id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
2,313 | https://bio-protocol.org/exchange/protocoldetail?id=2313&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Formation of Minimised Hairpin Template-transcribing Dumbbell Vectors for Small RNA Expression
Xiaoou Jiang
Volker Patzel
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2313 Views: 9008
Edited by: Longping Victor Tse
Reviewed by: Gal Haimovich
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
A major barrier for using non-viral vectors for gene therapy is the short duration of transgene expression in postmitotic tissues. Previous studies showed transgene expression from conventional plasmid fell to sub-therapeutic level shortly after delivery even though the vector DNA was retained, suggesting transcription was silenced in vivo (Nicol et al., 2002; Chen et al., 2004). Emerging evidence indicates that plasmid bacterial backbone sequences are responsible for the transcriptional repression and this process is independent of CpG methylation (Chen et al., 2008). Dumbbell-shaped DNA vectors consisting solely of essential elements for transgene expression have been developed to circumvent these drawbacks. This novel non-viral vector has been shown to improve transgene expression in vitro and in vivo (Schakowski et al., 2001 and 2007). Here we describe a novel method for fast and efficient production of minimised small RNA-expressing dumbbell vectors. In brief, the PCR-amplified promoter sequence is ligated to a chemically synthesized hairpin RNA coding DNA template to form the covalently closed dumbbell vector. This new technique may facilitate applications of dumbbell-shaped vectors for preclinical investigation and human gene therapy.
Keywords: Dumbbell vector Minimal vector Small RNA expression miRNA shRNA Genetic therapy
Background
With regard to delivery, a small vector size is advantageous improving extracellular transport including extravasation and diffusion through the extracellular matrix network as well as cellular uptake and nuclear diffusion. Various methods for dumbbell vector production have been developed over the time including methods for the generation of dumbbells expressing small RNAs such as small hairpin RNAs (shRNAs) and microRNAs (miRNAs) (Schakowski et al., 2001; Taki et al. 2004). These vectors usually harbour redundant sequences as the expressed RNAs are self-complementary. We eliminated redundant sequences generating minimised dumbbell vectors in which transcription goes around the hairpin structure of the dumbbell itself (Jiang et al., 2016). Such minimised dumbbell vectors can be as short as 130 bp representing the smallest expression vectors ever reported. An illustrated comparison between a conventional plasmid, a dumbbell harbouring a linear expression cassette, and a novel hairpin template-transcribing dumbbell vector is shown in Figure 1. This novel protocol facilitates the production of the new minimised small RNA expression dumbbell vectors.
.
Figure 1. Structures of small hairpin RNA-expressing plasmid and dumbbell vectors. Upper two: conventional plasmid p-iPR-linear-s/as and dumbbell db-iPR-linear-s/as vectors with linear shRNA expression cassettes and integrated promoter-restriction endonuclease site element (iPR). Lower vector: minimized hairpin template (hp) dumbbell harboring an iPRT element. R indicates a restriction overhang ligation site. T indicates termination signal. IT indicates inverted termination signal. Loops L1 and L2 are (T)4 tetra loops.
Materials and Reagents
0.2-10 μl pipette tips, Corning® Isotip® filtered (Corning, catalog number: 4807 )
1-200 μl pipette tips (Corning, Axyge®, catalog number: TF-200-R-S )
100-1,000 μl pipette tips (Corning, Axygen®, catalog number: TF-1000-R-S )
1.5 ml microcentrifuge tubes (RNase, DNase and Pyrogen-Free) (Corning, Axygen®, catalog number: MCT-150-C )
0.2 ml thin-walled PCR tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3412 )
Falcon® 50 ml conical centrifuge tubes (Corning, Falcon®, catalog number: 352070 )
pSuper-basic vector (Oligoengine, catalog number: VEC-pBS-0002 )
miRNA-coding oligonucleotide (PAGE purified) 5’-pGATCTAGCACGACTCGCAGCTCCCAAGAGCCTAACCCGTGGATTTAAACGGTAAACATCACAAGTTAGGGTCTCAGGGACTGAGAGGAGCGCAA-3’
Oligonucleotides for minimal H1 (mH1) promoter (PAGE purified)
mH1-Fw: 5’-pAATTCATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGAGCACAGA-3’
mH1-Rv: 5’-pGATCTCTGTGCTCTCATACAGAACTTATAAGATTCCCAAATCCAAAGACATTTCACGTTTATGGTGATTTCCCAGAACACATAGCGACATGCAAATATG-3’
UltraPureTM DNase/RNase-Free distilled water (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977015 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670-100G )
dNTP set 100 mM solutions (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0181 )
Oligonucleotide primers for mH1 promoter amplification (HPCL purified)
NbBpu-Fw
5’-pTTAGGAGTTTTCTCCTAAGCATATTTGCATGTCGCTATGTGTTCTG-3’
BamHI-Rv
5’-TGCAGGATCCCTGTGCTCTCATACAGAACTTATAAGATTCCC-3’
Taq DNA polymerase, recombinant (5 U/µl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EP0402 )
QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106 )
10x FD buffer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: B64 )
Nb.Bpu10I (5 U/µl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: ER1681 )
FastDigest BamHI (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FD0054 )
shRNA-coding oligonucleotide (PAGE purified) 5’-pGATCTAAAAAGAGCTGTTTCTGAGGAGCCTCTCTTGAAGGCTCCTCAGAAACAGCTCTTTTTA-3’
T4 DNA ligase (5 U/µl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EL0014 )
Neutralizing oligonucleotide (HPLC purified)
5’-TTAGGAGTTTTCTCCTAA-3’
Adenosine 5’-triphosphate disodium salt hydrate (Sigma-Aldrich, catalog number: A2383-1G )
FastDigest BglII (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FD0083 )
T7 DNA polymerase (10 U/µl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EP0081 )
Phenol solution (Sigma-Aldrich, catalog number: P4557-100ML )
Chloroform (Sigma-Aldrich, catalog number: 288306-1L )
3-methyl-1-butanol (Sigma-Aldrich, catalog number: 309435-100ML )
Ethanol, absolute (Fisher Scientific, catalog number: BP28184 )
3 M potassium acetate (pH 4.8)
Sodium acetate (Sigma-Aldrich, catalog number: S2889-250G )
FastDigest EcoRI (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FD0274 )
Agarose, LE, analytical grade (Promega, catalog number: V3125 )
Ethidium bromide solution (Bio-Rad Laboratories, catalog number: 1610433 )
GeneRuler DNA ladder mix (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SM0331 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888-500G )
Tris-HCl (Powder) (Roche Diagnostics, catalog number: 10812846001 )
EDTA (Sigma-Aldrich, catalog number: EDS-100G )
10x hybridization buffer (see Recipes)
TE buffer (see Recipes)
Equipment
Pipettes (Gilson, PIPETMAN® Classic, models: P2, P20N, P200N, and P1000N )
Standard thermal cycler (Thermo Fisher Scientific, Applied BiosystemsTM, model: GeneAmp PCR System 9700 )
Note: This product has been discontinued.
Gel doc (Bio-Rad Gel Doc Imager)
Gel running apparatus (Thermo Fisher Scientific, Amersham BiosciencesTM)
Gel staining tray
Benchtop centrifuge (Eppendorf, model: 5430 R )
Heat block (Eppendorf, model: Thermomixer® Comfort )
Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDrop 2000 )
Glass beaker (Schott, Duran)
Microwave (Panasonic)
Software
ImageJ (http://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jiang, X. and Patzel, V. (2017). Formation of Minimised Hairpin Template-transcribing Dumbbell Vectors for Small RNA Expression. Bio-protocol 7(11): e2313. DOI: 10.21769/BioProtoc.2313.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,314 | https://bio-protocol.org/exchange/protocoldetail?id=2314&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Flow Cytometric Analysis of HIV-1 Transcriptional Activity in Response to shRNA Knockdown in A2 and A72 J-Lat Cell Lines
DB Daniela Boehm
MO Melanie Ott
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2314 Views: 9529
Edited by: Emilie Besnard
Reviewed by: Emilie Battivelli
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
The main obstacle to eradicating HIV-1 from patients is post-integration latency (Finzi et al., 1999). Antiretroviral treatments target only actively replicating virus, while latent infections that have low or no transcriptional activity remain untreated (Sedaghat et al., 2007). To eliminate viral reservoirs, one strategy focuses on reversing HIV-1 latency via ‘shock and kill’ (Deeks, 2012). The basis of this strategy is to overcome the molecular mechanisms of HIV-1 latency by therapeutically inducing viral gene and protein expression under antiretroviral therapy and to cause selective cell death via the lytic properties of the virus, or the immune system now recognizing the infected cells. Recently, a number of studies have described the therapeutic potential of pharmacologically inhibiting members of the bromodomain and extraterminal (BET) family of human bromodomain proteins (Filippakopoulos et al., 2010; Dawson et al., 2011; Delmore et al., 2011) that include BRD2, BRB3, BRD4 and BRDT. Small-molecule BET inhibitors, such as JQ1 (Filippakopoulos et al., 2010; Delmore et al., 2011), I-BET (Nicodeme et al., 2010), I-Bet151 (Dawson et al., 2011), and MS417 (Zhang et al., 2012) successfully activate HIV transcription and reverse viral latency in clonal cell lines and certain primary T-cell models of latency. To identify the mechanism by which BET proteins regulate HIV-1 latency, we utilized small hairpin RNAs (shRNAs) that target BRD2, BRD4 and Cyclin T1, which is a component of the critical HIV-1 cofactor positive transcription elongation factor b (P-TEFb) and interacts with BRD2, and tested them in the CD4+ J-Lat A2 and A72 cell lines. The following protocol describes a flow cytometry-based method to determine the amount of transcriptional activation of the HIV-1 LTR upon shRNA knockdown. This protocol is optimized for studying latently HIV-1-infected Jurkat (J-Lat) cell lines.
Keywords: Human immunodeficiency virus-1 Latency shRNA knockdown Transcriptional activation Flow cytometry HIV-1 LTR J-Lat cells lines BRD2 BRD4 Cyclin T1
Background
A72 J-Lat cells contain a latent HIV minigenome composed of just the HIV promoter in the 5’LTR that drives the expression of the fluorescent marker GFP (LTR-GFP; A72) while in A2 cells transcriptional activity is driven by the viral transactivator Tat (LTR-Tat-IRES-GFP; A2) (Jordan et al., 2001 and 2003). HIV transcription can be induced in both cell lines with TNFα mimicking T cell-receptor engagement. Cells were transduced with lentiviral vectors expressing two different shRNAs targeting each cellular protein or a scrambled control, followed by puromycin treatment to select successfully transduced cells. Cells were then stimulated with a suboptimal or saturating dose of TNFα or were left unstimulated for 24 h, followed by flow cytometry of GFP to assess transcriptional activation of the HIV-1 LTR.
Materials and Reagents
Production of shRNA containing virus particles
175 cm2 tissue culture flask (Corning, Falcon®, catalog number: 353112 )
Tips
0.1-10 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-681-440 )
1-200 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-502 )
101-1,000 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-509 )
15 ml conical tube (Fisher Scientific, FisherbrandTM, catalog number: 05-539-5 )
10 cm dish (Corning, catalog number: 353803 )
10 ml syringes (BD, catalog number: 309604 )
0.45 µm syringe filter (EMD Millipore, catalog number: SLHV033RS )
HEK293T cells (ATCC, catalog number: CRL-3216 )
shRNA-expressing lentiviral vectors (Sigma-Aldrich) to knockdown:
a.BRD2: TRCN0000006308 and TRCN0000006310
b.BRD4: TRCN0000021424 and TRCN0000021428
c.Cyclin T1: TRCN0000013673 and TRCN0000013675
d.Control: pLKO.1 vector containing scramble shRNA
e.Lentiviral packaging construct pCMVdelta R8.91 (Naldini et al., 1996)
f.VSV-G glycoprotein-expressing vector (Naldini et al., 1996)
DMEM (Mediatech, catalog number: 10-013-CV )
Fetal bovine serum (FBS) (Gemini Bio-Products, catalog number: 100-106 )
L-glutamine (Mediatech, catalog number: 25-005-Cl )
100x penicillin/streptomycin (Mediatech, catalog number: 30-002-Cl )
1x PBS (Mediatech, catalog number: 21-031-CV )
Trypsin-EDTA (Mediatech, catalog number: 25-052-Cl )
Chloroquine diphosphate salt (Sigma-Aldrich, catalog number: C6628 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Dextrose (Fisher Scientific, catalog number: BP350-1 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Sodium phosphate dibasic (Na2HPO4) (Fisher Scientific, catalog number: BP332-500 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C1016 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Nuclease-free H2O (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9937 )
Lenti-XTM p24 Rapid Titer Kit (Takara Bio, Clontech, catalog number: 632200 )
25 mM chloroquine (see Recipes)
HBSS buffer (see Recipes)
2 M CaCl2 (see Recipes)
Glycerol shock solution (see Recipes)
Infection of A2 and A72 J-Lat cells
75 cm2 tissue culture flask (Corning, Falcon®, catalog number: 353110 )
6 well tissue culture plates (Corning, Falcon®, catalog number: 353224 )
Posi-ClickTM 1.7 ml microcentrifuge tubes (Denville Scientific, catalog number: C2170 )
Tips
0.1-10 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-681-440 )
1-200 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-502 )
101-1,000 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-509 )
A2 and A72 J-Lat cells (Jordan et al., 2003)
RPMI (Mediatech, catalog number: 10-040-CV )
Fetal bovine serum (FBS) (Gemini Bio-Products, catalog number: 100-106 )
L-glutamine (Mediatech, catalog number: 25-005-Cl )
100x penicillin/streptomycin (Mediatech, catalog number: 30-002-Cl )
Polybrene® (Santa Cruz Biotechnology, catalog number: sc-134220 )
Puromycin (Sigma-Aldrich, catalog number: P7255 )
Polybrene solution (see Recipes)
Analysis of HIV-1 LTR transcriptional activation by flow cytometry
96-well tissue culture plates and lids (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 249570 and 163320 )
Tips
0.1-10 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-681-440 )
1-200 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-502 )
101-1,000 µl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-509 )
A2 and A72 J-Lat cells (Jordan et al., 2003)
1x PBS (Mediatech, catalog number: 21-031-CV )
RPMI (Mediatech, catalog number: 10-040-CV )
Fetal bovine serum (FBS) (Gemini Bio-Products, catalog number: 100-106 )
L-glutamine (Mediatech, catalog number: 25-005-Cl )
100x penicillin/streptomycin (Mediatech, catalog number: 30-002-Cl )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
TNFα (PeproTech, catalog number: 300-01A ), make stock solution of 100 ng/μl in sterile H2O
7AAD, Propidium iodide or one of the Zombie viability dyes
JQ1 (Cayman Chemical, catalog number: 11187 ), make stock solution of 10 mM in DMSO
MACSQuant Running buffer (Miltenyi Biotech, catalog number: 130-092-747 )
ApoTox-GloTM Triplex Assay (Promega, catalog number: G6320 )
Confirmation of shRNA knockdown efficiency by SDS-PAGE and Western blot
Posi-ClickTM 1.7 ml microcentrifuge tubes (Denville Scientific, catalog number: C2170 )
Nitrocellulose membrane 0.2 µm (Bio-Rad Laboratories, catalog number: 1620112 )
Whatman paper (GE Healthcare, catalog number: 3030-917 )
High-performance chemiluminescence film (GE Healthcare, catalog number: 28906839 )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
NP-40 (Igepal CA-630) (Sigma-Aldrich, catalog number: I3021 )
Na-deoxycholate (Deoxycholic acid, sodium salt) (Fisher Scientific, catalog number: BP349-100 )
Sodium dodecyl sulfate (SDS) (Fisher Scientific, catalog number: BP166-500 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Ethylenediaminetetraacetic acid (EDTA) (Fisher Scientific, catalog number: S311-500 )
Sodium fluoride (NaF) (Sigma-Aldrich, catalog number: S6521 )
Note: This product has been discontinued.
DCTM Protein assay (Reagents A, B and S, Bio-Rad Laboratories, catalog numbers: 5000113 , 5000114 , 5000115 )
Mini-Protean® TGXTM Gels (Bio-Rad Laboratories, catalog number: 4569034 )
PageRulerTM Prestained protein ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 26617 )
Antibodies for Western blot
Rabbit polyclonal anti-BRD2 (Cell Signaling, catalog number: 5848 )
Rabbit polyclonal anti-BRD4 (Abcam, catalog number: ab75898 )
Rabbit polyclonal anti-Cyclin T1 (Santa Cruz Biotechnology, catalog number: sc-10750 )
Rabbit polyclonal anti-α-Tubulin (Abcam, catalog number: ab15246 )
Goat-anti-Rabbit IgG, HRP conjugated (Bethyl Laboratories, catalog number: A120-201P )
Tween® 20 (Fisher Scientific, catalog number: BP337-500 )
Glycine (Fisher Scientific, catalog number: BP381-5 )
Methanol (Fisher Scientific, catalog number: A433P-4 )
Blotting-grade blocker (dry milk) (Bio-Rad Laboratories, catalog number: 1706404 )
Lumi-light Western blotting substrate (Roche Diagnostics, catalog number: 12015200001 )
RIPA buffer (see Recipes)
Western blot running buffer (see Recipes)
Western blot transfer buffer (pH 8.3) (see Recipes)
TBS-T buffer (see Recipes)
Equipment
Pipette
Biosafety cabinet ‘Level 2’
Tabletop centrifuge for Eppendorf tubes (Eppendorf, model: 5415 D )
Tabletop centrifuge for 96-well plates, Eppendorf, 15 ml and 50 ml tubes; used for spininfection (Beckman Coulter, model: Allegra X-14R )
CO2 tissue culture incubator, 37 °C (Thermo Electron, model: FormaTM Steri-CultTM CO2 Incubators, catalog number: 3307)
MACSQuant VYB FACS analyzer (Miltenyi Biotech, model: MACSOuant® VYB , catalog number: 130-096-116)
Mini-PROTEAN® Electrophoresis System (Bio-Rad Laboratories, catalog-numbers: 1658006FC and 1703935 )
PowerPacTM HC (Bio-Rad Laboratories, model: Power Pac HC High-Current Power Supply , catalog number: 1645052)
Rocker II (Boekel Scientific, catalog number: 260350 )
SpectraMax MiniMaxTM 300 Imaging Cytometer (Molecular Devices, model: SpectraMax MiniMax 300 )
Software
FlowJo 9.9 or never (Tree Star)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Boehm, D. and Ott, M. (2017). Flow Cytometric Analysis of HIV-1 Transcriptional Activity in Response to shRNA Knockdown in A2 and A72 J-Lat Cell Lines. Bio-protocol 7(11): e2314. DOI: 10.21769/BioProtoc.2314.
Download Citation in RIS Format
Category
Cell Biology > Single cell analysis > Flow cytometry
Molecular Biology > DNA > Transfection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,315 | https://bio-protocol.org/exchange/protocoldetail?id=2315&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for Enrichment of the Membrane Proteome of Mature Tomato Pollen
Puneet Paul
Palak Chaturvedi
AM Anida Mesihovic
Arindam Ghatak
WW Wolfram Weckwerth
ES Enrico Schleiff
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2315 Views: 7516
Edited by: Samik Bhattacharya
Reviewed by: Ning Liu
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
We established and elaborated on a method to enrich the membrane proteome of mature pollen from economically relevant crop using the example of Solanum lycopersicum (tomato). To isolate the pollen protein fraction enriched in membrane proteins, a high salt concentration (750 mM of sodium chloride) was used. The membrane protein-enriched fraction was then subjected to shotgun proteomics for identification of proteins, followed by in silico analysis to annotate and classify the detected proteins.
Keywords: Membrane proteome Pollen Tomato Proteomics
Background
As proper distribution of proteins and solutes between different cellular compartments or the insertion of newly-synthesized proteins into membranes is largely dependent on membrane proteins, the membrane proteome is central for maintenance of cellular and organellar homeostasis (Paul et al., 2013; 2014 and 2016a). Considering the importance of membrane proteins in general, these are also essential for pollen function and development (Paul et al., 2016b). Many global pollen proteomic studies have been performed in the past (Chaturvedi et al., 2013 and 2016); however, information about the intracellular distribution of proteins and the composition of the membrane proteome in pollen is rarely discussed (Pertl et al., 2009). One reason might be the low abundance and solubility of membrane proteins. Here we describe a protocol to isolate and analyze a protein fraction enriched in membrane proteins from mature pollen, which was established for tomato (Figure 1).
Figure 1. Overview of the protocol for isolation of the membrane proteome of mature tomato pollen
Materials and Reagents
1.7 ml microtubes (Corning, Axygen®, catalog number: MCT-175-C )
Pipette tips
Cheesecloth Miniwipes (Fisher Scientific, catalog number: 06-665-28 )
Sharp blade (Red Devil, catalog number: 3272 )
Bond-Elute C-18 SPEC plate (Agilent Technologies, Santa Clara, CA, USA)
Seeds of the cultivar of choice. For the method development–seeds of Solanum lycopersicum cv. Moneymaker (Accesion: LA2706) and cv. Red setter were used
Liquid nitrogen
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-500 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P9599 )
6x Laemmli buffer (Alfa Aesar, catalog number: J61337 )
Urea (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 29700 )
Acrylamide/bis-acrylamide (Fisher Scientific, catalog number: BP1408-1 )
TEMED (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 17919 )
Ammonium persulfate (Acros Organics, catalog number: 327081000 )
Acetonitrile (Fisher Scientific, catalog number: A9561 )
Formic acid (Fisher Scientific, catalog number: A117-50 )
Boric acid (Fisher Scientific, catalog number: A73-500 )
Calcium nitrate tetrahydrate (Fisher Scientific, catalog number: C109-500 )
Magnesium sulphate anhydrous (Fisher Scientific, catalog number: M65-500 )
Potassium nitrate (Fisher Scientific, catalog number: P263-500 )
Potassium chloride (Fisher Scientific, catalog number: P217-500 )
Dithiothreitol (DTT) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0861 )
Ethylenediaminetetraacetic acid, disodium salt dihydrate (EDTA) (Fisher Scientific, catalog number: S311-100 )
Tris base (Fisher Scientific, catalog number: BP152-500 )
Methanol (Fisher Scientific, catalog number: A456-1 )
Acetic acid (Fisher Scientific, catalog number: A507-P500 )
Double distilled water
Coomassie Brilliant Blue R-250 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 20278 )
Trypsin solution sequencing grade (Roche Diagnostics, catalog number: 11418475001 )
Ammonium bicarbonate (Fisher Scientific, catalog number: A643-500 )
Calcium chloride (Fisher Scientific, catalog number: C70-500 )
Trifluoroacetic acid (TFA) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 28904 )
Germination solution (see Recipes)
Homogenization buffer (see Recipes)
Staining solution (see Recipes)
Destaining solution (see Recipes)
Trypsin buffer (see Recipes)
Equipment
Vortex (e.g., Fisher Scientific, model: Fisher ScientificTM Analog Vortex Mix , catalog number: 02-215-365)
Centrifuge (e.g., Eppendorf, model: 5424 R )
Ultracentrifuge (e.g., Thermo Fisher Scientific, model: Sorvall® DiscoveryTM 90 SE )
Daisy BBs (Daisy, model: 24, catalog number: 980024-001 )
Tissuelyser II (QIAGEN, model: Tissuelyser II, catalog number: 85300 )
Speed-Vac Labogene ApS (LabGeneTM, model: ScanVac CoolSafe 110-4 , catalog number: H01130032)
Pipette
Sonicator (BANDELIN electronic, model: Sonorex RK 100 , catalog number: 301.00044253.024)
Precolumn (Eksigent, Redwood City, CA, USA)
Ascentis column (Sigma-Aldrich, Supelco, model: Ascentis® Express Peptide ES-C18 HPLC Column, catalog number: 53552-U ), dimension 15 x 100 μm, pore size 2.7 μm
Orbitrap LTQ XL mass spectrometer (Thermo Fisher Scientific, model: LTQ XLTM )
Software
Proteome Discoverer 1.3 (Thermo, Germany) or other software like MaxQuant (http://www.maxquant.org/), Protmax (http://www.univie.ac.at/mosys/software.html) and MASCOT (http://www.matrixscience.com/)
PROMEX (http://promex.pph.univie.ac.at/promex/) or other software like ProteomeXchange (http://www.proteomexchange.org/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Paul, P., Chaturvedi, P., Mesihovic, A., Ghatak, A., Weckwerth, W. and Schleiff, E. (2017). Protocol for Enrichment of the Membrane Proteome of Mature Tomato Pollen. Bio-protocol 7(11): e2315. DOI: 10.21769/BioProtoc.2315.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,316 | https://bio-protocol.org/exchange/protocoldetail?id=2316&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ex vivo Model of Human Aortic Valve Bacterial Colonization
Alejandro Avilés-Reyes
IF Irlan Almeida Freires
PR Pedro Luiz Rosalen
José A. Lemos
Jacqueline Abranches
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2316 Views: 6465
Edited by: Valentine V Trotter
Reviewed by: Jose Antonio Reyes-Darias
Original Research Article:
The authors used this protocol in 14-Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
14-Oct 2013
Abstract
The interaction of pathogens with host tissues is a key step towards successful colonization and establishment of an infection. During bacteremia, pathogens can virtually reach all organs in the human body (e.g., heart, kidney, spleen) but host immunity, blood flow and tissue integrity generally prevents bacterial colonization. Yet, patients with cardiac conditions (e.g., congenital heart disease, atherosclerosis, calcific aortic stenosis, prosthetic valve recipients) are at a higher risk of bacterial infection. This protocol was adapted from an established ex vivo porcine heart adhesion model and takes advantage of the availability of heart tissues obtained from patients that underwent aortic valve replacement surgery. In this protocol, fresh tissues are used to assess the direct interaction of bacterial pathogens associated with cardiovascular infections, such as the oral bacterium Streptococcus mutans, with human aortic valve tissues.
Keywords: Streptococcus mutans Collagen Adherence ex vivo Aortic heart valve Cardiovascular infection
Background
The oral pathogen Streptococcus mutans is considered the major etiological agent in dental caries and can also be associated with extra-oral infections such as infective endocarditis (IE) (Banas, 2004). IE is generally initiated by a lesion of the heart valve endothelium which leads to the formation a sterile thrombus mainly composed of platelets, inflammatory cells, fibrin and other extracellular matrix (ECM) proteins (e.g., collagen, laminin) (Que and Moreillon, 2011). Other cardiovascular malignancies, such as calcific stenosis and atherosclerosis, can also cause tissue damage leading to the exposure and remodeling of ECM proteins (Yetkin and Waltenberger, 2009). This environment then provides suitable targets for colonization by different pathogens capable of interacting with host components. Thus, the development of relevant tools and experimental models may allow us to understand better how pathogens interact with heart tissues. Based on a previous protocol established by Chuang-Smith et al., 2010 using aortic heart valves from pigs, we developed an ex vivo tissue adherence assay using human heart valves obtained from patients that underwent aortic valve replacement (Freires et al., 2016). While this model does not reproduce the immunological responses and other host factors associated with the disease, it provides a relatively inexpensive system to assess the capacity of a given organism to directly interact with human heart valve tissues. Furthermore, while this model requires a close collaboration with a cardiac surgery unit, this type of surgery (i.e., aortic valve replacement) is routinely performed at health science centers in developed countries (Yetkin and Waltenberger, 2009).
Materials and Reagents
Sterile specimen containers (Fisher Scientific, catalog number: 16-320-730 )
12-well tissue culture plates (Corning, Falcon®, catalog number: 351143 )
Sterile culture tubes (4 ml) (Fisher Scientific, catalog number: 14-956-3D )
Microcentrifuge tubes (1.7 ml) (Fisher Scientific, catalog number: S348903 )
Glass scintillation vials (20 ml) (Sigma-Aldrich, catalog number: Z253081 )
Sterile culture tubes (15 ml) (Fisher Scientific, catalog number: 14-956-6D )
Desired bacterial strain(s) (e.g., Streptococcus mutans OMZ175)
Extirpated heart tissues
EGM-MV Bullet Kit (Lonza, catalog number: CC-3125 )
Gentamicin (Sigma-Aldrich, catalog number: G1397 )
Brain heart infusion medium (BHI) (BD, BactoTM, catalog number: 237500 )
Hank’s balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14025092 )
Erythromycin (Sigma-Aldrich, catalog number: E5389 )
Kanamycin (Sigma-Aldrich, catalog number: K1377 )
Sodium chloride (NaCl) (Avantor® Performance Materials, J.T. Baker®, catalog number: 3628-01 )
Potassium chloride (KCl) (Avantor® Performance Materials, J.T. Baker®, catalog number: 3045-01 )
Sodium phosphate dibasic (Na2HPO4) (Avantor® Performance Materials, J.T. Baker®, catalog number: 3827-01 )
Potassium dihydrogen phosphate (KH2PO4) (Avantor® Performance Materials, J.T. Baker®, catalog number: 3246-01 )
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
Glutaraldehyde (Sigma-Aldrich, catalog number: 340855 )
Sodium cacodylate trihydrate (Sigma-Aldrich, catalog number: C0250 )
Agar (Fisher Scientific, catalog number: BP1423 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F0392 )
Hydrocortisone
Bovine brain extract
Human recombinant epidermal growth factor
1x phosphate buffer solution (PBS) (see Recipes)
Fixative solution (see Recipes)
Equipment
Biosafety cabinet class 2 (Nuaire, model: Labgard ES Energy Saver Class II, Type A2 , catalog number: NU-425-600)
3 mm skin biopsy punch (Acuderm, catalog number: P325 )
Stainless steel forceps (Sigma-Aldrich, catalog number: Z168696 )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM MultifugeTM 1 S-R )
Vortex
Motorized pestle (Kimble Chase Life Science and Research Products, catalog number: 7495400000 )
pH meter
Rocker (Reliable Scientific, model: 55D )
CO2 incubator (VWR; model: 2325 )
Zeiss-Auriga focused ion beam field emission scanning electron microscope (FIB-FE-SEM)
Gatan Erlangshen digital camera
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Avilés-Reyes, A., Freires, I. A., Rosalen, P. L., Lemos, J. A. and Abranches, J. (2017). Ex vivo Model of Human Aortic Valve Bacterial Colonization. Bio-protocol 7(11): e2316. DOI: 10.21769/BioProtoc.2316.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Ex vivo model
Cell Biology > Tissue analysis > Physiology
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,317 | https://bio-protocol.org/exchange/protocoldetail?id=2317&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pituitary Isograft Transplantation in Mice
Chance Walker
Yan Hong
FK Frances Kittrell
DM Daniel Medina
DE David Edwards
Fariba Behbod
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2317 Views: 8102
Reviewed by: Thirupugal Govindarajan
Original Research Article:
The authors used this protocol in 2 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
2 2011
Abstract
The mouse pituitary isograft is a technique developed to administer persistent hormone stimulation, thereby increasing cellular proliferation in the mammary tissue (Christov et al., 1993). The pituitary isograft procedure was first described in ‘Induction of Mammary Cancer in Mice without the Mammary Tumor Agent by Isografts of Hypophyses’ by O. Mühlbock and L. M. Boot in 1959 (Muhlbock and Boot, 1959). Since then, the procedure has seen wide use. A pituitary gland is harvested posthumously from a donor mouse and implanted under the renal capsule of the recipient mouse through a small abdominal incision just below the last rib. Once the pituitary gland is implanted, it begins releasing hormones. These secretions increase serum levels of multiple hormones including prolactin, progesterone and 17β-estradiol (Christov et al., 1993). Although the effects of these hormones on cancer cell proliferation, growth, differentiation, and longevity are not well characterized, and, in some cases, controversial, the net effect of a pituitary isograft is to increase the proliferation of murine breast tissue depending upon strain specific characteristics (Lydon et al., 1999).
Below is a protocol describing how to perform the pituitary isograft procedure. After many of the steps, a time reference is listed in parentheses. Each reference corresponds to a time point in the embedded video of the procedure. (Video 1)
Video 1. Pituitary isograft transplantation in mice. Video portraying pituitary isograft transplantation procedure in donor and recipient mice.
Keywords: Pituitary isograft Mouse model Hormone stimulation Breast cancer Cancer model Pituitary transplantation Tumor
Background
Because of the simplicity, longevity, and applicability of the pituitary isograft procedure it has seen substantial and varied usage in the decades since its inception. Uniform, long term hormone stimulation in vivo is difficult to achieve; pituitary isografts deliver this capability. Once implanted pituitary isografts remain effective and safe for the duration of the experimental lifespan.
Materials and Reagents
Surgical gloves (Cardinal Health, catalog number: 2D72N80X )
1 ml Tuberculin (TB) syringe (BD, catalog number: 309625 )
18 gauge 1 ½ inch trocar (BD, catalog number: 305196 )
Silk suture 4-0 (Patterson Veterinary Supply, catalog number: 07-891-0230 )
Wound clips (BD, catalog number: 427631 )
Sterile cotton swab (Puritan Medical, catalog number: 25803 2WC )
8-20-week-old donor and recipient mice of the same strain
Nembutal sodium solution (Pentobarbital sodium injection, USP) (Akorn, catalog number: NDC 76478-501-20 )
Ketoprofen (Patterson Veterinary Supply, catalog number: 07-803-7377 )
Phosphate-buffered saline (PBS) (pH 7.4, 1x, sterile) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
70% ethanol
Antibiotic solution
Equipment
Balance
Sharp-blunt scissors (Fine Science Tool, catalog number: 14028-10 )
Straight flat broad tip forceps (Fisher Scientific, catalog number: 16-100-114 )
Graefe forceps curved serrated (Fine Science Tool, catalog number: 11051-10 )
Graefe forceps straight 1 x 2 teeth (rat tooth) (Fine Science Tool, catalog number: 11053-10 )
Animal clippers (Sunbeam Products, Oster, catalog number: 078005010002 )
Clip applier (BD, catalog number: 427630 )
Clip remover (BD, catalog number: 427637 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Walker, C., Hong, Y., Kittrell, F., Medina, D., Edwards, D. and Behbod, F. (2017). Pituitary Isograft Transplantation in Mice. Bio-protocol 7(11): e2317. DOI: 10.21769/BioProtoc.2317.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Animal models
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,318 | https://bio-protocol.org/exchange/protocoldetail?id=2318&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Localization in the Cyanobacterium Anabaena sp. PCC7120 Using Immunofluorescence Labeling
Carla Trigo*
Derly Andrade*
Mónica Vásquez
*Contributed equally to this work
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2318 Views: 7569
Edited by: Dennis Nürnberg
Reviewed by: Elizabeth Libby
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Techniques such as immunoflorescence are widely used to determine subcellular distribution of proteins. Here we report on a method to immunolocalize proteins in Anabaena sp. PCC7120 with fluorophore-conjugated antibodies by fluorescence microscopy. This method improves the permeabilization of cyanobacterial cells and minimizes the background fluorescence for non-specific attachments. In this protocol, rabbit antibodies were raised against the synthetic peptide of CyDiv protein (Mandakovic et al., 2016). The secondary antibody conjugated to the fluorophore Alexa488 was used due to its different emission range in comparison to the autofluorescence of the cyanobacterium.
Keywords: Cell division Cyanobacteria CyDiv Anabaena Protein immunolocalization
Background
The immunofluorescence of cyanobacteria has been used extensively in cell identification and counting studies (Jin et al., 2016). However, immunolocalization of proteins has not been achieved efficiently in cyanobacteria. The most recurrent method to localize proteins is by fusing the protein of interest to a fluorescent protein such as GFP (Green Fluorescent Protein) that has a different emission wavelength (compared with cyanobacterial autofluorescence), and subsequent visualization using epifluorescence or confocal microscopy (Flores et al., 2016; Santamaria-Gomez et al., 2016).
The structural properties of cyanobacterial cells are the main challenges for applying immunofluorescence techniques. They consist of an inner membrane (IM), a peptidoglycan layer (PG) and an outer membrane (OM) (Rippka, 1988; Baulina, 2012; Jin et al., 2016), with an additional exopolysaccharide layer (sheath). The sheath is found in both unicellular and filamentous cyanobacteria (Kehr and Dittmann, 2015), and their thickness, composition and appearance depend on growth conditions, metabolic status, cell differentiation and other external and internal parameters (Jin et al., 2016). The sheath tends to trap antibodies by unspecific interactions. To avoid this problem, the washing and membrane permeabilization steps are the key to a successful immunofluorescence technique in cyanobacteria.
Materials and Reagents
Pipette tips
1.5 ml tubes (Eppendorf)
50 ml tubes (Falcon tubes)
Poly-L-lysine coated glass slides (Sigma-Aldrich, catalog number: P0425-72EA )
Cover slips
Petri dish
Filter with a pore size of 0.2 µm
Filamentous cyanobacterium, Anabaena sp. PCC7120
BG-11 liquid supplied with 10 mM NaHCO3 (Rippka, 1988)
Sodium hydrogen carbonate (NaHCO3) (EMD Millipore, catalog number: 106329 )
Ethanol (EMD Millipore, catalog number: 1.00983.2500 )
Triton X-100 (Winkler Limitada, catalog number: BM-2020 )
Bovine serum albumin (BSA) (Divbio Science, catalog number: 41-903-100 )
Tween-20 (Winkler Limitada, catalog number: TW-1652 )
Secondary antibody Alexa Fluor 488 goat anti-rabbit IgG (Thermo Fisher Scientific, Invitrogen, catalog number: A11008 )
ProLong Gold Antifade Mountant (Thermo Fisher Scientific, InvitrogenTM, catalog number: P36930 )
Nail varnish
Primary polyclonal antibody against All2320 peptide (Mandakovic et al., 2016)
Sodium chloride (NaCl) (EMD Millipore, catalog number: 106404 )
Potassium chloride (KCl) (EMD Millipore, catalog number: 104938 )
Sodium dihydrogen phosphate (Na2HPO4) (EMD Millipore, catalog number: 106559 )
Potassium phosphate monobasic (KH2PO4) (EMD Millipore, catalog number: 529568 )
PBS buffer (pH 7.4) (see Recipes)
Equipment
Pipettes
Hydrophobic PAP pen (Thermo Fisher Scientific, catalog number: 008877 )
Freezer at -20 °C
Incubator at 4 °C
Incubator at 55 °C
Incubator at 24 °C with white light
Olympus Fluoview FV1000 Confocal Microscope (Olympus, model: FluoviewTM FV1000 ) and objectives of 60x/1.35 NA oil immersion and 100x/1.40 NA oil immersion. Laserline Argon 488 (Excitation 495 nm, Emission 509 nm) and Laserline DPSS (Excitation 565 nm, Emission 590 nm)
Moisture chamber (A dark plastic box with a moistened paper inside, PolarSafeTM Polypropylene Freezer Storage Box) (Argos Technologies, catalog number: R3130 )
Software
ImageJ software (https://imagej.net)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Trigo, C., Andrade, D. and Vásquez, M. (2017). Protein Localization in the Cyanobacterium Anabaena sp. PCC7120 Using Immunofluorescence Labeling. Bio-protocol 7(11): e2318. DOI: 10.21769/BioProtoc.2318.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,319 | https://bio-protocol.org/exchange/protocoldetail?id=2319&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Method to Convert mRNA into a Guide RNA (gRNA) Library without Requiring Previous Bioinformatics Knowledge of the Organism
Hiroshi Arakawa
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2319 Views: 9576
Edited by: Jihyun Kim
Reviewed by: Manuela Roggiani
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
While the diversity of species represents a diversity of special biological abilities, many of the genes that encode those special abilities in a variety of species are untouched, leaving an untapped gold mine of genetic information; however, despite current advances in genome bioinformatics, annotation of that genetic information is incomplete in most species, except for well-established model organisms, such as human, mouse, or yeast. A guide RNA (gRNA) library using the clustered regularly interspersed palindromic repeats (CRISPR)/Cas9 (CRISPR-associated protein 9) system can be used for the phenotypic screening of uncharacterized genes by forward genetics. The construction of a gRNA library usually requires an abundance of chemically synthesized oligos designed from annotated genes; if one wants to convert mRNA into gRNA without prior knowledge of the target DNA sequences, the major challenges are finding the sequences flanking the protospacer adjacent motif (PAM) and cutting out the 20-bp fragment. Recently, I developed a molecular biology-based technique to convert mRNA into a gRNA library (Arakawa, 2016) (Figure 1). Here I describe the detailed protocol of how to construct a gRNA library from mRNA.
Figure 1. A method to convert mRNA into a gRNA library construction (Sanjana et al., 2014). The scheme of the method is summarized. Each step of D-O is described in detail in the Procedure. Bg, BglII; Xb, XbaI; Bs, BsmBI; Aa, AatII. PCR, polymerase chain reaction; lentiCRISPR v2, lentiCRISPR version 2.
Keywords: CRISPR Cas9 gRNA Library
Background
The clustered regularly interspersed palindromic repeats (CRISPR) system is responsible for the acquired immunity of bacteria (Barrangou et al., 2007), which is shared among 40% of eubacteria and 90% of archaea (Grissa et al., 2007). While CRISPR/Cas9 is, physiologically, an endonuclease used to eliminate the infectious pathogen (Barrangou et al., 2007), CRISPR/Cas9 can be used to cleave any locus of the genome if a guide RNA (gRNA) is provided (Cong et al., 2013; Mali et al., 2013). By designing gRNA for the gene of interest, individual genes can be knocked out one-by-one by non-homologous end joining (NHEJ) (Cong et al., 2013; Mali et al., 2013); additionally, CRISPR/Cas9 can be utilized to make a gRNA library available for genetic screening (Zhou et al., 2001; Koike-Yusa et al., 2014; Shalem et al., 2014; Wang et al., 2014). The gRNA for Streptococcus pyogenes (Sp) Cas9 can be designed as a 20-bp sequence adjacent to the protospacer adjacent motif (PAM) NGG (Cong et al., 2013; Mali et al., 2013). Such a sequence can usually be identified from the coding sequence or locus of interest by bioinformatics techniques. Here, I describe a method to construct a gRNA library via molecular biology techniques without relying on bioinformatics. Briefly, one synthesizes cDNA from the extracted RNA using a semi-random primer containing a PAM-complementary sequence and then cuts out the 20-mer adjacent to the PAM using type IIS and type III restriction enzymes to create a gRNA library. The described approach does not require prior knowledge about the target DNA sequences, making it applicable to any species.
Materials and Reagents
1.5 ml microcentrifuge tube
0.2 ml PCR tube
Disposable pipette tip
OligodT column (QIAGEN, supplemented with the Oligotex mRNA Mini Kit [QIAGEN, catalog number: 70022 ])
STBL4 electro-competent cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11635018 )
Lentiviral vector
lentiCRISPR v2 (Sanjana et al., 2014) (Addgene, catalog number: 52961 )
Oligonucleotides
Semi-random primer p NNNCCN
5’ switching mechanism at RNA transcript (SMART) tagTGGTCAAGCTTCAGCAGATCTACACGGACGTCGCrGrGrG
5’ SMART PCR primer TGGTCAAGCTTCAGCAGATCTACACG
3’ linker I forward p CTGCTGACTTCAGTGGTTCTAGAGGTGTCCAA
3’ linker I reverse GTTGGACACCTCTAGAACCACTGAAGTCAGCAGT
5’ linker I forward GCATATAAGCTTGACGTCTCTCACCG
5’ linker I reverse p NNCGGTGAGAGACGTCAAGCTTATATGC
3’ linker II forward p GTTTGGAGACGTCTTCTAGATCAGCG
3’ linker II reverse CGCTGATCTAGAAGACGTCTCCAAACNN
3’ linker I PCR primer GTTGGACACCTCTAGAACCACTGAAGTCAGCAGTNNNCC
3’ linker II PCR primer CGCTGATCTAGAAGACGTCTCCAAAC
LentiCRISPR forward CTTGGCTTTATATATCTTGTGGAAAGGACG
LentiCRISPR reverse CGGACTAGCCTTATTTTAACTTGCTATTTCTAG
TRIzol reagent (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15596026 )
Phenol:chloroform:isoamyl alcohol 25:24:1 (Sigma-Aldrich, catalog number: P2069-100ML )
Ethanol
RNase-free water
Oligotex mRNA Mini Kit (QIAGEN, catalog number: 70022 )
T4 DNA ligase reaction buffer (New England Biolabs, catalog number: B0202S )
SMART Scribe reverse transcriptase (Takara Bio, Clontech, catalog number: 639536 )
DTT (Takara Bio, supplemented with SMART Scribe reverse transcriptase [Takara Bio, Clontech, catalog number: 639536 ])
dNTP mix (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18427013 )
RNaseOUT (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10777019 )
RNase H (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18021014 )
MilliQ water
Advantage 2 polymerase mix (Takara Bio, Clontech, catalog number: 639201 )
QIAquick PCR Purification Kit (QIAGEN, catalog number: 28104 )
Quick Ligation Kit (New England Biolabs, catalog number: M2200S )
EcoP15I (New England Biolabs, catalog number: R0646S )
BglII (New England Biolabs, catalog number: R0144S )
AcuI (New England Biolabs, catalog number: R0641S )
XbaI (New England Biolabs, catalog number: R0145S )
BsmBI (New England Biolabs, catalog number: R0580S )
AatII (New England Biolabs, catalog number: R0117S )
10-bp ladder
1x CutSmart buffer (included in XbaI [New England Biolabs, catalog number: R0145S ])
S-adenosylmethionine (SAM) (New England Biolabs, supplemented with AcuI [New England Biolabs])
3 M sodium acetate (pH 5.5) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9740 )
Acrylamide/Bis solution (19:1) (40 % w/v, 5 % C) (SERVA Electrophoresis, catalog number: 10679.01 )
Glycogen (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0561 )
Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32851 )
TE buffer (pH 8.0) (see Recipes)
Equipment
Pipettes
Centrifuge (Eppendorf, models: 5424 R , 5810 R )
Heating block
Glass beaker
GeneAmp PCR System 9700 (Thermo Fisher Scientific, model: GeneAmp PCR System 9700 )
Note: This product has been discontinued.
Mini-PROTEAN Tetra Vertical Electrophoresis Cell (Bio-Rad Laboratories, model: Mini-PROTEAN® Tetra Vertical Electrophoresis Cell )
GenePulser II (Bio-Rad Laboratories, model: Gene Pulser II )
High Performance Laboratory Incubator–Mod. 2800 (F.lli GALLI, model: MOD. 2800 )
CLC Genomics Workbench (QIAGEN, model: CLC Genomics Workbench )
Bioanalyzer (Agilent Technologies)
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Arakawa, H. (2017). A Method to Convert mRNA into a Guide RNA (gRNA) Library without Requiring Previous Bioinformatics Knowledge of the Organism. Bio-protocol 7(10): e2319. DOI: 10.21769/BioProtoc.2319.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Gene expression
Systems Biology > Genomics > Sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
232 | https://bio-protocol.org/exchange/protocoldetail?id=232&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Proteolytic Fragment Isolation and Analysis (ex. N-terminal GST-tagged CLAVATA3 Protein GST-CLV3)
JN Jun Ni
Published: Vol 2, Iss 14, Jul 20, 2012
DOI: 10.21769/BioProtoc.232 Views: 11824
Download PDF
Ask a question
Favorite
Cited by
Abstract
It has become clear that the post-embryonic growth and development of plants requires properly controlled short distance cell-to-cell communication not only through the historically well-known phytohormones, but also through secreted small peptide signals. This protocol demonstrates an example of how to isolate small peptides (< 10 daltons) from complex protein mixtures (e.g. cauliflower meristem protein extraction) for MS/MS analysis.
