Science Tools, catalog number: 15070-08 )
Electric drill (URAWA Kogyo, model: MINITORJET UC210 )
Scalpel holder (NATSUME SEISAKUSHO, catalog number: D-11 )
Heating pad (VIVARIA, catalog number: MP-916-NV)
Double sided micro spatula (Fine Science Tools, catalog number: 10091-12 )
Isoflurane dispenser (FORWICK, MURACO Medical)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Masuda, T., Kohro, Y., Inoue, K. and Tsuda, M. (2017). Peripheral Nerve Injury: a Mouse Model of Neuropathic Pain. Bio-protocol 7(9): e2252. DOI: 10.21769/BioProtoc.2252.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Neuroscience > Sensory and motor systems > Spinal cord
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,253 | https://bio-protocol.org/exchange/protocoldetail?id=2253&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Biotinylated Micro-RNA Pull Down Assay for Identifying miRNA Targets
PP Pornima Phatak
JD James M Donahue
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2253 Views: 18443
Edited by: HongLok Lung
Reviewed by: Chiara Ambrogio
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
microRNA (miRNA) directly associates with its target transcripts (mRNA). This protocol describes a method for detection of direct interaction between miRNA and mRNA. The result of interaction helps screening the specific target mRNAs for a miRNA.
Keywords: miRNA Biotin-pulldown miRNA-mRNA interaction Transfection Biotin labelling
Background
MiRNAs are small non coding regulatory RNAs. MiRNAs typically control the gene expression by binding to complementary sequence in their target mRNAs. Many bioinformatics and computational programs are available to predict miRNA targets. But experimental methods identifying direct association of miRNA with target mRNA are very limited. The current protocol can be very helpful in identifying miRNA targets (Phatak et al., 2016).
Materials and Reagents
10 cm tissue culture dishes
1.5 ml microfuge tube
PCR tubes
15 and 50 ml polypropylene tubes
Q-PCR plates
Cells
Custom synthesis of miRNA sequence with 3’BIOTIN manipulation
Phosphate buffered saline (PBS)
Protease inhibitor (100x cocktail) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 78430 )
RNase inhibitor (Thermo Fisher Scientific, catalog number: EO0381 )
Streptavidin-Dyna beads (Dyna beads M-280 streptavidin) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11205D )
Yeast tRNA (stock 10 mg/ml) (Thermo Fisher Scientific, AmbionTM, catalog number: AM7119 )
TRIzol (Thermo Fisher Scientific, AmbionTM, catalog number: 10296028 )
Chloroform (Sigma-Aldrich, catalog number: C2432 )
2-propanol (Sigma-Aldrich, catalog number: I9516 )
GlycoBlueTM coprecipitant (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9515 )
200% proof ethanol (Sigma-Aldrich, catalog number: E7023 )
Nuclease free water (Quality Biological, catalog number: 351-029-721 )
Reverse transcription system (Promega, catalog number: A3500 )
Micro RNA RT Kit (Thermo Fisher Scientific, Applied BiosystemTM)
miRNeasy Mini Kit (QIAGEN, catalog number: 217004 )
Qiashredder (QIAGEN, catalog number: 79656 )
RNAiMax (Thermo Fisher Scientific, InvitrogenTM, catalog number: 13778150 )
Potassium chloride (KCl)
Magnesium chloride (MgCl2)
Tris-hydrochloride (pH 7.5)
IGEPAL CA-630 (Sigma-Aldrich, catalog number: I8896 )
Sodium hydroxide (NaOH)
Sodium chloride (NaCl)
Lysis buffer (see Recipes)
Solution A (see Recipes)
Solution B (see Recipes)
Equipment
Magnetic separation Stand Magnesphere® technology (Promega, catalog number: Z5342 )
Mini tube rotator (Fisher Scientific, model: Fisher ScientificTM Mini-Tube rotators , catalog number: 05-450-127)
Refrigerated microfuge LegendTM micro 21R (Thermo Fisher Scientific, model: SorvallTM LegendTM 21R )
ABI Step one plus Q-PCR system (Thermo Fisher Scientific, Applied BiosystemTM, model: StepOnePlusTM Real-Time PCR System , catalog number: 4376599)
Veriti 96 well Thermal Cycler 0.2 ml alloy (Thermo Fisher Scientific, Applied BiosystemTM, model: Veriti® 96-Well Thermal Cycler , catalog number: 4375786)
-20 °C freezer
Vortexer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Phatak, P. and Donahue, J. M. (2017). Biotinylated Micro-RNA Pull Down Assay for Identifying miRNA Targets. Bio-protocol 7(9): e2253. DOI: 10.21769/BioProtoc.2253.
Download Citation in RIS Format
Category
Biochemistry > RNA > miRNA targeting
Molecular Biology > RNA > miRNA-mRNA interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,254 | https://bio-protocol.org/exchange/protocoldetail?id=2254&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Everted Membrane Vesicles from Escherichia coli Cells
Marina Verkhovskaya
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2254 Views: 8235
Edited by: Marc-Antoine Sani
Reviewed by: Ching Yao Yang
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
The protocol for obtaining electrically sealed membrane vesicles from E. coli cells is presented. Proton pumps such as Complex I, quinol oxidase, and ATPase are active in the obtained vesicles. Quality of the preparation was tested by monitoring the electric potential generated by these pumps.
Keywords: Escherichia coli Membrane vesicles Proton pumping
Background
Studying of membrane enzymes often requires embedding them into the natural lipid environment. Inside-out, everted membrane vesicles allowed to explore effects of different substrates, inhibitors and other ligands on the operation of these enzymes. Functioning proton pumps, such as NADH: ubiquinone oxidoreductase Type 1 (Complex I), quinol oxidase, and ATPase also requires good electrical sealing of the vesicles. This protocol provides sufficient results in preparation of such vesicles for studying these enzymes (e.g., Euro et al., 2008; Belevich et al., 2011).
Materials and Reagents
Glass test tubes (approximately 10 x 90 mm)
E. coli MWC215 (SmR ndh::CmR) or GR70N (wild type or mutated) cells grown under aeration
Luria Broth or other medium suitable for aerobic growth of E. coli culture
Antibiotics, as required for particular E. coli strain
Lysozyme
Ethylenediaminetetraacetic acid (EDTA)
Magnesium sulfate (MgSO4)
Dithiothreitol (DTT)
Phenylmethylsulfonyl fluoride (PMSF)
Ethanol
Liquid N2
Electric potential-sensitive probe Oxonol VI (Sigma-Aldrich, catalog number: 75926 )
Ammonium sulfate, (NH4)2SO4
Decylubiquinone (Sigma-Aldrich, catalog number: D7911 )
Potassium cyanide (KCN)
Nicotinamide adenine dinucleotide reduced (NADH)
Rolliniastatin
Ubiquinone 1 (Sigma-Aldrich, catalog number: C7956 )
Adenosine triphosphate (ATP)
Aurovertin B (Sigma-Aldrich, catalog number: A5297 )
Note: This product has been discontinued.
Tris-HCl
Sucrose
HEPES
Potassium hydroxide (KOH)
Potassium chloride (KCl)
Magnesium chloride (MgCl2)
3-(N-morpholino)propanesulfonic acid (MOPS)
1,3-bis(tris(hydroxymethyl)methylamino)propane (BTP)
The medium (see Recipes)
Buffer A (see Recipes)
Buffer B (see Recipes)
Buffer C (see Recipes)
Buffer D (see Recipes)
Equipment
200 ml Erlenmeyer flasks
2 L Erlenmeyer flasks
Shaker, such as Sertomat R/Sertomat HR or other suitable
Centrifuges, such as (Thermo Fisher Scientific, model: Sorvall RC 5C Plus )
Rotors (Thermo Fisher Scientific, Thermo ScientificTM, models: SS-34 , SLA 3000 ; Beckman Coulter, model: Ti70 )
Sonicator (Emerson, model: Branson Sonifier Cell Disruptor B15 ) or other with the tip diameter 10-12 mm
UV/VIS spectrophotometer (i.e., Ocean Optics, model: HR2000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Lipid
Biochemistry > Lipid > Lipid isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,255 | https://bio-protocol.org/exchange/protocoldetail?id=2255&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Mitochondrial Transfer in Direct Co-cultures of Human Monocyte-derived Macrophages (MDM) and Mesenchymal Stem Cells (MSC)
Megan V. Jackson
Anna D. Krasnodembskaya
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2255 Views: 12816
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Mesenchymal stem/stromal cells (MSC) are adult stem cells which have been shown to improve survival, enhance bacterial clearance and alleviate inflammation in pre-clinical models of acute respiratory distress syndrome (ARDS) and sepsis. These diseases are characterised by uncontrolled inflammation often underpinned by bacterial infection. The mechanisms of MSC immunomodulatory effects are not fully understood yet. We sought to investigate MSC cell contact-dependent communication with alveolar macrophages (AM), professional phagocytes which play an important role in the lung inflammatory responses and anti-bacterial defence. With the use of a basic direct co-culture system, confocal microscopy and flow cytometry we visualised and effectively quantified MSC mitochondrial transfer to AM through tunnelling nanotubes (TNT). To model the human AM, primary monocytes were isolated from human donor blood and differentiated into macrophages (monocyte derived macrophages, MDM) in the presence of granulocyte macrophage colony-stimulating factor (GM-CSF), thus allowing adaptation of an AM-like phenotype (de Almeida et al., 2000; Guilliams et al., 2013). Human bone-marrow derived MSC, were labelled with mitochondria-specific fluorescent stain, washed extensively, seeded into the tissue culture plate with MDMs at the ratio of 1:20 (MSC/MDM) and co-cultured for 24 h. TNT formation and mitochondrial transfer were visualised by confocal microscopy and semi-quantified by flow cytometry. By using the method we described here we established that MSC use TNTs as the means to transfer mitochondria to macrophages. Further studies demonstrated that mitochondrial transfer enhances macrophage oxidative phosphorylation and phagocytosis. When TNT formation was blocked by cytochalasin B, MSC effect on macrophage phagocytosis was completely abrogated. This is the first study to demonstrate TNT-mediated mitochondrial transfer from MSC to innate immune cells.
Keywords: Mesenchymal stem cells Macrophages Mitochondrial transfer ARDS Phagocytosis Oxidative phosphorylation
Background
Data from pre-clinical studies, including studies by our group (Xu et al., 2007 and 2008; Nemeth et al., 2009; Gupta et al., 2007 and 2012; Krasnodembskaya et al., 2010 and 2012; Mei et al., 2010; Lee et al., 2013; Jackson et al., 2016) demonstrated strong potential for MSC as a future cell-based therapy for the treatment of ARDS, an injurious hyper-inflammatory condition of the lung. In these studies MSC have displayed regenerative, immune-modulatory and anti-microbial effects which have consequently provided rationale for the design of phase I and phase II clinical trials for MSC in ARDS (Zheng et al., 2014; Wilson et al., 2015). However, despite the rapid translation of MSC into the clinical trials, mechanisms of how MSC alleviate symptoms of ARDS still need to be fully elucidated. Recent studies have reported MSC modulate lung epithelial and endothelial cells through mitochondrial transfer via TNTs, resulting in improvement of the host cell bioenergetics (Islam et al., 2012; Ahmad et al., 2014; Li et al., 2014; Liu et al., 2014). In ARDS, excessive pulmonary inflammation is one of the main characteristics of the disease in which alveolar macrophages (AM) are prominent cells. They orchestrate the inflammatory responses in the alveoli and play an important role in the lung bacterial clearance (Ware and Matthay, 2000; Jackson et al., 2016).
This protocol allowed us to study the functional effects of a TNT mediated process of an organelle transfer between MDMs both in vitro and using the same staining protocol, mouse alveolar macrophages in vivo (Jackson et al., 2016). Although the major focus of our study was mitochondrial transfer, this protocol can be adapted with slight modifications for investigations of transfer of other organelles or even fluorescently labelled molecules.
Materials and Reagents
Extraction of mononuclear cells from human donor Buffy Coats
50 ml Falcon tubes (SARSTEDT, catalog number: 62.554.502 )
T175 culture flasks (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 178883 )
Sterile Pasteur pipettes (BIOLOGIX GROUP LTD Technical, catalog number: 30-0138A1 )
Cover slip
Tissue culture coated 6 well plate (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 140675 )
Buffy coats are obtained from the Northern Ireland Blood Transfusion Service (NIBTS) following ethical approval by the School Research Ethics Committee of Queen’s University Belfast
Hank’s buffered salt solution (HBSS) No Ca2+ or Mg2+ (Thermo Fisher Scientific, catalog number: 14170138 )
Ficoll-Paque (GE Healthcare, catalog number: 17-5442-03 )
Complete RPMI 1640 (Thermo Fisher Scientific, GibcoTM, catalog number: 21875034 )
Foetal calf serum (FCS) (heat inactivated) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Granulocyte-macrophage colony stimulating factor (GM-CSF) (PeproTech, catalog number: 300-03 )
Penicillin/streptomycin 10,000 U/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Trypan blue (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Complete 1% FBS RPMI (see Recipes)
Complete RPMIGM-CSF (see Recipes)
Culture of human bone marrow-derived mesenchymal stromal cells (MSC)
50 ml Falcon tubes (SARSTEDT, catalog number: 62.554.502 )
8-well chamber slides (Sigma-Aldrich, catalog number: C7182 )
Tissue culture coated 6-well and 24-well plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 140675 , 142475 )
Pechiney PM999 Parafilm (Bemis, catalog number: PM999 )
Microscope slide
Sterile Eppendorf tubes (SARSTEDT, catalog number: 72.690.001 )
Flow tubes (SARSTEDT, catalog number: 55.475 )
Human bone marrow-derived MSCs are obtained from the NIH repository in Texas A&M Health Science Centre College of Medicine, Institute for Regenerative Medicine (Temple, Texas). The cells meet all the criteria for the classification as MSCs as defined by the International Society of Cellular Therapy (Dominici et al., 2006)
Liquid nitrogen
Dulbecco’s phosphate buffered saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190094 )
Complete α-MEM (Thermo Fisher Scientific, GibcoTM, catalog number: 22561021 )
Penicillin/streptomycin 10,000 U/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030024 )
Cytochalasin B (Sigma-Aldrich, catalog number: C6762 )
10x trypsin (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Foetal calf serum (FCS) (heat inactivated) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Trypan blue (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
MitoTracker Deep Red FM probe (APC) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: M22426 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Complete α-MEM (see Recipes)
Mitochondrial staining solution (1% FBS α-MEM1%MITO) (see Recipes)
Cytochalasin B solution (1%FBS α-MEM1%CYTO) (see Recipes)
Confocal microscopy
0.45 µm filter membrane (SARSTEDT, catalog number: 83.1826.001 )
Pechiney PM999 Parafilm (Bemis, catalog number: PM999 )
Paper towel
Microscope slide
Coverslip
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: 158127 )
1 N NaOH (Sigma-Aldrich, catalog number: S2770 )
1 N HCl (Sigma-Aldrich, catalog number: H9892 )
Normal goat serum (NGS) (Thermo Fisher Scientific, Invitrogen, catalog number: 31872 )
Mouse anti-human CD45 primary antibody (Abcam, catalog number: ab8216 )
Mouse IgG1 isotype (Abcam, catalog number: ab81032 )
Goat anti-rabbit Alexafluor 405 secondary antibody (Abcam, catalog number: ab175655 )
Brightmount/Plus aqueous mounting medium (Abcam, catalog number: ab103748 )
Nail varnish
1% FBS PBS (see Recipes)
4% paraformaldehyde (PFA) (see Recipes)
Strong and weak block for immunofluorescent staining (see Recipes)
Flow cytometry
Cell scrapers (Fisher Scientific, catalog number: 08-100-241 )
Sarstedt 5 ml polystyrene round bottomed flow tubes (SARSTEDT, catalog number: 55.1578 )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Human FcR binding inhibitor (Thermo Fisher Scientific, eBioscienceTM, catalog number: 14-9161-73 )
Anti-human CD45 (PE) antibody (Thermo Fisher Scientific, eBioscienceTM, catalog number: 12-9459-41 )
Isotype control (IgG1 kappa) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 12-4714 )
Zombie Aqua Fixable Dye (BioLegend, catalog number: 423101 )
Bacterial culture and phagocytosis assay
Escherichia coli K1 type strain
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
LB broth (Lennox) (Sigma-Aldrich, catalog number: L3022 )
LB broth with agar (Lennox) (Sigma-Aldrich, catalog number: L2897 )
Hank’s buffered salt solution (HBSS) No Ca2+ or Mg2+ (Thermo Fisher Scientific, catalog number: 14170138 )
Complete RPMI 1640 (Thermo Fisher Scientific, GibcoTM, catalog number: 21875034 )
Saponin (Sigma-Aldrich, catalog number: 47036 )
Gentamycin (Sigma-Aldrich, catalog number: G1397 )
Complete 1% FBS RPMI (see Recipes)
0.5% saponin (see Recipes)
Equipment
Water bath (37 °C) (Grant Instruments, model: JBN12 )
Centrifuge (Eppendorf, model: 5810 R )
Laminar flow cabinet (Contained Air Solutions, model: BioMAT 2 safety cabinet class 2 )
Haemocytometer and cover slips (Hawksley Medical and Laboratory Equipment, model: AC1000 Improved Neubauer , catalog number: BS 748)
Incubator (Panasonic Biomedical, model: MCO-170AIC-PE )
Dmi1 microscope (Leica Microsystems, model: DMi1 )
TCS SP5 II Leica confocal microscope (Leica Microsystems, model: TCS SP5 II )
BD FACSCanto II Flow cytometer (BD, model: BD FACSCanto II )
Vortex (Cole-Palmer Instrument, catalog number: UY-86579-20 )
2-20 µl pipette (Gilson, catalog number: F123600 )
20-200 µl pipette (Gilson, catalog number: F144565 )
100-1,000 µl pipette (Gilson, catalog number: F144566 )
Midi PlusTM pipette controller Automatic (Sartorius, catalog number: 710931 )
Software
FlowJo software (FlowJo)
Prism 5 software (GraphPad Software)
LAS-AF software (Leica confocal microscopy)
FACS DIVA software (flow cytometry)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jackson, M. V. and Krasnodembskaya, A. D. (2017). Analysis of Mitochondrial Transfer in Direct Co-cultures of Human Monocyte-derived Macrophages (MDM) and Mesenchymal Stem Cells (MSC). Bio-protocol 7(9): e2255. DOI: 10.21769/BioProtoc.2255.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Mesenchymal stem cell
Immunology > Immune cell function > Macrophage
Cell Biology > Cell-based analysis > Transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,256 | https://bio-protocol.org/exchange/protocoldetail?id=2256&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Escherichia coli Infection of Drosophila
CT Charles Tracy
Helmut Krämer
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2256 Views: 8185
Edited by: Ruth A. Franklin
Reviewed by: Modesto Redrejo-RodriguezFilipa Vaz
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Following septic insults, healthy insects, just like vertebrates, mount a complex immune response to contain and destroy pathogens. The failure to efficiently clear bacterial infections in immuno-compromised fly mutants leads to higher mortality rates which provide a powerful indicator for genes with important roles in innate immunity. The following protocol is designed to reproducibly inject a known amount of non-pathogenic E. coli into otherwise sterile flies and to measure the survival of flies after infection. The protocol can be easily adapted to different types of bacteria.
Keywords: Drosophila Innate immunity Bacterial infections Tolerance Survival
Background
Classic infection experiments involve infecting Drosophila orally (Chakrabarti et al., 2016) or with a needle dipped in a concentrated bacterial solution (Romeo and Lemaitre, 2008). Unlike these protocols, our experimental procedure allows us to determine the site of infection and precisely control the dose of bacteria injected into each fly. This provides homogeneity and reproducibility, and allows us to adapt bacterial load for different experiments (Akbar et al., 2011 and 2016).
Materials and Reagents
15 ml Falcon tubes (Corning, catalog number: 352196 )
1.5 ml Eppendorf tubes (USA Scientific, catalog number: 1615-5500 )
Kimwipes
26 G needle (BD, catalog number: 305111 )
Spin columns (e.g., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 69700 )
Empty and clean Drosophila vials (Genesee Scientific, catalog number: 32-109 )
Microloader tips (Eppendorf, catalog number: 930001007 )
Vials (Genesee Scientific, catalog number: 32-109 ) with standard Drosophila food (lightly yeasted)
Microslide (Corning, catalog number: 2948-75X25 )
50 Drosophila melanogaster adult virgins (Romeo and Lemaitre, 2008), aged five to seven days post eclosion (see Note 1)
E. coli-DH5α containing any ampicillin-resistant plasmid (e.g., expressing GFP)
pEGFP (https://www.addgene.org/vector-database/2485/)
pET-GFP-C11 (http://www.addgene.org/30183/)
LB broth (Fisher Scientific, catalog number: BP1426-500 )
Ampicillin (200 mg/ml) (Sigma-Aldrich, catalog number: A9518 )
70% ethanol–diluted from 100% ethanol (Pharmco-AAPER, catalog number: 111000200 )
Mineral oil (Fisher Scientific, catalog number: O121-1 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium phosphate dibasic heptahydrate (Na2HPO4·7H2O) (Sigma-Aldrich, catalog number: S9390 )
Potassium phosphate monobasic (KH2PO4) (Fisher Scientific, catalog number: S397-500 )
1x PBS (see Recipes)
Equipment
37 °C incubator with shaking (Eppendorf, New BrunswickTM, model: Innova® 44 )
Spectrophotometer (Molecular Devices, model: SpectraMax M2 )
Borosilicate glass capillaries (WPI, catalog number: TW100-4 )
Centrifuge capable of spinning Falcon tubes (Eppendorf, model: 5804 R )
Flaming/Brown Micropipette puller (Sutter Instrument, model: P-97 )
Mini benchtop centrifuge (Fisher Scientific, model: FisherbrandTM Standard Mini Centrifuge , catalog number: 05-090-100)
Pico-Injector (Nikon Instruments, catalog number: PLI-188 )–requires nitrogen gas
Note: Should have foot pedal for injecting.
25 °C incubator (BioCold Environment, model: BC49-IN )
Anesthetizing fly pad (Genesee Scientific, catalog number: 59-119 )
Small brush
Dissecting microscope (Leica)
Software
Prism (GraphPad) software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tracy, C. and Krämer, H. (2017). Escherichia coli Infection of Drosophila. Bio-protocol 7(9): e2256. DOI: 10.21769/BioProtoc.2256.
Download Citation in RIS Format
Category
Immunology > Animal model > Drosophila (Fruit fly)
Microbiology > in vivo model > Bacterium
Microbiology > Microbe-host interactions > Bacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,257 | https://bio-protocol.org/exchange/protocoldetail?id=2257&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Incubation of Cyanobacteria under Dark, Anaerobic Conditions and Quantification of the Excreted Organic Acids by HPLC
CY Chika Yasuda
HI Hiroko Iijima
HS Haruna Sukigara
Takashi Osanai
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2257 Views: 8148
Edited by: Neelanjan Bose
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Succinate and lactate are commodity chemicals used for producing bioplastics. Recently, it was found that such organic acids are excreted from cells of the unicellular cyanobacterium Synechocystis sp. PCC 6803 under dark, anaerobic conditions. To conduct the dark, anaerobic incubation, cells were concentrated within a vial that was then sealed with a butyl rubber cap, following which N2 gas was introduced into the vial. The organic acids produced were quantified by high-performance liquid chromatography via post-labeling with bromothymol blue as a pH indicator. After separation by ion-exclusion chromatography, the organic acids were identified by comparing their retention time with that of standard solutions. These procedures allow researchers to quantify the organic acids produced by microorganisms, contributing to knowledge about the biology and biotechnology of cyanobacteria.
Keywords: Anaerobic condition Cyanobacteria HPLC Lactate Organic acids Succinate Synechocystis sp.
Background
Cyanobacteria are a group of bacteria that perform oxygenic photosynthesis. Synechocystis sp. PCC 6803 (hereafter Synechocystis 6803) is a non-nitrogen-fixing, unicellular cyanobacterium that is commonly used for basic and applied research studies. Synechocystis 6803 cells are able to excrete organic acids, such as succinate and lactate, under both dark and anaerobic conditions (Osanai et al., 2015). Genetic manipulation and modification of the incubation conditions, such as addition of potassium or NaHCO3, have succeeded in increasing the levels of organic acids excreted from Synechocystis 6803 cells (Osanai et al., 2015; Hasunuma et al., 2016; Iijima et al., 2016; Ueda et al., 2016). Since succinate and lactate are commodity chemicals used to make various materials, such as bioplastics, their bio-based production is a desirable way to reduce the environmental burden. Herein, we describe the methods of Synechocystis 6803 incubation under dark, anaerobic conditions, and quantification of the organic acids by HPLC via post-labeling with bromothymol blue.
Materials and Reagents
50 ml disposable polypropylene tubes
Test tubes for cultivation (Iwaki, catalog number: TEST30NP )
20 ml headspace vials (GL Sciences, catalog number: 1030-46026 )
22 G x 1″ needle (Terumo Medical, catalog number: NN-2225R )
22 G x 1 ½″ needle (Terumo, catalog number: NN-2238S )
Aluminum foil
SupraPure hydrophilic PVDF syringe filters (Recenttec, catalog number: R7-PVDF033S022I )
Target DP vials (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: C4000-1 )
Screw caps (GL Sciences, catalog number: 1030-45261 )
300 µl target polyspring inserts (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: C4010-S630 )
Disposable syringes (Terumo, catalog number: SS-10LZ )
Open-top-style aluminum caps with butyl rubber septa (Systech, catalog number: 98552 )
MF-Millipore membrane filters (Merck Millipore, catalog number: HAWP03700 )
Cyanobacterium Synechocystis sp. PCC 6803
Ammonium chloride (NH4Cl) (Wako Pure Chemical Industries, catalog number: 017-02995 )
60% perchloric acid (HClO4) (Wako Pure Chemical Industries, catalog number: 160-05755 )
Trichloroacetic acid
Succinate
Lactate
Citric acid (Nacalai Tesque, catalog number: 09109-85 )
Acetate
Ferric ammonium citrate
Na2EDTA (Nacalai Tesque, catalog number: 15111-45 )
Sodium nitrate (NaNO3) (Wako Pure Chemical Industries, catalog number: 195-02545 )
Potassium phosphate dibasic (K2HPO4) (Wako Pure Chemical Industries, catalog number: 164-04295 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Wako Pure Chemical Industries, catalog number: 131-00405 )
Calcium chloride dihydrate (CaCl2·2H2O) (Wako Pure Chemical Industries, catalog number: 031-00435 )
Sodium carbonate (Na2CO3) (Nacalai Tesque, catalog number: 31311-25 )
Boric acid (H3BO3) (Wako Pure Chemical Industries, catalog number: 021-02195 )
Manganese chloride tetrahydrate (MnCl2·4H2O) (Wako Pure Chemical Industries, catalog number: 139-00722 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Wako Pure Chemical Industries, catalog number: 264-00402 )
Pentahydrate copper sulphate (CuSO4·5H2O) (Wako Pure Chemical Industries, catalog number: 039-04412 )
Sodium molybdate dehydrate (Na2MoO4·2H2O) (Wako Pure Chemical Industries, catalog number: 196-02472 )
Sulfuric acid (H2SO4) (Wako Pure Chemical Industries, catalog number: 199-15995 )
Cobalt dinitrate hexahydrate, Co(NO3)2·5H2O (Wako Pure Chemical Industries, catalog number: 031-03752 )
HEPES (Dojindo Molecular Technologies, catalog number: 342-01375 )
Potassium hydroxide (KOH) (Wako Pure Chemical Industries, catalog number: 168-21815 )
Bromothymol blue (BTB) (Wako Pure Chemical Industries, catalog number: 027-03052 )
Ethanol (Wako Pure Chemical Industries, catalog number: 057-00451 )
Disodium hydrogen phosphate dodecahydrate (Na2HPO4·12H2O) (Wako Pure Chemical Industries, catalog number: 196-02835 )
Succinic acid (Wako Pure Chemical Industries, catalog number: 190-04332 )
DL-Lactic acid lithium salt (MP Biomedicals, catalog number: 100824 )
Sodium acetate (Wako Pure Chemical Industries, catalog number: 190-01071 )
Modified BG-11 liquid medium (see Recipes)
Mobile phase (3 mM HClO4) (see Recipes)
Reaction solution (0.2 mM BTB in 15 mM Na2HPO4) (see Recipes)
500 mM succinate solution (see Recipes)
500 mM lactate solution (see Recipes)
500 mM citrate solution (see Recipes)
500 mM acetate solution (see Recipes)
1 M acetate solution (see Recipes)
Equipment
Cultivation chamber (TOMY Digital Biology, model: CLE-303 )
A gas mixer (KOFLOC, model: RK120XM )
An air pump (Yasunaga, model: LP-30A )
Spectrophotometer (Shimadzu, model: UV-2700 )
High-speed refrigerated microcentrifuge (TOMY Digital Biology, model: MX-305 )
N2 generator (Sanyo Denshi, model: SN4-4 )
Rotary shaker (Nissin, model: NX-20D )
Freeze dryer (Tokyo Rikaikai, EYELA, model: FDU-2200 )
Ultrasonic cleaning machine (SND, model: US-108 )
Autoclave
The HPLC system (JASCO International, model: LC-2000Plus ) was composed of the following equipment:
Photodiode array (PDA) detector (JASCO International, model: MD-2018Plus )
Intelligent HPLC pump (JASCO International, model: PU-2080Plus )
Line degasser (JASCO International, model: DG-2080-53 )
Ternary gradient unit (JASCO International, model: LG-2080-02 )
Intelligent column oven (JASCO International, model: CO-2065Plus )
Intelligent autosampler (JASCO International, model: AS-2057Plus )
Ion-exclusion column (300 x 8.0 mm) (GL Sciences, model: RSpak KC-811, catalog number: 5055-13509 ) and guard column (10 x 4.6 mm) (GL Sciences, model: GPC KF-G, catalog number: 5055-13150 )
Reaction coil unit (JASCO International, model: RU-2080-51 )
Software
ChromNAV software (Ver. 1.14)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yasuda, C., Iijima, H., Sukigara, H. and Osanai, T. (2017). Incubation of Cyanobacteria under Dark, Anaerobic Conditions and Quantification of the Excreted Organic Acids by HPLC. Bio-protocol 7(9): e2257. DOI: 10.21769/BioProtoc.2257.
Download Citation in RIS Format
Category
Microbiology > Microbial metabolism > Carbohydrate
Microbiology > Microbial biochemistry > Other compound
Biochemistry > Carbohydrate > Lactate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,258 | https://bio-protocol.org/exchange/protocoldetail?id=2258&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mating Based Split-ubiquitin Assay for Detection of Protein Interactions
Wijitra Horaruang
BZ Ben Zhang
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2258 Views: 15342
Edited by: Arsalan Daudi
Reviewed by: Ria SircarTimothy Notton
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
The mating based split-ubiquitin (mbSUS) assay is an alternative method to the classical yeast two-hybrid system with a number of advantages. The mbSUS assay relies on the ubiquitin-degradation pathway as a sensor for protein-protein interactions, and it is suitable for the determination of interactions between full-length proteins that are cytosolic or membrane-bound. Here we describe the mbSUS assay protocol which has been used for detecting the interaction between K+ channel and SNARE proteins (Grefen et al., 2010 and 2015; Zhang et al., 2015 and 2016)
Keywords: mbSUS Yeast Mating Split-ubiquitin Protein-protein interaction Gateway
Background
Figure 1 is an overview of the mbSUS assay. The ubiquitin moiety is split into two halves, and the N-terminal half is mutated (NubG) to avoid reassembly. The C-terminal half of the ubiquitin moiety (Cub) is linked with the transcription reporter complex PLV (Protein A-LexA-VP16). The fusion of two proteins (X and Y) to NubG and CubPLV, respectively, yields a system for protein-protein interaction analysis. After transformation, the yeast strain THY.AP5 contains the NubG-X fusion protein, while yeast strain THY.AP4 contains the Y-CubPLV fusion protein. After mating, in the diploid yeast, if proteins X and Y interact with each other, a functional ubiquitin will be reassembled which leads to cleavage of the PLV. The released transcription protein complex PLV switches on reporter genes (ADE2, HIS3) and allows yeast growth on selective media.
Figure 1. The split-ubiquitin system. A. The Ubiquitin is split into two halves, the N-terminal wild type half (NubWt; NubI) and the C-terminal half (Cub). Reassembly of NubWt and Cub leads to the release of the transcription reporter complex Protein A-LexA-VP16 (PLV) by ubiquitin-specific proteases (USPs). B. Mutating the isoleucine at position 13 of the N-terminal half to glycine yields the NubG protein, which inhibits the spontaneous reassembly of ubiquitin. In diploid yeast, NubG-X and Y-CubPLV fusion proteins are produced. If X and Y do not interact, no functional ubiquitin is formed, and the yeast cannot grow on selective media as shown in a small image on top-right. C. If X interacts with Y, then NubG and Cub can reassemble as a functional ubiquitin, which leads to the release of PLV. The PLV activates the reporter genes (ADE2, HIS3) synthesising ADE and HIS, which allows yeast growth on the selective media without these chemicals as shown in a small image on top-right.
Materials and Reagents
Sterile toothpick
Round bottom polystyrene tubes, 14 ml (purchased as sterile) (Corning, catalog number: 352051 )
Blue screw cap tubes, 50 ml (purchased as sterile; Cellstar)
Screw cap tubes, 2 ml (purchased as sterile; SARSTEDT)
PCR tubes, 0.2 ml, flat cap (Sterilized by autoclaving) (STARLAB INTERNATIONAL, catalog number: I1402-8100 )
Nitrocellulose transfer membranes, BioTraceTM NT (Pall, catalog number: 66485 )
1.5 ml screw cap tube
Minisart® syringe filter, non-pyrogenic, 0.2 µm (Sartorius)
Syringe filter w/0.45 µm polyethersulfone membrane (VWR, catalog number: 28145-503 )
Blotting paper (VWR, Blotting pad 707)
Petri dishes, 55 mm (purchased as sterile) (Greiner Bio One International, catalog number: 628102 )
Square Petri dishes, 120 x 120 mm (purchased as sterile) (Greiner Bio One International, catalog number: 688102 )
Filter tips 10, 200, 1,000 μl (Biosphere® Plus, for micropipettes, SARSTEDT)
Saccharomyces cerevisiae yeast strains used in the mbSUS assay (Table 1)
Table 1. Yeast strains used for mbSUS assay
Name
Genotype
Function
Reference
THY.AP4
MATa;
ade2-, his3-, leu2-, trp1-,
ura3-;
lexA::ADE2,
lexA::HIS3, lexA::lacZ
Bait: carrying the Y-
CubPLV in vector
pMetYC-Dest
(Obrdlik et al., 2004)
THY.AP5
MATα;
URA3;
ade2-, his3-, leu2-, trp1-
Prey: carrying the
NubG-X in vector
pNX35-Dest or NubWt
(Obrdlik et al., 2004)
Destination vectors used in the mbSUS assay (Table 2)
Table 2. The destination vectors used for mbSUS assay
Vector name
Promotor
Gateway site
Function
Reference
pMetYC-Dest
met25
attR1, attR2
Fusion protein with C-terminal
CubPLV as bait; synthesis of
LEU in yeast
(Grefen et al., 2009)
pNX35-Dest
ADH1
attR1, attR2
Fusion protein with N-terminal
NubG as prey; synthesis of
TRP in yeast
(Grefen and Blatt, 2012)
Donor vector: pDONR207 vector (Thermo Fisher Scientific) or other donor vectors contain attP1, attP2 Gateway cassette
Gateway® clonase enzyme:
BP Clonase®II Enzyme Mix (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11789020 )
LR Clonase®II Enzyme Mix (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11791020 )
Protein ladder (Pageruler Plus Prestained Protein Ladder, Thermo Fisher Scientific)
Western blot signal detection kit (SuperSignal West Dura Chemiluminescent Substrate) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 37071 )
Antibody solutions
Primary: anti-HA (1:20,000, Anti-HA high-affinity Rat monoclonal antibody) (Roche Diagnostics, catalog number: 11867423001 ) or anti-VP16 (1:20,000, Anti-VP16 tag antibody in Rabbit) (Abcam, catalog number: ab4808 )
Secondary: anti-rabbit HRP (1:20,000, goat anti-rabbit IgG-HRP) (Thermo Fisher Scientific, InvitrogenTM, catalog number: G-21234 ) or anti-rat HRP (1:20,000, Rabbit anti-Rat IgG H&L [HRP]) (Abcam, catalog number: ab6734 )
Methionine
Glycerol (Fisher Scientific, catalog number: 10795711 )
Peptone (FormediumTM, catalog number: PEP02 )
Glucose (Fisher Scientific, catalog number: 10141520 )
Yeast extract (FormediumTM, catalog number: YEA02 )
Oxoid agar (Agar No.1) (Oxoid, catalog number: LP0011 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 60377 )
Lithium acetate dihydrate (Sigma-Aldrich, catalog number: L4158 )
De-ionized water
Acetic acid (Sigma-Aldrich, catalog number: 1.00063 )
Salmon sperm DNA (ssDNA) (Sigma-Aldrich, catalog number: 31149 )
Polyethylene Glycol 3350 (Spectrum Chemical Manufacturing, catalog number: Po125-500gm )
YNB without ammonium sulphate, without potassium (MP Biomedicals, catalog number: 114029622 )
Potassium dihydrogen orthophosphate (Fisher Scientific, catalog number: 10783611 )
CSM-ADE-HIS-LEU-MET-TRP-URA (powder) (MP Biomedicals, catalog number: 114560222 )
Agar
Adenine sulphate (Sigma-Aldrich, catalog number: A3159 )
Uracil (Sigma-Aldrich, catalog number: U1128 )
L-leucine (Sigma-Aldrich, catalog number: L8912 )
L-tryptophane (Sigma-Aldrich, catalog number: T4196 )
L-histidine (Sigma-Aldrich, catalog number: H3911 )
L-methionine (Sigma-Aldrich, catalog number: M5308 )
Sodium dodecyl sulfate (SDS) (VWR, catalog number: 442444H )
Urea (Sigma-Aldrich, catalog number: U5378 )
DL-dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 43817 or 43815 )
Note: The product “ 43817 ” has been discontinued.
Acrylamide (Sigma-Aldrich, catalog number: A8887 )
Bromophenol blue
Ammonium persulfate (Fisher Scientific, catalog number: 10020020 )
TEMED (Sigma-Aldrich, catalog number: T9281 )
Ammonium sulphate (VWR, catalog number: 21333.296 )
Tris (Fisher Scientific, catalog number: BP152-1 )
Glycine (Fisher Scientific, catalog number: 10070150 )
Methanol (Sigma-Aldrich, catalog number: 34860 )
Ponceau S (Sigma-Aldrich, catalog number: P3504 )
Sodium chloride (VWR, catalog number: 27810.295 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: H1758 )
Tween® 20 (Sigma-Aldrich, catalog number: P1379 )
Milk powder (Marvel, Iceland, UK)
YPD media (see Recipes)
LiAc solution (see Recipes)
ssDNA solution (see Recipes)
PEG solution (see Recipes)
CSM-minimal media (see Recipes)
Reagents for auxotrophy selection (see Recipes)
SCM-auxotrophy selection media (see Recipes)
‘Lyse & Load’ buffer (see Recipes)
10% SDS-PAGE separation gel (see Recipes)
5% SDS-PAGE stacking gel (see Recipes)
Bjerrums buffer (see Recipes)
Ponceau S solution (see Recipes)
TBS solution and TBS-Tween solution (see Recipes)
Running buffer (see Recipes)
Blocking solution (see Recipes)
Equipment
Incubator shaker for yeast growth in liquid culture (Sartorius, model: BS1 )
Glass flask, 500 ml (sterilized by autoclaving) (Corning, PYREX®, catalog number: 4980-500 )
High speed refrigerated microcentrifuge (Eppendorf, model: 5417 R )
Refrigerated centrifuge for large volume liquid samples (Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM LegendTM RT )
PCR machine (VWR, PEQLAB, model: peqSTAR 96 Universal Gradient )
Pipette
Incubator for yeast growth on solid media plates (Gallenkamp, model: Ipr150 )
Ultrasonic disintegrator (MSE, model: Soniprep 150 MSS150.CX , 9.5 mm probe)
Biophotometer (Eppendorf, model: Biophotometer Plus 6132 )
SDS-PAGE gel electrophoresis and blotting boxes (Bio-Rad Laboratories, models: Power PAC 1000 and Mini-PROTEAN Tetra Cell )
Shaker for Western blot (Stuart, model: Stuart STR9 Gyro rocker )
Semi-dry blotting system (VWR, PEQLAB, model: PerfectBlueTM Semi-Dry Blotter )
Western blot imaging platform (Vilber, model: Fusion spectra )
Vortex (Scientific Industries, model: Vortex-Genie 2 )
Imaging system
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Horaruang, W. and Zhang, B. (2017). Mating Based Split-ubiquitin Assay for Detection of Protein Interactions. Bio-protocol 7(9): e2258. DOI: 10.21769/BioProtoc.2258.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,259 | https://bio-protocol.org/exchange/protocoldetail?id=2259&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunostaining of Formaldehyde-fixed Metaphase Chromosome from Untreated and Aphidicolin-treated DT40 Cells
Vibe H. Oestergaard
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2259 Views: 9580
Edited by: Antoine de Morree
Reviewed by: Tatsuki KunohXiaoyi Zheng
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
During mitosis chromosomes are condensed into dense X-shaped structures that allow for microscopic determination of karyotype as well as inspection of chromosome morphology.
This protocol describes a method to perform immunostaining of formaldehyde-fixed metaphase chromosomes from the avian cell line DT40. It was developed to characterize the localization of YFP-tagged TopBP1 on mitotic chromosomes and specifically determine the percentage of TopBP1 foci that formed on breaks/gaps as well as ends of individual metaphase macrochromosomes (Pedersen et al., 2015). For this purpose immunostaining of YFP was applied. However, the protocol may be optimized for other cell lines or epitopes.
Keywords: Metaphase chromosomes Cytogenetics Genomic instability Common fragile sites Replication stress Immunofluorescence Microscopy
Background
Microscopic analysis of stained metaphase chromosomes is a classical cytogenetic technique that is extensively used for both research and diagnostics. The basic principle involves induction of cell cycle arrest in metaphase by a spindle destabilizing reagent such as colcemid, which will trigger the spindle assembly checkpoint and therefore arrests cells in metaphase. This serves to enrich for cells with condensed chromosomes. Subsequently cells are subjected to swelling in hypotonic solution followed by spreading of mitotic cells on a microscope slide. The final result is microscopically detectable chromosomes from single cells convenient for karyotype analysis as well as investigations of individual chromosomes. Traditionally, swollen cells are fixed with methanol and acetic acid (3:1) before spreading on slides (Hungerford, 1965; Ronne et al., 1979).
The method described here uses formaldehyde rather than methanol for fixation. This can be useful for subsequent staining with antibodies that are not compatible with methanol fixation. The protocol is optimized for metaphase spreads from chicken DT40 cells, and immunostaining of YFP-tagged TopBP1 on metaphase macrochromosomes (Pedersen et al., 2015). TopBP1 foci on mitotic chromosomes mark DNA insults that are transmitted to G1 daughter cells (Pedersen et al., 2015; Gallina et al., 2016; Oestergaard and Lisby, 2016). The fluorescent signal of YFP is lost during the preparation of metaphase spreads, therefore this protocol includes immunostaining of the YFP epitope. However, it should be possible to apply the protocol for other cell lines and epitopes by optimizing incubation time in hypotonic buffer and antibody concentrations, respectively.
Aphidicolin is a replication inhibitor, which at low concentration induces formation of gaps and breaks on metaphase chromosomes preferentially at common fragile sites (Durkin and Glover, 2007). As stated by this protocol, DT40 cells may be subjected to 0.5 μM aphidicolin to induce breaks and gaps on metaphase chromosomes in DT40 (Pedersen et al., 2015).
The avian karyotype comprises macrochromosomes as well as mini and microchromosomes. The latter two groups are too small to reliably determine features such as breaks/gaps or ends. They are therefore not included in this analysis.
Materials and Reagents
15 ml tubes (such as Sigma-Aldrich, catalog number: T1943 )
Pipette tips
Round cover slips (Ø12 mm) (Thermo Fisher Scientific)
Cytospin slides (Thermo Fisher Scientific, catalog number: 5991059 )
A DT40 cell line (Baba and Humphries, 1985) carrying endogenous YFP-tagging at the TopBP1 gene (Germann et al., 2014; Pedersen et al., 2015)
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D4540 )
Aphidicolin (Sigma-Aldrich, catalog number: A0781 )
Colcemid (Thermo Fisher Scientific, GibcoTM, catalog number: 15212012 )
Cytofunnels (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: A78710020 )
Nail polish
RPMI 1640 medium GlutaMAX (Thermo Fisher Scientific, GibcoTM, catalog number: 61870044 )
Chicken serum (such as Sigma-Aldrich, catalog number: C5405 or Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 16110082 )
Fetal bovine serum (FBS) (Heat inactivated) (Thermo Fisher Scientific, GibcoTM, catalog number: 10500 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Penicillin/streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Potassium chloride (KCl) (TH GEYER, Chemsolute®, catalog number: 1632 )
Paraformaldehyde (Sigma-Aldrich, catalog number: 158127 )
Sodium hydroxide (NaOH)
Hydrochloric acid (HCl)
Sodium chloride (NaCl) (Avantor® Performance Materials, J.T. Baker, catalog number: 0278.1000 )
2-Amino-2-(hydroxymethyl)-1,3-propanediol (Tris, Trizma base) (Sigma-Aldrich, catalog number: T1503 )
(Ethylenedinitrilo)tetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: 27285 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Tween-20 (Sigma-Aldrich, catalog number: P9416 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A4503 )
Alexa Fluor 488-conjugated anti-mouse IgG (Thermo Fisher Scientific, Invitrogen, catalog number: A21121 )
Mouse anti-GFP antibody (Roche Diagnostics, catalog number: 11814460001 )
Glycerol (AppliChem, catalog number: 142329.1211 )
n-propyl-gallate (Sigma-Aldrich, catalog number: 02370 )
2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride, 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich, catalog number: D9542 )
DT40 cells medium (see Recipes)
Aphidicolin solution (see Recipes)
Hypotonic buffer (see Recipes)
3% paraformaldehyde in PBS (see Recipes)
KCM buffer (see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
PBS-T (see Recipes)
Blocking solution (see Recipes)
Alexa 488-secondary antibody working solution (see Recipes)
Anti-GFP antibody working solution (see Recipes)
DAPI-mounting buffer (see Recipes)
Equipment
Cytocentrifuge, Cytospin4 (Thermo Fisher Scientific, Thermo ScientificTM, model: CytospinTM 4 Cytocentrifuge )
Pipettes (P1000, P200, P20)
CO2 incubator (such as Nuaire, model: 4750E , series 6)
Flasks such as 25 cm2 flasks (TPP, catalog number: 90025 )
Vortex
Fume hood
Coplin jar such as ‘jar staining acc to Coplin W/cover’ (VWR, catalog number: 631-9331 )
Fluorescence microscope (such as GE Healthcare, DeltaVision Elite; Applied Precision) equipped with a 100x objective lens (NA 1.4; Olympus, model: U-PLAN S-APO ), a cooled EM CCD camera (Photometrics, model: Evolve 512 ), and a solid-state illumination source (Insight; Applied Precision) or similar fluorescence microscope. The microscope should be equipped with appropriate filters to image Alexa488 and DAPI
Software
SoftWoRx (Applied Precision) software or similar
Volocity software (PerkinElmer) or ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Oestergaard, V. H. (2017). Immunostaining of Formaldehyde-fixed Metaphase Chromosome from Untreated and Aphidicolin-treated DT40 Cells. Bio-protocol 7(9): e2259. DOI: 10.21769/BioProtoc.2259.
Pedersen, R. T., Kruse, T., Nilsson, J., Oestergaard, V. H. and Lisby, M. (2015). TopBP1 is required at mitosis to reduce transmission of DNA damage to G1 daughter cells. J Cell Biol 210(4): 565-582.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell staining > Nucleic acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
226 | https://bio-protocol.org/exchange/protocoldetail?id=226&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Mouse Bone Marrow-Derived Dendritic Cells (BM-DCs)
FG Francesca Granucci
RO Renato Ostuni
Ivan Zanoni
Published: Vol 2, Iss 12, Jun 20, 2012
DOI: 10.21769/BioProtoc.226 Views: 19946
Original Research Article:
The authors used this protocol in Jul 2009
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2009
Abstract
Generating mouse dendritic cells from bone-marrow progenitor cells is a useful tool to study biological functions of mouse dendritic cells. Dendritic cells are one of the major populations of phagocytes able to activate both innate and adaptive immune cells.
Keywords: Phagocytes Dendritic cells In vitro GM-CSF
Materials and Reagents
GM-CSF-transduced B16 cell line
HI FBS (EuroClone, catalog number: EC S0180L )
L-Glutamine (EuroClone, catalog number: EC B3000D )
Penicillin/streptomycin (EuroClone, catalog number: EC B3001D )
IMDM (EuroClone, catalog number: EC B2072L )
Beta-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
B16-GMCSF growth supernatant
Phosphate buffered saline (PBS) (EuroClone, catalog number: ECM9605AX )
EDTA
BMDCs culture medium/conditioned medium (see Recipes)
Equipment
Centrifuges 70 μm-wide cut-off cell strainer
Non-treated cell culture plates
Incubator (37 °C and 5% CO2)
Fluorescence activated cell sortor (FACS)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Granucci, F., Ostuni, R. and Zanoni, I. (2012). Generation of Mouse Bone Marrow-Derived Dendritic Cells (BM-DCs). Bio-protocol 2(12): e226. DOI: 10.21769/BioProtoc.226.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell differentiation
Stem Cell > Adult stem cell > Maintenance and differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,260 | https://bio-protocol.org/exchange/protocoldetail?id=2260&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Haustorium Induction Assay of the Parasitic Plant Phtheirospermum japonicum
Juliane K. Ishida
Satoko Yoshida
Ken Shirasu
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2260 Views: 8812
Edited by: Marisa Rosa
Reviewed by: Xinyan Zhang
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Phtheirospermum japonicum is a facultative root parasitic plant in the Orobanchaceae family used as a model parasitic plant. Facultative root parasites form an invasive organ called haustorium on the lateral parts of their roots. To functionally characterize parasitic abilities, quantification of haustorium numbers is required. However, this task is quite laborious and time consuming. Here we describe an efficient protocol to induce haustorium in vitro by haustorium-inducing chemicals and host root exudate treatments in P. japonicum.
Keywords: Parasitism Parasitic plant Orobanchaceae Haustorium Root Host Exudate DMBQ
Background
Parasitic plants have evolved to obtain nutrients from other plants. Some of parasitic plants cause significant damage to agriculture by infecting commercial crops (Spallek et al., 2013). Obligate parasitic plants require hosts to complete their lifecycle, while facultative parasitic plants can survive without hosts as autotrophic organisms but shift to heterotrophic by infection if host plants are nearby (Westwood et al., 2010). The common characteristic of all parasitic plants is a specialized organ called haustorium, which connects parasite with host by establishing vascular bridges (Saucet and Shirasu, 2016; Yoshida et al., 2016). Obligate root parasites form terminal haustoria that are derived from enlarged root tips, while facultative root parasites form lateral haustoria, which develop at the lateral side of the parasite roots without affecting the root meristem. Therefore, several lateral haustoria can form in a root. The early stage of haustorium development is characterized by enlarged root tissues caused by a combination of cell expansion and cell division. Several host-derived substances that are able to induce haustorium formation in vitro were previously identified. Such substances are called haustorium-inducing factors (HIF). Among them, the most active HIF is DMBQ (2,6-Dimethoxy-1,4-benzoquinone), initially isolated from sorghum root extracts (Chang and Lynn, 1986). Phtheirospermum japonicum, a facultative parasitic plant in the Orobanchaceae, is an ideal model to study the molecular mechanisms of the parasitism, because of its short life cycle, small size, and simple genetics as a selfing plant (Ishida et al., 2011; Cui et al., 2016). In addition, genetic manipulation of P. japonicum is now feasible (Ishida et al., 2011) and its large-scale transcriptome information is also available (Ishida et al., 2016). Here we report an efficient in vitro method for haustorium induction to investigate functionality of haustorium-related genes in P. japonicum. This method presents a step-by-step protocol for haustorium induction in vitro by DMBQ treatment or by contact with host exudates. This technique is useful to understand the genetic factors that trigger haustorium formation in parasitic plants.
Materials and Reagents
Falcon 50 ml conical centrifuge tube (e.g., Corning, Falcon®, catalog number: 352070 )
Filter paper, No. 2, Ø9 cm (Advantec, catalog number: 00021090 )
Sterilized plastic plate dish with diameter of 100 mm (e.g., BioLite φ100 TC Dish, Fisher Scientific, catalog number: 12-556-002 )
Manufacturer: Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 130182 .
Eppendorf® microcentrifuge tube (1.5 ml) (e.g., Fisher Scientific, catalog number: 05-408-129 )
Surgical tape (or Parafilm) (e.g., 3M, catalog number: 1530-1 )
Kitchen aluminium foil
Sterilized square plastic plate dish 140 x 100 x 14.5 mm (Eiken Chemical, catalog number: AW2000 703077 )
Microscope slides (e.g., Fisher Scientific, catalog number: 12-549-3 )
Microscope coverslips L x W x D: 22 x 70 x 1.0 mm (e.g., Fisher Scientific, catalog number: 10-016-24 )
Gloves
Rice seeds (Oryza sativa japonica variety Nipponbare)
Phtheirospermum japonicum seeds
Commercial hypochlorite solution (Kao Japan) (approx. 6% sodium hypochloride)
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 484016 )
Tween 20 (Sigma-Aldrich, catalog number: P9416 )
Water (Milli-Q grade)
Propidium iodide (Sigma-Aldrich, catalog number: P4170 )
Murashige and Skoog salts (Pre-mixed) (Wako Pure Chemical Industries, catalog number: 392-00591 )
Sucrose (Merck Millipore, catalog number: 107687 )
Myo-inositol (Sigma-Aldrich, catalog number: I7508 )
2,6-dimethoxy-1,4-benzoquinone (DMBQ) (Sigma-Aldrich, catalog number: 428566 )
Agar (Merck Millipore, catalog number: 101614 )
Dimethyl sulfoxide (DMSO) (Wako Pure Chemical Industries, catalog number: 041-29351 )
Chloral hydrate (Sigma-Aldrich, catalog number: V000554 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
GM media (see Recipes)
DMBQ stock solution (10 mM) (see Recipes)
Chloral hydrate solution (see Recipes)
Equipment
Rice husker (Fujiwara Scientific, model: Testing rice husker )
Tube rotator (e.g., TITEC, model: RT-50 , catalog number: 0000165-000)
Laminar flow hood (e.g., YAMATO SCIENTIFIC, model: CCV-1300E )
Plant growth chamber (e.g., NKsystem, model: LPH-411SP )
Daylight-white fluorescent lamp (NEC LIGHTING, model: FL40SEX-N-HG )
Microscope (Leica Microsystems, model: TCS-SP5 II )
Vortex shaker (e.g., Scientific Industries, model: Vortex-Genie2 , catalog number: G560-SI-0246 2)
Surgical scalpel handle (e.g., Swann-Morton, catalog number: 0933 )
Surgical scalpel blade number 11 (e.g., Swann-Morton, catalog number: 0303 )
Stainless steel forceps (e.g., Sigma-Aldrich, catalog number: F4142-1EA )
Semi-analytical balance (e.g., Shimadzu, model: AUW220D )
Water bath (e.g., Fisher Scientific, model: Fisher ScientificTM IsotempTM General Purpose Deluxe Water Bath, catalog number: S28124 )
Light stereo microscope (e.g., Carl Zeiss, model: Stemi-2000 )
Light microscope (e.g., Olympus, model: BX53-P )
Autoclave (e.g., Hirayama, model: HG series )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ishida, J. K., Yoshida, S. and Shirasu, K. (2017). Haustorium Induction Assay of the Parasitic Plant Phtheirospermum japonicum. Bio-protocol 7(9): e2260. DOI: 10.21769/BioProtoc.2260.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Biotic stress
Plant Science > Plant physiology > Phenotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,261 | https://bio-protocol.org/exchange/protocoldetail?id=2261&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Evaluation of Plasmid Stability by Negative Selection in Gram-negative Bacteria
Damián Lobato Márquez
Laura Molina García
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2261 Views: 11582
Edited by: Valentine V Trotter
Reviewed by: Alba BlesaSeda Ekici
Original Research Article:
The authors used this protocol in 14-Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
14-Oct 2013
Abstract
Plasmid stability can be measured using antibiotic-resistance plasmid derivatives by positive selection. However, highly stable plasmids are below the sensitivity range of these assays. To solve this problem we describe a novel, highly sensitive method to measure plasmid stability based on the selection of plasmid-free cells following elimination of plasmid-containing cells. The assay proposed here is based on an aph-parE cassette. When synthesized in the cell, the ParE toxin induces cell death. ParE synthesis is controlled by a rhamnose-inducible promoter. When bacteria carrying the aph-parE module are grown in media containing rhamnose as the only carbon source, ParE is synthesized and plasmid-containing cells are eliminated. Kanamycin resistance (aph) is further used to confirm the absence of the plasmid in rhamnose grown bacteria.
Keywords: Plasmid stability ParE Toxin Negative selection Gram-negative bacteria
Background
lassically, plasmid stability has been measured by positive selection using antibiotic-resistance plasmid derivatives. Cells harbouring the studied plasmid are positively selected in the presence of the selection antibiotic (Gerdes et al., 1985; del Solar et al., 1987). The main drawback of this technique is its sensitivity; highly stable plasmids are below the sensitivity of these assays. To solve this problem alternative methods relying on the direct selection of plasmid-free cells such as the tetAR-chlortetracycline system, have been described (Bochner et al., 1980; Maloy and Nunn, 1981; Garcia-Quintanilla et al., 2006). Limitations of the tetAR-chlortetracycline method include poor reproducibility and the frequent occurrence of false positives (Li et al., 2013). Here, we describe a novel, highly sensitive plasmid stability assay based on the counter-selection of plasmid-containing cells. This assay is based on a cassette containing a ParE toxin-encoding gene controlled by a rhamnose-inducible promoter and a kanamycin resistance gene (aph) (Figure 1) (Maisonneuve et al., 2011). ParE is the toxin of the toxin-antitoxin system parDE, and targets the DNA gyrase, blocks DNA replication and induces DNA breaks leading to cell death (Jiang et al., 2002). The aph-parE cassette is inserted into the plasmid of interest using homologous recombination. Upon induction of PparE in minimal media containing rhamnose as the only carbon source, only plasmid-free cells survive (Lobato-Marquez et al., 2016). Kanamycin is then used to confirm the loss of the plasmid (Figure 2).
Figure 1. Scheme showing the integration process of the aph-parE cassette into the plasmid of interest. (1) The aph-parE cassette is first amplified by PCR using pKD267 plasmid as template. (2) Then, cells harbouring a plasmid encoding λ-Red recombinase are electroporated with aph-parE DNA fragment. λ-Red recombinase directs the specific integration of the aph-parE module into the plasmid region containing the 50 bp upstream and 50 bp downstream homologous sequences included in the oligos used for PCR. (3) Confirm the aph-parE insertion by using primers annealing with the cassette (red arrows) and with the plasmid (black arrows).
Figure 2. Plasmid stability procedure. To avoid plasmid loss, the strain carrying the aph-parE cassette is initially grown under antibiotic selection pressure (using kanamycin). When kanamycin is removed from the medium, the plasmid of interest will be lost after a certain number of generations. Plasmid-free cells are selected when the culture is plated in M9-rhamnose plates containing rhamnose as the only carbon source. Modified from Lobato-Marquez et al., 2016.
Materials and Reagents
Pipette tips
1.5 ml Eppendorf tubes
Millipore 0.22 µm pore size filter (EMD Millipore, catalog number: SLGP033RS )
9-cm sterile Petri dishes
Electroporation cuvettes 0.2 cm gap (Bio-Rad Laboratories, catalog number: 1652082 )
Glass beads for bacterial plating (VWR, catalog number: 201-0279 )
pKD267 plasmid (described in Maisonneuve et al., 2011)
pKD46 plasmid (described in Datsenko and Wanner, 2000)
Expand High Fidelity DNA polymerase (Roche Molecular Systems, catalog number: 11732641001 )
DpnI restriction enzyme (New England Biolabs, catalog number: R0176 )
PCR purification kit (5Prime, catalog number: 2300610 )
Plasmid purification kit (Roche Molecular Systems, catalog number: 11754777001 )
4 °C chilled sterile distilled MilliQ water
Distilled MilliQ water
Ampicillin sodium salt (Sigma-Aldrich, catalog number: A0166 )
L-arabinose (Sigma-Aldrich, catalog number: A3256 )
Kanamycin (Sigma-Aldrich, catalog number: K1876 )
D-glucose (Sigma-Aldrich, catalog number: G8270 )
Bacto tryptone (BD, BactoTM, catalog number: 211705 )
Bacto yeast extract (BD, BactoTM, catalog number: 288620 )
Sodium chloride (NaCl) (VWR, BDH®, catalog number: 102415K )
European bacteriological agar (Conda, catalog number: 1800 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: 71645 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P9791 )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: A9434 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C3881 )
Magnesium sulfate (MgSO4) (VWR, BDH®, catalog number: 291175X )
Vitamin B1 (Thiamine) (Sigma-Aldrich, catalog number: T4625 )
L-rhamnose monohydrate (Sigma-Aldrich, catalog number: R3875 )
Potassium chloride (KCl)
Na2HPO4·12H2O
Glycerol (v/v) (Sigma-Aldrich, catalog number: G5516 )
Luria-Bertani (LB) broth medium (see Recipes)
Luria Bertani plates (see Recipes)
M9 (10x) (see Recipes)
CaCl2/MgSO4 solution (100x)
M9 minimum medium (see Recipes)
M9-rhamnose plates (see Recipes)
Phosphate saline buffered (PBS) (see Recipes)
10% sterile glycerol (see Recipes)
L-rhamnose (see Recipes)
Equipment
Selection of single channel pipettes (2 µl, 20 µl, 20 µl, 1,000 µl) (Gilson, P-2, P-20, P-200, P-1000)
Glass 100 ml flasks (Fisher Scientific, Fisherbrand)
Glass 50 ml flasks (Fisher Scientific, Fisherbrand)
MiniSpin® Eppendorf benchtop centrifuge (Eppendorf, model: MiniSpin® )
Bacterial shaking incubator (Eppendorf, New Brunswick, model: Innova® 4000 )
MicroPulserTM electroporator (Bio-Rad Laboratories, model: MicroPulser Electroporator , catalog number: 1652100)
Eppendorf refrigerated centrifuge (Eppendorf, model: 5804 )
Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: SPECTRONICTM 200 )
Milli-Q® integral water purification system for ultrapure (Nanopure) water
DNA SpeedVac (Savant Systems, model: SpeedVac DNA 110 )
Autoclave (Prestige Medical, catalog number: 210004 )
Software
GraphPad Prism Software (https://www.graphpad.com/scientific-software/prism/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lobato-Márquez, D. and Molina-García, L. (2017). Evaluation of Plasmid Stability by Negative Selection in Gram-negative Bacteria. Bio-protocol 7(9): e2261. DOI: 10.21769/BioProtoc.2261.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Plasmid
Molecular Biology > DNA > Extrachromosomal DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,262 | https://bio-protocol.org/exchange/protocoldetail?id=2262&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Nuclei Isolation from Nematode Ascaris
YK Yuanyuan Kang
JW Jianbin Wang
RD Richard E. Davis
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2262 Views: 8685
Edited by: Gal Haimovich
Reviewed by: Manish Chamoli
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Preparing nuclei is necessary in a variety of experimental paradigms to study nuclear processes. In this protocol, we describe a method for rapid preparation of large number of relatively pure nuclei from Ascaris embryos or tissues that are ready to be used for further experiments such as chromatin isolation and ChIP-seq, nuclear RNA analyses, or preparation of nuclear extracts (Kang et al., 2016; Wang et al., 2016).
Keywords: Nuclei isolation Embryos Tissue Nematodes Ascaris
Background
Nuclei isolation is often the first step in studying the molecular and biochemical aspects of nuclear events. Several methods have been developed to isolate nuclei from different tissues and cell types. However, few nuclei isolation protocols from nematodes other than C. elegans have been described (Ooi et al., 2010; Zanin et al., 2011; Haenni et al., 2012). Embryos of the parasitic nematode Ascaris have been used to prepare a variety of extracts for in vitro cell-free systems (Cohen et al., 2004; Lall et al., 2004). However, these extracts were typically whole cell extracts. Here we describe a method for preparation of nuclei from the nematode Ascaris.
Materials and Reagents
15 ml Falcon tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339651 )
50 ml Falcon tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339653 )
225 ml Falcon bottles (Corning, Falcon®, catalog number: 352075 )
Ascaris
Ascaris can be collected from slaughterhouses that process several thousand pigs a day and use the small intestines to make sausage casings. Ascaris can be picked up by hands (with gloves) from contents of intestine, which are pushed out to a tank by machines. Usually, it takes two persons 3-5 h to collect ~1,000 worms. Both fresh tissues and embryos can be obtained from these live worms. Female Ascaris can also be ordered from Carolina Biological, Living Zoology Department. These females are shipped dead on ice and the Ascaris zygotes can be obtained from the proximal uteri
Sodium hydroxide (NaOH) (Fisher Scientific, catalog number: S318-1 )
H2O (purified by Milli-Q® Integral Water Purification System)
DAPI (Santa Cruz Biotechnology, catalog number: sc-3598 )
Liquid nitrogen (Airgas, catalog number: NI NF160LT22 )
Phenylmethanesulfonyl fluoride (PMSF) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 36978 )
cOmpleteTM protease inhibitor cocktail (Roche Diagnostics, catalog number: 0493116001 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-3 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: P217-500 )
Sodium phosphate dibasic (Na2HPO4) (Fisher Scientific, catalog number: BP350-500 )
Potassium phosphate monobasic (KH2PO4) (Fisher Scientific, catalog number: P285-500 )
Hydrochloric acid (HCl)
1 M Tris-HCl, pH 8.0 (Thermo Fisher Scientific, AmbionTM, catalog number: AM9856 )
1 M Tris-HCl, pH 7.0 (Thermo Fisher Scientific, AmbionTM, catalog number: AM9851 )
Sodium hypochlorite solution (Fisher Scientific, catalog number: SS290-1 )
Potassium hydroxide (KOH) (Fisher Scientific, catalog number: P250-1 )
Magnesium chloride (MgCl2) (Fisher Scientific, catalog number: M33-500 )
EGTA (Thermo Fisher Scientific, USB, catalog number: 15703 )
Sucrose (Fisher Scientific, catalog number: BP220-212 )
DTT (Fisher Scientific, catalog number: BP172-5 )
Spermine (Sigma-Aldrich, catalog number: S3256 )
Spermidine (Sigma-Aldrich, catalog number: S2626 )
Nonidet P-40 (NP-40) (Alfa Aesar, Affymetrix/USB, catalog number: J19628 )
Triton X-100 (Promega, catalog number: H5142 )
Glycerol (Fisher Scientific, catalog number: BP229-1 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M6250-10ML )
EDTA (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 17892 )
PBS buffer (see Recipes)
1 M Tris-HCl, pH 7.8 (see Recipes)
KOH/Bleach (0.4 N KOH/1.4% sodium hypochlorite) (see Recipes)
Nuclei extraction buffer A (see Recipes)
Nuclei extraction buffer B (see Recipes)
Nuclei extraction buffer C (see Recipes)
Nuclei storage buffer (see Recipes)
Equipment
Erlenmeyer flask (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4112-0125 , 4112-0250 or 4112-0500 )
1 L beaker (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 12011000 )
4 L plastic beaker (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 12014000 )
Shaking incubator (example, Lab-Line, model: 4629 )
Fluorescence microscope (example, Nikon Instruments, model: TS100 )
Refrigerated centrifuge (example, Thermo Fisher Scientific, model: SorvallTM LegendTM XTR )
Metal dounce homogenizer (WHEATON, catalog number: 357574 )
Mortar and pestle (example, Fisher Scientific, catalog numbers: S02591 and S02594 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kang, Y., Wang, J. and Davis, R. E. (2017). Nuclei Isolation from Nematode Ascaris. Bio-protocol 7(9): e2262. DOI: 10.21769/BioProtoc.2262.
Download Citation in RIS Format
Category
Cell Biology > Organelle isolation > Nuclei
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,263 | https://bio-protocol.org/exchange/protocoldetail?id=2263&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Cyanobacterial Metabolism in Biofilms with NanoSIMS Isotope Imaging and Scanning Electron Microscopy (SEM)
RS Rhona K. Stuart
XM Xavier Mayali
MT Michael P. Thelen
JP Jennifer Pett-Ridge
PW Peter K. Weber
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2263 Views: 8918
Reviewed by: Claudia Catalanotti
Original Research Article:
The authors used this protocol in May/Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May/Jun 2016
Abstract
To advance the understanding of microbial interactions, it is becoming increasingly important to resolve the individual metabolic contributions of microorganisms in complex communities. Organisms from biofilms can be especially difficult to separate, image and analyze, and methods to address these limitations are needed. High resolution imaging secondary ion mass spectrometry (NanoSIMS) generates single cell isotopic composition measurements, and can be used to quantify incorporation and exchange of an isotopically labeled substrate among individual organisms. Here, incorporation of cyanobacterial extracellular organic matter (EOM) by members of a cyanobacterial mixed species biofilm is used as a model to illustrate this method. Incorporation of stable isotope labeled (15N and 13C) EOM by two groups, cyanobacteria and associated heterotrophic microbes, are quantified. Methods for generating, preparing, and analyzing samples for quantifying uptake of stable isotope-labeled EOM in the biofilm are described.
Keywords: Stable isotopes Extracellular matrix Extracellular organic matter Microbial ecology Substrate incorporation NanoSIP
Background
Stable isotope labeling combined with NanoSIMS (‘NanoSIP’) is an established method to quantify incorporation of stable isotope labeled substrates into individual microbial cells, which can then be extrapolated to estimate incorporation for a population of cells (for example, Lechene et al., 2006 and Woebken et al., 2012). Tracing multiple stable isotope labels (e.g., 13C and 15N) into individual cells can be used to examine differential incorporation between treatments over time (for example, Popa et al., 2007 and Stuart et al., 2016a). Biofilms present specific challenges to quantifying incorporation of label. Since individual organisms are embedded in an extracellular matrix and have a diverse range of cell sizes and shapes, cell counts and biomass calculations are difficult. Additionally, polymeric labeled substrates, such as EOM, can adhere to the matrix and cell surfaces, so unincorporated label needs to be accounted for. Imaging-based methods such as NanoSIMS, paired with SEM and fluorescence microscopy, are well-suited to address these challenges because cell sizes and unincorporated label can be identified. Here, we describe methods to address these challenges in order to quantify the incorporation of labels (13C and 15N) from a polymeric substrate (EOM) into a photosynthetic biofilm. EOM is extracellular material that is loosely associated with cells, and is separated from the cells in the biofilm. One drawback of this method is that biofilm spatial structure (the extracellular matrix) is not preserved. If the examination of spatial arrangements is desired, embedding and sectioning of the biofilm samples may be necessary (for example, Lechene et al., 2006).
Materials and Reagents
Sterile cell scrapers (VWR, catalog number: 89260-224 or 89260-222 )
Note: The product “ 89260-224 ” has been discontinued.
0.2 µm syringe filters (polyethersulfone membranes, e.g., Pall, catalog number: 4652 )
Pipet tip
1.7 ml microcentrifuge tubes
Sterile syringes
Silicon (Si) wafers, sized to fit NanoSIMS holder (e.g., 5 x 5 mm, Ted Pella, catalog number: 16008 )
Sterile tissue grinder (Fisher Scientific, catalog number: 02-542-08 )
Biofilm culture
Note: We examined a unicyanobacterial mixed species biofilm, however, the protocol is suitable for analysis of most biofilm types, provided that an aqueous substrate can be added to the sample, with even distribution. A detailed description of our biofilms and culturing procedures can be found in Stuart et al., 2016a.
Stable isotope labeled compound appropriate to support growth, or metabolism, of organism(s) of interest (e.g., 99 atom percent excess [atm%] 13C-NaHCO3, Cambridge Isotope Laboratories, catalog number: CLM-441-1 )
Appropriate defined medium for growth (e.g., modified artificial seawater base [ASN] medium, described in Stuart et al., 2016a)
50% ethanol (EtOH)
37% formaldehyde solution (Sigma-Aldrich, catalog number: 252549 )
10x phosphate buffered saline (Sigma-Aldrich, catalog number: P5493 )
Sodium chloride (NaCl)
Sterile MilliQ water
4% PFA (see Recipes)
Sterile 10% sodium chloride (NaCl) solution (see Recipes)
Modified artificial seawater base (ASN) medium recipe (with nitrate) (see Recipes)
Equipment
Dounce homogenizer (WHEATON, catalog number: 357546 )
Microcentrifuge, capable of variable rpm generating up to 15,000 x g
Isotope-ratio mass spectrometer (e.g., ANCA-IRMS, PDZE Europa Limited, Crewe, England)
Chambers for biofilm cultivation (e.g., Pyrex sealable flasks, Corning, PYREX®, catalog number: 4985-1L )
Incubator (as appropriate for cultivating the organism of interest)
Dissecting microscope (e.g., Fisher Scientific, model: Fisher ScientificTM 420 Series , catalog number: 11-350-124)
Desiccator cabinet (e.g., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 5317-0070 )
Epifluorescence light microscope (e.g., Leica Microsystems, model: Leica DMI600B )
Diamond or carbide scribe (e.g., Ted Pella, catalog number: 54412 )
Gold (or other conductive metal) sputter coater (e.g., Cressington, model: Sputter Coater 108 )
NanoSIMS 50 or 50 L (AMETEK, Cameca, model: NanoSIMS 50 or NanoSIMS 50 L )
Scanning electron microscope (SEM) with better than 50 nm resolution and micrograph recording capability (e.g., FEI, model: FEI Inspect F SEM )
Software
Ion image data processing software (e.g., LIMAGE, L. Nittler, Carnegie Institution of Washington, Washington, DC, USA; ImageJ with MIMS plugin; Look@NanoSIMS [Polerecky et al., 2012] or similar)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Stuart, R. K., Mayali, X., Thelen, M. P., Pett-Ridge, J. and Weber, P. K. (2017). Measuring Cyanobacterial Metabolism in Biofilms with NanoSIMS Isotope Imaging and Scanning Electron Microscopy (SEM). Bio-protocol 7(9): e2263. DOI: 10.21769/BioProtoc.2263.
Download Citation in RIS Format
Category
Microbiology > Microbial metabolism > Other compound
Cell Biology > Cell imaging > Electron microscopy
Biochemistry > Other compound > Bicarbonate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,264 | https://bio-protocol.org/exchange/protocoldetail?id=2264&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pathogenicity Assay of Penicillium expansum on Apple Fruits
YC Yong Chen
BL Boqiang Li
ZZ Zhanquan Zhang
Shiping Tian
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2264 Views: 9757
Edited by: Zhaohui Liu
Reviewed by: Tohir Bozorov
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Penicillium expansum, a widespread filamentous fungus, is a major causative agent of fruit decay and leads to huge economic losses during postharvest storage and shipping. Furthermore, it produces mycotoxin on the infected fruits that may cause harmful effects to human health. This pathogenicity assay involves a stab inoculation procedure of P. expansum on apple fruit, an important experimental technique to study fungal pathogenesis. This assay can be applied to analyze the virulence of postharvest pathogen on other fruits such as orange, pear and kiwifruit.
Keywords: Penicillium expansum Apple fruit Stab inoculation Pathogenicity assay
Background
Penicillium expansum is a destructive postharvest pathogen that causes decay in many popular fruits, such as apple and pear, during postharvest handling and storage. It causes significant socioeconomic impacts and has implications for international trade. The pathogen can also lead to serious health problems in human since it produces toxic secondary metabolites, including patulin, citrinin, and chaetoglobosins (Andersen et al., 2004). Control of decay caused by P. expansum has become important for ensuring the quality and safety of various fruits.
Conidia of P. expansum typically enter through wounds, which is necessary to provide sites for initiation of the pathogen development (Spotts et al., 1998). Pathogenicity of P. expansum on fruits is usually tested by needle-stab inoculation, which is also used for pathogenicity assays of Botrytis cinerea vs. tomato, Monilinia fructicola vs. peach, Colletotrichum gloeosporioides vs. mango, etc. (Liu et al., 2012; Shi et al., 2012; Zhang et al., 2014). Here, we described a protocol to assess pathogenicity of P. expansum on apple fruits based on stab inoculation method.
Materials and Reagents
90 x 15 mm Petri dish (any brand will suffice)
Plastic film (polyurethane material, any department store)
1,000 µl pipette tips (Corning, Axygen®, catalog number: TF-1000-R-S )
200 µl pipette tips (Corning, Axygen®, catalog number: TF-200-R-S )
10 µl pipette tips (Corning, Axygen®, catalog number: TF-300-R-S )
Polyester filter cloth cut into 8 x 8 cm squares (any fabric store)
Penicillium expansum T01: was isolated by our laboratory and whole-genome sequenced (Li et al., 2015)
Freshly harvested red Fuji apples
Glycerol (AMRESCO, catalog number: M152 )
Tween 20 (Sigma-Aldrich, catalog number: T2700 )
Sodium hypochlorite (Sigma-Aldrich, catalog number: 239305 )
Sterile distilled water
Potato
Dextrose (Macklin, catalog number: D823520 )
Agar (HUAAOBIO, catalog number: HA0552 )
2% sodium hypochlorite solution (see Recipes)
PDA medium (see Recipes)
Equipment
Clean bench (Beijing Donglian Har Instrument Manufacture, model: SCB-1520 )
Sterile nail (approximately 3 mm in diameter, manual polishing)
Constant temperature incubator (TAICANG, model: THZ-C )
Hemacytometer (QIUJING, catalog number: XB-K-25 )
Vortexer (Select BioProducts, model: SBS100-2 )
100 µl-1,000 µl pipette (Eppendorf, catalog number: 3120000267 )
10 µl-1,00 µl pipette (Eppendorf, catalog number: 3120000240 )
0.5µl-1,0 µl pipette (Eppendorf, catalog number: 3120000224 )
Optical microscope (CHONGQING OPTEC Instrument, model: B203LED )
40 x 30 x 10 cm plastic basket (any brand will suffice)
Hand held sprayer (any brand will suffice)
40 x 40 x 30 cm containers (any brand will suffice)
Hygrothermograph (Fisher Scientific, catalog number: 11-661-20 )
Software
SPSS version 13.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, Y., Li, B., Zhang, Z. and Tian, S. (2017). Pathogenicity Assay of Penicillium expansum on Apple Fruits. Bio-protocol 7(9): e2264. DOI: 10.21769/BioProtoc.2264.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > Fungus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,265 | https://bio-protocol.org/exchange/protocoldetail?id=2265&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Relative Stiffness Measurements of Tumour Tissues by Shear Rheology
CM Chris D. Madsen
TC Thomas R. Cox
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2265 Views: 9805
Edited by: Ralph Bottcher
Reviewed by: Vikash VermaCristina Rohena
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
The microenvironment of solid tumours is a critical contributor to the progression of tumours and offers a promising target for therapeutic intervention (Cox and Erler, 2011; Barker et al., 2012; Cox et al., 2016; Cox and Erler, 2016). The properties of the tumour microenvironment vary significantly from that of the original tissue in both biochemistry and biomechanics. At present, the complex interplay between the biomechanical properties of the microenvironment and tumour cell phenotype is under intense investigation. The ability to measure the biomechanical properties of tumour samples from cancer models will increase our understanding of their importance in solid tumour biology. Here we report a simple method to measure the viscoelastic properties of tumour specimens using a controlled strain rotational rheometer.
Keywords: Shear rheology Tissue stiffness Matrix remodeling Collagen cross-linking Lysyl oxidase Breast cancer
Background
The growth of solid tumours is accompanied by pathological remodelling of the native tissue (Cox and Erler, 2011; Bonnans et al., 2014). During progression, the local tissue environment experiences physical as well as biological changes, resulting in increased tissue stiffness (elastic modulus) (Humphrey et al., 2014). Alterations in the extracellular matrix lead to the generation of new tissue properties, which activate mechano-signalling pathways within tumour cells (DuFort et al., 2011). This outside-in signalling leads to altered behaviour, cell morphology, differentiation, proliferation, migration and stemness. In preclinical animal models of cancer, these changes have been shown to drive malignant progression and metastatic spread (Erler et al., 2006; Levental et al., 2009; Bonnans et al., 2014). Thus, as a result, the targeting of matrix remodelling and in particular stiffening has received substantial attention in recent years, and several clinical trials have been initiated (Barker et al., 2012; Baker et al., 2013; Cox et al., 2013; Miller et al., 2015; Madsen et al., 2015; Cox and Erler, 2016; Kai et al., 2016).
The mechanical properties of the tumour microenvironment can readily be examined using approaches such as atomic force microscopy (AFM) and nanoindentation (Akhtar et al., 2009). These approaches provide nanometre resolution and concurrent measurement of the applied force with picoNewton resolution (Kasas and Dietler, 2008). However, AFM is not applicable to understand the elastic properties of larger 3D samples. The mechanical properties of bulk 3D tumour samples can be more accurately examined using shear rheology (Picout and Ross-Murphy, 2003). Rheology is the study of how a material deforms when forces are applied to them. Thus applying shear stress to a 3D matrix can determine the elastic modulus (stiffness) as well as viscous properties of a bulk 3D tumour tissue. In this protocol, we describe a method to measure changes on tumour stiffness by shear rheology.
Materials and Reagents
1,000 μl sterile pipet tip
1.5 ml sterile microcentrifuge tubes
Cell strainer, 70 µm (VWR, catalog number: 734-0003 )
Hypodermic needles, 27 G (Fine-JectR) (VWR, catalog number: 613-2012 )
8 mm disposable biopsy punch (KAI, catalog number: BP-80F )
Precision syringes, 1 ml (VWR, catalog number: 613-3908 )
Standard scalpel #11 (Fine Science Tools, catalog number: 10011-00 )
The 4T1 wild-type cell line was obtained from F. Miller at the University of Michigan
The SW480, early-stage colon adenocarcinoma (Duke stage B) cell line was obtained from the American Type Culture Collection (ATCC) (LGC Standards) (ATCC, catalog number: CCL-228 )
The SW480 + LOX cell line was derived from the parent line and has been previously described (Baker et al., 2011; Baker et al., 2013)
For the human colorectal cancer model, 8-week-old female immunodeficient MF1 nude mice were used (Envigo [formerly known as Harlan Laboratories Inc.])
For the murine mammary carcinoma model, 8-week-old female BALB/c mice were used (Taconic Biosciences)
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 31966047 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Sterile PBS, pH 7.2 (Thermo Fisher Scientific, GibcoTM, catalog number: 20012068 )
Trypsin-EDTA (0.25%), phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Ethanol
Growth medium (see Recipes)
Equipment
Benchtop Centrifuge capable of holding 15 ml tubes
Pipette, P1000 (Gilson)
Cell incubator at 37 °C, 5% CO2 (HERAcell)
Standard glass haematocytometer
Calipers
Stainless Steel Spatula, One End Flat, One End Bent, 6 in. in length (United Scientific Supplies, model: SSFB06 )
Standard pattern surgical scissors blunt/blunt (Fine Science Tools, catalog number: 14000-18 )
8 mm sand-blasted smart-swap upper geometry, Figure 1A (arrowhead) (TA Instruments)
8 mm sand-blasted stepped lower geometry, Figure 1A (arrow) (TA Instruments)
Discovery Series Hybrid rheometer (TA Instruments, model: dhr-2 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Madsen, C. D. and Cox, T. R. (2017). Relative Stiffness Measurements of Tumour Tissues by Shear Rheology. Bio-protocol 7(9): e2265. DOI: 10.21769/BioProtoc.2265.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biomechanical assays
Cell Biology > Tissue analysis > Stiffness measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,266 | https://bio-protocol.org/exchange/protocoldetail?id=2266&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assay to Measure Interactions between Purified Drp1 and Synthetic Liposomes
YA Yoshihiro Adachi
KI Kie Itoh
MI Miho Iijima
HS Hiromi Sesaki
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2266 Views: 9713
Edited by: Nicoletta Cordani
Reviewed by: Jianwei SunDaniel Kraus
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
A mitochondrion is a dynamic intracellular organelle that actively divides and fuses to control its size, number and shape in cells. A regulated balance between mitochondrial division and fusion is fundamental to the function, distribution and turnover of mitochondria (Roy et al., 2015). Mitochondrial division is mediated by dynamin-related protein 1 (Drp1), a mechano-chemical GTPase that constricts mitochondrial membranes (Tamura et al., 2011). Mitochondrial membrane lipids such as phosphatidic acid and cardiolipin bind Drp1, and Drp1-phospholipid interactions provide key regulatory mechanisms for mitochondrial division (Montessuit et al., 2010; Bustillo-Zabalbeitia et al., 2014; Macdonald et al., 2014; Stepanyants et al., 2015; Adachi et al., 2016). Here, we describe biochemical experiments that quantitatively measure interactions of Drp1 with lipids using purified recombinant Drp1 and synthetic liposomes with a defined set of phospholipids. This assay makes it possible to define the specificity of protein-lipid interaction and the role of the head group and acyl chains.
Keywords: Mitochondria Organelle division Dynamin superfamily Phospholipids
Background
Interactions of proteins and membrane lipids are critical for the remodeling of biological membranes in cells such as organelle division. In mitochondrial division, Drp1 constricts the mitochondrial membranes and drives this membrane remodeling process. We have recently shown that a signaling phospholipid, phosphatidic acid, interacts with Drp1 and creates the priming step by restraining assembled division machinery on mitochondria (Adachi et al., 2016). Drp1 recognizes both the head group and acyl chains of phosphatidic acid. To analyze Drp1-phosphatidic acid binding, we set up several protein-lipid interaction assays, including a lipid dot blot assay, a competition assay and a liposome flotation assay. These assays allowed us to determine the function of the head group and acyl chain composition in protein-lipid interactions. In addition, we analyzed lipids under bilayer conditions in the liposome assay and lipids under non-bilayer conditions in dot blot and competition assays, which made it possible to examine the contribution of the membrane curvature and lipid packing to protein-lipid interactions. Below, we describe a liposome flotation assay that can be applied to many peripheral membrane proteins.
Materials and Reagents
0.45 µm Millex-HA syringe filter unit (EMD Millipore, catalog number: SLHA033SS )
15-ml column (Poly-prep chromatography column) (Bio-Rad Laboratories, catalog number: 7311550 )
Amicon Ultra-15 centrifugal filter unit with Ultracel-10 membrane (10k filter for domains of Drp1) (EMD Millipore, catalog number: UFC901024 )
Amicon Ultra-15 centrifugal filter unit with Ultracel-50 membrane (50k filter for full length Drp1) (EMD Millipore, catalog number: UFC905024 )
Polycarbonate membranes 0.4 μm (Avanti Polar Lipids, catalog number: 610007 )
96 well assay plate (Corning, catalog number: 3915 )
Extruder set with holder/heating block (Avanti Polar Lipids, catalog number: 610000 )
Filter support (Avanti Polar Lipids, catalog number: 610014 )
2 ml amber glass sample vials (WHEATON, catalog number: 224981 )
Disposable culture tubes (Fisher Scientific, catalog number: 14-961-27 )
50 Ulrta-Clear tubes (Beckman Coulter, catalog number: 344057 )
RosettaTM 2(DE3)pLysS competent cells (EMD Millipore, catalog number: 71403 )
pET15b vectors (EMD Millipore, Novagen)
50% Ni-NTA beads (EMD Millipore, catalog number: 70666 )
4-20% Tris-HCl precast gel (Bio-Rad Laboratories, catalog number: 3450034 )
Chloroform (Sigma-Aldrich, catalog number: C2432 )
Ethanol (PHARMCO-AAPER, catalog number: 111000200 )
DMSO (Fisher Scientific, catalog number: S369-500 )
Liquid nitrogen
1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) (Avanti Polar Lipids, catalog number: 850457 )
1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (rhodamine-DPPE) (Avanti Polar Lipids, catalog number: 810158 )
1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE) (Avanti Polar Lipids, catalog number: 850705 )
1,2-dipalmitoyl-sn-glycero-3-phosphate (DPPA) (Avanti Polar Lipids, catalog number: 830855 )
1,2-dioleoyl-sn-glycero-3-phosphate (DOPA) (Avanti Polar Lipids, catalog number: 840875 )
1-palmitoyl-2-hydroxy-sn-glycero-3-phosphate (Palmitoyl lysoPA) (Avanti Polar Lipids, catalog number: 857123 )
1,2-dihexanoyl-sn-glycero-3-phosphate (Dihexanoyl PA) (Avanti Polar Lipids, catalog number: 830841 )
1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) (Avanti Polar Lipids, catalog number: 850355 )
1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) (Avanti Polar Lipids, catalog number: 850375 )
1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) (Avanti Polar Lipids, catalog number: 850725 )
1,2-dipalmitoyl-sn-glycero-3-phospho-(1’-rac-glycerol) (DPPG) (Avanti Polar Lipids, catalog number: 840455 )
1,2-dioleoyl-sn-glycero-3-phospho-(1’-rac-glycerol) (DOPG) (Avanti Polar Lipids, catalog number: 840475 )
1,2-dipalmitoyl-sn-glycero-3-phospho-L-serine (DPPS) (Avanti Polar Lipids, catalog number: 840037 )
1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS) (Avanti Polar Lipids, catalog number: 840035 )
1’,3’-bis[1,2-dioleoyl-sn-glycero-3-phospho]-sn-glycerol (TOCL) (Avanti Polar Lipids, catalog number: 710335 )
1’,3’-bis[1,2-dipalmitoyl-sn-glycero-3-phospho]-sn-glycerol TPCL (Echelon Biosciences, catalog number: L-C160 )
Gas nitrogen
SilverQuestTM Silver Staining Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: LC6070 )
BactoTM tryptone (BD, BactoTM, catalog number: 211705 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271 )
BactoTM yeast extract (BD, BactoTM, catalog number: 212750 )
Agar (Alfa Aesar, catalog number: J10906 )
Ultrapure water (e.g., MilliQ)
Ampicillin, sodium salt (Alfa Aesar, catalog number: J11259 )
Chloramphenicol (Mediatech, catalog number: 61-239-RI )
beta-D-Galactopyranoside, Isopropyl-beta-D-thiogalactopyranoside (IPTG) (AMRESCO, catalog number: 0487 )
HEPES (Fisher Scientific, catalog number: BP310-1 )
Potassium hydroxide (KOH) (Avantor® Performance Materials, J.T. Baker, catalog number: 3116-01 )
Magnesium chloride hydrate (MgCl2·6H2O) (Avantor® Performance Materials, J.T. Baker, catalog number: 2444 )
Imidazole (Sigma-Aldrich, catalog number: I0125 or I202 )
Note: The product “ I0125 ” has been discontinue
2-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Sodium phosphate monobasic (NaH2PO4·H2O) (Fisher Scientific, catalog number: S369-500 )
Sodium phosphate dibasic heptahydrate (Na2HPO4·7H2O) (Fisher Scientific, catalog number: S373-3 )
Sodium hydroxide (NaOH) (Avantor® Performance Materials, J.T. Baker, catalog number: 3722 )
Coomassie Brilliant Blue R-250 (AMRESCO, catalog number: M128-50G )
Acetic acid (Fisher Scientific, catalog number: A38-212 )
Methanol (Fisher Scientific, catalog number: A412 )
MES (2-morpholinoethanesulfonic acid, mono hydrate) (Sigma-Aldrich, catalog number: M8250 )
Sucrose (Fisher Scientific, catalog number: S5-3 )
LB plate containing ampicillin and chloramphenicol (see Recipes)
LB with ampicillin and chloramphenicol (see Recipes)
0.5 M IPTG
0.5 M HEPES (pH 7.4) (see Recipes)
Lysis buffer (see Recipes)
Wash buffer (see Recipes)
Elution buffer (see Recipes)
10x PBS (see Recipes)
Coomassie Brilliant Blue solution (see Recipes)
100 mM MES (pH 7.0) (see Recipes)
20 mM MES (pH 7.0) (see Recipes)
20 mM MES (pH 7.0)/100 mM NaCl (see Recipes)
2.7 M sucrose/20 mM MES/100 mM NaCl (see Recipes)
1.25 M sucrose/20 mM MES/100 mM NaCl (see Recipes)
0.25 M sucrose/20 mM MES/100 mM NaCl (see Recipes)
Equipment
1 ml syringe (Hamilton, catalog number: 81365 )
500 µl syringe (Hamilton, catalog number: 81265 )
100 µl syringe (Hamilton, catalog number: 81065 )
50 µl syringe (Hamilton, catalog number: 80500 )
25 µl syringe (Hamilton, catalog number: 80400 )
Incubator shaker (37 °C) (Eppendorf, New BrunswickTM, model: Series 25 )
Incubator shaker (16 °C) (Lab Companion, model: IS-971R )
1,000 ml bottle (Beckman Coulter, catalog number: A98814 )
JLA8.1000 rotor (Beckman Coulter, catalog number: 969329 )
GH3.8 rotor (Beckman Coulter, catalog number: 360581 )
Fisher Scientific Sonic dismembrator (Fisher Scientific, model: 100 )
CS-6R centrifuge (Beckman Coulter, model: CS-6R )
Avanti J-E (Beckman Coulter, model: Avanti J-E , catalog number: 369001)
SpeedVac SVC100 (Savant System, model: SpeedVac SVC100 )
Heat block (37 °C, 42 °C, 95 °C) (Fisher Scientific, model: Fisher ScientificTM IsotempTM Digital and Analog Dry Bath Incubators , catalog number: 11-718)
Motorized upright fluorescence microscope (Olympus, model: BX61 )
POLARstar Omega (BMG LABTECH, model: POLARstar Omega )
Labquake Shaker Rotisserie (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4152110 )
SW55Ti rotor (Beckman Coulter, catalog number: 342196 )
Avanti J-26XP (Beckman Coulter, model: Avanti® J-26 XP , catalog number: 393124)
Optima L-100XP ultracentrifuge (Beckman Coulter, model: OptimaTM L-100XP , catalog number: 392050)
Scanmaker 8700 (Microtek, model: Scanmaker 8700 )
Power supply (Bio-Rad Laboratories, model: PowerPacTM HC )
Multi-Purpose rotator (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2309 )
Vortex mixer (Fisher Scientific, model: Fisher ScientificTM Analog Vortex Mixer , catalog number: 02215365)
Software
ImageJ (Version 1.48, http://imagej.net/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Adachi, Y., Itoh, K., Iijima, M. and Sesaki, H. (2017). Assay to Measure Interactions between Purified Drp1 and Synthetic Liposomes. Bio-protocol 7(9): e2266. DOI: 10.21769/BioProtoc.2266.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Lipid-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,267 | https://bio-protocol.org/exchange/protocoldetail?id=2267&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Adhesion and Invasion Assay Procedure Using Caco-2 Cells for Listeria monocytogenes
SR Swetha Reddy
FA Frank Austin
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2267 Views: 15014
Edited by: Valentine V Trotter
Reviewed by: Sofiane El-Kirat-ChatelAlexander B. Westbye
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Listeria monocytogenes is an important Gram-positive foodborne pathogen that is a particular problem in ready-to-eat food. It has an ability to survive in harsh conditions like refrigeration temperatures and high salt concentrations and is known to cross intestinal, placental and blood-brain barriers. Several cancerous cell lines like cervical, liver, dendritic, intestinal and macrophages have been used to study in vitro propagation and survival of listeria in human cells. Human intestinal epithelial cells have been used to study how listeria crosses the intestinal barrier and cause infection. The protocol in this articles describes the procedures to grow Caco-2 cells, maintain cells and use them for adhesion and invasion assays. During adhesion assay the cells are incubated with listeria for 30 min but in invasion assay the cell growth is arrested at several time points after infection to monitor the growth and survival rate of listeria in cells.
Keywords: Adhesion assay Invasion assay Listeria Caco-2 cells
Background
Listeria monocytogenes being a facultative intracellular bacterium can enter, survive and multiply in both phagocytic and non-phagocytic cells and this property of the bacterium has been extensively studied and understood. Being a foodborne pathogen it enters the blood stream in humans via intestines by crossing intestinal barriers. Thus human intestinal cells are used as an in vitro medium to study adhesion and intracellular survival of Listeria monocytogenes. Human colon adenocarcinoma cells, Caco-2 cells have been used extensively as a model for intestinal barrier (Angelis and Turco, 2011).The protocol described in this article explains the procedure to grow and maintain Caco-2 cells and then infect them to study adhesion and invasion properties of listerial species. This protocol can also be used with minor changes for cells like HT-29 (human colorectal adenocarcinoma cells) and Tc7 cells (a subclone of the Caco-2 cell line have) which have also been used to study Listeria. These assays are generally used to compare the pathogenicity of listerial mutants with wide type(WT) strains (Reddy and Lawrence, 2014). Adhesion assay is straight forward wherein the bacteria are incubated with Caco-2 cells for 30 min and the bacterial counts for mutants and WT strains are compared to observe any alteration in adhesion properties as a result of mutation. Bacterial counts obtained at different time points during invasion assay give more information about the survival of listeria in the human cells and the comparison of these counts between mutants and WT strains gives information about the changes in the adaptation of listeria after mutation in human cells. This protocol has been successfully used previously to study the adhesion and invasion properties of listerial strains (Jaradat and Bhunia, 2003; Lecuit, 2005; Sambuy et al., 2005; Reddy et al., 2016).
Materials and Reagents
MF-Millipore filters (EMD Millipore, catalog number: SCGPU05RE )
Eppendorf tubes (Eppendorf, catalog number: 022363204 )
Cell culture flasks (Corning, catalog number: 3275 )
Cell culture plates (12-well cell culture receiver plate, sterile) (EMD Millipore, catalog number: PIMWS1250 )
Pipette tip
15 ml culture tube
Cell scrapers (Corning, catalog number: 3010 )
ZapCap bottle-top filters, pore size 0.2 µm (Maine Manufacturing, catalog number: 10443421 )
Serological pipettes (1, 5, 10, 25, 50 ml) (Corning, catalog numbers: 4010 , 4050 , 4100 , 4250 , 4501 )
Culture tubes (Sigma-Aldrich, catalog number: T1661 )
Listeria monocytogenes strains F2365 (wild type strain), and F2365∆2117(mutant strain) (Reddy et al., 2016)
Caco-2 cell line (ATCC, catalog number: HTB-37 )
70% ethanol (Fisher Scientific, catalog number: BP82014 )
Trypsin-EDTA solution (Sigma-Aldrich, catalog number: T3924 )
Brain Heart Infusion (BHI) agar (Sigma-Aldrich, catalog number: 70138 )
BHI broth (Sigma-Aldrich, catalog number: 53286 )
Gentamicin (Sigma-Aldrich, catalog number: G1397 )
Eagle’s minimum Essential medium (EMEM) (ATCC, catalog number: 30-2003 )
Fetal bovine serum, certified, heat inactivated (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10082147 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Dulbecco’s phosphate buffered saline (Sigma-Aldrich, catalog number: D8537 )
Triton X-100 (Sigma-Aldrich, catalog number: 234729 )
Note: This product has been discontinued.
Phosphate-buffered saline, 10x (PBS) (Sigma-Aldrich, catalog number: P5493 )
cEMEM (see Recipes)
0.1% Triton-X 100 (see Recipes)
1x PBS (see Recipes)
Equipment
Water bath, 37 °C (Thermo Fisher Scientific)
CO2 forced-air incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Steri-CultTM CO2 Incubators , catalog number: 3307TS)
Biological safety cabinet (Thermo Fisher Scientific, Thermo ScientificTM, model: 1300 Series Class II )
Inverted microscope(Nikon Instruments, model: Eclipse Ti-S )
Pipette (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4642070 )
Pipettor (Daigger Scientific, model: Portable Pipet-Aid XP Pipette Controller )
Hemacytometer (Fisher Scientific, catalog number: S17040 )
37 °C incubator (Thermo Fisher Scientific)
37°C shaker (Thermo Fisher Scientific)
Microcentrifuge, 4 °C (Eppendorf)
Fisher Scientific Sonic dismembrator (Fisher Scientific, model: 100 )
Vortex (Thermo Fisher Scientific, Thermo ScientificTM, model: LP Vortex Mixer , catalog number: 88880018)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Reddy, S. and Austin, F. (2017). Adhesion and Invasion Assay Procedure Using Caco-2 Cells for Listeria monocytogenes. Bio-protocol 7(9): e2267. DOI: 10.21769/BioProtoc.2267.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vitro model
Microbiology > Microbe-host interactions > Bacterium
Cell Biology > Cell-based analysis > Cell adhesion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,268 | https://bio-protocol.org/exchange/protocoldetail?id=2268&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Metabolic Heavy Isotope Labeling to Study Glycerophospholipid Homeostasis of Cultured Cells
SH Satu Hänninen
PS Pentti Somerharju
MH Martin Hermansson
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2268 Views: 6387
Edited by: Neelanjan Bose
Reviewed by: Michael Enos
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Glycerophospholipids consist of a glycerophosphate backbone to which are esterified two acyl chains and a polar head group. The head group (e.g., choline, ethanolamine, serine or inositol) defines the glycerophospholipid class, while the acyl chains together with the head group define the glycerophospholipid molecular species. Stable heavy isotope (e.g., deuterium)-labeled head group precursors added to the culture medium incorporate efficiently into glycerophospholipids of mammalian cells, which allows one to determine the rates of synthesis, acyl chain remodeling or turnover of the individual glycerophospholipids using mass spectrometry. This protocol describes how to study the metabolism of the major mammalian glycerophospholipids i.e., phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines and phosphatidylinositols with this approach.
Keywords: Glycerophospholipid Stable heavy isotope labeling Deuterium-labeled precursor Mass spectrometry Lipid metabolism Cell culture
Background
Radiolabeled precursors have been extensively used to study glycerophospholipid (GPL) metabolism in cultured cells. However, this approach has serious drawbacks. First of all, it is unfeasible to study the metabolism of all molecular species of GPLs due to the fact that it is not possible, without reverting to highly complicated and time-consuming protocols, to separate the individual molecular species from each other (Patton et al., 1982), which is obviously necessary to study their metabolism. Second, the radioisotopes needed are quite expensive. Third, for optimal labeling, the unlabeled precursors should be depleted of the medium as much as possible. Fourth, only two different precursors (labeled with 3H or 14C) can be added to the cells simultaneously and even then accurate correction for the overlap between the isotope spectra is necessary upon liquid scintillation counting of the collected fractions. Because of those handicaps, a number of studies have recently introduced an alternative approach to study GPL metabolism (e.g., Heikinheimo and Somerharju, 2002; de Kroon, 2007; Kainu et al., 2008; Postle and Hunt, 2009; Kainu et al., 2013; Hermansson et al., 2016). This approach is based on the use of stable heavy isotope-labeled precursors and mass spectrometric (MS) analysis of GPL labeling. Clearly, this approach is far more convenient and efficient as compared to the traditional methods based on the use of radiolabeled precursors, due to the following facts: (a) multiple labeled precursors can be added simultaneously to the culture medium thus providing information on several GPL classes, (b) labeled and unlabeled GPLs can be conveniently and selectively detected using head group–specific scanning modes, (c) information is obtained on the turnover of individual GPL molecular species and (d) the stable heavy isotope-labeled precursors are generally much cheaper than the radiolabeled ones and can thus be added in amounts which avoids the use of special media depleted of the corresponding unlabeled precursors.