Keywords: CLAVATA3 Meristem protein isolation Proteolytic processing
Materials and Reagents
Glutathione Sepharose 4B (Amersham biosciences , catalog number: 17-0756-01 )
Glutathione (Thermo Fisher Scientific, catalog number: 78259 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P9599 )
Triton X-100 (Pierce, catalog number: 85111 )
GST-mCLV3 proteins
Tris-HCl
Hepes (Sigma-Aldrich, catalog number: H3375 )
EDTA (Sigma-Aldrich, catalog nummber: ED100g )
Phenylmethylsulfonyl fluoride (Sigma-Aldrich, catalog number: 78830-1G )
Aprotinin (Sigma-Aldrich, catalog number: A4529-1MG )
Chymostatin (Sigma-Aldrich, catalog number: C7268-1MG )
Leupeptin (Sigma-Aldrich, catalog number: L2884-5MG )
Eluting buffer (see Recipes)
Cauliflower extraction buffer (see Recipes)
Equipment
Rotor
Microcon YM-10 centrifugal filter (EMD Millipore)
Tabletop centrifuge
Mass spectrometer (4700 proteomics analyzer)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Protein
Systems Biology > Proteomics > Whole organism
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,320 | https://bio-protocol.org/exchange/protocoldetail?id=2320&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Creating a RAW264.7 CRISPR-Cas9 Genome Wide Library
B Brooke A Napier
DM Denise M Monack
Published: Vol 7, Iss 10, May 20, 2017
DOI: 10.21769/BioProtoc.2320 Views: 12571
Edited by: Ivan Zanoni
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
The bacterial clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 genome editing tools are used in mammalian cells to knock-out specific genes of interest to elucidate gene function. The CRISPR-Cas9 system requires that the mammalian cell expresses Cas9 endonuclease, guide RNA (gRNA) to lead the endonuclease to the gene of interest, and the PAM sequence that links the Cas9 to the gRNA. CRISPR-Cas9 genome wide libraries are used to screen the effect of each gene in the genome on the cellular phenotype of interest, in an unbiased high-throughput manner. In this protocol, we describe our method of creating a CRISPR-Cas9 genome wide library in a transformed murine macrophage cell-line (RAW264.7). We have employed this library to identify novel mediators in the caspase-11 cell death pathway (Napier et al., 2016); however, this library can then be used to screen the importance of specific genes in multiple murine macrophage cellular pathways.
Keywords: CRISPR Screen Macrophages Library RAW264.7
Background
Historically, understanding the contribution of specific genes to phenotypes of interest in eukaryotic cells was possible using RNA interference (RNAi) or cells derived from knockout mice. However, within the last few years the new genome editing technique CRISPR-Cas9 has allowed for easy and efficient generation of knockout cell lines and genome-wide screens within eukaryotic cells. CRISPR-Cas9 genome-wide screens have expanded the toolbox for mammalian genetics and for the identification of novel proteins and their contributions to specific phenotype. Using this method, researchers have been able to identify novel genes involved in tumor growth (Chen et al., 2015; Kiessling et al., 2016; Steinhart et al., 2017), microbial entry and replication (Popov et al., 2015; Marceau et al., 2016), cell death pathways (Shi et al., 2015; Napier et al., 2106), and much more. Here we harness the CRISPR-Cas9 system, to create a genome-wide knockout library in a murine macrophage cell line. Macrophages are the crux of many innate immune responses to invading pathogens or danger signals. By creating a genome-wide knockout library in macrophages we can now begin to identify novel mediators of these innate immune responses to identify novel diagnostic and therapeutic targets for acute and chronic inflammation.
Materials and Reagents
Pipette tips
10 cm bacteriological tissue culture (TC) treated Petri dish (Corning, Falcon®, catalog number: 353003 )
6-well plates TC treated (Corning, Costar®, catalog number: 353502 )
15 ml Falcon tube (E&K Scientific Products, catalog number: EK-4020 )
50 ml Falcon tube (E&K Scientific Products, catalog number: EK-4023 )
Cell scraper (SARSTEDT, catalog number: 83.1830 )
0.45 μm syringe filters (Corning, catalog number: 431225 )
T-75 flask (Corning, Falcon®, catalog number: 353136 )
T-125 flask (Corning, Falcon®, catalog number: 353112 )
Cryovials (Corning, catalog number: 430659 )
RAW264.7 cells (ATCC, catalog number: TIB-71 )
293T cells (ATCC, catalog number: CRL-3216 )
hCas9 plasmid (Addgene, catalog number: 52962 )
FuGene (Promega, catalog number: E2311 )
VSV-G (Addgene, catalog number: 8454 )
pAdVAntage (Promega, catalog number: E1711 )
△VPR (Addgene; catalog number: 8455 )
Genome-wide Mouse lentiviral CRISPR gRNA library v1 (Addgene, catalog number: 50947 )
Filtered DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 11995073 )
Filtered (0.2 μm filter) heat-inactivated (30 min at 37 °C) FBS (Thermo Fisher Scientific, GibcoTM; stock specific)
Protamine sulphate (Sigma-Aldrich, catalog number: P3369-10G ), keep stock at 8 mg/ml at 4 °C
Blasticidin hydrochloride (MP Biomedicals, catalog number: 02150477-25 mg ), keep aliquoted stock at 10 mg/ml at -20 °C
DMSO (Fisher Scientific, catalog number: BP231-100 )
Puromycin dihydrochloride from Streptomyces alboniger (Sigma-Aldrich, catalog number: P8833 )
RAW264.7 and 293T tissue culture media (see Recipes)
Blasticidin selection media (see Recipes)
Puromycin selection media (see Recipes)
Tissue culture freezing media (see Recipes)
Equipment
Pipettes
Fluorescence microscope that can visualize BFP
Incubator at 37 °C with 5% CO2
Centrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Napier, B. A. and Monack, D. M. (2017). Creating a RAW264.7 CRISPR-Cas9 Genome Wide Library. Bio-protocol 7(10): e2320. DOI: 10.21769/BioProtoc.2320.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Macrophage
Molecular Biology > RNA > Transfection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,321 | https://bio-protocol.org/exchange/protocoldetail?id=2321&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Mutant Pigs by Direct Pronuclear Microinjection of CRISPR/Cas9 Plasmid Vectors
Chin-kai Chuang
Ching-Fu Tu
Chien-Hong Chen
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2321 Views: 11244
Reviewed by: Longping Victor TseFang Xu
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
A set of Cas9 and single guide CRISPR RNA expression vectors was constructed. Only a very simple procedure was needed to prepare specific single-guide RNA expression vectors with high target accuracy. Since the de novo zygotic transcription had been detected in mouse embryo at the 1-cell stage, the plasmid DNA vectors encoding Cas9 and GGTA1 gene specific single-guide RNAs were micro-injected into zygotic pronuclei to confirm such phenomenon in 1-cell pig embryo. Our results demonstrated that mutations caused by these CRISPR/Cas9 plasmids occurred before and at the 2-cell stage of pig embryos, indicating that besides the cytoplasmic microinjection of in vitro transcribed RNA, the pronuclear microinjection of CRISPR/Cas9 DNA vectors provided an efficient solution to generate gene-knockout pig.
Keywords: CRISPR/Cas9 GGTA1 Pronuclear microinjection
Background
Since the initial discovery of a highly conserved 29 base pairs (bp) sequence tandemly repeated with a spacing of 32 bp downstream of the iap gene in Escherichia coli genome (Ishino et al., 1987; Nakata et al., 1989), a family of short regularly spaced repeats, varying in size from 25 to 50 bp, were found in about 50% of bacteria and 90% of archaea (Makarova et al., 2015). According to their characteristic structures, the name clustered regularly interspaced short palindromic repeats (CRISPRs) were introduced by Mojica (Mojica et al., 2009) and Jansen (Jansen et al., 2002) and are currently in general use. A set of CRISPR associated genes, cas1 to cas4, was first identified flanking the CRISPR loci by nucleotide sequence alignments (Jansen et al., 2002). New members of cas genes were identified in different bacterial species. According to the cas members within each host, the CRISPR-Cas systems can be classified into three major types based on the hallmark genes (Makarova et al., 2011; Burmistrz and Pyrc, 2015). The function of the CRISPR-Cas system was demonstrated by a seminar experiment. After being challenged by virulent bacteriophages: phage 858 and phage 2,972, new repeat-spacer units were observed on the leading end of the CRISPR array in the surviving Streptococcus thermophlis host cells. The DNA sequences of newly acquired spacers were matched to corresponding fragments, named proto-spacers, in the phage genomes. Streptococcus thermophlis strains with phage spacer(s) were resistant to the phage infection, while strains without phage spacer(s) were sensitive to the phage infection (Barrangou et al., 2007). To distinguish between the spacer in the host bacterial genome and the proto-spacer, which has the same sequence as the spacer in the invader genome, a proto-spacer adjacent motif (PAM) was evolved (Mojica et al., 2009; Shah et al., 2013). The CRISPR-Cas immunity was revealed, it can be divided into three stages (Rath et al., 2015; Wright et al., 2016). The first adaptation or acquisition stage is responsible for the acquisition of spacers into CRISPR array following the exposure to foreign mobile genetic elements, such as phages or plasmids. A Cas2 homodimer was sandwiched by two Cas1 homodimers forming a heterohexameric complex for all three types of CRISPR-Cas systems (Sternberg et al., 2016). In the second stage, the promoter embedded within the AT-rich leader sequence upstream of the CRISPR array transcribed the precursor CRISPR RNAs (pre-crRNAs), these were further processed into short CRISPR RNA (crRNA) guides by Cas proteins. Cas6 was involved in the RNA processing step in both of the type I and type III CRISPR-Cas systems (Charpentier et al., 2015; Hochstrasser and Doudna, 2015). Accompanied by the Cas9 protein, a trans-activating crRNA (tracrRNA) which contains an anti-repeat segment for duplex formation with the repeat compartment of crRNA was involved in the maturation of the crRNAs in the type II system (Deltcheva et al., 2011). In the last interference stage, in cooperation with a mature crRNA and a cascade of Cas proteins, the signature proteins Cas3 and Cas10 were integrated into the RNA guided endonuclease complex in the type I and type III CRISPR-Cas systems, respectively. The type II effector is simply composed of a Cas9 protein, a pair of processed mature crRNA and tracrRNA (Gasiunas et al., 2012). The crRNA and tracrRNA in the ternary complex can be substituted by a fused crRNA-tracrRNA single-guide RNA (sgRNA) (Jinek et al., 2012). Because of extreme simplicity, the Cas9-sgRNA, now commonly termed as CRISPR/Cas9, binary complexes were immediately applied in the field of gene editing (Cong et al., 2013; Mali et al., 2013).
Swine share a number of anatomic and physiologic characteristics with humans. Systems that are mostly cited as suitable models include cardiovascular, urinary, integumentary, and digestive system (Swindle et al., 2012). Therefore, pigs are considered as a good source of organs for xenotransplantation. Two strategies are currently utilized to overcome the interspecies rejection hurdles. The first one is to block donor organs expressing the antigens causing hyper-acute rejection, such as galactose-α1,3-galactose, N-glycolylneuroaminic acid and β1,4-N-acetylgalactosamine, by targeting the GGTA1, CMAH and β4GalNT2 genes, respectively (Estrada et al., 2015; Cooper et al., 2016). The second strategy is to prepare organs which are composed of acceptor’s cells in a surrogate animal by a blastocyst complementation technique (Kobayashi et al., 2010; Usui et al., 2012; Matsunari et al., 2013). To produce gene-knockout pigs, the traditional method uses gene editing in somatic cells, such as fetal fibroblasts, and somatic cell nuclear transfer (SCNT) techniques to create knockout zygotes. The examples of combining CRISPR/Cas9 and SCNT are reported to generate IgM JH (Chen et al., 2015), RUNX3 (Kang et al., 2016b), IL2RG (Kang et al., 2016a), and GGTA1/CMAH/β4GalNT2 triple knockout pigs (Estrada et al., 2015). Direct microinjection of DNA or RNA is another choice to prepare gene knockout pigs. Since the burst of de novo transcription in porcine zygotes was reported at the 4-cell stage (Anderson et al., 1999), RNA is preferred for micro-injection into embryos at the 1-cell stage. Previous studies have demonstrated that cytoplasmic microinjection of Cas9 mRNA with sgRNAs can produce Mitf (Wang et al., 2015) and DJ-1/Parkin/PINK1 triple-gene knockout pigs (Wang et al., 2016). Because de novo zygotic transcription had only been reported in the 1-cell stage mouse embryo (Ram and Schultz, 1993; Bouniol et al., 1995; Aoki et al., 1997), a trial was reported to produce GGTA1 knockout pigs by cytoplasmic microinjection of a CRISPR/Cas9 plasmid. With this strategy, CRISPR/Cas9 was expressed at, or later, than the 2-cell stage, and mosaic mutations on GGTA1 gene were found (Petersen et al., 2016). Pronucleus microinjection is needed to interpret whether zygotic transcription occurs at the 1-cell stage of pig embryo (Chuang et al., 2016).
A series of Cas9 and sgRNA expression vectors was constructed as shown in Figure 1. pCX-Flag2-NLS1-Cas9-NLS2, pCX-HA-NLS1-Cas9-NLS2, and pCX-Myc-NLS1-Cas9-NLS2 can be used to express Cas9 in mammalian cells. Three common tags are available to monitor Cas9 expressions. (Figure 1A) Porcine U6 promoter which could effectively derive short hairpin RNA [Chuang et al., 2009] was used to construct the ppU6-(BsaI)2-gRNA vector (Figure 1B) (Su et al., 2015). A pair of primers containing spacer and part of CRISPR repeat sequences, as shown in Figure 1B, is needed for each target site. Because guanine (G) is favored for U6 promoter as the first transcribed nucleotide, only proto-spacers initiated with G were chosen in our recent works.
Figure 1. Scheme of the Cas9 and single-guide RNA expression vectors. A. pCX-Flag2-NLS1-Cas9-NLS2, pCX-HA-NLS1-Cas9-NLS2, and pCX-Myc-NLS1-Cas9-NLS2; B. ppU6-(BsaI)2-gRNA and primer pair designation.
Materials and Reagents
Preparations of sgRNA expression vectors
BsaI (New England Biolabs, catalog number: R0535 )
T4 DNA ligase (Promega, catalog number: M1801 )
Clean and Gel Extraction Kit (Biokit, catalog number: Bio-C300 )
2x ligation buffer (Promega, catalog number: C671A )
pGEM-T Easy TA-cloning kit (Promega, catalog number: A1360 )
Plasmid Miniprep Kit (Biokit, catalog number: Bio-P300 )
Genomic DNA isolation Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: K0721 )
NeonTM Transfection System 100 µl Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: MPK10096 )
Cesium chloride (CsCl) (Avantor® Performance Materials, J.T. Baker®, catalog number: 4042-02 )
Tris-HCl, pH 8.0
EDTA, pH 8.0
Sodium chloride (NaCl)
TE buffer (see Recipes)
TEN buffer (see Recipes)
Collection of pig embryos
Glass tube for embryo flashing (glass tube with outside diameter of 4 mm as shown in Figure 2)
Falcon tube, 50 ml (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339653 )
Regumate® (containing 0.4% Altrenogest, Intervet, MSD, France, brand name: Regumate®)
PMSG (pregnant mare serum gonadotropin) (ASFK Pharmaceutical, Japan, brand name: PMSG)
hCG (human chorionic gonadotropin) (ASKA Pharmaceutical, Japan, brand name: hCG)
PGF2α (prostaglandin F2α; Estrumate injection) (Intervet Deutschland, Germany)
D-PBS (GE Healthcare, HyCloneTM, catalog number: SH30028.02 )
Fetal bovine serum (FBS) (GE Healthcare, HyCloneTM, catalog number: SH30071.03 )
Embryo transfer
3M paper tape (3M, catalog number: 200-24mm )
Atropine sulfate (TAI YU CHEMICAL & PHARMACEUTICAL)
Stresnil (azaperona, 40 mg/ml) (Janssen Pharmaceutica N.V., Belgium, brand name: Stresnil)
Citosol (Thiamylal sodium) (Shinlin Sinseng Pharmaceutical, Taiwan, brand name: Citosol)
Amoxicillin (ampicillin, 150 mg/ml) (China Chemical & Pharmaceutical, CCPG, catalog number: E000853 )
Heparin sodium (China Chemical & Pharmaceutical, CCPG, Taiwan, brand name: AGGLUTEX INJECTION)
Equipment
Preparations of sgRNA erxpression vectors
Ultracentrifugator (Beckman Coulter, model: Optima XL-80 ) equipped with NVTi65 rotor
Microcentrifugator (KUBOTA, model: 3740 )
Dry bath incubator (Major Science, model: MD-01N )
Thermocycler (Thermo Fisher Scientific, Applied BiosystemsTM, model: 2720 )
Semen assessment
computer-assisted sperm analysis system (UltiMate CASA system, Hamilton-Thorne Research, Beverly, MA)
Microinjection
Centrifugator (KUBOTA, model: 8920 )
Note: This product has been discontinued.
Microcentrifugator (KUBOTA, model: 3740 )
Inverted Differential Interference Contrast microscope (Olympus, model: IX71 )
Capillary injection needle (Sutter Instrument, catalog number: BF100-78-10 )
Capillary injection needle puller (Sutter Instrument, model: P-97 )
Micromanipulator (NARISHGE, model: ON3-99D )
Injectors (NARISHGE, model: IM-9B )
Collection of pig embryos and embryo transfer
Operation table (NEWPORT, LW3048B-OPT, VIBRATION ISOLATION TABLE)
Surgery mechanic devises (NARISHIGE, JAPAN)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chuang, C., Tu, C. and Chen, C. (2017). Generation of Mutant Pigs by Direct Pronuclear Microinjection of CRISPR/Cas9 Plasmid Vectors. Bio-protocol 7(11): e2321. DOI: 10.21769/BioProtoc.2321.
Download Citation in RIS Format
Category
Cell Biology > Cell engineering > CRISPR-cas9
Molecular Biology > DNA > Transfection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,322 | https://bio-protocol.org/exchange/protocoldetail?id=2322&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determining Genome Size from Spores of Seedless Vascular Plants
LK Li-Yaung Kuo
Y Yao-Moan Huang
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2322 Views: 8002
Edited by: Scott A M McAdam
Reviewed by: Emily Cope
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Seedless vascular plants, including ferns and lycophytes, produce spores to initiate the gametophyte stage and to complete sexual reproduction. Approximately 10% of them are apomictic through the production of genomic unreduced spores. Being able to measure the spore nuclear DNA content is therefore important to infer their reproduction mode. Here we present a protocol of spore flow cytometry that allows an efficient determination of the reproductive modes of seedless vascular plants.
Keywords: Apomixis Bead-vortex Fern Flow cytometry Lycophyte Spore
Background
In seedless vascular plants, sporogenesis features, such as meiotic chromosome counts, were traditionally used to infer nuclear DNA content as well as reproductive modes. However, these approaches are time-consuming, or can only provide indirect evidence. An efficient and reliable method to estimate spore nuclear DNA content of these plants had not been established until Kuo et al. (2017). Herein, we describe a protocol using flow cytometry to evaluate spore genome sizes of these plants based on the work of Kuo et al. (2017).
Materials and Reagents
Pipette tips (10, 100, and 1,000 μl)
50-ml tube
1.7-ml tubes with caps
2.0-ml tubes with caps
2.3-mm stainless steel beads (Bio Spec Products, catalog number: 11079123ss )
30-μmnylon meshes (Sysmex, CellTrics®, catalog number: 04-0042-2316 )
20-μmnylon meshes (Sysmex, CellTrics®, catalog number: 04-0042-2315 )
10-μm nylon meshes (Sysmex, CellTrics®, catalog number: 04-0042-2314 )
Glass Petri dish (Corning, PYREX®, catalog number: 423790 )
Leaf tissue of C-value standard (e.g., Nicotiana tabacum L. ‘Xanthi’; 2C = 10.04 pg, Johnston et al., 1999)
Spores of ferns or lycophytes (kept by dry storage and under < 4 °C)
PVP-40 (Sigma-Aldrich, catalog number: PVP40 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
RNaseA solution (10 mg/ml in ddH2O) (Sigma-Aldrich, catalog number: R5000-100MG )
Triton X-100
Sodium sulfite (Na2SO3)
Tris-HCl (pH 7.5)
Propidium iodide
Backmen stock buffer (see Recipes)*
*Note: LB01 buffer (Doležel et al., 2007) or GPB buffer (Loureiro et al., 2007) can be alternatively used depending on plant material properties.
PI solution (see Recipes)
Equipment
Pipette (10, 100, and 1,000 μl)
Vortex (Scientific Industries, model: Vortex-Genie 2 )
Razors and razor pen
Flow cytometer (BD, BD Biosciences, model: FACScan )*
*Note: FACScan with a 15 microW blue argon ion laser of an emission wave length of 488 nm.
Software
BD FACSCan system (BD Biosciences, Franklin Lake, NJ, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kuo, L. and Huang, Y. (2017). Determining Genome Size from Spores of Seedless Vascular Plants. Bio-protocol 7(11): e2322. DOI: 10.21769/BioProtoc.2322.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Tissue analysis
Plant Science > Plant molecular biology > DNA
Cell Biology > Single cell analysis > Mass cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,323 | https://bio-protocol.org/exchange/protocoldetail?id=2323&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Whole-seed Immunolabeling of Arabidopsis Mucilage Polysaccharides
Cătălin Voiniciuc
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2323 Views: 6803
Edited by: Marisa Rosa
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
In addition to synthesizing and secreting copious amounts of pectic polymers (Young et al., 2008), Arabidopsis thaliana seed coat epidermal cells produce small amounts of cellulose and hemicelluloses typical of secondary cell walls (Voiniciuc et al., 2015c). These components are intricately linked and are released as a large mucilage capsule upon hydration of mature seeds. Alterations in the structure of minor mucilage components can have dramatic effects on the architecture of this gelatinous cell wall. The immunolabeling protocol described here makes it possible to visualize the distribution of specific polysaccharides in the seed mucilage capsule.
Keywords: Arabidopsis thaliana Plant cell wall Immunolabeling Carbohydrate Fluorescence Seed coat Microscopy
Background
Since the first comprehensive immunofluorescence analysis of pectin-rich mucilage in Arabidopsis seed coat epidermal cells (Young et al., 2008), additional types of polysaccharides have been detected in this specialized cell wall (Voiniciuc et al., 2015a; 2015b and 2015c). To handle more samples in parallel, I adapted the original protocols (performed in 1.5-ml microcentrifuge tubes; Young et al., 2008; Harpaz-Saad et al., 2011) to a 24-well plate format. I recommend counterstaining seeds with Pontamine S4B, a fluorescent dye that is more specific to cellulose than previous stains (Anderson et al., 2010). By testing for cross-talk between multiple fluorophores and setting clear guidelines for image acquisition and processing, this protocol yields reproducible mucilage phenotypes that can be reliably interpreted.
Materials and Reagents
Personal protection equipment (safety glasses, lab coat, gloves)
1.5 ml snap-cap tubes
24-well plate with lid (VWR, catalog number: 734-2325 )
Plastic Pasteur pipette (VWR, catalog number: LSUK711117S/20 )
Manual pipettes tips (Eppendorf, Research plus and Repeater plus, or similar style)
Aluminum foil
MARIENFELD glass slides, low autofluorescence, L x B x H: 76 x 26 x 1 mm; pre-washed; Ground edges, 90° slides (VWR, catalog number: 631-9464 )
Precision cover slip glass, thickness No. 1.5H (Marienfeld-Superior, catalog number: 0107222 )
15 ml Falcon tubes (VWR, catalog number: 734-0452 )
Arabidopsis thaliana mature, dry seeds
Primary antibodies directed against plant cell wall carbohydrates, obtained from:
CarboSource (http://www.ccrc.uga.edu/~carbosource/CSS_home.html)
Plant probes (http://www.plantprobes.net/index.php)
Alexa Fluor® 488 secondary antibodies (against the host of the primary antibody)
Goat anti-mouse (Thermo Fisher Scientific, Invitrogen, catalog number: A-11001 )
Goat anti-rat (Thermo Fisher Scientific, Invitrogen, catalog number: A-11006 )
Clear nail polish
Sodium phosphate, dibasic (Na2HPO4·2H2O) (Carl Roth, catalog number: 4984.2 )
Sodium phosphate, monobasic (NaH2PO4·2H2O) (Carl Roth, catalog number: T879.2 )
Bovine serum albumin (BSA), IgG free (Carl Roth, catalog number: 3737.2 )
Pontamine S4B (sold as Direct Red 23) (Sigma-Aldrich, catalog number: 212490-50G )
Sodium chloride (NaCl) (Carl Roth, catalog number: P029.1 )
Phosphate-buffered saline (PBS), pH 7.0 (see Recipes)
Blocking solution (see Recipes)
Antibody solution (see Recipes)
0.01% (w/v) S4B in 50 mM NaCl (see Recipes)
Equipment
Manual pipettes (Eppendorf, models: Research® plus and Repeater® plus ; or similar style)
Water purification system (Milli-Q or similar style)
Balance
Autoclave
Orbital shaker
Vortex mixer (Scientific Industries, model: Vortex-Genie 2 ; or similar style)
Leica TCS SP8 confocal microscope (Leica Microsystems, model: TCS SP8 ) with the following key components:
DM 5000 upright microscope with manual stage
HC PL APO 10x/0.40 CS (Leica Microsystems, catalog number: 15506285 ) objective
Compact LIAchroic AOTF unit with 488 nm and 552 nm solid state lasers
SP8 Scan Head with LIAchroic beam splitters for filter-free spectral detection
Note: Alternatively, use a conventional confocal microscope equipped with filter-based detection. Filters designed for green fluorescent proteins (GFP) and red fluorescent proteins (RFP) are generally suitable for the acquisition of Alexa Fluor® 488 and Pontamine S4B signals, respectively. In this protocol, the emission of fluorophores was detected in 500-530 nm and 590-700 nm ranges.
Two fluorescence photomultipliers and one transmitted light detector
Scan optics module HIVIS with rotation
Computer for image acquisition and processing
Software
Leica Application Suite X (LAS X) software for image acquisition
Fiji is just ImageJ (Fiji) image processing package (https://fiji.sc/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Voiniciuc, C. (2017). Whole-seed Immunolabeling of Arabidopsis Mucilage Polysaccharides. Bio-protocol 7(11): e2323. DOI: 10.21769/BioProtoc.2323.
Voiniciuc, C., Gunl, M., Schmidt, M. H. and Usadel, B. (2015). Highly Branched Xylan Made by IRREGULAR XYLEM14 and MUCILAGE-RELATED21 Links Mucilage to Arabidopsis Seeds. Plant Physiol 169(4): 2481-2495.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,324 | https://bio-protocol.org/exchange/protocoldetail?id=2324&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Induction and Quantification of Patulin Production in Penicillium Species
YC Yong Chen
BL Boqiang Li
ZZ Zhanquan Zhang
Shiping Tian
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2324 Views: 7825
Edited by: Zhaohui Liu
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Patulin, a worldwide regulated mycotoxin, is primarily produced by Penicillium and Aspergillus species during fruit spoilage. Patulin contamination is a great concern with regard to human health because exposure of the mycotoxin can result in severe acute and chronic toxicity, including neurotoxic, mutagenic, and immunotoxic effects. Penicillium expansum is known as the main producer of patulin. This protocol addresses the cultivation procedure of P. expansum under patulin permissive conditions and describes the method of collection and detection of patulin.
Keywords: Penicillium expansum Patulin induction HPLC Quantification
Background
Patulin is a polyketide lactone mycotoxin and is produced by several species of fungi including Penicillium, Aspergillus and other species. Among them, Penicillium expansum, which is a well-known postharvest pathogen causing decay of pomaceous fruits during storage, is the main producer. Patulin levels in apple products are of great concern because of the severe acute and chronic effects caused by the toxin. Therefore the patulin level in food is limited in many countries around the world. The European Commission (2006) has set maximum permitted levels in apple juices (50 μg/kg), solid apple products (25 μg/kg) and, above all, fruit-derived baby foods (10 μg/kg), as children are major consumers of apple derived products.
Studies on patulin in recent years have focused on environmental factors regulating patulin production, molecular basis of patulin biosynthesis and biodegradation of patulin. The methods of induction and quantification of patulin production are important in these studies. Patulin analysis in fruits usually follows the AOAC method 995.10 (Brause et al., 1996). After treatment with pectinase, patulin is extracted with ethyl acetate from the puree of decayed portion of fruits. Many methods have been developed for measuring patulin such as TLC, mass spectrometry and gas chromatography/mass spectrometry. Now, high performance liquid chromatography with ultra violet light detection (HPLC-UV) is the most frequently used method (Baert et al., 2007).
In this protocol, we address two methods of patulin induction in vitro and describe the specific parameters appropriate for HPLC-UV analysis of patulin.
Materials and Reagents
1,000 µl pipette tips (Corning, Axygen®, catalog number: TF-1000-R-S )
200 µl pipette tips (Corning, Axygen®, catalog number: TF-200-R-S )
10 µl pipette tips (Corning, Axygen®, catalog number: TF-300-R-S )
Cheesecloth (Aladdin, catalog number: G6902 )
90 x 15 mm Petri dish (any brand will suffice)
10 ml centrifuge tubes (Sangon Biotech, catalog number: F601889 )
1.5 ml centrifuge tubes (Corning, Axygen®, catalog number: MCT-150-C )
Filter (pore size 0.45 μm) (EMD Millipore, catalog number: SLHV033RB )
Cellophane sheets (Bio-Rad Laboratories, catalog number: 1650963 )
24-well culture plates (Corning, Costar®, catalog number: 3524 )
Penicillium expansum T01: was isolated by our laboratory and whole-genome sequenced (Li et al., 2015)
Glycerol (AMRESCO, catalog number: M152 )
Tween 20 (Sigma-Aldrich, catalog number: T2700 )
Liquid nitrogen
Sterile distilled water
Water (HPLC grade) (Alfa Aesar, catalog number: 19391 )
Acetonitrile (HPLC grade) (Alfa Aesar, catalog number: 22927 )
Potato
Dextrose (Macklin, catalog number: D823520 )
Agar (HUAAOBIO, catalog number: HA0552 )
Sodium nitrate (NaNO3) (Beijing Chemical Works, GB/T 647-1993)
Potassium phosphate dibasic trihydrate (K2HPO4·3H2O) (Beijing Chemical Works, HG/T 3487-2000)
Potassium chloride (KCl) (Aladdin, catalog number: P112133 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Macklin, catalog number: M813599 )
Iron(II) sulfate heptahydrate (FeSO4·7H2O) (Aladdin, catalog number: F116341 )
Sucrose (Beijing Chemical Works, HG/T 3462-1999)
Yeast extract (Oxoid, catalog number: LP0021 )
Hydrochloric acid (HCl) (AMRESCO, catalog number: 0369 )
PDA medium (see Recipes)
CY medium (see Recipes)
Acidified distilled water (pH 4.0) (see Recipes)
Equipment
Glass spreading rod (any brand will suffice)
Hemacytometer (QIUJING, model: XB-K-25 )
100-1,000 µl pipette (Eppendorf, catalog number: 3120000267 )
10-100 µl pipette (Eppendorf, catalog number: 3120000240 )
0.5-10 µl pipette (Eppendorf, catalog number: 3120000224 )
Centrifuge (Beckman Coulter, model: Microfuge 16 , catalog number: A46473)
Tweezer (Thermo Fisher Scientific, catalog number: 402011 )
High-performance liquid chromatography (WATERS Corp., MA, USA)
Auto sampler (WATERS, catalog number: 2498 )
Binary HPLC pump (WATERS, catalog number: 1525 )
UV/Visible detector (WATERS, catalog number: 2487 )
C18 column (5 μm, 250 x 4.6 mm) (GL Sciences, model: Inertsil® ODS-3 )
Vortexer (Select BioProducts, catalog number: SBS100-2 )
Optical microscope (Chongqing Optec Instrument, model: B Series Biological Microscope , catalog number: B203LED)
Clean bench (Donglian Electronic & Technology Development, model: SCB-1520 )
Constant temperature incubator (TAICANG, model: THZ-C )
Software
Microsoft Excel
Empower 3.0
SPSS 13.0 (SPSS Inc., Chicago, IL, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, Y., Li, B., Zhang, Z. and Tian, S. (2017). Induction and Quantification of Patulin Production in Penicillium Species. Bio-protocol 7(11): e2324. DOI: 10.21769/BioProtoc.2324.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Plant Science > Plant immunity > Host-microbe interactions
Biochemistry > Other compound > Patulin
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,325 | https://bio-protocol.org/exchange/protocoldetail?id=2325&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Functional Analysis of Connexin Channels in Cultured Cells by Neurobiotin Injection and Visualization
Philipp Wörsdörfer
Klaus Willecke
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2325 Views: 7937
Reviewed by: Andrea GramaticaGunjan Mehta
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Functional gap junction channels between neighboring cells can be assessed by microinjection of low molecular weight tracer substances into cultured cells. The extent of direct intercellular communication can be precisely quantified by this method. This protocol describes the iontophoretic injection and visualisation of Neurobiotin into cultured cells.
Keywords: Gap junction Connexin Neurobiotin Microinjection Iontophoresis
Background
Gap junctions are intercellular conduits formed between neighboring cells, allowing the diffusional exchange of low molecular mass molecules (< 1.8 kDa). A gap junction channel consists of two hemichannels (connexons) docked to each other. Each connexon is a hexameric assembly of protein subunits termed connexins (Cx). The gap junction protein gene family consists of 20 members in mice and 21 in humans. Connexins are named according to their approximate molecular mass in kDa e.g., Cx43 has an approximate molecular mass of 43 kDa (for review see Söhl and Willecke, 2004). Different connexins are widely expressed in a variety of tissues throughout development where they mediate electrical as well as metabolic coupling. Furthermore, second messenger molecules and ions can be exchanged by direct diffusion through gap junctional channels.
Neurobiotin (N-(2-aminoethyl)biotinamide) is a compound of 286 Da molecular mass and a charge of +1 under physiological conditions. Due to its small size, this tracer passes even those gap junction channels which are not permeable to other common tracers of higher molecular mass e.g., Lucifer Yellow or carboxyfluorescein (Hampson et al., 1992), therefore representing a very sensitive method to detect gap junctional intercellular communication. Compared to the similar tracer biocytin, Neurobiotin appears to be superior regarding solubility, and stability. Furthermore, the compound can be selectively iontophoresed with positive current and subsequently fixed using paraformaldehyde or glutaraldehyde (Kita and Armstrong, 1991). As Neurobiotin does not show autofluorescence it needs to be detected using Avidin conjugated either to horseradish peroxidase or directly linked to a fluorescent dye.
Materials and Reagents
6 cm tissue culture treated culture dishes (several distributers available e.g., Corning, Tewksbury, MA)
GB 100-F8P borosilicate glass capillaries (Science Products GmbH, Hofheim, Germany)
Syringe (1 ml)
Spinal needle (0.5 mm, 25 G)
Reaction tube
Cell line or primary cell preparation of interest
pcDNATM3.1/Zeo(+)
HistoGreen HRP-substrate Kit (Linaris, catalog number: E109 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P9791 )
Neurobiotin (Vector Laboratories, catalog number: SP-1120 )
Rhodamine B isothiocyanate-Dextran (Sigma-Aldrich, catalog number: R9379 )
Tris base (Sigma-Aldrich, catalog number: T1503 )
Lithium chloride (LiCl) (Sigma-Aldrich, catalog number: L9650 )
50% glutaraldehyde solution (Sigma-Aldrich, catalog number: 340855 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Avidin D coupled horseradish peroxidase (Vector Laboratories, catalog number: A-2004 )
PBS (see Recipes)
Neurobiotin/Rhodamine B isothiocyanate-Dextran solution (see Recipes)
LiCl solution (see Recipes)
0.5% glutaraldehyde solution (see Recipes)
Triton X-100 solution (see Recipes)
Avidin D coupled horseradish peroxidase solution (see Recipes)
Equipment
Microelectrode-holder suitable for 1 mm glass capillaries with AgCl electrode (e.g., World Precision Instruments, model: MEH8 )
Dual Microiontophoresis current generator SYS-260 (World Precision Instruments, FL)
Zeiss IM35 inverted fluorescence microscope (Zeiss, model: Zeiss IM35 ) equipped with:
Heated stage set to 37 °C
HBO lamp (100 W)
Appropriate filter set to detect Rhodamine B fluorescence (Ex/Em 570/590; Filter Set 20 HE)
The microscope should be placed on an anti-vibration microscope desk
Incubator
Micropipette puller P97 (Sutter Instrument, model: P-97 )
Micromanipulator Injectman (Eppendorf, Hamburg, Germany)
AgCl reference electrode (disc)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wörsdörfer, P. and Willecke, K. (2017). Functional Analysis of Connexin Channels in Cultured Cells by Neurobiotin Injection and Visualization. Bio-protocol 7(11): e2325. DOI: 10.21769/BioProtoc.2325.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Maintenance and differentiation
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,326 | https://bio-protocol.org/exchange/protocoldetail?id=2326&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Whole Mammary Gland Transplantation in Mice Protocol
Hayley Hansford
Yan Hong
FK Frances Kittrell
DM Daniel Medina
Fariba Behbod
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2326 Views: 7933
Original Research Article:
The authors used this protocol in 14-Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
14-Oct 2013
Abstract
Whole Mammary Gland Transplantation involves transplanting an excised mammary gland into another, more suitable host. This method can be used to extend the life of a mammary gland past the mouse’s life span by transplanting the mammary gland of an older mouse into a young healthy mouse. As you can see in the video below (Video 1), by attaching it to the abdomen of the mouse, the gland will receive a steady blood supply and both epithelial and stromal cells will remain viable for up to one year. Although this method is not used often, it has been part of several experiments including determining whether the stroma or epithelium is the primary target in chemically induced mouse mammary tumorigenesis (Medina and Kittrell, 2005). To monitor transplants, palpate every week for tumor formation. The transplanted mammary gland may also be passaged serially every 8-10 weeks. Keep transplanted gland in the same mouse for no longer than one year.
Video 1. Whole mammary gland transplantation
Keywords: Mammary gland Transplant Viable epithelial cells Mammary tumorigenesis
Materials and Reagents
Surgical gloves (Cardinal Health, catalog number: 2D72N80X )
1 ml Tuberculin (TB) syringe (BD, catalog number: 309625 )
Dissolvable suture, size: 0000
Animals: 8-12-week old female mice
Note: Excised gland will need to be transplanted into the same strain of mouse. If donor and recipient are of different strains, the recipient must be immunocompromised (i.e., gland excised from Balb/c mouse and transplanted to NSG mouse).
Nembutal sodium solution CII (Pentobarbital sodium injection, USP) (Akorn, Oak Pharmaceuticals, NDC 76478-501-20 )
Ketofen® (Ketoprofen) (Zoetis, catalog number: 10004029 )
70% ethanol
Equipment
Balance
Hair clipper (Remington, model: PG525 )
Hemostatic forceps (Roboz Surgical Instruments, catalog number: RS-7131L )
Sharp/Ball Tip scissors (Fine Science Tool, catalog number: 14086-09 )
Rat tooth forceps (Sklar Surgical Instruments, catalog number: 19-1260 )
Curved forceps (Fine Science Tool, catalog number: 11052-10 )
Heating pad (Sunbeam Products, catalog number: 000771-810-000U )
Wound Clip applier, remover and clips (BD, catalog number: 427638 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hansford, H., Hong, Y., Kittrell, F., Medina, D. and Behbod, F. (2017). Whole Mammary Gland Transplantation in Mice Protocol. Bio-protocol 7(11): e2326. DOI: 10.21769/BioProtoc.2326.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Animal models
Cell Biology > Tissue analysis > Tissue isolation
Cell Biology > Cell Transplantation > Allogenic Transplantation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,327 | https://bio-protocol.org/exchange/protocoldetail?id=2327&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chromatin Immunoprecipitation Experiments from Whole Drosophila Embryos or Larval Imaginal Discs
VL Vincent Loubiere
AD Anna Delest
BS Bernd Schuettengruber
AM Anne-Marie Martinez
Giacomo Cavalli
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2327 Views: 12371
Edited by: Jihyun Kim
Reviewed by: Leonardo G. Guilgur
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
Chromatin Immunoprecipitation coupled either to qPCR (qChIP) or high-throughput sequencing (ChIP-Seq) has been extensively used in the last decades to identify the DNA binding sites of transcription factors or the localization of various histone marks along the genome. The ChIP experiment generally includes 7 steps: collection of biological samples (A), cross-linking proteins to DNA (B), chromatin isolation and fragmentation by sonication (C), sonication test (D), immunoprecipitation with antibodies against the protein or the histone mark of interest (E), DNA recovery (E), identification of factor-associated DNA sequences by PCR or sequencing (F). The protocol described here can readily be used for ChIP-seq and ChIP-qPCR experiments. The entire procedure, describing experimental setup conditions to optimize assays in intact Drosophila tissues, can be completed within four days.
Keywords: ChIP Drosophila Embryo Imaginal disc Epigenetic mark Transcription factor
Background
Despite the fact that immortalized cultured cells are extensively used to study the chromatin landscape of various cell types, valuable methods for probing interaction in vivo, under physiological conditions, are necessary to perform temporal or spatial comparative analysis of transcription factor and histone modification maps between different stages of Drosophila development or between different tissues. Here we present a detailed ChIP protocol that has been optimized to work on whole Drosophila embryos and larval imaginal discs, highlighting critical experimental parameters.
Materials and Reagents
Imaginal discs dissection step
1.Sterile tips for micropipettes, 1,000 µl
2.1.5 ml DNA low binding tubes (Eppendorf, catalog number: 022431021 )
3.Schneider’s insect medium (Sigma-Aldrich, catalog number: S0146 )
Embryos collection step
Petri dishes
1.5 ml DNA low binding (LoBind) tubes (Eppendorf, catalog number: 022431021 )
Drosophila embryos
SAF-INSTANT yeast (Lesaffre)
Liquid nitrogen
Agar
10% Moldex (Methyl-4-hydroxybenzoate) (Sigma-Aldrich, catalog number: W271004 ) dissolved in water
Neutral red (Sigma-Aldrich, catalog number: N4638 )
Egg laying medium (see Recipes)
Chromatin immunoprecipitation protocol
1.5 ml DNA low binding (LoBind) tubes (Eppendorf, catalog number: 022431021 )
15 ml sterile plastic tubes (Greiner Bio One International, catalog number: 188261 )
50 ml sterile plastic tubes (Greiner Bio One International, catalog number: 227261 )
15 ml polystyrene Falcon tubes (Corning, catalog number: 352095 )
Sterile filter tips, 10 µl, 200 µl, 1,000 µl (STARLAB INTERNATIONAL, catalog numbers: S1121-2710 , S1120-8810 , S1122-1830 ) (see Note 1 for more details)
Sterile, DNase and RNase free, DNA low binding filter tips, 10 µl, 200 µl, 1,000 µl (Sorenson BioScience, catalog numbers: 35210 , 35240 , 35260 ) (see Note 1 for more details)
Qubit® Assay tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: Q32856 )
LightCycler® 480 multiwell plate 96, white (Roche Molecular Systems, catalog number: 04729692001 )
LightCycler® 480 sealing foil (Roche Molecular Systems, catalog number: 04729757001 )
Liquid nitrogen
20% sodium dodecyl sulfate (SDS) (Biosolve, catalog number: 198123 )
Autoclaved 1 M KCl solution
Autoclaved 5 M NaCl solution
Autoclaved 1 M MgCl2 solution
Sterile filtered 1 M HEPES buffer pH 7.6 (Sigma-Aldrich, catalog number: H0887 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
1 M DL-Dithiothreitol (DTT) prepared from powder (Sigma-Aldrich, catalog number: D0632 ) dissolved in deionized water
1 M sodium butyrate prepared from powder (Sigma-Aldrich, catalog number: 303410 ) dissolved in deionized water
EDTA-free protease inhibitor cocktail tablets (Roche Molecular Systems, catalog number: 04693132001 )
16% formaldehyde solution, methanol-free (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 28906 )
2.5 M glycine prepared from powder (Sigma-Aldrich, catalog number: G8898 ) dissolved in deionized water filtered with a disposable syringe filter (0.45 μm) (Pall, catalog number: 4422 )
0.5 M EDTA pH 8.0 (Sigma-Aldrich, catalog number: 03690 )
0.5 M EGTA pH 8.0 prepared from powder (Sigma-Aldrich, catalog number: E3889 ) dissolved in deionized water
1 M sodium deoxycholate prepared from powder (Sigma-Aldrich, catalog number: D5670 ) dissolved in deionized water
20% N-Lauroylsarcosine sodium salt solution (Sigma-Aldrich, catalog number: L7414 )
10 mg/ml RNase A (Sigma-Aldrich, catalog number: R6513 ) dissolved in deionized water
UltraPureTM phenol:chloroform:isoamyl alcohol (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15593049 ) referred as phenol-chloroform in the text
3 M sodium acetate, pH 5.5 (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9740 )
35 mg/ml glycogen (MP-Biomedicals, catalog number: 11GLYCO001 )
Ethanol absolute AnalaR NORMAPUR® (VWR, catalog number: 20821.310 )
Agarose powder (Sigma-Aldrich, catalog number: A9539 )
1x TAE buffer prepared from 50x solution (Biosolve, catalog number: 205023 )
Autoclaved Tris HCl pH 8.0
Ethidium bromide (Sigma-Aldrich, catalog number: E1510 )
Nuclease free water, not DEPC treated (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9937 )
Urea (MP Biomedicals, catalog number: 821519 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Bromophenol blue (Sigma-Aldrich, catalog number: B5525 )
100 bp DNA ladder (New England Biolabs, catalog number: N3231S )
Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32854 )
Dynabeads® Protein A for Immunoprecipitation (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10001D ) or Dynabeads® Protein G for Immunoprecipitation (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10003D ) (see Note 2 for details)
20 mg/ml proteinase K (Sigma-Aldrich, catalog number: P2308 )
1 g/µl of normal rabbit IgG (Cell Signaling Technology, catalog number: 2729 )
Sterile filtered water (Sigma-Aldrich, catalog number: W3500 )
LightCycler® 480 SYBR Green I Master (Roche Molecular Systems, catalog number: 04707516001 )
10x embryo buffer stock solution (see Recipes)
Embryo buffer (see Recipes)
Buffer A1 (see Recipes)
Lysis buffer 1 (see Recipes)
Lysis buffer 2 (see Recipes)
Lysis buffer wash (see Recipes)
TE buffer
Low blue loading buffer (see Recipes)
Elution buffer 1 (see Recipes)
Elution buffer 2 (see Recipes)
Equipment
Sieves (pores < 0.5 mm)
Microwave
1 L beaker (Corning, PYREX®, catalog number: 1003-1L )
Magnetic stirrer
Cages (Dutscher Scientific, catalog number: 789092 )
Wash bottle
Paintbrush (Carolina Biological Supply, catalog number: 173094 )
Calibration checked pipettes 0-2 µl, 1-10 µl, 20-200 µl, 100-1,000 µl
Rotating wheels, one in a cold room and the other one at room temperature
Stereomicroscope
Fine #55 forceps for dissection (Fine Science Tools, catalog number: 11255-20 )
WheatonTM Tenbroeck tissue grinder (WHEATON, catalog number: 357422 )
Agarose gel caster
Shaker (For instance the Orbital Shaker from Starlab group) (STARLAB INTERNATIONAL, model: OrbitalTM Shaker, catalog number: N2400-8030 )
Cold centrifuge (4 °C, able to reach at least 14,000 x g)
Cold sonicator (we recommend the Bioruptor® from Diagenode, model: Bioruptor® Plus sonication device , catalog number: B01020001)
Magnetic rack (Thermo Fisher Scientific, model: DynaMagTM-2 Magnet, catalog number: 12321D )
Gel visualization system (UV lamp)
Qubit® fluorometer (Thermo Fisher Scientific, InvitrogenTM, model: Qubit® 3.0 , catalog number: Q33216)
LightCycler® Instrument II (Roche Molecular Systems, model: LightCycler® 480 Instrument II , catalog number: 05015278001)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Loubiere, V., Delest, A., Schuettengruber, B., Martinez, A. and Cavalli, G. (2017). Chromatin Immunoprecipitation Experiments from Whole Drosophila Embryos or Larval Imaginal Discs. Bio-protocol 7(11): e2327. DOI: 10.21769/BioProtoc.2327.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,328 | https://bio-protocol.org/exchange/protocoldetail?id=2328&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phototaxis Assays of Synechocystis sp. PCC 6803 at Macroscopic and Microscopic Scales
AJ Annik Jakob
NS Nils Schuergers
AW Annegret Wilde
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2328 Views: 9275
Edited by: Maria Sinetova
Reviewed by: Dennis Nürnberg
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Phototaxis is a mechanism that allows cyanobacteria to respond to fluctuations in the quality and quantity of illumination by moving either towards or away from a light source. Phototactic movement on low concentration agar or agarose plates can be analyzed at macroscopic and microscopic scales representing group behavior and single cell motility, respectively. Here, we describe a detailed procedure for phototaxis assays on both scales using the unicellular cyanobacterium Synechocystis sp. PCC 6803.