Materials and Reagents
Pipette tips (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 9400327 , 9401255 , 9401410 )
35 or 60 mm cell culture dishes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 153066 or 150288 )
12 ml screw-cap glass tubes (Kimble Chase Life Science and Research Products, catalog number: 45066A-16100 )
Pasteur pipettes (BRAND, catalog number: 747720 )
12 x 32 mm screw-neck vials with caps (WATERS, catalog number: 186002640 )
11.5 x 75 mm test tubes (VWR, catalog number: ZZ130296772 )
Cell scrapers and lifters (VWR, catalog numbers: 734-2603 and 734-2602 )
HeLa cells or other cultured mammalian cells
Phosphate buffered saline (PBS) (Merck Millipore, catalog number: 524650 )
Methanol (VWR, catalog number: 83638.320 )
Internal standards needed for mass spectrometric analyses:
Di-20:1-phosphatidylcholine (PC) (Avanti Polar Lipids, catalog number: 850396 )
Di-20:1-phosphatidylethanolamine (PE; synthesized in-house from corresponding PC) (Käkelä et al., 2003)
Di-20:1-phosphatidylserine (PS; synthesized from corresponding PC) (Käkelä et al., 2003)
Di-16:0-phosphatidylinositol (PI) (Avanti Polar Lipids, catalog number: 850141 )
Chloroform (Merck Millipore, catalog number: 102445 )
Acetonitrile, LC-MS grade (Fisher Scientific, catalog number: A/0638/17X )
Isopropanol, OptimaTM LC/MS grade (Fisher Scientific, catalog number: A461-212 )
Ammonium formate (Sigma-Aldrich, catalog number: 70221 )
Ammonia solution 25% Suprapur (Merck Millipore, catalog number: 105428 )
Acetic acid, glacial (Fisher Scientific, catalog number: 10171460 )
Deuterium-labeled choline (D9-choline chloride) (C/D/N ISOTOPES, catalog number: D-2142 )
Deuterium-labeled ethanolamine (D4-ethanolamine) (Cambridge Isotope Laboratories, catalog number: DLM-552-1 )
Deuterium-labeled serine (D3-L-serine) (Cambridge Isotope Laboratories, catalog number: DLM-1073-1 )
Deuterium-labeled inositol (D6-myo-inositol) (C/D/N ISOTOPES, catalog number: D-3019 )
Hydroxylamine (Sigma-Aldrich, catalog number: 55460 )
Dulbecco’s modified Eagle medium high glucose (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 41965039 ) or another medium appropriate for the cell line of interest
Note: We grew HeLa cells in DMEM containing 10% fetal calf serum and 100 U/ml penicillin and 100 U/ml streptomycin.
Choline chloride (Sigma-Aldrich, catalog number: C1879 )
Ethanolamine (Merck Millipore, catalog number: 800849 )
Myo-inositol (Sigma-Aldrich, catalog number: I5125 )
L-serine (Sigma-Aldrich, catalog number: S4500 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F7524 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Milli-Q H2O (Elga Stat Maxima Reverse Osmosis Water Purifier)
Nitrogen gas (Aga, Industrial gases, 99.95%)
Labeling medium (see Recipes)
Chase medium (see Recipes)
Equipment
Pipettes (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 4600170 , 4600240 and 4600250 )
Microliter syringe (Hamilton, model: 705 N, catalog number: 80565 )
Vortex mixer (VWR, catalog number: 444-1372 )
Centrifuge (Thermo Fisher Scientific, model: HeraeusTM MegafugeTM 1.0 )
Fume hood
Sample Concentrator with nitrogen evaporation (Cole-Parmer, Techne, catalog number: FSC400D )
Mass spectrometer or analysis of the samples by a service provider
Note: We used Quattro Micro and Quattro Premier triple-quadrupole mass spectrometers (WATERS, model: Quattro Premier Mass Spectrometers )
Acquity FTN Ultra Performance Liquid Chromatography instrument (WATERS, model: ACQUITY UPLC H-Class System )
1.0 x 150 mm Acquity BEH C18 column (WATERS, catalog number: 186002347 )
Software
MassLynx 4.1 and QuanLynx software (WATERS)
LIMSA software (Haimi et al., 2009)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hänninen, S., Somerharju, P. and Hermansson, M. (2017). Metabolic Heavy Isotope Labeling to Study Glycerophospholipid Homeostasis of Cultured Cells. Bio-protocol 7(9): e2268. DOI: 10.21769/BioProtoc.2268.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,269 | https://bio-protocol.org/exchange/protocoldetail?id=2269&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Comprehensive Methods for Leaf Geometric Morphometric Analyses
LK Laura L. Klein
HS Harlan T. Svoboda
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2269 Views: 14588
Edited by: Rainer Melzer
Reviewed by: Annis Elizabeth Richardson
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Leaf morphometrics are used frequently by several disciplines, including taxonomists, systematists, developmental biologists, morphologists, agronomists, and plant breeders to name just a few. Leaf shape is highly variable and can be used for identifying species or genotypes, developmental patterning within and among individuals, assessing plant health, and measuring environmental impacts on plant phenotype. Traditional leaf morphometrics requires hand tools and access to specimens, but modern efforts to digitize botanical collections make digital morphometrics a readily accessible and scientifically rigorous option. Here we provide detailed instructions for performing some of the most informative digital geometric morphometric analyses available: generalized Procrustes analysis, elliptical Fourier analysis, and shape features. This comprehensive procedure for leaf shape analysis is comprised of six main sections: A) scanning of material, B) acquiring landmarks, C) analysis of landmark data, D) isolating leaf outlines, E) analysis of leaf outlines, and F) shape features. This protocol provides a detailed reference for applying landmark and outline analysis to leaf shape as well as describing leaf shape features, thus empowering researchers to perform high throughput phenotyping for diverse applications.
Keywords: Digital leaf morphometrics Landmarks Generalized Procrustes Analysis Leaf outlines Elliptic Fourier Descriptors Shape features Aspect ratio Circularity
Background
There are a variety of approaches to digital leaf shape morphometrics, including outline or Fourier analysis, contour signatures, landmark analysis, shape features, fractal dimensions, and texture analysis (Cope et al., 2012). Among these analyses, landmark and Fourier analysis together perform exceptionally well at distinguishing between groups among leaf shapes (McLellan and Endler, 1998; Hearn, 2009). Landmark analysis is ideal for capturing aspects of shape that are consistent among all leaves within a given dataset. The selection of landmarks should include points that are biologically homologous and adequately represent the morphology of the leaf (see more pointers in Bookstein, 1991 and Zelditch et al., 2004). If leaves in the dataset do not have evolutionarily conserved shape features, ‘pseudo-landmarks’ can instead be placed (Chitwood and Sinha, 2016); that is, landmarks can be placed at equidistant points along the leaf outline relative to homologous points that act as anchors. Landmarks can then be analyzed using Generalized Procrustes Analysis (GPA), which normalizes shape data (annotated by landmarks) at equal scale, allowing for an accurate comparison of shapes regardless of their size. Outline analysis offers a more broadly applicable phenotyping method in that Elliptical Fourier Descriptors (EFDs) are used to build shape descriptors of the leaf outline (Kuhl and Giardina, 1982; Iwata and Ukai, 2002). While sensitive to noise, EFDs are ideal for large leaf datasets that have subtle differences between shapes. Shape features are an additional, simple method of outline analysis that can include the perimeter to area ratio, aspect ratio, and circularity measurements (Cope et al., 2012). In this protocol, we focus on aspect ratio and circularity, as they detect signatures of lobing and serration. Aspect ratio is the ratio of the major axis to the minor axis of a fitted ellipse, in which case values close to ‘1’ are more circular in shape regardless of lobing. Circularity is the ratio of the leaf area to perimeter outline. This measurement is useful for discriminating leaves with lobing and serration, with low circularity values indicating significant lobing and serration. This protocol is designed such that researchers can choose between all three methods (GPA, EFD, and shape features) based on which analyses best fit their data.
Materials and Reagents
Herbarium specimens and/or fresh leaf material
Equipment
Computer that can run Microsoft® Windows® XP (or later) and/or Mac® OS X® 10.4 (or later)
Flatbed photo scanner (Epson Expression, model: 10000XL )
Software
Adobe® Photoshop® CS4 (or later)
Epson® Scan Utility v3.4.9.6 (https://support.epson.com/)
JavaTM (https://java.com/)
ImageJ (https://imagej.nih.gov/ij/)
Microsoft® Excel® 2011 (or later)
SHAPE v1.3 (http://lbm.ab.a.u-tokyo.ac.jp/~iwata/shape/)
SHAPE is built for Windows but if using a Mac, Wine and Winebottler (http://winebottler.kronenberg.org/) are required
R (https://r-project.org/)
Packages: ‘shapes,’ ‘ggplot2,’ ‘devtools,’ ‘ellipse,’ and ‘roxygen2’
RStudio (https://rstudio.com/products/rstudio/)
RStudio is an optional user interface for R
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Klein, L. L. and Svoboda, H. T. (2017). Comprehensive Methods for Leaf Geometric Morphometric Analyses. Bio-protocol 7(9): e2269. DOI: 10.21769/BioProtoc.2269.
Chitwood, D. H., Rundell, S. M., Li, D. Y., Woodford, Q. L., Yu, T. T., Lopez, J. R., Greenblatt, D., Kang, J. and Londo, J. P. (2016). Climate and Developmental Plasticity: Interannual Variability in Grapevine Leaf Morphology. Plant Physiol 170(3): 1480-1491.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > Morphogenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
227 | https://bio-protocol.org/exchange/protocoldetail?id=227&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Enzyme-linked Immunosorbent Assay (ELISA) to Measure Serum Levels of Murine Anti-cardiolipin Antibodies
Zheng Liu
Published: Vol 2, Iss 12, Jun 20, 2012
DOI: 10.21769/BioProtoc.227 Views: 12741
Download PDF
Ask a question
Favorite
Cited by
Abstract
The circulating anticardiolipin antibody is a hallmark of antiphospholipid syndrome. It also appears in a number of autoimmune mouse models and is indicative of the break of tolerance against self antigens. This protocol describes a reliable method to determine the relative serum titer of anticardiolipin in autoimmune mouse models.
Keywords: Mouse ELISA Autoimmune Anti-cardiolipin antibody
Materials and Reagents
Cardiolipin (Sigma-Aldrich, catalog number: C0563 )
Ethanol
Phosphate buffered saline (PBS)
Tween 20
Na2HPO4 (anhydrous)
NaH2PO4 (anhydrous)
NaCl
Fetal bovine serum (FBS) (Hyclone)
Bovine serum albumin (BSA)
Horseradish peroxidase (HRP) conjugated goat anti-mouse isotype specific antibodies [Southern Biotech, catalog number: 1040-05 (IgA); 1030-05 (IgG); 1021-05 (IgM)]
ABTS Peroxidase Substrate Solution A and B (Kirkegaard & Perry Laboratories, catalog number: 50-62-01 )
ABTS Peroxidase Stop Solution (Kirkegaard & Perry Laboratories, catalog number: 50-85-01 )
10x PBS-Tween 20 (see Recipes)
Blocking solution (see Recipes)
Equipment
Standard bench-top centrifuge
Immulon 2HB plates (Fisher Scientific, catalog number: 14-245-61 )
ELISA reader
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Antibody analysis > Antibody detection
Biochemistry > Protein > Immunodetection
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,270 | https://bio-protocol.org/exchange/protocoldetail?id=2270&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Electroshock Induced Seizures in Adult C. elegans
MR Monica G Risley
SK Stephanie P Kelly
KD Ken Dawson-Scully
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2270 Views: 8027
Edited by: Neelanjan Bose
Reviewed by: Sanjib Kumar Guha
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
The nematode Caenorhabditis elegans is a useful model organism for dissecting molecular mechanisms of neurological diseases. While hermaphrodite C. elegans contains only 302 neurons, the conserved homologous neurotransmitters, simpler neuronal circuitry, and fully mapped connectome make it an appealing model system for neurological research. Here we developed an assay to induce an electroconvulsive seizure in C. elegans which can be used as a behavioral method of analyzing potential anti-epileptic therapeutics and novel genes involved in seizure susceptibility. In this assay, worms are suspended in an aqueous solution as current is passed through the liquid. At the onset of the shock, worms will briefly paralyze and twitch, and shortly after regain normal sinusoidal locomotion. The time to locomotor recovery is used as a metric of recovery from a seizure which can be reduced or extended by incorporating drugs that alter neuronal and muscular excitability.
Keywords: Epilepsy Seizure C. elegans Electroshock Electroconvulsion Antiepileptic drugs AEDs
Background
We were interested in using the powerful genetic model, Caenorhabditis elegans, to develop an electroconvulsive seizure assay that can be easily manipulated by pharmacology. Invertebrate models have been used in seizures research for decades (Lee and Wu, 2002) however there were no protocols specifically investigating electroconvulsive seizures in C. elegans. In the past, multiple groups have developed methods of analyzing paralysis in response to chemical proconvulsants such as the GABAA receptor blockers, pentylentetrazol (PTZ) and picrotoxin (PTX), as well as an acetylcholinesterase inhibitor, aldicarb (Williams et al., 2004; Vashlishan et al., 2008). While these methods typically analyze the time to paralysis, our method quantifies the time it takes to recover from an electric shock-induced seizure (Risley et al., 2016).
Materials and Reagents
60 x 15 mm Petri dishes (Excel Scientific, catalog number: D-901 )
Pipette tips (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 0094300120 )
Vacuum filter (Corning, catalog number: 430320 )
2, 20 gauge insulated copper wire, cut to 8 cm segments (Del City, catalog number: 1120101 )
Plastic tubing, cut into 9 mm segments (Emurdock, catalog number: AAQ04127 )
Note: This product has been discontinued.
2 x Alligator clip wires (United Scientific Supplies, catalog number: WAG024-PK/6 )
C. elegans wild type strain N2 (obtained from Caenorhabditis Genetics Center)
LB broth powder (Fisher Scientific, catalog number: BP1426-500 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Agar (Sigma-Aldrich, catalog number: A7002 )
Peptone (Fisher Scientific, catalog number: BP1420 )
Calcium chloride solution (CaCl2) (Sigma-Aldrich, catalog number: 21115 )
Magnesium sulfate solution (MgSO4) (Sigma-Aldrich, catalog number: M3409 )
Cholesterol (Sigma-Aldrich, catalog number: C8667 )
Ethanol (Fisher Scientific, catalog number: 04-355-226 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P3786 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: 795410 )
LB broth (see Recipes)
Nematode growth medium (NGM) agar plates (see Recipes)
KP buffer (see Recipes)
E. coli strain OP50 (see Recipes)
M9 solution (see Recipes)
Equipment
2 L flask
Pipettes
Stir bar
Dissection stereo microscope (Tritech Research, model: SMT1 )
Dissecting stereoscope (AmScope, model: SM-1TSX )
Timer output stimulator (Grass Instruments, model: S44 )
Stimulator (Grass Instruments, model: SD9 )
CCD color microscope camera (Hitachi, model: KP-D20BU )
Television monitor (RCA, model: 19LA30RQ )
HDD and DVD recorder (Magnavox, catalog number: MDR535H/F7 )
DVD-Recordable discs (Verbatim, catalog number: 95032 )
Digital oscilloscope (OWON Technology, catalog number: PDS5022T )
Ethanol lamp (Carolina, catalog number: 706604 )
Water bath (50 °C) (Corning, model: Corning® LSETM Digital Water Bath, catalog number:6783)
Incubators (37 °C) (Thelco, model: 4 )
Incubator (20 °C) (Cuisinart, catalog number: CWC 1200DZ )
Timer (VWR, catalog number: 62344-641 )
A metric ruler (Fisher Scientific, catalog number: 09-016 )
Infrared Temperature Gun (J-1 Trading Wholesale, Nubee, catalog number: NUB8380 )
Software
Open source image processing program, we use VLC media player (version 2.2.4)
SigmaPlot 11.0 (Systat Software, Inc., San Jose, CA, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Risley, M. G., Kelly, S. P. and Dawson-Scully, K. (2017). Electroshock Induced Seizures in Adult C. elegans. Bio-protocol 7(9): e2270. DOI: 10.21769/BioProtoc.2270.
Risley, M. G., Kelly, S. P., Jia, K., Grill, B. and Dawson-Scully, K. (2016). Modulating behavior in C. elegans using electroshock and antiepileptic drugs. PLoS One 11(9): e0163786.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,271 | https://bio-protocol.org/exchange/protocoldetail?id=2271&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Replicative Intermediates of Adeno-associated Virus through Hirt Extraction and Southern Blotting
Martino Bardelli
FZ Francisco Zarate-Perez
LA Leticia Agundez
NJ Nelly Jolinon
RL R. Michael Linden
CE Carlos R. Escalante
EH Els Henckaerts
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2271 Views: 9289
Edited by: Yannick Debing
Reviewed by: Pinchas TsukermanNádia Conceição-Neto
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Adeno-associated virus (AAV) is a small single-stranded DNA virus that requires the presence of a helper virus, such as adenovirus or herpes virus, to efficiently replicate its genome. AAV DNA is replicated by a rolling-hairpin mechanism (Ward, 2006), and during replication several DNA intermediates can be detected. This detailed protocol describes how to analyze the AAV DNA intermediates formed during AAV replication using a modified Hirt extract (Hirt, 1967) procedure and Southern blotting (Southern, 1975).
Keywords: Adeno-associated virus AAV DNA replication Replicative intermediates Southern blot
Background
AAV DNA replication is carried out by a rolling hairpin mechanism in cells co-infected by AAV and helper viruses such as adenovirus or herpes virus (Ward, 2006). The AAV DNA consists of a 4.7 kb linear DNA molecule with inverted terminal repeats (ITRs) that fold back to form T-shaped hairpin structures. The 3’ end hairpin serves as a primer for the replication of the AAV DNA. These hairpin structures are regenerated by the AAV Rep protein, allowing further rounds of replication (Im and Muzyczka, 1990). Both + and - strands of the AAV DNA are packaged and are infectious (Rose et al., 1969). When replicating AAV DNA is analyzed, several replicative intermediates can be detected (Straus et al., 1976). The most abundant replicative intermediate is a linear monomeric duplex molecule, formed by one + and one - strand of the AAV DNA, which is thought to be the immediate precursor of progeny single-stranded molecules that will be packaged in pre-formed capsids (Straus et al., 1976). Dimeric replicative intermediates are also common, and the AAV replication model is compatible with even larger replicative intermediates. The study of AAV replication benefitted from the discovery that AAV plasmids are infectious–the AAV DNA can be fully rescued from a plasmid (in the presence of helper virus) and its replication mimics that of the native virus (Samulski et al., 1982). The method detailed here allows the investigation of the DNA intermediates formed during DNA replication initiated from an AAV plasmid, and was used to compare different mutants of the AAV Rep protein for their ability to support AAV replication. The same method can be used to study other aspects of the AAV life cycle that can affect DNA replication of this virus, such as the effect of helper virus proteins or other factors that restrict/enhance AAV replication.
Materials and Reagents
Transfection of 293T cells and wild type (wt) AAV production
100 mm dishes (Corning, catalog number: 430293 )
293T cells (ATCC, catalog number: CRL-11268 )
pAV2 plasmid (Laughlin et al., 1983, available from ATCC, catalog number: 37216 )
Linear polyethylenimine (PEI), MW 25,000, at 1 mg/ml and pH 7.0 (Polysciences, catalog number: 23966-1 )
wt adenovirus serotype 5 (Graham and Prevec, 1991, available from ATCC, catalog number: VR-1516 )
Dulbecco modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, catalog number: 31966021 )
Foetal bovine serum (FBS) (Thermo Fisher Scientific, catalog number: 10270106 )
1x Dulbecco’s phosphate-buffered saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190094 )
Extraction of low molecular weight DNA
15 ml conical tube (Corning, catalog number: 430791 )
1.5 ml tube
Hirt lysis buffer (see Recipes)
Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, AmbionTM, catalog number: AM9822 )
Tris (pH 7.5)
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E9884 )
Proteinase K solution (20 mg/ml) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 25530049 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Phenol-chloroform-isoamyl alcohol 25:24:1 (Sigma-Aldrich, catalog number: 77617 )
Sodium acetate (CH3COONa) (Sigma-Aldrich, catalog number: 71183 )
2-propanol (EMD Millipore, catalog number: 109634 )
Ethanol (EMD Millipore, catalog number: 100983 )
ddH2O (Thermo Fisher Scientific, AmbionTM, catalog number: AM9937 )
RNaseA (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EN0531 )
Southern blot assay using Rep and Amp probes
WhatmanTM paper (GE Healthcare, catalog number: 3030-917 )
Amersham Hybond-N+ membrane (GE Healthcare, catalog number: RPN203B )
Hybridisation tubes (Chemglass Life Sciences, catalog number: CG-1140-05 )
Quick Spin Columns for radiolabeled DNA purification (Roche Diagnostics, catalog number: 11273973001 )
DpnI (New England Biolabs, catalog number: R0176S )
UltraPureTM agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500500 )
TAE (Tris-acetate-EDTA) buffer (see Recipes)
Tris (Roche Diagnostics, catalog number: 10708976001 )
Glacial acetic acid (Sigma-Aldrich, catalog number: ARK2183 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E9884 )
1 kb DNA ladder (New England Biolabs, catalog number: N3232 )
20x saline sodium citrate (SSC) solution (see Recipes)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Sodium citrate (Sigma-Aldrich, catalog number: W302600 )
Denaturing solution (see Recipes)
Sodium chloride (NaCl)
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 71687 )
Neutralising solution (see Recipes)
Tris (pH 7.4)
Sodium chloride (NaCl)
Rep probe primers
fw: AACTGGACCAATGAGAACTTTCC; rv: AAAAAGTCTTTGACTTCCTGCTT
Amp probe primers
fw: AATCAGTGAGGCACCTATCTCAGC; rv: AACTCGGTCGCCGCATACACTATT
GoTaq® Colorless Master Mix PCR Kit (Promega, catalog number: M7132 )
QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704 )
dCTPs, [α-32P]- 6,000 Ci/mmol 20 mCi/ml, 250 µCi (PerkinElmer, catalog number: BLU013Z250UC )
Prime-It RmT Random Primer Labeling Kit (Agilent Technologies, catalog number: 300392 )
Nylon Wash solution (see Recipes)
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Ethylenediaminetetraacetic acid (EDTA)
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Equipment
Pipette
CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraCell 240 )
Hemocytometer
Refrigerated benchtop microcentrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM FrescoTM 17 )
Refrigerated centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM MultifugeTM X3R )
Microbiological safety cabinet (Medical Air Technology, model: BioMAT2 Class II )
NanoDrop spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDrop 1000 or NanoDrop 2000 )
Gel electrophoresis system (Thermo Fisher Scientific, Thermo ScientificTM, model: OwlTM A1 )
Platform shaker (Heidolph Instruments, model: Polymax 1040 )
Glass plate
Glass tray
Ultraviolet crosslinker (UVP, model: CL-1000 )
Hybridisation oven (UVP, model: HB-1000 )
Perspex screen (Thermo Fisher Scientific, Thermo ScientificTM, model: NalgeneTM Acrylic Benchtop Beta Radiation Shield , catalog number: 67002418)
Typhoon Molecular Dynamics phosphor/fluorescence imager (GE Healthcare, model: Trio Variable Mode Imager )
PCR thermal cycler (Eppendorf, model: Mastercycler® )
Heat block (Cole-Parmer, Stuart, catalog number: SBH200DC )
Storage Phosphor screen (GE Healthcare, catalog number: 28-9564-75 )
Exposure cassette (GE Healthcare, catalog number: 63-0035-44 )
Software
ImageQuant analysis software (GE Healthcare)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bardelli, M., Zarate-Perez, F., Agundez, L., Jolinon, N., Linden, R. M., Escalante, C. R. and Henckaerts, E. (2017). Analysis of Replicative Intermediates of Adeno-associated Virus through Hirt Extraction and Southern Blotting. Bio-protocol 7(9): e2271. DOI: 10.21769/BioProtoc.2271.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,272 | https://bio-protocol.org/exchange/protocoldetail?id=2272&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
CRISPR/Cas9 Editing of the Bacillus subtilis Genome
PB Peter E. Burby
LS Lyle A. Simmons
Published: Vol 7, Iss 8, Apr 20, 2017
DOI: 10.21769/BioProtoc.2272 Views: 19779
Edited by: Modesto Redrejo-Rodriguez
Reviewed by: Judd F HultquistVinay Panwar
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
A fundamental procedure for most modern biologists is the genetic manipulation of the organism under study. Although many different methods for editing bacterial genomes have been used in laboratories for decades, the adaptation of CRISPR/Cas9 technology to bacterial genetics has allowed researchers to manipulate bacterial genomes with unparalleled facility. CRISPR/Cas9 has allowed for genome edits to be more precise, while also increasing the efficiency of transferring mutations into a variety of genetic backgrounds. As a result, the advantages are realized in tractable organisms and organisms that have been refractory to genetic manipulation. Here, we describe our method for editing the genome of the bacterium Bacillus subtilis. Our method is highly efficient, resulting in precise, markerless mutations. Further, after generating the editing plasmid, the mutation can be quickly introduced into several genetic backgrounds, greatly increasing the speed with which genetic analyses may be performed.
Keywords: Genome editing CRISPR Cas9 Bacillus subtilis Gene deletion Point mutation
Background
Bacillus subtilis is a highly tractable, Gram-positive bacterium. It is amenable to genetic studies, using a variety of vectors to quickly and efficiently introduce mutations by homologous recombination. Although there are many different methods to introduce mutations in B. subtilis, each method has its limitations. A simple and straightforward method to make a mutation in B. subtilis is gene disruption, wherein a plasmid is integrated within a gene of interest (Vagner et al., 1998). The major limitations include: 1) the potential for polar effects by disrupting an operon; 2) introduction and retention of foreign DNA; 3) once an antibiotic resistance cassette is used, the researcher has to use a different cassette if a given mutation is to be studied in the context of other mutations; and 4) the method is limited to targeting an entire gene and cannot yield more precise point mutations. Another method employed in B. subtilis genetic studies is allelic replacement, wherein a gene of interest is replaced with an antibiotic resistance cassette (Guerout-Fleury et al., 1996). Although polar effects should be reduced by simply replacing one gene with another, this method still suffers from several limitations described above. Recently, a gene deletion library was constructed which allows for the removal of the antibiotic resistance cassette (strains are available from the Bacillus genetic stock center). As a result, researchers can use the same method for many mutations because the resistance cassette is removed after each allelic replacement. The method is an improvement, although it is still limited to gene deletions and cannot be used for point mutations. Finally, there are two methods to introduce markerless mutations in B. subtilis including point mutations. One method utilizes the upp gene as a counter-selectable marker (Fabret et al., 2002), and the other uses a plasmid called pMad (Arnaud et al., 2004) or its derivative pMiniMad which allows for mutation integration after removal of the integrating vector (Patrick and Kearns, 2008). Although these methods can introduce precise point mutations, our experience (making four gene deletions and inserting gfp at one genetic locus) using the latter method (Arnaud et al., 2004; Patrick and Kearns, 2008) is that it is quite time consuming with a success rate that is not very high (on average, about 12% success). Although we do not have experience with the upp counter selection method, the authors engineered a GGA→GAC change in the lexA gene and reported the intended change in sequence for three out of four screened isolates with the incorrect isolate yielding multiple mutations in the targeted lexA gene (Fabret et al., 2002). A major drawback, though, is that the method requires deletion of the endogenous upp gene in B. subtilis, which requires that the Δupp strain be used as the new ‘wild-type’ control. Therefore, although the methods described above work, we were in search of a genome editing method with a higher efficiency that also required less time at the bench. These criteria prompted us to adapt a CRISPR/Cas9 genome editing system (Jiang et al., 2013) to B. subtilis (Burby and Simmons, 2017). CRISPR/Cas9 can be used to introduce a variety of mutations including gene deletions, fusions, and even point mutations (Sternberg and Doudna, 2015). Further, by constructing the editing system on a single broad host-range plasmid with a temperature sensitive origin of replication, all vector DNA introduced during the procedure can easily be removed. Success rates have proven to be much higher for point mutations and small, gene-sized deletions (often over 80% success, but 100% success is not atypical), reducing the number of isolates that need to be screened. Although this method solves many of the limitations of the contemporary methods, our CRISPR/Cas9 genome editing system is limited by the requirement of a proto-spacer adjacent motif or PAM sequence (NGG in our system), and the requirement of two cloning steps. Nonetheless, the ability to make a variety of markerless mutations, coupled with the rapidity with which the mutations can be transferred to different genetic backgrounds still provides a significant improvement over current methods for genome editing in B. subtilis. The system we have developed may also be applicable to other Gram-positive bacteria with little or no manipulation of the DNA reagents described herein.
Materials and Reagents
Pipette tips:
with boxes (USA Scientific, catalog numbers: 1161-3800 ; 1161-1800 and 1161-1820 )
for refills (USA Scientific, catalog numbers: 1161-3700 ; 1161-1700 and 1161-1720 )
Microfuge tubes (Fisher Scientific, catalog number: 02-681-320 )
PCR tubes (Fisher Scientific, catalog number: 14-230-225 )
Wooden sticks for colony purification/bacteria re-streaking (Ted Pella, catalog number: 1282 )
Round bottom culture tube (Fisher Scientific, catalog number: 14-956-6D )
Cryo-vials (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 368632 )
Cryo-vial caps (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 375930 )
Silica spin columns for gel extraction and plasmid mini-prep (Epoch Life Science, catalog number: 1920250 )
Petri dishes (Fisher Scientific, catalog number: FB0875712 )
pPB41 plasmid (plasmid and sequence available from the Bacillus Genetic Stock Center upon request; http://www.bgsc.org)
pPB105 plasmid (plasmid and sequence available from the Bacillus Genetic Stock Center upon request; http://www.bgsc.org)
TOP10 Escherichia coli competent cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: C404010 )
MC1061 Escherichia coli competent cells (Strain number PEB336, available upon request)
BsaI-HF with accompanying 10x Cutsmart buffer (New England Biolabs, catalog number: R3535L )
Calf intestinal alkaline phosphatase (CIP) (New England Biolabs, catalog number: M0290L )
Isopropanol (Fisher Scientific, catalog number: A451-4 )
Ultra-pure distilled H2O (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977-15 )
T4 DNA ligase with accompanying 10x T4 ligase buffer (New England Biolabs, catalog number: M0202L )
T4 polynucleotide kinase (New England Biolabs, catalog number: M0201S )
Q5 DNA polymerase (New England Biolabs, catalog number: M0491L )
PCR primers (synthesized by Integrated DNA Technologies)
Primers to amplify pPB41
oPEB217: 5’-GAACCTCATTACGAATTCAGCATGC
oPEB218: 5’-GAATGGCGATTTTCGTTCGTGAATAC
Primers to amplify CRISPR/Cas9
oPEB232: 5’-GCTGTAGGCATAGGCTTGGTTATG
oPEB234:
5’-GTATTCACGAACGAAAATCGCCATTCCTAGCAGCACGCCATAGTGACTG
Primer to sequence CRISPR insert
oPEB253: 5’-GAAGGGTAGTCCAGAAGATAACGA
Primer to sequence 5’ side of editing template
oPEB227: 5’-CCGTCAATTGTCTGATTCGTTA
Example upstream editing template primers
oPEB237:
5’-GCATGCTGAATTCGTAATGAGGTTCAAAACGGCAGAGTATACAGAGGAG
oPEB238: 5’-CCGGTTCCTTTTCCAGCGATGATTGACACTCTTGGATATCCG
Example downstream editing template primers
oPEB239: 5’-AAGAGTGTCAATCATCGCTGGAAAAGGAACCGGCGCTTTAAG
oPEB240: 5’-GCATAACCAAGCCTATGCCTACAGCtaggaagaagaatcatttcgaagc
Example genotyping primer for H743A mutation in mutS2
oPEB262: 5’- GGATATCCAAGAGTGTCAATCATCGCT
Glycerol (Fisher Scientific, catalog number: BP229-4 )
Tris base (Fisher Scientific, catalog number: BP152-5 )
Glacial acetic acid (Fisher Scientific, catalog number: A38-212 )
EDTA (Fisher Scientific, catalog number: BP120-1 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-10 )
Tryptone (BD, BactoTM, catalog number: 211699 )
Yeast extract (BD, BactoTM, catalog number: 212720 )
Ampicillin (Fisher Scientific, catalog number: BP1760-25 )
Spectinomycin (MP Biomedicals, catalog number: 0 215206725 )
Chloramphenicol (Fisher Scientific, catalog number: BP904-100 )
Agar (Acros Organics, catalog number: 400400050 )
Agarose (Fisher Scientific, catalog number: BP1356-500 )
Ethidium bromide (Sigma-Aldrich, catalog number: E8751-25G )
Guanidine thiocyanate (Fisher Scientific, catalog number: BP221-1 )
Guanidine HCl (Fisher Scientific, catalog number: BP178-1 )
Ethanol (Decon Labs, catalog number: 2701 )
Hydrochloric acid (HCl) (Fisher Scientific, catalog number: A144-212 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266-100G )
100 mM dNTP set (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10297018 )
Dithiothreitol (DTT) (Fisher Scientific, catalog number: BP172-25 )
β-nicotinamide adenine dinucleotide (NAD+) (Acros Organics, catalog number: 124530010 )
T5 exonuclease (New England Biolabs, catalog number: M0363S )
Phusion DNA polymerase (New England Biolabs, catalog number: M0530L )
Taq DNA ligase (New England Biolabs, catalog number: M0208L )
Magnesium sulfate (MgSO4) (Fisher Scientific, catalog number: M65-500 )
Potassium phosphate dibasic (K2HPO4) (Fisher, catalog number: BP363-1 )
Potassium phosphate monobasic (KH2PO4) (Fisher Scientific, catalog number: BP362-1 )
Trisodium citrate dihydrate (C6H5Na3O7·2H2O) (Fisher Scientific, catalog number: BP327-1 )
Glucose (Sigma-Aldrich, catalog number: G8270-1KG )
Tryptophan (Fisher Scientific, catalog number: BP395-100 )
Phenylalanine (Fisher Scientific, catalog number: BP391-100 )
Potassium hydroxide (KOH) (Fisher Scientific, catalog number: P250-500 )
Ferric ammonium citrate (Sigma-Aldrich, catalog number: F5879 )
Potassium aspartate (Sigma-Aldrich, catalog number: A6558 )
PEG-8000 (Dot Scientific, catalog number: DSP48080-500 )
50x TAE (see Recipes)
1x TAE (see Recipes)
LB media (see Recipes)
LB agar plates (see Recipes)
100 mg/ml ampicillin stock (see Recipes)
100 mg/ml spectinomycin stock (see Recipes)
5 mg/ml chloramphenicol stock (see Recipes)
70% (v/v) ethanol (see Recipes)
1% agarose gel (see Recipes)
QG buffer (see Recipes)
PB buffer (see Recipes)
Tris HCl, pH 7.5 (see Recipes)
PE buffer (see Recipes)
10x annealing buffer (see Recipes)
5x isothermal reaction buffer (Gibson, 2011) (see Recipes)
2x Gibson master mix (Gibson, 2011) (see Recipes)
1 M MgSO4 (see Recipes)
LM media (LB media + 3 mM MgSO4) (see Recipes)
10x PC buffer (see Recipes)
MD media (see Recipes)
0.1 N KOH (see Recipes)
100 mg/ml tryptophan stock (see Recipes)
100 mg/ml phenylalanine stock (see Recipes)
2.2 mg/ml ferric ammonium citrate stock (see Recipes)
100 mg/ml potassium aspartate stock (see Recipes)
Equipment
Incubator (Napco, model: 320 )
Dry heat block (Fisher Scientific, model: Fisher ScientificTM IsotempTM Digital Dry Baths/Block Heaters , catalog number: 11-718-2)
Pipettes (Eppendorf, catalog number: 022575442 )
Centrifuge (Eppendorf, model: 5424 )
Thermocycler (Eppendorf, model: 6325 )
Electrophoresis apparatus (Bio-Rad Laboratories, model: Mini-Sub® Cell GT Horizontal Electrophoresis System , catalog number: 1704406)
Power source for electrophoresis (Bio-Rad Laboratories, model: PowerPacTM Basic Power Supply , catalog number: 1645050)
Roller drum (Eppendorf, New Brunswick, model: TC-7 )
Milli-Q H2O dispenser (Thermo Fisher Scientific, Thermo ScientificTM, model: BarnsteadTM GenPureTM Pro , catalog number: 50131950)
Microwave (Panasonic, catalog number: NNS954WFR )
Autoclave
Software
Online tool Primer3 (Koressaar and Remm, 2007; Untergasser et al., 2012)
Oligocalc (Kibbe, 2007)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Burby, P. E. and Simmons, L. A. (2017). CRISPR/Cas9 Editing of the Bacillus subtilis Genome. Bio-protocol 7(8): e2272. DOI: 10.21769/BioProtoc.2272.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Microbiology > in vivo model > Bacterium
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,273 | https://bio-protocol.org/exchange/protocoldetail?id=2273&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Assays for Measuring Endothelial Permeability by Transwells and Electrical Impedance Systems
HC Hong-Ru Chen
TY Trai-Ming Yeh
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2273 Views: 25952
Edited by: Yannick Debing
Reviewed by: Kate HannanChris Tibbitt
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Vascular leakage is an important feature in several diseases, such as septic shock, viral hemorrhagic fever, cancer metastasis and ischemia-reperfusion injuries. Thus establishing assays for measuring endothelial permeability will provide insight into the establishment or progression of such diseases. Here, we provide transwell permeability assay and electrical impedance sensing assay for studying endothelial permeability in vitro. With these methods, the effect of a molecule on endothelial permeability could be defined.
Keywords: Endothelial permeability Vascular leakage Transwell
Background
The endothelial barrier is a well-regulated structure, which maintains a minimal and selective permeability to fluid and molecules under normal physiological conditions (Komarova and Malik, 2010). The disruption of the endothelial barrier occurs during exposure to inflammatory cytokines, pathogen infection, or cancer metastasis, which induces the disruption of cytoskeleton, cell-cell junction, or cell-to-matrix attachments. The increase in vascular permeability is an important feature in many diseases, including ischemia-reperfusion injury, sepsis, viral hemorrhagic fevers and cancers. To screen which molecules modulate vascular permeability, it is necessary to establish in vitro systems to test endothelial permeability before expanding to animal studies. There are two available systems to test endothelial permeability in vitro, transwell permeability assay and electrical impedance sensing devices (Bischoff et al., 2016). The transwell permeability assays directly detect the penetration of macromolecules and the electrical impedance sensing devices measure the cell layer’s tightness for ion flow. Basically, molecules which can be detected by a spectrometer-based absorbance reader can be used in the transwell permeability assay. As a result, the materials required for this assay are relatively easy to prepare. For the electrical impedance sensing assay, we used the xCELLigence Real-Time Cell Analysis (RTCA) systems to measuring endothelial permeability in a 96-well microplate. Compared to transwell permeability assay, electrical impedance sensing device is more sensitive, and is suitable for time-lapse tracking. However, it is also more expensive, and it may not accurately reflect the penetration of molecules through cell-cell junction. As a result, it is more accurate to apply both systems in parallel. Here, we show the protocol for using these two methods to measure the dengue virus nonstructural protein 1-induced endothelial hyperpermeability in vitro (Chen et al., 2016).
Materials and Reagents
General materials and reagents
Pipet tips
Human microvascular endothelial cells (HMEC-1) (ATCC, catalog number: CRL-3243 )
Medium 200 (Thermo Fisher Scientific, GibcoTM, catalog number: M-200-500 )
10% fetal bovine serum (FBS) (GE Healthcare, HyCloneTM, catalog number: SH30071.03HI )
Penicillin-streptomycin solution at a concentration of 100 U/ml (Caisson Laboratories, catalog number: PSL01-100ML )
Endothelial cell growth medium (see Recipes)
Materials and reagents for transwell permeability assay
Corning 6.5 mm Transwell inserts with 0.4 µm polycarbonate membranes in a 24-well plate (Corning, catalog number: 3413 )
96-well plate (clear polystyrene wells, flat bottom) (ExtraGene, catalog number: EL-1190-F )
Streptavidin-horseradish peroxidase (HRP) (R&D Systems, catalog number: DY998 )
3,3’,5,5’-tetramethylbenzidine (TMB) substrate (Sigma-Aldrich, catalog number: T0440 )
Stop solution (2 N H2SO4 water solution) (Sigma-Aldrich, catalog number: 30743 )
Materials and reagents for RTCA
96-well E-plate (ACEA BIO, catalog number: 05232368001 )
Equipment
Forceps
General equipment: 37 °C cell incubator supplied with 5% CO2 atmosphere
Transwell permeability assay: VersaMax microplate reader (Molecular Devices, model: VersaMax ELISA Microplate Reader )
RTCA: xCELLigence RTCA System (ACEA BIO, model: xCELLigence RTCA SP System , catalog number: 00380601030)
Software
GraphPad Prism software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, H. and Yeh, T. (2017). In vitro Assays for Measuring Endothelial Permeability by Transwells and Electrical Impedance Systems. Bio-protocol 7(9): e2273. DOI: 10.21769/BioProtoc.2273.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell-based analysis
Cell Biology > Cell-based analysis > Transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,274 | https://bio-protocol.org/exchange/protocoldetail?id=2274&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of in vivo Interaction between RNA Binding Proteins and Their RNA Targets by UV Cross-linking and Immunoprecipitation (CLIP) Method
PB Pamela Bielli
CS Claudio Sette
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2274 Views: 9867
Edited by: HongLok Lung
Reviewed by: Jingyu PengWeiyan Jia
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
RNA metabolism is tightly controlled across different tissues and developmental stages, and its dysregulation is one of the molecular hallmarks of cancer. Through direct binding to specific sequence element(s), RNA binding proteins (RBPs) play a pivotal role in co- and post-transcriptional RNA regulatory events. We have recently demonstrated that, in pancreatic cancer cells, acquisition of a drug resistant (DR)-phenotype relied on upregulation of the polypyrimidine tract binding protein (PTBP1), which in turn is recruited to the pyruvate kinase pre-mRNA and favors splicing of the oncogenic PKM2 variant. Herein, we describe a step-by-step protocol of the ultraviolet (UV) light cross-linking and immunoprecipitation (CLIP) method to determine the direct binding of an RBP to specific regions of its target RNAs in adherent human cell lines.
Keywords: CLIP Protein-RNA interaction Protein-RNA-immunoprecipitation RNA processing
Background
While being transcribed in the nucleus, nascent RNAs are immediately assembled with trans-acting factors collectively named RNA binding proteins (RBPs). These factors interact directly with specific cis-acting regulatory sequences in RNA molecules, thus forming ribonucleoprotein (RNP) complexes (Dreyfuss et al., 2002; Singh et al., 2015). These complexes control co-transcriptional RNA processing events as well as post-transcriptional mechanisms involved in RNA metabolism, such as subcellular localization and translation. For instance, spliceosomal and cleavage/polyadenylation complex components recognize specific RNA elements in the pre-mRNA, permitting introns removal (Black, 2003) and coordination between 3’-end processing and transcription termination (Proudfoot, 2016). A large number of RBPs functions as splicing factors, by assisting recognition of constitutively and alternatively spliced exons by the spliceosome (Chen and Manley, 2009) or by improving usage of alternative polyadenylation signals (Tian and Manley, 2016). Likewise, RBP-mediated recognition of zip code localization elements allows transport and local translation of mRNA in the cytoplasm (Martin and Ephrussi, 2009).
Eukaryotic genomes encode a wide array of RBPs to fine-tune cell-specific gene expression programs in a time- and space-sensitive manner, thus contributing to tissue homeostasis. RNPs are highly dynamic structures, which remodel under the influence of specific cell signaling pathways that influence the fate of the RNA transcript (Naro and Sette, 2013; Fu and Ares, 2014). By precisely integrating co- and post-transcriptional RNA regulatory events, RBPs ensure the physiological adaptation in response to environmental constraints. It follows that the precise arrangement of RNP complexes must be highly coordinated and that deregulation of these complexes can be harmful for cells. Indeed, dysregulation of each aspect of RNA metabolism is involved in a large number of pathological conditions, such as neurodegenerative disease and cancer (Mayr and Bartel, 2009; Cooper et al., 2009; Silvera et al., 2010; Pagliarini et al., 2015). In cancer, aberrant alternative splicing regulation often yields splice variants that confer a selective advantage to the tumor, in terms of proliferation, metabolism, invasion, drug resistance and survival (David et al., 2010; Olshavsky et al., 2010; Paronetto et al., 2010; Valacca et al., 2010; Anczuków et al., 2012; Cappellari et al., 2014; Bielli et al., 2014; Calabretta et al., 2016). Moreover, specific splicing signatures correlate with cancer progression, and alteration of RBPs expression and/or of cis-regulatory elements can contribute to tumorigenesis (Cooper et al., 2009; Danan-Gotthold et al., 2015). High-throughput next-generation sequencing technologies now allow genome-wide identification of alternative splicing events associated with pathological processes (Chen and Weiss, 2015; Byron et al., 2016). Furthermore, they might help understanding the global complexity of RNA regulation and the correlation between binding sites for RBPs and the splicing outcome in health and disease (Wang and Burge, 2008). Thus, understanding alternative splicing changes in pathological conditions requires deciphering the regulatory network between RBPs and cis-regulatory elements and the identification of RBP binding sites is a key step in this direction.
In a recent study, we investigated the role of alternative splicing and RBPs in the acquisition of a drug-resistant (DR) phenotype in pancreatic ductal adenocarcinoma cells (PDAC) (Calabretta et al., 2016). We demonstrated that acquisition of the DR-phenotype relied on upregulation of the polypyrimidine tract binding protein (PTBP1), which is recruited to the PKM pre-mRNA and favors splicing of the oncogenic PKM2 variant. To investigate the recruitment of PTBP1 on PKM pre-mRNA in vivo, we used the UV cross-linking and immunoprecipitation (CLIP) experimental approach modified from Wang et al. (2009) protocol. Herein, we describe a step-by-step protocol to investigate the direct binding of a specific factor to its RNA target(s), which can be extended to most adherent human cell lines.
Materials and Reagents
100 mm dish
PDAC cells or other adherent cells
Cold PBS (Sigma-Aldrich, catalog number: D8537 )
Liquid nitrogen
Turbo DNAse (Thermo Fisher Scientific, AmbionTM, catalog number: AM2239 )
Protein G Dynabeads (Thermo Fisher Scientific, NovexTM, catalog number: 10004D )
RBP polyclonal hnRNP I antibody for immunoprecipitation (Santa Cruz Biotechnology, catalog number: sc-16547 )
RNAse I (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2295 )
Bradford solution (Bio-Rad Laboratories, catalog number: 500-0006 )
Phenol:chloroform:isoamyl alcohol 25:24:1 (Sigma-Aldrich, catalog number: P3803 )
Ethanol (VWR, catalog number: 20821.321 )
Trizol (Thermo Fisher Scientific, AmbionTM, catalog number: 15596018 )
Chloroform (Honeywell International, Riedel-de Haen, catalog number: 32211 )
Isopropanol (CARLO ERBA Reagents, catalog number: 415156 )
Agarose (Lonza, catalog number: 50004 )
Water (Sigma-Aldrich, catalog number: W4502 )
cDNA synthesis kit (Promega, catalog number: M1705 )
Tris (VWR, catalog number: 0826 )
Sodium chloride (NaCl) (VWR, catalog number: 27810.364 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M2670 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C1016 )
NP-40 (Alfa Aesar, Affymetrix/USB, catalog number: J19628 )
Sodium deoxycholate (Sigma-Aldrich, catalog number: D6750 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
DL-dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D9779 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 )
RNase inhibitor (Promega, catalog number: N2511 )
EDTA (Sigma-Aldrich, catalog number: E5134 )
Glycerol (Sigma-Aldrich, catalog number: G9012 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Bromphenol blue (Sigma-Aldrich, catalog number: 114391 )
Proteinase K (Roche Molecular Systems, catalog number: 3115836001 )
DEPC (Sigma-Aldrich, catalog number: D5758 )
XQuantitative Real-Time PCR Kit (LightCycler®480 SYBR Green I Master) (Roche Molecular Systems, catalog number: 04887352001 )
Sodium acetate (Sigma-Aldrich, catalog number: S2889 )
Sodium metavanadate (Sigma-Aldrich, catalog number: 72060 )
Lysis buffer (see Recipes)
High-salt buffer (see Recipes)
3 M sodium acetate (pH 5.2) (see Recipes)
Laemmli buffer (2x) (see Recipes)
Proteinase K buffer (see Recipes)
Equipment
Centrifuge
UV crosslinker (Uvitec, model: CL 508 )
SDS-PAGE and PVDF/nitrocellulose transfer apparatus (Bio-Rad Laboratories)
Denaturating agarose gel apparatus (Bio-Rad Laboratories)
Magnetic stand (Thermo Fisher Scientific, Invitrogen)
Thermoblock
Quantitative Real-Time PCR (Roche Molecular Systems, model: LightCycler® 480 )
Sonicator (Hielscher ultrasonics, model: UP200S )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bielli, P. and Sette, C. (2017). Analysis of in vivo Interaction between RNA Binding Proteins and Their RNA Targets by UV Cross-linking and Immunoprecipitation (CLIP) Method. Bio-protocol 7(10): e2274. DOI: 10.21769/BioProtoc.2274.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Protein
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Some questions about RNA fragmentation
0 Answer
10 Views
Sep 11, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,275 | https://bio-protocol.org/exchange/protocoldetail?id=2275&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Primary Olfactory Ensheathing Cell Culture from Human Olfactory Mucosa Specimen
MH Mansoureh Hashemi
MH Mahmoudreza Hadjighassem
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2275 Views: 7566
Edited by: Oneil G. Bhalala
Reviewed by: Ehsan KheradpezhouhXiaoyu Liu
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
The human olfactory mucosa is located in the middle and superior turbinates, and the septum of nasal cavity. Olfactory mucosa plays an important role in detection of odours and it is also the only nervous tissue that is exposed to the external environment. This property leads to easy access to the olfactory mucosa for achieving various researches. The lamina propria of olfactory mucosa consists of olfactory ensheathing cells (OECs) that cover the nerve fibers of olfactory. Here we describe a protocol for isolation of OECs from biopsy of human olfactory mucosa.
Keywords: Human olfactory mucosa Olfactory ensheathing cells (OECs) S100-beta antigen Primary cell culture
Background
Olfactory ensheathing cells (OECs) are glial cells that express various antigens similar to astrocytes and Schwann cells such as glial fibrillary-associated protein (GFAP), S100-beta, p75 low-affinity nerve growth factor receptor, vimentin, nestin, and neuropeptide Y (Singh et al., 2013). Olfactory ensheathing cells release different neurotrophic factors and adhesion molecules that function in cellular growth and adhesions of central nervous system (Pastrana et al., 2007). In addition, these cells play an important role in the regeneration of the damaged central nervous system such as treatment of spinal cord injury and neurodegenerative diseases (Novikova et al., 2011). We select OECs as research material in our study as they have several advantage properties such as high migratory capacity, accessible source, differentiation from stem cells of nasal olfactory mucosa, and non-tumorigenicity behavior (Huang et al., 2008; Escada et al., 2009). This protocol describes a step-by-step procedure for the isolation of OECs from Human Olfactory Mucosa Specimen.
Materials and Reagents
15 ml centrifuge tubes (Corning, Falcon®, catalog number: 352096 )
50 ml centrifuge tubes (Corning, Falcon®, catalog number: 352070 )
T25 flask culture (Nest Biotechnology, catalog number: 707003 )
24-well plates (Nest Biotechnology, catalog number: 702001 )
No. 10 scalpel blade surgical tool (Aspen Surgical, catalog number: 371610 )
Cell strainer sieve (Corning, Falcon®, catalog number: 352340 )
Petri dish culture (Nest Biotechnology, catalog number: 704001 )
Olfactory mucosa fresh specimen (Human)
Hanks’ balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 24020117 )
Antibiotic-antimycotic (Thermo Fisher Scientific, GibcoTM, catalog number: 15240062 )
Dispase II (Sigma-Aldrich, catalog number: D4693 )
Collagenase IA (Sigma-Aldrich, catalog number: C9891 )
Dulbecco’s modified Eagle medium/F12 (DMEM/F12) (Thermo Fisher Scientific, GibcoTM, catalog number: 31331028 )
Nerve growth factor (NGF) (Sigma-Aldrich, catalog number: N0513 )
0.25% trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Bovine serum albumin (BSA, powder) (Sigma-Aldrich, catalog number: A2058 )
Primary antibody of rabbit anti-S100-beta (Sigma-Aldrich, catalog number: S2644 )
FITC-conjugated goat anti-rabbit (Abcam, catalog number: ab6717 )
(Optional) Cytosine arabinoside or Cytarabine (Sigma-Aldrich, catalog number: C3350000 )
Phosphate buffer saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 18912014 )
Paraformaldehyde (powder) (Sigma-Aldrich, catalog number: P6148 )
Culture medium (see Recipes)
Phosphate buffer saline (PBS) (see Recipes)
4% paraformaldehyde (see Recipes)
0.2% Triton X-100 (see Recipes)
10% bovine serum albumin (BSA) (see Recipes)
Equipment
Small forceps surgical tools (Fine Science Tools, catalog number: 11050-10 )
Hemocytometer (Sigma-Aldrich, catalog number: Z359629 )
Inverted fluorescence microscope (Optika, model: XDS-2FL )
Centrifuge machine (Hettich Lab Technology, model: Universal 320 R )
Ventilation hood (Vision Scientific, model: VS-7120LV )
CO2 cell culture incubator (Memmert, model: INC108 T2T3 )
37 °C water bath (Memmert, model: WNB 14 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hashemi, M. and Hadjighassem, M. (2017). Primary Olfactory Ensheathing Cell Culture from Human Olfactory Mucosa Specimen. Bio-protocol 7(10): e2275. DOI: 10.21769/BioProtoc.2275.
Download Citation in RIS Format
Category
Neuroscience > Sensory and motor systems > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,276 | https://bio-protocol.org/exchange/protocoldetail?id=2276&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Semi-quantitative Analysis of H4K20me1 Levels in Living Cells Using Mintbody
Yuko Sato
HK Hiroshi Kimura
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2276 Views: 8730
Edited by: Ralph Bottcher
Reviewed by: Cody KimeMartin V Kolev
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
Eukaryotic nuclear DNA wraps around histone proteins to form a nucleosome, a basic unit of chromatin. Posttranslational modification of histones plays an important role in gene regulation and chromosome duplication. Some modifications are quite stable to be an epigenetic memory, and others exhibit rapid turnover or fluctuate during the cell cycle. Histone H4 Lys20 monomethylation (H4K20me1) has been shown to be involved in chromosome condensation, segregation, replication and repair. H4K20 methylation is controlled through a few methyltransferases, PR-Set7/Set8, SUV420H1, and SUV420H2, and a demethylase, PHF8. In cycling cells, the level of H4K20me1 increases during G2 and M phases and decreases during G1 phase. To monitor the local concentration and global fluctuation of histone modifications in living cells, we have developed a genetically encoded probe termed mintbody (modification-specific intracellular antibody; Sato et al., 2013 and 2016). By measuring the nuclear to cytoplasmic intensity ratio, the relative level of H4K20me1 in individual cells can be monitored. This detailed protocol allows the semi-quantitative analysis of the effects of methyltransferases on H4K20me1 levels in living cells based on H4K20me1-mintbody described by Sato et al. (2016).
Keywords: Post translational modification Chromatin dynamics Live-cell imaging Mintbody Quantitative imaging
Background
Posttranslational modifications of histone proteins play important roles in transcriptional regulation and genome integrity. While the one-dimensional epigenomic landscape has been revealed in many cell types by chromatin immunoprecipitation and sequencing, less is known about the dynamics of histone modifications due to technical limitations (Kimura et al., 2015). Recently, a few techniques for detecting protein modifications in living cells have been developed. One strategy uses sensors based on fluorescence/Förster resonance energy transfer (FRET) to monitor the balance between the modifying and demodifying enzymes. However, the dynamics of endogenous modifications cannot be monitored using FRET sensors. Another strategy that we have developed uses probes based on modification-specific antibodies. Fab-based live endogenous modification labeling (FabLEM) is a live-imaging system using fluorescently labeled antigen-binding fragments (Fabs). Fabs loaded into cells bind to the target modification without disturbing cell function as the binding time is very small (a second to tens of seconds). A genetically encoded system to express a modification-specific intracellular antibody (mintbody) can be applied for observation with a longer period of time or in living animals (Figure 1). Both Fabs and mintbodies are just small enough to pass through the nuclear pore by diffusion. When the level of the target modification increases, more probes become enriched in the nucleus. Therefore, by measuring the nuclear/cytoplasmic intensity ratio, changes of modification level in living cells can be monitored (Hayashi-Takanaka et al., 2011; Sato et al., 2013 and 2016). The live cell modification monitoring system using mintbodies will be particularly useful to evaluate the effects of small chemicals and protein depletion and overexpression.
Histone H4 Lys20 monomethylation (H4K20me1) is an essential modification in mammals, involved in chromosome condensation, segregation, replication and repair, as well as gene regulation (Beck et al., 2012; Jørgensen et al., 2013). The level of H4K20me1 increases during G2 to M phases and the inhibition of PR-Set7/Set8, a methyltransferase responsible for H4K20 monomethylation, causes mitotic defects. In female cells, the enrichment of H4K20me1 in inactive X chromosomes is microscopically observed. H4K20me1-specific mintbody has proven useful for monitoring the dynamic behavior of H4K20me1 in living cells (Sato et al., 2016). In addition, alteration of H4K20me1 level by ectopic expression of a methyltransferase has been evaluated. Among methyltransferases (PR-Set7/Set8, SUV420H1, and SUV420H2) and a demethylase (PHF8), involved in H4K20me1 metabolism, the expression of SUV420H1, which add methyl-groups to monomethylated H4K20 towards to trimethylation, caused a drastic effect. As an example of measuring relative H4K20me1 levels, we here describe the method to evaluate the effect of SUV420H1 on H4K20me1 in living cells.
Figure 1. Schematic diagram of mintbody expression and function. A genetically encoded mintbody, which reversibly binds to specific modification, can be expressed in cells and animals that harbors the expression vector.
Materials and Reagents
Pipette tips (10, 20, 200, 1,000 μl)
6 well plate (Corning, catalog number: 3516 )
10 cm dish (Greiner Bio One International, catalog number: 664160-013 )
24 well glass-bottom plate (IWAKI, catalog number: 5826-024 )
HeLa cells (ATCC, catalog number: CRM-CCL-2 )
Purified plasmid DNA (~1 μg/μl) encoding H4K20me1-mintbody based on pEGFP (Clontech) or a piggybac system (Sato et al., 2016) and Halo-SUV420H1 (Kazusa DNA Research Institute; FlexiHaloTag clone FHC01413)
Dulbecco’s modified Eagle’s medium (DMEM), high glucose (4 g/L), containing L-Gln and sodium pyruvate (Nacalai Tesque, catalog number: 08458-16 )
L-glutamine-penicillin-streptomycin solution (Sigma-Aldrich, catalog number: G1146-100ML )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
FuGENE HD (Promega, catalog number: E2312 )
Opti-MEM media (Thermo Fisher Scientific, GibcoTM, catalog number: 31985070 )
G-418 disulfate aqueous solution (Nacalai Tesque, catalog number: 16513-26 )
FluoroBrite DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: A1896701 )
HaloTag TMR ligand (Promega, catalog number: G8251 )
Notes:
Nucleotide sequence of H4K20me1-scFv is available in public databases (DDBJ/EMBL/GenBank) under the accession number LC129890. The plasmid DNA is available upon request to the authors.
The original H4K20me1-specific antibody that was used to generate H4K20me1-mintbody (Hayashi-Takanaka et al., 2015) is available commercially (MBL International, catalog number: MABI0421).
Equipment
CO2 incubator
Pipette (10, 20, 200, 1,000 μl)
35 mm glass-bottom dishes, No. 1.5 coverslip (MATTEK, catalog number: P35G-1.5-14-C )
Fluorescence microscope (Nikon Instruments, model: ECLIPSE Ti-E ) operated by NIS-elements and equipped with:
A spinning disk confocal unit (Yokogawa Electric, model: CSU-W1 )
An EM-CCD camera (Andor, model: iXon3 DU888 X-8465 )
An objective lens (Plan Apo 40x DIC M N2 [NA 0.95])
A laser unit (Nikon Instruments, model: LU-N4 )
A heated stage (Tokai Hit)
A CO2-control system (Tokken)
Software
NIS-elements ver. 4.30 (Nikon Instruments)
Excel (Microsoft)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sato, Y. and Kimura, H. (2017). Semi-quantitative Analysis of H4K20me1 Levels in Living Cells Using Mintbody. Bio-protocol 7(10): e2276. DOI: 10.21769/BioProtoc.2276.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell staining > Protein
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,277 | https://bio-protocol.org/exchange/protocoldetail?id=2277&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Efficient Production of Functional Human NKT Cells from Induced Pluripotent Stem Cells − Reprogramming of Human Vα24+iNKT Cells
DY Daisuke Yamada
TI Tomonori Iyoda
KS Kanako Shimizu
YS Yusuke Sato
HK Haruhiko Koseki
SF Shin-ichiro Fujii
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2277 Views: 11553
Reviewed by: Lian Qun Qiu
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
Antigen-specific T cell-derived induced pluripotent stem cells (iPSCs) have been shown to re-differentiate into functional T cells and thus provide a potential source of T cells that could be useful for cancer immunotherapy. Human Vα24+ invariant natural killer T (Vα24+iNKT) cells are subset of T cells that are characterized by the expression of an invariant Vα24-Jα18 paired with Vβ11, that recognize glycolipids, such as α-galactosylceramide (α-GalCer), presented by the MHC class I-like molecule CD1d. Vα24+iNKT cells capable of producing IFN-γ are reported to augment anti-tumor responses, which affects both NK cells and CD8+ cytotoxic T lymphocytes to eliminate MHC- and MHC+ tumor cells, respectively. Here we describe a robust protocol to reprogram human Vα24+iNKT cells into iPSC, and then to re-differentiate them into Vα24+iNKT cells (iPS-Vα24+iNKT). We further provide a protocol to measure the activity of iPS-Vα24+iNKT cells.
Keywords: Induced pluripotent stem cell iPSC Vα24+invariant natural killer T cell Vα24+iNKT Anti-tumor activity IFN-γ production Tumor immunotherapy
Background
It was previously reported that clinical trials of Vα24+iNKT cell cancer immunotherapy targeting advanced non-small cell lung cancer (NSCLC) and head and neck cancer showed efficacy and were well-tolerated (Motohashi et al., 2009; Yamasaki et al., 2011). However, it has been known that the cell yield from ex vivo expansion of Vα24+iNKT cells from peripheral blood mononuclear cells (PBMCs) is often low (Motohashi et al., 2006). Reprogramming of somatic cells into induced pluripotent stem cells (iPSCs) using Yamanaka factors (Oct4, Sox2, Klf4 and c-Myc) has contributed greatly to the goals of regenerative medicine. The technology has recently been used to regenerate tumor-specific cytotoxic T lymphocytes and murine invariant natural killer T (iNKT) cells from iPSCs, thus opening up a new approach for cancer immunotherapy. Here, we have established a robust protocol to reprogram human Vα24+iNKT cells. We showed that iPS-derived Vα24+iNKT cells acted as cellular adjuvants and exerted anti-tumor activity, further extending their therapeutic potential. The complementation of other therapies with functionally validated Vα24+iNKT cells derived from iPSC could be valuable for cancer patients.
Materials and Reagents
Pipette tips
24-well plate (Corning, Falcon®, catalog number: 353047 )
15 ml centrifuge tube (Corning, Falcon®, catalog number: 352196 )
G27 needle (Terumo, catalog number: NN-2719S )
12-well plate (Corning, Falcon®, catalog number: 353043 )
Cell strainer (size: 100 μm) (Greiner Bio One International, catalog number: 542000 )
10 cm dish (Corning, Falcon®, catalog number: 353003 )
6-well plate (Corning, Falcon®, catalog number: 353046 )
6 cm dish (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 150288 )
96-well round-bottomed plate (Corning, Falcon®, catalog number: 351190 )
96-well round-bottomed plate for Procedures C and D (Corning, Falcon®, catalog number: 353077 )
StemPro EZ passage tool (Thermo Fisher Scientific, GibcoTM, catalog number: 23181010 )
Cell scraper (IWAKI, catalog number: 9000-220 )
0.22 μm bottle top filter (EMD Millipore, catalog number: SCGVU05RE )
Human Vα24+iNKT cells
K562 (ATCC, catalog number: CCL-243 )
OP9 feeder cells (obtained from RIKEN BRC Cell No. RCB2926)
SeV-KOS and SeV-c-MYC from CytoTune-iPS 2.0 (MEDICAL & BIOLOGICAL LABORATORIES, catalog number: DV-0305-3A )
OP9DLL1 feeder cells (obtained from RIKEN BRC Cell No. RCB2927)
Peripheral blood mononuclear cell (PBMC)
Cord blood mononuclear cell (CBMC)
Trypan blue stain 0.4% (Thermo Fisher Scientific, InvitrogenTM, catalog number: T10282 )
SeV vector with a SV40 large T antigen (T) insertion (SeV-SV40) (ID Pharma, custom order)
Mitomycin-C (Sigma-Aldrich, catalog number: M4287 )
iMatrix-511 (Nippi, catalog number: 892 012 )
StemFit AK02N (ReproCELL, catalog number: RCAK02N )
Freezing medium for human ES/iPS cells (DAP213) (ReproCELL, catalog number: RCHEFM001 )
Stem-cell banker GMP grade (Nippon Zenyaku Kogyo, Zenoaq, catalog number: CB045 )
0.25% trypsin-ethylenediaminetetraacetic acid (EDTA) (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
TripLE select (Thermo Fisher Scientific, GibcoTM, catalog number: 12563011 )
Y-27632, inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK) (Wako Pure Chemical Industries, catalog number: 253-00513 )
Hanks’ balanced salt solution without phenol red (HBSS+) (Wako Pure Chemical Industries, catalog number: 084-08965 )
Collagenase (Wako Pure Chemical Industries, catalog number: 036-23141 )
Dulbecco’s phosphate buffered saline (D-PBS) (Wako Pure Chemical Industries, catalog number: 045-29795 )
Stem cell factor (SCF) (R&D Systems, catalog number: 255-SC-050 )
Recombinant human interleukin-7 (IL-7) (PeproTech, catalog number: 200-07 )
Fms-related tyrosine kinase 3 (Flt-3) ligand (R&D Systems, catalog number: 3008-FK-025 )
Recombinant human IL-15 (PeproTech, catalog number: 200-15 )
7-AAD staining solution (BD, BD Biosciences, catalog number: 559925 )
V450 mouse anti-human CD3 clone UCHT1 (BD, BD Biosciences, catalog number: 560365 )
Anti-TCR Vβ11-APC (Beckman Coulter, catalog number: A66905 )
Anti-TCR Vα24-PE (Beckman Coulter, catalog number: IM2283 )
Lactate dehydrogenase (LDH) cytotoxicity detection kit (Takara Bio, catalog number: MK401 )
BD OptELISA human IFN-γ enzyme-linked immunosorbent assay (ELISA) set (BD, BD Biosciences, catalog number: 555142 )
BD OptELISA Human IL-4 ELISA Set (BD, BD Biosciences, catalog number: 555194 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787-100ML )
RPMI1640 (Sigma-Aldrich, catalog number: R8758 )
Fetal bovine serum (Sigma-Aldrich, catalog number: 172012-500ML )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Hanks’ balanced salt solution without phenol red, without calcium, without magnesium (HBSS-) (Wako Pure Chemical Industries, catalog number: 085-09355 )
2-[4-(2-Hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (HEPES) (Sigma-Aldrich, catalog number: H3375-250G )
Human IL-2 (Shionogi, catalog number: 4987058697900 )
Primate ES Cell Medium (ReproCELL, catalog number: RCHEMD001 )
Fibroblast growth factor basic (bFGF) (Wako Pure Chemical Industries, catalog number: 062-06661 )
MEMα (Thermo Fisher Scientific, GibcoTM, catalog number: 11900-073 )
Sodium hydrogen carbonate (NaHCO3) (Nacalai Tesque, catalog number: 31213-15 )
Recombinant mouse GM-CSF (PeproTech, catalog number: 315-03 )
α-galactosylceramide (α-GalCer) (Funakoshi, catalog number: KRN7000 )
Lipopolysaccharide (LPS) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 00-4976-93 )
Dulbecco’s modified Eagle’s medium (D-MEM) (Wako Pure Chemical Industries, catalog number: 044-29765 )
R10 medium (see Recipes)
NKT Media (see Recipes)
Human pluripotent stem cell medium (see Recipes)
OP9 medium (see Recipes)
DC/Gal (see Recipes)
MEF medium (see Recipes)
Equipment
CO2 incubator (35 °C, 37 °C, 38 °C) (Thermo Fisher Scientific, Thermo ScientificTM, model: HeracellTM 150i )
Inverted microscope (Leica Microsystems, model: DM IL LED )
Stereomicroscope (Leica, model: MZ75 )
P200-pipette (Gilson, catalog number: FA10005P )
Flow cytometers (BD, BD Biosciences, model: FACSCanto II )
Centrifuge (KUBOTA, model: 2800 )
Cell counter (Thermo Fisher Scientific, InvitrogenTM, catalog number: C10227 )
Controlled rate freezer (Grant Instruments, model: EF600M )
OptEIA (BD, BD Biosciences, San Jose, CA)
Microplate reader (Molecular Devices, model: SpectraMax 190 )
Software
FlowJo software (FlowJo, LLC)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yamada, D., Iyoda, T., Shimizu, K., Sato, Y., Koseki, H. and Fujii, S. (2017). Efficient Production of Functional Human NKT Cells from Induced Pluripotent Stem Cells − Reprogramming of Human Vα24+iNKT Cells. Bio-protocol 7(10): e2277. DOI: 10.21769/BioProtoc.2277.
Download Citation in RIS Format
Category
Stem Cell > Pluripotent stem cell > Cell induction
Immunology > Immune cell differentiation > T cell
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,278 | https://bio-protocol.org/exchange/protocoldetail?id=2278&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
1-MCP (1-methylcyclopropene) Treatment Protocol for Fruit or Vegetables
GD Gamrasni Dan
GM Goldway Martin
SY Stern Yosi
BD Breitel Dario
AA Aharoni Asaph
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2278 Views: 15483
Edited by: Arsalan Daudi
Reviewed by: Wenrong HeSimab Kanwal
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
1-MCP (1-methylcyclopropene) is a simple synthetic hydrocarbon molecule that interacts with the ethylene receptor and inhibits the response of fruit or plant to ethylene. 1-MCP has opened new opportunities in handling harvested crops and serves as a powerful tool to learn about plant response to ethylene (Watkins and Miller, 2006). 1-MCP is manufactured by Agrofresh and known by its commercial name SmartfreshSM.
Keywords: Ripening inhibition Ethylene Fruit Postharvest Storage
Background
Application of 1-MCP can serve as a powerful tool to examine the response of the plant to ethylene. The commercial production of 1-MCP by Agrofresh allows simple practice of this treatment, especially postharvest. The application of 1-MCP to plants, fruit or vegetable was mentioned in many articles but was not described in detail. This was the motivation to provide the following protocol. In this protocol tomatoes served as candidates for the treatment.
Materials and Reagents
Hand gloves (latex or nitrile)
Rubber septa (for the volumetric flask) (Sigma-Aldrich, catalog number: Z553964 )
Syringe 10 ml (OMG, catalog number: OMG-W-10M )
Needle 0.60 x 30 mm (Pic, catalog number: 03.070140.300.800 )
Weighing papers for the 1-MCP powder (Whatman, catalog number: 28414662 )
Freshly harvested tomatoes (any type and origin)
1-MCP powder (Agrofresh Inc.) containing 0.14% 1-MCP as active ingredient
Tap water
Equipment
30 L airtight HDPE plastic barrel wide mouth and cover with lid equipped with flexible latex hose or rubber septa (Chen Samuel chemicals, catalog number: 0100230 )
Brand volumetric flask 1,000 ml (Sigma-Aldrich, catalog number: Z326828 )
Benchtop weight scales with 0.01 g resolution (Vibra, catalog number: AJ-3200CE )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Dan, G., Martin, G., Yosi, S., Dario, B. and Asaph, A. (2017). 1-MCP (1-methylcyclopropene) Treatment Protocol for Fruit or Vegetables. Bio-protocol 7(10): e2278. DOI: 10.21769/BioProtoc.2278.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Other compound
Cell Biology > Cell signaling > Development
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,279 | https://bio-protocol.org/exchange/protocoldetail?id=2279&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Muscle Histology Characterization Using H&E Staining and Muscle Fiber Type Classification Using Immunofluorescence Staining
CW Chao Wang
FY Feng Yue
SK Shihuan Kuang
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2279 Views: 31751
Edited by: Antoine de Morree
Reviewed by: Jalaj Gupta
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
Muscle function is determined by its structure and fiber type composition. Here we describe a protocol to examine muscle histology and myofiber types using hematoxylin and eosin (H&E) and immunofluorescence staining, respectively. H&E stain nucleus in blue and cytoplasm in red, therefore allowing for morphological analyses, such as myofiber diameter, the presence of degenerated and regenerated myofibers, and adipocytes and fibrotic cells. Muscle fibers in adult skeletal muscles of rodents are classified into 4 subtypes based on the expression of myosin heavy chain proteins: Myh7 (type I fiber), Myh2 (type IIA fiber), Myh1 (type IIX fiber), Myh4 (type IIB fiber). A panel of monoclonal antibodies can be used to specifically label these muscle fiber subtypes. These protocols are commonly used in the study of muscle development, growth and regeneration (for example: Wang et al., 2015; Nie et al., 2016; Yue et al., 2016; Wang et al., 2017).
Keywords: Skeletal muscle Myofiber type Histology H&E staining Immunostaining
Background
Skeletal muscle is composed of myocytes, adipocytes, fibroblasts and other cell types. Multinuclear myocytes, the main composition of skeletal muscle, are also called myofibers (muscle fibers). Investigation of muscle histology is a routine approach to study muscle function. Generally, the diameter of muscle fiber and the extent of adipocytes and fibrotic area are associated with muscle strength (Yue et al., 2016). In addition, the presence of central nucleated muscle fibers serves as a surrogate indicator of newly regenerated muscle fibers during muscle regeneration (Wang et al., 2017). Based on the differential metabolic traits and the expression of myosin heavy chain (MyHC) subtypes, myofibers are classified into four types (I, IIa, IIx and IIb). The analysis of myofiber composition is helpful for studying muscle metabolic and contractile functions (Schiaffino and Reggiani, 2011).
Materials and Reagents
Clips (Universal, catalog number: UNV11240 )
Kimwipes (KCWW, Kimberly-Clark, catalog number: 34155 )
T-pin (Business Source, catalog number: 32351 )
Blade (Crescent Manufacturing, catalog number: 7223 )
Positive charged microscope slides (IMEB, catalog number: B-8255 )
Cover slides (IMEB, catalog number: CG1-2450 )
Adult mice
Note: DBA/2J female mice at 6 weeks were used to show the dissection of muscles. C57BL/6 male mice at 2-month old and 1-year old were used to do stainings in this protocol, but male or female mice of other genetic backgrounds or strains, at different ages can be used.
Tissue-Tek OCT compound (Sakura, catalog number: 4583 )
2-methylbutane (Fisher Scientific, catalog number: O3551-4 )
Dry ice (Purdue Lilly Stores, Local dry ice supplier)
Ethanol (Decon Labs, catalog number: V1001 )
Xylene (Avantor® Performance Materials, Macron, catalog number: 8668 )
Xylene-based mounting medium (Source Mount, catalog number: 9277722 )
Primary antibodies
Dystrophin (Abcam, catalog number: ab15277 )
Myh2 MyHC-2A (2F7), Myh4 MyHC-2B (10F5) and Myh7 MyHC-1 (BA-F8) are from Developmental Studies Hybridoma Bank (DSHB). We are using the concentrate 0.1 ml products
Phosphate-buffered saline (PBS) (pH 7.4) (Sigma-Aldrich, catalog number: P3813 )
Mounting medium for immunostaining (Agilent Technologies, catalog number: S3023 )
Nail polish (Crystal clear) (Sally Hansen, catalog number: 004677963 )
Secondary antibodies
Goat anti-Mouse IgG1, Alexa Fluor 568 (Thermo Fisher Scientific, Invitrogen, catalog number: A-21124 )
Goat anti-Mouse IgG1, Alexa Fluor 488 (Thermo Fisher Scientific, Invitrogen, catalog number: A-21121 )
Goat anti-Mouse IgG2b, Alexa Fluor 568 (Thermo Fisher Scientific, Invitrogen, catalog number: A-21144 )
Goat anti-Mouse IgG2b, Alexa Fluor 647 (Thermo Fisher Scientific, Invitrogen, catalog number: A-21242 )
Goat anti-Mouse IgM, Alexa Fluor 488 (Thermo Fisher Scientific, Invitrogen, catalog number: A-21042 )
Goat anti-Rabbit IgG (H+L), Alexa Fluor 647 (Thermo Fisher Scientific, Invitrogen, catalog number: A-21245 )
Hematoxylin (Sigma-Aldrich, catalog number: H9627 )
Potassium alum (Sigma-Aldrich, catalog number: 237086 )
Sodium iodate (Sigma-Aldrich, catalog number: S4007 )
Glacial acetic acid (Avantor® Performance Materials, Macron, catalog number: V193 )
Glycerol (Avantor® Performance Materials, Macron, catalog number: 5092 )
Eosin Y (Santa Cruz Biotechnology, catalog number: sc-203734 )
Goat serum (Jackson ImmunoResearch, catalog number: 005-000-121 )
Bovine serum albumin (BSA) (Gemini Bio-Products, catalog number: 700-105P )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Sodium azide (Fisher Scientific, catalog number: S2271 )
Hematoxylin solution (see Recipes)
Eosin Y solution (see Recipes)
Blocking buffer (see Recipes)
Equipment
Embedding molds (Structure Probe, SPI Supplies, catalog number: 2449M-AB )
Cold-resistant beaker (Sigma-Aldrich, catalog number: Z155519 )
-80 °C freezer (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM 8600 Series )
Leica CM1850 cryostat (Leica Biosystems, model: CM1850 )
Staining jar (BRAND, catalog number: 472800 )
Fume hood (Fisher Scientific, model: Fisher Hamilton SafeAire )
14.0 MP digital USB microscope camera (OMAX Microscope, catalog number: A35140U3 )
Leica DMI 6000B fluorescent microscope (Leica Microsystems, model: DMI 6000 B )
Lumen 200 fluorescence illumination system (Prior Scientific, model: Lumen 200 )
Coolsnap HQ CCD camera (Photometrics, model: Coolsnap HQ )
Liquid blocker (Ted Pella, catalog number: 22309 )
Dissecting scissors, 10 cm, straight (WPI, catalog number: 14393-G )
Vannas scissors, 8 cm, straight (WPI, catalog number: 14003-G )
Tweezer, 4.25”, straight (Excelta, catalog number: 5-S-SE )
Tweezer, 4.75”, straight (Excelta, catalog number: 3-S-SE )
Software
Photoshop software (e.g., Photoshop CC)
Procedure
Dissection of muscles
Tools used to dissect muscles of mice are shown in Figure 1A. Video 1 shows how to dissect muscles from a mouse.
Position the mouse supine on a dissection board (Styrofoam board) and secure the leg with a T-pin (Figure 1B).
Peel off the leg skin to expose the hind limb muscles. Expose tendons of tibialis anterior (TA) muscle and extensor digitorum longus (EDL) muscle (Figure 1B).
Gently remove the fascia covering the TA muscle.
Cut the distal TA tendon and use it to peel off the TA muscle. Carefully remove the TA muscle at its proximal attachment (Figure 1C).
After removing the TA muscle, cut distal EDL muscle and peel off the EDL muscle. Carefully cut the proximal EDL tendon and remove the EDL muscle. To dissect soleus muscle (SOL), position the mouse prone on a dissection board and secure the leg with a T-pin (Figure 1D).
Cut the tendon of gastrocnemius (GA) muscle and use it to peel off the GA muscle till the exposure of a SOL tendon (Figure 1E).
Cut the SOL tendon and use it to peel off the SOL muscle (Figure 1F).
Figure 1. Procedure of dissection muscles from a mouse. A. Tools used to dissect muscles; B-F. Key steps for muscle dissection; G. Illustration of how muscles are placed in embedding molds with O.C.T. compound. SOL is in the left mold and TA is in the right mold.
Video 1. Dissection of skeletal muscles from a mouse
Embedding of muscle
After dissection, skeletal muscles (e.g., tibialis anterior, soleus, extensor digitorum longus) are embedded in embedding molds (e.g., SPI Supplies) with minimum amount of Tissue-Tek O.C.T. compound possible to cover the muscles (Figure 1G).
Place a cold-resistant beaker of 2-methylbutane into a slurry of dry ice and ethanol (pure), which allows fast cooling to -78 °C. When the correct temperature is attained, no bubble will appear after putting a piece of dry ice into the 2-methylbutane.
Freeze the embedded muscle by placing it into the cooled 2-methylbutane for 5 min and then transfer the muscle sample to a -80 °C freezer for storage.
Cryosectioning
Before cryosectioning, the cryostat with the blade is pre-cooled to -22 ± 2 °C. Samples are placed in cryostat for at least 20 min for thermal equilibration. Attach the sample on the round metallic holders of the cryostat with Tissue-Tek O.C.T.
Make 10 µm-thick sections and collect them on room temperature positive charged microscope slides and then store the slides in a slide box in a -80 °C freezer. These slides can be processed further for H&E staining or immunostaining.
H&E staining
Bring the slides from the -80 °C freezer to room temperature.
Incubate the slides with hematoxylin solution in a staining jar for 10 min to stain the nuclei.
Transfer the slides to a staining jar with running water (tap water is fine) till the water is clear.
Transfer the slides to a staining jar with Eosin solution for 3 min.
Successively transfer the slides into staining jars with 70% ethanol for 20 sec, 90% ethanol for 20 sec, 100% ethanol for 1 min and xylene for 3 min.
Take out slides from xylene and place the slides in a fume hood till the slides are dry.
Mount the slides with xylene-based mounting media and cover with cover slides. Clips are used to press the slides to squeeze bubbles.
Store the slides at room temperature.
Hematoxylin and Eosin-stained images were captured with a 14.0 MP digital microscope camera which is attached via a c-mount to the side port of a Leica DMI 6000B microscope.
Immunostaining with MyHC antibodies
Bring the slides from the -80 °C freezer to room temperature and surround the sections with a liquid blocker (Ted Pella) to limit the usage of the incubation solutions.
Place the slides in a wet chamber (Note 5) and block the sections with blocking buffer for at least 30 min at room temperature. For the immunostaining with MyHC antibodies from DSHB, do not fix samples or sections with fixative solution (this is specifically for the MyHC antibodies).
Dilute primary antibodies with blocking buffer. Myh2, Myh4 and Myh7 antibodies are diluted at a ratio 1:300. Dystrophin antibody is diluted at a ratio 1:1,000. Remove blocking buffer from the sections and add diluted primary antibodies on sections. Place the slides in a wet chamber overnight at 4 °C.
Dilute secondary antibodies with PBS at a ratio 1:1,000. Incubate secondary antibodies with sections for 30 min to 1 h at room temperature. Slides are placed in a wet chamber.
Wash the slides with PBS for 5 times. Before mounting the slides, remove PBS as much as possible, but keep sections wet.
Mount the slides with immunostaining mounting media and cover with cover slides. Clips are used to press the slides to squeeze bubbles. Seal the slides with clear nail polish.
Store the slides at 4 °C.
Fluorescent images were captured using the Leica DMI 6000B fluorescent microscope.
Data analysis
H&E staining of Tibialis anterior muscle sections
Cardiotoxin (CTX) was injected into tibialis anterior (TA) muscles of 1-year old male mice to induce muscle damage which was followed by muscle regeneration. Two weeks after CTX injection, TA muscles were processed for cryosection and H&E staining (Figure 2). Most myofibers had central nuclei, indicative of muscle regeneration (Figure 2). Adipocytes and degenerated myofibers were found in TA muscle sections (Figure 2).
Figure 2. H&E staining of regenerated TA muscles isolated from 1-year old mice. Re/degenerated myofibers and adipocytes are indicated by different arrows. Scale bars = 100 µm.
Immunostaining of myofiber types
SOL muscles and TA muscles of 2-month old male mice were processed for immunostaining of myosin heavy chain (MyHC). For SOL muscles, we used Myh2, Myh7 and Dystrophin primary antibodies to stain Type IIa, Type I myofibers and sarcolemma, respectively. Goat anti-Mouse IgG1-488, Goat anti-Mouse IgG2b-568 and Goat anti-Rabbit IgG-647 secondary antibodies were used to distinguish Myh2, Myh7 and Dystrophin primary antibodies, respectively. SOL muscle is ‘slow’ muscle which contains Type I (Red), Type IIa (Green) and Type IIx (Black) myofibers (Figure 3).
Figure 3. Immunostaining of myofibers in SOL muscles of 2-month old male mice. Myh2, Myh7 and Dystrophin primary antibodies were used to stain Type IIa (Green), Type I (Red) myofibers and sarcolemma (Blue), respectively. Unlabeled myofibers (Black) are presumed to be Type IIx myofibers. One Type IIx myofiber is indicated by the arrow. Scale bar = 200 µm.
For TA muscles, we used Myh2, Myh4 and Myh7 primary antibodies to stain Type IIa, Type IIb and Type I myofibers, respectively. Goat anti-Mouse IgG1-568, Goat anti-Mouse IgM-488, and Goat anti-Mouse IgG2b-647 secondary antibodies were used to distinguish Myh2, Myh4 and Myh7 primary antibodies, respectively. TA muscle is ‘fast’ muscle which is dominated by Type IIa (Red), Type IIx (Black) and Type IIb (Green) myofibers (Figure 4). Few Type I myofibers exist in TA muscles (Figure 4).
Figure 4. Immunostaining of myofibers in TA muscles of 2-month old male mice. Myh2, Myh4 and Myh7 primary antibodies were used to stain Type IIa (Red), Type IIb (Green) and Type I (Blue) myofibers, respectively. Unlabeled myofibers (Black) are presumed to be Type IIx myofibers. One Type IIx myofiber is indicated by the arrow. Scale bar = 500 µm.
The numbers of myofibers are counted with Photoshop software (we use Photoshop CC, but any version of Photoshop containing the Count Tool works). For example, when counting different types of myofibers in a SOL muscle section, first, open image in Photoshop CC (Figure 5A). Next, choose Image > Analysis > Count Tool (Figure 5A). Next, choose Red and Blue channels (bottom right corner) to show Type I myofibers and sarcolemma (Figure 5B). A number will appear in a myofiber when you click the myofiber. Total number can be found in the Counts bar (top left corner, oval labeled, Figure 5B). After counting Type I myofibers, choose Green and Blue channels to count Type IIa myofibers. At last, choose Red, Green and Blue channels, myofibers without Red or Green labelling are Type IIx myofibers.
Figure 5. Illustration of myofiber counting in Photoshop CC. A. Open Count Tool in Photoshop CC; B. Choose a type of myofiber and count the number by clicking the myofiber. The total number is shown in the Count bar (oval highlighted).
Notes
Thermal equilibration is indispensable before cryosectioning.
The H&E staining protocol is generated based on our daily practice. It is not necessary to fix the sections before the hematoxylin staining. In addition, the ‘Blueing’ procedure is not required after the hematoxylin staining.
In the immunostaining using MyHC antibodies from DSHB, avoid fixation of the sections. Fixation disrupts the binding of antibody to myosin heavy chain.
The Abcam Dystrophin antibody works well in fixed and non-fixed sections.
The wet chamber is made by placing several wet papers in a slide box (Figure 6). Place a slide in a wet chamber as it is shown in Figure 6.
Figure 6. Setup of a wet chamber and placement of a slide in a wet chamber
Recipes
Hematoxylin solution
6 g hematoxylin
100 ml ethanol
150 g potassium alum
2,000 ml double-distilled H2O
1.2 g sodium iodate
120 ml glacial acetic acid
900 ml glycerol
Dissolve the hematoxylin in ethanol, and the potassium alum in distilled water. After that, mix them with glycerol, and add sodium iodate and glacial acetic acid at last. Store hematoxylin solution at room temperature
Eosin Y solution
2 g Eosin Y
40 ml double-distilled H2O
760 ml 95% ethanol
4 ml glacial acetic acid
Dissolve Eosin Y in double-distilled H2O. Then add 95% ethanol, and mix. While working in a fume hood, add glacial acetic acid and mix well. Store covered at room temperature
Blocking buffer
5% goat serum
2% BSA
0.2% Triton X-100
0.1% sodium azide
200 ml blocking buffer is prepared with PBS containing 10 ml goat serum, 4 g BSA, 4 ml 10% Triton X-100 and 0.2 g sodium azide. Aliquot and store at -20 °C
Acknowledgments
This work was supported by a grant from the US National Institutes of Health (R01AR071649 to S.K.).
References
Nie, Y., Sato, Y., Wang, C., Yue, F., Kuang, S. and Gavin, T. P. (2016). Impaired exercise tolerance, mitochondrial biogenesis, and muscle fiber maintenance in miR-133a-deficient mice. FASEB J 30(11): 3745-3758.
Schiaffino, S. and Reggiani, C. (2011). Fiber types in mammalian skeletal muscles. Physiol Rev 91(4): 1447-1531.
Wang, C., Wang, M., Arrington, J., Shan, T., Yue, F., Nie, Y., Tao, W. A. and Kuang, S. (2017). Ascl2 inhibits myogenesis by antagonizing the transcriptional activity of myogenic regulatory factors. Development 144(2): 235-247.
Wang, J. H., Wang, Q. J., Wang, C., Reinholt, B., Grant, A. L., Gerrard, D. E. and Kuang, S. (2015). Heterogeneous activation of a slow myosin gene in proliferating myoblasts and differentiated single myofibers. Dev Biol 402(1): 72-80.
Yue, F., Bi, P., Wang, C., Li, J., Liu, X. and Kuang, S. (2016). Conditional loss of Pten in myogenic progenitors leads to postnatal skeletal muscle hypertrophy but age-dependent exhaustion of satellite cells. Cell Rep 17(9): 2340-2353.
Copyright: Wang et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Wang, C., Yue, F. and Kuang, S. (2017). Muscle Histology Characterization Using H&E Staining and Muscle Fiber Type Classification Using Immunofluorescence Staining. Bio-protocol 7(10): e2279. DOI: 10.21769/BioProtoc.2279.
Bi, P., Yue, F., Sato, Y., Wirbisky, S., Liu, W., Shan, T., Wen, Y., Zhou, D., Freeman, J. and Kuang, S. (2016). Stage-specific effects of Notch activation during skeletal myogenesis. Elife 5.
Download Citation in RIS Format
Category
Neuroscience > Peripheral nervous system > Skeletal muscle
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
228 | https://bio-protocol.org/exchange/protocoldetail?id=228&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Enzyme-linked Immunosorbent Assay (ELISA) to Measure Serum Levels of Murine Anti-histone Antibodies
Zheng Liu
Published: Jun 20, 2012
DOI: 10.21769/BioProtoc.228 Views: 11993
Download PDF
Ask a question
Favorite
Cited by
Abstract
Autoimmune disease is characterized with the break of tolerance against self antigens. Anti-histone antibodies can be found in the majority of patients with system lupus erythematosus (SLE) and a number of lupus-prone mouse strains. This protocol describes a reliable method to determine the relative serum titers of anti-histone antibodies in these mice.
Keywords: ELISA Mouse Lupus Autoimmune Anti-histone antibody
Materials and Reagents
Histone from calf thymus (Roche Diagnostics, catalog number: 10223565001 )
Phosphate buffered saline (PBS)
Tween 20
Na2HPO4 (anhydrous)
NaH2PO4 (anhydrous)
NaCl
Fetal bovine serum (FBS) (Hyclone)
Bovine serum albumin (BSA)
Horseradish peroxidase (HRP) conjugated goat anti-mouse isotype specific antibodies [Southern Biotech, catalog number: 1040-05 (IgA); 1030-05 (IgG); 1021-05 (IgM)]
ABTS Peroxidase Substrate Solution A and B (Kirkegaard & Perry Laboratories, catalog number: 50-62-01 )
ABTS Peroxidase Stop Solution (Kirkegaard & Perry Laboratories, catalog number: 50-85-01 )
10x PBS-Tween 20 (see Recipes)
Blocking solution (see Recipes)
Equipment
Standard bench-top centrifuge
Falcon 96-well ELISA plates (BD Biosciences, catalog number: 35-3915 )
ELISA reader
Parafilm
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Antibody analysis > Antibody detection
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,280 | https://bio-protocol.org/exchange/protocoldetail?id=2280&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Simple Spectroscopic Determination of Nitrate, Nitrite, and Ammonium in Arabidopsis thaliana
TH Takushi Hachiya
YO Yuki Okamoto
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2280 Views: 19246
Edited by: Dennis Nürnberg
Reviewed by: Zhanwu Dai
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
Plants use nitrate, nitrite, and ammonium as inorganic nitrogen (N) sources. These N compounds are included in plant tissues at various concentrations depending on the balance between their uptake and assimilation. Thus, the contents of nitrate, nitrite, and ammonium are physiological indicators of plant N economy. Here, we describe a protocol for measurement of these inorganic N species in A. thaliana shoots or roots.
Keywords: Arabidopsis thaliana Nitrate Nitrite Ammonium
Background
Determination of inorganic N content is important for predicting the ability of a plant to uptake and assimilate N. Researchers often use techniques requiring expensive equipment, such as high-performance liquid chromatography (HPLC), for these measurements. The present protocol is based on versatile spectrometry with cheap reagents, making it practicable for many researchers. Nitration of salicylic acid by nitrate occurs under acidic conditions, and subsequent addition of an alkaline solution results in a yellow complex. Under acidic conditions, nitrite reacts with sulfanilamide to produce a diazonium compound that undergoes diazocoupling with N-(1-naphthyl)ethylenediamine to form a pink azo compound. Ammonium can be determined as a blue indophenol derivative under the catalytic influence of a nitroprusside salt. Each experimental procedure is easy, rapid, and simple.
Part I. Determination of nitrate (NO3-)
Materials and Reagents
0.1-10 µl pipette tips (NIPPON Genetics, catalog number: 30470 )
1-200 µl pipette tips (NIPPON Genetics, catalog number: 30430 )
100-1,000 µl pipette tips (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 111-N-Q )
2.0 ml microtube with O-ring (SARSTEDT, catalog number: 72.693 )
1.5 ml microtube (WATSON, catalog number: 131-5155C )
Assay plate (Iwaki, catalog number: 3881-096 )
Gloves and eye protection
Arabidopsis thaliana ecotype Col-0
Ultrapure water (Milli-Q, Millipore, 18 MΩ cm)
Liquid N2
Sulfuric acid (Wako Pure Chemical Industries, catalog number: 192-04696 )
Salicylic acid (Wako Pure Chemical Industries, catalog number: 196-14861 )
Sodium hydroxide (Wako Pure Chemical Industries, catalog number: 198-13765 )
Potassium nitrate (Wako Pure Chemical Industries, catalog number: 160-04035 )
Reaction reagent 1 (see Recipes)
Reaction reagent 2 (see Recipes)
Equipment
Pipettes (Nichiryo, model: Nichipet EX II )
Heat block (TAITEC, model: DTU-1B )
Refrigerated centrifuge (TOMY DIGITAL BIOLOGY, model: MX-300 )
Vortex mixer (Scientific Industries, catalog number: SI-0236 )
Multimode plate reader (PerkinElmer, model: EnSpire® 2300 )
Note: Versatile spectrophotometers are practicable.
Spectrophotometer (Shimadzu, model: UV-1650PC )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hachiya, T. and Okamoto, Y. (2017). Simple Spectroscopic Determination of Nitrate, Nitrite, and Ammonium in Arabidopsis thaliana. Bio-protocol 7(10): e2280. DOI: 10.21769/BioProtoc.2280.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Nitrogen
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
I want to measure ammonia of bifidobacterium cultured in BHI medium. Do I need to deproteinize the supernatant? If so, can I use TCA method, and how?
0 Answer
5 Views
May 23, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,281 | https://bio-protocol.org/exchange/protocoldetail?id=2281&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assaying the Effects of Splice Site Variants by Exon Trapping in a Mammalian Cell Line
Stuart W. Tompson
TY Terri L. Young
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2281 Views: 11935
Edited by: Jia Li
Reviewed by: Alberto Rissone
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
There are several in silico programs that endeavor to predict the functional impact of an individual’s sequence variation at splice donor/acceptor sites, but experimental confirmation is problematic without a source of RNA from the individual that carries the variant. With the aid of an exon trapping vector, such as pSPL3, an investigator can test whether a splice site sequence change leads to altered RNA splicing, through expression of reference and variant mini-genes in mammalian cells and analysis of the resultant RNA products.
Keywords: Splicing Mutation Exon Trapping Expression Transcript Variant Splice
Background
We wished to experimentally test the functional impact of two splice donor site variants, c.760+2T>C and c.3300+2delT, identified in the TEK gene (Souma et al., 2016). As is often the case, samples of cells or mRNA were not available from the individuals carrying these sequence variants, so we utilized the exon trapping method to serve as a functional test. DNA samples were available from patients for PCR amplification of the genomic regions of interest. If patient gDNA samples are unavailable, sequence variants can also be incorporated into wild-type sequence by methods such as PCR-based site-directed mutagenesis.
The exon trapping approach was originally developed to identify unknown exons within long stretches of genomic DNA (Duyk et al., 1990). The pSPL3 exon trapping vector was created to increase the efficiency and reliability of exon identification, and also allowed larger genomic fragments to be screened (Church et al., 1994; Nisson et al., 1994). The pSPL3 vector contains a small artificial gene composed of an SV40 promoter, an exon-intron-exon sequence with functional splice donor and acceptor sites, and a late polyadenylation signal. Within the single intron a multiple cloning site is located, into which a genomic fragment of interest is inserted to create a mini-gene expression construct.
In our example, patient and control genomic DNA fragments from the TEK gene were PCR amplified and cloned between pSPL3 vector exons V1 and V2 using XhoI and BamHI restriction sites. COS-7 cells were then transfected with the mini-gene constructs and the resulting RNA content purified. mRNA transcripts were then reverse transcribed into cDNA. Using vector exon-specific primers, cDNAs produced from the mini-gene constructs were specifically PCR amplified and Sanger sequenced. For the first splice site variant, c.760+2T>C within the 5’ splice site of exon 5, a 1,457 bp genomic fragment of the TEK gene encompassing all of intron 4, exon 5, intron 5, exon 6 and intron 6 was inserted into the construct (Figure 1A). RT-PCR and Sanger sequencing of the mini-gene expressed transcripts showed that the mutation destroyed the splice donor site, which resulted in partial intron 5 inclusion before a cryptic splice site was utilized (Figure 1C). This splicing error is predicted to result in a translational frameshift and premature termination signal, which would likely lead to transcript elimination via the nonsense-mediated decay pathway. For the second splice site variant, c.3300+2delT within the 5’ splice site of exon 22, an 831 bp genomic fragment of the TEK gene encompassing all of intron 21, exon 22 and intron 22 was inserted into the construct (Figure 1B). RT-PCR and Sanger sequencing of the mini-gene expressed transcripts revealed that the splice donor mutation led to skipping of exon 22, which is also predicted to result in a translational frameshift and premature termination signal in the genomic context of the patient (Figure 1C).
Figure 1. Exon trapping assay. Vector exons V1 and V2, are depicted as black boxes and TEK exons 5, 6, and 22 are shown in gray. Vector exon-specific primers are indicated by half-arrows in (A) and (B). Wild-type (WT) and mutant (M) splicing products, with included exon sizes in base pairs, are indicated by dashed lines above and below the construct, respectively. The locations of the splice site mutations are shown as an asterisk (*). A. Wild-type (WT-5) and mutant (M-5) genomic fragments containing TEK exons 5 and 6 were used to model the c.760+2T>C mutation. B. Wild-type (WT-22) and mutant (M-22) genomic fragments containing TEK exon 22 were used to model the c.3300+2delT mutation. C. Gel electrophoresis of RT-PCR products from transfected COS-7 cells. ‘Empty Vector’, cells transfected with vector containing no gDNA insert; ‘TF –ve’ (transfection negative), cells transfected with QIAGEN buffer EB only; ‘PCR –ve’ (PCR negative), PCR contamination control substituting water for cDNA template. Wild-type and mutant transcript content, determined by Sanger sequencing, is depicted to the right of the gel image. The additional 21 bp of intron 5 sequence identified within the M5 transcript is shown incorporating a premature termination codon between exons 5 and 6.
Materials and Reagents
PCR
0.2 ml PCR tubes with caps (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM12225 )
1.5 ml conical base screw cap tube (USA Scientific, catalog number: 1415-8399 )
Human genomic DNA samples with and without splice site variant (20 ng/μl)
TE buffer, 10 mM Tris 1 mM EDTA pH 8.0 (Sigma-Aldrich, catalog number: 93283 )
Custom-synthesized oligonucleotide primers incorporating restriction endonuclease sites to the 5’ end (Integrated DNA Technologies; https://www.idtdna.com/site/order/oligoentry):
TEK_E5-F: 5’-ctgactgaCTCGAGCACAGCTCCAGCCTGTAACCAT-3’
TEK_E5-R: 5’-tcagtcagGGATCCTCGGAACTACTTGGGAGCCTGT-3’
TEK_E22-F: 5’-ctgactgaCTCGAGATTCCAAGGCAAATGCTGCTCT-3’
TEK_E22-R: 5’-tcagtcagGGATCCTTGACTCCCAGATCGGTACAGC-3’
Note: Genome-specific sequences are underlined, restriction sites are shown in BOLD and an extra 8 bp added to the 5’ end are shown in lowercase. 5’-CTCGAG-3’ is the recognition sequence for XhoI and 5’-GGATCC-3’ is the recognition sequence for BamHI. ‘-F’ and ‘-R’ refers to the forwards and reverse primers in a pair, respectively. Resuspend primers and make 10 μM stocks with TE buffer.