Keywords: Cyanobacteria Synechocystis Motility Phototaxis Photoreceptors
Background
The model organism Synechocystis sp. PCC 6803 uses retractile type IV pili (T4P) to move across moist surfaces in a jerky motion referred to as twitching motility. Two secretion ATPases (PilB and PilT) are responsible for the extension and retraction of the pilus apparatus, thus pulling the cells forward. Synechocystis sp. PCC 6803 harbors a variety of photoreceptors covering the entire visible spectrum. Absorption of light can stimulate either positive or negative phototaxis depending on wavelength and intensity. Recently, it was demonstrated that single cells of Synechocystis sp. PCC 6803 are able to directly detect unidirectional illumination by focusing the light in a sharp focal point on the distal side (Schuergers et al., 2016). Moreover, it was shown that the direction of twitching motility correlates with a specific proximal localization of the motor ATPase PilB (Schuergers et al., 2015). A model was proposed that the focusing leads to a local inhibition of the motility apparatus, thus determining the direction of movement of single cells as a photophobic response away from the focal light spot (Schuergers et al., 2016).
Materials and Reagents
Sterile square (120 x 120 x 17 mm) Petri dishes (Greiner Bio One International, catalog number: 688161 ; supplied by VWR)
Sterile 1 µl inoculation loops (SARSTEDT, catalog number: 86.1567.010 )
Sterile 1.5 ml Eppendorf tubes 3810X (Eppendorf, catalog number: 0030125150 )
Sterile µ-dishes 35 mm high glass bottom (ibidi, catalog number: 81158 )
Microscope coverslips 20 x 20 mm (Carl Roth, catalog number: H873 )
Sterile syringes 50 ml (SARSTEDT, catalog number: 94.6077.137 )
Sterile syringe filters Filtropur S 0.2 (SARSTEDT, catalog number: 83.1826.001 )
Sterile 50 ml Greiner centrifuge tubes (Greiner Bio One International, catalog number: 227261 )
Serological pipettes 25 ml (SARSTEDT, catalog number: 86.1685.020 )
Serological pipettes 5 ml (SARSTEDT, catalog number: 86.1253.025 )
Synechocystis sp. PCC 6803 strain (motile wild type obtained from S. Shestakov, Moscow State University, Russia), resequenced by Trautmann et al. (2012)
Liquid paraffin, viscous (Carl Roth, catalog number: 8904 )
Ultrapure water
Ethylenediamine tetraacetic acid disodium salt dehydrate (Na2EDTA·2H2O) (Carl Roth, catalog number: 8043 )
Sodium hydroxide (NaOH) (Carl Roth, catalog number: 6771 )
di-Potassium hydrogen phosphate trihydrate (K2HPO4·3H2O) (EMD Millipore, catalog number: 105099 )
Sodium carbonate (Na2CO3) (Carl Roth, catalog number: P028 )
Boric acid (H3BO3) (Carl Roth, catalog number: 6943 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (Carl Roth, catalog number: T881 )
Zinc sulphate heptahydrate (ZnSO4·7H2O) (Carl Roth, catalog number: T884 )
Sodium molybdate dehydrate (Na2MoO4·2H2O) (Carl Roth, catalog number: 0274 )
Copper(II) sulphate pentahydrate (CuSO4·5H2O) (Carl Roth, catalog number: P024 )
Cobalt(II) nitrate hexahydrate, Co(NO3)2·6H2O (Carl Roth, catalog number: HN16 )
Ammonium ferric citrate (Carl Roth, catalog number: CN77 )
2-[(2-Hydroxy-1,1-bis(hydroxymethyl)ethyl)amino]ethanesulfonic acid (TES) (Carl Roth, catalog number: 9137 )
Sodium thiosulphate (Na2S2O3) (Carl Roth, catalog number: HN25 )
D(+)-glucose (Carl Roth, catalog number: X997 )
Sodium nitrate (NaNO3) (Carl Roth, catalog number: A136 )
Magnesium sulphate heptahydrate (MgSO4·7H2O) (Carl Roth, catalog number: P027 )
Calcium chloride dihydrate (CaCl2·2H2O) (Carl Roth, catalog number: 5239 )
Citric acid (Carl Roth, catalog number: X863 )
Agar-agar, Kobe I (Carl Roth, catalog number: 5210 )
UltraPureTM agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500500 )
0.5 M Na2EDTA pH 8.0 (see Recipes)
3% w/v K2HPO4·3H2O solution (see Recipes)
2% w/v Na2CO3 solution (see Recipes)
Trace metal mix solution (see Recipes)
0.6% w/v ammonium ferric citrate solution (see Recipes)
1 M TES buffer pH 8.0 (see Recipes)
30% w/v Na2S2O3 solution (see Recipes)
40% w/v D(+)-glucose solution (see Recipes)
100x BG11 medium (see Recipes)
2x BG11 medium (see Recipes)
1x BG11 medium (see Recipes)
1% w/v agar solution (see Recipes)
0.6% w/v agarose solution (see Recipes)
Macroscopic phototaxis plate medium (see Recipes)
Microscopic phototaxis plate medium (see Recipes)
Equipment
Laboratory bottles 1,000 ml (Duran Group, catalog number: 21 801 54 5 )
Laboratory bottles 500 ml (Duran Group, catalog number: 21 801 44 5 )
Laboratory bottles 250 ml (Duran Group, catalog number: 21 801 36 5 )
Laboratory bottles 100 ml (Duran Group, catalog number: 21 801 24 5 )
Non-transparent square box (127 x 127 x 19 mm) with a one-sided opening (custom-made from polyvinyl chloride)
Silicon ring (øo: 30 mm, øi: 16 mm) custom-made
Non-transparent hollow cylinder (ø: 40 mm, h: 30 mm) with 4 holes (ø: 5 mm, h: 7 mm) positioned in increments of 90° for the insertion of LEDs (custom-made from polyvinyl chloride)
Balance (Denver Instrument)
pH meter (Mettler-Toledo)
UV/Vis spectrophotometer (Shimadzu, model: UV-2401PC )
Light source (Philips Lighting Holding, model: MASTER TL-D Super 80 18W/840 1SL/25 )
Pipetting aid PIPETBOY acu 2 (INTEGRA Biosciences, model: PIPETBOY acu 2, catalog number: 155 017 )
Quantum Sensor LI-190R (LI-COR, model: LI-190R )
Transmitted light scanner (Epson, model: Epson Perfection V700 Photo , with adjustable cover)
Fluorescence microscope (Nikon Instruments, model: Eclipse Ni-U , with CFI Plan Fluor 40X/0.75)
Digital CCD camera (Hamamatsu Photonics, model: ORCA®-05G )
Microcontroller board (Arduino, model: Arduino UNO R3 )
RGB-LEDs (625 nm, 525 nm, 470 nm) 5 mm (World Trading Net)
Biological safety cabinet (NuAire, model: Class II Type A2 )
Software
NIS-Elements Basic Research 4.20.01
Arduino 1.0.6
MATLAB Runtime 8.3
BacteriaMobilityQuant (https://web.fe.up.pt/~dee11017/software/BacterialMobilityQuant.zip)
R
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jakob, A., Schuergers, N. and Wilde, A. (2017). Phototaxis Assays of Synechocystis sp. PCC 6803 at Macroscopic and Microscopic Scales. Bio-protocol 7(11): e2328. DOI: 10.21769/BioProtoc.2328.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell staining
Microbiology > Microbial physiology > Phototaxis
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,329 | https://bio-protocol.org/exchange/protocoldetail?id=2329&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Reliable Assay to Evaluate the Virulence of Aspergillus nidulans Using the Alternative Animal Model Galleria mellonella (Lepidoptera)
CF Caroline Mota Fernandes
FF Fernanda Lopes Fonseca
GG Gustavo Henrique Goldman
Marcos Dias Pereira*
EK Eleonora Kurtenbach*
*Contributed equally to this work
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2329 Views: 10125
Edited by: Valentine V Trotter
Reviewed by: Shahin S. Ali
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
The greater wax moth Galleria mellonella has emerged as an effective heterologous host to study fungal pathogenesis and the efficacy of promising antifungal drugs (Mylonakis et al., 2005; Li et al., 2013). Here, a methodology describing the Aspergillus nidulans infection in G. mellonella larvae, along with insect survival analysis, is reported. This protocol allowed the distinction between virulent A. nidulans strains (such as TNO2A3), which induced high larval mortality rates, to those in which gene deletion was accompanied by reduced pathogenicity such as ∆gcsA and ∆sdeA (Fernandes et al., 2016).
Keywords: Aspergillus nidulans Galleria mellonella Fungal pathogenicity Fungal virulence Alternative models
Background
G. mellonella is an inexpensive model, easy to handle and its innate immune response shares functional similarities with the mammalian immune system. Additionally, larvae and mice infected with fungal mutant strains exhibited similar survival rates (Brennan et al., 2002). Therefore, larvae constitute a convenient animal host to substitute the use of vertebrates in fungal pathogenesis analysis. Despite all the advantages of the insect model, only a few reports have shown the effect of Aspergillus infection in G. mellonella. This protocol describes an efficient methodology to analyze Aspergillus nidulans pathogenesis in G. mellonella larvae.
Materials and Reagents
Sterile toothpick
Inoculation loop (microstreaker) (Thermo Fischer Scientific, Thermo ScientificTM, catalog number: SL1S )
200-1,000 µl pipette tips (Corning, Axygen®, catalog number: T-1000-B )
2-20 µl pipette tips (Corning, Axygen®, catalog number: T-200-Y )
15 ml conical tube (Greiner Bio One International, catalog number: 188271 )
Miracloth filter, pore size 22-25 µm (EMD Millipore, catalog number: 475855 )
20 ml syringe (BD, catalog number: 302830 )
1.5 ml microcentrifuge tube (Corning, Axygen®, catalog number: MCT-150-R )
Gloves
Weighing paper
Glass wool (Sigma-Aldrich, catalog number: 18421 )
280 ml plastic boxes
Galleria mellonella larvae
Aspergillus nidulans strains (TNO2A3 strain is available commercially in Fungal Genetics Stock Center as #A1149; ∆sdeA and ∆gcsA mutants can be provided by us upon request)
Sterile deionized water
Yeast extract (BD, BactoTM, catalog number: 212750 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
Agar (BD, BactoTM, catalog number: 214010 )
Uridine (Sigma-Aldrich, catalog number: U3750 )
Uracil (Sigma-Aldrich, catalog number: U0750 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: V000283 )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: V000263 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (Sigma-Aldrich, catalog number: 221279 )
Iron(II) sulfate heptahydrate (FeSO4·7H2O) (Sigma-Aldrich, catalog number: V000119 )
Cobalt(II) chloride hexahydrate (CoCl2·6H2O) (Sigma-Aldrich, catalog number: V000213 )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (Sigma-Aldrich, catalog number: V000118 )
Ammonium molybdate tetrahydrate (Sigma-Aldrich, catalog number: V000122 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: V000114 )
10 N sodium hydroxide (NaOH) solution
Ethanol
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: V000106 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: V000317 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: V000225 )
Hydrogen chloride (HCl)
Honey (Local supermarket)
Glycerol (Sigma-Aldrich, catalog number: V000123 )
Milk (Local supermarket)
Wheat germ (Local supermarket)
Wheat flour (Local supermarket)
Wheat bran (Local supermarket)
Complete media (YUU media) for A. nidulans growth (see Recipes)
Trace elements solution for Aspergillus (see Recipes)
70% ethanol solution (see Recipes)
PBS buffer (see Recipes)
Artificial diet for Galleria mellonella (see Recipes)
Equipment
100 x 10 mm glass Petri dishes (Corning, PYREX®, catalog number: 3160-100 )
Autoclave (Prismatec, model: CS-18 )
Laminar flow cabinet (TROX Technik, model: TLF-A1 )
250 ml beaker (Roni Alzi, catalog number: 2-570 )
Blunt tipped tweezer (EMD Millipore, catalog number: XX6200006P )
Bunsen burner/lighter
Hemocytometer (Hausser Scientific, catalog number: 3500 )
Optical microscope with a 100x objective (American Optical Corporation)
10 µl Hamilton 700 series cemented syringe (Hamilton, catalog number: 80300 )
Analytical balance (Denver Instrument, model: XL-410 , catalog number: 8515.1)
Spatula (Sigma-Aldrich, catalog number: Z282774 )
Graduated cylinder (Roni Alzi, catalog number: 2-950 )
Glass bottle (Corning, PYREX®, catalog number: 1395-1L )
Manual adjustable pipette (200-1,000 µl, Pipetman P1000) (Gilson, catalog number: F123602 )
Manual adjustable pipette (2-20 µl, Pipetman P20) (Gilson, catalog number: F123600 )
Thermostatic incubators (Fanem®, model: 515 )
Software
GraphPad Prism 7.0 program (GraphPad Software; https://www.graphpad.com/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fernandes, C. M., Fonseca, F. L., Goldman, G. H., Pereira, M. D. and Kurtenbach, E. (2017). A Reliable Assay to Evaluate the Virulence of Aspergillus nidulans Using the Alternative Animal Model Galleria mellonella (Lepidoptera). Bio-protocol 7(11): e2329. DOI: 10.21769/BioProtoc.2329.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Fungus
Microbiology > Microbe-host interactions > In vivo model
Cell Biology > Cell viability > Cell death
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
233 | https://bio-protocol.org/exchange/protocoldetail?id=233&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Peptide Synthesis
ZM Zheng Miao
ZC Zhen Cheng
Published: Vol 2, Iss 14, Jul 20, 2012
DOI: 10.21769/BioProtoc.233 Views: 27620
Original Research Article:
The authors used this protocol in Nov 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2011
Abstract
This protocol describes the synthesis of peptides for affinity testing and bioconjugate with solid phase peptide synthesizer at a small scale.
Keywords: Solid phase Peptide Fmoc Scaffold protein Microcleavage
Materials and Reagents
Dichloromethane (DCM)
Dimetylformamide (DMF) (Fisher Science, catalog number: D119-4 )
Trifluoroacetic acid (TFA) (ACRO, catalog number: 13972 )
Thioanisole (TIS) (Sigma-Aldrich, 233781 )
Ethanedithiol (EDT) (TCI, catalog number: E0032 )
2-(1H-Benzotriazol-1-yl)-1,1,3,3-tertramethyluronumhexafluorophosphate (HBTU) (Anaspec, catalog number: AS-21001 )
N,N-diisopropylethylamine (DIEA) (Santa Cruz Biotech, catalog number: sc-215490 )
Piperidine (biotech. grade, ≥99.5%) (Sigma-Aldrich, catalog number: 571261 )
Dithiothriotol (DTT)
Pyridine
Potassium cyanide
Ninhydrin
Fmoc protected amino acids:
Fmoc-Ile-OH, Fmoc-Glu (OtBu)-OH, Fmoc-Met-OH, Fmoc-Leu-OH, Fmoc-Lys (Boc)-OH, Fmoc-Arg (Pbf)-OH, Fmoc-Asn (Trt)-OH, Fmoc-Ser (tBu)-OH, Fmoc-Ala-OH, Fmoc-His (Trt)-OH, Fmoc-Gln (Trt)-OH, Fmoc-Val-OH, Fmoc-Phe-OH, Fmoc-Thr(tBu)-OH, Fmoc-Pro-OH and Fmoc-Asp (OtBu)-OH, Fmoc-Gly-OH, Fmoc-Cys(Trt)-OH, Fmoc-Tyr(tBu)-OH, Fmoc-Trp(Boc)-OH.
Rink Amide Resin (0.66 mmol/g) (AAPPTec, catalog number: RRZ001 or equivalent)
C-18 column (Vydac, catalog number: 218TP510 or equivalent)
All reagents are ACS grade or synthesis grade
Anhydrous diethyl ether
Equipment
Peptide synthesizer CS-Bio 336x or equivalent
Analytical balance
Swing bucket eppendorf centrifuge or equivalent
High performance liquid chromatograph (HPLC)
Reaction vessel (SKU: PS-G002 )
Liquid chromatograph-mass spectrometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Miao, Z. and Cheng, Z. (2012). Peptide Synthesis. Bio-protocol 2(14): e233. DOI: 10.21769/BioProtoc.233.
Download Citation in RIS Format
Category
Biochemistry > Protein > Synthesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,330 | https://bio-protocol.org/exchange/protocoldetail?id=2330&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Modification of 3’ Terminal Ends of DNA and RNA Using DNA Polymerase θ Terminal Transferase Activity
TH Trung M. Hoang
TK Tatiana Kent
RP Richard T. Pomerantz
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2330 Views: 9106
Edited by: Gal Haimovich
Reviewed by: Vamseedhar RayaproluDavid Paul
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
DNA polymerase θ (Polθ) is a promiscuous enzyme that is essential for the error-prone DNA double-strand break (DSB) repair pathway called alternative end-joining (alt-EJ). During this form of DSB repair, Polθ performs terminal transferase activity at the 3’ termini of resected DSBs via templated and non-templated nucleotide addition cycles. Since human Polθ is able to modify the 3’ terminal ends of both DNA and RNA with a wide array of large and diverse ribonucleotide and deoxyribonucleotide analogs, its terminal transferase activity is more useful for biotechnology applications than terminal deoxynucleotidyl transferase (TdT). Here, we present in detail simple methods by which purified human Polθ is utilized to modify the 3’ terminal ends of RNA and DNA for various applications in biotechnology and biomedical research.
Keywords: DNA polymerase DNA repair DNA modification Alternative end-joining Terminal deoxynucleotidyl transferase Biotechnology Nucleotide analogs
Background
The human POLQ gene encodes a large protein that contains an N-terminal superfamily 2 (SF2) type helicase domain and a C-terminal A-family polymerase domain (Sfeir and Symington, 2015; Black et al., 2016; Wood and Doublie, 2016). The protein also encodes for a large central domain whose function has yet to be ascribed. Polθ is expressed in metazoans and has been shown to function in multiple aspects of DNA replication and repair (Black et al., 2016; Wood and Doublie, 2016). Recent work showed that mammalian Polθ is essential for the error-prone DNA double-strand break (DSB) repair pathway called alternative end-joining (alt-EJ), also known as microhomology mediated end-joining (MMEJ) (Yousefzadeh et al., 2014; Kent et al., 2015; Mateos-Gomez et al., 2015). This essential function of the polymerase is conserved among metazoans (Chan et al., 2010; Koole et al., 2014).
Interestingly, Polθ mediated alt-EJ results in relatively large deletions and insertions (indels) at DNA repair junctions compared to the more accurate non-homologous end-joining (NHEJ) pathway (Black et al., 2016). For instance, alt-EJ typically generates insertions ranging from 1-6 base pairs (bp), and in some cases insertions can exceed 30 bp (Yousefzadeh et al., 2014; Mateos-Gomez et al., 2015; Black et al., 2016; Kent et al., 2016). Intriguingly, multiple studies from invertebrates and vertebrate systems show that some insertion tracts are templated by nearby DNA sequences such as those flanking the DSB (Black et al., 2016). In other cases, insertion sequences appear to be random (Black et al., 2016). These and other studies led to the idea that Polθ might generate insertion tracts at DSBs by both templated and non-templated terminal transferase mechanisms.
Indeed, in a recent study Kent et al. demonstrated that the human Polθ polymerase domain, hereinafter referred to as Polθ, exhibits robust terminal transferase activity preferentially on single-strand DNA (ssDNA) and double-strand DNA containing 3’ ssDNA overhangs, referred to as partial ssDNA (pssDNA) (Kent et al., 2016). This study also compared the terminal transferase activities of Polθ and terminal deoxynucleotidyl transferase (TdT) using their respective optimal conditions, and found that Polθ is a more versatile enzyme for modifying the 3’ terminus of nucleic acids. For example, the authors showed that Polθ is able to modify nucleic acids with a wider variety of nucleotide analogs, such as those containing large fluorophores or attachment chemistries (Kent et al., 2016). As a specific example, Polθ was shown to efficiently modify ssDNA with a nucleotide analog containing click chemistry applicability (i.e., a linker attached to an azide group), whereas TdT failed to use the same nucleotide as a substrate (Kent et al., 2016). TdT was also unable to use a Texas Red conjugated nucleotide analog that Polθ efficiently utilized to modify ssDNA (Kent et al., 2016). Polθ is also capable of modifying the 3’ terminal ends of RNA and appears to show a significantly lower discrimination against ribonucleotides compared to TdT (Kent et al., 2016). Altogether, this recent report demonstrates that Polθ is a more versatile terminal transferase enzyme than TdT and therefore should be more useful for a wide range of applications in biotechnology and biomedical research that require modification of 3’ terminal DNA and RNA ends (Kent et al., 2016). Here, we explain in detail step-by-step procedures for using Polθ as a robust terminal transferase enzyme in vitro.
Materials and Reagents
The following reagents are needed for modifying nucleic acids with Polθ:
Pipette tips (i.e., Fisher Scientific, catalog number: 02-707-432 )
Microcentrifuge tubes (i.e., 0.5 ml or 1.5 ml). DNase and RNase free tubes are recommended for reactions (i.e., BioDot Ultra Spin 1.5 ml Microcentrifuge Tubes) (DOT Scientific, catalog number: 711-FTG )
ssDNA or RNA to be modified (typically 10-50 nt in length; desalted, HPLC or PAGE purified)
Purified Polθ (residues 1,792-2,590, MW = 90 kDa) (expression vector and purification methods: Hogg et al., 2011)
Nucleoside triphosphate analogs (i.e., TriLink BioTechnologies, catalog number: N-2008-102502 and TriLink BioTechnologies, catalog number: N-5001 ) or canonical nucleoside triphosphates (i.e., Promega, catalog number: U120 )
1 M Tris buffer pH 8.2 (i.e., DOT Scientific, catalog number: DST60040-10000 )
Hydrochloric acid (HCl) (i.e., Thomas Scientific, catalog number: C395L46 )
NP-40 detergent (i.e., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 28324 )
Bovine serum albumin (BSA) (protease free) (i.e., Fisher Scientific, catalog number: BP9703100 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (i.e., Sigma-Aldrich, catalog number: M3634-100G )
1 M HEPES buffer pH 8.0 (i.e., Oakwood Products, catalog number: 047861-1Kg )
Sodium hydroxide (NaOH)
Deionized water (dH2O) (Autoclaved Nanopure filtered water is recommended for reactions with RNA)
1 M Tris buffer pH 8.2 (see Recipes)
Buffer A (see Recipes)
1 M HEPES buffer pH 8.0 (see Recipes)
The following reagents are needed if visualization of RNA and DNA modification is desired:
Ammonium persulfate (APS) (i.e., Sigma-Aldrich, catalog number: A3678 )
40% acrylamide solution (19:1 acrylamide:bis acrylamide) (i.e., Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9022 )
Ethylenediaminetetraacetic acid (EDTA) (i.e., Sigma-Aldrich, catalog number: 03620 )
Tetramethylethylenediamine (TEMED) (i.e., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 17919 )
Formamide (i.e., Sigma-Aldrich)
1 M HEPES buffer pH 8.0 (i.e., Oakwood Products, catalog number: 047861-1Kg )
Sodium chloride (NaCl) (i.e., Sigma-Aldrich, catalog number: S9888 )
Glycerol (i.e., Avantor Performance Materials, Macron Fine Chemicals, catalog number: 5092-16 )
NP-40 detergent (i.e., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 28324 )
Xylene cyanol (i.e., Fischer Scientific, catalog number: BP125-100 )
Bromophenol blue (i.e., DOT Scientific, catalog number: DSB40160-25 )
Dithiothreitol (DTT) (i.e., bioWORLD, catalog number: 40400120 )
Buffer B (see Recipes)
2x stop buffer (see Recipes)
Equipment
The following equipment is needed for modifying nucleic acids with Polθ:
Pipettes (i.e., P2, P20)
Temperature controlled water bath or incubator
The following equipment is needed if visualization of RNA and DNA modification is desired:
Large vertical sequencing gel apparatus (i.e., APOGEE ELECTROPHORESIS, model: Model S2 ) or small vertical gel apparatus (i.e., Bio-Rad Laboratories)
Glass plates for large or small gels
Note: Large glass plates for APOGEE ELECTROPHORESIS Model S2 SEQUENCER can be obtained from APOGEE ELECTROPHORESIS, and standard small plates and apparatuses can be obtained from Bio-Rad Laboratories.
Plastic combs for gels
Note: Plastic combs for large sequencing gels can be obtained from APOGEE ELECTROPHORESIS.
Gel spacers 0.4 mm thick (i.e., APOGEE ELECTROPHORESIS)
Electrophoresis power supply (standard voltage [i.e., 300 V] source for small gels, high voltage [i.e., 5,000 V] source for large sequencing gels)
Note: Power supplies may be obtained from Bio-Rad Laboratories.
Fluorescence imaging system (for fluorophore labeled nucleic acids)
Film developer or phosphorimager (i.e., FUJIFILM, model: FLA7000 ) (for 5’ 32P radio-labeled nucleic acids)
Procedure
Modification of the 3’ terminal ends of DNA and RNA using Polθ
Purified Polθ is needed for modifying the 3’ terminal ends of DNA and RNA. Procedures for expressing and purifying Polθ from E. coli are described in previous studies (Hogg et al., 2011).
Notes:
Synthetic single-stranded DNA (ssDNA) and RNA typically ~10-50 nt (nucleotides) in length have been routinely modified in our laboratory. Thus, we recommend using nucleic acids of similar length for the following procedure.
All reagents below are listed as final concentrations.
A typical procedure for modifying ssDNA or RNA is described as follows:
50-100 nM of the ssDNA or RNA to be modified is mixed with 50-500 μM concentration of the desired nucleotide used for modification in buffer A (see Recipes) along with 5 mM MnCl2 in a reaction volume of 10-20 μl.
Note: We have not thoroughly tested the effects of different nucleotide concentrations. However, concentration ranges between 50-500 μM have shown efficient terminal transferase activity. Most of our previous reactions included 500 μM nucleotides. Reaction volumes can be varied according to preference and concentrations of ssDNA and RNA used successfully in the reaction in our experience are 50-100 nM. Importantly, the DNA or RNA must include a 3’ terminal nucleotide containing a hydroxyl group at the 3’ position of the sugar moiety for Polθ terminal transferase activity to occur.
The terminal transferase reaction is then initiated by adding 200-500 nM purified Polθ and incubating at 42 °C for 2 h. Reactions are gently mixed with a pipette. Vortexing is not recommended.
Reactions can be terminated by heating to ≥ 80 °C for 10 min or by the addition of ≥ 10 mM EDTA. Although the amount of Polθ can vary, optimal terminal transferase activity is observed with a 5-10 higher ratio of polymerase to nucleic acid molecule. We note that relatively high concentrations (i.e., > 50 mM) of salt (e.g., NaCl) suppress Polθ terminal transferase activity.
The 2 h incubation time specified in the above procedure will give rise to multiple (i.e., 3 to > 100) terminal transfer events for most canonical nucleotides. However, in some cases only a single transfer event may occur depending on the particular nucleotide analog used. For example, certain nucleotide analogs may not be efficiently incorporated by Polθ and thus limit the enzyme to a single nucleotide transfer event. For determining the number of terminal transferase events that occur on a given substrate in the presence of particular nucleotides, we recommend visualizing the initial nucleic acid substrate and nucleic acid reaction products in a denaturing sequencing gel as described below in the Data analysis section.
Examples of experimental procedures for modifying the 3’ terminal ends of DNA and RNA using Polθ
As examples of Polθ terminal transferase activity on ssDNA and RNA, reactions were performed as follows. 50 nM of 5’ 32P radio-labeled ssDNA oligo (sequence indicated; Figures 1A and 1B) or RNA (sequence indicated; Figure 1C) was mixed with 50 µM (Figures 1A and 1B) or 500 µM.
Figure 1. Use of Polθ terminal transferase activity to modify the 3’ terminal ends of DNA and RNA. A-C. Denaturing gels showing Polθ terminal transferase activity on the indicated ssDNA (A and B) and RNA (C) substrates in the presence of the indicated nucleotides. Lanes 1 lack Polθ and nucleotides. Lanes 2 and 3 include Polθ and the indicated nucleotides. ssDNA and RNA sequences are indicated at bottom. *, 32P radio-label.
(Figure 1C) of the indicated nucleotides along with 5 mM MnCl2 in 20 µl of buffer A (see Recipes).
Reactions were initiated by adding 200 nM of purified Polθ (stored in buffer B [see Recipes]), then incubating at 42 °C.
After 2 h, reactions were terminated by adding 20 µl of 2x stop buffer (see Recipes).
Radio-labeled ssDNA and RNA were then analyzed after denaturing gel electrophoresis and autoradiography as described below in the Data analysis section. The data show that Polθ efficiently transfers nucleotides to the 3’ terminus of nucleic acid substrates as demonstrated in previous studies (Figure 1) (Kent et al., 2016). These experiments also demonstrate the ability of Polθ to efficiently transfer large nucleotide analogs, consistent with recent work (Kent et al., 2016). We note that Polθ may also be used to modify double-strand blunt ended DNA, however, fewer nucleotides are transferred to these substrates as demonstrated in previous work (Kent et al., 2016). Partial single-strand DNA containing 3’ overhangs are most efficiently extended by Polθ (Kent et al., 2016).
Data analysis
Visualizing modified RNA and DNA in denaturing gels
Reactions should be performed as above with the following modifications. The RNA or DNA should be either 5’ radio-labeled, or conjugated with a fluorophore prior to the reaction for their detection in denaturing gels. Nucleic acids can be radio-labeled using T4 polynucleotide kinase in the presence of gamma-ATP. For fluorophore detection, DNA and RNA oligonucleotides can be purchased with 5’ fluorophore linkages. We recommend terminating reactions with an equal volume of 2x stop buffer (see Recipes).
Initial nucleic acid substrates and reaction products should be resolved in standard urea denaturing 10-20% polyacrylamide gels. Helpful protocols for pouring and processing urea denaturing polyacrylamide sequencing gels are referenced here (Summer et al., 2009; Flett, et al., 2013). Large sequencing gels will allow for the highest resolution (i.e., single nucleotide resolution). However, smaller gels may provide enough resolution depending on the particular application. In the case of RNA, we recommend adding 10-15% formamide to urea denaturing polyacrylamide gels to reduce RNA secondary structures that can appear as smears in the gel. Large sequencing gels are typically run at 70-80 W using a high voltage (5,000 V) power supply. The resolved nucleic acids can then be visualized using a fluorescent imager (for 5’ fluorophore conjugated oligos) or using a phosphorimager or autoradiography (for 5’ 32P labeled oligos). Figure 1 shows examples of 5’ 32P radio-labeled nucleic acids that were resolved in large sequencing gels, then visualized by autoradiography.
Notes
Reproducibility
In our experience, extension of nucleic acids by Polθ is highly reproducible. However, we note that the precise amount of initial substrates extended may vary. For example, in some cases 100% of nucleic acid substrates are extended, whereas in other cases a small fraction (i.e., ~5-15%) of substrates are not extended. A 4-5 fold higher ratio of Polθ to nucleic acid substrates will usually allow for the majority of substrates to be extended. We note that the number of nucleotides transferred to the 3’ terminus of nucleic acids may vary. Thus, the final length of extended nucleic acids will not be identical for all molecules. The respective structures of canonical nucleotides and nucleotide analogs will also give rise to different terminal transferase efficiencies. For example, deoxyadenosine monophosphate is most efficiently transferred by Polθ (Kent et al., 2016). Other deoxyribonucleotides are somewhat less efficiently transferred by the polymerase (Kent et al., 2016). The initial nucleic acid sequence may also affect Polθ terminal transferase activity. Previous studies compare the efficiency of Polθ terminal transferase activity on different nucleic acid substrates and in the presence of various canonical nucleotides and nucleotide analogs (Kent et al., 2016).
Additional notes, technical tips and cautionary points
For optimal Polθ terminal transferase activity, we recommend storing the enzyme in buffer B (see Recipes) at concentrations ≥ 1 mg/ml in small aliquots at -80 °C and limiting freeze thaw cycles to 2-3 times. We note that oligonucleotides relatively short in length (< 10 nt) may not be extended as efficiently as those longer in length (> 10 nt). Oligos containing a high proportion of closely spaced guanosine bases, for example similar to telomere repetitive DNA sequences or those that form G quadruplexes, may exhibit a lower efficiency of extension by Polθ (Kent et al., 2016). As noted above, Polθ can also be used to modify double-stranded DNA, however, only 1-3 nucleotides are generally transferred to these substrates (Kent et al., 2016).
Recipes
1 M Tris buffer pH 8.2
Weigh 121.1 g of Tris Ultra Pure and add 800 ml of dH2O
Stir until dissolved, then adjust pH to 8.2 with HCl
Adjust final volume to 1 L with dH2O
Buffer A
20 mM Tris-HCl pH 8.2
0.01% NP-40
0.1 mg/ml BSA
10% glycerol
1 M HEPES buffer pH 8.0
Weigh 238.3 g of HEPES and add 800 ml of dH2O
Stir until dissolved, then adjust pH to 8.0 with NaOH
Adjust final volume to 1 L with dH2O
Buffer B
50 mM HEPES pH 8.0
300 mM NaCl
10% glycerol
0.01% NP-40
5 mM DTT
2x stop buffer
90% formamide
50 mM EDTA
0.03% xylene cyanol
0.03% bromophenol blue
Acknowledgments
This work was funded by National Institutes of Health grant 1R01GM115472-01 awarded to R.T.P. Competing interests: R.T.P. and T.K. filed a patent application about the use of DNA polymerase theta to modify the 3’ terminus of nucleic acids. The protocol described herein was adapted from previous studies (Kent et al., 2016).
References
Black, S. J., Kashkina, E., Kent, T. and Pomerantz, R. T. (2016). DNA polymerase theta: A unique multifunctional end-joining machine. Genes (Basel) 7(9).
Chan, S. H., Yu, A. M. and McVey, M. (2010). Dual roles for DNA polymerase theta in alternative end-joining repair of double-strand breaks in Drosophila. PLoS Genet 6(7): e1001005.
Flett, F. and Interthal, H. (2013). Separation of DNA oligonucleotides using denaturing urea PAGE. Methods Mol Biol 1054: 173-185.
Hogg, M., Seki, M., Wood, R. D., Doublie, S. and Wallace, S. S. (2011). Lesion bypass activity of DNA polymerase theta (POLQ) is an intrinsic property of the pol domain and depends on unique sequence inserts. J Mol Biol 405(3): 642-652.
Kent, T., Chandramouly, G., McDevitt, S. M., Ozdemir, A. Y. and Pomerantz, R. T. (2015). Mechanism of microhomology-mediated end-joining promoted by human DNA polymerase theta. Nat Struct Mol Biol 22(3): 230-237.
Kent, T., Mateos-Gomez, P. A., Sfeir, A. and Pomerantz, R. T. (2016). Polymerase θ is a robust terminal transferase that oscillates between three different mechanisms during end-joining. Elife 5.
Koole, W., van Schendel, R., Karambelas, A. E., van Heteren, J. T., Okihara, K. L. and Tijsterman, M. (2014). A Polymerase Theta-dependent repair pathway suppresses extensive genomic instability at endogenous G4 DNA sites. Nat Commun 5: 3216.
Mateos-Gomez, P. A., Gong, F., Nair, N., Miller, K. M., Lazzerini-Denchi, E. and Sfeir, A. (2015). Mammalian polymerase theta promotes alternative NHEJ and suppresses recombination. Nature 518(7538): 254-257.
Sfeir, A. and Symington, L. S. (2015). Microhomology-mediated end joining: A back-up survival mechanism or dedicated pathway? Trends Biochem Sci 40(11): 701-714.
Summer, H., Gramer, R. and Droge, P. (2009). Denaturing URea polyacrylamide gel electrophoresis (Urea PAGE). J Vis Exp (32): 1485.
Wood, R. D. and Doublie, S. (2016). DNA polymerase theta (POLQ), double-strand break repair, and cancer. DNA Repair (Amst) 44: 22-32.
Yousefzadeh, M. J., Wyatt, D. W., Takata, K., Mu, Y., Hensley, S. C., Tomida, J., Bylund, G. O., Doublie, S., Johansson, E., Ramsden, D. A., McBride, K. M. and Wood, R. D. (2014). Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. PLoS Genet 10(10): e1004654.
Copyright: Hoang et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
Category
Molecular Biology > DNA > DNA labeling
Molecular Biology > RNA > RNA labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,331 | https://bio-protocol.org/exchange/protocoldetail?id=2331&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Root Aliphatic Suberin Analysis Using Non-extraction or Solvent-extraction Methods
CD Camille Delude
Sollapura J. Vishwanath
Owen Rowland
Frédéric Domergue
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2331 Views: 9590
Edited by: Arsalan Daudi
Reviewed by: Sibongile Mafu
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
Here we describe both non-extraction and solvent-extraction methods for root aliphatic suberin analysis. The non-extraction method is fast as roots are directly depolymerized using acidic transmethylation. However, suberin aliphatic components are isolated together with all the other acyl chains making up the lipids (e.g., membranes) present in roots. For the solvent-extraction method, roots are first delipidated before transmethylation. This method is longer but allows separation of soluble and polymerized root lipids. This protocol is optimized for tissue culture- or soil-grown Arabidopsis thaliana plants, but can be used with roots of other plants.
Keywords: Suberin Lipid polymer Cell wall Root Lipid extraction Gas chromatography Arabidopsis thaliana
Background
Suberin is an extracellular plant lipid polymer deposited in the cell walls of various tissues such as endodermis, exodermis and periderm of roots. Suberin acts as a barrier controlling water and solute fluxes and restricting pathogen infections (Ranathunge et al., 2011; Andersen et al., 2015; Vishwanath et al., 2015; Barberon et al., 2016). Suberin is a complex heteropolymer made up of aliphatics, phenolics, and glycerol, which is associated with solvent-extractable waxes (Bernards, 2002). In the model plant Arabidopsis thaliana, the suberin polymer is primarily made of ω-hydroxy acids and α,ω-dicarboxylic acids, but it also contains unsubstituted fatty acids and primary fatty alcohols (Domergue et al., 2010; Vishwanath et al., 2013), whereas the associated waxes are in the form of alkyl hydroxycinnamates (AHCs; Kosma et al., 2012; Delude et al., 2016). The non-extraction method described here allows for high-throughput and rapid analysis of suberin composition, which is particularly advantageous when screening large numbers of plant lines (e.g., mutants, overexpressing transgenic lines, or natural variants). A more traditional and accurate solvent extraction method applicable when soluble and polymerized lipids (i.e., suberin polyester) need to be analyzed separately is included for comparison.
Materials and Reagents
Petri dish (90 mm diameter) (Fisher Scientific)
Peat moss, vermiculite and perlite (3:1:1, v/v/v; Medan S.A.)
Paper towels
8 ml glass tubes (Dutscher, catalog number: 065307B ) with polytetrafluoroethylene (PTFE)-lined caps (Dutscher, catalog number: 001031 )
Pots for Arabidopsis (Polystyrene, 9 x 9 x 9.5 cm) (SOPARCO, catalog number: 4686 )
2 ml GC vials with caps (Agilent Technologies, catalog number: 5182-0557 ) and 400 μl flat bottom glass inserts (Agilent Technologies, catalog number: 5181-3377 )
Arabidopsis seeds
95% ethanol
Sodium hypochlorite (Bleach)
Distilled water
Isopropanol (Fisher Scientific, catalog number: 10315720 )
Chloroform (Sigma-Aldrich, catalog number: 32211 )
Methanol (Sigma-Aldrich, catalog number: 34885 )
Nitrogen (H2O < 3 ppm; CnHm < 0.5 ppm; O2 < 2 ppm)
Sulfuric acid (H2SO4) (CARLO ERBA Reagents, catalog number: E410391 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S5886 )
Methyl tert-butyl ether (MTBE) (Sigma-Aldrich, catalog number: 20256 )
Tri(hydroxymethyl)aminomethane (Tris base) (Sigma-Aldrich, catalog number: T6066 )
N,O-Bis(trimethylsilyl)-trifluoroacetamide (BSTFA) with 1% trimethylchlorosilane (TMCS) (Sigma-Aldrich, catalog number: T6381 )
Heptane (Sigma-Aldrich, catalog number: 32287 )
Toluene (Sigma-Aldrich, catalog number: 32249 )
Murashige and Skoog medium (Duchefa Biochemie, catalog number: M0222.0050 )
Vitamins
Plant agar (Duchefa Biochemie, catalog number: P1001.1000 )
2-(N-Morpholino)-ethane sulfonic acid (MES) (Euromedex, catalog number: EU0033-B )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: P5958 )
Internal standards:
Heptadecanoic acid (C17:0) (Sigma-Aldrich, catalog number: H3500 )
Pentadecanol (C15:0-OH) (Sigma-Aldrich, catalog number: 412228 )
ω-pentadecalactone (yielding ω-OH-C15:0) (Sigma-Aldrich, catalog number: W284009 )
Murashige and Skoog (MS) medium (see Recipes)
Stock solutions (5 mg/ml) of internal standards (see Recipes)
Equipment
Growth chamber (Fitotron, Weiss Technik)
Pair of scissors (Holtex) and tweezers (Hammacher)
Dry heating block (Fisher Scientific, catalog number: FB15103 )
Polytron (IKA, model: T 25 digital )
Tube rotator (Cole-Parmer, Stuart, model: SB3 )
Fume hood (Delagrave)
Dessicator (Nalgene)
Centrifuge (Hettich Lab Technology, model: ROTORFIX 32 A , 6000RPM max)
Glass Pasteur pipets (e.g., VWR)
Weighing scales (Sartorius, model: SECURA124-1S )
Temperature-controlled evaporator connected to nitrogen tank (Meyer N-Evap Organomation)
Agilent 6850 (Agilent Technologies, model: Agilent 6850 ) gas chromatograph equipped with an HP-5MS column (length 30 m, id 0.25 mm, film thickness 0.25 μm) and an Agilent 5975 mass spectrometric detector (70 eV, mass-to-charge ratio 50-750) (or equivalent GC-MS)
pH meter (Hanna Instruments, model: Hi4222 )
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Delude, C., Vishwanath, S. J., Rowland, O. and Domergue, F. (2017). Root Aliphatic Suberin Analysis Using Non-extraction or Solvent-extraction Methods. Bio-protocol 7(12): e2331. DOI: 10.21769/BioProtoc.2331.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Lipid
Plant Science > Plant cell biology > Tissue analysis
Biochemistry > Lipid > Extracellular lipids
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,332 | https://bio-protocol.org/exchange/protocoldetail?id=2332&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorophore Labeling, Nanodisc Reconstitution and Single-molecule Observation of a G Protein-coupled Receptor
RL Rajan Lamichhane
JL Jeffrey J. Liu
RI Raymond F. Pauszek III
David P. Millar
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2332 Views: 8907
Edited by: Arsalan Daudi
Reviewed by: Kenji SugiyamaStéphane Roméro
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
Activation of G protein-coupled receptors (GPCRs) by agonist ligands is mediated by a transition from an inactive to active receptor conformation. We describe a novel single-molecule assay that monitors activation-linked conformational transitions in individual GPCR molecules in real-time. The receptor is site-specifically labeled with a Cy3 fluorescence probe at the end of trans-membrane helix 6 and reconstituted in phospholipid nanodiscs tethered to a microscope slide. Individual receptor molecules are then monitored over time by single-molecule total internal reflection fluorescence microscopy, revealing spontaneous transitions between inactive and active-like conformations. The assay provides information on the equilibrium distribution of inactive and active receptor conformations and the rate constants for conformational exchange. The experiments can be performed in the absence of ligands, revealing the spontaneous conformational transitions responsible for basal signaling activity, or in the presence of agonist or inverse agonist ligands, revealing how the ligands alter the dynamics of the receptor to either stimulate or repress signaling activity. The resulting mechanistic information is useful for the design of improved GPCR-targeting drugs. The single-molecule assay is described in the context of the β2 adrenergic receptor, but can be extended to a variety of GPCRs.
Keywords: G-protein coupled receptors β2 adrenergic receptor Single-molecule fluorescence Phospholipid nanodiscs Conformational dynamics
Background
GPCRs mediate cellular communications, both locally and over long distances, especially in the endocrine system. For instance, the cellular response to hormones such as adrenaline is mediated through adrenergic receptors, of which the β2 adrenergic receptor (β2AR) is a prominent member. β2AR is expressed throughout the human body and is especially important in pulmonary, cardiac and immunological systems. Pharmacologically, agonists targeting β2AR are medically proven to alleviate acute asthma attacks, since activation of β2AR relaxes smooth muscle lining in the respiratory tracts. At the molecular level, β2AR binds extracellular ligands and transmits signals across the cell membrane to intracellular effectors, such as G proteins or β arrestin. A variety of β2AR ligands are known, and these are classified as agonists or inverse agonists, depending on whether they stimulate signaling activity or reduce the activity below the basal level, respectively (Baker, 2010). Crystallographic studies have revealed the three-dimensional structures of β2AR in both inactive (Cherezov et al., 2007) and active (Rasmussen et al., 2011) conformations. However, less is known about how the receptor converts from the inactive to active conformation during signaling and how these transitions are linked to ligand binding.
Observation of single receptor molecules can reveal spontaneous conformational transitions and the influence of ligands on conformational switching, providing a unique perspective on receptor activation (Lamichhane et al., 2015). Development of a single-molecule assay requires labeling the receptor with a fluorescent reporter group at an informative position and a method for reconstituting individual receptor molecules in a membrane-like environment. A Cy3 fluorophore attached to the cytoplasmic end of trans-membrane helix 6 is a suitable reporter of conformational transitions, since the fluorescence quantum yield is sensitive to the local protein environment, a phenomenon referred to as protein-induced fluorescence enhancement (Hwang et al., 2011; Stennett et al., 2015). Moreover, phospholipid nanodiscs provide an ideal system for reconstitution and observation of single receptor molecules (Bayburt and Sligar, 2010). Individual labeled receptors in nanodiscs can be monitored over extended time periods by total internal reflection fluorescence (TIRF) microscopy, directly revealing transitions between inactive and active-like receptor conformations. The concept of the assay is illustrated in Figure 1. Statistical analysis of a collection of receptor molecules provides the rate constants for conformational exchange and the equilibrium distribution of the two conformational states, information that is difficult to obtain otherwise. These analyses can be readily performed in the absence or presence of various β2AR ligands, providing detailed mechanistic information on the linkage of receptor activation to ligand binding. Such information should be useful in the design of improved GPCR-targeting drugs with finely tuned pharmacological efficacies and reduced side effects. Here we describe the protocols to label β2AR with a Cy3 fluorophore, to reconstitute the labeled receptor in nanodiscs, to attach receptor-nanodisc complexes to a microscope slide and the procedures used to record and analyze single-molecule TIRF microscopy data. Although we describe these methods in the context of β2AR, they are equally applicable to a variety of GPCRs.
Figure 1. Experimental system to monitor conformational transitions of β2AR at the single-molecule level (reproduced from Lamichhane et al., 2015). A. An individual receptor molecule (black) labeled with Cy3 (red sphere) incorporated in a phospholipid nanodisc is tethered to a quartz surface coated with polyethylene glycol (wavy lines) via biotin (orange circles) and streptavidin (dark blue rectangles). The labeled receptor is illuminated in the evanescent field of a totally internally reflected 532 nm laser beam (green). The cartoon of the receptor-nanodisc complex is adapted from Bayburt and Sligar (2010). B. Expanded view of a single receptor-nanodisc complex, showing the receptor exchanging between inactive (blue) and active (red) conformations, with corresponding changes in the local environment of the Cy3 probe attached to Cys265 (light or dark red spheres, respectively). The transparent cylinder represents an abstraction of the lipid bilayer.
Materials and Reagents
PD-10 desalting column (GE Healthcare, catalog number: 17085101 )
2 ml Eppendorf tube
Quartz microscope slides 1” x 3” x 1 mm thick, with a small diameter hole drilled at each end (http://finkenbeiner.com/quartzslides.php)
Microscope cover slips 22 x 40-1 (Fisher Scientific, catalog number: 12-545-C )
Double sided tape (Scotch, 3M)
Pipette tip
100 kDa MWCO vivaspin 2 concentrators polyethersulfon (PES) membrane (Sartorius, catalog number: VS1041 )
Cy3 maleimide, mono-reactive dye (GE Healthcare, catalog number: PA13131 )
Timolol maleate salt (Sigma-Aldrich, catalog number: T6394 )
cOmpleteTM, Mini, EDTA-free protease inhibitor cocktail (Roche Diagnostics)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Talon metal affinity resin (Takara Bio, catalog number: 635502 )
Imidazole (Sigma-Aldrich, catalog number: I5513 )
DMSO (Thermo Fisher Scientific, InvitrogenTM, catalog number: D12345 )
SDS-PAGE gels (Invitrogen NuPAGE Bis-Tris Pre-cast gels)
Purified membrane scaffold protein 1 (MSP1), expressed in E. coli, as described (Ritchie et al., 2009)
1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) (Avanti Lipids Polar, catalog number: 850457P )
1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (POPS) (Avanti Lipids Polar, catalog number: 840034P )
16:0 biotinyl Cap PE (Avanti Lipids Polar, catalog number: 870277P )
Bio-beads SM-2 resin (Bio-Rad Laboratories, catalog number: 1523920 )
Ni-NTA resin (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88222 )
Glycerol (Sigma-Aldrich, catalog number: G6279 )
Grease (Borer Chemie, catalog number: glisseal N )
Neutravidin (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 31000 )
4-(2-hydroyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma-Aldrich, catalog number: H3375 )
Magnesium chloride (MgCl2) (anhydrous) (Sigma-Aldrich, catalog number: M8266 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Ethylenediaminetetraacetic acid (EDTA) (0.5 M solution) (Sigma-Aldrich, catalog number: 03690 )
N-dodecyl- β-D-maltopyranoside (DDM) (Anatrace, catalog number: D310 )
Cholesteryl hemisuccinate (CHS) (Sigma-Aldrich, catalog number: C6512 )
ATP (Sigma-Aldrich, catalog number: A26209 )
Phosphate-buffered saline (PBS) (Fisher Scientific, catalog number: 70-011-044 )
Trolox (Acros Organics, catalog number: 218940050 )
Glucose (Sigma-Aldrich, catalog number: 158968 )
Glucose oxidase (Sigma-Aldrich, catalog number: G2133 )
Catalase (Sigma-Aldrich, catalog number: C3155 )
Low salt wash buffer (see Recipe)
High salt wash buffer (see Recipe)
Solubilization buffer (see Recipe)
Wash buffer 1 (see Recipe)
Wash buffer 2 (see Recipe)
Labeling buffer (see Recipe)
SEC elution buffer (see Recipe)
IMAC elution buffer (see Recipe)
Final buffer (see Recipe)
Imaging buffer (see Recipe)
Equipment
100 ml glass tissue homogenizer (Sigma-Aldrich, catalog number: T2567 )
Beckman Ultra centrifuge
Ti45 rotor (Beckman Coulter, model: Type 45 Ti , catalog number: 339160)
Ti70 rotor (Beckman Coulter, model: Type 70 Ti , catalog number: 337922)
Beckman X-12R centrifuge(Beckman Coulter, model: Allegra® X-12R ) or equivalent
AKTAxpress FPLC system (GE Healthcare, model: AKTAxpress )
Superdex 200 Increase 100/300 size exclusion column (GE Healthcare, catalog number: 17517501 )
Chromatography column packed with 1-2 ml Ni-NTA agarose beads (referred to below as Ni column)
Axiovert 200 microscope (Carl Zeiss, model: Axiovert 200 ) or equivalent
Water-immersion C-Apochromat 63x/1.2 W objective (Carl Zeiss, model: C-Apochromat 63x/1.2 W Corr ) or equivalent
Charge-coupled device (EMCCD) camera (Andor Technology, model: DU-897E iXon+ EMCCD ) or equivalent
532 nm (green) laser (CrystaLaser, catalog number: CL532-050-S ) or equivalent
Software
Data acquisition software (available from https://cplc.illinois.edu/software/)
MATLAB scripts
Igor software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lamichhane, R., Liu, J. J., Pauszek III, R. F. and Millar, D. P. (2017). Fluorophore Labeling, Nanodisc Reconstitution and Single-molecule Observation of a G Protein-coupled Receptor. Bio-protocol 7(12): e2332. DOI: 10.21769/BioProtoc.2332.
Download Citation in RIS Format
Category
Biochemistry > Protein > Single-molecule Activity
Biochemistry > Protein > Labeling
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,333 | https://bio-protocol.org/exchange/protocoldetail?id=2333&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Producing GST-Cbx7 Fusion Proteins from Escherichia coli
TH Thao Ngoc Huynh
Xiaojun Ren
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2333 Views: 10214
Edited by: Arsalan Daudi
Reviewed by: Thibaud T. RenaultJose Thekkiniath
Original Research Article:
The authors used this protocol in 15-Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
15-Oct 2016
Abstract
This protocol describes the production of GST-Cbx7 fusion proteins from E. coli, originally developed in the recent publication (Zhen et al., 2016). The pGEX-6P-1-GST plasmids encoding the Cbx7 variants were transformed into BL21 competent cells. The fusion protein production was induced by isopropyl-beta-D-thiogalactopyranoside and they were purified by Glutathione Sepharose 4B. This protocol can be adapted for the purification of other proteins.
Keywords: Polycomb Cbx7 GST-fusion proteins pGEX-6P-1 Affinity purification Glutathione Sepharose 4B
Background
Polycomb group (PcG) proteins regulate gene expression by modulating higher order chromatin structures (Kerppola, 2009; Simon and Kingston, 2013). PcG proteins are generally found in two major complexes, Polycomb repressive complex (PRC) 1 and 2 (Kerppola, 2009; Simon and Kingston, 2013). PRC2 is a methyltransferase that catalyzes di- and tri-methylation of lysine 27 on histone H3 (H3K27me2/3) (Cao et al., 2002); PRC1 is an ubiquitin ligase that monoubiquitylates histone H2A on lysine 119 (H2AK119Ub) (Wang et al., 2004). Mammalian PRC1 complexes are further divided to canonical and variant PRC1 (Gao et al., 2012, Tavares et al., 2012). Canonical PRC1 is composed of one of each Ring1 (Ring1A/Ring1B), Pcgf (Mel18/Bmi1), Phc (Phc1/2/3), and Cbx (Cbx2/4/6/7/8) proteins. The Cbx family proteins have a conserved chromodomain (CD) that recognizes H3K27me3, suggesting molecular links between the recruitment of canonical PRC1 and H3K27me3 (Blackledge et al., 2015). Recently, we have interrogated the molecular mechanisms underlying the binding of Cbx7-PRC1 to chromatin by live-cell single-molecule imaging (Zhen et al., 2016). We showed that the CD and AT-hook-like (ATL) motif of Cbx7 constitute a functional DNA-binding unit by electrophoretic mobility shift assay (Zhen et al., 2016). Here, detailed conditions are presented which allow the production of GST-Cbx7 fusion proteins from E. coli. With modifications, this protocol may be used for the purification of other proteins. The purification of fusion proteins by GST fusion system has been widely applied in various biochemical and structural studies (Harper and Speicher, 2011).
Materials and Reagents
50 ml conical tube
Dialysis membrane (Spectra/Por® Molecularporous membrane tubing, standard RC tubing, MWCO: 3.5 kD) (Spectrum, catalog number: 132720 )
Bio-Rad Chromatography Column (2.5 x 10 cm Econo-Column) (Bio-Rad Laboratories, catalog number: 7311550 )
BL21 competent cells (made in the laboratory)
pGEX-6P-1-GST (GE Healthcare)
Ampicillin
Isopropyl-1-thio-β-D-galactopyranoside (IPTG) (Omega Bio-tek, catalog number: AC121 )
Glutathione Sepharose 4B (GE Healthcare, catalog number: 17075601 )
Phosphate-buffered saline (PBS, pH 7.4)
PierceTM Coomassie (Bradford) Protein Assay Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23200 )
Coomassie Blue (Bio-Rad Laboratories, catalog number: 1610786 )
Tryptone
Yeast extract
Sodium chloride (NaCl)
1% Triton X-100
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: 93482 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 )
L-glutathione reduced (Sigma-Aldrich, catalog number: G4251 )
LB medium (see Recipes)
Wash buffer (see Recipes)
Lysis buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
Culture flasks (2,000 ml) (NALGENE, U.S.A.)
Shaker
Centrifuges (Eppendorf, model: 5702 R )
Centrifuge bottle
Vibra-CellTM sonicator (Sonics & Materials, model: VCX 130 ) with standard probe (1/4”; 6 mm), length 4.5” (113 mm), Titanium alloy Ti-6Al-4V, Autoclavable (Sonics & Materials, catalog number: 630-0435 )
S-3200-2 GyroMixer (BioExpress, model: GeneMate GyroMixer , catalog number: S-3200-2)
Procedure
Note: The experimental procedure was revised from the published protocol (Harper and Speicher, 2011).
Expression of GST fusion protein
Transform competent BL21 cells with pGEX-6P-1-GST plasmids that encode the Cbx7 variants by incubating plasmid with cells on ice for 10 min, then heat shock at 42 °C for 45 sec. The mixture was put on ice for 2 min, LB medium was added, and the mixture was incubated for 1 h at 37 °C while shaking at 250-300 rpm. After that, the cells were spread onto agar plate containing ampicillin.
Transfer a single, isolated colony of transformed BL21 cells to 100 ml LB medium with 100 µg/ml ampicillin and incubate the inoculated culture overnight at 37 °C while shaking at 250-300 rpm.
Transfer 50 ml of the overnight culture into 950 ml of warm, fresh LB medium with 100 µg/ml ampicillin.
Incubate the culture at 37 °C while shaking at 250-300 rpm until the OD600 is 0.5-0.7 (Note 1).
Induce the protein expression by adding IPTG to a final concentration of 1.0 mM (stock concentration: 100 mM, the powder was dissolved in MilliQ water and the solution was filtered before used) and incubating at 37 °C while shaking at 250-300 rpm for 5 h.
Harvest cells by centrifugation at 4,000 x g for 20 min at 4 °C.
Carefully decant the supernatant, leaving about 15-50 ml in the centrifuge bottle.
Resuspend the cells and transfer to a 50 ml conical tube and centrifuge at 4,000 x g for 20 min at 4 °C.
Decant the supernatant (Note 2).
Sonication (Note 3)
Resuspend the cell pellet in 25 ml of lysis buffer.
Lyse cells by sonication at 4 °C using the standard probe with the following settings:
15-sec on
45-sec off
45% input (45% amplitude)
6 min: total time on
Purification
To the mixture after sonication, add Triton X-100 to a final concentration of 1% and mix gently for 30 min at 4 °C with the mixer to increase the solubility of the protein.
Centrifuge the mixture at 10,000 x g for 10 min at 4 °C.
Wash 0.75 ml of Glutathione Sepharose beads with 3 x 10 ml of cold PBS, centrifuge at 500 x g for 3 min at 4 °C.
Transfer the supernatant by pipetting from step C2 to pre-washed beads in a conical tube and rotate at 4 °C for 1 h.
Centrifuge at 500 x g for 3 min at 4 °C and remove the supernatant.
Wash the beads with 4 x 10 ml of wash buffer.
Pour the beads into a Bio-Rad Chromatography Column and wash with 2 x 10 ml of cold PBS.
Elute the fusion protein by incubating at room temperature for 10 min with 1 ml elution buffer. Repeat this step to get a total of three elutions.
Dialyze against PBS three times.
Run SDS-PAGE gel to determine the purity and identity of the fusion protein (Figure 1).
Figure 1. SDS-PAGE gel stained with Coomassie for determination of Cbx7 variant GST-fusion proteins
Data analysis
The PierceTM Coomassie (Bradford) Protein Assay Kit (Thermo Scientific) was performed to determine the concentration of the protein. SDS-PAGE gel was used to determine the identity of the proteins by their expected molar mass and also to check for contaminates (if yes, there will be other bands shown together with the protein band). Furthermore, GST protein was run with the SDS-PAGE gel as a control. The gel was stained with Coomassie Blue and is presented in Figure 6-figure supplement 1 in (Zhen et al., 2016): Live-cell single-molecule tracking reveals co-recognition of H3K27me3 and DNA targets polycomb Cbx7-PRC1 to chromatin.
Notes
To monitor the OD, measure the absorbance at 600 nm. Estimate the amount of time by assuming the population of E. coli doubles every 20 min.
The cell pellet from step C10 can be frozen at -80 °C for several months.
For sonication: cell disruption is evidenced by partial clearing of the suspension. Avoid over sonication since it will heat the solution, leading to protein aggregation and denaturation.
After sonication, 1% Triton X-100 was added, Triton X-100 can be replaced with other detergents such as NP-40 or Tween 20.
Recipes
LB medium (Autoclaved, 1 L, pH 7.2)
10 g tryptone
5 g yeast extract
5 g NaCl
Wash buffer
1x PBS + 1% Triton X-100
Lysis buffer
1x PBS
0.1 mM PMSF
0.1 mM protease inhibitor cocktail
Elution buffer
20 mM reduced glutathione, pH 8.0
Adjust pH with NaOH
Acknowledgments
This work was supported, in whole or in part, by the National Cancer Institute of the National Institutes of Health under Award Number R03CA191443 (to XR). This work was also supported by grants from the CU-Denver Office Research Service (to XR) and the American Cancer Society Grant IRG 57-001-53 subaward (to XR).
This protocol was modified from (Harper and Speicher, 2011).
References
Blackledge, N. P., Rose, N. R. and Klose, R. J. (2015). Targeting Polycomb systems to regulate gene expression: modifications to a complex story. Nat Rev Mol Cell Biol 16(11): 643-649.
Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P., Jones, R. S. and Zhang, Y. (2002). Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 298(5595): 1039-1043.
Gao, Z., Zhang, J., Bonasio, R., Strino, F., Sawai, A., Parisi, F., Kluger, Y. and Reinberg, D. (2012). PCGF homologs, CBX proteins, and RYBP define functionally distinct PRC1 family complexes. Mol Cell 45(3): 344-356.
Harper, S. and Speicher, D. W. (2011). Purification of proteins fused to glutathione S-transferase. Methods Mol Biol 681: 259-280.
Kerppola, T. K. (2009). Polycomb group complexes--many combinations, many functions. Trends Cell Biol 19(12): 692-704.
Simon, J. A. and Kingston, R. E. (2013). Occupying chromatin: Polycomb mechanisms for getting to genomic targets, stopping transcriptional traffic, and staying put. Mol Cell 49(5): 808-824.
Tavares, L., Dimitrova, E., Oxley, D., Webster, J., Poot, R., Demmers, J., Bezstarosti, K., Taylor, S., Ura, H., Koide, H., Wutz, A., Vidal, M., Elderkin, S. and Brockdorff, N. (2012). RYBP-PRC1 complexes mediate H2A ubiquitylation at polycomb target sites independently of PRC2 and H3K27me3. Cell 148(4): 664-678.
Wang, H., Wang, L., Erdjument-Bromage, H., Vidal, M., Tempst, P., Jones, R. S. and Zhang, Y. (2004). Role of histone H2A ubiquitination in Polycomb silencing. Nature 431(7010): 873-878.
Zhen, C. Y., Tatavosian, R., Huynh, T. N., Duc, H. N., Das, R., Kokotovic, M., Grimm, J. B., Lavis, L. D., Lee, J., Mejia, F. J., Li, Y., Yao, T. and Ren, X. (2016). Live-cell single-molecule tracking reveals co-recognition of H3K27me3 and DNA targets polycomb Cbx7-PRC1 to chromatin. Elife 5.
Copyright: Huynh and Ren . This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Huynh, T. N. and Ren, X. (2017). Producing GST-Cbx7 Fusion Proteins from Escherichia coli. Bio-protocol 7(12): e2333. DOI: 10.21769/BioProtoc.2333.
Zhen, C. Y., Tatavosian, R., Huynh, T. N., Duc, H. N., Das, R., Kokotovic, M., Grimm, J. B., Lavis, L. D., Lee, J., Mejia, F. J., Li, Y., Yao, T. and Ren, X. (2016). Live-cell single-molecule tracking reveals co-recognition of H3K27me3 and DNA targets polycomb Cbx7-PRC1 to chromatin. Elife 5.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,334 | https://bio-protocol.org/exchange/protocoldetail?id=2334&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Single Genome Sequencing of Expressed and Proviral HIV-1 Envelope Glycoprotein 120 (gp120) and nef Genes
DN David J. Nolan
Susanna L. Lamers
RR Rebecca Rose
JD James J. Dollar
MS Marco Salemi
MM Michael S. McGrath
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2334 Views: 8782
Reviewed by: Chao JiangYi Zhang
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
The current study provides detailed protocols utilized to amplify the complete HIV-1 gp120 and nef genes from single copies of expressed or integrated HIV present in fresh-frozen autopsy tissues of patients who died while on combined antiretroviral therapy (cART) with no detectable plasma viral load (pVL) at death (Lamers et al., 2016a and 2016b; Rose et al., 2016). This method optimizes protocols from previous publications (Palmer et al., 2005; Norström et al., 2012; Lamers et al., 2015; 2016a and 2016b; Rife et al., 2016) to produce single distinct PCR products that can be directly sequenced and includes several cost-saving and time-efficient modifications.
Keywords: HIV-1 Single genome sequencing SGS Gene amplification Nested PCR
Background
Over thirty years ago, HIV infection and its clinical manifestation, Acquired Immunodeficiency Syndrome (AIDS), emerged as a worldwide epidemic. Since then, significant understanding of HIV pathogenesis has occurred and the development of drug treatments now significantly extend patients’ lives. Current cART regimens encompass a variety of drugs that inhibit viral replication in several ways, which allows for the almost complete suppression of viral particles found in the blood and recovery of a healthy CD4+ T-cell population (CD4+) (Autran et al., 1997). However, the persistence of very low levels of HIV in plasma of cART treated patients, even those treated for decades, suggests the presence of a cell based ‘viral reservoir’. Viral reservoirs contain infected cells that do not release infectious virus (i.e., are latently infected), but can do so following activation, which may occur under a variety of conditions (Chun et al., 1995 and 1997). HIV latency is primarily attributed to proviral HIV DNA in resting memory CD4+ T cells (Anderson et al., 2011; Ho et al., 2013), although recent reviews highlight a breadth of research into other potential reservoirs (Abbas et al., 2015; Kandathil et al., 2016; Rothenberger et al., 2016; Sacha and Ndhlovu, 2016). The resting memory CD4+ T cells can live for long periods of time, contribute to low-level persistent viremia during cART and viral rebound after treatment interruption, and produce viral variants with escape mutations (Chun et al., 1997; Finzi et al., 1997). Methods to determine the effectiveness of antiretroviral therapy and latency-reversing agents by measuring the circulating resting memory CD4+ T cells have been developed and evaluated (Ericksson et al., 2013; Crooks et al., 2015). However, it is pertinent to consider that less than 2% of the total body lymphocyte population resides in peripheral blood (Svincher et al., 2014), making the evaluation of HIV persistence of tissue-resident lymphocyte populations in anatomical reservoirs critically important.
The use of single genome sequencing or SGS (also known as single genome amplification or SGA) has become the routine way to generate sequences for examination of HIV intrahost evolution (Kearney et al., 2014; Lamers et al., 2016; Rose et al., 2016), compartmentalization (Sturdevant et al., 2012; Evering et al., 2014), phyloanatomy (Salemi and Rife, 2016), persistence (Josephsson et al., 2013; Buzon et al., 2014; Boritz et al., 2016), and rebound dynamics (Kearney et al., 2015; Bednar et al., 2016). In contrast to bulk PCR methods wherein many targets are amplified together in the same tube, SGS uses end-point dilution to amplify from only one template. While some studies have demonstrated that bulk PCR and SGS produce sequences that are similar by certain metrics and the techniques can be used interchangeably (Jordan et al., 2010; Etemad et al., 2015), some analyses can only yield accurate results with sequences generated from SGS. These include identifying identical HIV sequences that may arise from clonally-expanding cells rather than PCR resampling (Wagner et al., 2013; Simonetti et al., 2016), determining proportions of viral variants in a sample through sequencing (Iyer et al., 2015), estimating evolutionary rate from point-mutations that occur only from viral reverse-transcriptase rather than PCR Taq errors (Novitsky et al., 2013), and evaluating recombination rates in vivo without including PCR-mediated recombination (Brown et al., 2011; Sanborn et al., 2015).
We used SGS to generate linked gp120 envelope and nef gene sequences from single starting templates to assess viral expression, compartmentalization and evolution in RNA and DNA extracted from a collection of fresh frozen tissues obtained from HIV-infected patients on cART who died with no detectable viral load in their plasma or cerebral spinal fluid at the time of death (Lamers et al., 2016a and 2016b; Rose et al., 2016). Our data demonstrated that a privileged environment exists in some tissues of these patients wherein expression of HIV continues; however, in other tissues, only unexpressed proviral DNA copies were identified. The inferred evolutionary rate of the tissue-based HIV sequences was not significantly different than previously reported rates of replicating virus in cART-negative subjects, suggesting on-going evolution.
Materials and Reagents
RNA and DNA extraction
Pipette tips
TissueRuptor disposable probes (QIAGEN, catalog number: 990890 )
Fresh frozen tissue sections (30-50 ng)
ELIMINaseTM Decontaminant (Fisher Scientific, catalog number: 04-355-32 )
AllPrep DNA/RNA Mini Kit (QIAGEN, catalog number: 80204 )
RNeasy MinElute Cleanup Kit (QIAGEN, catalog number: 74204 )
Qubit 2.0 fluorometer (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32857 )
Ethyl alcohol pure (200 Proof molecular biology grade) (Sigma-Aldrich, catalog number: E7023 )
Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32854 )
Qubit® RNA HS Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32852 )
cDNA synthesis
0.2 ml PCR 8-tube FLEX-FREE strip, attached clear flat caps, natural (USA Scientific, catalog number: 1402-4700 )
SuperScript® III First-Strand Synthesis System (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18080051 ). The SuperScript® III First-Strand Synthesis System is supplied with the following:
Oligo(dT)20 (50 µM), 50 µl
Random hexamers (50 ng/µl), 250 µl
10x RT buffer, 1 ml
0.1 M DTT, 250 µl
25 mM magnesium chloride (MgCl2), 500 µl
10 mM dNTP mix, 250 µl
SuperScript® III RT (200 U/µl), 50 µl
RNase-OUTTM (40 U/µl), 100 µl
E. coli RNase H (2 U/µl), 50 µl
DEPC-treated water, 1.2 ml
Total HeLa RNA (10 ng/µl), 20 µl
Sense Control Primer (10 µM), 25 µl
Antisense Control Primer (10 µM), 25 µl
Single genome sequencing of gp120 and nef
24 PCR wells
Pipette tips
TempPlate semi-skirted polypropylene 0.2 ml 96-well PCR plate (USA Scientific, catalog number: 1402-9220 )
Posi-Click 1.7 ml microcentrifuge tube, 1.7 ml natural color (Denville Scientific, catalog number: C2170 )
Molecular biology grade sterile purified water (RNase, DNase, proteinase free)
EB buffer (QIAGEN, catalog number: 19086 )
Platinum® Blue PCR SuperMix (Thermo Fisher Scientific, InvitrogenTM, catalog number: 12580023 )
Agarose (Fisher Scientific, catalog number: BP160-500 )
Ethidium bromide (Fisher Scientific, catalog number: BP102-1 )
Tris-base (Sigma-Aldrich, catalog number: T1378 )
Acetic acid, glacial (Fisher Scientific, catalog number: A38-212 )
Ethylenediaminetetraacetic acid, EDTA, 0.5 M solution/pH 8.0 (Fisher Scientific, catalog number: BP2482-500 )
Milli-Q quality water (RNase, DNase free water [dH2O])
Primers listed in Table 1
Table 1. Primers
50x TAE stock solution (see Recipes)
1x TAE buffer(see Recipes)
Equipment
TissueRupter rotor-stator homogenizer (QIAGEN, model: TissueRupter, catalog number: 9001271 )
Matrix multichannel electronic pipette (Range: 2-125 µl; 12-channel) (Fisher Scientific, catalog number: 14-387-117 )*
Matrix multichannel electronic pipette (Range: 1-30 µl; 12-channel) (Thermo Fisher Scientific, catalog number: 14-387-137 )*
Matrix multichannel electronic pipette (Range: 2-125 µl; 12-channel) (Thermo Fisher Scientific, catalog number: 14-387-138 )*
Eppendorf RepeaterTM stream electronic pipette (Eppendorf, catalog number: 4987000118 )
Eppendorf ResearchTM Plus adjustable-volume pipettes: 0.1-2.5 µl, 2-20 µl, 20-200 µl, 100-1,000 µl (Eppendorf, catalog number: 022575442 )
Tape pads (QIAGEN, catalog number: 19570 )
Sub-CellTM Model 192 electrophoresis system (Bio-Rad Laboratories, model: Model 192, catalog number: 1704507 )
51-Well comb (Bio-Rad Laboratories, catalog number: 1704529 )
Comb holder (Bio-Rad Laboratories, catalog number: 1704525 )
UV-Transparent gel tray (Bio-Rad Laboratories, catalog number: 1704524 )
Model 192 gel caster (Bio-Rad Laboratories, model: Model 192, catalog number: 1704517 )
Centrifuge 5424, non-refrigerated, with Rotor FA-45-24-11, keypad, 230 V/50 -60 Hz (Eppendorf, model: 5424 , catalog number: 5424000010)
IsotempTM Digital Dry Bath incubator (Fisher Scientific, catalog number: 11-718-2Q )*
T100TM Thermal cycler (Bio-Rad Laboratories, model: T100TM, catalog number: 1861096 )
DNA oligonucleotides were obtained from Invitrogen
Applied Biosystems 3730xl DNA analyzer (Thermo Fisher Scientific, Applied BiosystemsTM, model: 3730xl DNA Analyser , catalog number: 3730XL)
*Note: These products have been discontinued.
Software
Geneious R7 software package (Biomatters http://www.geneious.com)
MEGA5
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nolan, D. J., Lamers, S. L., Rose, R., Dollar, J. J., Salemi, M. and McGrath, M. S. (2017). Single Genome Sequencing of Expressed and Proviral HIV-1 Envelope Glycoprotein 120 (gp120) and nef Genes. Bio-protocol 7(12): e2334. DOI: 10.21769/BioProtoc.2334.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Microbiology > Microbial genetics > RNA
Molecular Biology > DNA > Genotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,335 | https://bio-protocol.org/exchange/protocoldetail?id=2335&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Optogenetic Stimulation and Recording of Primary Cultured Neurons with Spatiotemporal Control
JB Jérémie Barral
AR Alex D Reyes
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2335 Views: 10956
Edited by: Pengpeng Li
Reviewed by: Zinan Zhou
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
We studied a network of cortical neurons in culture and developed an innovative optical device to stimulate optogenetically a large neuronal population with both spatial and temporal precision. We first describe how to culture primary neurons expressing channelrhodopsin. We then detail the optogenetic setup based on the workings of a fast Digital Light Processing (DLP) projector. The setup is able to stimulate tens to hundreds neurons with independent trains of light pulses that evoked action potentials with high temporal resolution. During photostimulation, network activity was monitored using patch-clamp recordings of up to 4 neurons. The experiment is ideally suited to study recurrent network dynamics or biological processes such as plasticity or homeostasis in a network of neurons when a sub-population is activated by distinct stimuli whose characteristics (correlation, rate, and, size) were finely controlled.
Keywords: Primary culture of neurons Optogenetics Patterned optical stimulation
Background
Optogenetics provide a mean to control neuronal activity with millisecond precision. However, neurons are often activated simultaneously either by flashes of light that activate the whole population synchronously or by a light whose intensity is temporally modulated over the whole field of view (Boyden et al., 2005). Yet, several methods exist to modulate the light spatially and have been used to uncage glutamate (Nawrot et al., 2009) or activate channelrhodopsin (ChR2) expressing neurons (Guo et al., 2009) (for review of available methods to stimulate neurons with both spatial and temporal resolution see Anselmi et al., 2015).
To gain spatial control of the stimulation, a first possibility is to use a laser and move its beam quickly over different positions. For example, uncaging glutamate at different dendritic locations has been achieved by deflecting a laser beam with acousto-optic deflectors (Shoham et al., 2005). This strategy is likely viable only if we modulate the light intensity sufficiently slowly over a limited area. Alternatively, a spatial pattern of light can be achieved using phase or intensity light modulators. Holographic technique based on phase modulation permits to obtain an image in three dimensions with a good spatial precision but patterns can be displayed at a rate of only 100 Hz (Papagiakoumou et al., 2010). If a two dimensional pattern is sufficient, intensity modulation can simply be obtained by placing a projector or an array of LEDs in the conjugated plane of the sample (Farah et al., 2007; Guo et al., 2009). This technique has the advantages of being easy to implement, can target many regions of interest simultaneously and has the fastest temporal resolution.
Here we took advantage of a fast video projector based on the workings of a Digital Micromirror Device (DMD). A LED light source is split by an array of micromirrors that can be controlled with sub millisecond precision in order to display any arbitrary pattern of light (Barral and Reyes, 2016). An image of the projector is focalized to the sample plane via a pair of lenses and the microscope objective. The DMD technology offers an unprecedented temporal precision that enables to display patterns at 1.44 kHz and even faster DMDs are now available. In our settings, the resulting pixel size (2.2 x 1.1 µm) was sufficiently small to stimulate single neurons.
To activate a single neuron, we selected a region of interest of ~30 x 30 µm, centered at the soma of the neuron of interest and sent a 5 msec pulse of light. By designing patterns that are projected onto the sample, we could target independently and simultaneously a large number of neurons (10 to 100 neurons). Stimulated neurons were both excitatory and inhibitory (expression of ChR2 under the Synapsin promoter) and were activated by Poisson spike trains. The rate and correlation of the spike stimuli were controlled by the experimenter (see Barral and Reyes, 2016). By recording from neurons that expressed ChR2, we verified that stimulated neurons responded faithfully to the light pulses. We then recorded concurrently the membrane potentials of up to 4 neurons in cell-attached and in whole-cell configurations to isolate the spiking activity and the postsynaptic inputs, respectively.
Materials and Reagents
For the neuronal culture
Round coverslips, 25 mm diameter, German glass (Electron Microscopy Sciences, catalog number: 72196-25 )
Siliconized low-retention microcentrifuge tubes (1.5 ml) (Fisher Scientific, catalog number: 02-681-331 )
Low-retention pipet tips 200 µl (Fisher Scientific, catalog number: 02-717-165 )
Low-retention pipet tips 1,000 µl (Fisher Scientific, catalog number: 02-717-166 )
Disposable Petri dishes (35 x 10 mm) (Corning, Falcon®, catalog number: 351008 )
Stericup-GP sterile vacuum filtration system, 0.22 µm, polyethersulfone (EMD Millipore, catalog number: SCGPU05RE )
Syringe filters; MCE membrane; pore size: 0.22 µm (EMD Millipore, catalog number: SLGS033SS )
Sterile transfer pipets (Fisher Scientific, catalog number: 13-711-20 )
Conical sterile polypropylene centrifuge tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339650 )
Postnatal (P0-P1) mice
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 320331 )
Nitric acid (Sigma-Aldrich, catalog number: 258121 )
70% ethanol
Poly-L-lysine hydrobromide–mol wt 70,000-150,000 (Sigma-Aldrich, catalog number: P1274 )
Sodium tetraborate decahydrate ≥ 99.5% (Sigma-Aldrich, catalog number: B9876-500G )
Boric acid (cell culture tested) (Sigma-Aldrich, catalog number: B9645-500G )
HBSS (10x), no calcium, no magnesium, no phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 14185052 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
Agar (Sigma-Aldrich, catalog number: A1296-100G )
Sodium bicarbonate (NaHCO3) (Fisher Scientific, catalog number: S233 )
Sodium pyruvate solution (Sigma-Aldrich, catalog number: S8636-100ML )
Sodium hydroxide (NaOH) (Fisher Scientific, catalog number: S318 )
L-cysteine hydrochloride monohydrate (Sigma-Aldrich, catalog number: C7880-500MG )
DNase I grade II, from bovine pancreas–100 mg (Roche Diagnostics, catalog number: 10104159001 )
Papain from Carica papaya–10 ml 100 mg (Roche Diagnostics, catalog number: 10108014001 )
Calcium chloride (CaCl2) (Fisher Scientific, catalog number: C79 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Trypsin inhibitor from chicken egg white (Sigma-Aldrich, catalog number: T9253-500MG )
Albumin from bovine serum (powder, suitable for cell culture, = 96%) (Sigma-Aldrich, catalog number: A9418-5G )
Trypan blue solution (0.4%, liquid, sterile-filtered, suitable for cell culture) (Sigma-Aldrich, catalog number: T8154-20ML )
Neurobasal medium (1x) (Thermo Fisher Scientific, GibcoTM, catalog number: 21103049 )
B-27 serum-free supplement containing vitamin A (50x), liquid (Thermo Fisher Scientific, GibcoTM, catalog number: 17504044 )
GlutaMAXTM supplement (Thermo Fisher Scientific, GibcoTM, catalog number: 35050061 )
AAV virus for ChR2 expression (University of North Carolina Vector Core Services, AAV2-hSyn-hChR2(H134R)-mCherry)
Sodium chloride (NaCl) (Fisher Scientific, catalog number: BP358 )
D-glucose (Fisher Scientific, catalog number: BP350 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: P333 )
Sodium phosphate monobasic (NaH2PO4) (Fisher Scientific, catalog number: S369 )
K-gluconate (Sigma-Aldrich, catalog number: P1847 )
Phosphocreatine (Sigma-Aldrich, catalog number: P1937 )
ATP-Mg (Sigma-Aldrich, catalog number: A9187 )
GTP (Sigma-Aldrich, catalog number: G8877 )
Poly-L-Lysine (PLL solution) (see Recipes)
Dissection solution (see Recipes)
Papain solution (see Recipes)
DNase/L-cysteine solution (see Recipes)
DNase/Mg solution (see Recipes)
Trypsin inhibitor solution (see Recipes)
Culture medium (NB/B27 medium) (see Recipes)
For electrophysiology recordings
Borosilicate glass capillaries (1.5 OD) (World Precision Instruments, catalog number: 1B150F-4 )
Artificial cerebrospinal fluid (aCSF, see Recipes)
Intracellular solution (see Recipes)
Equipment
For the neuronal culture
Tissue culture hood
P1000 pipet
P200 pipet
Cell culture incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Series II 3110 , catalog number: 3110)
Vibratome slicer (Leica Biosystems, model: Leica VT1200 S )
Dumont #5 forceps (Fine Science Tools, catalog number: 11251-30 )
Dumont #7 forceps (Fine Science Tools, catalog number: 11271-30 )
Extra fine bonn scissors (straight) (Fine Science Tools, catalog number: 14084-08 )
For the electrophysiology setup
Upright water immersion microscope with fluorescence (Olympus, model: BX51 )
Fluorescence filter set for mCherry (TRITC, Chroma Technology, model: 41002c )
CCD camera for fluorescence imaging (Hamamatsu Photonics, model: C8484 )
CCD camera for IR imaging (Olympus, model: OLY-150 IR )
Micromanipulator (Luigs & Neumann, model: SM6 )
Patch-clamp amplifiers (Dagan, model: BVC-700A )
18-bit interface card (National Instruments, model: PCI-6289 )
Flaming/Brown micropipette puller (Sutter Instrument, model: P-97 )
Hemacytometer (Hausser, catalog number: 3110 )
For the optogenetic setup
DLP projector (Texas Instruments, model: DLP® LightCrafterTM Evaluation Module )
Aluminum Breadboard, 150 x 300 x 12.7 mm, double density, M6 thread (Thorlabs, model: MB1530/M )
Ø1" Achromatic Doublet, SM1-Threaded Mount, f = 35 mm, ARC: 400-700 nm (Thorlabs, model: AC254-035-A-ML )
Ø2" Achromatic Doublet, SM2-Threaded Mount, f = 200 mm, ARC: 400-700 nm (Thorlabs, model: AC508-200-A-ML )
Ø2" (Ø50.8 mm) Protected Silver Mirror, 0.47" (12.0 mm) Thick (Thorlabs, model: PF20-03-P01 )
Kinematic Mount for Ø2" Optics (Thorlabs, model: KM200 )
U-DP; Dual port intermediate tube (Olympus, model: U-IT140 )
U-EPA2; Eyepoint adjuster, BX2, Raises eyepoint 30MM (Olympus, model: U-IT101 )
BX2 filter cube (U-MF2) for Olympus BX2 and IX2 models (Chroma Technology, model: U-MF2, catalog number: 91018 )
510 nm beamsplitter (BS, Part Size: 25.5 x 36 x 1 mm) (Chroma Technology, model: T510lpxrxt )
50/50 beamsplitter (BS, Part Size: 25.5 x 36 x 1 mm) (Chroma Technology, model: 21000 )
EVGA GeForce GT 520 graphic card with a mini HDMI connector (EVGA, model: 01G-P3-1526-KR )
Light-to-voltage optical sensors (ams, TAOS, model: TSL13T )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Barral, J. and Reyes, A. D. (2017). Optogenetic Stimulation and Recording of Primary Cultured Neurons with Spatiotemporal Control. Bio-protocol 7(12): e2335. DOI: 10.21769/BioProtoc.2335.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell signaling > Intracellular Signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,336 | https://bio-protocol.org/exchange/protocoldetail?id=2336&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA Capping by Transcription Initiation with Non-canonical Initiating Nucleotides (NCINs): Determination of Relative Efficiencies of Transcription Initiation with NCINs and NTPs
JB Jeremy G. Bird
BN Bryce E. Nickels
Richard H. Ebright
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2336 Views: 8402
Edited by: Gal Haimovich
Reviewed by: Melike Çağlayan
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
It recently has been established that adenine-containing cofactors, including nicotinamide adenine dinucleotide (NAD+), reduced nicotinamide adenine dinucleotide (NADH), and 3’-desphospho-coenzyme A (dpCoA), can serve as ‘non-canonical initiating nucleotides’ (NCINs) for transcription initiation by bacterial and eukaryotic cellular RNA polymerases (RNAPs) and that the efficiency of the reaction is determined by promoter sequence (Bird et al., 2016). Here we describe a protocol to quantify the relative efficiencies of transcription initiation using an NCIN vs. transcription initiation using a nucleoside triphosphate (NTP) for a given promoter sequence.
Keywords: RNA polymerase Transcription Non-canonical initiating nucleotide (NCIN) RNA capping ab initio RNA capping NAD+ NADH 3’-desphospho coenzyme A
Background
Transcription in bacteria, archaea, and eukaryotes is carried out by multi-subunit RNA polymerases (RNAPs) conserved in sequence, structure, and mechanism (Ebright, 2000; Lane and Darst, 2010). To initiate transcription, RNAP, together with one or more initiation factors, binds to a specific DNA sequence referred to as a ‘promoter’ and unwinds promoter DNA to form an RNAP-promoter open complex (RPo) containing an unwound ‘transcription bubble’ (Figure 1A; Ruff et al., 2015). RNAP then selects a transcription start site by expanding (‘scrunching’) or contracting (‘antiscrunching’) the transcription bubble to place transcription-start-site nucleotides in the RNAP active-center initiating site (‘i site’) and extending site (‘i+1 site’), binds a complementary initiating nucleotide substrate in the i site and a complementary extending substrate in the ‘i+1’ site, and catalyzes phosphodiester-bond formation to yield an initial RNA product (Winkelman et al., 2016).
In standard de novo transcription initiation, the initiating substrate is a nucleoside triphosphate (NTP), typically ATP or GTP (Nickels and Dove, 2011). However, recently it has been established that adenine-containing cofactors, including nicotinamide adenine dinucleotide (NAD+), reduced nicotinamide adenine dinucleotide (NADH), and 3’-desphospho-coenzyme A (dpCoA), can serve as alternative initiating substrates (‘non-canonical initiating nucleotides’; NCINs), yielding NCIN-capped RNA products that have distinctive 5’-end structures, stabilities, and translation efficiencies (Figures 1B-1C; Bird et al., 2016; Barvik et al., 2016; Jiao et al., 2017; Walters et al., 2017). It further has been established that the relative efficiencies of NCIN-mediated initiation vs. NTP-mediated initiation are determined by promoter sequence (Bird et al., 2016).
Here, we describe a protocol to determine the relative efficiencies of NCIN-mediated transcription initiation versus ATP-mediated transcription initiation, (kcat/KM, NCIN)/(kcat/KM, ATP), for a given promoter sequence. The protocol involves generating radiolabeled initial RNA products in a set of transcription reactions having a constant concentration of NCIN and varying concentrations of ATP, followed by quantifying NCIN-initiated RNA and total RNA, followed by plotting observed ratios of NCIN-initiated RNA to total RNA as a function of ratios of NCIN concentration to ATP concentration.
Figure 1. Transcription initiation. A. RNAP-promoter open complex (RPo) with unwound transcription bubble. Gray, RNAP; blue, -10-element nucleotides; i and i+1, RNAP active-center initiating nucleotide binding site and extending nucleotide binding site; boxes, DNA nucleotides (nontemplate-strand nucleotides above template-strand nucleotides). B. Structures of ATP and NAD+, Red, identical atoms in ATP and NAD+; C. Initial RNA products formed in transcription initiation using ATP (top) or transcription initiation using NAD+ (bottom). Left subpanels show initiating ATP or NAD+ bound in i site; right subpanels show initial RNA products formed using CTP as extending nucleotide. Red boxes, adenosine and cytosine moieties of ATP, NAD+, and CTP; green boxes, nicotinamide-riboside moiety of NAD+.
Materials and Reagents
E. coli RNA polymerase σ70 holoenzyme
Note: Prepared as in Mukhopadhyay et al. (2003) or purchased (New England Biolabs, catalog number: M0551S )
E. coli RNA polymerase core enzyme
Note: Prepared as in Artsimovitch et al. (2003).
E. coli σ70
Note: Prepared as Marr and Roberts (1997); Perdue and Roberts (2010).
NAD+ (grade I, free acid) (Roche Molecular Systems, catalog number: 10127965001 )
NADH (grade I, free acid) (Roche Molecular Systems, catalog number: 10107735001 )
Phusion Flash HF master mix (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: F548L )
Note: For generating transcription templates.
Oligodeoxyribonucleotides (template and primers) (Integrated DNA Technologies, www.IDTdna.com)
QIAquick PCR purification kit (QIAGEN, catalog number: 28106 )
TEMED (Avantor Performance Materials, J.T. Baker®, catalog number: 4098-01 )
Ammonium persulfate (VWR, AMRESCO, catalog number: 97064-594 )
GeneMate LE Quick-Dissolve agarose (BioExpress, catalog number: E-3119-500 )
3’-Desphosphocoenzyme A (Sigma-Aldrich, catalog number: D3385 )
SequaGel sequencing system (National Diagnostics, catalog number: EC-833 )
High purity rNTP set (ATP, UTP, GTP, CTP) (100 mM) (GE Healthcare, catalog number: 27-2025-01 )
[α-32P]-CTP EasyTide (3,000 Ci/mmol) (250 μCi) (Perkin Elmer, catalog number: BLU508H250UC )
Tris base (VWR, AMRESCO, catalog number: 97061-800 )
Potassium chloride (KCl) (EMD Millipore, catalog number: PX1405-1 )
Magnesium chloride hexahydrate (EMD Millipore, catalog number: 5980-500GM )
EDTA disodium salt dyhydrate (1 kg) (VWR, AMRESCO, catalog number: 97061-018 )
Dithiothreitol (DTT) (Gold Bio, catalog number: DTT50 )
Bovine serum albumin (BSA) fraction V (Alfa Aesar, Affymetrix/USB, catalog number: J10857 )
Sodium dodecylsulfate (SDS) (VWR, AMRESCO, catalog number: 97064-470 )
Deionized formamide (EMD Millipore, catalog number: 4610-100ML )
Xylene cyanol (Sigma-Aldrich, catalog number: X4126-10G )
Bromophenol blue (EMD Millipore, catalog number: BX1410-7 )
Amaranth red (Acros Organics, catalog number: AC15303-0250 )
Boric acid (ACS grade) (VWR, AMRESCO, catalog number: 97061-980 )
Sodium acetate, trihydrate (Avantor Performance Materials, MACRON, catalog number: 7364-06 )
Hydrochloric acid (ACS plus) (Fisher Scientific, catalog number: A144-212 )
Glycerol (ACS grade) (EMD Millipore, catalog number: GX0185-5 )
Transcription buffer (1x) (see Recipes)
Transcription buffer (5x) (see Recipes)
Transcription stop buffer (see Recipes)
Tris-borate EDTA buffer (TBE) (see Recipes)
TBE + 0.3 M sodium acetate (see Recipes)
Equipment
NanoDrop 2000c spectrophotometer ND2000C (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000/2000c , catalog number: ND-2000C)
Glass plate
Block digital heater w/20 tapered hole blocks (VWR, catalog numbers: 12621-088 ; 13259-002 )
5424 table top centrifuge with w/FA-45-24-11 rotor (Eppendorf, mdoel: 5424/5424 R , catalog number: 5424000410)
Powerpack HV powersupply (Bio-Rad Laboratories, model: PowerPac HV Power Supply, catalog number: 1645056 )
Sequi-gen GT sequencing gel system (38 x 30 cm gel) (Bio-Rad Laboratories, catalog number: 1653862 )
Note: This product has been discontinued.
Hydrotech vacuum pump (Bio-Rad Laboratories, catalog number: 1651781 )
Model 583 gel dryer (Bio-Rad Laboratories, model: Model 583, catalog number: 1651745 )
DNA Engine Dyad PCR Machine 4 x 48 well blocks (Bio-Rad Laboratories)
Unmounted phosphor exposure screen (35 x 43 cm) (GE Healthcare, model: General Purpose Screens, catalog number: 63-0034-79 )
Storm 840 scanner (Molecular Dynamics, model: Storm 840 )
Windows computer (HP, model: Compaq dc7700 )
Software
Excel (Microsoft)
ImageQuant (GE)
SigmaPlot (Systat)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bird, J. G., Nickels, B. E. and Ebright, R. H. (2017). RNA Capping by Transcription Initiation with Non-canonical Initiating Nucleotides (NCINs): Determination of Relative Efficiencies of Transcription Initiation with NCINs and NTPs. Bio-protocol 7(12): e2336. DOI: 10.21769/BioProtoc.2336.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > RNA
Molecular Biology > RNA > Transcription
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,337 | https://bio-protocol.org/exchange/protocoldetail?id=2337&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Contusion Spinal Cord Injury Rat Model
CC Chuan-Wen Chiu
HC Henrich Cheng
Shie-Liang Hsieh
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2337 Views: 11217
Edited by: Soyun Kim
Reviewed by: Qing Yan
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Spinal cord injury (SCI) can lead to severe disability, paralysis, neurological deficits and even death. In humans, most spinal cord injuries are caused by transient compression or contusion of the spinal cord associated with motor vehicle accidents. Animal models of contusion mimic the typical SCI’s found in humans and these models are key to the discovery of progressive secondary tissue damage, demyelination, and apoptosis as well as pathophysiological mechanisms post SCI. Here we describe a method for the establishment of an efficient and reproducible contusion model of SCI in adult rat.