Phusion Hot Start II High-Fidelity DNA polymerase (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: F549S )
Molecular grade water, nuclease-free (Dot Scientific, catalog number: DS248700 )
dNTP Set (QIAGEN, catalog number: 201913 )
2 mM dNTPs (see Recipes)
Gel electrophoresis
1 M Trizma hydrochloride solution, Tris-HCl, pH 7.8 (Sigma-Aldrich, catalog number: T2569 )
3 M sodium acetate buffer solution, pH 5.2 (Sigma-Aldrich, catalog number: S7899 )
0.5 M EDTA, pH 8.0 (Santa Cruz Biotechnology, catalog number: sc-203932 )
Agarose (IBI Scientific, catalog number: IB70042 )
SYBR safe DNA gel stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: S33102 )
Ficoll-400 (Dot Scientific, catalog number: DSF10400-25 )
Bromophenol blue, sodium salt (MP Biomedicals, catalog number: 02152506 )
Orange G (Sigma-Aldrich, catalog number: O3756 )
HyperLadder 1 kb (Bioline, catalog number: BIO-33053 )
1x TAE buffer (see Recipes)
1% or 1.5% agarose gel (see Recipes)
10x gel loading dye (see Recipes)
Cloning
1.5 ml Eppendorf tubes (VWR, catalog number: 20170-022 )
Petri dishes, 100 x 15 mm (VWR, catalog number: 25384-302 )
Whatman GD/X syringe filters, 0.2 μm pore size (Whatman, catalog number: 6901-2502 )
BD 60 ml syringes, Luer-Lok Tip (BD, catalog number: 309653 )
Pasteur glass pipettes, 230 mm (for spreading bacteria on plates) (WHEATON, catalog number: 357335 )
2 ml cryovial, self-standing (Simport, catalog number: T310-2A )
50 ml polypropylene conical tube, Falcon (Corning, Falcon®, catalog number: 352070 )
0.5 ml PCR tubes (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM12275 )
JM109 E. coli competent cells (Promega, catalog number: L2001 )
pSPL3 vector (Thermo Fisher Scientific, Invitrogen)
Restriction endonuclease, XhoI (New England Biolabs, catalog number: R0146S )
Restriction endonuclease, BamHI (New England Biolabs, catalog number: R0136S )
QIAquick PCR Purification Kit (QIAGEN, catalog number: 28104 )
T4 DNA ligase (New England Biolabs, catalog number: M0202S )
SOC medium (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15544034 )
Luria Bertani broth (Lennox) powder microbial growth medium (Sigma-Aldrich, catalog number: L3022 )
Select Agar (Thermo Fisher Scientific, InvitrogenTM, catalog number: 30391023 )
Carbenicillin, disodium salt (Dot Scientific, catalog number: DSC46000-5 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27104 )
Carbenicillin antibiotic, 1,000x (see Recipes)
LB (Luria-Bertani) medium with carbenicillin antibiotic (see Recipes)
LB agar with carbenicillin antibiotic plates (see Recipes)
Mammalian cell culture
Serological pipettes
5 ml (Corning, Costar®, catalog number: 4487 )
10 ml (Corning, Costar®, catalog number: 4488 )
25 ml (Corning, Costar®, catalog number: 4489 )
Transfer pipette, polyethylene, general purpose blood bank, bulb draw 1.9 ml, sterile (Sigma-Aldrich, catalog number: Z350699 )
Pasteur glass pipettes, 5.75” (for aspiration) (VWR, catalog number: 14673-010 )
25 cm2 (T25) cell culture flasks with 0.2 μm vent caps (Corning, catalog number: 430639 )
COS-7 mammalian cells (ATCC, catalog number: CRL-1651 )
Dulbecco’s modified Eagle’s medium, DMEM, + GlutaMAX-1 cell culture medium (Thermo Fisher Scientific, GibcoTM, catalog number: 10569010 )
Fetal bovine serum, FBS (Thermo Fisher Scientific, GibcoTM, catalog number: 10437028 )
Phosphate-buffered saline, PBS, pH 7.4, 1x (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Penicillin-streptomycin, 10,000 U/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Trypsin-EDTA (0.5%), no phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 15400054 )
FuGENE 6 Transfection Reagent (Promega, catalog number: E2691 )
Opti-MEM I reduced serum medium (Thermo Fisher Scientific, GibcoTM, catalog number: 31985062 )
RNA extraction
RNeasy Mini Kit (QIAGEN, catalog number: 74104 )
QIAshredder (disposable cell-lysate homogenizers) (QIAGEN, catalog number: 79654 )
cDNA generation
High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4374966 )
RT-PCR
0.2 ml PCR tubes with caps (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM12225 )
HotStarTaq DNA polymerase (QIAGEN, catalog number: 203203 )
TE buffer, 10 mM Tris 1 mM EDTA pH 8.0 (Sigma-Aldrich, catalog number: 93283 )
Vector-specific oligonucleotide primers (Integrated DNA Technologies; https://www.idtdna.com/site/order/oligoentry):
V1-F: 5’-TCTGAGTCACCTGGACAACC-3’
V2-R: 5’-ATCTCAGTGGTATTTGTGAGC-3’
Note: Resuspend primers and make 10 μM stocks with TE buffer.
2 mM dNTPs (see Recipes)
Sanger sequencing
Sanger sequencing (GeneWiz commercial sequencing service; https://www.genewiz.com/en/Public/Services/Sanger-Sequencing)
Sequencing primers (V1-F and V2-R oligonucleotide primers, same as for RT-PCR)
Equipment
Gel doc system (Labnet International, model: EnduroTM GDS )
Water bath (37 °C) (Fisher Scientific, model: Fisher ScientificTM IsotempTM 215 )
Bacterial shaking incubator (37 °C) (GeneMate, model: Incubated Shaker Mini )
Bacterial incubator (37 °C) (Lab-Line Imperial III Incubator)
Mammalian cell incubator (37 °C, 5% CO2) (Eppendorf, model: Galaxy® 170 S )
Bunsen Burner, simple natural gas burner version (Fisher Scientific, catalog number: S95941 )
NanoDrop Lite spectrophotometer (Thermo Fisher Scientific)
Eppendorf centrifuge (benchtop) (Eppendorf, model: 5415 D )
PCR thermocycler (Eppendorf, model: Mastercycler® Pro S )
Pyrex bottle/flask, 500 ml
HotPlate Stirrer (GeneMate, model: HotPlate Magnetic Stirrer )
VWR Spinbar Magnetic Stir Bar, Polygon with Pivot Ring, 6 mm (¼") diameter, 35 mm (1⅜") length (VWR, catalog number: 74950-290 )
Fisher Vortex Genie 2 (Thermo Fisher Scientific, catalog number: 12-812 )
Household microwave oven, 1,000 W
Gel electrophoresis tank (and tray) (Bio-Rad Laboratories, model: Wide Mini-Sub GT Cell )
Electrophoresis power pack (Bio-Rad Laboratories, model: PowerPacTM Basic Power Supply )
Autoclave (Medium Healthcare Sterilizer) (Tuttnauer, model: 6690 )
Biological safety cabinet (The Baker Company, model: SterilGARD e3 High Efficiency SG403A-HE )
Handheld aspirator and collector trap (Argos Technologies, model: EV514 )
Software
Sequencher software (version 5.2.4, Gene Codes Corporation; http://www.genecodes.com/sequencher)
Primer3Plus (http://primer3plus.com/cgi-bin/dev/primer3plus.cgi)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tompson, S. W. and Young, T. L. (2017). Assaying the Effects of Splice Site Variants by Exon Trapping in a Mammalian Cell Line. Bio-protocol 7(10): e2281. DOI: 10.21769/BioProtoc.2281.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA cloning
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,282 | https://bio-protocol.org/exchange/protocoldetail?id=2282&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Tactile-visual Conditional Discrimination Task for Testing Spatial Working Memory in Rats
AE Alicia Edsall
Zachary Gemzik
AG Amy Griffin
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2282 Views: 6311
Edited by: Soyun Kim
Reviewed by: Carey Y. L. Huh
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
This protocol describes a novel dual task comparison across two variants of a tactile-visual conditional discrimination (CD) T-maze task, one is dependent upon spatial working memory (SWM; CDWM) and the other one (CDSTANDARD) is not. The task variants are equivalent in their sensory and motor requirements and overt behavior of the rat. Therefore, differences between the two task variants in the dependent variables such as choice accuracy, neural firing patterns, and the effects of pharmacological or optogenetic inactivation in brain regions of interest can be attributed to SWM, ruling out confounding sensorimotor variables, such as tactile, visual and self-motion cues. The CDWM task protocol is published in Hallock et al., 2013b and Urban et al., 2014.
Keywords: Spatial working memory Conditional discrimination T-maze Encoding Retrieval
Background
Our laboratory is interested in exploring the neural mechanisms of working memory. Therefore, we have developed a task that can be used to assess spatial working memory (SWM) ability in rats. Working memory is defined as holding a limited amount of information ‘online’ so that the information can be used or manipulated to guide goal-directed behavior (Baddley, 1992). Because rodents are naturally inclined to forage for food, they are excellent models to use to probe SWM. Our laboratory has developed and used a conditional discrimination (CD) T-maze task in which floor inserts that vary in texture and color serve as conditional cues for the rewarded goal arm (Griffin et al., 2012; Hallock and Griffin, 2013; Hallock et al., 2013a; Shaw et al., 2013; Hallock et al., 2016). For example, the rats learn to choose the left goal arm if they encounter a mesh insert and the right goal arm if they encounter a wooden insert. To discriminate between the inserts, rats can use visual information (black vs. light brown), tactile information (rough mesh vs. smooth wood), or a combination of both types of information. Because the insert covers the entire floor of the maze and is available when the rat makes a goal-arm choice, this task does not require SWM. More recently, we have developed a working-memory variant of the task (CDWM; Hallock et al., 2013b; Urban et al., 2014). In this variant of the task, the floor insert cues extend only halfway up the central arm of the maze and are not available when the rat makes a goal-arm choice, thus requiring the rats to hold the cue in mind for a brief period of time in order to make a correct choice and receive food reward. In an ongoing experiment, we have found that it is possible to train rats on both variants of the task, giving us a powerful way to identify behavioral correlates of SWM while ruling out confounding sensorimotor variables such as visual, tactile, and self-motion cues.
Materials and Reagents
Male Long Evans Hooded (Harlan, Indianapolis) rats, weighing between 250 g and 500 g upon arrival (approximately 90 days of age)
Chocolate Sprinkles are used for food reward. Our lab uses the Chef’s Quality brand
70% ethanol for cleaning the maze between daily training sessions
Equipment
Wooden T-Maze that consists of a central stem (117 x 10 x 5 cm), two goal arms (56.5 x 10 x 5 cm) and two return arms (112 x 10 x 5 cm). The floor of the maze is covered with Roppe black vinyl (3 mm thick) (Figure 1)
Note: The T-maze was custom-built by members of our lab.
Figure 1. T-Maze used for both variants of the CD task shown with (A) and without (B) the removable barrier is used to confine the rat to the start box during the intertrial interval
A wooden stool (height: 69 cm) with a plastic saucer (diameter: 38 cm) attached to the seat serves, as the start box, is positioned at the base of the maze. The start box is separated from the maze by a removable 6-cm tall wooden barrier
Three removable wooden floor inserts covered with black plastic mesh on one side and smooth wood on the other serve as conditional cues (Figure 2). The black mesh was glued to one side of the inserts with superglue, and consisted of 4 x 4 mm mesh squares. For the CDWM variant of the task, the central arm insert (74 x 8 cm) extends halfway from the start box to the T-intersection. For the CDSTANDARD variant of the task, the central arm insert (117 x 8 cm) covers the entire length of the central arm from the start box to the T-intersection. The three goal arm inserts, one large insert (61 x 8 cm) and two small inserts (26 x 8 cm) are placed at the ends of the goal arms next to the reward cups
Figure 2. Removable wooden inserts shown mesh side up used for the CDWM (A) and CDSTANDARD (B) variants of the task, and close up view of the insert (C)
Black curtain, surrounding entire behavior room, 51 cm away from the maze
Distal cues taped to black curtain, 142 cm from the floor, located behind the start pedestal, left and right reward cups (Figure 3). The cues are a pink triangle (38.1 x 29.2 cm), a red X (40.6 x 35.6 cm) and a blue cube (43.2 x 41.9 cm) made out of colored tape
Figure 3. Distal cues taped to the curtains that surround the maze above the reward cups (A) and above the start box (B)
Plastic cups (3 cm diameter; 1 cm depth) located at the end of each goal arm where chocolate sprinkles (4-5 pieces) are delivered. The caps were 20 oz. water/soda bottle caps
One 60 W incandescent lamp attached to the curtain track of the back middle wall, near the ceiling. The lamp is facing up towards the ceiling, therefore the room is dimly lit with no direct lighting on any portion of the maze
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,283 | https://bio-protocol.org/exchange/protocoldetail?id=2283&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Locomotor Assay in Drosophila melanogaster
QL Qingqing Liu
JT Jingsong Tian
XY Xing Yang
YL Yan Li
AG Aike Guo
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2283 Views: 9445
Edited by: Xi Feng
Reviewed by: Manuel Sarmiento
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
This protocol describes a simple locomotor assay in Drosophila melanogaster. In brief, the locomotor of each single fly in the culture dish is recorded by a web camera. The moving time, walking length, speed and the locomotor trails of the single fly could be quantitatively analyzed.
Keywords: Locomotor Drosophila Video analysis Motion detection Motion trail Behavior
Background
This protocol was implemented in the previously published study (Liu et al., 2016). In that study, this assay was combined with the optogenetic system by simply providing the proper excitation light.
Materials and Reagents
3.5 cm culture dishes with black paper inside
Drosophila strains to be analyzed
Ice for anesthesia
Equipment
Empty vial for cold anesthesia
Fluorescent lamp (Bannet T5 8 W, China)
Infrared LEDs (TUOENS, model: TS-6036A )
Web camera (Omiky, model: CEL USB 2.0 50.0M PC Camera , catalog number: CEL9002255) with the IR filter removed; Replacing the IR filter with the floppy disk (the black floppy disk contained in the hard shell) to filter the visible light
Behavior room with the temperature and humidity controlled
Software
MATLAB (MathWorks, R2013a)
Procedure
Set the environmental illuminance (provided by the fluorescent lamp) to be 1,000-1,300 Lux, the temperature to be 24 ± 1 °C and the humidity to be 40-60%.
Transfer the flies into the empty vial and anesthetize them on ice for 10 min.
Transfer one fly to each culture dish, and let the flies recover from the anesthesia for at least 10 min.
Record the locomotion of the flies for 2 min with the web camera equipped with a visible light filter (Figures 1A and 1D; Video1). The fly is light up and the background is dark (Figure 1B). The angle of the infrared LEDs should be adjusted before recording to reduce the reflection on the dish.
Figure 1. Locomotor assay in Drosophila melanogaster. A. The schematic diagram of the locomotor assay; B. A photo of the dish with a fly inside; C. The motion trial of a recorded fly; D. A photo of the setup.
Video 1. Recording of the locomotor behavior of the flies
Data analysis
Analyze the photos with MATLAB (MathWorks, R2013a; For MATLAB code for video analysis, see Supplemental file 1) (Figure 1C). Figure out the coordinate of the fly on each photo, and then calculate the moving time, walking length and speed of the fly, and analyze the locomotor trail of the fly.
Individuals with the walk length less than half of the fly body length during recording should be excluded.
The Wilcoxon signed rank test should be applied to evaluate differences between matched samples.
Acknowledgments
We would like to thank Jingwu Hou for assistance with experimental setup. This protocol was designed by Q. L. and was implemented in the previously published study (Liu et al., 2016). This study was supported by the ‘Strategic Priority Research Program’ of the CAS (XDB02040004), by grants from the 973 Program (2011CBA00400), as well as by the National Science Foundation of China (91232000, 91132709, 31130027, and 31070956). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
Liu, Q., Yang, X., Tian, J., Gao, Z., Wang, M., Li, Y. and Guo, A. (2016). Gap junction networks in mushroom bodies participate in visual learning and memory in Drosophila. Elife 5.
Copyright: Liu et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Liu, Q., Tian, J., Yang, X., Li, Y. and Guo, A. (2017). Locomotor Assay in Drosophila melanogaster. Bio-protocol 7(10): e2283. DOI: 10.21769/BioProtoc.2283.
Liu, Q., Yang, X., Tian, J., Gao, Z., Wang, M., Li, Y. and Guo, A. (2016). Gap junction networks in mushroom bodies participate in visual learning and memory in Drosophila. Elife 5.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
2 Q&A
Can I use something else instead of culture dish?
0 Answer
7 Views
Sep 1, 2024
Hi I am trying to use this protocol and I dont undestand how do you select coordinates of fly once image frame appears.
0 Answer
6 Views
Aug 29, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,284 | https://bio-protocol.org/exchange/protocoldetail?id=2284&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ultradeep Pyrosequencing of Hepatitis C Virus to Define Evolutionary Phenotypes
BP Brendan A. Palmer
ZD Zoya Dimitrova
PS Pavel Skums
OC Orla Crosbie
EK Elizabeth Kenny-Walsh
LF Liam J. Fanning
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2284 Views: 5760
Edited by: Yannick Debing
Reviewed by: Raju GhoshVamseedhar Rayaprolu
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Analysis of hypervariable regions (HVR) using pyrosequencing techniques is hampered by the ability of error correction algorithms to account for the heterogeneity of the variants present. Analysis of between-sample fluctuations to virome sub-populations, and detection of low frequency variants, are unreliable through the application of arbitrary frequency cut offs. Cumulatively this leads to an underestimation of genetic diversity. In the following technique we describe the analysis of Hepatitis C virus (HCV) HVR1 which includes the E1/E2 glycoprotein gene junction. This procedure describes the evolution of HCV in a treatment naïve environment, from 10 samples collected over 10 years, using ultradeep pyrosequencing (UDPS) performed on the Roche GS FLX titanium platform (Palmer et al., 2014). Initial clonal analysis of serum samples was used to inform downstream error correction algorithms that allowed for a greater sequence depth to be reached. PCR amplification of this region has been tested for HCV genotypes 1, 2, 3 and 4.
Keywords: Ultradeep pyrosequencing Virus Quasispecies Hypervariability
Background
Analysis of UDPS datasets derived from virus amplicons frequently relies on software tools that are not optimized for amplicon analysis, assume random incorporation of sequencing mutations and are focused on finding true sequences rather than false variants. These difficulties are further complicated by the presence of hypervariable regions present in RNA virus genomes. Many studies utilizing UDPS look to overcome these issues by applying arbitrary frequency cut offs to the data, resulting in the loss of minor variants. Here, a temporally matched clonal dataset, together with an error correction methodology designed to overcome the problems outlined, facilitated the retention of valuable sequence information.
Materials and Reagents
1.5 ml tube (SARSTEDT, catalog number: 72.690.001 )
200 µl MicroAmp® PCR tube (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: N8010840 )
Clean stainless steel blade
One Shot® TOP10 Competent Cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: C404003 )
QIAamp® Viral RNA mini kit (QIAGEN, catalog number: 52904 )
Random primer (Promega, catalog number: C1181 )
Deoxynucleoside triphosphate (dNTP’s, 100 mM) set, PCR grade (Roche Molecular Systems, catalog number: 11969064001 )
AMV reverse transcriptase (Promega, catalog number: M5101 )
RNasin® Ribonuclease inhibitor (Promega, catalog number: N2511 )
Outer-forward primer: 5’- ATGGCATGGGATATGAT -3’ (10 pmol/µl, Eurofins)
Outer-reverse primer: 5’- AAGGCCGTCCTGTTGA -3’ (10 pmol/µl, Eurofins)
Inner-forward primer: 5’- GCATGGGATATGATGATGAA -3’ (10 pmol/µl, Eurofins)
Inner-reverse primer: 5’- GTCCTGTTGATGTGCCA -3’ (10 pmol/µl, Eurofins)
Pwo DNA polymerase (5 U/µl,) including 10x reaction buffer (- MgSO4) and MgSO4 stock solution (25 mM) (Roche Molecular Systems, catalog number: 11644955001 )
dH2O (Sigma-Aldrich, catalog number: W4502 )
Sybr safe DNA gel stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: S33102 )
Agarose (Sigma-Aldrich, catalog number: A9539 )
GeneRuler 100 bp Plus DNA ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SM0323 )
Gel extraction kit (QIAGEN, catalog number: 28704 )
CloneJet PCR Cloning Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: K1231 )
GeneJet Plasmid Miniprep Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: K0503 )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
Acetic acid glacial (BDH Laboratory Supplies, catalog number: 10001CU )
Ethylenediaminetetraacetic acid solution 0.5 M (EDTA) (Sigma-Aldrich, catalog number: 03690 )
1x TAE (see Recipes)
Equipment
PCR thermal cycler (Thermo Fisher Scientific, Applied BiosystemsTM, model: Applied Biosystems® 2720 )
BioPhotometer (Eppendorf, http://arboretum.harvard.edu/wp-content/uploads/Biophotometer-manual.pdf)
Water bath (JULABO, model: SW22 )
Orbital shaker incubator (Grant, model: ES-80 )
Ultraviolet transilluminator (UVP, model: TMW-20 )
Software
SFFFile tools (Roche Molecular Systems)
k-mer error correction (KEC) and empirical threshold (ET) (Skums et al., 2012)
MEGA 6.0 (Tamura et al., 2013)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Palmer, B. A., Dimitrova, Z., Skums, P., Crosbie, O., Kenny-Walsh, E. and Fanning, L. J. (2017). Ultradeep Pyrosequencing of Hepatitis C Virus to Define Evolutionary Phenotypes. Bio-protocol 7(10): e2284. DOI: 10.21769/BioProtoc.2284.
Download Citation in RIS Format
Category
Molecular Biology > RNA > RNA sequencing
Microbiology > Microbial genetics > RNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,285 | https://bio-protocol.org/exchange/protocoldetail?id=2285&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Nucleosome Positioning Assay
ZZ Zhongliang Zhao
HB Holger Bierhoff
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2285 Views: 11072
Edited by: Antoine de Morree
Reviewed by: Xiaoyi ZhengToshitsugu Fujita
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
The basic unit of chromatin is the nucleosome, a histone octamer with 147 base pairs of DNA wrapped around it. Positions of nucleosomes relative to each other and to DNA elements have a strong impact on chromatin structure and gene activity and are tightly regulated at multiple levels, i.e., DNA sequence, transcription factor binding, histone modifications and variants, and chromatin remodeling enzymes (Bell et al., 2011; Hughes and Rando, 2014). Nucleosome positions in cells or isolated nuclei can be detected by partial nuclease digestion of native or cross-linked chromatin followed by ligation-mediated polymerase chain reaction (LM-PCR) (McPherson et al., 1993; Soutoglou and Talianidis, 2002). This protocol describes a nucleosome positioning assay using Micrococcal Nuclease (MNase) digestion of formaldehyde-fixed chromatin followed by LM-PCR. We exemplify the nucleosome positioning assay for the promoter of genes encoding ribosomal RNA (rRNA genes or rDNA) in mice, which has two mutually exclusive configurations. The rDNA promoter harbors either an upstream nucleosome (NucU) covering nucleotides -157 to -2 relative to the transcription start site, or a downstream nucleosome (NucD) at position -132 to +22 (Li et al., 2006; Xie et al., 2012). Radioactive labeling of LM-PCR products followed by denaturing urea-polyacrylamide gel electrophoresis allows resolution and relative quantification of both configurations. As depicted in the diagram in Figure 1, the nucleosome positioning assay is a versatile low to medium throughput method to map discrete nucleosome positions with high precision in a semi-quantitative manner.
Figure 1. Flow chart depicting the nucleosome positioning assay. The diagram shows how the assay is used to detect the ratio between upstream (NucU) and downstream (NucD) nucleosome positions at the mouse rDNA promoter. After all steps have been performed, the LM-PCR yields two radiolabeled products that differ in size and correspond to NucU and NucD. Signal intensities of the bands reflect the relative abundance of each nucleosome position in the original sample.
Keywords: Chromatin Nucleosome positioning Micrococcal nuclease LM-PCR
Background
Chromatin accessibility is regulated by nucleosome packaging, which therefore directs DNA-templated reactions such as transcription, DNA repair, recombination and replication. Dynamic positioning of nucleosomes depends on DNA sequence, transcription factor binding, histone modifications, histone variants and chromatin remodeling enzymes, and is used by cells to regulate genome activity (Bell et al., 2011; Hughes and Rando, 2014). The inaccessibility of nucleosomal DNA facilitates probing of nucleosome positions in cells by digesting nucleosome-free chromatin regions with nucleases like DNase I and MNase. These, and similar approaches are nowadays frequently combined with deep sequencing methods and provide thereby a genome-wide picture of nucleosome positioning (Tsompana and Buck, 2014). However, DNase-seq and MNase-seq assays are relative labor- and cost-intensive and might be immoderate for analysis of the nucleosomal architecture of a specific genomic region. In such a case, MNase digestion of chromatin followed by LM-PCR provides a simple and straightforward alternative, which allows interrogation of nucleosome positions at a given genomic site. Here we describe this gene-centric nucleosome positioning assay and demonstrate its application for analysis of the two nucleosome configurations at the mouse rRNA gene promoter (Li et al., 2006; Xie et al., 2012; Zhao et al., 2016a and 2016b).
Materials and Reagents
Pipette tips (TipOne filter tips, STARLAB INTERNATIONAL)
10 cm-dish
Tubes (Eppendorf Safe-lock microcentrifuge tubes) (Eppendorf, catalog number: 0030120086 )
Cell scraper (Sigma-Aldrich, catalog number: SIAL0010 )
Syringe
Whatman paper (Whatman, catalog number: 10547922 )
Plastic wrap
Clean razor blades
Immortalized mouse embryonic fibroblast cell line NIH/3T3 (ATCC, catalog number: CRL-1658 )
Formaldehyde solution (Sigma-Aldrich, catalog number: F8775 )
Glycine (Sigma-Aldrich, catalog number: G7126 )
Phosphate buffered saline (PBS)
0.2 M ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA), adjust the pH to 8.0 with NaOH (Sigma-Aldrich, catalog number: E3889 )
0.5 M ethylenediaminetetraacetic acid (EDTA), adjust the pH to 8.0 with NaOH (Sigma-Aldrich, catalog number: E5134 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Phenol:chloroform:isoamyl alcohol (25:24:1, v/v) (Carl Roth, catalog number: A156.1 )
Sodium acetate (pH 5.2)
70% ethanol
QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28706 )
Quick Blunting Kit (New England Biolabs, catalog number: E1210L )
QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106 )
T4 DNA ligase (New England Biolabs, catalog number: M0202S )
T4 polynucleotide kinase (New England Biolabs, catalog number: M0201S )
PCR-primer specific for the nucleosomal region of interest. For the mouse rDNA promoter we used mrDNA (-63/-36): GATCACAAGCATAAAAGAGACAGGGAGG
QIAquick Nucleotide Removal Kit (QIAGEN, catalog number: 28306 )
[γ-32P]-ATP (3,000 Ci/mmol, 10 mCi/ml) (PerkinElmer, catalog number: BLU002001MC )
GoTaq G2 Hot-Start Green PCR Master Mix (Promega, catalog number: M742A )
Linker primers: linker S: 5’-gaattcagatc-3’, linker L: 5’-gcggtgacccgggagatctgaattc-3’
DMSO (Sigma-Aldrich, catalog number: D8418 )
Sucrose (Sigma-Aldrich, catalog number: 84097 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) adjust the pH to 7.9 with NaOH (Applichem, catalog number: A1069 )
Potassium phosphate dibasic (K2HPO4·3H2O) (Carl Roth, catalog number: 6878.1 )
Magnesium chloride (MgCl2·6H2O) (Applichem, catalog number: 131396.1211 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: 499609 )
L-α-lysophosphatidylcholine (Sigma-Aldrich, catalog number: L4129 )
Micrococcal Nuclease (MNase) (New England Biolabs, catalog number: M0247S )
Tris base
Boric acid
Formamide
Xylene cyanol
Bromophenol blue
SDS (Sigma-Aldrich, catalog number: 74255 )
Rotiphorese sequencing gel concentrate (Carl Roth, catalog number: 3043.1 )
Rotiphorese sequencing gel diluents (Carl Roth, catalog number: 3047.1 )
Ammonium persulfate (APS) (Carl Roth, catalog number: 9592.2 )
TEMED (Carl Roth, catalog number: 2367.3 )
Permeabilization buffer (see Recipes)
MNase digestion buffer (see Recipes)
TE buffer (see Recipes)
10x TBE buffer (see Recipes)
Formamide loading buffer (see Recipes)
Denaturing polyacrylamide gel (6%) (see Recipes)
Equipment
Pipette
Standard microcentrifuge
NanoDrop 2000 UV-Vis spectrophotometer (Thermo Fisher ScientificTM, model: NanoDrop 2000 )
PCR machine
Electrophoresis equipment with power supply
Vacuum pump
Gel dryer (Bio-Rad Laboratories, model: 583 )
Note: This product has been discontinued.
Phosphor imaging instrument (FujiFilm, model: FLA-3000 )
Imaging plate (GE Healthcare, model: BAS-IP MS 2025 E )
Software
Quantification software (Raytest, AIDA Image Analyzer)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhao, Z. and Bierhoff, H. (2017). Nucleosome Positioning Assay. Bio-protocol 7(10): e2285. DOI: 10.21769/BioProtoc.2285.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Molecular Biology > DNA > DNA structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,286 | https://bio-protocol.org/exchange/protocoldetail?id=2286&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Lung Section Staining and Microscopy
XZ Xiaofeng Zhou
BM Bethany B Moore
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2286 Views: 24449
Edited by: Ivan Zanoni
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Our protocol describes immunofluorescent staining, hematoxylin and eosin staining and Masson’s trichrome staining on lung sections.
Keywords: Immunofluorescent staining Hematoxylin and eosin staining Masson’s trichrome staining Frozen tissue sections Paraffin-embedded tissue sections Antibodies
Background
The primary function of the lungs is gas exchange. The lungs are composed of various specialized cells and tissues, including the bronchi, the bronchioles and the pulmonary alveoli to facilitate gas exchange. To study lung development or lung diseases in mouse models, the lungs can be removed from mice and either frozen and embedded in optimal cutting temperature (OCT) compound or chemically preserved and embedded in paraffin. To preserve lung tissue architecture, we filled the lung with 1 ml of OCT compound for preparing frozen sections, or 10% buffered formalin for paraffin sections (Zhou et al., 2016). Lung sections are then sliced from frozen or paraffin-embedded lungs and mounted onto slides for preparation of staining. We used frozen tissue sections for antibody-based immunofluorescent staining and used paraffin-embedded sections for hematoxylin and eosin (H&E) staining or Masson’s trichrome staining. Frozen sections are quicker to prepare for immunofluorescent staining and most antibodies work well on frozen sections. Paraffin sections can also be used for immunofluorescent staining, but they require deparaffinization, rehydration and antigen retrieval. Some antibodies do not work well on paraffin sections even after antigen retrieval. However, paraffin samples can be stored at room temperate for very long periods and can be easily cut into very thin sections. Paraffin sections preserve better tissue morphology than frozen sections, so they are better for H&E or trichrome staining.
Immunofluorescent staining is a type of immunohistochemistry that makes use of fluorophores to visualize the location of the antibodies that specifically bind to their target proteins. H&E staining is the most widely used stain in histology and medical diagnosis. This staining method involves application of hemalum and eosin Y that color cell nuclei blue and cytoplasm pink to red. Masson’s trichrome staining is a three-color staining that is used for detecting collagen fibers in tissues. The staining produces blue collagen, dark brown to black cell nuclei and red background.
Materials and Reagents
Fisherbrand Superfrost Plus microscope slides (Fisher Scientific, catalog number: 12-550-15 )
Disposable mold
Coverslip slides
C57BL/6 mice
Tissue-Tek OCT compound (SAKURA FINETEK, catalog number: 4583 )
Formaldehyde, 37-40% ACS (Newcomer Supply, catalog number: 1089 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Phosphate buffered saline (PBS, pH 7.4) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Serum from secondary antibody’s host
Primary antibodies: Rabbit anti α-smooth muscle actin (α-SMA) antibody (Abcam, catalog number: ab5694 )
Secondary reagents: Texas Red conjugated goat anti-rabbit IgG antibody (Abcam, catalog number: ab6719 )
Prolong® Gold anti-fade reagent (Cell Signaling Technology, catalog number: 9071 ), or with DAPI (Cell Signaling Technology, catalog number: 8961 )
Paraffin
Ethyl alcohol (Newcomer Supply, catalog number: 10841 )
Xylene (Newcomer Supply, catalog number: 1446 )
S-mounting medium (Newcomer Supply, catalog number: 6750 )
Bouin Fluid (Newcomer Supply, catalog number: 1020 )
Biebrich scarlet-acid fuchsin solution (Sigma-Aldrich, catalog number: HT151 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3912 )
Fetal bovine serum (FBS) (GE Healthcare, HycloneTM, catalog number: SH30396.03 )
Eosin Y (Sigma-Aldrich, catalog number: E4009 )
Acetic acid, glacial (Sigma-Aldrich, catalog number: A6283 )
Aluminum potassium sulfate (Sigma-Aldrich, catalog number: 237086 )
Hematoxylin (Sigma-Aldrich, catalog number: H3136 )
Sodium iodate (Sigma-Aldrich, catalog number: S4007 )
Citric acid (Sigma-Aldrich, catalog number: 251275 )
Ferric chloride (Sigma-Aldrich, catalog number: 157740 )
Hydrochloric acid (Sigma-Aldrich, catalog number: 320331 )
Phosphomolybdic acid solution (Sigma-Aldrich, catalog number: HT153 )
Phosphotungstic acid solution (Sigma-Aldrich, catalog number: HT152 )
Aniline blue (Sigma-Aldrich, catalog number: 415049 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S8282 )
Blocking buffer (see Recipes)
Eosin Y solution (see Recipes)
Eosin Y working solution (0.25%) (see Recipes)
Mayer’s hematoxylin solution (see Recipes)
Weigert’s iron hematoxylin solution (see Recipes)
Phosphomolybdic-phosphotungstic acid solution (see Recipes)
Aniline blue solution (see Recipes)
Equipment
Cryostat microtome
-70 °C freezer
Fluorescence microscope or a confocal microscope
Staining jar and slide rack, for example EasyDip Slide Staining System (Newcomer Supply, catalog number: 5300KIT )
Optical microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhou, X. and Moore, B. B. (2017). Lung Section Staining and Microscopy. Bio-protocol 7(10): e2286. DOI: 10.21769/BioProtoc.2286.
Download Citation in RIS Format
Category
Immunology > Immune cell staining > Immunodetection
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,287 | https://bio-protocol.org/exchange/protocoldetail?id=2287&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Murine Bronchoalveolar Lavage
FS Fan Sun
GX Gutian Xiao
ZQ Zhaoxia Qu
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2287 Views: 25414
Edited by: HongLok Lung
Reviewed by: Riddhi Atul Jani
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
A basic Bronchoalveolar lavage (BAL) procedure in mouse is described here. Cells and fluids obtained from BAL can be analyzed by Hema3-staining, immunostaining, Fluorescence-activated cell sorting (FACS), PCR, bicinchoninic acid protein assay, enzyme-linked immunosorbent assay (ELISA), luminex assays, etc., to examine the immune cells, pathogens, proteins such as cytokines/chemokines, and the expression levels of inflammation-related and other genes in the cells. This will help to understand the underlying mechanisms of these lung diseases and develop specific and effective drugs.
Keywords: Bronchoalveolar lavage Lung cancer Hema3-staining
Background
Bronchoalveolar lavage (BAL) is a simple and typical method commonly performed to diagnose pulmonary diseases including lung cancer (Daubeuf and Frossard, 2012). It is used to sample pulmonary components to determine the protein composition, immune cells and pathogens in the lung. Pulmonary chronic inflammation plays a critical role in lung cancer initiation and progression. To clarify the underlying mechanism of inflammation in lung tumorigenesis, a basic BAL protocol in mice is used in our laboratory to determine the pulmonary immune response (Qu et al., 2015; Zhou et al., 2015; Sun et al., 2016; Zhou et al., 2017).
Materials and Reagents
Needles (BD, catalog number: 305167 ) or tapes
Nylon string (Dynarex, catalog number: 3243 )
22 G x 1” Exel Safelet Catheter (Exel International, catalog number: 26746 )
1 ml syringe (BD, catalog number: 309659 )
1.5 ml Eppendorf tubes (VWR, catalog number: 87003-294 )
0.22 µm filter (EMD Millipore, catalog number: SLGP033RS )
Mice (THE JACKSON LABORATORY)
70% ethanol (Decon Labs, catalog number: 2701 )
Protease inhibitor cocktail (Roche Diagnostics, catalog number: 11697498001 )
Phenylmethylsulfonyl fluoride (PMSF) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 36978 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9625 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Disodium hydrogen phosphate heptahydrate (Na2HPO4·7H2O) (Fisher Scientific, catalog number: BP331-500 )
Potassium phosphate monobasic (KH2PO4) (Acros Organics, catalog number: 205925000 )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: A9434-1KG )
Potassium bicarbonate (KHCO3) (Sigma-Aldrich, catalog number: P9144-1KG )
Note: This product has been discontinued.
Ethylenediaminetetraacetic acid disodium salt dihydrate (Na2-EDTA-2H2O) (Sigma-Aldrich, catalog number: E5134-100G )
Phosphate-buffered saline (PBS) (see Recipes)
ACK lysis buffer (see Recipes)
Equipment
CO2 chamber
Biosafety cabinet
Styrofoam board
Forceps (Roboz Surgical Instrument, catalog number: RS-5135 )
Scissors (Roboz Surgical Instrument, catalog number: RS-6802 )
Centrifuge (Eppendorf, model: 5417 R )
Hemocytometer (Hausser Scientific, catalog number: 3110 )
Microscope (Olympus, model: CK30 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sun, F., Xiao, G. and Qu, Z. (2017). Murine Bronchoalveolar Lavage. Bio-protocol 7(10): e2287. DOI: 10.21769/BioProtoc.2287.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,288 | https://bio-protocol.org/exchange/protocoldetail?id=2288&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Murine Alveolar Type II Epithelial Cells
FS Fan Sun
GX Gutian Xiao
ZQ Zhaoxia Qu
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2288 Views: 11325
Edited by: HongLok Lung
Reviewed by: Jason A. NeidlemanShahzada Khan
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
We have optimized a protocol for isolation of alveolar type II epithelial cells from mouse lung. Lung cell suspensions are prepared by intratracheal instillation of dispase and agarose followed by mechanical disaggregation of the lungs. Alveolar type II epithelial cells are purified from these lung cell suspensions through magnetic-based negative selection using a Biotin-antibody, Streptavidin-MicroBeads system. The purified alveolar type II epithelial cells can be cultured and maintained on fibronectin-coated plates in DMEM with 10% FBS. This protocol enables specific investigation of alveolar type II epithelial cells at molecular and cellular levels and provides an important tool to investigate in vitro the mechanisms underlying lung pathogenesis.
Keywords: Alveolar type II epithelial cells Lung Biotin Streptavidin Dispase Agarose
Background
Alveolar type II epithelial cells play critical roles in alveolar integrity maintenance, surfactant protein synthesis and secretion, and defense against pulmonary infection of bacteria and viruses. Recent studies using mouse lung cancer models have proven that alveolar type II epithelial cells are a key cell of origin of adenoma/adenocarcinoma induced by chemical carcinogens and oncogenic mutations (Qu et al., 2015; Zhou et al., 2015 and 2017). To further expand our understanding of the role of alveolar type II epithelial cells in lung pathogenesis in vivo, isolation of alveolar type II epithelial cells is needed to allow for a precise mechanism analysis in vitro. Based on previous studies (Corti et al., 1996; Rice et al., 2002), a modified method was used in our laboratory to isolate highly purified, viable and culturable alveolar type II epithelial cells from mice (Zhou et al., 2015; Sun et al., 2016).
Materials and Reagents
Needles (BD, catalog number: 305167 ) or tapes
10 ml syringe (BD, catalog number: 309604 )
27 gauge needle (BD, catalog number: 305109 )
Nylon string (Dynarex, catalog number: 3243 )
22 G x 1” Exel Safelet Catheter (Exel International, catalog number: 26746 )
1 ml syringe (BD, catalog number: 309659 )
15 ml tubes (VWR, catalog number: 89039-666 )
60 mm non-coated cell culture dish (Greiner Bio One International, catalog number: 628160 )
Cell strainer (70 µm) (Fisher Scientific, catalog number: 22-363-548 )
Cell strainer (40 µm) (Fisher Scientific, catalog number: 22-363-547 )
Nylon mesh (25 µm) (ELKO filtering, catalog number: 03-25/19 )
MS column (Miltenyi Biotec, catalog number: 130-042-201 )
Fibronectin-coated plate (Corning, catalog number: 354402 )
Mice (THE JACKSON LABORATORY)
70% ethanol (Decon Labs, catalog number: 2701 )
Dispase (1 mg/ml dissolved in PBS) (Roche Diagnostics, catalog number: 4942078001 )
1% low melting point agarose (Dissolved in PBS, autoclaved, aliquoted and stored at 4 °C) (Lonza, catalog number: 50100 )
DMEM (Lonza, catalog number: 12-604F )
DNase I (Roche Diagnostics, catalog number: 10104159001 )
Biotinylated anti-CD45 (Miltenyi Biotec, catalog number: 130-101-952 )
Biotinylated anti-CD16/CD32 (Miltenyi Biotec, catalog number: 130-101-895 )
Streptavidin MicroBeads (Miltenyi Biotec, catalog number: 130-048-101 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437028 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9625 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Disodium hydrogen phosphate heptahydrate (Na2HPO4·7H2O) (Fisher Scientific, catalog number: BP331-500 )
Potassium phosphate monobasic (KH2PO4) (Acros Organics, catalog number: 205925000 )
Bovine serum albumin (BSA) (MP Biomedicals, catalog number: 199898 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E26282-500G )
Note: This product has been discontinued.
Penicillin-streptomycin (Lonza, catalog number: 17-602E )
Phosphate buffered saline (PBS) (see Recipes)
Labeling buffer (see Recipes)
Equipment
CO2 chamber
Biosafety cabinet
Styrofoam board
Forceps (Roboz Surgical Instrument, catalog number: RS-5135 )
Scissors (Roboz Surgical Instrument, catalog number: RS-6802 )
Water bath incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: BarnsteadTM 18000A-1CE )
Shaker (Thermo Fisher Scientific, Thermo ScientificTM, model: BarnsteadTM 2314 )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: IEC CL40R , catalog number: 11210927)
MACS MultiStand (Miltenyi Biotec, catalog number: 130-042-303 )
Hemocytometer (Hausser Scientific, catalog number: 3110 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sun, F., Xiao, G. and Qu, Z. (2017). Isolation of Murine Alveolar Type II Epithelial Cells. Bio-protocol 7(10): e2288. DOI: 10.21769/BioProtoc.2288.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,289 | https://bio-protocol.org/exchange/protocoldetail?id=2289&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Exopolysaccharide Quantification for the Plant Pathogen Ralstonia solanacearum
Rémi Peyraud
TD Timothy P. Denny
SG Stéphane Genin
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2289 Views: 7704
Edited by: Arsalan Daudi
Reviewed by: Hiroyuki HiraiKanika Gera
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
Soluble exopolysaccharide is a major virulence factor produced by the plant pathogen Ralstonia solanacearum. Its massive production during plant infection is associated with the arrest of water flow in xylem vessels leading eventually to plant death. The composition of this heavy macromolecule includes mainly N-acetylgalactosamine. Here we describe a colorimetric method for quantitative determination of the soluble exopolysaccharide present in culture supernatant of R. solanacearum.
Keywords: Ralstonia solanacearum Exopolysaccharide Virulence factor Plant pathogen Hexoseamine
Background
The plant pathogen Ralstonia solanacearum produces exopolysaccharide under the control of quorum sensing system, i.e., at high cell density, above 5 x 107 cell ml-1 (Flavier et al., 1997). The sugar content of the exopolysaccharide includes galactosamine, glucose, and rhamnose in the ratio of 10:2.5:1 (Drigues et al., 1985). A protocol for a reliable extraction and quantification of the exopolysaccharide from culture supernatant was initially developed by Brumbley and Denny (1990) and was updated recently by Peyraud et al. (2016). The quantification is based on the determination of hexoseamine content of the macromolecule using an adapted Elson and Morgan assay (Elson and Morgan, 1933; Gatt and Berman, 1966). Exopolysaccharides containing N-acetyl-D-galactosamine are produced by diverse Gram-negative or Gram-positive bacteria (Vaningelgem et al., 2004; Balzaretti et al., 2017) and also some fungi (Lee et al., 2015), so this protocol may also be applicable to such organisms.
Materials and Reagents
Millex®-GP 33 mm syringe filter with a polyethersulfone membrane and 0.22 µm pore size (EMD Millipore, catalog number: SLGP033RB )
Polypropylene microcentrifuge tubes of 2.0 ml Eppendorf® Safe-Lock (Eppendorf, catalog number: 0030120094 )
Paper towel
Aluminum foil
Pipette tips
15-ml conical polypropylene Greiner centrifuge tubes (Greiner Bio One International, catalog number: 188271 )
50-ml conical polypropylene Greiner centrifuge tubes (Greiner Bio One International, catalog number: 227261 )
Bridges for microcentrifuge tube (Milian, catalog number: 045427 )
Gloves
R. solanacearum strain GMI1000 (Salanoubat et al., 2002). This strain can be retrieved from the CIRM Biological Resource Center (http://www6.inra.fr/cirm_eng/CFBP-Plant-Associated-Bacteria) in the CIRM-BP collection (code CFBP6924)
Acetone > 99.8% AnalaR NORMAPUR® (VWR, catalog number: 20066.296 )
Milli-Q water obtained at a resistivity of 18.2 MOhm cm at 25 °C
Acetyl acetone > 99% AnalaR NORMAPUR® (VWR, catalog number: 20092.23 0)
Ethanol, 99.8% (Sigma-Aldrich, catalog number: 02851 )
4-(dimethylamino)benzaldehyde, 98% (Erlich’s reagent) (Sigma-Aldrich, catalog number: 109762 )
Sodium L-glutamic acid monohydrate (Sigma-Aldrich, catalog number: 49621 )
Iron(II) sulfate heptahydrate (FeSO4·7H2O) (Sigma-Aldrich, catalog number: F8263 )
Ammonium sulfate, (NH4)2SO4 (Sigma-Aldrich, catalog number: A4418 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: M5921 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 60377 )
Sodium chloride (NaCl) > 99.5% AnalaR NORMAPUR® (VWR, catalog number: 27810.295 )
N-acetylgalactosamine, 98% (Sigma-Aldrich, catalog number: A2795 )
Hydrochloric acid (HCl), 37%, AnalaR NORMAPUR® (VWR, catalog number: 20252.29 0)
Sodium carbonate (Na2CO3) > 99.9 AnalaR NOR MAPUR® (VWR, catalog number: 27771.29 0)
Minimal medium (see Recipes)
5 M NaCl solution (see Recipes)
Standard samples of N-acetyl galactosamine (see Recipes)
N-acetylgalactosamine standard stock solution (see Recipes)
2% acetyl acetone, 1.5 M Na2CO3 solution (see Recipes)
Erlich’s reagent (see Recipes)
Equipment
Dry bath heater with dual block Corning® (Corning, model: Corning® LSETM Digital Dry Bath Heater, catalog number: 6786-DB )
Fume hood
Eppendorf® microcentrifuge 5415 R (Eppendorf, model: 5415 R )
Mini microcentrifuges Corning® (Corning, model: Corning® LSETM Mini Microcentrifuge, catalog number: 6766 )
Vortex for microcentrifuge tubes
UltrospecTM 2100 pro UV/Visible spectrophotometer (GE Healthcare, model: UltrospecTM 2100 pro UV/Visible Spectrophotometer , catalog number: 80211221)
10 ml volumetric flask
Software
Appropriate software (SciDavis, Excel, etc.)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Peyraud, R., Denny, T. P. and Genin, S. (2017). Exopolysaccharide Quantification for the Plant Pathogen Ralstonia solanacearum. Bio-protocol 7(10): e2289. DOI: 10.21769/BioProtoc.2289.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Plant Science > Plant immunity > Host-microbe interactions
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
229 | https://bio-protocol.org/exchange/protocoldetail?id=229&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Primary Tumor Preparation
LL Liang Lei
Published: Vol 2, Iss 12, Jun 20, 2012
DOI: 10.21769/BioProtoc.229 Views: 14115
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
This protocol has been developed for culturing primary glioblastoma cells. We have most experience in using it on rodent preparations, but it can also be used in culturing cells from other species.
Materials and Reagents
Phosphate buffered saline (PBS)
Fetal bovine serum (FBS)
Trypsin (Corning, Cellgro®, catalog number: 25-054-CI )
Minimum essential medium (MEM)
HEPES
Sucrose
B104 conditioned media
N2 supplement (Life Technologies, Invitrogen™, catalog number: 17502-048 )
T3 (Sigma-Aldrich, catalog number: T2877 )
Penicillin/streptomycin/amphotericin (Life Technologies, Invitrogen™, catalog number: 15240-062 )
DMEM (Life Technologies, Invitrogen™, catalog number: 11965-167 )
Poly-L-lysine
PDGF-AA (Sigma-Aldrich)
FGFb (Life Technologies, Gibco®)
Basal media (in DMEM) (see Recipes)
Equipment
Mesh (BD Biosciences, Falcon®)
Shaking bath
Centrifuges
6-well tissue culture plates
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lei, L. (2012). Primary Tumor Preparation. Bio-protocol 2(12): e229. DOI: 10.21769/BioProtoc.229.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,290 | https://bio-protocol.org/exchange/protocoldetail?id=2290&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Flow Cytometric Analysis of Drug-induced HIV-1 Transcriptional Activity in A2 and A72 J-Lat Cell Lines
DB Daniela Boehm
MO Melanie Ott
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2290 Views: 10456
Edited by: Emilie Besnard
Reviewed by: Emilie Battivelli
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
The main obstacle to eradicating HIV-1 from patients is post-integration latency (Finzi et al., 1999). Antiretroviral treatments target only actively replicating virus, while latent infections that have low or no transcriptional activity remain untreated (Sedaghat et al., 2007). A combination of antiretroviral treatments with latency-purging strategies may accelerate the depletion of latent reservoirs and lead to a cure (Geeraert et al., 2008). Current strategies to reactivate HIV-1 from latency include use of prostratin, a non-tumor-promoting phorbol ester (Williams et al., 2004), BET inhibitors (Filippakopoulos et al., 2010; Delmore et al., 2011), and histone deacetylase (HDAC) inhibitors, such as suberoylanilidehydroxamic acid (i.e., SAHA or Vorinostat) (Kelly et al., 2003; Archin et al., 2009; Contreras et al., 2009; Edelstein et al., 2009). As the mechanisms of HIV-1 latency are diverse, effective reactivation may require combinatorial strategies (Quivy et al., 2002). The following protocol describes a flow cytometry-based method to quantify transcriptional activation of the HIV-1 long terminal repeat (LTR) upon drug treatment. This protocol is optimized for studying latently HIV-1-infected Jurkat (J-Lat) cell lines that contain a GFP cassette. J-Lats that contain a different reporter, for example Luciferase, can be treated with drugs as described but have to be analyzed differently.
Keywords: Human immunodeficiency virus-1 Latency Drug treatment Transcriptional activation HIV-1 LTR Flow cytometry J-Lat cell lines
Background
Studies that assess transcriptional activation or repression of the HIV-1 LTR generally use CD4+ T cells containing latent full-length HIV-1, such as NL4-3/E-/GFP-IRES–nef (Kutsch et al., 2002) or R7/E-/GFP (Jordan et al., 2003), which contains a frameshift mutation in the viral Env gene to prevent viral spread and expresses GFP in the Nef open reading frame allowing separation of actively infected GFP+ from GFP− cells (uninfected or latently infected) by cell sorting (Jordan et al., 2003). To specifically investigate transcriptional activation of the HIV-1 LTR, we utilize the J-Lat cell line A72 containing only a latent LTR-GFP construct (Jordan et al., 2003). To determine if drug treatment specifically activates Tat, we utilize a J-Lat cell line harboring a latent lentiviral construct expressing Tat with GFP from the HIV-1 LTR (clone A2; LTR-Tat-IRES-GFP) (Jordan et al., 2003).
Materials and Reagents
A2 and A72 J-Lat cell culture
75 cm2 tissue culture flask (Corning, Falcon®, catalog number: 353110 )
Tips
0.1-10 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-681-440 )
1-200 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-502 )
101-1,000 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-509 )
A2 and A72 J-Lat cells (Jordan et al., 2003)
RPMI (Mediatech, catalog number: 10-040-CV )
Fetal bovine serum (FBS) (Gemini Bio-Products, catalog number: 100-106 )
L-glutamine (Mediatech, catalog number: 25-005-Cl )
100x penicillin/streptomycin (Mediatech, catalog number: 30-002-Cl )
Analysis of HIV-1 LTR transcriptional activation by flow cytometry
96-well V-bottom tissue culture plates and lids (Thermo Fisher Scientific, Thermo Scientific TM, catalog numbers: N249570 and N163320 )
Tips
0.1-10 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-681-440 )
1-200 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-502 )
101-1,000 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-509 )
RPMI (Mediatech, catalog number: 10-040-CV )
Fetal bovine serum (FBS) (Gemini Bio-Products, catalog number: 100-106 )
L-glutamine (Mediatech, catalog number: 25-005-Cl )
100x penicillin/streptomycin (Mediatech, catalog number: 30-002-Cl )
TNFα (PeproTech, catalog number: 300-01A )
JQ1 (Cayman Chemical, catalog number: 11187 )
Prostratin (Sigma-Aldrich, catalog number: P0077 )
Suberoylanilide hydroxamic acid (SAHA) (Sigma-Aldrich, catalog number: SML0061 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
1x PBS (Mediatech, catalog number: 21-031-CV )
MACSQuant Running buffer (Miltenyi Biotech, catalog number: 130-092-747 )
ApoTox-GloTM Triplex Assay (Promega, catalog number: G6320 )
RPMI medium (see Recipes)
TNFα stock solution (see Recipes)
JQ1 stock solution (see Recipes)
Prostratin stock solution (see Recipes)
Suberoylanilide hydroxamic acid (SAHA) stock solution (see Recipes)
Equipment
Pipette
Biosafety cabinet level 2
CO2 tissue culture incubator (Thermo Electron, model: FormaTM Steri-CultTM CO2 Incubators , catalog number: 3307)
Tabletop centrifuge (Beckman Coulter, model: Allegra X-14R ) for 96-well plates
MACSQuant VYB FACS analyzer (Miltenyi Biotech, model: MACSOuant® VYB, catalog number: 130-096-116 )
SpectraMax MiniMaxTM 300 Imaging Cytometer (Molecular Devices, model: SpectraMax MiniMax 300 )
Software
FlowJo 9.9 or never (Tree Star)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Boehm, D. and Ott, M. (2017). Flow Cytometric Analysis of Drug-induced HIV-1 Transcriptional Activity in A2 and A72 J-Lat Cell Lines. Bio-protocol 7(10): e2290. DOI: 10.21769/BioProtoc.2290.
Download Citation in RIS Format
Category
Cell Biology > Single cell analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,291 | https://bio-protocol.org/exchange/protocoldetail?id=2291&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Imaging the Pharynx to Measure the Uptake of Doxorubicin in Caenorhabditis elegans
SA Sivathevy Amirthagunabalasingam
AP Arturo Papaluca
TH Taramatti Harihar
Dindial Ramotar
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2291 Views: 7720
Edited by: Neelanjan Bose
Reviewed by: Kanika GeraJianwei Sun
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
Caenorhabditis elegans offers an array of advantages to investigate the roles of uptake transporters. Herein, an epifluorescent microscopy approach was developed to monitor the uptake of the autofluorescent anticancer drug, doxorubicin, into the pharynx of C. elegans by organic cation transporters.
Keywords: C. elegans Organic cation uptake transporters Drug uptake Doxorubicin Autofluorescent drug Epifluorescent microscopy RNAi feeding bacteria
Background
Human cells have over 450 solute carrier transporters that are believed to facilitate the uptake of several ions, nutrients, as well as both therapeutic and anticancer drugs (Cesar-Razquin et al., 2015). However, the roles and substrates of a large number of these uptake transporters are not known. C. elegans is an inexpensive model organism that offers a multitude of advantages over mammalian cells to rapidly study many biological processes that are highly conserved in nature. During the last decade, this organism has been instrumental in several drug discovery programs to identify novel small molecules, e.g., those that act as antimicrobials and inhibit oxidative stress, although the yield of bioactive compounds has been less striking (Burns et al., 2010; O’Reilly et al., 2014). We reason that the recovery rate could be higher if there is greater and selective influx of the molecules by uptake transporters into the animal cells. To date, only three studies have been performed to understand the roles of uptake transporters in C. elegans (Wu et al., 1999; Cheah et al., 2013; Papaluca and Ramotar, 2016). Thus, characterization of the function and substrate specificities of uptake transporters in this organism will be advantageous towards improving the strategies employed to identify novel bioactive molecules. Herein, we outline a method to monitor uptake of the anticancer drug doxorubicin into the pharynx of C. elegans (Papaluca and Ramotar, 2016). Doxorubicin autofluorescence can be readily monitored by several widely available detection systems such as the epifluorescent microscope. We note that several benefits can be derived from this approach including a hunt for novel therapeutic substrates of the transporter by competing for doxorubicin uptake.
Materials and Reagents
Petri dish 60 x 15 mm (SARSTEDT, catalog number: 82.1194.500 )
15 ml conical tube
Frosted microscope slides (size: 1 x 3” ; thickness: 1-2 mm) (UltiDent Scientific, catalog number: 170-7107A )
Microscope cover glass (size: 22 x 22 #1.5) (Fisher Scientific, catalog number: 12-541B )
Platinum wire (Thomas Scientific, catalog number: 1233S71 )
Pasteur pipet (Fisher Scientific, catalog number: 13-678-20C )
E. coli bacteria HT115DE3 with the plasmid pL4440-empty vector
E. coli bacteria HT115DE3 with the plasmid pL4440-oct-1 (Ahringer’s collection). Sequence verified
E. coli bacteria HT115DE3 with the plasmid pL4440-oct-2 (Ahringer’s collection). Sequence verified
Bristol N2 (wild type) and RB1084 [oct-1(ok1051) I] from Caenorhabditis Genetic Center
Ampicillin (Sigma-Aldrich, catalog number: A9518 )
Potassium phosphate monobasic (KH2PO4) (Bio Basic, catalog number: PB0445 )
Magnesium sulfate (MgSO4) (Bio Basic, catalog number: MRB0329 )
Calcium chloride dihydrate (CaCl2) (Fisher Scientific, catalog number: C79-500 )
Cholesterol (Sigma-Aldrich, catalog number: C8503 )
Ethanol 100% (works from any company)
Doxorubicin (for Research from Hôpital Maisonneuve-Rosemont, Montreal, Canada). Stock concentration at 2 mg/ml
IPTG (Bio Basic, catalog number: PRB0447 )
Levamisol hydrochloride (MP Biomedical, catalog number: 155228 )
Clear nail polish from Wild Shine from Dollarama
Tryptone (Bio Basic, catalog number: TG217 (G211)) for Luria Broth (LB) media
Yeast extract (Wisent Bioproducts, catalog number: 800-150-LG ) for LB media
Sodium chloride (NaCl) (Wisent Bioproducts, catalog number: 600-082 )
Bacteriological agar (Wisent Bioproducts, catalog number: 800-010-CG )
Peptone (Wisent Bioproducts, catalog number: 800-157-LG ) for nematode grown media (NGM)
Agarose (Wisent Bioproducts, catalog number: 800-015-CG )
Sodium hydroxide (NaOH) (Bio Basic, catalog number: SB0617 )
Bleach Lavo Pro6 (Lavo Inc, Montreal, Canada)
Sodium phosphate dibasic (Na2HPO4) (Bio Basic, catalog number: S0404 )
LB solution (see Recipes)
Nematode growth media (NGM) (see Recipes)
Agar pad (see Recipes)
Alkaline Hypochlorite solution for bleaching the worms (see Recipes)
M9 buffer (see Recipes)
Equipment
Incubator at 20 °C, but with a range from 15 to 37 °C (SHEL LAB, model: 2020 )
37 °C incubator (Panasonic Healthcare, model: Mir-262 )
37 °C shaker (Inforst, model: Multitron Standard )
500 ml glass bottle (Wheaton graduated glass media bottles with lined caps)
Microwave (inverter model, Panasonic Healthcare)
55 °C water bath (Precision Scientific, catalog number: 66800 )
Metal spatula (VWR)
Flame
Neutrex culture tubes 16 x 15 mm
Pyrex Erlenmeyer flask different sizes for bacteria culturing
Autoclave
Stereomicroscope Leica MZ 8 (Leica 10445538 Plan Microscope Objective Lens 1.0x) (Leica, model: MZ 8 )
DeltaVision Elite Restoration System (GE Healthcare, model: DeltaVision Elite High Resolution Microscope ) and the DeltaVision imaging system user’s manual
Fisher Vortex Genie 2 (Fisher Scientific, catalog number: 12-812 )
Eppendorf 5810 R centrifuge (Eppendorf, model: 5810 R )
VWR rocking platform shakers basic (VWR)
Ptc-100 Programmable Thermal Controller 96 Well (Bio-Rad Laboratories, model: Ptc-100® Programmable Thermal Controller )
Centrifuge (Sigma Centrifuge, model: Sigma 1-14 )
Software
ImageJ imaging software
SoftWorx software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Amirthagunabalasingam, S., Papaluca, A., Harihar, T. and Ramotar, D. (2017). Imaging the Pharynx to Measure the Uptake of Doxorubicin in Caenorhabditis elegans. Bio-protocol 7(10): e2291. DOI: 10.21769/BioProtoc.2291.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Genotoxicity
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,292 | https://bio-protocol.org/exchange/protocoldetail?id=2292&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of ASC Oligomerization by Western Blotting
Jérôme Lugrin
F Fabio Martinon
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2292 Views: 21190
Edited by: Andrea Puhar
Reviewed by: Saskia F. ErttmannMeenal Sinha
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
The apoptosis-associated speck-like protein with a caspase-recruitment domain (ASC) adaptor protein bridges inflammasome sensors and caspase-1. Upon inflammasome activation, ASC nucleates in a prion-like manner into a large and single platform responsible for the recruitment and the activation of caspase-1. Active caspase-1 will in turn promote the proteolytic maturation of the pro-inflammatory cytokine IL-1β. ASC oligomerization is direct evidence for inflammasome activation and its detection allows a read-out independent of caspase-1 and IL-1β. This protocol describes how to detect the oligomerization of ASC by Western blot.
Keywords: Inflammasome Caspase-1 Pyroptosis Biochemistry Auto-inflammation
Background
Inflammasomes are large multiprotein platforms that sense a variety of microbial, endogenous and environmental stressors leading to the maturation of the pro-inflammatory IL-1 family of cytokines (Martinon et al., 2002; Sharma and Kanneganti, 2016). Upon activation, inflammasome sensors recruit the adaptor protein ASC through pyrin domain (PYD)-PYD homotypic interactions. ASC will in turn bind to caspase-1 via caspase activation and recruitment domain (CARD)-CARD interactions and favor auto-proteolytic cleavage of caspase-1, leading to maturation of IL-1β and IL-18 (Hoss et al., 2016). Inflammasome activation triggers supramolecular oligomerization of ASC dimers into large interweaving fibrils also termed ‘ASC-specks’ or ‘pyroptosome’ (Fernandes-Alnemri et al., 2007). ASC-speck/pyroptosomes is a hallmark of inflammasome activation that correlates with caspase-1 cleavage and release of mature IL-1β (Dick et al., 2016). Recently we showed that Nelfinavir, an HIV-protease inhibitor, promotes the release of self-DNA into the cytosol, activates the DNA sensing inflammasome AIM2 and subsequent ASC oligomerization (Di Micco et al., 2016). This protocol aims at detecting endogenous ASC oligomerization in immortalized bone marrow-derived macrophages (iBMDMs) by Western blot analysis. It is adapted from the publication of Fernandes-Alnemri et al. (2007) that used this technique to detect ASC oligomerization in THP-1 cells.
Materials and Reagents
6 well culture dishes (TPP, catalog number: 92406 )
Syringe 1 ml (BD, catalog number: 300013 )
21 gauge needle (B. Braun Melsungen, Sterican®, catalog number: 4657527 )
1.5 ml Eppendorf tubes (Corning, Axygen®, catalog number: MCT-150-C-S )
200 μl pipette tips (STARLAB INTERNATIONAL, TipOne, catalog number: S1111-1000 )
1,000 μl pipette tips (STARLAB INTERNATIONAL, TipOne, catalog number: S1111-6001 )
Cell scrapers (Corning, Falcon®, catalog number: 352340 )
Nitrocellulose blotting membrane (Amersham) (GE Healthcare, catalog number: 10600003 )
Immortalized Murine Bone-Marrow-Derived Macrophages (iBMDMs), obtained from Professor Petr Broz, Biozentrum, University of Basel, Switzerland
Opti-MEM (Thermo Fisher Scientific, GibcoTM, catalog number: 31985070 )
Nigericin sodium salt resuspended at 5 mg/ml in 100% ethanol (Sigma-Aldrich, catalog number: N7143 )
poly(dA:dT) resuspended at 1 mg/ml (InvivoGen, catalog number: tlrl-patn-1 )
Lipofectamine 2000 (Thermo Fischer Scientific, InvitrogenTM, catalog number: 11668019 )
EDTA (Acros Organics, catalog number: 118432500 )
Disuccinimidyl suberate (DSS) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 21655 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: 41640 )
Rabbit anti-ASC antibody (Santa Cruz Biotechnology, catalog number: sc-22514-R or Martin Oeggerli, Adipogen, catalog number: AG-25B-0006-C100)
Peroxidase-conjugated goat anti-Rabbit IgG (H+L) (Jackson ImmunoResearch, catalog number: 115-035-146 )
Nelfinavir Mesylate 10 mM in DMSO (Axon Medchem, catalog number: AG-1342 )
ECL Western blotting detection reagent (GE Healthcare, catalog number: RPN2106 )
Sodium chloride (NaCl)
Potassium chloride (KCl) (AppliChem, catalog number: A1362 )
Sodium phosphate dibasic (Na2HPO4) (AppliChem, catalog number: 131965.1210 )
Potassium dihydrogen phosphate (KH2PO4) (AppliChem, catalog number: A1042 )
RPMI 1640 (Thermo Fisher Scientific, GibcoTM, catalog number: 681870010 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Penicillin and streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15640055 )
HEPES-KOH (BioConcept, Amimed, catalog number: 5-31F00-H )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
EGTA (Sigma-Aldrich, catalog number: 03777 )
Sucrose (Sigma-Aldrich, catalog number: 84097 )
PMSF (Sigma-Aldrich, catalog number: P7626 )
CHAPS (AppliChem, catalog number: A1099 )
SDS 20% (AppliChem, catalog number: A3942 )
Glycerol (AppliChem, catalog number: A0970 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Acrylamide (Applichem, catalog number: A1672 )
TEMED (AppliChem, catalog number: A1148 )
Ammonium persulfate (APS) (GE Healthcare, catalog number: 17-1311-01 )
Tris base (Biosolve, catalog number: 20092391 )
Ethanol (Fisher Scientific, catalog number: 10437341 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 84422 )
Note: This product has been discontinued.
Tween-20 (Applichem, catalog number: A1389 )
Non-fat dry milk 5% (Migros, Rapilait)
Lipopolysaccharide (LPS) resuspended at 5 mg/ml in endotoxin free water (InvivoGen, catalog number: tlrl-eklps )
1x PBS (see Recipes)
Growth media (see Recipes)
Buffer A (see Recipes)
CHAPS buffer (see Recipes)
4x protein loading buffer (see Recipes)
15% SDS-PAGE (see Recipes)
Stacking gel (see Recipes)
Migration buffer SDS-PAGE (see Recipes)
Transfer buffer (see Recipes)
PBS-Tween (PBS-T) (see Recipes)
Blocking buffer (see Recipes)
Equipment
Pipettes (Gilson, Pipetman Classic)
Pipette aid (INTEGRA Biosciences, model: PIPETBOY acu 2 )
37 °C, 5% CO2 cell culture incubator (Thermo Fischer Scientific, Thermo ScientificTM, model: Series 8000 Direct-Heat CO2 Incubators )
Bench top refrigerated centrifuge for 1.5 ml tubes (LabNet International, model: PrismTM R )
Tissue culture class II laminar flow hood (Gelaire, model: TC48 )
SDS-PAGE Migration System (VWR, Peqlab, model: PerfectBlueTM Dual Gel System Twin ExWS )
Electrotransfer Blotter System (VWR, Peqlab, model: PerfectBlueTM Tank Electro Blotter )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lugrin, J. and Martinon, F. (2017). Detection of ASC Oligomerization by Western Blotting. Bio-protocol 7(10): e2292. DOI: 10.21769/BioProtoc.2292.
Download Citation in RIS Format
Category
Immunology > Host defense > General
Immunology > Inflammatory disorder > Inflammasome
Cell Biology > Cell signaling > Intracellular Signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,293 | https://bio-protocol.org/exchange/protocoldetail?id=2293&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Conjugation Assay for Testing CRISPR-Cas Anti-plasmid Immunity in Staphylococci
FW Forrest C. Walker
Asma Hatoum-Aslan
Published: Vol 7, Iss 9, May 5, 2017
DOI: 10.21769/BioProtoc.2293 Views: 11654
Edited by: Daan C. Swarts
Reviewed by: Lionel SchiavolinBenoit Chassaing
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
CRISPR-Cas is a prokaryotic adaptive immune system that prevents uptake of mobile genetic elements such as bacteriophages and plasmids. Plasmid transfer between bacteria is of particular clinical concern due to increasing amounts of antibiotic resistant pathogens found in humans as a result of transfer of resistance plasmids within and between species. Testing the ability of CRISPR-Cas systems to block plasmid transfer in various conditions or with CRISPR-Cas mutants provides key insights into the functionality and mechanisms of CRISPR-Cas as well as how antibiotic resistance spreads within bacterial communities. Here, we describe a method for quantifying the impact of CRISPR-Cas on the efficiency of plasmid transfer by conjugation. While this method is presented in Staphylococcus species, it could be more broadly used for any conjugative prokaryote.
Keywords: Conjugation CRISPR-Cas Plasmids Staphylococcus Antibiotic resistance Horizontal gene transfer
Background
CRISPR-Cas (Clustered, regularly interspaced, short palindromic repeats-CRISPR associated) is a prokaryotic adaptive immune system found in almost 90% of sequenced archaea and about 40% of bacteria (Makarova et al., 2015). These systems recognize and destroy nucleic acid invaders in a sequence-specific manner (van der Oost et al., 2014). A CRISPR locus typically contains an array of short DNA repeats (~35 nucleotides in length) separated by equally-short unique sequences called spacers, which are often derived from mobile genetic elements. The repeats and spacers are transcribed and processed into small CRISPR RNAs (crRNAs) that each specifies a single target. crRNAs assemble with one or more Cas proteins to form an effector complex that recognizes and degrades nucleic acids that bear a sequence, called a protospacer, complementary to the crRNA. Depending on the CRISPR-Cas type present in an organism, other limitations exist on target recognition, such as the presence of a short protospacer-adjacent motif (PAM) required for targeting by Type I and II systems (Mojica et al., 2009) or the requirement in Type III systems for specific base-pair mismatches between the crRNA and the target (Marraffini and Sontheimer, 2010). Nucleic acid invaders targeted by CRISPR-Cas are typically bacteriophages or mobile genetic elements such as plasmids or transposons that often carry virulence factors, including antibiotic resistance genes and toxins (Novick, 2003; Liu et al., 2016). CRISPR-Cas is thus a potential major barrier to the spread of virulence factors within prokaryotes and has been shown to prevent conjugative transfer of antibiotic resistance plasmids within human clinical isolates of Staphylococcus species (Marraffini and Sontheimer, 2008). Some staphylococci, including human pathogenic isolates of S. epidermidis and S. aureus, the two Staphylococcus species most commonly found in human infections, carry CRISPR-Cas systems (Cao et al., 2016; Li et al., 2016). Within these strains, multiple CRISPR spacers have been found that naturally bear homology to mobile staphylococcal plasmids, indicating that these organisms are capable of using CRISPR-Cas to limit the spread of virulence factors (Samai et al., 2015; Li et al., 2016). Investigations of the effect of mutations within the cas genes and the repeat-spacer array in Staphylococcus on anti-plasmid immunity have provided key insights into the function and mechanisms of Type III-A CRISPR-Cas in S. epidermidis RP62a (Hatoum-Aslan et al., 2011 and 2014; Maniv et al., 2016). Notably, similar assays have been used for mechanistic CRISPR-Cas studies in other organisms, including Enterococcus faecalis, Escherichia coli, and Listeria monocytogenes (Richter et al., 2014; Sesto et al., 2014; Price et al., 2016). Other methods of quantifying CRISPR anti-plasmid immunity, namely transformation via electroporation, have been used (Cao et al., 2016); however, this method cannot be used in non-competent or weakly/selectively competent organisms such as L. monocytogenes and many strains of Staphylococcus (Monk et al., 2012; Sesto et al., 2014). In these organisms, conjugation assays provide not only a viable alternative, but also a more physiologically relevant means of testing CRISPR-Cas anti-plasmid immunity. Described below is a quantitative method to determine the efficacy of CRISPR-mediated interference of the transfer of conjugative plasmid pG0400 between S. aureus and S. epidermidis. While this protocol focuses on staphylococci, it could be adapted for any prokaryotes capable of conjugation.
Materials and Reagents
15 ml centrifuge tubes (VWR, catalog number: 21008-216 )
1.7 ml microcentrifuge tubes (VWR, catalog number: 87003-294 )
0.45 μm membrane filters, 25 mm (EMD Millipore, catalog number: HAWP02500 )
50 ml centrifuge tubes (VWR, catalog number: 21008-242 )
Pipette tips with filter, 100-1,000 μl (VWR, catalog number: 89003-060 )
Pipette tips with filter, 1-200 μl (VWR, catalog number: 89003-056 )
Pipette tips with filter, 1-40 μl (VWR, catalog number: 89003-048 )
100 x 15 mm Petri dishes (VWR, catalog number: 25384-088 )
0.2 ml PCR strip tubes (VWR, catalog number: 20170-004 )
1 mm path length cuvettes (VWR, catalog number: 97000-586 )
Recipient S. epidermidis RP62a (Christensen et al., 1985), bearing a CRISPR-Cas system (see Note 1) (ATCC, catalog number: 35984 )
Donor S. aureus RN4220 (Kreiswirth et al., 1983), bearing the conjugative plasmid pG0400 (Morton et al., 1995) (see Note 2) (ATCC, BEI Resources, catalog number: NR-45913 )
Negative control S. epidermidis LAM104 (Marraffini and Sontheimer, 2008), lacking the CRISPR repeat-spacer array (see Note 3)
Mupirocin (The United States Pharmacopeial Convention, catalog number: 1448901 )
Brain-heart infusion broth (BD, BBL, catalog number: 211060 )
Brain-heart infusion agar (BD, Difco, catalog number: 241830 )
Tryptic soy broth (BD, BactoTM, catalog number: 211822 )
Neomycin sulfate (AMRESCO, catalog number: 0558-25G )
Brain-heart infusion broth (see Recipes)
Brain-heart infusion agar (see Recipes)
Tryptic soy broth (see Recipes)
Equipment
Micropipettes set (Eppendorf, model: Research® Plus )
37 °C incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: HerathermTM Advanced Protocol Microbiological Incubators )
37 °C incubated shaker capable of 160 rpm (Eppendorf, model: I26 )
Autoclave (Getinge)
Spectrophotometer (GE Healthcare, model: UltroSpec 10 )
Microcentrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM PicoTM 17 )
Digital vortex mixer (VWR, model: Advanced Heavy-Duty Vortex Mixer )
Inoculating wire loop
Forceps
Magnetic stir plate
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Walker, F. C. and Hatoum-Aslan, A. (2017). Conjugation Assay for Testing CRISPR-Cas Anti-plasmid Immunity in Staphylococci. Bio-protocol 7(9): e2293. DOI: 10.21769/BioProtoc.2293.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Transformation
Microbiology > Microbial biochemistry > DNA
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,294 | https://bio-protocol.org/exchange/protocoldetail?id=2294&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Cultivation of Primary Brain Endothelial Cells from Adult Mice
JA Julian Christopher Assmann
KM Kristin Müller
JW Jan Wenzel
Thomas Walther
JB Josefine Brands
PT Peter Thornton
SA Stuart M. Allan
MS Markus Schwaninger
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2294 Views: 13730
Edited by: Oneil G. Bhalala
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
Brain endothelial cells are the major building block of the blood-brain barrier. To study the role of brain endothelial cells in vitro, the isolation of primary cells is of critical value. Here, we describe a protocol in which vessel fragments are isolated from adult mice. After density centrifugation and mild digestion of the fragments, outgrowing endothelial cells are selected by puromycin treatment and grown to confluence within one week.
Keywords: Primary culture Blood-brain barrier Tight junctions CD31 Occludin Claudin-5 ZO-1 VE-cadherin
Background
The blood-brain barrier protects the brain from uncontrolled entry of cells and substances. This is mainly achieved by brain endothelial cells that form a barrier composed of tight and adherens junctions to restrict paracellular transport.
This protocol was developed to overcome the limited availability of mouse brain endothelial cell lines that maintain their key characteristics, e.g., the expression of sufficient amounts of tight junction proteins such as occludin, ZO-1 or claudin-5 to induce a high transendothelial resistance.
In addition, the isolation of brain endothelial cells from genetically modified mice allows investigating of gene-specific functions in vitro.
Using this method, we previously complemented in vivo studies demonstrating the importance of NF-κB signaling in brain endothelial cells for maintaining normal blood-brain barrier function (Ridder et al., 2015).
Materials and Reagents
Materials
Multiwell plate (cell culture grade) (Greiner Bio One International, catalog number: 662160 )
Cellulose chromatography paper (sterilize at 180 °C) (Whatman, catalog number: 3030-931 )
50 ml centrifuge tubes (cell culture grade) (Greiner Bio One International, catalog number: 210261 )
10 ml disposable pipette (Greiner Bio One International, catalog number: 607160 )
Mice (C57BL/6, age 6 weeks up to 1 year from Charles River, Germany or the in-house breeding facility)
Ice
Reagents
Reagents
Manufacturer
Brand
Catalog number
Preparation
Aliquots
Storage
Stock concentration
Working concentration
Dilution
1
Hydrochloric acid (HCl) 1 N (sterile filtered)
Carl Roth
K025.1
1 L
RT
0.05 N
1 ml HCl 1 N + 19 ml H2O, sterile
2
Dulbecco’s PBS (DPBS)
Biowest
L0615-500
500 ml
4 °C
1x
1x
undiluted
3
70% EtOH (denatured)
Th. Geyer
2270
RT
4
Isoflurane
Baxter
KDG9623
RT
5
Collagenase/dispase
(sterile filtered)
Roche Diagnostics
11097113001
500 mg/5 ml H2O, sterile
200 µl
-20 °C
100 mg/ml
1 mg/ml
100 µl collagenase/dispase in 10 ml medium
6
DNase I
Roche Diagnostics
11284932001
100 mg/10 ml H2O, sterile
100 µl
-20 °C
10 mg/ml
4 µg/ml
40 µl DNase I in 10 ml medium
7
Nα-Tosyl-L-lysine chloromethyl ketone hydrochloride (TLCK)
Sigma-Aldrich
90182
14.7 mg/10 ml H2O, sterile
200 µl
-20°C
1.47 mg/ml diluted to 14.7 µg/ml
0.147 µg/ml
100 µl TLCK in 10 ml medium
8
Puromycin
Sigma-Aldrich
P8833
2.5 mg/10 ml H2O, sterile
500µl
-20°C
0.25 mg/ml
8 µg/ml
32 µl puromycin in 1 ml medium
9
Trypsin-EDTA 0.25%
Thermo Fisher Scientific
GibcoTM
25200-056
100 ml
-20°C
1x
1x
undiluted
10
4% paraformaldehyde
Merck Millipore
1040051000
4% paraformaldehyde in DPBS
-20°C
11
CD31
BD
BD Pharmingen
557355
1:500
12
α-smooth muscle Actin (α-SMA)
Acris Antibodies
DM001-05
13
Iba1
Wako Pure Chemical Industries
019-19741
14
Glial Fibrillary Acidic Protein (GFAP)
EMD Millipore
AB5541
15
Zona occludens-1
(ZO-1)
Thermo Fisher Scientific
Invitrogen
40-2200
16
VE-Cadherin
Santa Cruz Biotechnology
sc-6458
17
Claudin-5 (Cldn-5)
Thermo Fisher Scientific
Invitrogen
34-1600
18
Occludin (Ocln)
Sigma-Aldrich
SAB3500301
19
Mouse collagen, type IV
Corning
354233
890 mg/ml 0.05 N HCl
100 µl
-80 °C
890 mg/ml
50 µg/ml
56 µl collagen IV + 944 µl 0.05 N HCl
20
Dextran MW 60,000-90,000
Alfa Aesar
J14495
1 kg
RT
18%
5.4 g dextran in 30 ml DPBS
21
Penicillin/streptomycin (100x)
Biochrom
A2212
100 ml
1 ml
-20 °C
100x
1x
100 µl pen/strep in 10 ml medium/dextran
22
L-glutamine
Thermo Fisher Scientific
GibcoTM
25030024
100 ml
1 ml
-20 °C
200 mM (100x)
2 mM (1x)
100 µl L-glutamine in 10 ml medium
23
DMEM-F12 w/o glutamine
Thermo Fisher Scientific
GibcoTM
21331020
500 ml
4 °C
1x
1x
undiluted
24
DMEM w/o glucose
Thermo Fisher Scientific
GibcoTM
11966025
500 ml
4 °C
1x
1x
undiluted
25
Plasma-derived bovine serum (PDS)
First Link
60-00-810
500 ml
10 ml
-20 °C
100%
20%
10 ml PDS in 50 ml medium
26
Antibiotic/antimycotic (100x)
Thermo Fisher Scientific
GibcoTM
15240062
100 ml
1 ml
-20 °C
100x
1x
100 µl AA in 10 ml medium/dextran
27
Heparin-sodium
Ratiopharm
PZN 003029843
1 ampule
4 °C
5,000 I.E./ml
750 I.E./50 ml
150 µl heparin in 50 ml medium
28
Endothelial Cell Growth Supplement (ECGS)
Sigma-Aldrich
E2759
15 mg/5 ml DPBS
500 µl
-20 °C
3 mg/ml
30 µg/ml
500 µl ECGS in 50 ml medium
29
18% dextran solution (see Recipes)
30
Working medium (see Recipes)
31
Digestion medium (see Recipes)
32
Full medium (see Recipes)
Note: Mouse collagen, type IV: Defrost stock vial slowly on ice at 4 °C overnight. Vortex thoroughly. Aliquot and store at -80 °C. The collagen concentration varies from lot to lot. Therefore, the amount of HCl added has to be adjusted for every new lot.
Equipment
Refrigerator (4 °C)
Shaker
Sterile beakers 100-150 ml (sterilize at 180 °C)
Laminar flow work bench
Dounce tissue grinder, 15 ml, autoclave (Sigma-Aldrich, catalog number: D9938 )
Scalpel
Tweezers (sterilize at 180 °C)
Centrifuge (Hettich Lab Technology, model: UNIVERSAL 320 R ),
Fixed-angle rotor (Hettich Lab Technology, catalog number: 1620A )
Big scissors (sterilize at 180 °C)
Small scissors (sterilize at 180 °C)
Pipette or vacuum pump
Water bath
Microwave oven
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Assmann, J. C., Müller, K., Wenzel, J., Walther, T., Brands, J., Thornton, P., Allan, S. M. and Schwaninger, M. (2017). Isolation and Cultivation of Primary Brain Endothelial Cells from Adult Mice. Bio-protocol 7(10): e2294. DOI: 10.21769/BioProtoc.2294.
Khan, M. A., Schultz, S., Othman, A., Fleming, T., Lebron-Galan, R., Rades, D., Clemente, D., Nawroth, P. P. and Schwaninger, M. (2016). Hyperglycemia in Stroke Impairs Polarization of Monocytes/Macrophages to a Protective Noninflammatory Cell Type. J Neurosci 36(36): 9313-9325.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,295 | https://bio-protocol.org/exchange/protocoldetail?id=2295&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phos-tag Immunoblot Analysis for Detecting IRF5 Phosphorylation
GS Go R. Sato
TB Tatsuma Ban
TT Tomohiko Tamura
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2295 Views: 13959
Edited by: Alka Mehra
Reviewed by: Fabienne C. FieselShahzada Khan
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
While the activation of the transcription factor interferon regulatory factor 5 (IRF5) is critical for the induction of innate immune responses, it also contributes to the pathogenesis of the autoimmune disease systemic lupus erythematosus (SLE). IRF5 phosphorylation is a hallmark of its activation in the Toll-like receptor (TLR) pathway, where active IRF5 induces type I interferon and proinflammatory cytokine genes. By using the phosphate-binding molecule Phos-tag, without either radioisotopes or phospho-specific antibodies, the protocol described here enables detection of the phosphorylation of both human and murine IRF5, as well as that of other proteins.
Keywords: IRF5 Phosphorylation Innate immunity TLR SLE Phos-tag Immunoblot SDS-PAGE
Background
In the TLR-MyD88 pathway, IRF5 is activated through post-translational modifications such as ubiquitination and phosphorylation, and then active IRF5 translocates into the nucleus and induces its target genes (Takaoka et al., 2005; Balkhi et al., 2008; Tamura et al., 2008; Hayden and Ghosh, 2014). Regarding the activation status of IRF5 in SLE, it has been reported that IRF5 accumulates in the nucleus in monocytes of SLE patients (Stone et al., 2012). Furthermore, we recently showed in an SLE murine model that IRF5 hyperactivation (e.g., elevated phosphorylation) leads to the development of an SLE-like disease (Ban et al., 2016). Therefore, analyzing the activation status of IRF5 is important for studying SLE as well as innate immune responses. Phosphorylation is central to the activation of IRF5, as numerous studies have revealed the functional phosphorylation sites of IRF5 by site-directed mutagenesis and/or mass spectrometry (Barnes et al., 2002; Lin et al., 2005; Chen et al., 2008; Chang Foreman et al., 2012; Lopez-Pelaez et al., 2014; Ren et al., 2014). However, antibodies specific for these phosphorylation sites are not commercially available. In addition, phosphorylated IRF5 is normally not separated from non-phosphorylated IRF5 using standard SDS-PAGE. We thus utilized the functional molecule Phos-tag, which binds specifically to the phosphate group via metal ions (Kinoshita et al., 2006). Without using radioisotopes or phospho-specific antibodies, this protocol enables the detection of multiple phosphorylations of the IRF5 protein as up-shifted bands in the resulting immunoblot analysis (Figure 1). This protocol can be applied for detecting the phosphorylation of other proteins if a specific antibody for the total protein of the target protein is available.
Figure 1. Schematic of Phos-tag immunoblot analysis. Phos-tag binds specifically to a phosphate group on the target protein via metal ions, such as Zn2+ or Mn2+. Non-phosphorylated and phosphorylated forms of the target protein (IRF5 in this figure) are separated by SDS-PAGE using acrylamide conjugated with Phos-tag, and then detected by immunoblot analysis using an appropriate specific antibody. The mobility shift of the phosphorylated protein is caused by trapping of its phosphate groups by the polyacrylamide gel-conjugated Phos-tag. Thus, multiple phosphorylations of IRF5 appear as different up-shifted bands, whose mobility shift increases with the phosphorylation level of each IRF5 molecule.
Materials and Reagents
Tips (BM Equipment, catalog numbers: BMT-10G and BMT-200 ; Corning, catalog number: 4846 )
Disposable pipette (Greiner Bio One International, catalog numbers: 606160 and 607160 )
Microcentrifuge tube (Greiner Bio One International, catalog number: 616201 )
Filter paper (GE Healthcare, catalog number: 3030-6461 )
Polyvinylidene fluoride (PVDF) membrane (EMD Millipore, catalog number: IPVH00010 )
Bio-Rad Protein Assay (Bio-Rad Laboratories, catalog number: 5000006 )
Bovine serum albumin (BSA) (Wako Pure Chemical Industries, catalog number: 017-23294 )
Lambda protein phosphatase (λPPase) (New England Biolabs, catalog number: P0753 )
Calf intestinal alkaline phosphatase (CIAP) (Takara Bio, catalog number: 2250 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (Wako Pure Chemical Industries, catalog number: 136-15301 )
Bromophenol blue (BPB) (Wako Pure Chemical Industries, catalog number: 029-02912 )
Marker III (Wako Pure Chemical Industries, catalog number: 230-02461 )
Anti-IRF5 antibody (Abcam, catalog number: ab21689 )
MaxBlot solution 1 (MEDICAL & BIOLOGICAL LABORATORIES, catalog number: 8455-100 )
Horseradish peroxidase-conjugated anti-rabbit IgG antibody (GE Healthcare, catalog number: NA934 )
ECL Prime (GE Healthcare, catalog number: RPN2236 )
Immunostar® LD (Wako Pure Chemical Industries, catalog number: 292-69903 )
Sodium chloride (NaCl) (Wako Pure Chemical Industries, catalog number: 191-01665 )
Na2HPO4·12H2O (Wako Pure Chemical Industries, catalog number: 196-02835 )
Potassium chloride (KCl) (Wako Pure Chemical Industries, catalog number: 163-03545 )
Potassium dihydrogen phosphate (KH2PO4) (Wako Pure Chemical Industries, catalog number: 169-04245 )
NP-40 (Nacalai Tesque, catalog number: 25223-75 )
Sodium deoxycholate (Nacalai Tesque, catalog number: 10712-12 )
SDS (Nacalai Tesque, catalog number: 08933-05 )
cOmplete protease inhibitor cocktail tablets (Roche Diagnostics, catalog number: 11836170001 )
PhosSTOP phosphatase inhibitor cocktail tablets (Roche Diagnostics, catalog number: 04906837001 )
Glycerol (Nacalai Tesque, catalog number: 17018-25 )
2-mercaptoethanol (Wako Pure Chemical Industries, catalog number: 131-14572 )
Tween 20 (Nacalai Tesque, catalog number: 28353-85 )
Skim milk (Morinaga Milk Industry)
Acrylamide (Nacalai Tesque, catalog number: 00809-85 )
N,N’-methylenebisacrylamide (bis) (Wako Pure Chemical Industries, catalog number: 138-06032 )
Phos-tag acrylamide (Wako Pure Chemical Industries, catalog number: AAL-107 )
APS (Wako Pure Chemical Industries, catalog number: 016-08021 )
TEMED (Wako Pure Chemical Industries, catalog number: 205-06313 )
Glycine (Nacalai Tesque, catalog number: 17109-35 )
Tris (Nacalai Tesque, catalog number: 35406-91 )
MOPS (Dojindo, catalog number: 343-01805 )
Sodium bisulfite (Nacalai Tesque, catalog number: 31219-55 )
Methanol (Wako Pure Chemical Industries, catalog number: 139-01827 )
EDTA.2Na (Dojindo, catalog number: 345-01865 )
7.5% Phos-tag precast gel (Wako Pure Chemical Industries, catalog number: 192-17381 )
Phosphate-buffered saline (PBS, 1x) (see Recipes)
EDTA-free lysis buffer (see Recipes)
1% NP-40 TBS buffer (see Recipes)
6x sample buffer (see Recipes)
Tris-buffered saline containing Tween 20 (TBS-T) (see Recipes)
Blocking solution (see Recipes)
Handmade Phos-tag acrylamide gel (see Recipes)
Separating (lower) gel
Stacking (upper) gel
Tris-glycine running buffer (see Recipes)
Tris-MOPS running buffer (see Recipes)
Transfer buffer (see Recipes)
Equipment
Refrigerated mini-centrifuge (TOMY SEIKO, model: KITMAN-24 )
Microplate reader with 595 nm wavelength available (Tecan, model: F039300REMOTER )
Heat block (Major Science, model: MD-02N )
Power supply (Bio-Rad Laboratories, catalog number: 1645070 )
Gel tank (NIHON EIDO, model: NA-1012 )
Horizontal shaker (YAMATO SCIENTIFIC, model: MK200D )
Semi-dry blotter (NIHON EIDO, model: NA-1512 )
Blotting roller (Bio-Rad Laboratories, catalog number: 1651279 )
Luminescent image analyzer (GE Healthcare, model: ImageQuant LAS 4000 mini )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sato, G. R., Ban, T. and Tamura, T. (2017). Phos-tag Immunoblot Analysis for Detecting IRF5 Phosphorylation. Bio-protocol 7(10): e2295. DOI: 10.21769/BioProtoc.2295.
Download Citation in RIS Format
Category
Cell Biology > Cell signaling > Phosphorylation
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,296 | https://bio-protocol.org/exchange/protocoldetail?id=2296&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Spore Preparation Protocol for Enrichment of Clostridia from Murine Intestine
EV Eric M. Velazquez
FR Fabian Rivera-Chávez
AB Andreas J. Bäumler
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2296 Views: 7204
Edited by: Andrea Puhar
Reviewed by: Ana Santos AlmeidaEmilie Viennois
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
In recent years, many spore-forming commensal Clostridia found in the gut have been discovered to promote host physiology, immune development, and protection against infections. We provide a detailed protocol for rapid enrichment of spore-forming bacteria from murine intestine. Briefly, contents from the intestinal cecum are collected aerobically, diluted and finally treated with chloroform to enrich for Clostridia spores.
Keywords: Spores Clostridia Bacteria Mammalian Murine Intestine Colonization resistance
Background
Chloroform kills vegetative bacterial cells but not spores and thus is a useful treatment for enriching Clostridia, the dominant spore-forming group in the mammalian intestine. Experimental procedures for chloroform treatment of mouse feces exist (Momose et al., 2009; Yano et al., 2015). However, they utilize specialized equipment including an anaerobic chamber. We realized that several brief exposures to oxygen occur during experimental manipulation of intestinal contents in preparation for and after chloroform treatment. Therefore, we reasoned the sufficient recover of murine spore-forming bacteria could be obtained without the use of an anaerobic chamber. Since spore-forming Clostridia are a dominant species in the mammalian intestine, this protocol could potentially be used for isolation of spores from the intestines of other mammalian organisms, including larger rodents, primates, and humans.
Materials and Reagents
Sterile 1.5 ml microcentrifuge tubes (Eppendorf, catalog number: 022363204 )
15 ml tubes
Female (male mice may be used if necessary) C57BL/6 mice aged 8-12 weeks (THE JACKSON LABORATORIES)
Compressed CO2 gas in cylinder (AirGas)
Chloroform (Sigma-Aldrich, catalog number: 288306 )
Sterile PBS pH 7.4 (Reference 2)
Equipment
Sterile necropsy instruments (operating scissors, tweezers and forceps) to avoid contamination
Shaker with 200 rpm capacity and 37 °C setting (or inside 37 °C room)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Velazquez, E. M., Rivera-Chávez, F. and Bäumler, A. J. (2017). Spore Preparation Protocol for Enrichment of Clostridia from Murine Intestine. Bio-protocol 7(10): e2296. DOI: 10.21769/BioProtoc.2296.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Biochemistry > Other compound > Spore
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,297 | https://bio-protocol.org/exchange/protocoldetail?id=2297&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Plasma Membrane Preparation from Lilium davidii and Oryza sativa Mature and Germinated Pollen
Ning Yang
Bing Han
Lingtong Liu
Hao Yang
Tai Wang
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2297 Views: 7932
Edited by: Samik Bhattacharya
Reviewed by: Cindy Ast
Original Research Article:
The authors used this protocol in Dec 2010
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2010
Abstract
Pollen germination is an excellent process to study cell polarity establishment. During this process, the tip-growing pollen tube will start elongating. The plasma membrane as the selectively permeable barrier that separates the inner and outer cell environment plays crucial roles in this process. This protocol described an efficient aqueous polymer two-phase system followed by alkaline solution washing to prepare Lilium davidii or Oryza sativa plasma membrane with high purity.
Keywords: Mature pollen grains Germinated pollen grains Plasma membran Aqueous polymer two-phase system Alkaline solution
Background
Pollen plasma membrane contains various proteins that are vital for pollen tube growth and fertilization, such as receptor-like kinases (Wang et al., 2016) and ion channels (Hamilton et al., 2015). Isolating pure plasma membrane (PM) is the premise for the comprehensive PM proteome analysis. There are mainly four methods for PM preparation: differential centrifugation, density gradient centrifugation, preparative free-flow electrophoresis and the aqueous polymer two-phase system. Normally, differential centrifugation is often combined with density gradient centrifugation together to separate the subcellular components according to their size, shape and density. This technique is rapid, but due to the organelle density’s overlap, the resultant PM yield and purity are low (Schindler and Nothwang, 2006). Both free-flow electrophoresis and the aqueous polymer two-phase system separate membrane vesicles according to their surface properties. These two methods can enrich PM pure enough for proteomic analysis (Alexandersson et al., 2007). However, the instrument for the free-flow electrophoresis is complicated to operate (Sandelius et al., 1986). On the contrast, the aqueous polymer two-phase system can be performed easily and rapidly with centrifugation, making this method more convenient for PM preparation. PM enriched by the aqueous polymer two-phase system present in the form of vesicles which contain some cytoplasm contaminations (Alexandersson et al., 2008). Treatment with alkaline solution (100 mM Na2CO3, pH 11.5) can open these vesicles into sheets to release the contaminations (Fujiki et al., 1982).
Materials and Reagents
1,000 μl pipette tips (Corning, Axygen®, catalog number: T-1000-B )
20 x 10 cm envelope
50 ml tube (Corning, catalog number: 430829 )
60 x 15 mm Petri dish (Corning, catalog number: 430196 )
150 x 25 mm Petri dish (Corning, catalog number: 430599 )
Gauze
10 ml tube (Biosharp, catalog number: BS-100-M )
100 μm cell strainer (Corning, Falcon®, catalog number: 352360 )
2 ml microtube (SARSTEDT, catalog number: 72.694.005 )
4 ml ultracentrifuge tube (Beckman Coulter, catalog number: 355603 )
26.3 ml ultracentrifuge tube (Beckman Coulter, catalog number: 355654 )
Lily mature pollen grains harvest according to Han et al. (2010)
Rice mature pollen grains harvest according to Dai et al. (2007)
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: B9645 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C2661 )
Note: This product has been discontinued.
Sucrose (Sigma-Aldrich, catalog number: S7903 )
Calcium nitrate tetrahydrate, Ca(NO3)2·4H2O (Sigma-Aldrich, catalog number: C1396 )
Thiamine hydrochloride (VB1) (Sigma-Aldrich, catalog number: T4625 )
Poly (ethylene glycol), average Mn 4,000 (PEG 4000) (Sigma-Aldrich, catalog number: 81240 )
3-(N-Morpholino)propanesulfonic acid (MOPS) (Sigma-Aldrich, catalog number: M1254 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
DL-Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
cOmplete, EDTA-free protease inhibitor cocktail tablets (Roche Diagnostics, catalog number: 04693132001 )
L-ascorbic acid (VC) (Sigma-Aldrich, catalog number: A7506 )
Poly (vinylpolypyrrolidone) (PVPP) (Sigma-Aldrich, catalog number: 77627 )
Potassium phosphate tribasic (K3PO4) (Sigma-Aldrich, catalog number: P5629 )
Polyethylene glycol, average mol wt 3,350 (PEG 3350) (Sigma-Aldrich, catalog number: P4338 )
Dextran T-500 (Pharmacia, catalog number: 17-0320-01 )
Sodium carbonate (Na2CO3) (Sigma-Aldrich, catalog number: S7795 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A1933 )
Lily pollen germination medium (see Recipes)
Rice pollen germination medium (see Recipes)
Homogenate buffer (see Recipes)
Plasma membrane isolation buffer (see Recipes)
Aqueous polymer two-phase system (see Recipes)
Dilution buffer (see Recipes)
Washing buffer (see Recipes)
Equipment
Pipette (Gilson, model: P1000N )
Vortex
Balance
Centrifuge (Beckman Coulter, model: J2-HS )
Homogenizer (MP Biomedicals, model: FastPrep®-24 )
Ultra-centrifuge (Beckman Coulter, model: OptimalTM L-80XP )
Microscope with 5x and 10x objective (Carl Zeiss, model: Axio Imager 1 )
Software
ZEN lite software (2012, blue edition)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yang, N., Han, B., Liu, L., Yang, H. and Wang, T. (2017). Plasma Membrane Preparation from Lilium davidii and Oryza sativa Mature and Germinated Pollen. Bio-protocol 7(10): e2297. DOI: 10.21769/BioProtoc.2297.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Organelle isolation
Plant Science > Plant cell biology > Cell isolation
Cell Biology > Organelle isolation > Membrane
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,298 | https://bio-protocol.org/exchange/protocoldetail?id=2298&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Isolation from Plasma Membrane, Digestion and Processing for Strong Cation Exchange Fractionation
Ning Yang
Bing Han
Tai Wang
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2298 Views: 10337
Original Research Article:
The authors used this protocol in Dec 2010
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2010
Abstract
Plasma membrane (PM) proteins play crucial roles in diverse biological processes. But their low abundance, alkalinity and hydrophobicity make their isolation a difficult task. This protocol describes an efficient method for PM proteins isolation, digestion and fractionation so that they can be well prepared for mass spectrometry analysis.
Keywords: Plasma membrane proteins RapiGest SF Trypsin Strong cation exchange Fractionation
Background
Plasma membrane (PM) proteins participate in diverse biological processes including signal transduction, ion transport and membrane trafficking, and are the first responders in cell-environment communication. They have a complicated composition varying from species, cell types and developmental stages (Alexandersson et al., 2008). Revealing their components and the expression features comprehensively with mass spectrometry (MS) is of great importance for developmental biology. However, their hydrophobic nature and the low abundance are a big challenge for the proteomic analysis (Wu and Yates, 2003). Additives like normal surfactants, organic solvents and urea are often used to improve PM proteins’ solubility, but they will reduce the proteases’ activities and create ion suppression during MS analysis (Zhang, 2015). RapiGest SF is a novel acid-labile anionic surfactant, which is structurally and functionally similar to SDS but does not inhibit the common endopeptidases activities at low concentration (0.1% w/v). Thus RapiGest SF used in solubilizing PM proteins can not only facilitate their digestion by exposing cleavage sites but is also easily quenched by strong acid and removed through centrifugation so that the surfactant does not affect the MS identification (Yu et al., 2003). Peptides yield by the RapiGest SF-assisted digestion can directly undergo the strong cation exchange (SCX) fractionation (Yang and Wang, 2017), so that the low abundance peptides can be detected by the MS.