Keywords: Spinal cord injury Contusion Rat Demyelination
Background
The spinal cord plays an important role in the interconnections between the brain and peripheral nerves. Severe SCI causes the loss of physiological functions and even paralysis or death (Singh et al., 2014). After SCI, the microvascular hemorrhage with disruption of the blood-spinal cord barrier is followed by edema, ischemia, and the release of cytotoxic chemicals from inflammatory pathways (Oyinbo, 2011; Mothe and Tator, 2012). Secondary neurodegenerative events such as demyelination, Wallerian degeneration and axonal dieback occur in the non-permissive tissue environment. Contusion, a type of blunt injury in the spinal cord, mimics typical SCI in humans which is mainly caused by vehicle accidents, especially motorcycles. In contrast to the sharp SCI model such as the transection that provides an anatomical model for evaluating axonal regeneration, the contused spinal cord presents a preferable microenvironment for studying of pathophysiological mechanisms post injury (Young, 2002). Experimental induction of a contusive SCI in a rat model using the NYU-MASCIS (New York University-Multicenter Animal Spinal Cord Injury Study) impactor device has been validated as an analog to human SCI. Furthermore, a comparison between the rat model of SCI with human SCI shows functional electrophysiological and morphological evidence of similar patterns recorded in motor evoked potentials and somatosensory evoked potentials (SSEP) as well as high-resolution magnetic resonance imaging (Basso et al., 1996; Metz et al., 2000; Kwon et al., 2002; Young, 2002). Here we describe a method with tips for construction of an efficient and reproducible contusion model of SCI in adult rat.
Materials and Reagents
Surgical blade #21 (DIMEDA Instrumente, catalog number: 06.121.00 )
Chromic catgut (4/0) (UNIK, catalog number: CT134 )
Nylon suture (3/0) (UNIK, catalog number: NC203 )
Adult female Sprague Dawley (SD) rat (225-250 g)
Isoflurane (Halocarbon Laboratories, NDC12164-002-25 )
0.9% saline solution (TAI YU CHEMICAL & PHARMACEUTICAL, catalog number: RH1704 )
Povidone-iodine solution (YING YUAN CHEMICAL PHARMACEUTICAL, catalog number: S-166 )
Acetaminophen solution (CENTER Laboratories, catalog number: 19746 )
Luxol fast blue stain kit (Abcam, catalog number: ab150675 )
Hematoxylin and Eosin Stain Kit (Vector Laboratories, catalog number: H-3502 )
Trimethoprim-sulfamethoxazole pre-mixed antibacterial solution (YUNG SHIN PHARM, catalog number: TRI-004 )
Trimethoprim-sulfamethoxazole antibacterial injectable working solution (see Recipes)
Equipment
NYU-MASCIS weight-drop impactor with an alligator and the software
2.5 mm tip of impactor for rat
Scalpel handle #4 (DIMEDA Instrumente, catalog number: 06.104.00 )
Heating pad
Adson toothed forceps (DIMEDA Instrumente, catalog number: 10.180.12 )
ALM self-retaining retractor (DIMEDA Instrumente, catalog number: 18.620.07 )
MAYO HEGAR needleholder (DIMEDA Instrumente, catalog number: 24.180.16 )
Littauer bone cutter (Stoelting, catalog number: 52167-80P )
Operating scissors (Shinetech, catalog number: ST-S114PK )
CMA/150 Temperature controller (CMA Microdialysis, model: CMA 150 , catalog number: 600)
Dry sterilizer (Braintree Scientific, model: Germinator 500 , catalog number: GER 5287-120V)
Surgical microscope (Carl Zeiss, model: Zeiss Stativ S3 )
Table top anesthesia system (AM Bickford, catalog number: 61020 )
EVA soft foam mat (Lee Chyun Enterprise, model: FM 600T )
Software
MAS 7.0 version
Microsoft Windows 98 operating system
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chiu, C., Cheng, H. and Hsieh, S. E. (2017). Contusion Spinal Cord Injury Rat Model. Bio-protocol 7(12): e2337. DOI: 10.21769/BioProtoc.2337.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,338 | https://bio-protocol.org/exchange/protocoldetail?id=2338&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Loading of Extracellular Vesicles with Chemically Stabilized Hydrophobic siRNAs for the Treatment of Disease in the Central Nervous System
RH Reka A. Haraszti
AC Andrew Coles
NA Neil Aronin
AK Anastasia Khvorova
MD Marie-Cécile Didiot
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2338 Views: 8360
Edited by: Longping Victor Tse
Reviewed by: Vaibhav B Shah
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
Efficient delivery of oligonucleotide therapeutics, i.e., siRNAs, to the central nervous system represents a significant barrier to their clinical advancement for the treatment of neurological disorders. Small, endogenous extracellular vesicles were shown to be able to transport lipids, proteins and RNA between cells, including neurons. This natural trafficking ability gives extracellular vesicles the potential to be used as delivery vehicles for oligonucleotides, i.e., siRNAs. However, robust and scalable methods for loading of extracellular vesicles with oligonucleotide cargo are lacking. We describe a detailed protocol for the loading of hydrophobically modified siRNAs into extracellular vesicles upon simple co-incubation. We detail methods of the workflow from purification of extracellular vesicles to data analysis. This method may advance extracellular vesicles-based therapies for the treatment of a broad range of neurological disorders.
Keywords: RNA interference Hydrophobically modified siRNA Extracellular vesicles Therapy Neurological disorder
Background
siRNAs are one type of oligonucleotide therapeutics, a new class of drugs directly targeting messenger RNAs (mRNAs) to prevent the expression of proteins leading to disease phenotypes. The therapeutic application of siRNAs is extremely promising as siRNAs can be designed to target any gene, including genes not ‘druggable’ with small molecules or protein-based therapies. The progress made in the chemistry of oligonucleotide therapeutics enables the design of fully stabilized hydrophobically modified siRNAs (hsiRNAs, modified with 2’-O-Methyl or 2’-Fluoro as well as phosphorothioates and sense strand covalently conjugated to cholesterol), which promote cellular self-internalization of hsiRNAs and maintain an ability to be efficiently loaded into the RNA-induced silencing complex (RISC) (Byrne et al., 2013; Khvorova and Watts, 2017). A cholesterol conjugate, linked to the 3’ end of the passenger strand, is essential for rapid cellular membrane association (Byrne et al., 2013; Alterman et al., 2015). The single-stranded phosphorothioate tail promotes cellular internalization (Geary et al., 2015). We recently demonstrated that hsiRNAs bind cellular membranes within seconds after treatment, enter cells and promote potent gene silencing in vitro (Byrne et al., 2013; Alterman et al., 2015; Ly et al., 2017). However, upon local bolus injection in vivo in mouse brain, hsiRNA spread and efficacy are limited to the region surrounding the site of administration (Alterman et al., 2015). Whereas hsiRNAs remain therapeutically promising due to potent and specific gene silencing, their delivery to the brain hampers their advancement for the treatment of diseases in the central nervous system.
Endogenously produced extracellular vesicles mediate intercellular transfer of lipids, proteins, and RNAs between cells over short and long distances, thus playing a crucial role in health and disease (Distler et al., 2005; Muralidharan-Chari et al., 2010). The ability of extracellular vesicles to carry functional RNAs has attracted considerable interest to their use as novel vehicles to transport and deliver RNA-based therapeutics. The cargo includes siRNAs or other oligonucleotide therapeutics (Tetta et al., 2013). Strategies used to load RNA-based therapeutics into extracellular vesicles include electroporation (Alvarez-Erviti et al., 2011; Ohno et al., 2013) or overexpression of miRNAs in extracellular vesicle-producing cells (Kosaka et al., 2012; Ohno et al., 2013; Mizrak et al., 2013). Though both strategies have been able to promote the transfer of siRNA-loaded extracellular vesicles into target cells and the silencing of the target gene, they cannot be controlled or scaled up for clinical-stage manufacturing (Kooijmans et al., 2013). Moreover, electroporation compromises the integrity of extracellular vesicles (Kooijmans et al., 2013). We demonstrated the efficient loading of extracellular vesicles with hsiRNAs without modifying the vesicle size distribution, concentration and integrity. hsiRNA-loaded extracellular vesicles were shown to induce gene silencing of the target gene, huntingtin mRNA, in vitro in mouse primary neurons, and in vivo in mouse brain (Didiot et al., 2016).
Here, we describe a method exploring the ability of hsiRNAs to bind membranes to promote their loading into extracellular vesicles. The co-incubation of hsiRNAs with extracellular vesicles purified from cell culture conditioned medium, promotes loading into extracellular vesicles. We provide details on our methods for extracellular vesicles purification, loading of extracellular vesicles with hsiRNAs, size, charge and integrity characterization of hsiRNA-loaded extracellular vesicles, as well as in vivo testing of hsiRNAs-loaded extracellular vesicles in mouse brain, and data analysis. This technology may promote the loading of several other classes of oligonucleotide therapeutics (i.e., antisense, splice-switching oligonucleotides, sterically blocking oligonucleotides, aptamers and others) to extracellular vesicles, thus providing a significant leap forward to advance multiple classes of oligonucleotide therapeutics for the treatment of diseases in the brain. Subsequently, exploiting the natural properties of extracellular vesicles to functionally transport small RNAs (Valadi et al., 2007; Pegtel et al., 2010; Wang et al., 2010) offers a strategy for improving the in vivo distribution of and cellular uptake of oligonucleotide therapeutics (Zomer et al., 2010; El Andaloussi et al., 2013; Kooijmans et al., 2012; Lasser, 2012; Lee et al., 2012; Pan et al., 2012; Marcus and Leonard, 2013; Nazarenko et al., 2013; Didiot et al., 2016).
Materials and Reagents
Tips (from 0.2 µl to 1,000 µl) (VWR)
Paper towel
Serological pipettes individually wrapped (from 5 ml to 50 ml) (Olympus)
0.22-μm filter-sterilization system (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 567-0020 )
Tissue culture treated multilayer flask–T500 cm2 triple flask (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 132867 )
50 ml conical centrifuge tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339652 )
Vacuum-connected Pasteur pipette
1.7 ml microcentrifuge tubes (Genesee Scientific, catalog number: 22-282 )
Aluminum foil
UV-transparent, flat-bottom 96-well plate (Corning, catalog number: 3635 )
1 ml syringe (BD, catalog number: 309659 )
Parafilm (Bemis, Parafilm M®)
Whatman No. 1 filter paper (GE Healthcare, Whatman, catalog number: 10010155 )
30 G ½ needle
Electron microscopy grids (Electron Microscopy Sciences, catalog number: FCF2010-Ni ) and clean forceps to manipulate the grid
Grid storage box (Electron Microscopy Sciences, catalog number: 71156 )
Mouse (FVB/NJ) (THE JACKSON LABORATORY, catalog number: 001800 )
200-proof ethanol (Decon Labs, catalog number: 2805M )
Fetal bovine serum (FBS) (Mediatech, catalog number: 35-010-CV )
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190250 )
Protease inhibitor cocktail stock solution (Sigma-Aldrich, catalog number: P8340 )
Cy3-labeled or biotinylated cholesterol-conjugated hsiRNAs (produced in-house)
Cy3-OO-PNA strands, fully complementary to the hsiRNA guide strand (20 nucleotides long) (PNA Bio)
Peptide-nucleic acid (PNA) hybridization assay (developed by Axolabs, Kulmbach, Germany)
RIPA buffer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 89900 )
Proteinase K (Thermo Fisher Scientific, InvitrogenTM, catalog number: 25530049 )
Glycine (Sigma-Aldrich, catalog number: G7126 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Saponin (Sigma-Aldrich, catalog number: S1252 )
Note: This product has been discontinued.
Glutaraldehyde (Polysciences, catalog number: 01909-10 )
Avertin (Sigma-Aldrich, catalog number: T48402 )
QuantiGene 2.0 Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: QS0011 )
Quantigene 2.0 Probesets (Varies by gene)
Dulbecco’s modified Eagle medium (DMEM)
MSC culture media (ATCC, catalog number: PCS-500-041 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Tris base (TRIZMA) (Sigma-Aldrich, catalog number: T6066 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: H1758 )
Ethylenediaminetetraacetate acid disodium salt (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Sodium hydroxide (NaOH) (~50 ml of NaOH) (Sigma-Aldrich, catalog number: 72068 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Sodium phosphate monobasic monohydrate (NaH2PO4·H2O)
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S3139 )
Acetonitrile (50% acetonitrile solution, diluted in distilled H2O) (Fisher Scientific, catalog number: A998-4 )
Sodium perchlorate monohydrate (NaClO4·xH2O) (Fisher Scientific, catalog number: S490-500 )
Methyl cellulose (Sigma-Aldrich, catalog number: M6385 )
PFA powder (Sigma-Aldrich, catalog number: P6148 )
Uranyl acetate (Electron Microscopy Sciences, catalog number: 22400 )
Oxalic acid
Tris-HCl (pH 8.5) (Fisher Scientific, catalog number: BP153 )
Ammonium hydroxide (NH4OH) (Fisher Scientific, catalog number: A669-212 )
Cell culture medium (see Recipes)
1 M sucrose (see Recipes)
1 M Tris-HCl (see Recipes)
0.5 M EDTA (see Recipes)
3 M KCl (see Recipes)
10% SDS (see Recipes)
0.1 M sodium phosphate buffer (see Recipes)
HPLC buffer A (see Recipes)
HPLC buffer B (see Recipes)
Glutaraldehyde, 1% (v/v) (see Recipes)
Methyl cellulose, 2% (w/v) (see Recipes)
Paraformaldehyde (PFA), 2% and 4% (w/v) (see Recipes)
Uranyl acetate (4% w/v), pH 4 (see Recipes)
Uranyl-oxalate, pH 7 (see Recipes)
Methyl cellulose-UA, pH 4 (see Recipes)
Equipment
Tissue culture hood
Soft brush
Ultracentrifuge 70 ml polycarbonate bottles (Beckman Coulter, catalog number: 355655 )
Fixed-angle Ti45 ultracentrifuge rotor (Beckman Coulter, model: Type 45 Ti , catalog number: 339160)
Refrigerated ultracentrifuge (Beckman Coulter, model: Optima XE )
Refrigerated benchtop centrifuge (Beckman Coulter, model: Allegra® X-15R )
Micropipettes from 0.5 µl to 1 ml (Labnet International, model: BioPetteTM Plus )
Fixed-angle TLA-110 rotor (Beckman Coulter, model: TLA-110 , catalog number: 366735)
1.5 ml microcentrifuge adapters (Beckman Coulter, catalog number: 360951 )
Refrigerated benchtop ultracentrifuge (Beckman Coulter, model: OptimaTM MAX-TL )
Orbital thermo-shaker for 1.5 ml microtube (Grant Instruments, model: PHMT series )
Plate reader spectrophotometer (Tecan Trading, model: Infinite® M1000 Pro )
Stereotactic frame (KOPF INSTRUMENTS, model: Model 963 )
HPLC system with fluorescent detector with autosampler (Agilent Technologies, model: HPLC 1100 series )
Hamilton syringe (Hamilton, model: Gastight #1002 )
Extracellular vesicles size distribution and concentration reader (Malvern Instruments, model: NanoSight NS300 )
Extracellular vesicles charge reader (Malvern Instruments, model: Zetasizer Nano NS )
Glass micro-electrophoresis cuvette Dip Cell kit (Malvern Instruments, catalog number: ZEN1002 )
Transmission electron microscope (JEOL, model: JEM-1011 )
Note: This product has been discontinued.
ALZET® osmotic pumps (DURECT, ALZET, catalog numbers: 1003D and 1007D )
Water bath at 37 °C
Microscissors (Fine Science Tools, catalog numbers: 14060-10 ; 14002-12 )
Set of two forceps (Fine Science Tools, catalog number: 11251-30 )
Vibratome (Leica Biosystems, model: Leica VT1000 S)
Autoplate washer (BioTek Instruments, model: ELx405 )
Tissue culture incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: HeracellTM 150i )
Pipet-aid (Drummond Scientific, model: Portable Pipet-Aid® XP )
Tissue culture phase-contrast inverted microscope (Motic, model: AE2000 )
Anion exchange column (Thermo Fisher Scientific, Thermo ScientificTM, model: DNAPacTM PA100 )
Heat block (Fisher Scientific, model: IsotempTM 2050FS )
µPlate carrier (Beckman Coulter, model: SX4750 )
-86 °C freezer (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM 900 Series )
Biological safety cabinet connected to vacuum (Thermo Fisher Scientific, Thermo ScientificTM, model: 1300 Series Class II , Type A2)
Software
Nanoparticles Tracking Analysis (NTA) software
Microsoft Office Excel (Microsoft Pack Office)
GraphPad Prism 6 software (GraphPad Software, Inc.)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Haraszti, R. A., Coles, A., Aronin, N., Khvorova, A. and Didiot, M. (2017). Loading of Extracellular Vesicles with Chemically Stabilized Hydrophobic siRNAs for the Treatment of Disease in the Central Nervous System. Bio-protocol 7(12): e2338. DOI: 10.21769/BioProtoc.2338.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Lipid
Neuroscience > Nervous system disorders > Animal model
Biochemistry > Lipid > Extracellular lipids
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,339 | https://bio-protocol.org/exchange/protocoldetail?id=2339&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Targeted Nucleotide Substitution in Mammalian Cell by Target-AID
TA Takayuki Arazoe
KN Keiji Nishida
Akihiko Kondo
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2339 Views: 18544
Edited by: Daan C. Swarts
Reviewed by: Zhen Shi
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Programmable RNA-guided nucleases based on CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated protein) systems have been applied to various type of cells as powerful genome editing tools. By using activation-induced cytidine deaminase (AID) in place of the nuclease activity of the CRISPR/Cas9 system, we have developed a genome editing tool for targeted nucleotide substitution (C to T or G to A) without donor DNA template (Figure 1; Nishida et al., 2016). Here we describe the detailed method for Target-AID to perform programmable point mutagenesis in the genome of mammalian cells. A specific method for targeting the hypoxanthine-guanine phosphoribosyltransferase (HPRT) gene in Chinese Hamster Ovary (CHO) cell was described here as an example, while this method principally should be applicable to any gene of interest in a wide range of cell types.
Figure 1. Schematic illustration for Target-AID and its targetable site. In a guide-RNA (gRNA)-dependent manner, PmCDA1 fused to nCas9 (D10A) via a linker performs programmable cytidine mutagenesis around -21 to -16 positions relative to PAM sequence on the non-complementary strand in mammalian cells. The targetable site was determined based on the efficient base substitution (> 20%) observed in the previous work.
Keywords: Genome editing CRISPR/Cas9 Target-AID Cytidine deaminase Mammalian cell
Background
Insertion or deletion caused by DNA double strand break at the target site is efficiently induced to disrupt gene function. However, more precise genome modifications are still limited as homology directed repair is not always efficient enough in higher eukaryotes, especially when considering delivery of template DNA for in vivo genome editing. In addition, CRISPR nucleases also have some potential for off-target effect by cutting the genome (Cox et al., 2015). Target-AID demonstrated a very narrow range of targeted nucleotide modification without use of template DNA. AID can convert cytosine to uracil without DNA cleavage by deamination and then, uracil is converted to thymine or the other bases through DNA replication and/or repair. Use of uracil DNA-glycosylase inhibitor (UGI), which blocks removal of uracil in DNA and the subsequent repair pathway, rendered mutations more likely to be C to T substitutions and improved the efficiency. While a series of variable components for Target-AID had been tested such as linkage, nickase Cas9 (nCas9) and UGI in the original study, we will focus on the use of AID ortholog PmCDA1 derived from sea lamprey, fused to nCas9 or nCas9 plus UGI for simplicity. Consistent to our study, applying the rat apolipoprotein B mRNA editing enzyme, catalytic polypeptide (rAPOBEC1) has also been reported as a programmable base editor (BE). Although BE targeted 5 bases surrounding the -15 position upstream of PAM (Komor et al., 2016), Target-AID can modify 3 to 6 bases surrounding the -18 position upstream PAM. More recently, it has been reported that Target-AID can be applied for precise editing of plant genome (Shimatani et al., 2017).
Materials and Reagents
Cell culture-treated polystyrene 24 well plate (Sumitomo Bakelite, catalog number: MS-80240Z )
100 mm dish (TPP, catalog number: 93100 )
15 ml and 1.5 ml tubes
200 μl pipette tips
CHO-K1 cells (ECACC, catalog number: 85051005 )
Target-AID vectors
nCas9-PmCDA1 (Addgene, catalog number: 79617 )
nCas9-PmCDA1-UGI (Addgene, catalog number: 79620 )
Opti-MEM (Thermo Fisher Scientific, GibcoTM, catalog number: 31985070 )
Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668019 )
Dulbecco’s phosphate buffered saline (D-PBS) (Nacalai Tesque, catalog number: 14249-24 )
NucleoSpin Tissue XS (MACHEREY-NAGEL, catalog number: 740901.50 )
A pair of primers to amplify the target genomic region plus 150-200 bp upstream and downstream sequences (for HPRT target1, Fw: 5’-GGCTACATAGAGGGATCCTGTGTCA-3’; Rev: 5’-ACAGTAGCTCTTCAGTCTGATAAAA-3’) (Eurofin genomics)
KOD FX Neo (TOYOBO, catalog number: KFX-201 )
Gel extraction kit (QIAGEN, catalog number: 28704 )
(Optional) NEBNext Multiplex Oligos for Illumina (Dual Index Primer Set1) (New England Biolabs, catalog number: E7600S )
(Optional) MiSeq reagent Kit v3 (Illumina, catalog number: MS-102-3003 )
Ham’s F12 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 11765054 )
Fetal bovine serum (FBS) (Biosera, catalog number: FB-1360/500 )
Penicillin-streptomycin (Nacalai Tesque, catalog number: 26253-84 )
G418
Trypsin-EDTA, 0.25% (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
(Optional) 6-TG
Ham’s F12 culture medium (see Recipes)
Ham’s F12-G418 culture medium (see Recipes)
Trypsin-EDTA 0.025% (see Recipes)
(Optional) Ham’s F12-G418-6-TG culture medium (see Recipes)
Equipment
Cell culture incubator at 37 °C with 5% CO2 (Panasonic, catalog number: KMCC17RU2J ) or equivalent
Micropipette
Optical microscope with 10x eyepiece and 10x objective lens (Olympus, model: CKX41 ) or equivalent
Cell counting plate (WAKENBTECH, catalog number: OC-C-S02 )
Centrifuge (Max speed: 15,000 rpm; Max RCF: 21,380 x g; 24 x 1.5/2.0 ml angle rotor; 12 x 15 ml swing-out rotor) (KUBOTA, model: 3740 ) or equivalent
Heat block (TAITEC, model: CTU-Mini , catalog number: 0063288-000) or equivalent
PCR thermal cycler (TaKaRa Bio, model: TP600 ) or equivalent
Agarose gel electrophoresis system
3130xL Genetic Analyzer (Thermo Fisher Scientific, Applied BiosystemsTM, model: 3130xL Genetic Analyzer ) or equivalent
Software
CLC Genomic workbench 7.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Arazoe, T., Nishida, K. and Kondo, A. (2017). Targeted Nucleotide Substitution in Mammalian Cell by Target-AID. Bio-protocol 7(11): e2339. DOI: 10.21769/BioProtoc.2339.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Genetics
Cell Biology > Cell engineering > CRISPR-cas9
Molecular Biology > DNA > DNA damage and repair
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
234 | https://bio-protocol.org/exchange/protocoldetail?id=234&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Site Density Protocol
JH Jun Huang
Published: Jul 5, 2012
DOI: 10.21769/BioProtoc.234 Views: 8548
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
The site densities of cell surface molecules are useful information for cell function analysis. Using antibody staining and commercial available calibration beads, this assay quantitatively determines the T cell receptor site density at the single T cell level. This method can be easily extended to quantify other surface molecule densities on different cells or beads.
Materials and Reagents
PE-conjugated anti-mouse TCR Va2 monoclonal antibody B20.1 (BD)
PE Rat IgG2a, λ Isotype Control (BD)
QuantiBRITE PE beads tube (BD)
Equipment
Countertop Centrifuge
BD LSR flow
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Huang, J. (2012). Site Density Protocol. Bio-101: e234. DOI: 10.21769/BioProtoc.234.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,340 | https://bio-protocol.org/exchange/protocoldetail?id=2340&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Protocol for Production of Mutant Mice Using Chemically Synthesized crRNA/tracrRNA with Cas9 Nickase and FokI-dCas9
SH Satoshi Hara
MT Miho Terao
ST Shuji Takada
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2340 Views: 10137
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system is the most widely used genome editing tool. A common CRISPR/Cas9 system consists of two components: a single-guide RNA (sgRNA) and Cas9. Both components are required for the introduction of a double-strand break (DSB) at a specific target sequence. One drawback of this system is that the production of sgRNA in the laboratory is laborious since it requires cloning of an sgRNA sequence, in vitro transcription reaction and sgRNA purification. An alternative to targeting Cas9 activity by sgRNA is to target it with two small RNAs: CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). Both of these small RNAs can be chemically synthesized which makes the production of these RNAs less difficult when compared to sgRNA. Another downside of the CRISPR/Cas9 systems is that off-target effects have been reported. However, modified forms of Cas9 have been developed to minimize off-target effects. For example, nickase-type Cas9 (nCas9) and FokI domain-fused catalytically-inactive Cas9 (FokI-dCas9; fCas9) induce DSBs only when two guide RNAs bind opposite strands within a defined distance. In this protocol, we describe our experimental system for the production of mutant mice using a CRISPR/Cas9 system that combines crRNA, tracrRNA, and modified forms of Cas9. This method not only facilitates the preparation of reagents for the genome editing system but it can also reduce the risk of off-target effects.
Keywords: CRISPR/Cas9 crRNA/tracrRNA nCas9 fCas9 Mutant mice
Background
The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system is an effective genome editing tool. In bacteria, CRISPR/Cas9 functions as an adaptive immune system. It consists of two small RNAs, CRISPR RNA (crRNA) and trans-activation crRNA (tracrRNA) and the Cas9 DNA nuclease, which digests targeted DNA (Jinek et al., 2013). Several groups have established the CRISPR/Cas9 system as a tool for introducing mutations in many cell types (Cong et al., 2013; Mali et al., 2013). When the Cas9 nuclease is targeted to genomic DNA, it cleaves DNA resulting in a lesion that is repaired by non-homologous end joining (NHEJ) or homologous DNA recombination. Since NHEJ can be an error-prone mechanism, mutations can be introduced into the genome when DNA is repaired by this mechanism. The CRISPR/Cas9 system can be used to edit the genomes of mice by microinjecting Cas9 and the single-guide RNA (sgRNA) into fertilized eggs. Although sgRNAs have been used extensively with success, the generation of the sgRNA is laborious because the sgRNA must be cloned from DNA oligomers and then transcribed in vitro. Systems that use crRNA and tracrRNA can eliminate much of the labor involved in preparing sgRNAs since crRNA and tracrRNA are small enough in length to be chemically synthesized. So instead of injecting Cas9 with sgRNA, mutant mice can be obtained by microinjecting Cas9 with both crRNA and tracrRNA (crRNA/tracrRNA). One drawback of using the CRISPR/Cas9, is guide RNA/Cas9 complex can generate off-target mutations, which are unintended mutations that occur at loci with similar sequences to the target sequence of the guide RNA. The risk of inducing off-target mutations can be reduced by incorporating the use of modified forms of Cas9, such as the nickase-type of Cas9 (nCas9) and the FokI domain-fused catalytically-inactive Cas9 (FokI-dCas9; fCas9). These Cas9 forms cleave target DNA only when two sgRNAs bind opposite strands with a limited distance between them (Ran et al., 2013; Hara et al., 2015). Recently, we successfully generated mutant mice by microinjecting modified Cas9s with chemically synthesized crRNA/tracrRNA into fertilized eggs (Terao et al., 2016). This protocol reduces time and labor for the preparation of targeting RNA and can reduce the risk of off-target effects.
Materials and Reagents
35 mm dish*
60 mm dish*
Mouth pipettes*
0.22 µm filter*
Microloader (Eppendorf, catalog number: 5242956003 )
Glass capillary for mouth pipettes (Drummond Scientific, catalog number: 1-000-0500 )
Glass capillary for holding pipettes (Sutter Instrument, catalog number: B100-75-10 )
Glass capillary for injection pipettes (World Precision Instruments, catalog number: TW100F-4 )
Male and female C57BL/6 x DBA/2 hybrid (B6D2F1) or other strains (for recipient zygotes)
Male and female ICR (for preparation of pseudopregnant mice)
Cas9 plasmids (available from Addgene)
Nickase-type of Cas9 (nCas9) (Addgene, catalog number: 41816 )
FokI domain-fused catalytically-inactive (fCas9) (Addgene, catalog number: 52970 )
PrimeSTAR MAX (Takara Bio, catalog number: R045A ) or other PCR polymerases
Qiaquick PCR Purification Kit (QIAGEN, catalog number: 28104 ) or equivalent
AgeI*
mMESSAGE/mMACHINE T7 Transcription Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM1344 )
MEGAclear Transcription Clean-Up Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM1908 )
Pregnant mare serum gonadotropin (PMSG) (ASKA Animal Health, Serotropin®, catalog number: 879412 )
Human chronic gonadotropin (hCG) (ASKA Animal Health, catalog number: Gonatropin 3000 )
Hyaluronidase (Sigma-Aldrich, catalog number: H4272 )
KSOM medium (ARK resource)
Dichlorodimethylsilane (Tokyo Chemical Industry, catalog number: D0358 )
ExoSAP-IT (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 78200.200.UL )
Sodium chloride (NaCl) (Wako Pure Chemical Industries, catalog number: 191-01665 )
Potassium chloride (KCl) (Nacalai Tesque, catalog number: 28514-75 )
Calcium chloride (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C7902 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Magnesium sulfate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: M2773 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S5761 )
HEPES (DOJINDO, catalog number: 342-01375 )
Sodium DL-lactate (Sigma-Aldrich, catalog number: L7900 )
Sodium pyruvate (Sigma-Aldrich, catalog number: P2256 )
D-(+)-glucose (Sigma-Aldrich, catalog number: G7528 )
Polyvinyl alcohol (Sigma-Aldrich, catalog number: P8136 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Phenol red (Sigma-Aldrich, catalog number: P0290 )
Sodium hydroxide (NaOH) (Sigma-Aldrich)
Paraffin liquid (Nacalai Tesque, catalog number: 26137-85 )
BIOTAQ (Bioline, catalog number: BIO-21040 ) or other PCR polymerases
M2 medium (see Recipes)
*Note: No particular preference.
Equipment
Spectrophotometer (Thermo Fisher Scientific, model: NanoDrop ND-1000 )
Capillary puller (Sutter Instrument, model: P-1000 )
Microforge (NARISHIGE, model: MF-900 )
Micro centrifuge*
Thermal cycler*
Heating block*
Upright microscope*
Micromanipulator (NARISHIGE, model: NT-88-V3 )
Injectors (NARISHIGE, models: IM-11-2 and IM-9B )
FemtoJet (Eppendorf, model: FemtoJet® Express )
CO2 incubator (37 °C, 5% CO2, and 95% air condition)
*Note: No particular preference.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hara, S., Terao, M. and Takada, S. (2017). A Protocol for Production of Mutant Mice Using Chemically Synthesized crRNA/tracrRNA with Cas9 Nickase and FokI-dCas9. Bio-protocol 7(11): e2340. DOI: 10.21769/BioProtoc.2340.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Mutagenesis
Molecular Biology > RNA > Transfection
Cell Biology > Cell engineering > CRISPR-cas9
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,341 | https://bio-protocol.org/exchange/protocoldetail?id=2341&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Assay to Measure DNA Polymerase β Nucleotide Insertion Coupled with the DNA Ligation Reaction during Base Excision Repair
Melike Çağlayan
SW Samuel H. Wilson
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2341 Views: 6937
Edited by: Gal Haimovich
Reviewed by: Omar Akil
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
We previously reported that oxidized nucleotide insertion by DNA polymerase β (pol β) can confound the DNA ligation step during base excision repair (BER) (Çağlayan et al., 2017). Here, we describe a method to investigate pol β nucleotide insertion coupled with DNA ligation, in the same reaction mixture including dGTP or 8-oxo-dGTP, pol β and DNA ligase I. This in vitro assay enables us to measure the products for correct vs. oxidized nucleotide insertion, DNA ligation, and ligation failure, i.e., abortive ligation products, as a function of reaction time. This protocol complements our previous publication and describes an efficient way to analyze activities of BER enzymes and the functional interaction between pol β and DNA ligase I in vitro.
Keywords: DNA base excision repair DNA polymerase β DNA ligase Oxidative stress Oxidized nucleotides
Background
This protocol is to observe the last two steps of the BER pathway: nucleotide insertion by pol β and DNA ligation by ligase I. Using this protocol, one measures both reactions as a function of time of incubation in the same reaction mixture in vitro. The original entity was to analyze BER enzymes pol β and DNA ligase I on the single-nucleotide gapped DNA substrate that mimics a BER intermediate. These BER enzymes bind to and function on this BER intermediate. The DNA substrate used in this protocol includes a fluorescent label at both 5’- and 3’-ends that enables us to observe single-nucleotide insertion and DNA ligation of the DNA substrate. The pol β nucleotide insertion coupled with DNA ligation mimics the hand off or channeling of the nicked DNA intermediate from nucleotide insertion step to following ligation step during BER pathway. Using this protocol, one is also able to measure ligation failure, or abortive ligation, after pol β oxidized nucleotide (8-oxo-dGTP) insertion. This is achieved by quantification of the addition of an adenylate (AMP) group at 5’-end of the BER intermediate. This protocol can also be used to measure nucleotide insertion coupled with ligation using other DNA polymerases and DNA ligases.
Materials and Reagents
Eppendorf tubes (1.5 ml)
Pipette tips (10 μl, 100 μl, 1,000 μl)
Deoxyguanosine triphosphate (dGTP) (New England Biolabs, catalog number: N0447S )
8-oxo-2’-deoxyguanosine-5’-Triphosphate (8-oxo-dGTP) (Jena Bioscience, catalog number: NU-1117L )
DNA substrate: The DNA substrate includes a fluorescent tag at both the 5’- and 3’-ends of one of the gap-containing strand in the double-stranded DNA with a single nucleotide gap opposite template base Cytosine (Çağlayan et al., 2017)
Note: The sequence information for the DNA substrate is presented in the Notes section of the protocol.
Tris-HCl (pH 7.5)
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Adenosine 5’-Triphosphate (ATP) (New England Biolabs, catalog number: P0756S )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
Bovine serum albumin (BSA) (New England Biolabs, catalog number: B9000S )
Glycerol (Sigma-Aldrich, catalog number: G9012 )
HEPES (pH 7.5)
Sodium chloride (NaCl)
EDTA (Sigma-Aldrich, catalog number: 93283 )
Purified enzymes: Recombinant human DNA polymerase β and DNA ligase I (see Recipes and Figure 2)
Formamide (Sigma-Aldrich, catalog number: F9037 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Xylene cyanol (Sigma-Aldrich, catalog number: X4126 )
Trizma-base (Sigma-Aldrich, catalog number: T4661 )
Boric acid (Promega, catalog number: H5003 )
Urea (National Diagnostic, catalog number: EC-605 )
Ammonium persulfate (APS) (Sigma-Aldrich, catalog number: A3678-25G )
Tetramethylethylenediamine (TEMED) (Sigma-Aldrich, catalog number: T9281-25ML )
Sterile water
AccuGel (40%) 19:1 Acrylamide to Bisacrylamide Stabilized Solution (National Diagnostic, catalog number: EC-850 )
Full-range rainbow protein ladder (AmershamTM ECLTM RainbowTM Marker) (GE Healthcare, catalog number: RPN800E )
1x reaction buffer (see Recipes)
1x protein storage and dilution buffer (see Recipes)
Enzyme mixture (see Recipes)
Gel-loading dye (see Recipes)
10x TBE solution (see Recipes)
Denaturing PAGE solution (15%) (see Recipes)
EDTA buffer (pH 8.0) (see Recipes)
Equipment
Pipettes (P2, P10, P20, P100, P200)
Table-top heat block (Digital Dry Block Heater, VWR)
Polyacrylamide gel electrophoresis (PAGE) apparatus (Biometra, model: Model S2 )
Typhoon Phosphor Imager (GE Healthcare, model: Typhoon FLA 9500 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Çağlayan, M. and Wilson, S. H. (2017). In vitro Assay to Measure DNA Polymerase β Nucleotide Insertion Coupled with the DNA Ligation Reaction during Base Excision Repair. Bio-protocol 7(12): e2341. DOI: 10.21769/BioProtoc.2341.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA damage and repair
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,342 | https://bio-protocol.org/exchange/protocoldetail?id=2342&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Activity of O-acetylserine(thiol)lyase (OASTL) from Microalga Chlorella sorokiniana
Giovanna Salbitani
Simona Carfagna
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2342 Views: 10953
Edited by: Dennis Nürnberg
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
O-acetylserine(thiol)lyase (OASTL) is an enzyme catalysing the reaction of inorganic sulphide with O-acetylserine to form the S-containing amino acid L-cysteine. Here we describe an improved protocol to evaluate the activity of this enzyme from the microalga Chlorella sorokiniana. It is a colorimetric assay based on the reaction between cysteine, the product of OASTL activity, and ninhydrin reagent, which forms a thiazolidine (Thz).
Keywords: Chlorella sorokiniana Colorimetric assay Cysteine Microalgae Ninhydrin O-acetylserine(thiol)lyase Sulphur
Background
In archaea, bacteria, microalgae and plants, the synthesis of cysteine (Cys) represents a decisive stage of assimilatory sulphate reduction (Hell and Wirtz, 2008). Cys biosynthesis is the last step of sulphur assimilation and proceeds by two interconnected reactions catalysed by serine acetyltransferase (SAT, EC 2.3.1.30) and O-acetylserine(thiol)lyase (OASTL, EC 4.2.99.8) (Salbitani et al., 2014; Carfagna et al., 2015).
OASTLs catalyse the reaction between O-acetilserine (OAS) and sulphide to form Cys and acetate (Figure 1).
Figure 1. Schematic mechanism of cysteine biosynthesis catalyzed by O-acetylserine(thiol)lyase
In vascular plants, OASTLs are localized in chloroplasts, mitochondria and the cytosol with different functions for Cys synthesis (Jost et al., 2000; Birke et al., 2013). In microalgae, OASTLs seem to be mainly localized essentially in the chloroplasts (Merchant et al., 2007; Bromke, 2013). However, in Chlorella sorokiniana two isoforms, chloroplastic and cytosolic OASTL, were found under S-deprivation conditions (Carfagna et al., 2011).
Many researchers have developed and modified protocols to determine OASTLs activity in plants and bacteria (Gaitonde, 1967; Burnell and Whatley, 1977; Lèon et al., 1987; Rolland et al., 1992). Here we describe a protocol for the determination of OASTL activity, optimized for the green microalga Chlorella sorokiniana 211-8K (Figure 2). This OASTL assay is a spectrophotometric analysis based on the colorimetric reaction of the formed L-cysteine with ninhydrin reagent to form a thiazolidine (Thz) (Prota and Posiglione, 1973).
Figure 2. Optical microscope image of Chlorella sorokiniana cells
Materials and Reagents
Eppendorf tubes (1.5-2.0 ml)
Cuvettes 1.5 ml (BRAND, catalog number: 759115 )
CO2 tank
Chlorella sorokininana Shihira & Krauss, strain 211/8K (CCAP, Cambridge University) (Figure 2)
Liquid nitrogen
Milli-Q water
O-Acetyl-L-serine (OAS) (Sigma-Aldrich, catalog number: CDS020792 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D9779 )
Sodium sulfide nonahydrate (Na2S·9H2O) (Sigma-Aldrich, catalog number: S2006 )
Trichloracetic acid (TCA) (Sigma-Aldrich, catalog number: 91228 )
Acetic acid (CH3COOH) (Avantor Performance Materials, J.T. Baker®, catalog number: 401424 )
Ethanol (EtOH) (Avantor Performance Materials, J.T. Baker®, catalog number: 8007 )
Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, catalog number: 5000006 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: 04248 )
Note: This product has been discontinued.
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S5886 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M2643 )
Ethylenediaminetetraacetic acid ferric sodium salt (Fe-EDTA) (Sigma-Aldrich, catalog number: E6760 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C5670 )
Potassium nitrate (KNO3) (Sigma-Aldrich, catalog number: P8291 )
Copper(II) sulfate (CuSO4) (Sigma-Aldrich, catalog number: 451657 )
Ammonium molybdate tetrahydrate, (NH4)6Mo7O24·4H2O (Sigma-Aldrich, catalog number: M1019 )
Manganese(II) chloride (MnCl2) (Sigma-Aldrich, catalog number: 13217 )
Note: This product has been discontinued.
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: Z0251 )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: B6768 )
Pyridoxal-phosphate (PLP) (Sigma-Aldrich, catalog number: P3657 )
Ninhydrin (Sigma-Aldrich, catalog number: N4876 )
Hydrochloric acid 37% (Avantor Performance Materials, J.T. Baker®, catalog number: 6012 )
HEPES (Sigma-Aldrich, catalog number: H4034 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7030 )
Basal medium (see Recipes)
Phosphate buffer (see Recipes)
Extraction buffer (see Recipes)
Ninhydrin solution (see Recipes)
1 M HEPES solution (see Recipes)
Equipment
Culture flask (WHEATON, catalog number: 356954 )
Fluorescent lamps (Philips Lighting, model: TL-D 30W/55 )
Bench centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: IEC CL30 )
French pressure cell press (AMINCO RESOURCES, model: FA-078 )
Superspeed centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: Sorvall RC-5C Plus )
Vortex mixer (Troemner, catalog number: 945302 )
Eppendorf ThermoMixer® Comfort (Eppendorf, model: 5355 )
Eppendorf MiniSpin® (Eppendorf, model: 5453000011 )
Thermo bath (Labortechnik medingen, model: MWB 5 )
Spectrophotometer (Cole-Parmer, JENWAY, model: 7315 )
Optical microscope (Esselte, Leitz, model: Leitz Laborlux K )
Software
SigmaPlot® 12 software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Salbitani, G. and Carfagna, S. (2017). Extraction and Activity of O-acetylserine(thiol)lyase (OASTL) from Microalga Chlorella sorokiniana. Bio-protocol 7(12): e2342. DOI: 10.21769/BioProtoc.2342.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,343 | https://bio-protocol.org/exchange/protocoldetail?id=2343&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Modification and Application of a Commercial Whole-body Plethysmograph to Monitor Respiratory Abnormalities in Neonatal Mice
YL Yen-Ting Lai
Yi-Shuian Huang
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2343 Views: 8265
Edited by: Pengpeng Li
Reviewed by: Murugappan SathappaLU HAN
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
Proper breathing is essential for mammals to acquire oxygen after birth and requires coordinated actions among several tissues, including diaphragm, intercostal muscles, trachea, bronchi, lung and respiration-regulating neurons located in the medulla oblongata. Genetically modified mice that die early postnatally may have respiratory defects caused by maldevelopment of any one of these tissues (Turgeon and Meloche, 2009). Because of the small body size of neonatal pups, whole-body plethysmography can be used to monitor their respiratory activities. In this protocol, we modified the commercial whole-body plethysmograph by increasing metal filters in the pneumotach, connecting an extension tube to the pneumotach and removing the bias flow supply. With these modifications, the sensitivity of this device is significantly increased to enable the detection of rhythmic respiration in neonatal mice as early as postnatal day 1 (P1).
Keywords: Neonatal mice Whole body plethysmography Respiration
Background
Several labs have used home-made or custom-built plethysmograph devices to identify respiratory failure in genetically modified neonatal mice (Nsegbe et al., 2004; Crone et al., 2012). However, for researchers who are novices in this field and want to investigate the cause of neonatal lethality in mice, a commercial whole-body plethysmograph (WBP, Buxco system, DSI) is a reasonable choice.
When we first set up this system to monitor respirations of P0 mice, the respiratory activities in C57BL/6 newborns were most of the time undetectable until mice reached 3 days old. Because the WBP measures the pressure changes within the animal chamber that are due to inspired air humidified and heated by an animal’s lung during breathing, increasing the detection sensitivity of this device was the only way to monitor respiration of C57BL/6 neonates before P3.
In this protocol, we share our experience in modifying this system to reliably detect rhythmic respiration in C57BL/6 neonatal pups as early as P1 and possibly P0. Once the recorded traces are obtained, several parameters calculated by the FinePointe software are useful for exploring respiratory abnormalities in mice who do not die of cyanosis due to severe respiratory failure right after birth (Lai et al., 2016).
Materials and Reagents
P0 and P3 C57BL/6 litter (C57BL/6) (THE JACKSON LABORATORY, catalog number: 000664 )
ICR foster dams [Crl:CD-1 (ICR), Charles River, strain code: 022]
Equipment
Mouse pup WBP (DATA SCIENCES INTERNATIONAL, Buxco system; Figure 1) with:
Max II Amplifier (DATA SCIENCES INTERNATIONAL, Buxco, model: MAX2275 )
Recording chambers (DATA SCIENCES INTERNATIONAL, Buxco, model: PLY4241 ), ~30 ± 1 °C with built-in heating pad on
Figure 1. Modified setup for the Buxco mouse-pup whole-body plethysmograph
Flow transducer (DATA SCIENCES INTERNATIONAL, Buxco, model: TRD5700 )
Small rodent bias flow supply (DATA SCIENCES INTERNATIONAL, Buxco, model: B04-BFL0100 , for mouse pup)
Extension tube (length: 14 cm; internal/external diameter: 2.6/3 mm)
Metal filters (DATA SCIENCES INTERNATIONAL, Buxco, model: HDW1514 )
Hybridization oven (GE Healthcare, model: RPN2511E )
Software
FinePointe software (Buxco system, DSI)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lai, Y. and Huang, Y. (2017). Modification and Application of a Commercial Whole-body Plethysmograph to Monitor Respiratory Abnormalities in Neonatal Mice. Bio-protocol 7(12): e2343. DOI: 10.21769/BioProtoc.2343.
Lai, Y. T., Su, C. K., Jiang, S. T., Chang, Y. J., Lai, A. C. and Huang, Y. S. (2016). Deficiency of CPEB2-confined choline acetyltransferase expression in the dorsal motor nucleus of vagus causes hyperactivated parasympathetic signaling-associated bronchoconstriction. J Neurosci 36(50): 12661-12676.
Download Citation in RIS Format
Category
Biophysics > Bioengineering > Plethysmography
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,344 | https://bio-protocol.org/exchange/protocoldetail?id=2344&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Functional ex-vivo Imaging of Arterial Cellular Recruitment and Lipid Extravasation
EV Emiel P.C. van der Vorst
SM Sanne L. Maas
AO Almudena Ortega-Gomez
JH Jeroen M.M. Hameleers
MB Mariaelvy Bianchini
YA Yaw Asare
OS Oliver Soehnlein
YD Yvonne Döring
Christian Weber
Remco T.A. Megens
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2344 Views: 8486
Edited by: Gal Haimovich
Reviewed by: Vasiliki Koliaraki
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
The main purpose of this sophisticated and highly versatile method is to visualize and quantify structural vessel wall properties, cellular recruitment, and lipid/dextran extravasation under physiological conditions in living arteries. This will be of interest for a broad range of researchers within the field of inflammation, hypertension, atherosclerosis, and even the pharmaceutical industry. Currently, many researchers are using in vitro techniques to evaluate cellular recruitment, like transwell or flow chamber systems with cultured cells, with unclear physiological comparability. The here introduced method describes in detail the use of a sophisticated and flexible method to study arterial wall properties and leukocyte recruitment in fresh and viable murine carotid arteries ex vivo under arterial flow conditions. This model mimics the in vivo situation and allows the use of cells and arteries isolated from two different donors (for example, wildtype vs. specific knockouts) to be combined into one experiment,thereby providing information on both leukocyte and/or endothelial cell properties of both donors. As such, this model can be considered an alternative for the complicated and invasive in vivo studies, such as parabiotic experiments.