Materials and Reagents
1.5 ml tubes (Corning, Axygen®, catalog number: MCT-150-C )
ZipTip® pipette tip (Merck Millipore, catalog number: ZTC18S096 )
PierceTM Spin columns, screw cap (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 69705 )
C18 (FUJIGEL HANBAI, catalog number: MB 100 - 40/75 )
Tris (2-carboxyethyl) phosphine hydrochloride solution, 0.5 M, pH 7.0 (TCEP) (Sigma-Aldrich, catalog number: 646547 )
Formic acid (Sigma-Aldrich, catalog number: 94318 )
Acetonitrile (Sigma-Aldrich, catalog number: 34851 )
RapiGest SF surfactant (WATERS, catalog number: 186001861 )
Iodoacetamide (Sigma-Aldrich, catalog number: I1149 )
Trypsin (Roche Diagnostics, catalog number: 11418025001 )
Potassium phosphate dibasic trihydrate (K2HPO4·3H2O)
Potassium phosphate monobasic (KH2PO4)
Phosphoric acid (H3PO4)
Ammonium chloride (Sigma-Aldrich, catalog number: A9434 )
Hydrochloric acid (HCl)
0.5 M iodoacetamide stock (see Recipes)
0.1 μg/μl trypsin stock (see Recipes)
50 mM potassium phosphate buffer, pH 7.8 (see Recipes)
100 ml solvent A (5 mM NH4Cl, 25% [v/v] acetonitrile, pH 3.0) (see Recipes)
100 ml solvent B (500 mM NH4Cl, 25% [v/v] acetonitrile, pH 3.0) (see Recipes)
Equipment
2 μl, 10 μl, 100 μl, 1,000 μl Pipetman (Gilson, France)
Optimal MAX-XP ultracentrifuge (Beckman Coulter, model: Optimal MAX-XP )
AKTA purifier-10 (GE Healthcare, model: AKTApurifier 10 )
ISS 110 SpeedVac System (Thermo Fisher Scientific, Thermo ScientificTM, model: ISS 110 )
PolySULFOETHYL ATM columns, 2.1 x 200 mm, 5 μm particles, 300 Å poresize (PolyLC, catalog number: 202SE05 )
Software
UNICORN 5.2 software (GE Healthcare, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yang, N., Han, B. and Wang, T. (2017). Protein Isolation from Plasma Membrane, Digestion and Processing for Strong Cation Exchange Fractionation. Bio-protocol 7(10): e2298. DOI: 10.21769/BioProtoc.2298.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,299 | https://bio-protocol.org/exchange/protocoldetail?id=2299&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Endogenous C-terminal Tagging by CRISPR/Cas9 in Trypanosoma cruzi
Noelia Lander*
Miguel A. Chiurillo*
AV Aníbal E. Vercesi
Roberto Docampo
*Contributed equally to this work
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2299 Views: 14237
Edited by: Renate Weizbauer
Reviewed by: Jingyu Peng
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
To achieve the C-terminal tagging of endogenous proteins in T. cruzi we use the Cas9/pTREX-n vector (Lander et al., 2015) to insert a specific tag sequence (3xHA or 3xc-Myc) at the 3’ end of a specific gene of interest (GOI). Chimeric sgRNA targeting the 3’ end of the GOI is PCR-amplified and cloned into Cas9/pTREX-n vector. Then a DNA donor molecule to induce DNA repair by homologous recombination is amplified. This donor sequence contains the tag sequence and a marker for antibiotic resistance, plus 100 bp homology arms corresponding to regions located right upstream of the stop codon and downstream of the Cas9 target site at the GOI locus. Vectors pMOTag23M (Oberholzer et al., 2006) or pMOHX1Tag4H (Lander et al., 2016b) are used as PCR templates for DNA donor amplification. Epimastigotes co-transfected with the sgRNA/Cas9/pTREX-n construct and the DNA donor cassette are then cultured for 5 weeks with antibiotics for selection of double resistant parasites. Endogenous gene tagging is finally verified by PCR and Western blot analysis.
Keywords: CRISPR/Cas9 Endogenous tagging Genome editing Subcellular localization Trypanosoma cruzi
Background
Genetic manipulation of protist parasites has significantly increased since the emergence of the CRISPR/Cas9 technology (Lander et al., 2016a). Trypanosoma cruzi is the causative agent of Chagas disease, which affects millions of people worldwide, particularly in Central and South America where the disease is endemic. Vaccines to prevent this disease have not been developed, and available drug treatments are not completely effective (Urbina and Docampo, 2003). This parasite has been particularly refractory to genetic manipulation (Docampo, 2011). However, the recent use of the CRISPR/Cas9 technology for gene knockout and knockdown (Peng et al., 2014; Lander et al., 2015) and to perform endogenous gene tagging (Lander et al., 2016b) has transformed the approaches for functional study of proteins in this organism. Here we describe a protocol to generate CRISPR/Cas9-mediated endogenous gene tagging in T. cruzi, leading to the expression of specific C-terminal tagged proteins in this parasite. Tagged proteins can be detected by Western blot analysis and their subcellular localization can be determined by immunofluorescence microscopy. Other potential applications of the technique include immunoprecipitation assays and tandem affinity purification (TAP) to establish protein-protein interactions.
Materials and Reagents
Pipette tips for P10, P20, P200 and P1000 pipettes
Microcentrifuge tubes (1.5 ml)
0.6 ml tube
PCR tubes (0.2 ml)
Petri dishes
T25 culture flasks
Centrifuge tubes (15 ml)
Electroporation cuvettes 0.4 cm gap (Bio-Rad Laboratories, catalog number: 1652081 )
Cas9/pTREX-n vector (Addgene, catalog number: 68708 ) (Lander et al., 2015)
pUC_sgRNA vector (Addgene, catalog number: 68710 ) (Lander et al., 2015)
pMOTag23M vector (Oberholzer et al., 2006)
pMOHX1Tag4H vector (Lander et al., 2016b)
Chemically competent E. coli DH5α cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18265017 ) (storage temperature: -80 °C)
T. cruzi Y strain
Platinum® Taq DNA polymerase high fidelity (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11304011 )
Miniprep kit (Wizard® Plus SV Minipreps DNA Purification System) (Promega, catalog number: A1460 )
DNA extraction kit from agarose gels (Wizard® SV Gel and PCR Clean-Up System) (Promega, catalog number: A9281 )
BamHI (New England Biolabs, catalog number: R0136S ) (storage temperature: -20 °C)
Antarctic Phosphatase (New England Biolabs, catalog number: M0289S ) (storage temperature: -20 °C)
Agarose (Promega, catalog number: V3125 )
1 kb plus ladder
T4 DNA ligase (Promega, catalog number: M1801 ) (storage temperature: -20 °C)
2x rapid ligation buffer (Promega, catalog number: C6711 ) (storage temperature: -20 °C)
LB broth (Sigma-Aldrich, catalog number: L3022 )
LB broth with agar (Sigma-Aldrich, catalog number: L2897 )
Ampicillin sodium salt (Sigma-Aldrich, catalog number: A0166 )
GoTaq G2 Flexi DNA polymerase (Promega, catalog number: M7805 ) (storage temperature: -20 °C)
Ethanol
DNA oligonucleotides, purity desalted (Exxtend Biotecnologia Ltda., Campinas, Brazil)
DNA ultramer oligonucleotides, purity HPLC (Exxtend Biotecnologia Ltda., Campinas, Brazil)
Acetic acid
Phenol/chloroform/isoamyl alcohol (25:24:1)
Heat inactivated fetal bovine serum (FBS) (Vitrocell Embriolife, catalog number: S0011) (storage temperature: -20 °C)
Penicillin (10,000 U/ml)/streptomycin (10 mg/ml) stock solution (Vitrocell Embriolife, Campinas, Brazil) (storage temperature: -20 °C)
Phosphate buffer saline (PBS) pH 7.4
G418 disulfate (KSE Scientific, catalog number: 6483-TB-2G-001-5 )
Puromycin dihydrochloride (Thermo Fisher Scientific, GibcoTM, catalog number: A1113803 )
Hygromycin B (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10687010 )
Anti-HA high affinity rat monoclonal antibody (clone 3F10) (Roche Diagnostics, catalog number: 11867423001 )
Monoclonal anti-α-Tubulin antibody produced in mouse (clone B-5-1-2) (Sigma-Aldrich, catalog number: T5168 )
HA epitope tag monoclonal antibody (clone 2-2.2.14) (Thermo Fisher Scientific, Invitrogen, catalog number: 26183 )
Rabbit anti-HA polyclonal antibody (Y-11) (Santa Cruz Biotechnology, catalog number: sc-805 )
Anti-c-Myc monoclonal antibody (clone 9E10) (Santa Cruz Biotechnology, catalog number: sc-40 )
Rabbit anti-c-Myc polyclonal antibody (N-262) (Santa Cruz Biotechnology, catalog number: sc-764 )
Dimethyl sulfoxide (DMSO)
Sodium hydroxide (NaOH)
Sodium chloride (NaCl)
Potassium chloride (KCl)
Sodium phosphate dibasic (Na2HPO4)
D-(+)-glucose (Sigma-Aldrich, catalog number: G7021 )
Liver infusion broth (BD, Difco, catalog number: 226920 )
TrypticaseTM peptone (BD, BBL, catalog number: 211921 )
Hemin (Sigma-Aldrich, catalog number: H9039 )
Calcium chloride (CaCl2)
Dibasic potassium phosphate (K2HPO4)
HEPES (Sigma-Aldrich, catalog number: H3375 )
Ethylenediaminetetraacetic acid (EDTA)
Tris base
SOC medium (Sigma-Aldrich, catalog number: S1797 )
Sodium acetate
sgRNA amplification PCR reaction mix for 1 reaction (see Recipes)
Colony PCR reaction mix for 1 reaction (see Recipes)
Donor DNA PCR reaction mix for 1 reaction (see Recipes)
Hemin stock solution (see Recipes)
LIT medium (Liver Infusion Tryptose) (see Recipes)
Electroporation buffer (Cytomix), pH 7.6 (see Recipes)
1x TAE (Tris-acetate-EDTA) buffer, pH 8.3 (see Recipes)
Equipment
Pipettes (Gilson, Pipetman®, P10, P20, P200 and P1000)
Incubator with refrigeration (28 °C) (Shel Lab, model: SSI5R )
Incubator with agitation (37 °C) (Gallemkamp, model: IOI400.XX2.C )
Electrophoresis chamber (Bio-Rad Laboratories, model: Mini-Sub® Cell GT Cell )
Image digitalizer (UVITEC, model: Alliance 2.7 )
NanoDrop spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000c )
Microcentrifuge (Eppendorf, model: 5418 )
Refrigerate centrifuge (Eppendorf, model: 5810 R )
Electroporator (Bio-Rad Laboratories, model: Gene Pulser XcellTM Electroporation System )
Neubauer chamber (Sigma-Aldrich, model: Bright-LineTM Hemacytometer, catalog number: Z359629 )
Biological safety cabinet (Labconco, model: Class II A2, Purifier Cell Logic+ )
Autoclave
Software
DNAMAN software version 7.212 (Lynnon Corporation)
Alliance 1D software (UVITEC)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lander, N., Chiurillo, M. A., Vercesi, A. E. and Docampo, R. (2017). Endogenous C-terminal Tagging by CRISPR/Cas9 in Trypanosoma cruzi. Bio-protocol 7(10): e2299. DOI: 10.21769/BioProtoc.2299.
Lander, N., Chiurillo, M. A., Storey, M., Vercesi, A. E. and Docampo, R. (2016b). CRISPR/Cas9-mediated endogenous C-terminal tagging of Trypanosoma cruzi genes reveals the acidocalcisome localization of the inositol 1,4,5-trisphosphate receptor. J Biol Chem 291(49): 25505-25515.
Download Citation in RIS Format
Category
Immunology > Host defense > General
Molecular Biology > DNA > DNA modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
23 | https://bio-protocol.org/exchange/protocoldetail?id=23&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
ChIP Assay for Cell Culture
RC Ran Chen
Published: Jan 20, 2011
DOI: 10.21769/BioProtoc.23 Views: 18258
Download PDF
Ask a question
Favorite
Cited by
Abstract
Chromatin immunoprecipitation (ChIP) is a method used to determine the location of DNA binding sites on the genome for a particular protein of interest. Following crosslinking, cells are lysed and the DNA is broken into pieces 0.2-1.0 kb in length by sonication. At this point immunoprecipitation is performed resulting in the purification of protein–DNA complexes. The identity and quantity of the isolated DNA fragments can then be determined by PCR. This protocol describes how to perform a ChIP experiment and can be applied to different types of cell culture.
Keywords: ChIP Immunoprecipitation DNA
Materials and Reagents
Salmon Sperm DNA (Life Technologies, InvitrogenTM, catalog number: AM9680 )
Protein inhibitors
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: 78830-5G )
Aprotinin (Sigma-Aldrich, catalog number: A3428-10MG )
Pepstatin A (Sigma-Aldrich, catalog number: P5318-5MG )
Formaldehyde (Thermo Fisher Scientific, catalog number: F75F-1GAL )
Protein A agarose beads (Upstate, Millipore, catalog number: 16-157 )
General chemicals (Sigma-Aldrich)
DPBS (Life Technologies, InvitrogenTM, catalog number: 14190-250 )
QIAGEN PCR purification kit (QIAGEN, catalog number: 28104 )
ChIP lysis buffer (see Recipes)
Low salt wash buffer (see Recipes)
High salt wash buffer (see Recipes)
LiCl buffer (see Recipes)
TE buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
Standard bench-top refrigerated centrifuge that can reach at least 13,000 rpm
Conical tube
Rotating platform
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > DNA-protein interaction
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
230 | https://bio-protocol.org/exchange/protocoldetail?id=230&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Oil Red O Staining of Fixed Worm
Fanglian He
Published: Jul 5, 2012
DOI: 10.21769/BioProtoc.230 Views: 26246
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Oil red O staining is used to assess major fat stores in C. elegans. This protocol is adapted from the Ashrafi Lab at the University of California-San Francisco.
Keywords: Lipid staining C. elegans Fat stores
Materials and Reagents
20% paraformaldehyde
Na2EGTA
Spermidine 3 HCl (1 g) (Sigma-Aldrich, catalog number: 85578 )
Spermine (5 g) (Sigma-Aldrich, catalog number: 85590 )
Oil Red O (Sigma-Aldrich, catalog number: O0625 )
NaPIPES (pH 7.4)
Beta-ME
Isopropanol
DTT
Tris Base
HCl
PBS
Agarose
NaCl
KCl
Na2HPO4•7H2O
KH2PO4
NaOH
10x PBS buffer (see Recipes)
1 M Tris-Cl (pH 7.4) (see Recipes)
2x MRWB (see Recipes)
Reduction buffer (see Recipes)
Equipment
Eppendorf Thermomixer Shaker (Eppendorf, catalog number: EF4283A )
Dissecting stereo microscope (LEICA MZ12 )
Compound microscope (Nikon ECLIPSE, model: E600 )
Tabletop centrifuge
15 ml conical tube
1.5-ml Eppendorf tube
0.2 µm filter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：He, F. (2012). Oil Red O Staining of Fixed Worm. Bio-101: e230. DOI: 10.21769/BioProtoc.230.
Download Citation in RIS Format
Category
Cell Biology > Cell staining > Lipid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,300 | https://bio-protocol.org/exchange/protocoldetail?id=2300&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Infection of Drosophila Primary Hemocytes
CT Charles Tracy
Helmut Krämer
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2300 Views: 9793
Edited by: Ruth A. Franklin
Reviewed by: Benoit ChassaingRamalingam Bethunaickan
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Phagocytosis of invading pathogens and their subsequent clearance in lysosomes is important for organismal fitness. We have devised the following protocol to extract phagocytic hemocytes from wild-type and mutant Drosophila larvae and infect the isolated hemocytes with GFP-labeled E. coli to measure the rate of phagocytosis and degradation within individual hemocytes over time.
Keywords: Drosophila Hemocytes Infection Phagocytosis Phagosome maturation
Background
The experiment described below can be used to study phagosome biogenesis, maturation, and delivery to lysosomes. Bacterial accumulation has been well studied in the context of immuno-compromised Drosophila with defects in IMD or Toll signaling and the resulting reduced expression of antimicrobial peptides (e.g., Lemaitre and Hoffmann, 2007; Kleino and Silverman, 2014). Cellular responses to bacterial infections have been less investigated in Drosophila, with most studies focused on mutations that interfere with the initial phagocytic uptake of bacteria by hemocytes (Kocks et al., 2005; Parsons and Foley, 2016). Such bacterial uptake is straightforward to measure using FACS analysis (Tirouvanziam et al., 2004). For a detailed analysis of phagosomal maturation, however, we found it advantageous to examine individual hemocytes attached to a glass cover slip (Akbar et al., 2011; Rahman et al., 2012; Akbar et al., 2016) as this procedure offered us the best combination of temporal and spatial resolution for our studies of phagosome maturation.
Materials and Reagents
Falcon tubes (15 ml) (Corning, Falcon®, catalog number: 352196 )
Eppendorf tubes
Cover glass, No 1.5, 22 mm2 (Corning, catalog number: 2850-22 )
Petri dish (100 x 15 mm) (Corning, catalog number: 351029 )
Kimwipe
Micro slides (Corning, catalog number: 2948-75X25 )
Sterile filter unit: 0.22 µm cellulose acetate filter flasks (Corning, catalog number: 430769 )
Drosophila melanogaster wandering third instar larvae (Ashburner, 1989)
E. coli (DH5α) constitutively expressing GFP
peGFP (https://www.addgene.org/vector-database/2485/)
pET-GFP-C11 (http://www.addgene.org/30183/)
Bucket of ice
LB growth media (Fisher Scientific, catalog number: BP1425-500 )
Schneider’s Drosophila medium (Thermo Fisher Scientific, GibcoTM, catalog number: 21720 ) with 10% FBS (Atlanta Biologicals, Advantage, catalog number: S11095 )
S2 cell media
PBSS = 0.3% Saponin (Sigma-Aldrich, catalog number: S7900 ) in PBS
10% NGS
Phalloidin Alexa 594 (Thermo Fisher Scientific, InvitrogenTM, catalog number: A12381 )
Vectashield (Vector Laboratories, catalog number: H-1000 )
Clear nail polish
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium phosphate dibasic heptahydrate (Na2HPO4·7H2O) (Sigma-Aldrich, catalog number: S9390 )
Potassium phosphate monobasic (KH2PO4) (Fisher Scientific, catalog number: P285 )
Hydrochloric acid (HCl)
Sodium hydroxide (NaOH)
Paraformaldehyde (Electron Microscopy Sciences, catalog number: 19208 )
10% normal goat serum (Jackson ImmunoResearch, catalog number: 005-000-121 ) in PBSS
10x PBS (see Recipes)
8% paraformaldehyde (see Recipes)
Fixative: 4% paraformaldehyde in PBS (see Recipes)
Equipment
Spectrophotometer (Molecular Devices, model: SpectraMax M2 )
Low speed centrifuge for 15 ml Falcon tubes (Eppendorf, model: 5804 R )
Dissecting stereomicroscope with Leica L2 cold light source (Leica Microsystems, model: Leica L2 )
Fine dissecting forceps (Fine Scientific Tools)
37 °C incubator with shaking (Eppendorf, New BrunswickTM, model: Innova® 44 )
25 °C incubator (BioCold Environment, model: BC49-IN )
Dissecting dish
Confocal Microscope
Note: We use a Zeiss LSM510 (Zeiss, model: LSM510 ) with 63 x NA1.4 objective.
Software
ImageJ (NIH)
Prism (GraphPad)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tracy, C. and Krämer, H. (2017). Isolation and Infection of Drosophila Primary Hemocytes. Bio-protocol 7(11): e2300. DOI: 10.21769/BioProtoc.2300.
Download Citation in RIS Format
Category
Immunology > Animal model > Drosophila (Fruit fly)
Microbiology > Microbe-host interactions > Bacterium
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,301 | https://bio-protocol.org/exchange/protocoldetail?id=2301&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DNA Fiber Assay upon Treatment with Ultraviolet Radiations
Alfano Luigi
Antonio Giordano
Francesca Pentimalli
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2301 Views: 19558
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Genome stability is continuously challenged by a wide range of DNA damaging factors. To promote a correct DNA repair and cell survival, cells orchestrate a coordinated and finely tuned cascade of events collectively known as the DNA Damage Response (DDR). Ultra Violet (UV) rays are among the main environmental sources of DNA damage and a well recognized cancer risk factor. UV rays induce the formation of toxic cyclobutane-type pyrimidine dimers (CPD) and [6-4]pyrimidine-pyrimidone (6-4PP) photoproducts which trigger the activation of the intra-S phase cell cycle checkpoint (Kaufmann, 2010) aimed at preventing replication fork collapse, late origin firing, and stabilizing fragile sites (Branzei and Foiani, 2009). To monitor the activation of the intra-S phase checkpoint in response to UV type C (UVC) exposure, the DNA fiber assay can be used to analyse the new origin firing and DNA synthesis rate (Jackson et al., 1998; Merrick et al., 2004; Alfano et al., 2016). The DNA fiber assay technique was conceived in the 90s and then further developed through the use of thymidine analogues (such as CldU and IdU), which are incorporated into the nascent DNA strands. By treating the cells in sequential mode with these analogues, which can be visualized through specific antibodies carrying different fluorophores, it is possible to monitor the replication fork activity and assess how this is influenced by UV radiations or others agents.
Keywords: Ultra Violet radiation DNA damage Cell cycle checkpoints DNA fiber assay Halogenated pyrimidines
Background
Genomic instability is one of the hallmarks of cancer involved in both tumour development and progression (Hanahan and Weinberg, 2011). The preservation of genomic stability depends on a complex cascade of finely tuned events which are collectively known as the DNA damage response. This includes the activation of cell cycle checkpoints, which stall cell cycle to allow the cellular repair machinery to mend the damage. The identification of novel druggable proteins, involved in the DNA repair mechanisms, is part of modern cancer therapy. In this context, the DNA fiber assay can be used as a readout of replication fork activity to identify new potential players in the regulation of the intra-S phase checkpoint, which is triggered upon exposure to various chemotherapeutic drugs.
The unique chemistry of DNA, of its constituents and its chemical-physical properties allowed pioneering scientists to visualize the whole length of DNA fibers, first by labelling DNA with tritiated thymidine followed by detection through autoradiography (Cairns, 1963). Then Bensimon and colleagues showed that it was possible to align and ‘comb’ the DNA fibers on a solid matrix achieving a uniform stretching and an easy access for specific hybridizations (Bensimon et al., 1994). Jackson and Pombo were the first to use sequential labelling with halogenated pyrimidines, such as bromo-deoxyuridine (BrdU) and iodo-deoxyuridine (IdU), which are incorporated into DNA as thymidine analogues (Jackson and Pombo, 1998). This allowed them to assess qualitatively and quantitatively the activity of replicon clusters in HeLa cells at different times during S phase. Afterwards another study (Merrick et al., 2004) described a modified DNA fiber labelling, which was adapted by a classical DNA fiber autoradiography (Huberman and Riggs, 1968). Diffley and colleagues used pulse labelling with two halogenated nucleotides: chloro-deoxyuridine (CldU) and IdU, which could be differentially detected through specific antibodies, each carrying a different fluorescent dye. This allowed to visualize through fluorescent microscopy the effect of a specific cell treatment on the dynamics of the DNA synthesis process. The protocol described below was made as described by the two previously cited protocols with some modifications (Jackson and Pombo, 1998; Merrick et al., 2004).
Materials and Reagents
60 mm cell culture dishes (Sigma-Aldrich, catalog number: CLS430166 )
Manufacturer: Corning, catalog number: 430166.
Silane-Prep Slides: glass slides coated with silane (aminoalkylsilane) (Sigma-Aldrich, catalog number: S4651 )
HeLa cells (ATCC, catalog number: CCL-2 )
Cell culture
Roswell Park Memorial Institute (RPMI) 1640 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 61870010 )
10% fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15070063 )
0.25% trypsin-EDTA (Thermo Fisher Scientific, catalog number: 25200056 )
Note: HeLa cells were cultured in RPMI 1640 supplemented with 10% FBS, 1 μg/ml penicillin and 1 µg/ml streptomycin (defined as ‘complete medium’).
5-Iodo-2’-deoxyuridine (IdU) (Sigma-Aldrich, catalog number: I7125 )
5-Chloro-2’-deoxyuridine (CldU) (Sigma-Aldrich, catalog number: C6891 )
Chemicals of analytical grade
Methanol (CARLO ERBA Reagents, catalog number: 414814 )
Acetic acid glacial (Fisher Scientific, catalog number: A38-212 )
Ethanol absolute (CARLO ERBA Reagents, catalog number: 308605 )
39.5% hydrochloric acid (HCl) (CARLO ERBA Reagents, catalog number: 403878 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9418 )
Tween® 20 (Sigma-Aldrich, catalog number: P9416 )
ProLong® Gold anti-fade reagent (Thermo Fisher Scientific, InvitrogenTM, catalog number: P36935 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: 255793 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: 795488 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: 71725 )
Tris (Roche Diagnostics, catalog number: 10708976001 )
0.5 M EDTA (pH 8.0) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9262 )
NP-40 (Thermo Fisher Scientific, catalog number: 85124 )
Antibodies
Anti-BrdU clone BU1/75 (ICR1) (detects CldU) (Bio-Rad Laboratories, catalog number: OBT0030CX )
Anti-BrdU clone B44 (detects IdU) (BD, BD Biosciences, catalog number: 347580 )
Alexa Fluor 488-conjugated chicken anti-rat (Thermo Fisher Scientific, Invitrogen, catalog number: A21470 )
Alexa Fluor 594-conjugated rabbit anti-mouse (Thermo Fisher Scientific, Invitrogen, catalog number: A-11062 )
1x phosphate buffered saline (PBS) (see Recipes)
Spreading buffer (see Recipes)
Stringent buffer (see Recipes)
Equipment
Incubator
UVC 500 UV Crosslinker (GE Healthcare, model: UVC 500 )
Centrifuge
Confocal microscope (e.g., Carl Zeiss, model: Zeiss LSM100 )
Fume hood
Software
GraphPad software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Luigi, A., Giordano, A. and Pentimalli, F. (2017). DNA Fiber Assay upon Treatment with Ultraviolet Radiations. Bio-protocol 7(11): e2301. DOI: 10.21769/BioProtoc.2301.
Download Citation in RIS Format
Category
Cancer Biology > Genome instability & mutation > Cell biology assays
Biochemistry > DNA > Single-molecule Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,302 | https://bio-protocol.org/exchange/protocoldetail?id=2302&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
ELISPOT Assay to Measure Peptide-specific IFN-γ Production
Michelle N. Wykes
Laurent Renia
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2302 Views: 18625
Edited by: Ivan Zanoni
Reviewed by: Per Anderson
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Interferon-gamma (IFN-γ) is crucial for immunity against intracellular pathogens and for tumor control. It is produced predominantly by natural killer (NK) and natural killer T cells (NKT) as well as by antigen-specific Th1 CD4+ and CD8+ effector T cells. When investigating immune responses against pathogens and cancer cells, measuring antigen-specific cytokine-responses by cells of adaptive immunity offers an advantage over total non-specific cytokine responses. Significantly, the measurement of antigen-specific IFN-γ responses against pathogens or cancer cells, when compared to a treatment group, provides a quantitative measure of how well the treatment works. Measuring antigen-specific IFN-γ responses involves culture of the cells being considered (CD4+ or CD8+ T cells) with antigen presenting cells (APC) and a specific peptide from the target pathogen or cancer cell compared to control cultures without a peptide. After a suitable timeframe, the cytokine released is measured by an ELISPOT assay. The difference in the number of cells secreting IFN-γ, with and without peptide, is a measure of antigen-specific IFN-γ responses. This assay can be applied to other cytokines such as IL-10.
Keywords: IFN-gamma ELISPOT Antigen-specific Peptide-specific T cells
Background
Interferon gamma (IFN-γ) is a dimerized soluble cytokine that is the only member of the type II class of interferons (Gray and Goeddel, 1982). IFN-γ has anti-pathogen, immuno-regulatory, and anti-tumor properties (Schroder et al., 2004) which promotes NK cell activity, increase in antigen presentation, activates inducible nitric oxide synthase, induces the production of IgG2a from activated plasma cells and promotes Th1 differentiation by up-regulating the transcription factor T-bet.
Given the significant role of this cytokine in immune responses, there are several protocols to quantify IFN-γ. Perhaps the simplest measure is an ELISA assay which is used to measure levels of the cytokine in serum samples and tissue culture supernatants by capturing the cytokine with antibodies (Schreiber, 2001). There is also a flow cytometry based-assay where intracellular IFN-γ is detected by flow cytometry following cell-permeabilization (Andersson et al., 1988). The percentage of cells containing the cytokine is usually low, and does not indicate if the protein is functional, if it would be secreted and does not measure if it is in response to a specific target antigen or multiple antigens.
To measure IFN-γ responses to specific antigens, culture assays were developed. Here, CD4+ and CD8+ T cells were stimulated in culture with APC and peptides from the target protein and the supernatants were tested by ELISA for IFN-γ levels (Bradley et al., 1991). Recently, instead of ELISA, several commercial flow cytometry-based bead array assays (e.g., BD Biosciences) are available which offer greater sensitivity to detect low cytokine levels at the nanogram level. However, while the assay can quantify total cytokine secreted, it does not differentiate between a few cells producing a lot of cytokine from a large number of cells secreting little cytokine. The number of cells secreting the cytokine quantifies the number of cells committed to a specific target of immunity. Thus, the enzyme-linked immunospot (ELISPOT) assay is a highly sensitive immunoassay that measures the frequency of cytokine-secreting cells at the single-cell level. An antigen-specific ELISPOT assay allows the quantification of the number of a specific cell type (CD4+ or CD8+ T cells) which secretes IFN-γ in response to a specific antigen (Carvalho et al., 2001; Schmittel et al., 2001)
The IFN-γ–specific antibody on an ELISPOT plate captures the IFN-γ immediately after secretion from the cells with a limit of detection typically around 1 in 100,000 cells. The high sensitivity of the assay makes it particularly useful for studies of the small population of cells found in specific immune responses (Horne-Debets et al., 2013 and 2016; Karunarathne et al., 2016).
Materials and Reagents
Nitrile gloves
Sterile 15 ml and 50 ml polypropylene tubes
Disposable sterile pipettes: 2 ml, 5 ml, 10 ml, 25 ml
Filters for syringes: 0.45 μM and/or 0.22 μM
Multiscreen HTS-IP plates (PVDF membrane) (Merck, catalog number: MSIPS4510 )
Mouse (BioLegend, catalog number: 575402 ) or human (Thermo Fisher Scientific, GibcoTM, catalog number: PHC0026 ) recombinant IL-2
Microbeads (Miltenyi Biotec)
Note: Catalog numbers depend on the cell type to be tested.
Dynabeads magnetic beads (Thermo Fisher Scientific, USA, https://www.thermofisher.com/kr/en/home/brands/product-brand/dynal.html)
Note: Catalog numbers depend on the cell type tested.
Ethanol
Peptides or antigen from the protein of choice to stimulate antigen-specific IFN-γ
Rat anti-mouse IFNγ mAb, clone AN18, purified (capture) (50 μg, Thermo Fisher Scientific, eBioscienceTM, catalog number: 14-7313-81 or 500 μg, Thermo Fisher Scientific, eBioscienceTM, catalog number: 14-7313-85 ) mouse anti-human IFNγ mAb, p clone NIB42, purified (capture) (50 μg, BioLegend, catalog number: 502403 or 500 μg, BioLegend, catalog number: 502404 )
Note: Either titrate or use as recommended by manufacturer. Prepare immediately before coating wells.
Rat anti-mouse IFNγ mAb, clone R4-6A2, biotinylated (detection) (50 μg, Thermo Fisher Scientific, eBioscienceTM, catalog number: 13-7312-81 or 500 μg, Thermo Fisher Scientific, eBioscienceTM, catalog number: 13-7312-85 ) or mouse anti-human IFNγ mAb, clone 4S.B3, biotinylated (detection) (50 μg, BioLegend, catalog number: 502503 or 500 μg, BioLegend, catalog number: 502504 )
Note: Either titrate or use as recommended by manufacturer.
0.5% BSA
Streptavidin-horseradish peroxidase (BioLegend, catalog number: 405210 )
3-amino-9-ethylcarbazole (AEC) substrate/chromogen (BD, catalog number: 551951 )
Milli-Q water
Sodium chloride (NaCl)
Potassium chloride (KCl)
Sodium phosphate dibasic (Na2HPO4)
Potassium phosphate monobasic (KH2PO4)
Hydrochloric acid (HCl)
Sodium bicarbonate (NaHCO3)
Sodium phosphate (Na2CO3)
IMDM-1640
Fetal calf serum (FCS)
Note: Any brand that is suitable for cell culture and is heat inactivated at 56 °C for 30 min.
Penicillin-streptomycin (Tissue culture grade; Life technologies)
β-mercaptoethanol
Tween 20 (store at room temperature)
IMDM culture medium
L-glutamine (Tissue culture grade; Life technologies)
Phytohemagglutinin-L (PHA, positive control) stock (Roche Diagnostics, catalog number: 11249738001 ). Refer to Recipes section for details
Sterile phosphate buffered saline (1x PBS) (see Recipes)
Coating buffer working solution (see Recipes)
Blocking solution (see Recipes)
Anti-IFN-γ capture working solution (see Recipes)
Biotin-anti-IFN-γ working solution (see Recipes)
Streptavidin-horseradish peroxidase working solution (see Recipes)
Tween 20 working solution (see Recipes)
10% fetal calf serum in IMDM culture medium (see Recipes)
PHA stock solution (see Recipes)
Equipment
Note: ELISPOTS on the plate can be manually counted under a dissection microscope, or stereomicroscope (For example, Greenough, high-performance zoom stereomicroscope, SMZ 168-series). Alternatively, there are several specialist automated systems for high throughput screening (AELVIS, Autoimmun Diagnostika, Bio-Sys, Cellular Technology and the Zeiss reader) and there pros and cons discussed elsewhere and beyond the scope of this protocol (Janetzki et al., 2015).
Waste container
Gilson pipette and tips: P-2, P-10, P-20, P200, P1000
Gilson multichannel pipette with matched tips
Beckman Allegra 12 refrigerated centrifuge (Beckman Coulter, model: Allegra X-12 )
Class II biohazard hood
Incubator
1 L bottles
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wykes, M. N. and Rénia, L. (2017). ELISPOT Assay to Measure Peptide-specific IFN-γ Production. Bio-protocol 7(11): e2302. DOI: 10.21769/BioProtoc.2302.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Cytokine
Cell Biology > Cell-based analysis > Protein secretion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,303 | https://bio-protocol.org/exchange/protocoldetail?id=2303&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescently Labelled Aerolysin (FLAER) Labelling of Candida albicans Cells
SS Sneh Lata Singh
SK Sneha Sudha Komath
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2303 Views: 9731
Edited by: Yanjie Li
Reviewed by: Emmanuel ZavalzaMichael Tscherner
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
In this protocol we describe a nonradiolabelled labelling of GPI anchor in Candida albicans. The method uses a fluorescent probe to bind specifically to GPI anchors so that the level of GPI-anchored proteins at the cell surface can be measured. The labelling does not need permeabilization of cells and can be carried out in vivo.
Keywords: FLAER GPI anchor Candida albicans
Background
The GPI (glycosylphosphatidylinositol) anchor is a post translational modification occurring in the endoplasmic reticulum (ER). The preformed GPI anchor is attached in the lumen of the ER to the C-terminus of specific proteins that carry a GPI anchor attachment signal sequence. These proteins are subsequently transported (and extensively further modified) by the secretory pathway to the cell surface where the proteins are present anchored to the extracellular leaflet of the plasma membrane or covalently linked to the cell wall in organisms that have a wall. A variety of proteins get GPI anchored proteins in eukaryotes, for example, hydrolytic enzymes, cell surface adhesion molecules or receptor proteins (Orlean and Menon, 2007). In fungal pathogens, such as Candida albicans, many of the adhesins involved in host recognition and adherence, as well as several pathogenesis and virulence factors are GPI anchored proteins; besides, several GPI-anchored proteins in Candida albicans have proteolytic activity (Richard and Plaine, 2007; Nobile et al., 2008). The pathway is essential in Candida albicans and downregulating it or targeting it could be a useful strategy to combat Candida infections. The protocol used for assessing GPI anchor levels in Candida albicans is elaborated here.
Fluorescently Labelled Aerolysin (FLAER) is a fluorescein labelled inactive derivative of aerolysin, a Gram-negative bacterial toxin, which binds to GPI-anchored proteins in the cell membrane of the eukaryotic host and forms pores (Howard et al., 1987; Parker et al., 1994). In FLAER, proaerolysin is tagged with Alexa Fluor 488 dye which can bind to GPI anchors of eukaryotic cells without any harm to the cell (Sutherland et al., 2007). FLAER is also clinically used to detect GPI anchor levels in Paroxysmal Nocturnal Hemoglobinuria (PNH) cells, a disease caused by somatic mutations in PIGA (a subunit of glycosylphosphatidylinositol-N-acetylglucosamine transferase enzyme complex) in mammals (Brodsky et al., 2000). Once stained with FLAER, the fluorescence of cells can be monitored/quantified under a confocal fluorescence microscope in the GFP channel and the data used as a measure of GPI anchored proteins on the cell surface. In a previous study, we monitored the levels of GPI-anchored proteins on the cell surface of a GPI biosynthetic mutant, Cagpi14, in Candida albicans by using FLAER (Singh et al., 2016). CaGPI14 encodes for the catalytic subunit of the first mannosyltransferase of the GPI-anchor biosynthesis pathway. Deficiency in CaGpi14 severely affects cell growth and wall integrity in the organism although low levels of expression appear to be sufficient to make the cells viable. Its homolog in S. cerevisiae is essential (Kim et al., 2007). The protocol for FLAER labelling used to assess GPI anchor levels in this mutant of Candida albicans is described here.
Materials and Reagents
Pipette tips
Sterile plastic toothpick
Culture tubes (50 ml)
1.5 ml micro-centrifuge tubes
Glass slides
Cover slips
Candida albicans strains CAF2-1 (URA3/ura3::imm434 IRO1/iro1::imm434) and conditional null mutant of CaGPI14 (CAF2-1::Cagpi14/pMET3-CaGPI14), encoding the catalytic subunit of the first mannosyltransferase in the GPI biosynthetic pathway, for this study
Synthetic defined (SD) medium with Uridine+Cys-Met- dropout mix was made in the lab for this study since the strains were uridine auxotrophs. Cys/Met was used to repress CaGPI14 expression (all L-amino acids were obtained from Sisco Research Laboratory). This was possible because the conditional mutant strain had the only surviving allele of CaGPI14 placed under the control of the MET3 promoter, which permits gene expression in the absence of Cys/Met and represses its expression in the presence of Cys/Met
Liquid FLAER (25 µg/0.5 ml) from Pinewood Scientific Services Inc. (FL1S-C)
50% glycerol (Merck, catalog number: 1.07051.0521 )
D-glucose (Fisher Scientific, catalog number: D16-500 )
Yeast nitrogen base (HiMedia Laboratories, catalog number: M878 )
Cysteine (Sisco Research Laboratory, catalog number: 034890 )
Methionine (Sisco Research Laboratory, catalog number: 134869 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: 15915 )
Potassium chloride (KCl) (Merck, catalog number: 1049360500 )
Sodium phosphate dibasic (Na2HPO4) (Fisher Scientific, catalog number: S374-3 )
Potassium phosphate monobasic (KH2PO4) (Merck, catalog number: 1.93205.0521 )
Hydrochloric acid (HCl)
SD Uri+Cys-Met-/SD Uri+Cys+Met+ broth (100 ml) (see Recipes)
Phosphate buffered saline (PBS; pH 7.5) (see Recipes)
Equipment
Pipettes
100-1,000 µl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4642090 )
20-200 µl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4642080 )
2-20 µl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4642060 )
Vortex mixer (REMI GROUP, model: CM-101 )
Shaker incubator (Set at either 30 °C or 20 °C according to requirement) (Labtech, model: LSI-5002M )
Centrifuge (Plasto Craft Industries, model: Micro-spin R-V/FM )
Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: MultiskanTM GO Microplate Spectrophotometer , catalog number: 51119300)
Andor spinning Disk confocal microscope
Autoclave
Software
Andor iQ2.7 (for image capturing)
GIMP 2.8.18 software (for quantification)
Origin 0.5 software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Singh, S. L. and Komath, S. S. (2017). Fluorescently Labelled Aerolysin (FLAER) Labelling of Candida albicans Cells. Bio-protocol 7(11): e2303. DOI: 10.21769/BioProtoc.2303.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,304 | https://bio-protocol.org/exchange/protocoldetail?id=2304&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorometric Estimation of Glutathione in Cultured Microglial Cell Lysate
Vikas Singh
Ruchi Gera
Mahaveer Prasad Purohit
SP Satyakam Patnaik
Debabrata Ghosh
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2304 Views: 12691
Edited by: Xi Feng
Reviewed by: Amey G RedkarPooja Mehta
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Glutathione is one of the major antioxidant defense components present in cells. It is predominantly present as reduced glutathione (GSH) and converted into oxidized glutathione (GSSG) while reducing the free radicals like hydroxyl ions (OH-). For the measurement of GSH and GSSG, o-phthalaldehyde (OPT) has been used as a fluorescent reagent. O-phthalaldehyde has an ability to react specifically with GSH at pH 8 and GSSG at pH 12 respectively. N-ethylmaleimide (NEM) has been used to prevent auto-oxidation of GSH during measurement of GSSG in the present protocol. The original protocol by Hissin and Hilf was developed for glutathione estimation in Rat liver tissue. The present protocol has been standardized following Hissin and Hilf (1976) for the estimation of glutathione in cultured microglial cell lysate but it can also be used for other mammalian cell lysate. In our lab same protocol has been used for the estimation of glutathione in the whole cell lysate of murine neuroblastoma cell, N2a.
Keywords: Glutathione Antioxidant Free radical Microglia (N9) o-Phthalaldehyde N-ethylmaleimide
Background
This method was published by Hissin and Hilf in analytical biochemistry way back in 1976 (Hissin and Hilf, 1976). There are methods available to detect GSH accurately however; due to readily oxidative conversion of GSH into GSSG most of the methods give an overestimate of GSSG. Cohen and Lyle (1966) solved the problem by using NEM to prevent oxidative conversion of GSH into GSSG and also preventing GSH to react with OPT during GSSG estimation (Figures 1 and 2). We have used this simple and reliable method to detect GSH and GSSG in our experimental system (microglial cell lysate). The main advantage of this protocol is that, it does not involve sophisticated instrument like high performance liquid chromatography (HPLC) which also needs sufficient expertise to handle as compared to plate reader which is more commonly available and easy to operate (Rahman et al., 2006).
Figure 1. Schematic of chemical reaction during GSH estimation in the N9 cell lysate
Figure 2. Schematic of chemical reaction during GSSG estimation in the N9 cell lysate
Materials and Reagents
Pipette tips (Corning, Axygen®, catalog number: T-1005-WB-C-L )
0.22 μm filter
6 well culture plate (SRL LIFE SCIENCES, catalog number: 30006 )
Culture flask
1.5 ml centrifuge tube (Corning, Axygen®, catalog number: MCT-150-R )
0.5 ml tube (Corning, Axygen®, catalog number: 14-222-292 )
96 well plate (SPL life sciences, catalog number: 30096 )
Disposable plastic cell scraper (SRL LIFE SCIENCES, catalog number: 90020 )
Cell line: In the present protocol mouse microglial cell line, N9 has been used, which was kindly gifted by Dr. Anirban Basu, National Brain Research Centre (NBRC), India (Singh et al., 2016). N9 cell line was developed by retroviral transfection of primary microglia cells with the v-myc or v-mil oncogenes of the avian retrovirus MH2. Cells were cultured in DMEM/F12 medium supplemented with 10% FBS and 1% penicillin-streptomycin in a 5% CO2 incubator at 37 °C
DMEM/F12 (Sigma-Aldrich, catalog number: 56498C )
Sodium bicarbonate
Double distilled water
Fetal bovine serum (FBS) (Genetix Biotech, Cell cloneTM, catalog number: CCS-500-SA-U )
Penicillin-streptomycin (Pen-Strep) (Thermo Fisher Scientific, GibcoTM, catalog number: 10378016 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 )
Bradford reagent (Bio-Rad Laboratories, catalog number: 5000006 )
Tri-chloroacetic acid (TCA) (Sigma-Aldrich, catalog number: T6399 )
o-Phthalaldehyde (Sigma-Aldrich, catalog number: P1378 )
N-ethylmaleimide (Sigma-Aldrich, catalog number: E3876 )
Glutathione reduced (GSH) (Sigma-Aldrich, catalog number: G4251 )
Glutathione oxidized (GSSG) (Sigma-Aldrich, catalog number: G4376 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S5881 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Dipotassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P3786 )
Potassium phosphate dibasic trihydrate (K2HPO4·3H2O)
EDTA disodium salt (Sigma-Aldrich, catalog number: E5513 )
Note: This product has been discontinued.
100% ethanol (Merck, catalog number: 1009831011 )
Methanol (SRL Laboratories, catalog number. 65524 )
0.1 M potassium phosphate EDTA buffer (KPE buffer) (see Recipes)
50% trichloroacetic acid (see Recipes)
o-Phthaldehyde solution (10 mg/ml) (see Recipes)
0.4 M N-ethylmaleimide (see Recipes)
0.1 N sodium hydroxide (see Recipes)
Equipment
1 ml and 200 µl pipettes (Eppendorf)
Table top centrifuge (Sigma-zentrifuges, model: Sigma 3-18KS )
Microplate reader (BMG LABTECH, model: FLUOstar Omega )
CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Steri-CycleTM CO2 Incubators )
Sonicator (Sonics & Materials, model: VC 505 )
Software
Mars data analysis software, ver. 1.01 (Data analysis software for Microplate reader)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Singh, V., Gera, R., Purohit, M. P., Patnaik, S. and Ghosh, D. (2017). Fluorometric Estimation of Glutathione in Cultured Microglial Cell Lysate. Bio-protocol 7(11): e2304. DOI: 10.21769/BioProtoc.2304.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Protein
Biochemistry > Protein > Quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
2 Q&A
Help running this assay
2 Answers
30 Views
Apr 29, 2024
Question about the molarity of the buffer and concentrations
1 Answer
26 Views
Dec 7, 2022
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,305 | https://bio-protocol.org/exchange/protocoldetail?id=2305&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Single-molecule Analysis of DNA Replication Dynamics in Budding Yeast and Human Cells by DNA Combing
HT Hélène Tourrière
Julie Saksouk
AL Armelle Lengronne
P Philippe Pasero
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2305 Views: 13082
Edited by: Emilie Besnard
Original Research Article:
The authors used this protocol in Jun 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2012
Abstract
The DNA combing method allows the analysis of DNA replication at the level of individual DNA molecules stretched along silane-coated glass coverslips. Before DNA extraction, ongoing DNA synthesis is labeled with halogenated analogues of thymidine. Replication tracks are visualized by immunofluorescence using specific antibodies. Unlike biochemical and NGS-based methods, DNA combing provides unique information on cell-to-cell variations in DNA replication profiles, including initiation and elongation. Finally, this assay can be used to monitor the effect of DNA lesions on fork progression, arrest and restart.
Keywords: Replication Yeast Human cells Fork speed Replication origin DNA stretching
Background
DNA synthesis is initiated at thousands of sites on eukaryotic chromosomes called replication origins. Origin activation follows a well-defined replication timing program that is controlled by checkpoint kinases and epigenetic modifications of chromatin (Prioleau and MacAlpine, 2016). Replication forks frequently stall during a normal S phase. Fork arrest is caused by multiple events, such as DNA lesions, tightly bound protein complexes, and transcription at highly expressed genes (Tourriere and Pasero 2007; Zeman and Cimprich, 2013). Eukaryotes have developed different strategies to deal with this replication stress, including repair mechanisms to restart arrested forks and activation of dormant replication origins to rescue terminally-arrested forks.
DNA combing is a method of choice to monitor different aspects of replication (fork speed, origin usage, fork restart, sister fork asymmetry). Unlike other DNA fiber methods such as DNA fiber spreading, the stretching, density and alignment of DNA molecules are highly reproducible and tightly controlled in the DNA combing method. Stretching is imposed by the force exerted by a receding air/water interface, independently of the length of DNA fibers (Bensimon et al., 1994; Michalet et al., 1997). Origin firing and progression of replication forks are followed after incorporation of thymidine analogs, such as 5-bromo-2’-deoxyuridine (BrdU), 5-iodo-2’-deoxyuridine (IdU) and 5-chloro-2’-deoxyuridine (CldU) in newly-synthesized DNA. This technique has been successfully used to monitor DNA replication dynamics in a variety of organisms, including bacteria, yeast, Drosophila, Xenopus and mammals.
Here, we provide detailed protocols to analyze newly synthesized DNA fibers in budding yeast and in human cells and to investigate various aspects of DNA replication in normal growth conditions and under replicative stress.