Keywords: Imaging Two-photon laser scanning microscopy Arteriograph chamber Cellular recruitment Lipid extravasation
Background
The core of the method is the application of two-photon laser scanning microscopy (TPLSM) to visualize an ex vivo carotid artery which is mounted in an arteriograph chamber, which has been shown to mimic physiological conditions as present in the in vivo situation (Megens et al., 2007). Fresh arteries, in our case murine carotid arteries but the method is also applicable for other blood vessels of comparable size including human vessels (Bloksgaard et al., 2015), are carefully extracted and mounted in the arteriograph chamber on two glass micropipettes using thin threads. The chamber should provide sufficient space to access the artery with the microscope objective (preferably water dipping or immersion objective with a working distance of > 1 mm). After applying luminal pressure (80 mmHg) and the subsequent correction of the shortening of the length due to isolation (Megens et al., 2007), a variety of fluorescently labeled cells and/or vessel wall components of interest can be perfused into the vessel either under flow or under static conditions. This enables the user to A) count the number of adherent leukocyte subsets, B) determine molecular extravasation (dextrans, lipids) into the arterial wall, C) visualize vascular properties and structures using fluorescently conjugated (specific) antibodies or intrinsic fluorescence signals derived from extracellular matrix components, D) combine the previously described targets.
The general basis of this method was described in 2007 (Megens et al., 2007). Since then this method has been used in several scientific publications, for example to show cell recruitment under control and inflammatory conditions (Schmitt et al., 2014), chemokine presence (Soehnlein et al., 2011), detection of smooth muscle cells (Subramanian et al., 2010; Spronck et al., 2016) or proliferating endothelial cells (Schober et al., 2014), endothelial protein depositions (Ortega-Gomez et al., 2016), adhering platelets (Karshovska et al., 2015), atherosclerotic lesions in the bifurcation (Megens et al., 2007 and 2008; Weber et al., 2011), visualization of the endothelial glycocalyx (Reitsma et al., 2011), or evaluation of extracellular matrix markers (Boerboom et al., 2007; Megens et al., 2007).
TPLSM imaging can be performed prior-, during-, and/or post-perfusion. The settings of the microscope system strongly depend on the available microscope. We utilize a modern Leica SP5II MP system with a 20x WD objective and a Ti:Sa pulsed laser which allows 4 channel imaging at video rate. This is however not a requirement for application of this method as older, less well equipped TPLSM systems also suffice.
In recent years, we have further advanced the method, making it applicable to investigate recruitment of specific cell-types to the viable carotid artery (Döring et al., 2014; Schmitt et al., 2014; Karshovska et al., 2015). Not only does this method enable the user to specifically and simultaneously investigate recruitment of various cell types like monocytes, neutrophils or T-cells to highly physiological endothelium by differential fluorescent labeling (using cell trackers or equivalent), it also allows us to combine specific arteries and cells isolated (blood, bone marrow) from different (wildtype vs. knockout) mouse subsets. As a result, a system is created that can define whether effects on recruitment are mediated by the vascular and/or haematopoietic deficiency. Besides the functional readout of cell recruitment, the method further enables simultaneous or subsequent labelling and subcellular resolution imaging of vascular structures and presence of compounds in the vessel wall. As a result, altered adhesion may directly be linked to the presence or absence of specific targets.
By simultaneous application of various fluorescently labeled leukocyte subsets, the experimental conditions are equal for each cell-type, thereby limiting the experimental variation due to for example flow pattern differences (data may be presented in absolute numbers or ratios). The latter also limits the number of experiments required and, in combination with a reduced number of necessary experimental animals because inflammatory cells and arteries can be isolated from the same animals, ultimately the method reduces the number of required animals.
In addition to the cell recruitment assay we have developed an application using fluorescently labeled low-density lipoprotein particles or dextrans to visualize and quantify lipid or dextran extravasation in viable (diseased) arteries. Lastly, unlike in vivo imaging of large arteries, this ex vivo model does not suffer from unwanted motions of the arterial wall as is the case in the in vivo situation, thereby allowing imaging with subcellular resolution. Moreover, stimuli or specific dyes may be applied at any given time during the experiment giving the researcher full flexibility to tailor the methodology and achieve the required goals.
Materials and Reagents
Isolation of carotid arteries
Fixation tape Durapore 1.25 cm (3M, catalog number: 1538-0 )
Polystyrene dishes 35 x 10 mm (2 x) (Corning, Falcon®, catalog number: 353001 )
Hanks balanced saline solution (HBSS) with CaCl2 and MgCl2 (Thermo Fisher Scientific, catalog number: 1402550 ), pH 7.4
Cell suspension
50 ml tubes (3 x) (SARSTEDT, catalog number: 62.547.254 )
Needle 27 G x 1.5 (Grey) (BD, catalog number: 301629 )
Syringe 10 ml (1 x) (BD, DiscarditTM catalog number: 309110 )
Cell strainer 50 µm (Sysmex, CellTrics®, catalog number: 25004-0042-2317 )
Hanks balanced saline solution (HBSS) with CaCl2 and MgCl2 (Thermo Fisher Scientific, catalog number: 1402550 ), pH 7.4
Fluorescent cell markers: cell tracker green (Thermo Fisher Scientific, InvitrogenTM, catalog number: C7025 ) and Red (Thermo Fisher Scientific, InvitrogenTM, catalog number: C34565 )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: A9434 )
Potassium bicarbonate (KHCO3) (Sigma-Aldrich, catalog number: 60339 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Lysis buffer (see Recipes)
Mounting of artery
Glass etching material (NH4HF2 or NH4F·HF) (Carglass, catalog number: ZB10 EI0003 )
Needles 14 G x 80 mm, shortened and blunted to 40 mm and 50 mm (Braun Sterican 14 G x 80 mm) (B. Braun Medical, catalog number: 4665473 )
Nylon thread Ø ~20 µm, for tying of blood vessels (Living Systems Instruments, catalog number: THR-G )
Three-way tab (2 x) (B. Braun Medical, catalog number: 4095111 )
Syringe 1 ml (BD, PlastipakTM, catalog number: 300026 )
Silicone tubing 3 x 1 mm (Carl Roth, catalog number: 9556.1 ) cut to 0.5 m length
Hanks balanced saline solution (HBSS) with CaCl2 and MgCl2 (Thermo Fisher Scientific, catalog number: 1402550 ), pH 7.4
Molecular extravasation
Silicone tubing 3 x 1 mm cut to 1.0 m length (Carl Roth, catalog number: 9556.1 )
Needle 20 G x 1.5 (yellow) (BD, catalog number: 301300 )
Safe lock tubes 1.5 ml (3 x) (Eppendorf, catalog number: 0030120086 )
Syringes 1 ml (2 x) (BD, PlastipakTM, catalog number: 300026 )
Three-way tab (B. Braun Medical, catalog number: 4095111 )
Fixation tape Durapore 1.25 cm (3M, catalog number: 1538-0 )
Human Dil-LDL (Kalen Biomedical, catalog number: 770230-9 )
Hanks balanced saline solution (HBSS) with CaCl2 and MgCl2 (Thermo Fisher Scientific, catalog number: 1402550 ), pH 7.4
Directly conjugated anti-CD31/eFluor450 (PECAM: Thermo Fisher Scientific, eBioscienceTM, catalog number: 48-0311-82 )
Alternatives: Directly conjugated anti-CD54/A488 (ICAM: BioLegend, catalog number: 116112 ) or anti-CD106/A594 (VCAM: BioLegend, catalog number: 105724 )
Flow assay
Silicone tubing 3 x 1 mm cut to 1.5 m and 1.0 m length (Carl Roth, catalog number: 9556.1 )
Needle 20 G x 1.5 (yellow) (BD, catalog number: 301300 )
Syringes 1 ml (1 x) (see Reagent C5) and 10 ml (2 x) (BD, DiscarditTM, catalog number: 309110 )
Three-way Tab (2 x) (B. Braun Medical, catalog number: 4095111 )
50 ml tubes (2 x) (SARSTEDT, catalog number: 62.547.254 )
Fixation tape Durapore 1.25 cm (3M, catalog number: 1538-0 )
Hanks balanced saline solution (HBSS) with CaCl2 and MgCl2 (Thermo Fisher Scientific, catalog number: 1402550 ), pH 7.4
Equipment
Isolation of carotid arteries
Pen
FST student spring scissors (Fine Science Tools, catalog number: 91500-09 )
Dumont forceps (2 x) (Fine Science Tools, catalog number: 91150-20 )
Scissors (Fine Science Tools, catalog number: 14084-08 )
Stereomicroscope Leica S8 Apo (LED light source and 0.63x objective) (Leica Microsystems, model: Leica S8 Apo )
Cell suspension
Timer
Pen (see Equipment A1)
Scissors (Fine Science Tools, catalog number: 91401-12 )
1 ml pipette (Eppendorf, catalog number: 3120000062 )
Centrifuge (Eppendorf, model: 5430 )
Cell counting chamber (Neubauer)
Cell culture microscope (Leica DMi1 with phase contrast and 10x NA0.3 objective) (Leica Microsystems, model: Leica DMi1 )
Flow cytometer (BD, model: BD FACSCANTO SYSTEM )
Mounting of artery
Arteriograph chamber (2 x, IDEE©, Maastricht University, the Netherlands)
Glass pipettes 1.5 x 0.86 mm (2 x, Harvard Apparatus, catalog number: 30-0057 )
Pipette puller (NARISHIGE, catalog number: PP-830 )
Pipette tip grinder (IDEE©, Maastricht University, the Netherlands)
Alternative: Glass pipettes readymade (Living Systems Instruments, catalog number: GCP-300-325 )
Silicone kit, 73 clear (Farnell, catalog number: 101705 )
Sphygmomanometer (Riester, Big Ben®, catalog number: 1453-100 ) adapted with a 500 ml air chamber (Schott) and Luer-connectors to fit 1 x 3 mm silicone tubing (IDEE©, Maastricht University, the Netherlands)
Luer-coupling adapter female (1x) (Carl Roth, catalog number: CT62.1 )
Stereomicroscope Leica S8 Apo (with LED light source and 0.63x objective) (Leica Microsystems, model: Leica S8 Apo)
Microscope
Commercially available Leica SP5IIMP laser scanning microscope system based on a DM6000FS microscope stand (for more info we refer to the manufacturer’s website:
https://www.leica-microsystems.com/products/confocal-microscopes/details/product/leica-tcs-sp5-ii/downloads/)
Alternative: Any functional TPLSM enabling spectral specificity in ≥ 2 detectors and a water dipping objective with sufficient working distance (≥ 1 mm) can be used in combination with the here described assays.
Spectra physics MaiTai DeepSee Ti:Sa laser source
Leica Hybrid detectors (4 x)
Luigs and Neumann SM7 motorized microscope stage
Leica 20x NA1.00WD objective
Ludin Climate control /laser safety box
Molecular extravasation
Timer (see Equipment B1)
Pen (see Equipment A1)
Luer-coupling adapters: male (1 x) (Carl Roth, catalog number: CT58.1 ) and female (1 x) (Carl Roth, catalog number: CT62.1 )
Syringe infusion pump (Harvard Apparatus pump11 elite) (Harvard Apparatus, catalog number: 70-4504 )
Flow assay
Luer-coupling adapters: male (2 x) (Carl Roth, catalog number: CT58.1 ) and female (1 x) (Carl Roth, catalog number: CT62.1 )
Syringe infusion pump (Harvard Apparatus pump11 elite) (Harvard Apparatus, catalog number: 70-4504 )
Column stand with clamp (unknown brand, length 100 cm, footprint 15 x 25 cm)
Pc with excel and/or paper for cell count
Software
Leica LAS AF 2.6 acquisition software
Leica LAS X 3.11 image processing software (including 3D analyses package); offline
Note: Any processing software package that allows the user to handle multidimensional data can be used.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：van der Vorst, E. P., Maas, S. L., Ortega-Gomez, A., Hameleers, J. M., Bianchini, M., Asare, Y., Soehnlein, O., Döring, Y., Weber, C. and Megens, R. T. (2017). Functional ex-vivo Imaging of Arterial Cellular Recruitment and Lipid Extravasation. Bio-protocol 7(12): e2344. DOI: 10.21769/BioProtoc.2344.
Download Citation in RIS Format
Category
Cell Biology > Tissue analysis > Tissue isolation
Immunology > Immune cell imaging > Two-photon microscopy
Cell Biology > Tissue analysis > Tissue imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,345 | https://bio-protocol.org/exchange/protocoldetail?id=2345&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Culturing Bacteria from Caenorhabditis elegans Gut to Assess Colonization Proficiency
Facundo Rodriguez Ayala
Sebastián Cogliati
Carlos Bauman
Cecilia Leñini
Marco Bartolini
Juan Manuel Villalba
Federico Argañaraz
Roberto Grau
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2345 Views: 15108
Edited by: Jyotiska Chaudhuri
Reviewed by: Jian ChenLeonardo G. Guilgur
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Determining an accurate count of intestinal bacteria from Caenorhabditis elegans is one critical way to assess colonization proficiency by a given bacteria. This can be accomplished by culturing appropriate dilutions of worm gut bacteria on selective or differential agarized media. Because of the high concentration of bacteria in gut worm, dilution is necessary before plating onto growth media. Serial dilutions can reduce the concentration of the original intestinal sample to levels low enough for single colonies to be grown on media plates, allowing for the calculation of the initial counts of bacteria in the intestinal sample.
Keywords: Caenorhabditis elegans Bacillus subtilis Escherichia coli Culture
Background
Animals rarely live in isolation but rather exist in association with microorganisms. The more characteristic host-microbe interaction in nature is the symbiotic relationship between host and intestinal microbiota (Rosenberg and Zilber-Rosenberg, 2011). In mammals, host-microbe symbiotic interactions mainly occur along mucosal surfaces, with the most important one being the intestinal mucosa. When freshly isolated from the wild, C. elegans often harbours a diverse bacterial flora in its gut lumen, reminiscent of the microbial communities of higher organisms (Duveau and Felix, 2012; Bumbarger et al., 2013). By contrast, in the laboratory C. elegans is typically maintained in the presence of single bacterial strain (Brenner, 1974). Most often, this is the Gram-negative bacterium Escherichia coli. However, other species are sometimes used, such as the Gram-positive Bacillus subtilis (Garsin et al., 2003). An adult worm contains approximately 10,000 bacterial cells, a number 10-times greater than that of host worm somatic cells (Portal-Celhay and Blaser, 2012): perhaps coincidentally, this microbiota-to-host cell ratio is similar to that found in humans.
Different strategies are being used to measure the colonization proficiency of C. elegans gut by a bacterium such as fluorescein isothiocyanate (FITC)-labelled bacteria, bacteria expressing a fusion reporter (green fluorescent protein [GFP] or β-galactosidase). However, the more accurate method is to measure the number of CFU isolated from the worm intestine. In this protocol, we show how to isolate and count E. coli and B. subtilis strains from C. elegans gut. In the case of B. subtilis, we also show how to distinguish vegetative forms from highly resistant spores formed by this bacterium inside the C. elegans gut.
Materials and Reagents
Pipette tips 2-200 µl Eppendorf® epT.I.P.S. (Eppendorf, catalog number: 022492039 )
Pipette tips 50-1,000 µl Eppendorf® epT.I.P.S. (Eppendorf, catalog number: 022492055 )
Petri dishes 60 x 15 mm 500/cs (Fisher Scientific, catalog number: FB0875713A )
Petri dishes 35 x 10 mm 500/cs (Fisher Scientific, catalog number: FB0875711YZ )
Corning® 15 ml centrifuge tubes (Corning, catalog number: 430791 )
Eppendorf® Safe-Lock 1.5 ml microcentrifuge tubes (Eppendorf, catalog number: 022363204 )
Toothpick
99.95 % Platinum, 0.05 % Iridium wire (3 ft/pk) (Tritech Research, catalog number: PT-9901 )
OP50 E. coli bacteria (University of Minnesota, C. elegans Genetics Center, MN)
Experimental and control C. elegans strains (University of Minnesota, C. elegans Genetics Center, MN)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Bacto peptone (BD, BactoTM, catalog number: 211677 )
Agar (Sigma-Aldrich, catalog number: A1296 )
Hypochlorite (Sigma-Aldrich, catalog number: 13440 )
Commercial Bleach 60 g/L (DROGUERÍA INDUSTRIAL SAN JUAN, http://www.sanjuandrogueria.com)
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Luria broth (Sigma-Aldrich, catalog number: L3522 )
Luria broth with agar (Sigma-Aldrich, catalog number: L2897 )
Lysozyme from chicken egg white (Sigma-Aldrich, catalog number: L6876 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Cholesterol (Sigma-Aldrich, catalog number: C8667 )
100% ethanol (Sigma-Aldrich, catalog number: E7023 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: M1880 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C3881 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P2222 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S8045 )
Levamisole hydrochloride (Sigma-Aldrich, catalog number: L0380000 )
Nematode growth medium (NGM) (see Recipes)
M9 buffer (see Recipes)
5 mg/ml cholesterol (see Recipes)
1 M MgSO4 (see Recipes)
1 M CaCl2 (see Recipes)
Phosphate buffer (see Recipes)
1 N NaOH (see Recipes)
25 mM Levamisole (see Recipes)
Equipment
Erlenmeyer flask (Fisher Scientific, catalog number: FB5006000 )
Pipettor (Gilson, catalog number: F167300 )
Worm pick. Worm picks can either be purchased (Genesee Scientific, catalog number: 59-AWP ) or made in the lab as described in Wollenberg et al., 2013
Pasteur glass pipette (Fisher Scientific, catalog number: 22-378893 )
Autoclave (Tuttnauerusa, model: 6690 )
Stirring hotplate (Corning, catalog number: 6795-620 )
Centrifuge (Eppendorf, model: 5430 )
Tabletop centrifuge (Eppendorf, model: 5424 )
Pellet pestle (Kimble Chase Life Science and Research Products, catalog number: 7495211590 )
Refrigerated incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: HerathermTM General Protocol Microbiological Incubators , catalog number: 51028064)
Bunsen burner (Humbolt, catalog number: H-5870 )
Dissecting stereomicroscope (Olympus, model: SMZ645 )
Incubators for stable temperature (AQUA® LYTIC incubator 20 °C)
Freezers (-20 °C; So-Low Environmental Equipment) (Siemens, model: C85-22 )
Water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rodriguez Ayala, F., Cogliati, S., Bauman, C., Leñini, C., Bartolini, M., Villalba, J. M., Argañaraz, F. and Grau, R. (2017). Culturing Bacteria from Caenorhabditis elegans Gut to Assess Colonization Proficiency. Bio-protocol 7(12): e2345. DOI: 10.21769/BioProtoc.2345.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Nematode
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,346 | https://bio-protocol.org/exchange/protocoldetail?id=2346&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stereotaxic Surgery for Suprachiasmatic Nucleus Lesions in Mice
Kimiko Shimizu
YF Yoshitaka Fukada
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2346 Views: 18253
Edited by: Xi Feng
Reviewed by: Xiaoyu LiuHélène M. Léger
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
Site-specific lesions are invaluable methods for investigating the function of brain regions within the central nervous system and can be used to study neural mechanisms of behaviors. Precise stereotaxic surgery is required to lesion small regions of the brain such as the suprachiasmatic nucleus (SCN), which harbors the master circadian clock. In this protocol, we describe stereotaxic surgery optimized for bilateral lesion of the mouse SCN by loading electric current. Success of the SCN lesion is verified histologically and behaviorally by monitoring arrhythmic locomotor activity. The SCN-lesioned mouse allows for the evaluation of behavioral, biochemical, and physiological consequences of ablation of the master circadian clock.
Keywords: Suprachiasmatic nucleus Stereotaxic surgery SCN-lesion Circadian rhythm Hypothalamus
Background
The suprachiasmatic nucleus (SCN) is a small region within the hypothalamus of the mammalian brain. It is positioned bilaterally above the optic chiasm and contains approximately 20,000 neurons. The SCN is known as the location of the master circadian oscillator (clock) and is required for synchronization with the light-dark cycle. Ablation of the SCN is a useful strategy for assessing the physiological influence of the master circadian clock.
An electrolytic lesion of the SCN has advantages that enable fast and localized ablation of the master circadian clock in comparison to gene modification by virus injection or SCN-specific promoters. Location of the lesion by electrical impulse can be verified right after surgery by Nissl staining, and monitoring activity rhythm can be started one day after the surgery. In addition, lesion by administration of chemicals often results in non-specific damage and thus it is not as precise as lesion by electrical impulse, especially for small targets such as SCN. Therefore, this protocol provides a useful strategy to evaluate effects (outputs) of master circadian clock.
Materials and Reagents
Adult mouse (C57BL/6J, usually 8-14 weeks old)
Ketamine (Daiichi Sankyo Propharma, Ketalar for intramuscular injection 500 mg)
Xylazine (Bayer, Serakutaru 2% injection)
Bacteriostatic saline (Otsuka pharmaceutical, 20 ml ampoule)
70% ethanol
For confirmation of SCN-lesioning
Glacial acetic acid
0.2% cresyl violet acetate solution (see Recipes)
Filter paper
Equipment
Note: Refer to Figures 1, 2, 3 for the Equipment used in this protocol.
Stereotaxic frame (NARISHIGE, model: SR-6M-HT )
Stereotaxic micromanipulator (NARISHIGE, model: SM-15R/L )
Wide-field dissecting microscope (ZEISS, model: Stemi 2000 ) with boom stand
Cold light source (ZEISS, model: CL 1500 ECO )
Figure 1. Equipment list 1-4
Auxiliary ear bar (NARISHIGE, model: EB-5N )
Scissors (e.g., Fine Science Tools, catalog number: 14068-12 )
Scalpel (FEATHER Safety Razor, catalog number: No.11 )
Surgical needle with suture (e.g., NATSUME SEISAKUSHO, catalog number: C21-40 )
Hemostats (e.g., Fine Science Tools, catalog number: 13008-12 )
Forceps (e.g., Fine Science Tools, catalog number: 11009-13 or 11008-13 )
Tuberculin syringe with needle (e.g., Terumo Medical, catalog numbers: SS-01T and NN-2719S )
Razor (e.g., FEATHER Safety Razor, catalog number: FAS-10 )
Cotton swabs (e.g., Q-tip)
Heating pad (e.g., electric heating pad for pets)
Hand drill with engraving cutter (DREMEL, model: 106 )
Figure 2. Equipment list 5-15
Lesion-making device (Ugo Basile, catalog number: 53500 )
Electrode (100 μm, coated with epoxy except for 200 μm at the tip, Neuroscience)
Plug connecter cables with crocodile clip
Area sensor with an infrared detector for confirmation of SCN-lesioning (EK, catalog number: PS-3241 )
Figure 3. Equipment list 16-18
Software
ClockLab software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Neuroanatomy and circuitry > Animal model
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
This was quite a professional work, and I would like to ask more detailed information about the infrared detector.
0 Answer
3 Views
Aug 8, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,347 | https://bio-protocol.org/exchange/protocoldetail?id=2347&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Estimation of Stomatal Aperture in Arabidopsis thaliana Using Silicone Rubber Imprints
TS Telma E. Scarpeci
MZ María I. Zanor
Estela M. Valle
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2347 Views: 12532
Edited by: Dennis Nürnberg
Reviewed by: Harrie van ErpMoritz Bomer
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Estimation of stomatal aperture using low viscosity silicone-base impression material has the advantage of working with the whole leaf. The developmental stage and the environment strongly affect the stomatal aperture. Therefore, it is mandatory to have accurate estimations of the stomatal aperture of intact leaves under different situations. With this technique, it is possible to get the real picture at any moment. The outputs of the data include studies on cell area and morphology, epidermis cell and stomata lineages, among others. This protocol is useful for the accurate estimation of stomatal aperture in many samples of intact leaves in Arabidopsis thaliana.
Keywords: Drought Epidermis Leaf development Oxidative stress Photorespiration Stomatal density
Background
The epidermis of all leaves has specialized cells, the guard cells, surrounding microscopic pores. The guard cells and pores are called stomata, and they permit gas exchange and diffusion of water vapor between the atmosphere and the interior of the leaf. Stomata are products of an intracellular program, which generates the specific stomatal patterns during their development (Kagan et al., 1992). Stomata are found both in the abaxial and adaxial sides of the leaf, although the stomatal density (and starch accumulation) is higher on the abaxial side of the leaf sheath in Arabidopsis thaliana (Schlüler et al., 2003; Tsai et al., 2009). The stomatal density is controlled by endogenous and exogenous factors in Arabidopsis thaliana (Berger and Altmann, 2000; von Groll et al., 2002). Stomatal aperture actively responds to changes in the environment and regulates leaf transpiration rates (Santelia and Lawson, 2016). An accurate estimation of the stomatal aperture provides insight into the impact of environmental stress on plants.
Materials and Reagents
10-cm pots
Plastic spatula
Microscope glass slide (Glass Klass, Yancheng Huisheng Medical Instrument Factory, catalog number: 7102 )
Silicone low viscosity impression material (Polysiloxane) and hardener/catalyst (Zhermack, catalog number: U113368/G )
Leaves of Arabidopsis (Arabidopsis thaliana)
Clear nail varnish (Colorama, Maybelline, Argentina)
Equipment
Plant growth chamber: closed cabinet with controlled environmental conditions of photoperiod, light intensity, temperature, and humidity
Light microscope with a 60x objective lens (Olympus, model: BH-2 ) equipped for photomicrography (Nikon Instruments, model: DS-Fi1 )
Software
ImageJ (http://rsb.info.nih.gov/ij/)
Microsoft Excel
Sigma Plot (version 11.0)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Scarpeci, T. E., Zanor, M. I. and Valle, E. M. (2017). Estimation of Stomatal Aperture in Arabidopsis thaliana Using Silicone Rubber Imprints. Bio-protocol 7(12): e2347. DOI: 10.21769/BioProtoc.2347.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Tissue analysis
Cell Biology > Cell structure > Cell adhesion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,348 | https://bio-protocol.org/exchange/protocoldetail?id=2348&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Serial Immunoprecipitation of 3xFLAG/V5-tagged Yeast Proteins to Identify Specific Interactions with Chaperone Proteins
XZ Xu Zheng
David Pincus
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2348 Views: 8880
Edited by: Arsalan Daudi
Reviewed by: Vasudevan AchuthanPooja Saxena
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
This method was generated to isolate high affinity protein complexes from yeast lysate by performing serial affinity purification of doubly tagged 3xFLAG/V5 proteins. First, the bait protein of interest is immunoprecipitated by anti-FLAG-conjugated magnetic beads and gently eluted by 3xFLAG antigen peptide. Next, the bait protein is recaptured from the first eluate by anti-V5-conjugated magnetic beads and eluted with ionic detergent. In this manner, the majority of abundant, nonspecific proteins remain either bound to the first beads or in the first eluate, allowing pure, high affinity complexes to be obtained. This approach can be used to show specific interactions with notoriously ‘sticky’ chaperone proteins.
Keywords: Immunoprecipitation Yeast FLAG tag V5 tag Protein complexes
Background
Immunoprecipitation followed by mass spectrometry (IP/MS) is an unbiased method to identify protein-protein interactions with a specific bait protein of interest. While this approach has been fruitfully applied to identify protein interaction networks, it is plagued by false positives–proteins that appear to interact but are actually non-specifically bound to the beads or antibodies used in the affinity purification. In particular, highly abundant proteins such as ribosomal proteins, metabolic enzymes and chaperone proteins are common contaminants. However, sometimes these common contaminants may be bona fide interaction partners, yet it is challenging to demonstrate specificity. To overcome this obstacle, we developed a serial affinity purification approach to isolate specific, high affinity complexes between bait proteins of interest tagged with two affinity epitopes–the 3xFLAG and V5 tags (Figure 1). We have generated a plasmid containing the 3xFLAG-V5 epitopes and a HIS3 selectable marker that can be amplified and used to C-terminally tag any yeast protein of interest in a single yeast transformation (Zheng et al., 2016). We originally applied our method to demonstrate a specific interaction between the heat shock transcription factor (Hsf1) and the major Hsp70 chaperone proteins present in the yeast cytosol, Ssa1/2. However, this approach can be generally applied to identify high affinity complexes involving a protein of interest. While this technique removes the bulk of false positive interactions, a major caveat is that low affinity and transient interactions are likely to be lost.
Figure 1. Schematic overview of the protocol. A 3xFLAG/V5 dual-tagged bait protein is serially purified with anti-FLAG beads followed by anti-V5 beads.
Materials and Reagents
Pipette tips
Glass culture tubes (20 x 150 mm) (Sigma-Aldrich, catalog number: C1048 )
50 ml Falcon tubes
1.5 ml microcentrifuge tubes
Saccharomyces cerevisiae (W303 background) with 3xFLAG-V5 tagged bait protein of interest (Hsf1-3xFLAG/V5 in this protocol–Pincus lab strain DPY118: MATa ADE2 leu2-3,112 can1-100 ura3-1 his3-11,15 hsf1∆::KAN HSF1-3xFLAG/V5::TRP1)
3xFLAG peptide (Sigma-Aldrich, catalog number: F4799 )
Liquid nitrogen
Dry ice pellets
Anti-FLAG magnetic beads (Sigma-Aldrich, catalog number: M8823 )
Anti-V5 magnetic beads (MBL International, catalog number: M167-11 )
2% SDS
Yeast extract (RPI, catalog number: Y20020 )
Peptone (RPI, catalog number: P20240 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
Dextrose (Sigma-Aldrich, catalog number: D9434 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Deoxycholate (Sigma-Aldrich, catalog number: D6750 )
Ethylenediaminetetraacetate acid (EDTA) (Sigma-Aldrich, catalog number: EDS )
cOmplete Mini EDTA-free protease inhibitor (Roche Molecular Systems, catalog number: 11836170001 )
YPD media (see Recipes)
IP lysis buffer (see Recipes)
Equipment
Pipettes
Incubator shaker (e.g., Eppendorf, New BrunswickTM, model: Innova® 44 , catalog number: M1282-0004)
500 ml flask
Spectrophotometer (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: OrionTM AquaMate 7000 , catalog number: AQ7000)
Centrifuge for 50 ml Falcon tubes (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM LegendTM XT , catalog number: 75004505)
Cryogenic tissue grinder (Bio Spec Products, catalog number: CTG111 )
200 ml glass beaker
Intelli-mixer rotating mixer (Labscoop, catalog number: EL-RM2L )
Magnetic separation rack (New England Biolabs, catalog number: S1506S )
Thermomixer (Eppendorf, model: ThermoMixer® C , catalog number: 5382000023)
Vortex mixer (VWR, catalog number: 97043-562 )
Procedure
Inoculate the yeast strain harboring Hsf1-FLAG-V5 in a culture tube containing 3 ml YPD liquid media (see Recipes) and grow overnight at 30 °C in a shaker set at 200 rpm.
Dilute 2 ml overnight grown culture into the 500 ml flask containing 100 ml YPD media, and grow to OD600 = 0.5-0.8 OD at 30 °C in a shaker set at 200 rpm (~4 h).
Pour the growth media into two 50 ml Falcon tubes, and centrifuge at 4,000 x g for 4 min. Discard the media and submerge the Falcon tubes containing the yeast pellets in liquid nitrogen. The pellets can be stored at -80 °C for up to 3 months.
Add dry ice pellets into a cryogenic tissue grinder pre-chilled at 4 °C (a simple coffee grinder will work as well) and grind it into powder that covers the blades. The dry ice allows the cells to be lysed while remaining frozen. Dry ice should be handled with care and never confined in an airtight compartment.
Add the yeast pellets to the crushed dry ice and grind the yeast pellet with the dry ice for 30 sec.
Repeat the grinding 5 more times for a total of 6 grindings. Add more dry ice pellets as needed to keep the blades fully covered with dry ice.
Transfer the pulverized cells/dry ice powder into beaker, and sublimate/evaporate dry ice at room temperature.
Add 1 ml lysis buffer and incubate the lysate at 4 °C for 5 min with intermittent swirling to resuspend.
Transfer the lysate into a 1.5 ml centrifuge tube, and centrifuge at 20,000 x g for 10 min. Reserve the supernatant (cleared lysate). Take a 10 µl sample of the cleared lysate for analysis by Western blot (input sample).
Add 25 µl anti-FLAG magnetic beads to a 1.5 ml tube. Place the tube on a magnetic separation rack and remove the buffer. Wash with 200 µl lysis buffer (see Recipes) on the magnetic rack and discard the wash.
Pipet the cleared lysate into the 1.5 ml tube containing the anti-FLAG beads and incubate at 4 °C for 2 h on an inversion rotating mixer.
Place the tube on the magnetic separation rack. When the solution clears (~2 min), take a 10 µl sample for analysis by Western blot (unbound sample).
Discard the unbound fraction and wash the beads 3 times with 500 µl lysis buffer. Gently vortex the beads with each wash step and incubate on ice for 5 min. Return to the magnetic separation rack and discard washes.
Elute the Hsf1-FLAG-V5 complex with 500 µl lysis buffer containing 100 µg/ml 3xFLAG peptide. Incubate on ice for 30 min. Repeat for a total of 2 elutions, and pool the eluate fractions.
Add 25 µl anti-V5 magnetic beads to a 1.5 ml tube. Place the tube on a magnetic separation rack and remove the buffer. Wash with 200 µl lysis buffer on the magnetic rack and discard the wash.
Pipet the pooled 3xFLAG eluate into the tube with the V5 beads and incubate at 4 °C for 2 h on an inversion rotating mixer.
Place the tube on the magnetic separation rack. Discard the unbound fraction and wash the beads 3 times with 500 µl lysis buffer. Vortex the beads at half-maximal setting for 5 sec with each wash step and incubate on ice for 5 min. Return to the magnetic separation rack and discard washes.
Add 100 µl lysis buffer + 2% SDS. Incubate for 15 min at 95 °C. Place tube on the magnetic separation rack and reserve solution.
Use 10 µl for analysis by Western blot (final eluate: this is 10x concentrated compared to input and unbound fraction).
Submit remaining 90 µl samples to a mass spectrometry core facility (e.g., Whitehead Institute Proteomics Facility) for analysis as described (Zheng et al., 2016). Mass spectrometry is extremely sensitive to contamination by proteases, so wearing gloves, working quickly and keeping samples on ice prior to analysis is of paramount importance.
Data analysis
Mass spectrometry data should be analyzed by first ensuring that you observed your bait protein with reasonable coverage (> 25%). Putative interacting proteins should be validated by repeated experiments and alternative detection methods, such as Western blotting (Figure 2). For examples of peptide counts of a bait protein, binding partners and nonspecific contaminants, see Figure 1–source data 1 in Zheng et al., 2016.
Figure 2. Western blot of immuno-precipitated Hsf1-3xFLAG/V5. 3xFLAG/V5-tagged Hsf1 was serially purified with anti-FLAG and anti-V5 beads from cells under control (-) and heat shock conditions (+). Hsf1 is low abundance and cannot be easily detected in the input, but is enriched following immunoprecipitation. Hsf1 migrates slower in the gel under heat shock conditions due to phosphorylation (HS = heat shock).
Notes
Despite the stringency of the serial affinity protocol, background contaminants will still be observed in the mass spectrometry data. In general, the repertoire of highly abundant ribosomal proteins and metabolic enzymes that are nonspecific contaminants is not very reproducible, though a subset is always present. Thus, with enough replicates, most of these contaminants can be discarded.
Recipes
YPD media
1% yeast extract
2% peptone
2% glucose
Autoclave before adding glucose or filter sterilize
IP lysis buffer
50 mM HEPES pH 8.0
150 mM NaCl
1% Triton X-100
0.1% deoxycholate
5 mM EDTA
1x cOmplete Mini EDTA-free protease inhibitor
Acknowledgments
This protocol was adapted from our previous work (Zheng et al., 2016). This work was supported by a grant from the Office of the Director of the National Institutes of Health to D.P. (DP5 OD017941-01).
References
Zheng, X., Krakowiak, J., Patel, N., Beyzavi, A., Ezike, J., Khalil, A. S. and Pincus, D. (2016). Dynamic control of Hsf1 during heat shock by a chaperone switch and phosphorylation. Elife 5.
Copyright: Zheng and Pincus. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Zheng, X. and Pincus, D. (2017). Serial Immunoprecipitation of 3xFLAG/V5-tagged Yeast Proteins to Identify Specific Interactions with Chaperone Proteins. Bio-protocol 7(12): e2348. DOI: 10.21769/BioProtoc.2348.
Zheng, X., Krakowiak, J., Patel, N., Beyzavi, A., Ezike, J., Khalil, A. S. and Pincus, D. (2016). Dynamic control of Hsf1 during heat shock by a chaperone switch and phosphorylation. Elife 5.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell-based analysis
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,349 | https://bio-protocol.org/exchange/protocoldetail?id=2349&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Thermostability Measurement of an α-Glucosidase Using a Classical Activity-based Assay and a Novel Thermofluor Method
Karin Ernits
Katrin Viigand
Triinu Visnapuu
Kristina Põšnograjeva
Tiina Alamäe
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2349 Views: 9363
Edited by: Yanjie Li
Reviewed by: Ayelign M. Adal
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
α-glucosidases (including maltases and isomaltases) are enzymes which release glucose from a set of α-glucosidic substrates. Their catalytic activity, substrate specificity and thermostability can be assayed using this trait. Thermostability of proteins can also be determined using a high-throughput differential scanning fluorometry method, also named Thermofluor. We have shown that Thermofluor can also be applied to predict binding of substrates and inhibitors to a yeast α-glucosidase. The methods described here in detail were used in Viigand et al., 2016.
Keywords: Maltase Isomaltase Maltase assay Methylotrophic yeast Ogataea polymorpha Glucose liquicolor Differential scanning fluorometry
Background
Maltases (EC 3.2.1.20) and isomaltases (EC 3.2.1.10) are α-glucosidases belonging to family 13 of glycoside hydrolases according to the CAZy classification (Lombard et al., 2014). Maltase MAL1 of a methylotrophic yeast Ogataea polymorpha is nonselective–it hydrolyses maltose- and isomaltose-like α-glucosidic sugars producing D-glucose as one of the reaction products. Thus, activity of maltase on its substrates can be determined according to glucose release. The Glucose liquicolor-aided method described in this work allows rapid and convenient assay of the activity, substrate specificity and thermostability of the maltase. Importantly, this activity-based method can be adapted to other enzymes that produce glucose as a reaction product. A high-throughput Thermofluor method is mostly used in protein crystallography to measure (thermal) stability of the protein (Boivin et al., 2013; Ericsson et al., 2006). We used Thermofluor 1) to evaluate thermostability of the maltase protein and 2) to study its substrate specificity (Viigand et al., 2016). Substrate specificity assay of glycoside hydrolases and other sugar-acting enzymes using Thermofluor is cost-efficient–it requires very low amounts of the protein as well as ligand sugars that can be very expensive. Regarding substrates of α-glucosidases, one gram of isomaltose from Sigma-Aldrich costs almost 1,000 euros, 10 milligrams of nigerose 143 euros and 1 mg of kojibiose almost 200 euros.
Materials and Reagents
For both methods
1.5 ml microtubes (Corning, Axygen®, catalog number: MCT-150-C )
0.2 μm cellulose acetate membrane filter (Sartorius, catalog number: 11107-47-N )
Sucrose (Sigma-Aldrich, catalog number: 16104 )
MilliQ quality water (MQ)
Crushed ice
In-house laboratory purified C-terminally His-tagged maltase MAL1 (from Ogataea polymorpha) and its inactive mutant protein (Asp199Ala) overexpressed in Escherichia coli (prepared as in Viigand et al., 2016)
For classical activity assay
Special PS (polystyrene) micro photometer cuvette, 2 ml (LP ITALIANA, catalog number: 112117 )
Glucose liquicolor kit (GOD-PAP Method, Enzymatic Colorimetric Test for Glucose) (Human, catalog number: 10260 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: 795488 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: RES20765 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E9884 )
Tris base (Roche Molecular Systems, catalog number: 10708976001 )
Hydrochloric acid 37% (HCl) (AppliChem, catalog number: A0659 )
1 M Tris-HCl buffer (pH 8.3) (see Recipes)
Maltase buffer (see Recipes)
For Thermofluor method
LightCycler® 480 Multiwell Plate 96 (white) with sealing foils (Roche Molecular Systems, catalog number: 04729692001 )
5,000x SYPRO Orange Protein Gel Stain (Sigma-Aldrich, catalog number: S5692 )
HEPES buffer (Sigma-Aldrich, catalog number: H3375 )
Sodium hydroxide (NaOH) (AppliChem, catalog number: 131687.1211 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 31434-M )
0.5 M HEPES buffer (pH 7.0) (see Recipes)
4x Thermofluor buffer (see Recipes)
Equipment
Pharmaceutical balance PS2100/C/2 (RADWAG Balances and Scales, model: PS 2100/C/2 )
JENWAY pH meter model 3510 (Cole-Parmer Instrument, model: Jenway 3510 )
Pipettes (FisherbrandTM Elite Pipette Kit) (Fisher Scientific, catalog number: 14-388-100 )
Refrigerator-freezer (Electrolux, model: EN2900AOW )
Ultrospec 3100 pro UV/Visible spectrophotometer (GE Healthcare, Amersham Biosciences, model: Ultrospec 3100 pro , catalog number: 80-2112-37)
ThermoBlock TDB-120 (Biosan, model: TDB-120 )
Digital timer/clock (Fisher Scientific, catalog number: S01619 )
Plate sealer spatula for microtiter plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 5701 )
LightCycler® 480 Instrument II (Roche Molecular Systems, model: LightCycler® 480 Instrument II , catalog number: 05015278001)
Refrigerated centrifuge 4K-15 (Sigma Laborzentrifugen, model: 4K-15 , catalog number: 10742) with the swing-out rotor for 4 buckets (Sigma Laborzentrifugen, catalog number: 11150 ) and bucket, aluminium, for microtiter plates (Sigma Laborzentrifugen, catalog number: 13220 )
Part I. A classical thermostability assay
Note: A classical thermostability assay of the maltase is based on determination of residual catalytic activity of the enzyme after its incubation at various temperatures. Therefore, we first give the protocol for the measurement of maltase activity.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Fluorescence
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
235 | https://bio-protocol.org/exchange/protocoldetail?id=235&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Hippocampal Neuron Dissociation Transfection and Culture in Microfluidics Chambers
YG Yang Geng
Published: Vol 2, Iss 14, Jul 20, 2012
DOI: 10.21769/BioProtoc.235 Views: 16099
Original Research Article:
The authors used this protocol in Dec 2006
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2006
Abstract
Microfluidics chamber is an ideal tool to study local events that occurring in neuronal projections by perfectly compartmentalizing the cell soma from certain branches. It is very well suited for live cell imaging or immunohistochemistry staining. This protocol has been carefully modified in detail to fit the requirement of primary rat hippocampal neuronal cultures. It can also be applied to a more general neuronal culture purpose in microfluidics.
Materials and Reagents
β-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
HBSS (Hyclone, catalog number: SH30268 )
Boric acid (Sigma-Aldrich, catalog number: B0252 )
Borax (Sigma-Aldrich, catalog number: B9876 )
Cysteine (Sigma-Aldrich, catalog number: C7352 )
EtOH
Neural basal media (NBM)
Glutamax
B27
PenStrep
Gentamicin
Glutamate
FBS
Laminin
Trypan blue
Na2SO4
K2SO4
MgCl2
CaCl2
Glucose
Phenol Red
EDTA
0.1 M borate buffer (pH 8.5) (see Recipes)
Dissection media (DM) (see Recipes)
Papain activation buffer (see Recipes)
Papain (100 mg) (Worthington Biochemical Corp, catalog number: LS003119 ) (see Recipes)
DNase (F. Hoffmann-La Roche, catalog number: 10104159001 ) (see Recipes)
Papain digestion media (see Recipes)
Dissociation media (see Recipes)
Plating media with phenol red (see Recipes)
Growth media without phenol red (see Recipes)
Equipment
PDMS devices
Microscope
Hemacytometer
TC hood
Incubator
-80 °C freezer
37 °C water bath
6 cm cell culture dishs
Plasma-bonding machine (model PDC-32G , http://www.harrickplasma.com/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Geng, Y. (2012). Hippocampal Neuron Dissociation Transfection and Culture in Microfluidics Chambers. Bio-protocol 2(14): e235. DOI: 10.21769/BioProtoc.235.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Live-cell imaging
Developmental Biology > Cell signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,350 | https://bio-protocol.org/exchange/protocoldetail?id=2350&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Validating Candidate Congenital Heart Disease Genes in Drosophila
Jun-yi Zhu*
YF Yulong Fu*
AR Adam Richman
Zhe Han
*Contributed equally to this work
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2350 Views: 8299
Edited by: Yanjie Li
Reviewed by: Leonardo G. Guilgur
Original Research Article:
The authors used this protocol in 13-Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
13-Jan 2017
Abstract
Genomic sequencing efforts can implicate large numbers of genes and de novo mutations as potential disease risk factors. A high throughput in vivo model system to validate candidate gene association with pathology is therefore useful. We present such a system employing Drosophila to validate candidate congenital heart disease (CHD) genes. The protocols exploit comprehensive libraries of UAS-GeneX-RNAi fly strains that when crossed into a 4XHand-Gal4 genetic background afford highly efficient cardiac-specific knockdown of endogenous fly orthologs of human genes. A panel of quantitative assays evaluates phenotypic severity across multiple cardiac parameters. These include developmental lethality, larva and adult heart morphology, and adult longevity. These protocols were recently used to evaluate more than 100 candidate CHD genes implicated by patient whole-exome sequencing (Zhu et al., 2017).
Keywords: Drosophila High-throughput screening Congenital heart disease Lethal rate Heart morphology
Background
The use of the Drosophila model to elucidate molecular mechanisms underlying human diseases is well documented (Bier and Bodmer, 2004; Cagan, 2011; Zhang et al., 2013; Owusu-Ansah and Perrimon, 2014; Diop and Bodmer, 2015; Na et al., 2015), and 75% of human disease associated genes are represented by functional homologs in the fly genome (Reiter et al., 2001). While it is a challenge to link Drosophila developmental phenotypes directly to patient symptoms, Drosophila can be used as a very sophisticated and efficient platform to test and validate candidate disease gene function in development, and this can readily be scaled to evaluate a large number of candidate genes identified from patient genomic sequencing efforts. Drosophila has been used to study genes related to CHD for over 20 years, based on evolutionarily conserved genetic mechanisms of heart development (Bier and Bodmer, 2004; Olson, 2006; Yi et al., 2006). We developed a highly efficient cardiac-targeted gene silencing approach in flies to examine effects on heart structure and function for fly homologs of candidate CHD genes (Zhu et al., 2017).
Materials and Reagents
1,250 μl pipette tips (BioExpress, GeneMate, catalog number: P-1234-1250 )
200 μl pipette tips (BioExpress, GeneMate, catalog number: P-1237-200 )
10 μl pipette tips (BioExpress, GeneMate, catalog number: P-1234-10XL )
Permanent marker
FisherbrandTM plastic Petri dishes (Fisher Scientific, catalog number: S33580A )
Microscope slides (VWR, catalog number: 16004-430 )
24 x 50 mm gold SealTM cover slips (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3322 )
Heart-specific Gal4 driver line, 4XHand-Gal4/Cyo (Generated by Dr. Zhe Han)
UAS RNAi transgenic strains targeting Drosophila orthologs of candidate CHD genes (Bloomington Drosophila Stock Center)
Carbon dioxide (Roberts Oxygen Company)
Fly food (Meidi Laboratories)
Vaseline (COVIDIENTM)
Schneider’s Drosophila medium (Thermo Fisher Scientific, GibcoTM, catalog number: 21720001 )
Paraformaldehyde solution, 4% in PBS (Alfa Aesar, Affymetrix/USB, catalog number: J19943 )
Phosphate buffered saline (PBS), prepared from 10x PBS, pH 7.4 (GENAXY, catalog number: 40-029 )
Bovine serum albumin, Powder (Santa Cruz Biotechnology, catalog number: sc-2323 )
Triton X-100 (Fisher Scientific, catalog number: BP151-100 )
Alexa Fluor 555 Phalloidin (Thermo Fisher Scientific, InvitrogenTM, catalog number: A34055 )
EC11 anti-Pericardin primary anti-mouse antibody (Developmental Studies Hybridoma Bank, catalog number: EC11 )
Biotin-conjugated goat anti-mouse antibody (Vector Laboratories, catalog number: SP-1100 )
Streptavidin (Cy5) (Thermo Fisher Scientific, InvitrogenTM, catalog number: SA1011 )
VECTASHIELD antifade mounting medium with DAPI (Vector Laboratories, catalog number: H-1200 )
Electron microscopy science clear nail polish (Electron Microscopy Science, catalog number: 72180 )
Equipment
Gilson P200 pipette classic large plunger (Gilson, model: P200 )
Vannas spring scissors–3 mm cutting Edge (Fine Science Tools, catalog number: 15000-10 )
Dumont #5 forceps (Roboz Surgical Instrument, catalog number: RS-4955 )
Ultimate Flypad (Genesee Scientific, catalog number: 59-172 )
Stereo microscope (ZEISS, model: Stemi 305 )
Zeiss ApoTome.2 microscope using a 20x Plan-Apochromat 0.8 N.A/air objective (ZEISS, model: Apotome.2 )
Drosophila incubator set to 25 °C and 29 °C (Panasonic Healthcare, model: MIR-154-PA )
Software
ImageJ software Version 1.49
Procedure
High-throughput gene function validation system in Drosophila
5 male flies homozygous for a UAS-RNAi transgene (targeting the Drosophila ortholog of candidate CHD gene) are combined with 10 to 15 4-day-old virgin female flies of genotype 4XHand-Gal4/Cyo (Figure 1) at 25 °C.
Figure 1. 5 male homozygous UAS-RNAi transgenic flies are crossed to 10-15 4-day-old virgin female flies of genotype 4XHand-Gal4/Cyo
The flies are maintained at 25 °C and are transferred daily to a fresh vial of fly food for 5-6 days.
Each day the emptied vial containing freshly laid eggs is transferred to 29 °C to boost UAS-transgene expression. At the end of this process, 5-6 vials of flies are developing at 29 °C.
As adult progeny flies emerge over a period of four to five days, they are anesthetized with CO2 on a fly pad (Genesee Scientific) and the numbers of curly winged (CyO, no RNAi transgene) vs. straight winged (RNAi transgene expressed in cardioblasts) flies are recorded (Figure 2). Counting continues until at least 200 curly winged flies have been recorded.
Figure 2. Progeny adult flies emerge and the number of adult flies with curly wings (CyO, no transgene) vs. straight wings (RNAi transgene expressed in cardioblasts) are recorded. An example of lethal rate of approx. 65% is shown.
The [developmental] lethal rate attributable to target gene silencing in the heart is calculated as (Curly - Straight)/Curly x 100% = % Mortality.
Adult survival assay
At least 60 adult progeny flies with straight wings (4XHand-Gal4 driven UAS-RNAi transgene expression in cardioblasts) are collected and maintained at 29 °C. This number of flies can typically be collected in one to two days. Maintain no more than 15 flies per vial. To obtain sufficient numbers of straight winged progeny flies at least 5 crosses should be set up. In the case of RNAi transgenes that induce high mortality, more than 10 crosses should be established.
The survival assay initiates immediately upon fly collection. The number of live flies is thereafter recorded every two days until all flies have died.
Flies are transferred every two days to a fresh vial of fly food (to prevent flies from becoming stuck in wet food).
A survival curve is generated that plots % surviving flies against time (Figure 3).
Figure 3. Survival curves for control flies (no RNAi transgene) and flies expressing RNAi targeting the Rbbp5 gene in cardioblasts. Heart-specific Rbbp5 knockdown significantly reduces longevity.
Adult heart morphology
Six to ten straight wing adult progeny flies (RNAi transgene expressed in cardioblasts) and six to ten curly wing control progeny adult flies (no RNAi transgene) are anesthetized with CO2 and carefully immobilized (ventral side up) in the bottom of a Petri dish by gently affixing flies in vaseline (Vogler and Ocorr, 2009). Each fly genotype is inscribed directly on the petri dish using a permanent marker. The flies remain in the same Petri dish throughout the procedure until being mounted for microscopic examination. Processing experimental and control flies simultaneously eliminates variability that might result from separate treatments.
The legs are removed by amputation using fine spring scissors.
Schneider’s Drosophila medium (~20 ml per dish) is added by pouring from one side of the Petri dish until flies are completely submerged.
Using scissors, begin at the rostral end of the fly and cut circumferentially and continuously to remove the entire ventral abdominal cuticle, revealing the inner organs.
Remove the internal organs (viscera) that tend to float free of the abdominal cavity by pipetting adjacent medium up and down 5 to 6 times using a P200 pipette set at 200 μl volume.
Remnant viscera and fat body tissue are delicately cleared away using fine forceps (Figure 4).
Figure 4. Adult fly dissection. Step 1: Stick the fly on the Petri dish; Step 2: Remove the fly legs; Step 3: Open the body from bottom; Step 4: Remove the organs.
Pour out the original medium. Add fresh Schneider’s Drosophila medium (~20 ml) to the Petri dish by pouring from one side until flies are completely submerged to wash the fly carcasses. Pour out the wash medium.
Add ~20 ml formaldehyde solution (4% in PBS) to the Petri dish by pouring from one side until flies are completely submerged. Fix for 10 min at room temperature. Pour out the fixative solution.
Rinse carcasses by adding ~20 ml PBS to the Petri dish by pouring from one side until flies are completely submerged. Pour out the PBS. Repeat the rinse procedure another 2 x.
Add ~20 ml BSA solution (2% in PBS) containing 0.1% Triton X-100 to the Petri dish by pouring from one side until flies are completely submerged. Incubate for 30 min at room temperature. Pour out the BSA solution.
Add ~20 ml PBS containing Alexa Fluor 555 Phalloidin (1:1,000 dilution) and anti-Pericardin (EC11) mouse primary antibody (1:500 dilution) to the Petri dish by pouring from one side until flies are completely submerged. Incubate overnight at 4 °C in the dark.
Remove Petri dish from 4 °C.
Note: The following steps need not be performed in the dark.
Rinse 3 x with PBS at room temperature as described in step C9.
Add ~20 ml PBS and incubate for 20 min at room temperature. Repeat 3 x.
Add ~20 ml PBS containing Biotin-conjugated goat anti-mouse antibody (1:500 dilution). Incubate for 2 h at room temperature.
Rinse 3 x with PBS at room temperature as described in step C9.
Add ~20 ml PBS and incubate for 20 min at room temperature. Repeat 3 x.
Add ~20 ml PBS containing Streptavidin Cy5 (1:1,000 dilution) and incubated for 1 h at room temperature.
Rinse 3 x with PBS at room temperature as described in step C9.
Add ~20 ml PBS and incubate for 20 min at room temperature. Repeat 3 x.
Mount heart tissue on a glass slide in ~2 ml VECTASHIELD antifade mounting medium.
Apply a cover slip using forceps.
Seal edges of cover slip using nail polish.
Confocal imaging is performed using a Zeiss ApoTome.2 microscope fitted with a 20x Plan-Apochromat 0.8 N.A/air objective.
Control groups are imaged first to establish light intensity and exposure time. An exposure time is found at which the image is saturated, and then reduced to a set point of approx. 70% saturation to allow comparison of fluorescence intensity across genotypes.
The entire heart is imaged by collecting Z-stack images. Same number of samples of each phenotype are imaged.
Images are exported to tiff file format.
ImageJ software Version 1.49 is used for image processing.
Z-stack projections are screened and image levels containing cardiac myofibers are selected for analysis, avoiding the ventral muscle layer that underlies the heart tube (Figure 5).
Samples of reduced myofibrillar density and increased pericardin deposition are shown (Figure 6).
Figure 5. Z-stack layers that exclude ventral muscle fibers are selected for analysis. Scare bar = 50 μm.
Figure 6. Samples of reduced myofibrillar density and increased pericardin deposition. Scale bar = 50 μm.
3rd instar larva heart morphology
Larvae are grown at 29 °C to the 3rd instar stage. Six to ten control larvae (lacking RNAi transgene) are selected on the basis of GFP expression in the head, detected by fluorescence stereo microscopy (the GFP marker is linked to CyO on the inherited balancer chromosome). Six to ten experimental larvae carrying a UAS-RNAi transgene expressed in cardioblasts are identified by the absence of GFP marker expression (Brent et al., 2009).
Using forceps insert insect pins into tail and head to affix larvae to Petri dish, ventral side UP.
Submerge each larva under a drop of Schneider’s Drosophila medium.
Using scissors, make a ventral incision through the cuticle from tail to head.
Insert another 4 insect pins to hold open the excised cuticle.
The internal organs are carefully removed using No. 5 forceps (Figure 7).
Figure 7. Dissection process of 3rd instar larva. Step 1: Put the larva on the Petri dish; Step 2: Use insect pins to secure the larva; Step 3: Open the body from bottom to top; Step 4: Secure the open cuticle with another 4 insect pins; Step 5: Remove the organs. Scale bar ≈ 0.25 mm.
Wash the remaining larva carcass 1 x with Schneider’s Drosophila medium.
The remaining steps are identical to the adult protocol.
Data analysis
Use Freehand selection of ImageJ to carefully select the same area of all tissue samples.
Cardiac myofibrillar density, cardioblast cell numbers, and Pericardin deposition are quantified.
Use PAST.exe to perform statistical analysis. Sample error is presented as standard error of the mean (SEM). First test results for normality using the Shapiro-Wilk test (a = 0.05). Analyze normally distributed data by Student’s t-test (two groups) and Bonferroni comparison to adjust P value, or by a one-way analysis of variance followed by a Tukey-Kramer post-test for comparing multiple groups. Analyze non-normally distributed data by either a Mann-Whitney test (two groups) and Bonferroni comparison to adjust the P value, or a Kruskal-Wallis H-test followed by a Dunn’s test for comparisons between multiple groups. Statistical significance is defined as P < 0.05.
Notes
All samples are imaged 1x only to avoid bleaching. All samples are imaged the same day at the same light intensity and exposure time.
No ventral muscle layer is present at 3rd instar larval stage.
Acknowledgments
Z.H. was supported by grants from the National Institutes of Health (RO1-HL090801, RO1-NK098410).
References
Bier, E. and Bodmer, R. (2004). Drosophila, an emerging model for cardiac disease. Gene 342(1): 1-11.
Brent, J. R., Werner, K. M. and McCabe, B. D. (2009). Drosophila larval NMJ dissection. J Vis Exp 24: 1107.
Cagan, R. L. (2011). The Drosophila nephrocyte. Curr Opin Nephrol Hypertens 20(4): 409-415.
Diop, S. B. and Bodmer, R. (2015). Gaining insights into diabetic cardiomyopathy from Drosophila. Trends Endocrinol Metab 26(11): 618-627.
Na, J., Sweetwyne, M. T., Park, A. S., Susztak, K. and Cagan, R. L. (2015). Diet-induced podocyte dysfunction in Drosophila and mammals. Cell Rep 12(4): 636-647.
Olson, E. N. (2006). Gene regulatory networks in the evolution and development of the heart. Science 313(5795): 1922-1927.
Owusu-Ansah, E. and Perrimon, N. (2014). Modeling metabolic homeostasis and nutrient sensing in Drosophila: implications for aging and metabolic diseases. Dis Model Mech 7(3): 343-350.
Reiter, L. T., Potocki, L., Chien, S., Gribskov, M. and Bier, E. (2001). A systematic analysis of human disease-associated gene sequences in Drosophila melanogaster. Genome Res 11(6): 1114-1125.
Vogler, G. and Ocorr, K. (2009). Visualizing the beating heart in Drosophila. J Vis Exp (31).
Yi, P., Han, Z., Li, X. and Olson, E. N. (2006). The mevalonate pathway controls heart formation in Drosophila by isoprenylation of Gγ1. Science 313(5791): 1301-1303.
Zhang, F., Zhao, Y., Chao, Y., Muir, K. and Han, Z. (2013). Cubilin and amnionless mediate protein reabsorption in Drosophila nephrocytes. J Am Soc Nephrol 24(2): 209-216.
Zhu, J. Y., Fu, Y., Nettleton, M., Richman, A. and Han, Z. (2017). High throughput in vivo functional validation of candidate congenital heart disease genes in Drosophila. Elife 6.
Copyright: Zhu et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Zhu, J., Fu, Y., Richman, A. and Han, Z. (2017). Validating Candidate Congenital Heart Disease Genes in Drosophila. Bio-protocol 7(12): e2350. DOI: 10.21769/BioProtoc.2350.
Zhu, J. Y., Fu, Y., Nettleton, M., Richman, A. and Han, Z. (2017). High throughput in vivo functional validation of candidate congenital heart disease genes in Drosophila. Elife 6.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Ageing
Systems Biology > Genomics > Functional genomics
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,351 | https://bio-protocol.org/exchange/protocoldetail?id=2351&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Soft Agar Colony Formation Assay as a Hallmark of Carcinogenesis
FD Feng Du
XZ Xiaodi Zhao
DF Daiming Fan
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2351 Views: 28829
Edited by: Antoine de Morree
Reviewed by: Vanesa Olivares-IllanaXiaoyi Zheng
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Soft agar colony formation assay is established to estimate the anchorage-independent growth ability of cells. In this assay, a bottom layer of agar with complete media is poured and solidified first, followed by an upper layer containing a specified number of cells suspended in medium-agar mixture. After two weeks of incubation, the number of colonies will be counted, serving as an indicator of malignancy of tumor cells.
Keywords: Anchorage-independent growth Colony formation Carcinogenesis Malignant phenotype Agar
Background
Anchorage-independent growth is an ability of cells to grow independently on a solid surface, and is considered as a hallmark of carcinogenesis (de Larco and Todaro, 1978). Soft agar colony formation assay is a well-established method to evaluate cellular anchorage-independent growth for the detection of the tumorigenic potential of malignant cells (Roberts et al., 1985), which is developed from plate colony formation assay described by Puck et al. in 1956 where cells were seeded on to a culture plate to assay the ability of cells to form colonies (Puck et al., 1956). The limitation of plate colony formation assay is that it only displays cellular abilities for anchorage-dependent growth, by which normal cells can escape from anoikis (a form of programmed cell death that occurs in anchorage-dependent cells when they detach from the surrounding extracellular matrix) and survive (Taddei et al., 2012). In contrast, malignant cells are capable of proliferating and growing without attachment to a substrate. Therefore, soft agar colony formation assay is developed to characterize this ability in vitro (Hamburger and Salmon, 1977; Yuan et al., 2017). The soft agar colony formation assay has been widely adapted for researches on cell differentiation, transformation and tumorigenesis as well as the efficacy evaluation of anti-tumor treatment.
Materials and Reagents
Cell culture disc (75-cm2) (Corning, catalog number: 430641 )
Cell culture plate (12-well) (Corning, Costar®, catalog number: 3513 )
Falcon 15 ml conical centrifuge tubes (Corning, catalog number: 430791 )
Counting slides (Bio-Rad Laboratories, catalog number: 1450011 )
0.1-20 ml volume pipette tips (Eppendorf, catalog number: 22492012 )
5-200 ml volume pipette tips (Eppendorf, catalog number: 22492039 )
50-1,000 ml volume pipette tips (Eppendorf, catalog number: 22492055 )
Human SGC7901 cell line (Cell Resource Center of the Chinese Academy of Sciences, catalog number: CC-Y1456 )
Phosphate buffered saline (PBS) pH 7.4 (Thermo Fisher Scientific, GibcoTM, catalog number: C10010500BT )
Trypsin-EDTA (0.25%) (Thermo Fisher Scientific, GibcoTM, catalog number: 25200072 )
RPMI 1640 medium (Thermo Fisher Scientific, GibcoTM, catalog number: C11875500BT )
Fetal bovine serum (Thermo Fisher Scientific, GibcoTM, catalog number: 10099141 )
Penicillin-streptomycin (5,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15070063 )
L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Agar (Biowest, catalog number: 111860 )
Complete 1640 medium (see Recipes)
5% agar solution (see Recipes)
Equipment
2-20 μl pipettes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4641060N )
20-200 μl pipettes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4641080N )
100-1,000 μl pipettes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4641100N )
Clean bench (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraguardTM ECO )
Autoclave (TOMY DIGITAL BIOLOGY, model: SX-500 )
Water-Jacketed CO2 incubators (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Series II 3110 , catalog number: 3131)
Thermostat water bath (Prima Technology, model: YB12 )
Centrifuge (Eppendorf, model: 5424 R )
Automated cell counter (Bio-Rad Laboratories, model: TC20TM )
Advanced microscopy group microscope (Thermo Fisher Scientific, model: EVOS )
Gel count colony counter (Oxford optronix, model: GelCountTM )
Software
Statistical Program for Social Sciences 17.0 software (SPSS)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Du, F., Zhao, X. and Fan, D. (2017). Soft Agar Colony Formation Assay as a Hallmark of Carcinogenesis. Bio-protocol 7(12): e2351. DOI: 10.21769/BioProtoc.2351.
Zhao, X. D., Lu, Y. Y., Guo, H., Xie, H. H., He, L. J., Shen, G. F., Zhou, J. F., Li, T., Hu, S. J., Zhou, L., Han, Y. N., Liang, S. L., Wang, X., Wu, K. C., Shi, Y. Q., Nie, Y. Z. and Fan, D. M. (2015). MicroRNA-7/NF-kappaB signaling regulatory feedback circuit regulates gastric carcinogenesis. J Cell Biol 210(4): 613-627.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell-based analysis > Colony formation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,352 | https://bio-protocol.org/exchange/protocoldetail?id=2352&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DNA-free Genome Editing of Chlamydomonas reinhardtii Using CRISPR and Subsequent Mutant Analysis
JY Jihyeon Yu*
KB Kwangryul Baek*
EJ EonSeon Jin
Sangsu Bae
*Contributed equally to this work
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2352 Views: 14361
Reviewed by: Vinay PanwarKaisa Kajala
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
We successfully introduced targeted knock-out of gene of interest in Chlamydomonas reinhardtii by using DNA-free CRISPR. In this protocol, the detailed procedures of an entire workflow cover from the initial target selection of CRISPR to the mutant analysis using next generation sequencing (NGS) technology. Furthermore, we introduce a web-based set of tools, named CRISPR RGEN tools (http://www.rgenome.net/), which provides all required tools from CRISPR target design to NGS data analysis.
Keywords: Genome editing CRISPR-Cas9 Microalgae Ribonucleoproteins Chlamydomonas reinhardtii DNA-free transformation
Background
We recently reported (Baek et al., 2016) a one-step transformation of the model green microalga Chlamydomonas reinhardtii (Harris, 2001) using preassembled Cas9 protein-guide RNA ribonucleoproteins (RNPs). The manner of DNA-free CRISPR-Cas9 delivery has several advantages such as no need for codon optimization and specific promoters in different species of microalgae. Furthermore, it reduces off-target effects and may also be less cytotoxic in cells because the Cas9 protein is transiently active and then degraded by endogenous proteases in cells (Kim et al., 2014). In addition, the resulting gene-edited microalgae could be exempt from genetically modified organism (GMO) regulations due to the absence of foreign DNA sequences. In this protocol, the detailed procedures of an entire workflow are contained from the initial target selection of CRISPR to the mutant analysis using NGS technology (Bae et al., 2014a and 2014b; Park et al., 2015 and 2017).
Materials and Reagents
Cas9 protein purification
1.5 ml Eppendorf tubes
Sterile 50 ml conical tubes
10 ml syringe
0.45 μm syringe filter
Protein concentrator–100K MWCO (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88533 )
Poly-Prep Chromatography columns (Bio-Rad Laboratories, catalog number: 7311550 )
BL21-Pro cells
pET28 plasmid containing 6xHis-SpCas9 (Addgene)
Kanamycin
Lysozyme
PMSF
Ni-NTA agarose beads (QIAGEN, catalog number: 30210 )
Bradford reagent (Bio-Rad Laboratories, catalog number: 5000205 )
Bovine serum albumin (BSA)
Sodium chloride (NaCl)
Tryptone
Yeast extract
IPTG
Sodium phosphate monobasic (NaH2PO4)
Imidazole
Sodium hydroxide (NaOH)
HEPES
Ethylenediaminetetraacetic acid (EDTA)
DL-dithiothreitol (DTT)
Sucrose
Glycerol
LB medium (see Recipes)
1 M IPTG stock (see Recipes)
Lysis buffer (see Recipes)
Wash buffer (see Recipes)
Elution buffer (see Recipes)
Cas9 storage buffer (see Recipes)
In vitro transcription and library PCR
1.5 ml Eppendorf tubes
Forward and reverse oligos (see Tables 1 and 2)
Table 1. Pre-index primers
Pre-index forward primer
5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT gDNA target-3’
Pre-index reverse primer
5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT gDNA target-3’
Table 2. Index primer sequences
index sequence [i5]
Index forward primer sequence
D501
tatagcct
AATGATACGGCGACCACCGAGATCTACACtatagcctACACTCTTTCCCTACACGAC
D502
atagaggc
AATGATACGGCGACCACCGAGATCTACACatagaggcACACTCTTTCCCTACACGAC
D503
cctatcct
AATGATACGGCGACCACCGAGATCTACACcctatcctACACTCTTTCCCTACACGAC
D504
ggctctga
AATGATACGGCGACCACCGAGATCTACACggctctgaACACTCTTTCCCTACACGAC
D505
aggcgaag
AATGATACGGCGACCACCGAGATCTACACaggcgaagACACTCTTTCCCTACACGAC
D506
taatctta
AATGATACGGCGACCACCGAGATCTACACtaatcttaACACTCTTTCCCTACACGAC
D507
caggacgt
AATGATACGGCGACCACCGAGATCTACACcaggacgtACACTCTTTCCCTACACGAC
D508
gtactgac
AATGATACGGCGACCACCGAGATCTACACgtactgacACACTCTTTCCCTACACGAC
index sequence [i7]
Index reverse primer sequence
D701
cgagtaat
CAAGCAGAAGACGGCATACGAGATcgagtaatGTGACTGGAGTTCAGACGTGT
D702
tctccgga
CAAGCAGAAGACGGCATACGAGATtctccggaGTGACTGGAGTTCAGACGTGT
D703
aatgagcg
CAAGCAGAAGACGGCATACGAGATaatgagcgGTGACTGGAGTTCAGACGTGT
D704
ggaatctc
CAAGCAGAAGACGGCATACGAGATggaatctcGTGACTGGAGTTCAGACGTGT
D705
ttctgaat
CAAGCAGAAGACGGCATACGAGATttctgaatGTGACTGGAGTTCAGACGTGT
D706
acgaattc
CAAGCAGAAGACGGCATACGAGATacgaattcGTGACTGGAGTTCAGACGTGT
D707
agcttcag
CAAGCAGAAGACGGCATACGAGATagcttcagGTGACTGGAGTTCAGACGTGT
D708
gcgcatta
CAAGCAGAAGACGGCATACGAGATgcgcattaGTGACTGGAGTTCAGACGTGT
D709
catagccg
CAAGCAGAAGACGGCATACGAGATcatagccgGTGACTGGAGTTCAGACGTGT
D710
ttcgcgga
CAAGCAGAAGACGGCATACGAGATttcgcggaGTGACTGGAGTTCAGACGTGT
D711
gcgcgaga
CAAGCAGAAGACGGCATACGAGATgcgcgagaGTGACTGGAGTTCAGACGTGT
D712
ctatcgct
CAAGCAGAAGACGGCATACGAGATctatcgctGTGACTGGAGTTCAGACGTGT
dNTP mix
Phusion DNA polymerase (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: F530L )
PCR purification kit
ATP, CTP, GTP, UTP, 100 mM MgCl2, DEPC-treated water
T7 RNA polymerase (New England Biolabs, catalog number: M0251L )
DNase I (RNase-free) (New England Biolabs, catalog number: M0303L )
RNase inhibitor murine (New England Biolabs, catalog number: M0314L )
RNeasy MinElute Cleanup Kit (QIAGEN, catalog number: 74204 )
Illumina Miseq Reagent Kit (v2)
Transfection
1.5 ml Eppendorf tubes
Sterile 15 ml and 50 ml conical tubes
Purified Cas9 protein and sgRNA
Chlamydomonas reinhardtii strains CC-4349 cw15 mt-(Chlamydomonas Resource Center)
PCR DNA purification kit (MG Med, catalog number: MD008 )
TAP medium (Harris, 1989 or Thermo Fisher Scientific, GibcoTM, catalog number: A1379801 )
TAP sucrose solution (see Recipes)
TAP agar plates (see Recipes)
Top agar (see Recipes)
Equipment
Cas9 protein purification
Centrifuge: swing rotor (LaboGene, model: 1580R )
Sonicators (Qsonica, model: Q125 )
Pipettes
Shaking incubator (JS Research, model: JSSI-300C )
In vitro transcription and library PCR
Incubator (JS Research, model: JSGI-050T )
Thermal cycler (Bio-Rad Laboratories, model: C1000 TouchTM Thermal Cycler )
Micro centrifuge (LaboGene, model: 1730R )
Spectrophotometer
Transfection
100 ml flask
Spectrophotometer (GE Healthcare, Amersham Biosciences, model: Ultrospec 2100 pro )
Hemocytometer (Marienfeld-Superior, catalog number : 0650030 )
Microscope (Olympus, model: CH30 )
Micro high speed centrifuge (Hanil, model: MICRO 17TR )
Orbital shaker (N-biotek, model: NB-101M )
Clean bench (BioFree, model: BF-150BSC )
Electroporation device (Bio-Rad Laboratories, model: Gene Pulser XcellTM Electroporation Systems )
Electroporation cuvettes (Bio-Rad Laboratories, 0.4 cm gap)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yu, J., Baek, K., Jin, E. and Bae, S. (2017). DNA-free Genome Editing of Chlamydomonas reinhardtii Using CRISPR and Subsequent Mutant Analysis. Bio-protocol 7(11): e2352. DOI: 10.21769/BioProtoc.2352.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Electroporation
Cell Biology > Cell engineering > CRISPR-cas9
Plant Science > Plant molecular biology > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,353 | https://bio-protocol.org/exchange/protocoldetail?id=2353&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Purification of the Cas10-Csm Complex from Staphylococci
Lucy Chou-Zheng
Asma Hatoum-Aslan
Published: Vol 7, Iss 11, Jun 5, 2017
DOI: 10.21769/BioProtoc.2353 Views: 10494
Edited by: Daan C. Swarts
Reviewed by: Lionel SchiavolinLongping Victor Tse
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
CRISPR-Cas (Clustered regularly interspaced short palindromic repeats-CRISPR-associated proteins) is a class of prokaryotic immune systems that degrade foreign nucleic acids in a sequence-specific manner. These systems rely upon ribonucleoprotein complexes composed of Cas nucleases and small CRISPR RNAs (crRNAs). Staphylococcus epidermidis and Staphylococcus aureus are bacterial residents on human skin that are also leading causes of antibiotic resistant infections (Lowy, 1998; National Nosocomial Infections Surveillance, 2004; Otto, 2009). Many staphylococci possess Type III-A CRISPR-Cas systems (Marraffini and Sontheimer, 2008; Cao et al., 2016), which have been shown to prevent plasmid transfer and protect against viral predators (Goldberg et al., 2014; Hatoum-Aslan et al., 2014; Samai et al., 2015) in these organisms. Thus, gaining a mechanistic understanding of these systems in the native staphylococcal background can lead to important insights into the factors that impact the evolution and survival of these pathogens. Type III-A CRISPR-Cas systems encode a five-subunit effector complex called Cas10-Csm (Hatoum-Aslan et al., 2013). Here, we describe a protocol for the expression and purification of Cas10-Csm from its native S. epidermidis background or a heterologous S. aureus background. The method consists of a two-step purification protocol involving Ni2+-affinity chromatography and a DNA affinity biotin pull-down, which together yield a pure preparation of the Cas10-Csm complex. This approach has been used previously to analyze the effects of mutations on Cas10-Csm complex integrity (Hatoum-Aslan et al., 2014), crRNA formation (Hatoum-Aslan et al., 2013), and to detect binding partners that directly interact with the core Cas10-Csm complex (Walker et al., 2016). Importantly, this approach can be easily adapted for use in other Staphylococcus species to probe and understand their native Type III-A CRISPR-Cas systems.
Keywords: CRISPR-Cas Type III-A Cas10-Csm Staphylococci Protein purification Protein Expression DNA affinity chromatography Biotin pull-down
Background
Staphylococcus epidermidis and Staphylococcus aureus are prevalent skin-dwelling bacteria that have a range of opposing impacts. While S. aureus asymptomatically colonizes ~30% of the population (Conlan et al., 2012), this organism is a leading cause of skin and soft tissue infections (Stryjewski and Chambers, 2008; Grice and Segre, 2011). In contrast, S. epidermidis is generally considered beneficial, and promotes human health by 1) preventing S. aureus colonization (Iwase et al., 2010), 2) producing antimicrobial peptides that target skin pathogens (Cogen et al., 2010), and 3) stimulating the human immune system to facilitate pathogen defense (Lai et al., 2010; Naik et al., 2015). However, when allowed to breach the skin barrier, this species can also cause antibiotic resistant infections, particularly on indwelling medical devices (Otto, 2009; Harris and Richards, 2006). Furthermore, pathogenic staphylococci that are resistant to all known antibiotics have recently emerged in both hospital and community settings (Furuya and Lowy, 2006) and have become a major threat to global public health. Horizontal gene transfer (HGT), or the exchange of genetic information between related bacterial species, is a major route by which these organisms acquire virulence factors and multi-drug resistance. Therefore, it is of utmost importance to understand the factors that impact and regulate HGT in these organisms.
CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR associated proteins) is a class of bacterial immune systems that degrade invading nucleic acids and prevent all modes of HGT (Marraffini, 2015). CRISPR loci consist of short sequences derived from past invaders, known as spacers, which are integrated between repeat sequences of similar length (~30-40 nucleotides). These repeat-spacer arrays encode small CRISPR RNAs (crRNAs) that associate with Cas proteins, forming a ribonucleoprotein complex that destroys foreign DNA and/or RNA in a sequence-dependent manner. Many staphylococci possess Type III-A CRISPR-Cas systems (Marraffini and Sontheimer, 2008; Golding et al., 2012; Cao et al., 2016). The Type III-A system in S. epidermidis RP62a, a wild-type human isolate (Christensen et al., 1987), encodes a multi-subunit complex called Cas10-Csm, composed of Cas10, Csm2, Csm3, Csm4, Csm5 and a crRNA (Hatoum-Aslan et al., 2013). This system has been shown to prevent the conjugative transfer of antibiotic resistance genes (Marraffini and Sontheimer, 2008; Hatoum-Aslan et al., 2014) and phage infection (Goldberg et al., 2014; Maniv et al., 2016), thus providing a natural barrier for HGT, and a model for Type III CRISPR-Cas systems in staphylococci.
The overexpression and purification of recombinant CRISPR-associated proteins from Escherichia coli (both the Cas10-Csm complex and individual subunits) followed by in vitro biochemical assays have revealed important insights into their functions (Hatoum-Aslan et al., 2013; Samai et al., 2015; Walker et al., 2016). However, such assays fail to 1) recover information about protein function and stability in the native cellular environment, and 2) identify biologically relevant binding partners that are not a part of the core Cas10-Csm complex. Indeed, purification of Cas10-Csm from its native S. epidermidis background has yielded additional insights into the genetic requirements for complex stability and function, crRNA processing, and non-Cas binding partners that might play a role in the CRISPR-Cas pathway (Hatoum-Aslan et al., 2013 and 2014; Walker et al., 2016). Here, we provide a detailed protocol for the purification of Cas10-Csm from S. epidermidis or S. aureus strains bearing the Type III-A CRISPR-Cas system on a plasmid. The protocol involves two affinity-purification steps that can be carried out over the course of five days (Figure 1). Importantly, this protocol can be easily adapted to study Cas10-Csm complexes in other Staphylococcus species, thus providing an essential tool to probe and understand these important immune systems.
Figure 1. Timeline of activities for expression and purification of the Cas10-Csm complex from staphylococci
Materials and Reagents
Note: Equivalent materials and reagents may be used as substitutes.
Centrifuge tubes (50 ml) (VWR, catalog number: 21008-242 )
Pipet tips with filter (0.1-10 µl) (VWR, catalog number: 89368-972 )
Pipet tips with filter (1-200 µl) (VWR, catalog number: 89003-056 )
Pipet tips with filter (100-1,000 µl) (VWR, catalog number: 89003-060 )
PES membrane vacuum filter (0.22 µm) (VWR, catalog number: 10040-468 )
Centrifuge tubes (15 ml) (VWR, catalog number: 21008-216 )
Microcentrifuge tubes (VWR, catalog number: 87003-294 )
Cellulose syringe filter (0.22 µm) (VWR, catalog number: 28145-477 )
Petri dishes (100 x 15 mm) (VWR, catalog number: 25384-088 )
Spectrophotometer cuvettes (VWR, catalog number: 97000-586 )
Syringe (10 ml) (BD, catalog number: 309604 )
Syringe (3 ml) (BD, catalog number: 309657 )
Centrifugation polypropylene bottles (400 ml) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 75007585 )
Disposable gravity flow columns for protein purification (Geno Technology, G-Biosciences, catalog number: 786-169 )
S. epidermidis LM1680 expressing pcrispr/Csm26HN (Hatoum-Aslan et al., 2013) (see Note 1)
S. aureus RN4220 expressing pcrispr/Csm26HN (Hatoum-Aslan et al., 2013) (see Note 1)
HisPur Ni-NTA resin (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88222 )
Sera-MagTM magnetic streptavidin coated beads (GE Healthcare, catalog number: 30152105011150 )
SDS PAGE Gel 0.75 MM ‘Snap-A-GelsTM Mini Tris Glycine Precast Gels, Jule’ (VWR, catalog number: 66025-389 )
Color protein standard ladder (New England Biolabs, catalog number: P7712S )
BBLTM brain heart infusion (BHI) broth (BD, BBLTM, catalog number: 211060 )
DifcoTM brain heart infusion (BHI) agar (BD, DifcoTM, catalog number: 241810 )
Chloramphenicol (Alfa Aesar, catalog number: B20841 )
100% ethanol (Decon Labs, catalog number: V1016TP )
Neomycin sulfate (AMRESCO, catalog number: 0558-25G )
Magnesium chloride (MgCl2) (AMRESCO, catalog number: J364 )
Tris (AMRESCO, catalog number: 0497 )
Hydrochloric acid (HCl) (VWR, BDH®, catalog number: BDH3030-2.5LPC )
Potassium chloride (KCl) (VWR, BDH®, catalog number: BDH9258-500G )
EDTA, disodium salt, dihydrate (EMD Millipore, OmniPur®, catalog number: 4050 )
Sodium hydroxide (NaOH) (AMRESCO, catalog number: 0583 )
Sodium dodecyl sulfate (SDS) (VWR, catalog number: 97064-862 )
Bromophenol blue (VWR, catalog number: 97061-690 )
Ambicin® L (Recombinant lysostaphin) (AMBI, catalog number: LSPN-50 )
Sodium acetate anhydrous (NaOAc) (AMRESCO, catalog number: 0602 )
Sodium phosphate monobasic (NaH2PO4) (AMRESCO, catalog number: 0571 )
Sodium chloride (NaCl) (VWR, BDH®, catalog number: BDH9286 )
Glycerol (AMRESCO, catalog number: M152 )
Beta-mercaptoethanol (β-ME) (Geno Technology, G-Biosciences, catalog number: BC98 )
Coomassie Blue G-250 (AMRESCO, catalog number: M140-10G )
Methanol (VWR, BDH®, catalog number: BDH20864.400 )
Acetic acid (HAc) (VWR, BDH®, catalog number: BDH3096-2.5LPC )
Tris-glycine-SDS 10x buffer (AMRESCO, catalog number: 0783-5L )
Imidazole (Alfa Aesar, catalog number: A10221 )
Pierce protease and phosphatase inhibitor mini tablets, EDTA-free (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88669 )
Triton X-100 surfactant (EMD Millipore, catalog number: TX1568 )
Potassium hydroxide (KOH) (Alfa Aesar, catalog number: 13451 )
Media and antibiotics (see Recipes)
Brain heart infusion (BHI) broth
Chloramphenicol stock (10 mg/ml)
Neomycin stock (15 mg/ml)
Stock solutions (see Recipes)
1 M MgCl2
1 M Tris-HCl, pH 8.3
1 M Tris-HCl, pH 6.8
1 M KCl
500 mM EDTA, pH 8.0
10% sodium dodecyl sulfate (SDS)
1% bromophenol blue
2 mg/ml recombinant lysostaphin
2x lysis buffer
5x annealing buffer
5x protein loading buffer
Coomassie Blue staining solution
Destaining solution
1x Tris-glycine buffer
Buffers to prepare on Day 4 for purification–Part 1 (see Recipes)
Elution buffer
Resuspension buffer
Equilibration buffer
Wash 1 buffer
Wash 2 buffer
Equipment
Eppendorf Research® plus pipettes set (Eppendorf, catalog number: 2231000222 ), or equivalent pipettes set with a range of 1 μl to 1,000 μl
Media/storage bottles (250 ml) (VWR, catalog number: 10754-816 ), or equivalent
Erlenmeyer flask (2 L) (VWR, catalog number: 10545-844 ), or equivalent
Standard orbital shaker (VWR, model: 1000, catalog number: 89032-088 ), or equivalent shaker that can gently rotate for gel staining and destaining
New Brunswick I26 incubating shakers (Eppendorf, New BrunswickTM, model: I26 , catalog number: M1324-0008), or equivalent shaking incubator that can maintain 37 °C and 180 rpm
Heraeus Multifuge X1R centrifuge series (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM MultifugeTM X1R , catalog number: 75004251), or equivalent refrigerated centrifuge with a rotor capable of holding 400 ml bottles and applying 13,000 x g of centrifugal force
General purpose water baths (VWR, model: VWR General Purpose Water Baths, catalog number: 89501-460 ), or equivalent capable of maintaining 37 °C
Sonifier® S-450 Analog sonicator (Emerson, Branson, model: S-450 , catalog number: 101-063-198), or equivalent ultrasonic homogenizer with operating frequency of 20 kHz and tip diameter of 3.2 mm
30 ml beaker (Corning, PYREX®, catalog number: 1000-30 ) or equivalent
Digital dry block heaters (VWR, catalog number: 12621-088 ), or equivalent block heater capable of heating up to 95 °C
Magnetic bead separation rack (Thermo Scientific, catalog number: MR02 ), or equivalent rack capable of collecting magnetic beads
Autoclave (Getinge), or equivalent autoclaving instrument capable of heating up to 121 °C while applying 15 atm pressure
Graduated cylinder (100 ml) (VWR, catalog number: 65000-006 ), or equivalent
Graduated cylinder (1 L) (VWR, catalog number: 65000-012 ), or equivalent
Media/storage bottles (1 L) (VWR, catalog number: 10754-820 ), or equivalent
Media/storage bottles (100 ml) (VWR, catalog number: 10754-814 ), or equivalent
Media/storage bottles (500 ml) (VWR, catalog number: 10754-818 ), or equivalent
UltrospecTM 10 cell density meter (GE Healthcare, catalog number: 80-2116-30 ), or equivalent spectrophotometer that can measure the density of cells in suspension at 600 nm
Mini-PROTEAN tetra cell (Bio-Rad Laboratories, model: Mini-PROTEAN Tetra Cell, catalog number: 1658004EDU ), or equivalent vertical electrophoresis system
pH meter AccumetTM AB15 plus basic (Fisher Scientific, model: Fisher ScientificTM accumetTM AB15+ Basic and BioBasicTM, catalog number: 13-636-AB15P ), or equivalent pH meter with a range of 0.000-10.000
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chou-Zheng, L. and Hatoum-Aslan, A. (2017). Expression and Purification of the Cas10-Csm Complex from Staphylococci. Bio-protocol 7(11): e2353. DOI: 10.21769/BioProtoc.2353.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Molecular Biology > Protein > Expression
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,354 | https://bio-protocol.org/exchange/protocoldetail?id=2354&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Tagged Highly Degenerate Primer (THDP)-PCR for Community Analysis of Methane- and Ammonia-oxidizing Bacteria Based on Copper-containing Membrane-bound Monooxygenases (CuMMO)
JW Jian-Gong Wang
FX Fei Xia
JZ Jemaneh Zeleke
BZ Bin Zou
Zhe-Xue Quan
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2354 Views: 7831
Edited by: Dennis Nürnberg
Reviewed by: Palash Kanti Dutta
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
We describe a two-step PCR strategy using tagged highly degenerate primer (THDP-PCR) targeting copper-containing membrane-bound monooxygenases (CuMMO) genes for community analysis of methane- or ammonia-oxidizing bacteria. This strategy consists of a primary CuMMO gene-specific PCR followed by a secondary PCR with a tag as a single primer. This strategy remarkably increases the divergence of CuMMO gene amplicons while maintaining PCR efficiency without obvious amplification bias. This THDP-PCR strategy can be extended to other functional gene-based community analysis with design of new highly degenerate primer covering target functional gene sequences.
Keywords: Tagged highly degenerate primer Two-step PCR CuMMO
Background
Gene types in CuMMO superfamily are divergent and existent primer sets can only cover some CuMMO types (Tuomivirta et al., 2009). To cover the divergent types of genes in the CuMMO superfamily, highly degenerate primers are inevitable, but previous strategies using highly degenerate primers have limitations when applied to environmental samples, like low PCR efficiency or non-specific amplification (Ledeker and De Long, 2013). We recently used a two-step PCR strategy with tagged highly degenerate primers, designated THDP-PCR, to amplify a wide range of genes in the CuMMO family with satisfactory PCR efficiency and no obvious amplification bias (Wang et al., 2017).
Materials and Reagents
Pipette tips (20 μl, 200 μl, 1,000 μl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 3521-HR , 3551-HR , 3101-05-HR )
1.5 ml Eppendorf tubes (Eppendorf, catalog number: T9661-1000EA )
Strip PCR tubes and caps (Roche Diagnostics, catalog number: 1667009001 )
PowerSoilTM DNA Isolation Kit (Mo Bio Laboratories, catalog number: 12888-100 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
Premix Taq (Takara Bio, catalog number: R004A )
dNTP mixture
Tris-HCl (pH 8.3)
Potassium chloride (KCl)
Magnesium chloride (MgCl2)
AxyPrepTM PCR Cleanup Kit (Corning, Axygen®, catalog number: AP-PCR-250 )
Primers
Equipment
Pipettes (0-10 μl, 10-100 μl, 100-1,000 μl) (Eppendorf, catalog numbers: k03030 , k03031 , k03032 )
Vortex-genieTM 2 (Mo Bio Laboratories, model: Vortex-Genie® 2 )
PICO 17 centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM PicoTM 17 )
Automated thermal cycler TP600 (Takara Bio, model: TP600 )
Software
Mothur (www.mothur.org)
BLAST+ (ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/)
Megan5 (http://ab.inf.uni-tuebingen.de/software/megan5/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, J., Xia, F., Zeleke, J., Zou, B. and Quan, Z. (2017). Tagged Highly Degenerate Primer (THDP)-PCR for Community Analysis of Methane- and Ammonia-oxidizing Bacteria Based on Copper-containing Membrane-bound Monooxygenases (CuMMO). Bio-protocol 7(12): e2354. DOI: 10.21769/BioProtoc.2354.
Download Citation in RIS Format
Category
Microbiology > Community analysis > THDP-PCR
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,355 | https://bio-protocol.org/exchange/protocoldetail?id=2355&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of 3D Cellular Organization of Fixed Plant Tissues Using a User-guided Platform for Image Segmentation
ES Ethel Mendocilla Sato
CB Célia Baroux
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2355 Views: 10977
Reviewed by: Carsten Ade
Original Research Article:
The authors used this protocol in Jun 2008
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2008
Abstract
The advent of non-invasive, high-resolution microscopy imaging techniques and computational pipelines for high-throughput image processing has contributed to gain insights in plant organ morphogenesis at the cellular level. Confocal scanning laser microscopy (CSLM) allows the generation of three dimensional images constituted of serial optical sections reporting on stained subcellular structures. Fluorescent labels of cell walls or cell membranes, either chemically or through reporter proteins, are particularly useful for the analyses of tissue organization and cellular shapes in 3D. Image segmentation based on cell boundary signals is used as an input to generate 3D-segments representing cells. These digitalized, 3D objects provide quantitative data on cell shape, size, geometry, position or on (intercellular) intensity signals if additional reporters are used. Herein, we report a detailed, annotated workflow for image segmentation using microscopic data. We used it in the context of a study of tissue patterning during ovule primordium development in Arabidopsis thaliana. Whole carpels are stained for cell boundaries using a modified pseudo-Schiff propidium iodide (mPS-PI) protocol, 3D images are acquired at high resolution by CSLM, segmented and annotated for individual cell types using ImarisCell. This allows for quantitative analyses of cell shape and cell number that are relevant for tissue morphodynamic studies.
Keywords: High-resolution 3D imaging Plant tissues Image segmentation Morphodynamics Tissue patterning Arabidopsis Ovule primordium
Background
Organ and tissue morphodynamic studies in plants rely on the analysis of the three-dimensional process of growth along development progression. The evolution of cell number, cell size and cell shape allows interpreting events of proliferation, cellular expansion and anisotropy, respectively (Roeder et al., 2011; Barbier de Reuille et al., 2015; Bassel and Smith, 2016; Coen and Rebocho, 2016). While time-lapse imaging appears in principle as the method of choice, it is not easily applicable to all plant organs, sometimes embedded in inaccessible structures, and image quality often compromise on robust quantitative analyses over a large number of samples and at the cellular level. A complementary, robust alternative is to stain and record three dimensional images of optically cleared tissue/organ at high-resolution, at consecutive time points in order to reconstruct a developmental progression. These 3D images can then be digitally segmented into individual cell objects, from which measurements of number, different descriptors of cell shape and cell size can be extracted. Whole-mount tissue clearing and staining of the cell wall using the modified pseudo-Schiff propidium iodide (mPS-PI) protocol (Truernit et al., 2008) is widely used in the plant community for 3D shape analyses (Sankar et al., 2014; Yoshida et al., 2014; Hervieux et al., 2016). It is described here with only minor modifications and specific notes enabling high-quality sample preparation for the delicate carpel structures. In addition, while plant tissue imaging using confocal scanning laser microscopy became common practice in many labs, specific knowledge on how to fine-tune the optical and software-controlled image recording remains elusive and often kept ‘in house’. Here we provide detailed recommendations aimed at guiding the user towards producing high-quality, high-resolution 3D images suitable for robust qualitative and quantitative analyses. For image segmentation, different open-source algorithms proved invaluable for tissue morphodynamic studies in plants and Drosophila, namely: MARS-ALT (Fernandez et al., 2010), MorphographX (Barbier de Reuille et al., 2015) and RACE (Stegmaier et al., 2016). Yet, these interfaces usually require computational skills to fine-tune segmentation parameters, correct manually for wrongly segmented objects, customize cell labelling when tissue models are not available in the software and export quantitative data for downstream analyses. An alternative solution for biologists lacking this expertise lies in the use of commercially available software with a streamlined user interface. We present here one option with Imaris, a software for 3D visualization and image processing. We report a detailed, annotated workflow applied to ovule tissue analyses but that is of broad application to analyze various plant tissues.