Materials and Reagents
Common to human/yeast cells
Tape
14 ml round-bottom polypropylene tubes (Corning, Falcon®, catalog number: 352059 )
Tips 1 ml, 200 µl, 20 µl
Silanized coverslips (Genomic Vision, catalog number: COV-001 ) purchased from Genomic Vision or prepared as described (Labit et al., 2008)
2 ml Teflon reservoir (Reservoir MCS Support [x 2]; from Genomic Vision)
Whatman paper
Microscope slides SuperFrost (VWR, catalog number: 630-1987 )
Cyanoacrylate glue
Diamond tip engraving pen (Sigma-Aldrich, catalog number: Z225568-1EA )
Saran plastic film (Dominique Dutscher, catalog number: 090264 )
Coplin Jar
EDTA (Sigma-Aldrich, catalog number: E6758 )
LMP agarose (Bio-Rad Laboratories, catalog number: 161-3111 )
Plug mold (Bio-Rad Laboratories, catalog number: 170-3713 )
Proteinase K (Sigma-Aldrich, catalog number: P6556 )
10x PBS (Sigma-Aldrich, catalog number: D1408 )
YOYO-1 (Thermo Fisher Scientific, InvitrogenTM, catalog number: Y3601 )
Sodium chloride (NaCl) (VWR, catalog number: 27810-295 )
β-agarase (New England Biolabs, catalog number: M0392L )
Sodium hydroxide (NaOH) (Merck, catalog number: 1.06462.1000 )
BSA fraction V (Sigma-Aldrich, catalog number: A9647 )
Prolong Gold Antifade reagent (Thermo Fisher Scientific, InvitrogenTM, catalog number: P36930 )
BrdU (Sigma-Aldrich, catalog number: B5002 )
IdU (Sigma-Aldrich, catalog number: I7125 )
CldU (MP Biomedicals, catalog number: 0 2105478 )
DMSO (Sigma-Aldrich, catalog number: D2650 )
Hydroxyurea (Sigma-Aldrich, catalog number: H8627 )
N-laurylsarcosine sodium salt (Sigma-Aldrich, catalog number: L9150 )
MES hydrate (Sigma-Aldrich, catalog number: M2933 )
MES sodium salt (Sigma-Aldrich, catalog number: M5057 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Mouse anti-BrdU clone B44 IgG1 (BD, BD Biosciences, catalog number: 347580 )
Rat anti-BrdU clone BU1/75 (Bio-Rad Laboratories, catalog number: OBT0030 )
Mouse anti ssDNA (poly dT) IgG2a (EMD Millipore, catalog number: MAB3034 or MAB3868 )
Goat anti-Rat Alexa 488 (Thermo Fisher Scientific, Invitrogen, catalog number: A-11006 )
Goat anti-Mouse Alexa 546 (Thermo Fisher Scientific, Invitrogen, catalog number: A-11030 )
Goat anti-Mouse IgG2a Alexa 647 (Thermo Fisher Scientific, Invitrogen, catalog number: A-21241 )
Goat anti-Mouse IgG1 Alexa 546 (Thermo Fisher Scientific, Invitrogen, catalog number: A-21123 )
LMP agarose (see Recipes)
TE50 (see Recipes)
TE 1x (see Recipes)
10x MES buffer pH 6 (see Recipes)
1 N NaOH (see Recipes)
PBS/T (see Recipes)
Antibodies (dilution in PBS/T) (see Recipes)
Detection of CldU/IdU/ssDNA (see Recipes)
Detection of BrdU/ssDNA (see Recipes)
S. cerevisiae specific reagents
Yeast strain PP872 (genetic background: W303; genotype: MATa, ade2-1, trp1-1, can1-100, leu2-3,112, his3-11,15, ura3, GAL, psi+, RAD5, ura3::URA3-GPD-TK7) (Crabbe et al., 2010)
Yeast strain HSV-TK + hENT1 (Viggiani and Aparicio, 2006)
Bacto peptone (BD, BactoTM, catalog number: 211677 )
Adenine (Sigma-Aldrich, catalog number: A8626 )
Yeast extract (Sigma-Aldrich, catalog number: 70161 )
Glucose (VWR, catalog number: 101175P )
Alpha factor (custom peptide synthesis, Sequence: WHWLQLKPGQPMY)
Pronase (EMD Millipore, catalog number: 53702-50KU )
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: 71289 )
Tris-HCl (Sigma Aldrich, catalog number: RES3098T )
Citric acid monohydrate (C6H8O7·H2O) (Sigma-Aldrich, catalog number: C1909 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Monopotassium phosphate (KH2PO4) (VWR, catalog number: 26936.293 )
Dibasic potassium phosphate (K2HPO4) (VWR, catalog number: 26930.293 )
Enzyme powder Zymolyase 20T (MP Biomedicals, catalog number: 0 8320921 )
YPAD (see recipes)
Zymolyase buffer (see Recipes)
1 M potassium phosphate buffer pH 7.0 (see Recipes)
0.1 M citrate phosphate buffer pH 5.6 (see Recipes)
BrdU stock solution (see Recipes)
Proteinase K buffer (see Recipes)
Human cells specific reagents
6 well plates (Dominique Dutscher, catalog number: 009206 )
1x PBS (Sigma-Aldrich, catalog number: D8537 )
0.05% trypsin-EDTA
Regular recommended cell growth medium
BrdU stock solution (see Recipes)
IdU stock solution (see Recipes)
CldU stock solution (see Recipes)
Proteinase K buffer (see Recipes)
Equipment
Centrifuge (Eppendorf, model: 5810 R )
Microcentrifuge (Eppendorf, model: MiniSpin® )
Thermoblock (thermomixer comfort Eppendorf with 2 ml; 15 ml and 50 ml block)
Cell counter (CASY® Modell TT - Cell Counter, OLS for yeast cells or Malassez hemocytometer [VWR, catalog number: 631-0975 ] for human cells)
Pasteur pipette Rubber bulb (Dominique Dutscher, catalog number: 042250 )
Microwave
Roller mixer (Cole-Parmer, Stuart, model: SRT9D )
Leica DM6000B microscope (Leica Microsystems, model: DM6000B )
CoolSNAP HQ CCD camera (Photometrics, model: CoolSNAP HQ CCD )
P1000, P200, P20 pipetman
DNA combing device (Genomic Vision, catalog number: MCS-001 ). Can also be assembled as described (Gallo et al., 2016; Kaykov et al., 2016; Norio and Schildkraut, 2001)
Metal coverslip holder
Humid chamber (StainTray slide staining system) (Sigma-Aldrich, catalog number: Z670146-1EA )
Hybridization oven (Shake ‘n’ StackTM Hybridization Ovens) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 6240TS )
Epifluorescence microscope Zeiss Axio Imager Z2 (Zeiss, model: Axio Imager Z2 ) with a camera Hamamatsu ORCA-Flash4.0 LT, Cmos sensor of 6.5 µm with an objective Zeiss 40x PL APO 1.4 oil and with the filters GFP HE: BP470/40 FT495 BP525/50; Texas Red: BP560/40 FT585 BP630/75; CY5: BP 640/30 FT660 BP690/50)
Microscope (Nikon Instruments, model: YS100 )
Software
MetaMorph (Molecular Devices) or open source software such as ImageJ (http://rsbweb.nih.gov/ij/) with bio-formats plugins
IDeFIx Montpellier (IGMM, CNRS) or software developed by Genomic Vision
Prism 7.0 (GraphPad) or open source software such as R (https://www.r-project.org/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tourrière, H., Saksouk, J., Lengronne, A. and Pasero, P. (2017). Single-molecule Analysis of DNA Replication Dynamics in Budding Yeast and Human Cells by DNA Combing. Bio-protocol 7(11): e2305. DOI: 10.21769/BioProtoc.2305.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Biochemistry > DNA > Single-molecule Activity
Molecular Biology > DNA > DNA labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,306 | https://bio-protocol.org/exchange/protocoldetail?id=2306&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
CRISPR-PCS Protocol for Chromosome Splitting and Splitting Event Detection in Saccharomyces cerevisiae
Yu Sasano
Satoshi Harashima
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2306 Views: 9850
Edited by: Renate Weizbauer
Reviewed by: Judd F Hultquist
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Chromosome engineering is an important technology with applications in basic biology and biotechnology. Chromosome splitting technology called PCS (PCR-mediated Chromosome Splitting) has already been developed as a fundamental chromosome engineering technology in the budding yeast. However, the splitting efficiency of PCS technology is not high enough to achieve multiple splitting at a time. This protocol describes a procedure for achieving simultaneous and multiple chromosome splits in the budding yeast Saccharomyces cerevisiae by a new technology called CRISPR-PCS. At least four independent sites in the genome can be split by one transformation. Total time and labor for obtaining a multiple split yeast strain is drastically reduced when compared with conventional PCS technology.
Keywords: Saccharomyces cerevisiae Chromosome engineering CRISPR/Cas9 Chromosome splitting
Background
Chromosome engineering technologies that enable rapid and efficient manipulation of multiple genetic loci or chromosomal regions have become increasingly important. Such technologies offer a powerful means for elucidating chromosome and genome function. Additionally, it can be used for breeding useful strains through the creation of a wide array of genetic variants. A chromosome splitting technology called PCS (PCR-mediated Chromosome Splitting) technology has been developed in the budding yeast Saccharomyces cerevisiae. This technology allows the splitting of yeast chromosomes at any desired site by introducing centromeres and telomere seed sequences based on the homologous recombination mechanism. The resulting chromosomes possess one centromere and telomeres at both ends, thus function as normal chromosomes (Sugiyama et al., 2005). However, low splitting efficiency is a drawback in PCS, therefore simultaneous and multiple splitting of chromosomes has been impossible. In this situation, we developed a novel chromosome splitting technology called CRISPR-PCS. It is well known that double strand break (DSB) markedly increases homologous recombination activity around the DSB site in yeast (Agmon et al., 2009). The CRISPR/Cas9 system is a genome editing technology that can induce targeted DSBs. By utilizing CRISPR/Cas9 system, we can induce DSB at any genomic locus and thus activate homologous recombination activity. CRISPR-PCS is a technology that combines CRISPR/Cas9 system with PCS, thus allowing the increase of splitting efficiency by approximately 200 fold. This drastically increased efficiency enables simultaneous and multiple chromosome spitting. Overview of the CRISPR-PCS technology is illustrated in Figure 1.
Figure 1. Overview of CRISPR-PCS. In CRISPR-PCS, one gRNA expressing plasmid for the specific targeting site and two splitting modules are required to split yeast chromosome at a specific site. These DNA molecules are introduced into the Cas9 expressing strain, i.e., the strain carrying p414-TEF1p-Cas9-CYC1t plasmid. Transformants where the expected split event occurred are selected by auxotrophic marker selection. Closed black circles represent the centromere. Red and blue boxes represent the homology sequences for recombination. Arrows represent the telomere sequence.
Materials and Reagents
10-100 μl pipette tips (e.g., Greiner Bio One International, catalog number: 685280 )
100-1,000 μl pipette tips (e.g., Greiner Bio One International, catalog number: 686290 )
PCR tube (e.g., Greiner Bio One International, catalog number: 683201 )
p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene, catalog number: 43803 )
p414-TEF1p-Cas9-CYC1t (Addgene, catalog number: 43802 )
Escherichia coli DH5α competent cell (NIPPON GENE, catalog number: 316-06233 )
DNA, MB-grade from fish sperm (Roche Diagnostics, catalog number: 11467140001 )
KOD plus neo (TOYOBO, catalog number: KOD-401 )
2 mM dNTP solution (Attached in the KOD plus neo)
25 mM magnesium sulfate (MgSO4) (Attached in the KOD plus neo)
Oligonucleotide primer 1 for construction of a gRNA expressing plasmid (5’-N20GTTTTAGAGCTAGAAATAGCAAG-3’) (synthesized in Sigma-Aldrich Japan)
Oligonucleotide primer 2 for construction of gRNA expressing plasmid (5’-cN20GATCATTTATCTTTCACTGCGGA-3’) (synthesized in Sigma-Aldrich Japan)
DpnI (Takara Bio, catalog number: 1235A )
QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704 )
10x NEB buffer 2 (New England Biolabs, catalog number: B7002S )
BSA solution (attached in the T4 DNA polymerase) (New England Biolabs, catalog number: M0203 )
10x T4 DNA ligase buffer (New England Biolabs, catalog number: M0202 )
T4 DNA polymerase (New England Biolabs, catalog number: M0203 )
2.5 mM each dNTP mix (Takara Bio, catalog number: 4030 )
Ampicillin (Wako Pure Chemical Industries, catalog number: 015-10382 )
Oligonucleotide primer 1 for construction of a splitting module (5’-N50GGCCGCCAGCTGAAGCTTCG-3’) (synthesized in Sigma-Aldrich Japan)
Oligonucleotide primer 2 for construction of a splitting module (5’-CCCCAACCCCAACCCCAACCCCAACCCCAACCCCAAAGGCCACTAGTGGATCTGAT-3’) (synthesized in Sigma-Aldrich Japan)
Oligonucleotide primer for sequencing (5’-ACGCCAAGCGCGCAATTAAC-3’) (synthesized in Sigma-Aldrich Japan)
Lithium acetate dihydrate (Wako Pure Chemical Industries, catalog number: 120-01535 )
Polyethylene glycol 4,000 (Wako Pure Chemical Industries, catalog number: 162-09115 )
ECL Direct Nucleic Acid Labelling and Detection System (GE Healthcare, catalog number: RPN3000 )
Ethidium bromide solution (10 mg/ml) (Nacalai Tesque, catalog number: 14631-94 )
LB broth (Sigma-Aldrich, catalog number: L3022-1KG )
Agar (Wako Pure Chemical Industries, catalog number: 010-08725 )
Glucose (Wako Pure Chemical Industries, catalog number: 043-31163 )
Yeast nitrogen base without amino acids (e.g., BD, Difco, catalog number: 291940 )
Sodium hydroxide (NaOH) (e.g., Wako Pure Chemical Industries, catalog number: 192-15985 )
Peptone (e.g., BD, BactoTM, catalog number: 211677 )
Yeast extract (e.g., BD, BactoTM, catalog number: 288620 )
Hydrochloric acid (HCl) (e.g., Wako Pure Chemical Industries, catalog number: 087-10361 )
LB plate (see Recipes)
Yeast minimum medium (SD medium) (see Recipes)
YPD medium (see Recipes)
Equipment
Pipettes
Thermal cycler (e.g., Takara Bio, model: Dice® Touch, catalog number: TP350 ) (Use at Procedure B and Procedure C)
Incubator (e.g., Panasonic Healthcare, model: MIR-H163 ) (Use at Procedure B and Procedure D)
Air shaker (e.g., TAITEC, model: BR-21UM MR ) (Use at Procedure B and Procedure D)
Heat block (e.g., TAITEC, model: DTU-1BN ) (Use at Procedure B, Procedure D and Procedure E)
DNA sequencer (e.g., Applied Biosystems, model: ABI PRISM® 3100 Genetic Analyzer ) (Use at Procedure B)
CHEF-DR® III pulsed field gel electrophoresis system (Bio-Rad Laboratories, model: CHEF-DR III Chiller System , catalog number: 1703700)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sasano, Y. and Harashima, S. (2017). CRISPR-PCS Protocol for Chromosome Splitting and Splitting Event Detection in Saccharomyces cerevisiae. Bio-protocol 7(10): e2306. DOI: 10.21769/BioProtoc.2306.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Chromosome engineering
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,307 | https://bio-protocol.org/exchange/protocoldetail?id=2307&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Antigen-presentation Assay for Self- and Microbial-derived Antigens
LC Laura Campisi
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2307 Views: 16666
Edited by: Andrea Puhar
Reviewed by: Guangzhi Zhang
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Antigen presenting cells (APC) are able to process and present to T cells antigens from different origins. This mechanism is highly regulated, in particular by Patter Recognition Receptor (PRR) signals. Here, I detail a protocol designed to assess in vitro the capacity of APC to present antigens derived from bacteria, apoptotic and infected apoptotic cells.
Keywords: Antigen presentation Bone marrow derived dendritic cells CD4 T cells Self-antigens Bacterial antigens Apoptotic cells
Background
T cell lymphocytes express on their surface the T cell receptor (TCR), which allows the recognition of cellular (self) or microbial (non-self) antigens that are processed and presented as peptides bound to the major histocompatibility complex (MHC) molecules by antigen presenting cells (APC). APC are able to process antigens and to present them to T cells, and MHC-TCR interactions are critical steps for T cell activation during both infectious and autoimmune responses.
Previous works have described a mechanism of regulation of antigen presentation based on the stimulation of Pattern Recognition Receptors (PRRs), such as toll-like receptors (TLRs) (Blander and Medzhitov, 2004 and 2006). Indeed, TLR signals specifically from phagosomes containing microbial pathogens favor the presentation of non-self-antigens within MHC-II molecules. On the other hand, self-antigens generated after phagocytosis of apoptotic cells are directed to lysosomal degradation because of the absence of TLR stimuli. However, the segregation of self and non-self-antigens does not occur when both derive from infected apoptotic cells and are simultaneously carried by the same phagosome, which is optimally tailored by TLR signals for antigen presentation. Such mechanism of phagosome maturation and antigen presentation upon TLR triggering has been demonstrated in vitro using bone marrow derived dendritic cells (BMDC) and apoptotic murine B cells–either primary or A20 B cell line–previously incubated with the TLR4 ligand lipopolysaccharide (LPS), which is internalized by B cells and mimics bacterial infection (Blander and Medzhitov, 2004 and 2006; Campisi et al., 2016). Despite its elegance, this experimental system fails to reproduce bacterial invasion of the eukaryotic target cell. Furthermore, no T cell traceable antigens are present in the apoptotic cargo that internalized LPS.
I developed an in vitro alternative protocol where A20 cells are directly infected by the cell invasive bacteria Listeria monocytogenes expressing a recombinant antigen, allowing to assess the capacity of BMDC to present self and non-self-antigens derived from the same infected apoptotic cargo (Campisi et al., 2016).
Materials and Reagents
Sterile pipette tips and serological pipettes (Fisher Scientific, FisherbrandTM)
Optilux non-tissue culture10 cm Petri dishes (Corning, catalog number: 430591 )
Sterile 50 and 15 ml conical tubes (Denville)
1 ml syringe with 26 G gauge needle (BD, catalog number: 309625 )
70 μm cell strainers (Fisher Scientific, FisherbrandTM, catalog number: 22-363-548 )
Tissue culture 24 well plates (flat bottom) (Corning, Costar®, catalog number: 3524 )
Tissue culture 96 well plates (flat bottom) (Corning, catalog number: 3595 )
Sterile bacterial inoculating needles or loops
Sterile 5 ml tubes with cap for bacterial culture (Corning, catalog number: 352058 )
Tissue culture 6 well plates (flat bottom) (Corning, Costar®, catalog number: 3516 )
20 G gauge needle (BD, catalog number: 305175 )
3 ml syringe (BD, catalog number: 309656 )
FACS tubes with rack (National Scientific, catalog number: TN0946-01R )
Mice:
Wild-type C57BL/6J mice
Note: We initially purchased them from THE JACKSON LABORATORIES and then bred in the mouse facility of the Icahn School of Medicine at Mount Sinai for at least 5 years.
OT-II TCR transgenic mice (strain B6.Cg-Tg(TcraTcrb)425Cbn/J) (THE JACKSON LABORATORIES, catalog number: 004194 ), which express the mouse alpha-chain and beta-chain T cell receptor that pairs with the CD4 coreceptor and is specific for an epitope derived from the chicken ovalbumin (OVA323-339) in the context of I-A b
1H3.1 TCR transgenic mice, which express the mouse alpha-chain and beta-chain T cell receptor that pairs with the CD4 coreceptor and is specific for the 52-68 fragment of the alpha-chain of I-E class II molecules (the Eα52-68 peptide) in the context of I-A b
Antigen sources:
Cell cargo: A20 cell line (ATCC, catalog number: TIB-208 )
Bacteria: Listeria monocytogenes expressing ovalbumin (OVA) as a recombinant protein (Pope et al., 2001)
Purified peptides: OVA329-337 (sequence ISQAVHAAHAEINEAGR) and Eα52-68 (sequence ASFEAQGALANIAVDKA)
70% ethanol
1x PBS (Sigma-Aldrich, catalog number: D8537 )
Red blood cell lysis solution (Sigma-Aldrich, catalog number: R7757 )
Bacterial growing medium: brain heart infusion (BHI) broth (BD, BactoTM, catalog number: 237500 )
Ampicillin (Sigma-Aldrich, catalog number: A9393 )
Anti-CD95 antibody, clone Jo2 (BD, BD Biosciences, catalog number: 554255 )
Trypan blue stain (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Fetal bovine serum (FBS)
EDTA disodium dihydrate (Biological Industries, BI, catalog number: 41-922 ), to dissolve in PBS at pH = 8, stock solution 0.5 M
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Anti-CD4 magnetic microbeads for T cell positive selection (Miltenyi Biotec, catalog number: 130-049-201 )
Carboxyfluorescein succinimidyl ester (CFSE) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 65-0850-84 )
Anti-mouse CD4-APC, clone RM4-5 (Thermo Fisher Scientific, eBioscienceTM, catalog number: 14-0042 )
Optional: anti-mouse CD11c (clone N418), CD11b (clone M1/70) and MHC-II (clone M5/114.15.2) markers
RPMI (Sigma-Aldrich, catalog number: R8758 )
GM-CSF
Note: We used to prepare GM-CSF using J558 cells transfected with GM-CSF cDNA (Liu et al., 2006, p.148), but recombinant GM-CSF can be also purchased.
L-glutamine (Sigma-Aldrich, catalog number: G7513 )
HEPES solution BioXtra, 1 M, pH 7.0-7.6 (Sigma-Aldrich, catalog number: H0887 )
Sodium pyruvate (Sigma-Aldrich, catalog number: S8636 )
MEM, nonessential amino acids (Sigma-Aldrich, catalog number: M7145 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
IMDM (Sigma-Aldrich, catalog number: I3390 )
Fc-block: rat anti-mouse CD16/32, clone 2.4G2 (BD, BD Biosciences, catalog number: 553141 )
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: 13412 )
Note: This product has been discontinued.
BMDC medium (see Recipes)
A20 cell medium (see Recipes)
T cell medium (see Recipes)
FACS buffer (see Recipes)
Equipment
Single channel pipettes, 1, 20, 200 and 1,000 μl
Scissors
Forceps
Laminar flow hood
Bench top centrifuge
Hemocytometer or automatic cell counter
Cell incubator (37 °C, 5% CO2)
Bacterial incubator (37 °C) with shaker
Sterile 100 ml Erlenmeyer flasks
Flasks for cell culture
Optical density (OD) reader
MACS columns, LS columns (Miltenyi Biotec, catalog number: 130-042-401 )
MACS separators
Note: I suggest QuadroMACS separator (Miltenyi Biotec, catalog number: 130-090-976 )
Flow cytometer
Software
Flow cytometer analysis software, FlowJo, LLC
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Campisi, L. (2017). In vitro Antigen-presentation Assay for Self- and Microbial-derived Antigens. Bio-protocol 7(11): e2307. DOI: 10.21769/BioProtoc.2307.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Antigen-specific response
Microbiology > Microbe-host interactions > Bacterium
Cell Biology > Cell signaling > Intracellular Signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,308 | https://bio-protocol.org/exchange/protocoldetail?id=2308&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Kinetic Lactate Dehydrogenase Assay for Detection of Cell Damage in Primary Neuronal Cell Cultures
DF Dorette Freyer
Christoph Harms
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2308 Views: 10745
Edited by: Soyun Kim
Reviewed by: Anna La Torre
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
The aim of many in vitro models of acute or chronic degenerative disorders in the neurobiology field is the assessment of survival or damage of neuronal cells. Damage of cells is associated with loss of outer cell membrane integrity and leakage of cytoplasmic cellular proteins. Therefore, activity assays of cytoplasmic enzymes in supernatants of cell cultures serve as a practicable tool for quantification of cellular injury (Koh and Choi, 1987; Bruer et al., 1997). Lactate dehydrogenase (LDH) is such a ubiquitously expressed cytosolic enzyme, which is very stable due to a very long protein half-life (Hsieh and Blumenthal, 1956; Koh and Cotman, 1992; Koh et al., 1995).
Keywords: LDH assay Primary neurons Cell damage LDH release Cell culture Cell death Survival Oxygen-glucose deprivation Glutamate toxicity
Background
LDH catalyzes the formation of lactate and Nicotinamidadenindinucleotid (NAD+) from pyruvate and reduced Nicotinamidadenindinucleotid (NADH) in a reversible biochemical reaction. NADH has an absorption on the wavelength of 340 nm. The basis of this kinetic LDH activity assay is the decrease of optical density at the specific wave length caused by a decrease of NADH. The amount of LDH in the supernatant is calculated using a standard enzyme solution with known LDH activity. Different cell densities or metabolic activation rates might be confounders; therefore normalization of LDH activity is recommended. This is achieved by assessment of LDH activity after outer cell membrane lysis that does not block LDH activity itself (‘full kill’ with 0.5% Triton-X). Finally, percentage of absolute LDH activity from LDH activity by full kill indicates the rate of damaged or dead cells in the cell culture well.
Materials and Reagents
96 well plate, flat bottom (SARSTEDT, catalog number: 82.1581 )
Pipette tips
Neuronal cell cultures which was treated by noxes (e.g., oxygen and glucose deprivation, glutamate or other toxins) (Koh and Choi, 1987; Bruer et al., 1997; Harms et al., 2001; Ruscher et al., 2002; Harms et al., 2004; Meisel et al., 2006; Harms et al., 2007; Datwyler et al., 2011; Schweizer et al., 2015; Donath et al., 2016)
Note: This protocol works for primary neuronal cultures that were derived from various regions of the brain including septum, hippocampus, striatum, spinal cord, cortex, cerebellum or raphe nuclei and that were seeded in various densities or with various media formulations or coatings of the plates. However, we achieve best results with cultures that are at least cultivated for more than 7 days in vitro (DIV) and that were seeded in a reasonable density as illustrated below (Figures 1 and 2). These cultures contain approximately 10% glial cells and this does not impact on the possibility to analyze LDH release in the supernatant medium.
Figure 1. Primary cortical neuronal cultures derived from mouse E15 embryos after 7 days in vitro (DIV). Scale bar = 50 µm.
Figure 2. Primary cortical neuronal cultures that were treated with 50 µM glutamate for 24 h on DIV 8. Scale bar = 50 µm.
Triton X-100 solution (Sigma-Aldrich, catalog number: 93443 )
Potassium phosphate monobasic (KH2PO4) (MW 136.1) (Sigma-Aldrich, catalog number: P5655 )
Dibasic potassium phosphate (K2HPO4; MW 174.2) or potassium phosphate trihydrate (K2HPO4·3H2O; MW 228.2) (Sigma-Aldrich catalog number: P5504 )
Distilled water
Na-pyruvate (MW 110) (Sigma-Aldrich, catalog number: P2256 )
LDH standard (TruCal U) (DiaDys Diagnostic Systems, catalog number: 5 9100 99 10 063 )
-NADH (MW 709.4, reduced form) (Sigma-Aldrich, catalog number: N8129 )
10x LDH-buffer (see Recipes)
1x LDH-buffer (see Recipes)
LDH-standard (see Recipes)
Na-pyruvate-solution (see Recipes)
-NADH-solution (see Recipes)
Equipment
Pipette
CO2-incubator for cell cultures
Multi-pipette (Eppendorf, model: Multipette® plus )
Spectrophotometer for 96 well plate that can measure 340 nm and kinetic measurement (e.g., Dynex Technologies, model: MRX Microplate Reader )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Freyer, D. and Harms, C. (2017). Kinetic Lactate Dehydrogenase Assay for Detection of Cell Damage in Primary Neuronal Cell Cultures. Bio-protocol 7(11): e2308. DOI: 10.21769/BioProtoc.2308.
Donath, S., An, J., Lee, S. L., Gertz, K., Datwyler, A. L., Harms, U., Muller, S., Farr, T. D., Fuchtemeier, M., Lattig-Tunnemann, G., Lips, J., Foddis, M., Mosch, L., Bernard, R., Grittner, U., Balkaya, M., Kronenberg, G., Dirnagl, U., Endres, M. and Harms, C. (2016). Interaction of ARC and Daxx: A novel endogenous target to preserve motor function and cell loss after focal brain ischemia in mice. J Neurosci 36(31): 8132-8148.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Cellular mechanisms
Biochemistry > Protein > Quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,309 | https://bio-protocol.org/exchange/protocoldetail?id=2309&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
The Repeated Flurothyl Seizure Model in Mice
Russell J. Ferland
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2309 Views: 7665
Edited by: Soyun Kim
Reviewed by: Edel Hennessy
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Development of spontaneous seizures is the hallmark of human epilepsy. There is a critical need for new epilepsy models in order to elucidate mechanisms responsible for leading to the development of spontaneous seizures and for testing new anti-epileptic compounds. Moreover, rodent models of epilepsy have clearly demonstrated that there are two independent seizure systems in the brain: 1) the forebrain seizure network required for the expression of clonic seizures mediated by forebrain neurocircuitry, and 2) the brainstem seizure network necessary for the expression of brainstem or tonic seizures mediated by brainstem neurocircuitry. In seizure naïve animals, these two systems are separate, but developing models that can explore the intersection of the forebrain and brainstem seizure systems or for elucidating mechanisms responsible for bringing these two seizure systems together may aid in our understanding of: 1) how seizures can become more complex over time, and 2) sudden unexpected death in epilepsy (SUDEP) since propagation of seizure discharge from the forebrain seizure system to the brainstem seizure system may have an important role in SUDEP because many cardiorespiratory systems are localized in the brainstem. The repeated flurothyl seizure model of epileptogenesis, as described here, may aid in providing insight into these important epilepsy issues in addition to understanding how spontaneous seizures develop.
Keywords: Epilepsy Epileptogenesis Flurothyl Mouse Spontaneous seizures Seizure semiology changes
Background
Epilepsy is a complex and multifactorial disease defined by unprovoked spontaneous seizures. Approximately two-thirds of the epilepsy population are successfully treated with anticonvulsant drug regimens, but the remaining one third continue to experience seizures (Kwan and Brodie, 2000; Lindsten et al., 2001; Kwan et al., 2010; Loscher et al., 2013; Brodie, 2017). Given the complexities of genetic heterogeneity and inherent difficulties in studying the pathophysiology of epileptogenesis in humans, animal models of epilepsy have served important roles for understanding how spontaneous seizures develop. The mainstays of animal models of spontaneous seizures are either 1) chemically-induced status epilepticus models (SE: a condition characterized by continuous seizure activity) or electrically-induced SE models, or 2) traumatic brain injury (TBI) models. However, there are caveats with these models (Pitkänen et al., 2006). For instance, at least 30 min of SE (but more typically 1-2 h of SE) are required for the appearance of spontaneous seizures with the presence of spontaneous seizures being highly dependent on the duration of SE (Lemos and Cavalheiro, 1995; Gorter et al., 2003; Curia et al., 2008; Loscher, 2013; Kandratavicius et al., 2014; Polli et al., 2014; Gorter et al., 2016). Following these prolonged bouts of SE, there can be a significant increase in mortality (Goodman, 1998; Curia et al., 2008; Scorza et al., 2009; Loscher, 2013; Reddy and Kuruba, 2013; Kandratavicius et al., 2014). Given that SE is a significant seizure event, substantial neuronal death occurs (Goodman, 1998; Curia et al., 2008; Scorza et al., 2009; Loscher, 2013; Reddy and Kuruba, 2013; Kandratavicius et al., 2014). Importantly, both SE and substantial neuronal death are not common findings in most human epilepsies. Lastly, TBI models in rodents also have caveats in that very large regions of the brain require damage to produce spontaneous seizures, and substantial brain damage is not a common observation found in human epilepsy (Pitkänen et al., 2006). Therefore, new rodent models are needed limiting these caveats to continue to advance our understanding of epileptogenesis.
Experimental evidence suggests that there are two largely independent seizure systems that are responsible for the expression of generalized seizures (Kreindler et al., 1958; Browning et al., 1981; Browning and Nelson, 1986; Magistris et al., 1988; Applegate et al., 1991). These two seizure systems are referred to as the forebrain seizure network and the brainstem seizure network. Whereas the forebrain seizure network is responsible for the expression of clonic seizures, the brainstem seizure network is responsible for the expression of brainstem (tonic) seizures (Kreindler et al., 1958; Browning et al., 1981; Browning and Nelson, 1986; Magistris et al., 1988; Applegate et al., 1991). As such, forebrain neurocircuitry modulates the expression of clonic seizures, while brainstem neurocircuitry is both necessary and sufficient for the expression of a variety of tonic-brainstem seizure types. Notably, these seizure systems are mostly independent and the seizures elicited in one network do not readily spread to the other in seizure naïve rodents (Kreindler et al., 1958; Browning et al., 1981; Browning and Nelson, 1986; Magistris et al., 1988; Applegate et al., 1991). Interestingly, BOLD fMRI and SPECT imaging has revealed the critical nature of brainstem structures in the expression of tonic seizures in humans and in animal models (Blumenfeld et al., 2009; Varghese et al., 2009; DeSalvo et al., 2010). However, little is known regarding reorganizations that occur in the brainstem seizure network, or at the intersection of the forebrain seizure network and brainstem seizure network, which can both give rise to brainstem seizure expression.
Flurothyl is a volatile chemoconvulsant acting as a GABAA antagonist that was extensively used historically to induce seizures in severely depressed patients as an alternative to electroconvulsive shock therapy (Krasowski, 2000; Fink, 2014). There are three primary advantages of flurothyl as a chemoconvulsant. First, there are minimal stressors imparted on the rodents since flurothyl is highly volatile. It is infused into a chamber wherein the animal inhales the flurothyl thereby eliminating the need for injections. Second, flurothyl is rapidly eliminated unmetabolized through the lungs, thus eliminating potential confounds of residual convulsant remaining in the body (Krantz et al., 1957; Dolenz, 1967). Finally, flurothyl-induced seizure durations are short (e.g., typically 15-60 sec depending on the seizure type expressed) due to the ease of controlling seizures by simply exposing the animals to room air.
The repeated flurothyl seizure model can be used to understand how seizures develop and become more complex over time, and to explore the mechanistic intersections of the forebrain seizure network and brainstem seizure network that may lead to more complex seizure types (Applegate et al., 1997; Samoriski and Applegate, 1997; Samoriski et al., 1997; Ferland and Applegate, 1998a; 1998b and 1999). With the repeated flurothyl seizure model, C57BL/6J mice express clonic-forebrain seizures during eight flurothyl induction trials (Samoriski and Applegate, 1997; Papandrea et al., 2009). Following a one month incubation period and a rechallenge with flurothyl, C57BL/6J mice express a clonic-forebrain seizure that rapidly and uninterruptedly transitions into a tonic-brainstem seizure (Samoriski and Applegate, 1997; Ferland and Applegate, 1998b). We refer to these seizures as forebrainbrainstem seizures denoting the ictal progression from the forebrain seizure network to the brainstem seizure network (Papandrea et al., 2009; Kadiyala et al., 2015). Lastly, C57BL6/J mice exposed to the repeated flurothyl seizure model rapidly develop spontaneous seizures that appear to remit without treatment following 1 month (Kadiyala et al., 2016), in contrast to DBA2/J mice which also rapidly develop spontaneous seizures that do not remit (Kadiyala and Ferland, 2017). Here, we describe the methods for assaying mice in the repeated flurothyl seizure model, which was originally described 20 years ago (Applegate et al., 1997; Samoriski and Applegate, 1997) and continues to be characterized.
Materials and Reagents
18 G needle
3 x 3 in. medium gauze pads (CVS, catalog number: 893120 )
C57BL/6J male mice (6-7 weeks on arrival) (THE JACKSON LABORATORY, catalog number: 000664 )
Aquarium sealant
Flurothyl (Bis(2,2,2-trifluoroethyl) ether or 2,2,2-trifluoroethyl ether) (Sigma-Aldrich, catalog number: 287571 )
IMPORTANT: Perform all flurothyl exposures in a certified chemical fume hood with exhaust out of the laboratory, since the inhalation of flurothyl will result in seizures in humans.
95% ethanol (ethyl alcohol 190 proof) (PHARMCO-AAPER, catalog number: 111000190 )
Petroleum jelly
10% flurothyl solution (see Recipes)
Equipment
All-clear vacuum Plexiglas desiccator chamber (Ted Pella, model: 2240-1 )
20 ml glass syringe (Sigma-Aldrich, catalog number: Z101079 )
Syringe pump (Kent Scientific, model: GENIE Plus )
Forceps (for removing the flurothyl saturated gauze pad from the chamber)
Wire mesh colander with at least ¼” square mesh
Chemical fume hood
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ferland, R. J. (2017). The Repeated Flurothyl Seizure Model in Mice. Bio-protocol 7(11): e2309. DOI: 10.21769/BioProtoc.2309.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
231 | https://bio-protocol.org/exchange/protocoldetail?id=231&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In utero Electroporation of Mouse Embryo Brains
Xuecai Ge
Published: Vol 2, Iss 14, Jul 20, 2012
DOI: 10.21769/BioProtoc.231 Views: 28136
Original Research Article:
The authors used this protocol in Jan 2010
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2010
Abstract
This is a non-invasive technique to introduce transgenes into developing brains. In this technique, DNA is injected into the lateral ventricle of the embryonic brains, and is incorporated into the cells through electroporation. Embryos then continue their development in normal conditions in vivo. The effects of genes of interest can be evaluated at certain time points after in utero electroporation. This technique allows acute knockdown or over expression of genes of interest. Compensatory effects from other genes are less likely to happen; it also circumvents possible chronic detrimental effects.
Keywords: In utero electroporation Embryo DNA Neocortex Brain
Materials and Reagents
EndoFree Plasmid Kit (QIAGEN, catalog number: 12362 )
Fast green FCF (Sigma-Aldrich, catalog number: F7252 )
Sterile saline (0.9% sodium chloride)
70% ethanol
Katemine + Xylzaine mixture (see Recipes)
Equipment
Micropipettes (Borosilicate with filament O.D.: 1mm, I.D.: 0.78 mm, 10 cm length) (Sutter Instruments, catalog number: BF100-78-10 )
Micropipette puller P-97/ IVF (Sutter Instruments, Novato, CA)
Electroporator (Electro-Square porator CUY21) (NEPA Gene)
Platinum plate tweezers-type electrode (Protech International, model: CUY650-P5 )
Ring forceps (Fine Science Tools, catalog number: 11101-09 )
Serrated forceps (Fine Science Tools, catalog number: 11000-12 )
Fine scissors (Fine Science Tools, catalog number: 14060-09 )
Needle holder (Fine Science Tools, catalog number: 12003-15 )
Silk Black Braided Suture (Ethicon, catalog number: K871 )
3”x3” Sterile Gauze (Dynarex, catalog number: 3353 )
Square pulse electroporator CUY21 (Nepagene, Japan). A foot pedal is required, because during the surgery both of your hands are occupied to hold the animal and the electrodes, respectively.
Mouth pipet (Sigma-Aldrich, catalog number: A5177 )
Fiber optic light Nikon MKII or any other brand)
Vaporizer for isoflurane anesthetic (Porter Instruments Company, model: 100-F )
Isoflurane is highly recommended as anesthetics. If this is not available, intraperitoneal injection of the mixture of ketamine (80-100 mg/kg) and xylazine (5-10 mg/kg) will also work. But avoid avertin that is toxic to embryos.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ge, X. (2012). In utero Electroporation of Mouse Embryo Brains. Bio-protocol 2(14): e231. DOI: 10.21769/BioProtoc.231.
Download Citation in RIS Format
Category
Neuroscience > Development > Morphogenesis
Molecular Biology > DNA > Transformation
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,310 | https://bio-protocol.org/exchange/protocoldetail?id=2310&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Photometric Assays for Chloroplast Movement Responses to Blue Light
HG Halina Gabryś
AB Agnieszka Katarzyna Banaś
PH Pawel Hermanowicz
WK Weronika Krzeszowiec
SL Sebastian Leśniewski
JŁ Justyna Łabuz
OS Olga Sztatelman
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2310 Views: 7191
Edited by: Scott A M McAdam
Reviewed by: Sam-Geun Kong
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
Assessment of chloroplast movements by measuring changes in leaf transmittance is discussed, with special reference to the conditions necessary for reliable estimation of blue light–activated chloroplast responses.
Keywords: Arabidopsis thaliana Blue light Chloroplast movements Leaf transmittance Photometric method Phototropins
Background
Following the discovery of phototropins, chloroplast movements activated with blue light absorbed by these photoreceptors began to arouse much interest. Quantitative assessment of chloroplast redistribution in a multilayer leaf relies mainly on measuring transmittance changes of the tissue that are a consequence of this redistribution. Various devices have been used for that purpose, including a recently adapted commercial microplate reader (Wada and Kong, 2011; Johansson and Zeidler, 2016), particularly suited for screening large number of samples. However, samples must be properly pretreated and characterized to make their comparison reliable. This aspect has not been referred to in many papers making use of the transmittance technique. Hence, we found it important to discuss these issues in the current protocol.
Materials and Reagents
Thin microscope slide with double wells (Ted Pella, catalog number: 260242 )
Cling film
Tissue paper
Optionally, for measurements of water plants or infiltrated leaf pieces
Parafilm M (Sigma-Aldrich, catalog number: P7793 )
Silicon grease (Baysilone-Paste, GE Bayer Silicones)
2 ml syringe
Equipment
Custom-made photometer, based on Walczak and Gabryś (1980). This device is a prototype that contains the following commercially available parts (Figure 1):
Luxeon Royal Blue LXHL-FR5C LED (460 nm) (Luxeon Star, catalog number: LXHL-FR5C )–the source of the blue actinic beam (Figure 1A)
Note: This product has been discontinued.
L-793SRD-B LED (660 nm) (Kingbright, catalog number: L-793SRD-B )–the source of the red measuring light (Figure 1B)
BPW20RF Planar Silicon PN photodiode (Vishay, catalog number: BPW20RF )–the detector (Figure 1E)
NI USB-6001 DAQ board (National Instruments, model: USB-6001 )–for signal digitization (Figure 1F)
Figure 1. A double-beam photometer used for measurements of transmittance changes resulting from blue light–activated chloroplast movements. Key components: A. blue LED housing; B. red LED housing; C. measuring chamber; D. 660 nm interference filter; E. receiver photodiode; F. electronic controller.
Software
Software appropriate for analysis of numerical data, e.g., R, Octave, MATLAB, or Mathematica, equipped with a digital filter appropriate for numerical differentiation (e.g., Savitzky-Golay filter, available in the R software as ‘sgolayfilt’, part of the ‘signal’ library)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gabryś, H., Banaś, A. K., Hermanowicz, P., Krzeszowiec, W., Leśniewski, S., Łabuz, J. and Sztatelman, O. (2017). Photometric Assays for Chloroplast Movement Responses to Blue Light. Bio-protocol 7(11): e2310. DOI: 10.21769/BioProtoc.2310.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Live-cell imaging
Cell Biology > Organelle isolation > Chloroplast
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,311 | https://bio-protocol.org/exchange/protocoldetail?id=2311&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Intracaecal Orthotopic Colorectal Cancer Xenograft Mouse Model
HL Hsin-Wei Liao
MH Mien-Chie Hung
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2311 Views: 13018
Edited by: Jia Li
Reviewed by: ilgen MenderAmriti Rajender LullaAna Santos Almeida
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
The host microenvironment plays a prominent role in tumor growth, angiogenesis, invasion, metastasis, and response to therapy. Orthotopic tumor model mimics the natural environment of tumor development and provides an effective approach to investigate tumor pathophysiology and develop therapeutic strategies. This protocol describes the technique involving injection of colorectal cancer cell suspension into the intestinal wall of mice to establish an orthotopic colorectal tumor model.
Keywords: Colorectal cancer Orthotopic model Cecum Ascending colon Nude mice
Background
Various murine models have been developed to facilitate studies of human cancers and allow better understanding of mechanisms contributing to tumor growth. While heterotopic xenograft models involve implanting cancer cells into the flank of immunocompromised mouse subcutaneously, orthotopic tumor models more closely resemble the original tumor development due to the implantation of tumor cells directly into the organ of origin (Richmond and Su, 2008). Although orthotopic xenograft models are technically challenging and labor-intensive, orthotopic transplants are able to more accurately mimic human tumor and better predict a patient’s response to chemotherapy in comparison with heterotopic transplants because of the effects of tumor microenvironment (Talmadge et al., 2007). With increased knowledge regarding the important role of tumor-host cell interaction during tumor progression, genetically engineered mouse (GEM) models using immunocompetent mice extend our ability to model the complexity of human cancers (Gopinathan and Tuveson, 2008; Zitvogel et al., 2016). However, GEM models are more expensive, often require months to a year to develop tumors, and have the drawbacks regarding the heterogeneity of tumor frequency, latency and growth. By contrast, xenografts are less expensive, require less time to establish tumors, and have better reproducibility (Vandamme, 2014). In this protocol, we describe the procedure of generating orthotopic colorectal cancer by injecting human cancer cells into immunocompromised mice (Tseng et al., 2007; Liao et al., 2015).
Materials and Reagents
27 G x 5/8 syringes (BD, catalog number: 329412 )
0.5-μm membrane filter (EMD Millipore, catalog number: FHLC04700 )
6-8-week old female NU/J nude mice (THE JACKSON LABORATORY, catalog number: 007850 ) or CB17 severe combined immunodeficient (SCID) mice (Charles River, Quebec, Canada)
Phosphate-buffered saline (PBS), sterile (Corning, catalog number: 21-040 )
Buprenorphine SR-LAB (Zoopharm, Windsor, CO)
Betadine
70% alcohol
Ophthalmic ointment
0.9% sodium chloride irrigation (Hospira, catalog number: 0409-6138-22 )
2,2,2-Tribromoethanol (Sigma-Aldrich, catalog number: T48402 )
2-methyl-2-butanol (Sigma-Aldrich, catalog number: 152463 )
Avertin working solution or ketamine/xylazine/acepromazine (see Recipes)
Equipment
Forceps (sterilize before use) (Fine Science Tools, catalog number: 11006-12 )
Surgical scissors (sterilize before use) (Fine Science Tools, catalog number: 91402-12 )
Reflex wound closure clip applier (Fine Science Tools, catalog number: 12020-09 )
Reflex wound closure clips (Fine Science Tools, catalog number: 12022-09 )
Reflex wound clip remover (Fine Science Tools, catalog number: 12023-00 )
Heat lamp (Morganville Scientific, catalog number: HL0100 )
BETADINE® Solution Swab Aid® Antiseptic pads (Moore medical, catalog number: 90697 )
Virkon® disinfectant cleaner (Sigma-Aldrich, catalog number: Z692158 )
Trimmer/clipper (Wahl Clipper, catalog number: 8685 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liao, H. and Hung, M. (2017). Intracaecal Orthotopic Colorectal Cancer Xenograft Mouse Model. Bio-protocol 7(11): e2311. DOI: 10.21769/BioProtoc.2311.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Animal models
Cell Biology > Cell Transplantation > Allogenic Transplantation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,312 | https://bio-protocol.org/exchange/protocoldetail?id=2312&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Heavy Metal Stress Assay of Caenorhabditis elegans
SP Strahil Iv. Pastuhov
TS Tatsuhiro Shimizu
NH Naoki Hisamoto
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2312 Views: 10594
Edited by: Oneil G. Bhalala
Reviewed by: Tugsan TezilJian Chen
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
Organisms have developed many protective systems to reduce the toxicity from heavy metals. The nematode Caenorhabditis elegans has been widely used to determine the protective mechanisms against heavy metals. Responses against heavy metals can be monitored by expression of reporter genes, while sensitivity can be determined by quantifying growth or survival rate following exposure to heavy metals.
Keywords: Caenorhabditis elegans Arsenic Cadmium Copper
Background
Some heavy metals, such as arsenic, cadmium and mercury, are known to be harmful to the majority of organisms including humans (Valko et al., 2005). To reduce the toxicity by these metals, the organisms have developed various protective systems. The nematode Caenorhabditis elegans has been used to understand the mechanisms of protection against heavy metals. Previous studies have revealed that many genes, such as detoxification enzymes, transcription factors and signaling factors, are involved in the protection from heavy metals in this organism (Broeks et al., 1996; Mizuno et al., 2004; Inoue et al., 2005; Schwartz et al., 2010). Determinations of viability and growth, in addition to measurements of reporter gene expression, are usually used to monitor the effects of heavy metals in C. elegans. In this protocol, we describe the methods for assays for arsenic, copper and cadmium using C. elegans.
Materials and Reagents
Latex glove (KCWW, Kimberly-Clark, catalog number: 57330 )
Petri dishes 60 x 15 mm (Iwaki, catalog number: 1010-060 )
1.5 ml plastic tubes (Eppendorf, catalog number: 3810X )
1 ml pipetman tips (Thermo Fisher Scientific, Thermo Scientific, catalog number: 111-N-Q )
0.2 ml pipetman tips (Thermo Fisher Scientific, Thermo Scientific, catalog number: 110-N-Q )
Slide glass (Matsunami Glass, catalog number: S2227 )
Paper tape
Cover glass (Matsunami Glass, 18 x 18, Thickness No.1)
Corning 50 ml centrifuge tubes (Corning, catalog number: 4558 )
Petri dishes 35 x 15 mm (Iwaki, catalog number: 1000-035 )
Pasteur pipet, 5 inch (Iwaki, catalog number: IK-PAS-5P )
Parafilm (Wako Pure Chemical Industries, catalog number: 535-02443 )
Autoclave tape
pH probe (As One, catalog number: 2-347-05 )
10 ml glass tubes (Iwaki, catalog number: 09183982 )
99.98% Platinum Wire, ø0.2 mm (Nilaco, catalog number: 351325 )
OP50 E. coli bacteria (University of Minnesota, C. elegans Genetics Center, N/A)
Worm strains (can be obtained from CGC: see Table 1 for example)
Calcium chloride dihydrate (CaCl2·2H2O) (Wako Pure Chemical Industries, catalog number: 031-00435 )
Potassium phosphate dibasic (K2HPO4) (Wako Pure Chemical Industries, catalog number: 164-04295 )
Potassium phosphate monobasic (KH2PO4) (Wako Pure Chemical Industries, catalog number: 169-04245 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Wako Pure Chemical Industries, catalog number: 138-00415 )
Bacto peptone (BD, BactoTM, catalog number: 211677 )
Sodium chloride (NaCl) (Wako Pure Chemical Industries, catalog number: 191-01665 )
Bacto agar (BD, BactoTM, catalog number: 214010 )
Distilled water
Cholesterol (Wako Pure Chemical Industries, catalog number: 034-03002 )
99.5% ethanol (Wako Pure Chemical Industries, catalog number: 057-00456 )
LB broth (BD, Difco, catalog number: 244620 )
Sodium phosphate dibasic (Na2HPO4) (Wako Pure Chemical Industries, catalog number: 194-02875 )
Pentahydrate copper sulphate (CuSO4·5H2O) (Wako Pure Chemical Industries, catalog number: 034-20065 )
Cadmium chloride, anhydrous (CdCl2) (Wako Pure Chemical Industries, catalog number: 036-00125 )
Sodium (mate)arsenite (NaAsO2) (Sigma-Aldrich, catalog number: S7400 )
Gelatin (Sigma-Aldrich, catalog number: G7765 )
Agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500500 )
Tris base (Nacalai Tesque, catalog number: 35434-05 )
Hydrochloric acid (HCl; 35-37%) (Wako Pure Chemical Industries, catalog number: 080-01066 )
SDS (Wako Pure Chemical Industries, catalog number: 191-07145 )
Glycerol (Wako Pure Chemical Industries, catalog number: 075-00616 )
Bromophenol blue (Wako Pure Chemical Industries, catalog number: 021-02911 )
2-mercaptoethanol (Wako Pure Chemical Industries, catalog number: 135-07522 )
Sodium azide (Wako Pure Chemical Industries, catalog number: 195-11092 )
1 M CaCl2 (see Recipes)
1 M K-phosphate buffer (pH 6) (see Recipes)
1 M MgSO4 (see Recipes)
NGM solution (see Recipes)
6 cm NGM dish with OP50 (see Recipes)
0.5% cholesterol (see Recipes)
LB broth (see Recipes)
M9 buffer (see Recipes)
1 M sodium azide (see Recipes)
1 M CuSO4 (see Recipes)
1 M CdCl2 (see Recipes)
0.5 M sodium arsenite (see Recipes)
2% gelatin (see Recipes)
2% agarose (see Recipes)
2% agarose with 10 mM sodium azide (see Recipes)
Tris-HCl (pH 6.8) (see Recipes)
1 M 3x SDS sample buffer (see Recipes)
Equipment
Stereomicroscope (Olympus, model: SZ60 )
Centrifuge (TOMY, model: MX-100 )
Rotator (TAITEC, model: RT-50 , catalog number: 0000165-000)
Fluorescent microscope (Nikon Instruments, model: Eclipse E800 ) with highly sensitive camera (ANDOR, model: Zyla 5.5 ) controlled by Nikon NIS-Elements software
Pipetman (P-20, P-200, P-1000; Gilson)
Heat block (TAITEC, model: DTU-Mini , catalog number: 0063287-000)
Autoclave (TOMY DIGITAL BIOLOGY, model: SX-500 )
Microwave oven (Sharp)
Pipettor (Drummond Scientific, model: Pipet-Aid® XP , catalog number: 4-000-101)
Shaker (TAITEC, model: Personal-11 , catalog number: 0000145-000)
Refrigerated incubator (Panasonic Healthcare, model: MIR-154-PJ )
Bunsen burner (Warzef)
Dental burner (Phoenix-Dent, model: APT-3 )
Software
ImageJ software (https://imagej.nih.gov/ij/download.html)
GraphPad Prism QuickCalcs (https://www.graphpad.com/quickcalcs/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Pastuhov, S. I., Shimizu, T. and Hisamoto, N. (2017). Heavy Metal Stress Assay of Caenorhabditis elegans. Bio-protocol 7(11): e2312. DOI: 10.21769/BioProtoc.2312.
Pastuhov, S. I., Fujiki, K., Tsuge, A., Asai, K., Ishikawa, S., Hirose, K., Matsumoto, K. and Hisamoto, N. (2016). The Core Molecular Machinery Used for Engulfment of Apoptotic Cells Regulates the JNK Pathway Mediating Axon Regeneration in Caenorhabditis elegans. J Neurosci 36(37): 9710-9721.
Download Citation in RIS Format
Category
Biochemistry > Other compound > Elements
Molecular Biology > Protein > Expression
Microbiology > Microbial physiology > Stress response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.