Materials and Reagents
Microscope slides (76 x 26 mm) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 10143562CEF )
Microscope cover slips for confocal imaging: 18 x 18 mm, 0.17 ± 0.01 mm thickness (Hecht Assistant, catalog number: 41014509 )
Dissecting needles (Tungsten, diameter: 0.75 and 0.35 mm)
Round Petri dishes 35 mm (Greiner Bio One International, catalog number: 627102 )
2 ml micro tubes (SARSTEDT, catalog number: 72.695.500 )
Dust-free paper
Glass wool
Plant material: Flowering Arabidopsis thaliana plants
Sodium dodecyl sulfate, sodium salt (SDS) (Sigma-Aldrich, catalog number: 71729 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 71690 )
Ethanol (70%, 80%) (Fisher Scientific, catalog number: 10428671 )
Periodic acid (Sigma-Aldrich, catalog number: 375810 )
Nail polish
Mounting medium
Methanol (Sigma-Aldrich, catalog number: 34860 )
Acetic acid (Merck, catalog number: 100063 )
Sodium metabisulphite (Na2S2O5) (Sigma-Aldrich, catalog number: 31448 )
Hydrochloric acid fuming, 37% (HCl) (Carl Roth, catalog number: 4625.1 )
Propidium iodide (PI) (Sigma-Aldrich, catalog number: P4864 )
Chloral hydrate (Sigma-Aldrich, catalog number: 15307 )
Glycerol (Carl Roth, catalog number: 3783.1 )
Gum arabic (Sigma-Aldrich, catalog number: 51198 )
Modified pseudo-Schiff propidium iodide (mPS-PI) solution (see Recipes)
Fixative solution
Pseudo-Schiff reagent with propidium iodide (PI)
Chloral hydrate solution
Hoyer’s solution
Equipment
Stereomicroscope (e.g., Leica Microsystems, model: Leica M60 )
Incubator (e.g., Eppendorf, model: Thermomixer® C )
Diamond- or carbide-tip pen (Sigma-Aldrich, catalog number: Z225568 )
Confocal scanning laser microscope, resonant scanner with laser line 561 nm and APO PL objectives lenses 20x (NA 0.7) and 63x (NA 1.4) suitable for glycerol immersion (e.g., Leica Microsystems, model: Leica TCS SP5 )
Computer ideally with high-end processor, memory and graphic environment as recommended (http://www.bitplane.com/systemrequirements.aspx). Lower-end settings are possible but will result in slower processing speed
Software
Imaris 8.3.1 (www.bitplane.com, Oxford Instruments, UK)
Data analysis software (e.g., R, www.r-project.org)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mendocilla Sato, E. and Baroux, C. (2017). Analysis of 3D Cellular Organization of Fixed Plant Tissues Using a User-guided Platform for Image Segmentation. Bio-protocol 7(12): e2355. DOI: 10.21769/BioProtoc.2355.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Confocal microscopy
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,356 | https://bio-protocol.org/exchange/protocoldetail?id=2356&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phototaxis Assay for Chlamydomonas reinhardtii
Noriko Ueki
Ken-ichi Wakabayashi
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2356 Views: 13514
Edited by: Maria Sinetova
Reviewed by: Agnieszka Zienkiewicz
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Phototaxis is a behavior in which organisms move toward or away from the light source (positive or negative phototaxis, respectively). It is crucial for phototrophic microorganisms to inhabit under proper light conditions for phototaxis. The unicellular green alga Chlamydomonas reinhardtii rapidly changes its swimming direction upon light illumination, and thus is a nice model organism for phototaxis research. Here we show two methods to assay Chlamydomonas phototaxis; one is a quick, easy and qualitative analysis, so-called the dish assay; and the other is a quantitative single-cell analysis.
Keywords: Phototaxis Green algae Flagella Channelrhodopsin Photoreception
Background
The unicellular green alga Chlamydomonas reinhardtii is used as a model organism in various research fields including phototaxis of microorganisms, photosynthesis, and ciliary/flagellar motility (Hegemann and Berthold, 2009). A Chlamydomonas cell perceives light at its eyespot, the photoreceptive organelle observed as an orange spot located near the cell equator. The eyespot contains the photoreceptor proteins channelrhodopsins localized in the cellular membrane and the carotenoid-rich granule layers right behind the channelrhodopsins which function as a light reflector. Because of their relative position, the eyespot undergoes highly directional photoreception, and the cell can accurately detect the direction of light illumination (Foster and Smyth, 1980; Ueki et al., 2016). Upon photoreception, two flagella change their beating balance, and the cell changes its swimming direction either toward or away from the light source.
The Chlamydomonas phototactic direction (or ‘sign’) is regulated by cellular reduction-oxidation state, which is affected by cellular metabolism such as photosynthetic and respiratory activities (Wakabayashi et al., 2011). The phototactic sign thus indirectly reflects those activities in vivo. For instance, a mutant showing fast phototactic response has been shown to have high photosynthetic activity (Kim et al., 2016). In addition, for the regulation of flagellar beating for phototactic turning of the cell, flagellar dyneins should be strictly regulated (Kamiya and Witman, 1984; Okita et al., 2005; Hegemann and Berthold, 2009). Therefore, phototaxis assay contributes to a wide variety of biological researches, such as photoreception, photosynthesis, respiration, and motor proteins.
Various methods have been developed to quantify Chlamydomonas phototaxis. Mergenhagen developed an automatic assay system for phototaxis (photoaccumulation), which detects the density of cells in the light path by a photocell (Mergenhagen, 1984). Takahashi et al. developed a computer-assisted system that automatically detects the direction of cellular movement using an infrared-sensitive video camera (Takahashi et al., 1991). Comparing to those sophisticated systems with hand-made equipment, our protocol is rather simple, and can be carried out with equipment that is commercially or freely available.
Materials and Reagents
50 ml tube (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339652 )
4 cm Petri dish (AS ONE, catalog number: 1-8549-01 )
Chlamydomonas strain of interest
Tris-acetate-phosphate medium
(Optional) Tertiary-butyl hydroperoxide (t-BOOH: final concentration, 0.2 mM) (WAKO Pure Chemical Industries, catalog number: 026-13451 )
(Optional) N,N’-dimethylthiourea (DMTU: final concentration, 75 mM) (Sigma-Aldrich, catalog number: D188700 )
HEPES (pH 7.4) (NACALAI TESQUE, catalog number: 17514-15 )
EGTA (DOJINDO, catalog number: 346-01312 )
Potassium chloride (KCl) (NACALAI TESQUE, catalog number: 28514-75 )
Calcium chloride dihydrate (CaCl2·2H2O) (NACALAI TESQUE, catalog number: 06731-05 )
Phototaxis assay solution (Okita et al., 2005) (see Recipes)
Equipment
Centrifuge (Hitachi Koki, model: CR20GIII )
Swing rotor (Hitachi Koki, model: R4SS )
Green light-emitting diode (LED) (λ = 525 nm) (OptoSupply, model: OSPG5111A-VW )
Red light (or white light with a red filter [λ > 600 nm])
White sheet of paper/plastic
Dark room or dark box
Digital still camera (SONY, model: RX100II )
Imaging table with camera mount (AS ONE, model: NS-CPS360N )
Inverted microscope equipped with video camera (Olympus, model: IX70 ; Wraymer, model: 1129HMN1/3)
Red filter (630 nm long-pass filter) (SCHOTT, model: RG630 )
(Optional) Photometer (Apogee Instrument, model: MQ-200 )
(Optional) Neutral density filters (HOYA, models: ND10AH and ND30AH )
Software
Image Hyper (Science Eye, Japan) or any particle-tracking software (e.g., ImageJ with MTrack2 plugin)
Microsoft Excel or any spreadsheet software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ueki, N. and Wakabayashi, K. (2017). Phototaxis Assay for Chlamydomonas reinhardtii. Bio-protocol 7(12): e2356. DOI: 10.21769/BioProtoc.2356.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Phenotyping
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,357 | https://bio-protocol.org/exchange/protocoldetail?id=2357&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Single-molecule RNA Fluorescence in situ Hybridization (smFISH) in Caenorhabditis elegans
CL ChangHwan Lee
HS Hannah S. Seidel
TL Tina R. Lynch
ES Erika B. Sorensen
SC Sarah L. Crittenden
JK Judith Kimble
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2357 Views: 16806
Edited by: Peichuan Zhang
Reviewed by: Prashanth SuravajhalaPia Giovannelli
Original Research Article:
The authors used this protocol in 15-Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
15-Oct 2016
Abstract
Single-molecule RNA fluorescence in situ hybridization (smFISH) is a technique to visualize individual RNA molecules using multiple fluorescently-labeled oligonucleotide probes specific to the target RNA (Raj et al., 2008; Lee et al., 2016a). We adapted this technique to visualize RNAs in the C. elegans whole adult worm or its germline, which enabled simultaneous recording of nascent transcripts at active transcription sites and mature mRNAs in the cytoplasm (Lee et al., 2013 and 2016b). Here we describe each step of the smFISH procedure, reagents, and microscope settings optimized for C. elegans extruded gonads.
Keywords: Active transcription site mRNA smFISH sygl-1 C. elegans Gonad
Background
smFISH enables direct and precise quantitation of mRNA in vivo. In addition, multiple RNA species can be scored simultaneously in the same cell by multiplexing smFISH probes. There have been previous publications using smFISH in C. elegans, but those studies used wide-field microscopy, which often has lower spatial resolution and requires additional image processing (e.g., image deconvolution) (Ji and van Oudenaarden, 2012). Here we describe an smFISH procedure optimized for the C. elegans germline tissue. Each step is detailed, including use of confocal microscopy to obtain precise measurements. Our protocol minimizes sample-to-sample variability and allows precise quantitation of mRNA and nascent transcripts.
Materials and Reagents
Gloves
RNase-free microcentrifuge tubes (1.5 ml) (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: AM12450 )
Microscope slide (Fisher Scientific, catalog number: 12-544-1 )
High-precision microscope cover glass (Marienfeld-Superior, catalog number: 0107052 ; can be ordered through Azer Scientific)
Note: Any cover glass compatible with the microscope used for smFISH can be used.
Kimwipes (KCWW, Kimberly-Clark, catalog number: 34155 )
Aluminum foil
Scalpel (Feather disposable scalpel #10) (Medex Supply, catalog number: GRF-2975#10 ) or needle (25 G) (BD, catalog number: 305125 )
RNase-free filtered tips (Mettler-Toledo, Rainin, catalog numbers: 17007957 , 17002927 and 17014361 for 20, 200 and 1,000 µl tips, respectively)
0.2 µm syringe filter (EMD Millipore, catalog number: SCGP00525 )
C. elegans. Some strains were provided by the CGC (http://www.cgc.cbs.umn.edu, which is funded by NIH Office of Research Infrastructure Programs [P40 OD010440])
smFISH probe(s) conjugated with fluorophores (LGC BioSearch Technologies, https://www.biosearchtech.com/), see below for probe storage and dilution
RNaseZap® (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9780 )
ProLong Gold Antifade Reagent Mountant (Thermo Fisher Scientific, InvitrogenTM, catalog number: P36930 )
Nail polish
RNase-free 1x PBS (Fisher Scientific, catalog number: BP24384 )
Tween-20 (Fisher Scientific, catalog number: BP337-100 )
Levamisole (or Tetramisole) (Sigma-Aldrich, catalog number: L9756-10G ); store at -20 °C
37% formaldehyde (AMRESCO, catalog number: 0493-500ML )
Triton X-100 (Fisher Scientific, catalog number: BP151-100 )
Ethanol (Acros Organics, catalog number: 615090010 )
Tris base (Fisher Scientific, catalog number: BP152-5 )
0.5 M EDTA, pH 8.0 (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9260G )
SSC (20x) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9763 )
Formamide, deionized (EMD Millipore, catalog number: 4610-100ML ); store at 4 °C; warm to room temperature prior to opening
DEPC water, sterile (EMD Millipore, catalog number: 9610-1L )
4’,6-Diamidino-2-Phenylindole, Dihydrochloride (DAPI) (Thermo Fisher Scientific, InvitrogenTM, catalog number: D1306 )
Dextran sulfate (VWR, catalog number: 97061-196 )
Glucose, nuclease free (Fisher Scientific, catalog number: D16-500 )
Tris, pH 8.0, nuclease free (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9855G )
Glucose oxidase (MP Biomedicals, catalog number: 0 2195196 ); store at 4 °C
Catalase (Fisher Scientific, catalog number: S25239A )
Trolox (Acros Organics, catalog number: 218940050 )
Sodium acetate (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9740 )
Tricaine (Sigma-Aldrich, catalog number: E10521-10G ); store at -20 °C
Vaseline
Lanolin
Paraffin
Fixation: nuclease-free (see Recipes)
1x PBS + 0.1% Tween-20 (PBSTw)
1x PBSTw + 0.25 mM levamisole
1x PBSTw + 3.7% formaldehyde
1x PBS + 0.1% Triton X-100
70% ethanol
Probe and hybridization: nuclease-free (see Recipes)
TE buffer
Formamide
smFISH wash buffer
smFISH wash buffer + DAPI
Hybridization buffer (HB)
Reagents for GLOX buffer/mounting medium: nuclease-free (see Recipes)
GLOX buffer, no enzymes
GLOX buffer + enzymes
10% glucose
Glucose oxidase, 3.7 mg/ml
Catalase
200 mM Trolox
VALAP
Equipment
Pipettors (e.g., Mettler-Toledo, Rainin, model: P10, P20, P200, P1000)
Glass Petri dish (e.g., diameter: 5 cm) or depression slide for dissecting worms
Rotator (e.g., BD, Clay Adams Nutator, model: 421105 )
Microcentrifuge at room temperature (Eppendorf, model: 5415 D )
37 °C incubator
Vortexer (e.g., Baxter, catalog number: S8223-1 )
Confocal microscope (Leica Microsystems, model: Leica TCS SP8 )
Procedure
Note: Figure 1 shows a flowchart of the protocol. All spins are at 400 x g (2,000 rpm) for 30 sec unless otherwise stated and buffer recipes are listed at the end.
Figure 1. Flowchart of the smFISH protocol for the C. elegans gonad
Probe preparation for use
smFISH probes can be designed and purchased through the Biosearch Technologies website (https://www.biosearchtech.com/). Choose fluorophores compatible with the microscopic system used for the experiments. For multiplexed probes, carefully choose probe-conjugated fluorophores to eliminate bleed-through between channels during image acquisition. To store smFISH probes, resuspend in 20 µl TE buffer (see Recipes) at pH 8.0 (final concentration of 250 µM) and store at -20 °C. This stock solution can be diluted to an appropriate dilution (e.g., 1:10-1:100) in TE buffer to make the working solution. Choose the dilution that works best for smFISH (e.g., the highest signal-to-noise ratio) and keep diluted probe solution at -20 °C in the dark. The frozen probe solution should be thawed at RT when used for smFISH. In our hands, multiple rounds of freezing-thawing did not affect the performance of smFISH. Do not boil the probes.
Day 1: Gonad dissections for smFISH
Wipe down bench top, gloves, and pipettors with RNaseZap®.
Pick worms from growth plates into glass Petri dish (or depression slide) with PBS with 0.1% Tween-20 (PBSTw) containing anesthesia (e.g., 0.25 mM levamisole [or tetramisole]). Alternatively, add 200-300 µl PBSTw with anesthesia to growth plate and pipet worms into Petri dish or depression slide. A larger volume (1-2 ml) of PBSTw can also be used for moving worms into Petri dish. In case of whole worm staining, skip steps B2-B3 and proceed to step B4.
Extrude gonads as quickly as possible (< 10 min including spin) directly in the Petri dish. Cut behind pharynx or at tail with a #10 scalpel or a needle (Figure 2) (Crittenden et al., 2017).
Pipet extruded gonads into a 1.5 ml microcentrifuge tube. Spin and remove supernatant.
Add 1 ml fix solution (final 3.7% formaldehyde v/v in 1x PBS + 0.1% Tween-20) and incubate for at least 15 min (up to 45 min) at room temperature (RT) on rocker.
Spin down the sample.
Wash 1 x in 1 ml PBSTw.
Incubate for 10 min in 1 ml 1x PBS + 0.1% Triton X-100 at RT to permeabilize.
Wash 2 x with 1 ml PBSTw.
Resuspend in 1 ml 70% EtOH and incubate at 4 °C for 16-18 h (overnight). The sample can be stored in 70% EtOH for up to one week.
Figure 2. Gonad extrusion. Cut the head (behind the pharynx) or tail of the worm (black dashed lines) using a scalpel or a needle to extrude gonads. Internal pressure of the worm causes gonads to extrude readily. Image: Maria Gallegos.
Day 2: Hybridization
Make wash buffer fresh, letting formamide come to RT before opening.
Bring hybridization buffer (HB) to RT before opening.
Thaw diluted probe, protecting from light.
Spin the extruded gonads prepared on Day 1, remove ethanol.
Add 1 ml wash buffer, equilibrate for 5 min at RT. Spin and remove as much buffer as possible.
Add 1 μl diluted probe to 100 μl HB per sample (final probe concentration of 0.025-0.5 µM) and gently flick the tube (see Day 2 hybridization notes).
Resuspend sample in HB with probe and mix well.
Incubate overnight at 37 °C, with rotation and protected from light.
Note: You can leave samples for up to 48 h at this step.
Day 3: Wash and mount samples (all at room temperature)
Add 1 ml smFISH wash buffer, invert to mix. Spin and remove buffer.
Note: If worms don’t pellet well due to HB viscosity, this spin may be done at 400-500 x g (2,200-2,400 rpm) for 1.5 min.
Wash with 1 ml wash buffer + 1 μg/ml DAPI for 30 min on rotator (protected from light).
Wash 2 x with 1 ml wash buffer.
Note: Either wash 5 min on the rotator or invert tube ~10 times before spinning down again.
Remove as much wash buffer as possible from fixed samples.
Resuspend gonads in the mounting media (e.g., ProLong Gold Antifade Mountant or GLOX buffer).
Let sit for 30 min to a few hours.
Pipet 12-15 µl onto a slide, cover with a 22 x 22 coverslip. Remove excess liquid.
Cure at least overnight and up to 4 days in the dark at room temp or 4 °C. The ProLong Gold user manual recommends a ‘curing’ process (~24 h at RT) for best performance. We have observed that the curing process does improve fluorescence signal.
Seal with nail polish for long term storage.
Data analysis
Representative smFISH image (Figure 3).
Figure 3. sygl-1 smFISH at the distal gonad. The sygl-1 gene is a direct target of Notch transcriptional activation. SYGL-1 protein is a critical regulator for germline stem cell (GSC) maintenance. Individual nascent transcripts (bright white nuclear spots; overlay of yellow and magenta channel, indicated by arrowheads) and cytoplasmic mRNA (magenta) of sygl-1 are visualized with spectrally distinct smFISH probes. DAPI marks DNA (blue). Maximum Z-projection is shown. Dashed line marks gonadal outline. Scale bar = 5 µm. Modified from Lee et al. (2016b).
Images taken using confocal microscopy do not require further image processing. However, images taken using wide-field (compound) microscopy must be deconvolved with carefully chosen image processing conditions (e.g., iterations). A caveat to the wide-field method is that over- or under-processed images can produce false-positive or false-negative signals. Using confocal images, the RNA spots can be systematically quantified with standard image processing (e.g., ImageJ) or published tools (e.g., MATLAB codes) (Mueller et al., 2013; Lee et al., 2016b). The wide-field microscope with a typical CCD camera (e.g., Hamamatsu C11440) generates microscopic images with the resolution high enough (pixel size: 0.1-0.2 µm) for identifying single RNA spots (Lee et al., 2016a). For confocal microscopy, we recommend using a pixel size similar to the size that works for wide-field microscopy (Abbaszadeh and Gavis, 2016; Lee et al., 2016b). As a first step of smFISH analysis, we quantify the size, shape (e.g., Gaussian distribution), signal intensities and subcellular location of detected RNA spots to validate singularity of detected RNA spots. In the Kimble lab, we consistently see nuclei containing one to four active transcription sites using intron-specific smFISH probes, with four matching the maximum number of loci of a gene (after DNA replication in S phase). The nascent RNAs are nuclear and colocalized to DAPI (or other DNA strain of choice). The mRNAs are cytoplasmic. Detected mRNA spots show tight signal distribution (C.V. < 0.5) in most RNA species, indicating that the detected spots are likely single RNA molecules (Lee et al., 2013 and 2016b). Control experiments such as detecting RNAs in the target gene knock-out background and using a different set of probes hybridizing the same target gene should be done to ensure the specificity of the probes to the target gene.
Notes
Day 1, probe design notes
We used the standard settings of smFISH probe designer (Biosearch Technologies), which spread the probes throughout the gene. We have not tested whether smFISH performance changes depending on the region the probes bind, but one prediction is that 5’ probes will better visualize earlier transcription events. RNA-seq data from consortiums (e.g., ModEncode) may provide information on the gene expression level before choosing the target gene. For the C. elegans germline, we use RNA-seq data (Ortiz et al., 2014 and Wormbase), in-situ hybridization data (NEXTDB) and qPCR to estimate the level of target gene expression.
Day 1, dissection notes
Periodically re-wipe gloves and pipettors with RNaseZap®. Use RNase-free filtered tips and RNase-free tubes; keep tip boxes closed when not in active use. Put 50-100 worms in the same tube for the entire protocol.
Day 2, hybridization notes
Minimize exposure to light during and after hybridization. Shield tube in your hand while changing buffers/tips, and wrap in foil for washes. To remove liquid from samples, use a P1000 pipettor because it can remove most liquid (within ~20 μl) without exposing tube to dissection scope light. The exceptions are before adding HB and before adding mounting media (look under the dissection scope [or check your tip before expelling liquid] and use a P1000, then a P200 and then a P10 to remove as much wash buffer as possible).
Probe dilution is an effective way to optimize and should be determined empirically for each probe set. Probe stocks (250 μM) are diluted in RNase-free TE buffer before adding to the HB and typical final concentrations in HB are 0.025-0.5 μM (usually 0.25 μM is the first concentration we try). More dilute = less background.
While samples are equilibrating in wash buffer, mix HB and probe in a separate RNase-free tube. It is recommended to use 50-100 μl HB + 1-3 µl probe per sample of fixed dissected worms.
Note: Adding HB and probe sequentially on top of fixed germlines can also work, but mix gently and thoroughly–no vortexing.
Day 3 notes
Washing and mounting notes
Note: With the Quasar 570 probe, either ProLong Gold Antifade or GLOX mounting media can be used. We saw essentially no difference in signal quality between the two media.
Using ProLong Gold Antifade Mountant (PLG, Life Technologies):
Slides and coverslips can be baked as an extra precaution against RNase contamination, or simply dedicate a box to smFISH.
Collect any gonads/PLG remaining in tube and add to drop of gonads/PLG on the slide. Or if there is a lot left, mount on a separate slide.
Remove bubbles from PLG droplet, being careful not to take gonads with them. Recommended methods include: popping with eyelash tool or flamed hot platinum wire, or aspirating gently with P10. Arrange worms inside drop quickly, using a pick to spread samples evenly.
Cover with a 22 x 22 mm square coverslip. Place in drawer or other dark areas, on flat surface, at RT to cure. Put gentle pressure on coverslip to remove excess liquid and flatten gonads.
Seal coverslip edges with nail polish. Stored in the dark at 4 °C, samples last for months.
Using GLOX buffer for sensitive fluorophores (e.g., Quasar 570 and Quasar 670)
Remove wash buffer, resuspend in 850 μl GLOX without enzymes. Let sit for 5 min (or place at 4 °C several hours until ready to image, as this method images each sample immediately after adding GLOX + enzymes).
Immediately before imaging, remove buffer and add 100 μl GLOX + enzymes.
Dissected gonads are extremely sticky; it is helpful to pipette up and down once in 1-10% Triton X-100 to coat the inside of the pipette.
Pipette 4 μl sample onto a 22 x 22 mm square coverslip.
Place a 12 x 12 mm square coverslip over sample drop. Lay a Kimwipe over the sample and press lightly on edges to remove excess liquid.
Invert coverslip ‘sandwich’ so that the 12 x 12 coverslip is face down and placed on microscope slide to create imaging chamber. Seal with VALAP, starting with corners and then sealing edges. Be very careful that VALAP seal is airtight.
Imaging notes
Note: In case of using multiple fluorophores, carefully select the dichroic mirrors (wide-field microscope) or acquisition wavelength range (confocal microscope) to avoid signal bleed-through. Use settings to minimize photobleaching for image analysis and single-molecule quantitation. We recommend acquiring images sequentially, channel by channel, starting from the excitation light with the longest wavelength for the best performance. Below are the general smFISH image acquisition settings used in the Kimble lab.
Microscope: Leica SP8 confocal
Objective: 63x 1.4
Zoom 300% to focus on distal ~60-70 µm of germline.
Frequency: 400 Hz
Laser power: between 1-5%, typically 3.5%
Gain: typically 40 for HyD detectors
8-16 line averaging, no accumulation
Pinhole: ~1 Airy unit. Match pinholes for exon and intron channels to improve colocalization. We have adjusted to between 1.0 and 1.5 to gather more light–typically, we stay below 1.25-1.3.
Bidirectional X: ON, phase = -32.40
Z-stack interval = 0.3 μm
Note: This way transcription sites are present in more than one slice and all mRNAs should be captured.
Identifying C. elegans gonads: The gonads are typically attached to the worm carcass but sometimes they fall off during the wash step. Both attached and detached gonads can be imaged for smFISH. The extruded gonad is an elongate light-colored tissue with hundreds of packed small cells. The extruded intestine, by contrast, is an elongate dark-colored tissue with only tens of large cells and is therefore morphologically different from the gonad. It is not necessary to isolate the gonads but the microscopic field can be adjusted so that only the region of interest within the gonad will be imaged.
Recipes
Fixation: nuclease-free
1x PBS + 0.1% Tween-20 (PBSTw) (need 5 ml per sample)
50 ml 1x PBS, nuclease-free
50 μl Tween-20
1x PBSTw + 0.25 mM levamisole
1 ml 1x PBS, nuclease-free
1 µl Tween-20
1 µl 0.25 M levamisole stock solution (51 mg in 1 ml M9 or 1x PBS)
1x PBSTw + 3.7% formaldehyde (need 1 ml per sample, make fresh)
900 µl PBSTw
100 μl 37% formaldehyde
1x PBS + 0.1% Triton X-100 (need 1 ml per sample)
9.9 ml 1x PBS, nuclease-free
100 μl 10% Triton X-100, diluted in nuclease-free water
70% ethanol (need 1 ml per sample)
3 ml 100% EtOH, nuclease-free
7 ml H2O, nuclease-free
Probe and hybridization: nuclease-free
TE buffer (DEPC-treated)
10 mM Tris base
1 mM EDTA
pH 8.0
Formamide
Aliquot and store at 4 °C, warm to RT before opening
smFISH wash buffer (need 6 ml per sample)
1 ml 20x SSC
1 ml formamide
8 ml DEPC water
10 μl Tween-20
smFISH wash buffer + DAPI (need 1 ml per sample)
1 ml wash buffer
1 μl DAPI (1 mg/ml, stored in the dark at 4 °C)
Hybridization buffer (HB)
*Note: 10% formamide is generally used. However, formamide concentration can be adjusted to modify stringency. If target RNA has high GC content, try increasing formamide to 15-20%, or up to 50%. If adjusting formamide concentration, match concentration in wash buffer.
1 g dextran sulfate
7.3 ml DEPC water (or up to 10 ml volume)
1 ml 20x SSC
1 ml formamide
Notes:
Combine dextran sulfate and DEPC-H2O, rock ~30 min until fully dissolved. Add 20x SSC and formamide; invert to mix. Store in 500 μl aliquots at -20 °C.
*Other labs (see for example Lee et al., 2013) also add (per 10 ml HB):
10 mg E. coli tRNA
100 μl Vanadyl ribonucleoside complex (200 mM)
40 μl BSA (nuclease-free) (50 mg/ml)
We started with these reagents but gradually omitted them. If experiencing problems with background, try adding them back in one at a time (in order listed).
Reagents for GLOX buffer/mounting medium: nuclease-free
GLOX buffer, no enzymes (need 1 ml per sample)
850 µl H2O, nuclease-free
100 µl 20x SSC, nuclease-free
40 µl 10% glucose, nuclease-free
10 µl 1 M Tris, pH 8.0, nuclease-free [TE also works]
Note: Prepare fresh immediately before use.
GLOX buffer + enzymes
100 µl GLOX buffer
1 µl glucose oxidase, 3.7 mg/ml
1 µl catalase
1 µl 200 mM Trolox
Note: Keep on ice or at 4 °C.
10% glucose
5 g glucose (weighed out in nuclease-free way)
50 ml nuclease-free H2O
Note: Pass through a 0.2 µm syringe filter and store at 4 °C.
Glucose oxidase, 3.7 mg/ml
37 mg glucose oxidase (weighed out in nuclease-free way)
167 µl 3 M sodium acetate, pH 5.5, nuclease-free
10 ml H2O, nuclease-free
Note: Divide into 100 µl aliquots and store at -20 °C.
Catalase
Note: Store in the dark at 4 °C. Vortex or pipet up and down before use but do not spin.
200 mM Trolox
5 mg Trolox (weighed out in nuclease-free way)
1 ml 100% ethanol
Note: Store as 100 µl aliquots at -20 °C.
VALAP
Vaseline + lanolin + paraffin (1:1:1 w/w/w)
Note: To use, melt at ~70 °C and apply with paintbrush or metal spatula.
Acknowledgments
This protocol has been adapted from Lee et al. (2016b). ESK was supported by the American Cancer Society–George F. Hamel Jr. Fellowship (PF-14-147-01-DDC). HSS was supported by an Ellison Medical Foundation Fellowship of the Life Science Research Foundation. TRL is supported by the National Science Foundation Graduate Research Fellowship Program (Grant No. DGE-1256259). JK is an Investigator of the Howard Hughes Medical Institute.
References
Abbaszadeh, E. K. and Gavis, E. R. (2016). Fixed and live visualization of RNAs in Drosophila oocytes and embryos. Methods 98: 34-41.
Crittenden, S. L., Seidel, H. S. and Kimble, J. (2017). Analysis of the C. elegans germline stem cell pool. Methods Mol Biol 1463: 1-33.
Ji, N. and van Oudenaarden, A. (2012). Single molecule fluorescent in situ hybridization (smFISH) of C. elegans worms and embryos. WormBook: 1-16.
Lee, C., Roberts, S. E. and Gladfelter, A. S. (2016a). Quantitative spatial analysis of transcripts in multinucleate cells using single-molecule FISH. Methods 98: 124-133.
Lee, C., Sorensen, E. B., Lynch, T. R. and Kimble, J. (2016b). C. elegans GLP-1/Notch activates transcription in a probability gradient across the germline stem cell pool. Elife 5.
Lee, C., Zhang, H., Baker, A. E., Occhipinti, P., Borsuk, M. E. and Gladfelter, A. S. (2013). Protein aggregation behavior regulates cyclin transcript localization and cell-cycle control. Dev Cell 25(6): 572-584.
Mueller, F., Senecal, A., Tantale, K., Marie-Nelly, H., Ly, N., Collin, O., Basyuk, E., Bertrand, E., Darzacq, X. and Zimmer, C. (2013). FISH-quant: automatic counting of transcripts in 3D FISH images. Nat Methods 10(4): 277-278.
Ortiz, M. A., Noble, D., Sorokin, E. P. and Kimble, J. (2014). A new dataset of spermatogenic vs. oogenic transcriptomes in the nematode Caenorhabditis elegans. G3 (Bethesda) 4: 1765-1772.
Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A. and Tyagi, S. (2008). Imaging individual mRNA molecules using multiple singly labeled probes. Nat Methods 5(10): 877-879.
Copyright: Lee et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lee, C., Seidel, H. S., Lynch, T. R., Sorensen, E. B., Crittenden, S. L. and Kimble, J. (2017). Single-molecule RNA Fluorescence in situ Hybridization (smFISH) in Caenorhabditis elegans. Bio-protocol 7(12): e2357. DOI: 10.21769/BioProtoc.2357.
Lee, C., Sorensen, E. B., Lynch, T. R. and Kimble, J. (2016b). C. elegans GLP-1/Notch activates transcription in a probability gradient across the germline stem cell pool. Elife 5.
Download Citation in RIS Format
Category
Molecular Biology > RNA > RNA detection
Molecular Biology > RNA > Transcription
Cell Biology > Cell staining > Nucleic acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,358 | https://bio-protocol.org/exchange/protocoldetail?id=2358&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Representation-mediated Aversion as a Model to Study Psychotic-like States in Mice
AB Arnau Busquets-Garcia
Edgar Soria-Gómez
GF Guillaume Ferreira
GM Giovanni Marsicano
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2358 Views: 6653
Edited by: Soyun Kim
Reviewed by: Xiaoyu Liu
Original Research Article:
The authors used this protocol in 14-Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
14-Oct 2013
Abstract
Several paradigms for rodent models of the cognitive and negative endophenotypes found in schizophrenic patients have been proposed. However, significant efforts are needed in order to study the pathophysiology of schizophrenia-related positive symptoms. Recently, it has been shown that these positive symptoms can be studied in rats by using representation-mediated learning. This learning measure the accuracy of mental representations of reality, also called ‘reality testing’. Alterations in ‘reality testing’ performance can be an indication of an impairment in perception which is a clear hallmark of positive psychotic-like states. Thus, we describe here a mouse task adapted from previous findings based on a sensory preconditioning task. With this task, associations made between different neutral stimuli (e.g., an odor and a taste) and subsequent selective devaluation of one of these stimuli have allowed us to study mental sensory representations. Thus, the interest of this task is that it can be used to model positive psychotic-like states in mice, as recently described.
Keywords: Positive symptoms Schizophrenia Delusions Reality testing Representation-mediated learning
Background
The presence of positive symptoms, such as delusions or hallucinations, is a key feature of a psychotic-like state (American Psychiatric Association, 2000 and 2013; Tandon, 2013) and represents a major challenge to rodent models (Wong and Van Tol, 2003; van den Buuse et al., 2005; Mouri et al., 2007; Jones et al., 2011). Indeed, these symptoms are often neglected due to the lack of suitable animal models (Jones et al., 2011; Rubino and Parolaro, 2014 and 2016). Psychotogenic drug-induced hyperlocomotion in rodents has long been considered an acceptable approximation of positive symptoms of drug-induced psychotic-like states (Wong and Van Tol, 2003; van den Buuse et al., 2005; Mouri et al., 2007; Jones et al., 2011). However, locomotor activity cannot be used to study the mismatch between perception and reality that is the hallmark of positive psychotic-like states (Wong and Van Tol, 2003; van den Buuse et al., 2005). For instance, the ‘Diagnostic and Statistical Manual of Mental Disorders’ (DSM V) defines delusions as ‘erroneous beliefs that usually involve a misinterpretation of perception or experiences’ (American Psychiatric Association, 2013). To overcome this methodological limitation, recent studies have used behavioral procedures in rodents designed to measure the accuracy of mental representations of reality, also called ‘reality testing’ (McDannald and Schoenbaum, 2009; McDannald et al., 2011; Kim and Koh, 2016). Alterations in ‘reality testing’ performance can be an indication of an impairment in perception which, as we mentioned before, might lead to positive psychotic-like states such as delusions. Thus, we adapt these previous protocols (McDannald and Schoenbaum, 2009; McDannald et al., 2011; Wheeler et al., 2013; Kim and Koh, 2016) to design a behavioral paradigm for measuring ‘reality testing’ in mice (Busquets-Garcia et al., 2017). Notably, deficits in task performance induced by psychotogenic drugs (e.g., amphetamine or cannabinoids) seem to reflect the kind of perceptual alterations that are the hallmarks and early features of positive psychotic-like symptoms.
Materials and Reagents
1 ml syringe and 26 G needles (Terumo Europe, Leuven, Belgium)
Mice (C57BL6/N mice purchased from Janvier Labs, Le Genest-Saint-Isle, France)
Banana odor (isoamyl acetate) (Sigma-Aldrich, catalog number: W205508 )
Almond odor (benzaldehyde) (Sigma-Aldrich, catalog number: 418099 )
Maltodextrin (Sigma-Aldrich, catalog number: 419672 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Lithium chloride (LiCl) (Sigma-Aldrich, catalog number: 203637 )
Banana solution (0.05%) (see Recipes)
Almond solution (0.01%) (see Recipes)
Maltodextrin solution (5%) (see Recipes)
Sucrose solution (5%) (see Recipes)
Combined odor-taste solution (see Recipes)
LiCl (3 M) (see Recipes)
Note: Any psychotogenic drug (e.g., amphetamine or cannabinoids) can be used as a positive control for the test, as previously shown (Busquets-Garcia et al., 2017).
Equipment
50-ml drinking tubes (Conical Centrifuge Tube, Thermo Fisher Scientific, Rochester, USA)
Standard balance
Standard individual plexiglas cage for each mouse
Metal tube (TD-100, 2.5” straight ball point tube, stainless steel, Ancare, New York, USA)
Rubber plug with 25 mm diameter hole (Thermo Fisher Scientific, Rochester, USA)
Note: It is important that the bottles be assembled before starting the experiment (Figure 1).
Figure 1. Drinking bottles used in the protocol. The bottles are carefully put together, as shown in the image. Note that the metal tube must pass through the rubber plug and all possible leakage must be avoided.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Busquets-Garcia, A., Soria-Gómez, E., Ferreira, G. and Marsicano, G. (2017). Representation-mediated Aversion as a Model to Study Psychotic-like States in Mice. Bio-protocol 7(12): e2358. DOI: 10.21769/BioProtoc.2358.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,359 | https://bio-protocol.org/exchange/protocoldetail?id=2359&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Targeted Mutagenesis Using RNA-guided Endonucleases in Mosses
TN Toshihisa Nomura
HS Hitoshi Sakakibara
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2359 Views: 11985
Edited by: Dennis Nürnberg
Reviewed by: Vinay Panwar
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
RNA-guided endonucleases (RGENs) have been used for genome editing in various organisms. Here, we demonstrate a simple method for performing targeted mutagenesis and genotyping in a model moss species, Physcomitrella patens, using RGENs. We also performed targeted mutagenesis in a non-model moss, Scopelophilla cataractae, using a similar method (Nomura et al., 2016), indicating that this experimental system could be applied to a wide range of mosses species.
Keywords: Genome editing RNA-guided endonucleases CRISPR/Cas system Targeted mutagenesis Mosses
Background
Targeted mutagenesis using RNA-guided endonucleases (RGENs) derived from the adaptive immune system, using the bacterial CRISPR (clusters of regularly interspaced palindromic repeats)/Cas (CRISPR-associated) systems, has dramatically advanced in recent years. In this method, the Cas9 endonuclease, derived from Streptococcus pyogenes, and an artificially designed single-chain guide RNA (sgRNA) are used. The Cas9-sgRNA complex recognizes the protospacer-adjacent motif (5’-NGG-3’) and cleaves 3 bp upstream of the target site (Jinek et al., 2012). Subsequently, random insertion and/or deletion mutations occur during the repair process for double-strand breaks (DSBs) in the DNA. As targeted mutagenesis using these RGENs is efficient as well as cost- and time-effective, it has been used for genome editing in various organisms, including many plant species. Here, we established a protocol for targeted mutagenesis using RGENs in mosses, and demonstrated it in a model and a non-model species (Nomura et al., 2016).
Materials and Reagents
Washed and autoclaved cellophane (FUTAMURA CHEMICAL, catalog number: PS-1 )
9 cm plastic Petri dish (SANSEI MEDICAL, catalog number: 01-013 )
1.5 ml plastic tubes (FUKAEKASEI and WATSON, catalog number: 131-415C )
15 ml plastic tubes (FUKAEKASEI and WATSON, catalog number: 1332-015S )
PCR tubes (NIPPON Genetics, FastGene, catalog number: FG-028DC )
10 µl plastic pipette tips (FUKAEKASEI and WATSON, catalog number: 123R-254CS )
200 µl plastic pipette tips (FUKAEKASEI and WATSON, catalog number: 123R-755CS )
1,000 µl plastic pipette tips (FUKAEKASEI and WATSON, catalog number: 122-804B )
Protonemata of Physcomitrella patens (or other mosses)
pSCgRNA, pSCOE1-fcoCas9 (Nomura et al., 2016, Figure 1A)
DH5α-competent cells (Home-made)
NEBuffer 2.1 (New England Biolabs, catalog number: R0539S )
BbsI (New England Biolabs, catalog number: R0539S )
Sterile Milli-Q water
GEL/PCR Purification Mini Kit (Favorgen Biotech, catalog number: FAGCK 001-1 )
Ligation high ver.2 (TOYOBO, catalog number: LGK-201 )
ScU6p Ins. check F primer 5’-GAGGATCACGGTGTCACATGTCC-3’
Quick Taq® HS DyeMix (TOYOBO, catalog number: DTM-101 )
ScU6p Seq. check F primer 5’-ATGTCAAACATAACCTGG-3’
Ampicillin (NACALAI TESQUE, catalog number: 02739-74 )
Plasmid DNA Extraction Mini Kit (Favorgen Biotech, catalog number: FAPDE 001-1 )
Agarose S (NIPPON GENE, catalog number: 312-01193 )
DNA ladder markers (SMOBIO Technology, catalog number: DM3100 )
NucleoBond® Xtra Midi (MACHEREY-NAGEL, catalog number: 740410.50 )
G418 Disulfate (NACALAI TESQUE, catalog number: 16512-81 )
BCDAT medium (Nishiyama et al., 2000)
Glucose (Wako Pure Chemical Industries, catalog number: 049-31165 )
Tks Gflex DNA polymerase (Takara Bio, catalog number: R060A )
Zero Blunt PCR Cloning Kit (Thermo Fisher Scientific, Invitrogen, catalog number: K275020 )
CloneJET PCR Cloning Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: K1231 )
LB agar, Miller (BD, DifcoTM, catalog number: 244520 )
LB broth, Miller (BD, DifcoTM, catalog number: 244620 )
Tris (hydroxymethyl) aminomethane (NACALAI TESQUE, catalog number: 35434-21 )
Potassium chloride (Wako Pure Chemical Industries, catalog number: 163-03545 )
Ethylenediaminetetraacetic acid (EDTA) (DOJINDO, catalog number: 345-01865 )
Acetic acid (Wako Pure Chemical Industries, catalog number: 017-00256 )
Ethidium bromide solution (NACALAI TESQUE, catalog number: 14631-94 )
LB agar plate with 50 µg/ml ampicillin (see Recipes)
Lysis buffer (see Recipes)
50 x TAE buffer (see Recipes)
1x TAE buffer (see Recipes)
Equipment
Plant growth chamber (SANYO, model: MLR-350HT )
Micropipettes (Eppendorf, model: Reference® 2 )
Sterile tweezers (Electron Microscopy Sciences, DUMONT, catalog number: 0108-5-PO )
Thermal cycler (PCR Thermal Cycler Dice® Gradient, Takara Bio, model: TP600 )
High-speed centrifuge (TOMY DIGITAL BIOLOGY, model: MX-300 )
Block incubator (ASTEC, model: Bl-515A )
Spectrophotometer (GE Healthcare, model: NanoVue )
Autoclave (TOMY DIGITAL BIOLOGY, model: SX300 )
Agarose gel electrophoresis equipment (Cosmo Bio, model: i-MyRun.N )
Ultraviolet transilluminator (ATTO, models: DTB-20MP , TYPE-CX )
Heated incubator (SANYO, model: MIR-262 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nomura, T. and Sakakibara, H. (2017). Targeted Mutagenesis Using RNA-guided Endonucleases in Mosses. Bio-protocol 7(12): e2359. DOI: 10.21769/BioProtoc.2359.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
236 | https://bio-protocol.org/exchange/protocoldetail?id=236&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Macrophage Infection by Dimorphic Fungi
KB Kylie Boyce
AA Alex Andrianopoulos
Published: Vol 2, Iss 14, Jul 20, 2012
DOI: 10.21769/BioProtoc.236 Views: 11486
Original Research Article:
The authors used this protocol in Dec 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2011
Abstract
Mammalian infection by dimorphic fungi occurs through the inhalation of asexual spores (conidia), which are phagocytosed by host pulmonary alveolar macrophages of the innate immune system. Once phagocytosed, fungal conidia germinate into the pathogenic cell type; unicellular yeast cells which divide by fission (Vanittanakom et al., 2006; Boyce et al., 2011). To investigate if mutation of a particular fungal gene affects macrophage phagocytosis or the production of yeast cells, a murine macrophage cell culture assay can be utilized. This protocol was developed for Penicillium marneffei but is applicable to most dimorphic fungi.
Materials and Reagents
Lipopolysaccharide (LPS) from E. coli (Sigma-Aldrich, catalog number: L2630 )
Flask (or petri dish) of confluent J77A murine macrophages (available from Sigma-Aldrich, catalog number: 91051511 )
10x Trypsin-EDTA solution (Life Technologies, Gibco®, catalog number: R-001-100 )
1 x 107/ml fungal conidia (suspended in 0.001% Tween 20) (harvested from a 10 day 25 °C agar plate)
1 mg/ml fluorescent brightener 28 (calcofluor) (Sigma-Aldrich, catalog number: F3543 )
70% ethanol (any supplier)
NaCl (ChemSupply, catalog number: SA046 )
KCl (ChemSupply, catalog number: PA054 )
MgSO4 (ChemSupply, catalog number: MA048 )
NaOH (ChemSupply, catalog number: SA178 )
Na2HPO4 (Thermo Fisher Scientific/Ajax Finechem Pty, catalog number: A621 )
KH2PO4 (Merck KGaA, product number: 1048729025 )
Fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 26140 )
Penicillin streptomycin solution (Sigma-Aldrich, catalog number: P0781 )
L-glutamine (Sigma-Aldrich, catalog number: 59202C )
Dulbecco’s Modified Eagle’s Medium (DMEM) (Sigma-Aldrich, catalog number: D6546 )
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
PIPES (Sigma-Aldrich, catalog number: P6757 )
EGTA (Sigma-Aldrich, catalog number: E4378 )
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
4% fixation solution (see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
Complete DMEM (see Recipes)
0.001% Tween 20 (see Recipes)
PME buffer (see Recipes)
Equipment
Standard tabletop centrifuges
Clyde-Apac BH2000 Series Biological safety cabinet class II
Leica Microscope with a UV filter (Reichert-Jung)
Refrigeration centrifuge with a swing bucket rotor (Beckman Coulter, model: TJ-6 )
Cell culture incubator (37°C, 5% CO2)
Bunsen burner
Well sterile cell culture plate (Greiner Bio-One, catalog number: 657160 )
Disposable, sterile 10ml pipettes (Corning Incorporated/Costar stripettes, manufacture number: 4488 )
Sterile 10 ml centrifuge tubes (any supplier)
22 x 22 mm standard microscope coverslips (any supplier)
76 x 26 mm standard microscope slides (any supplier)
Nail varnish (any supplier)
Biological safety cabinet
Haemocytometer
Tweezers
25 cm2 small flask
75 cm2 big flask
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Boyce, K. and Andrianopoulos, A. (2012). Macrophage Infection by Dimorphic Fungi. Bio-protocol 2(14): e236. DOI: 10.21769/BioProtoc.236.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Fungus
Cell Biology > Cell isolation and culture > Cell growth
Immunology > Immune cell function > Macrophage
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,360 | https://bio-protocol.org/exchange/protocoldetail?id=2360&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transplantation of Embryonic Cortical Tissue into Lesioned Adult Brain in Mice
CW Cong Wang
HG Hao Gao
SZ Shengxiang Zhang
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2360 Views: 7516
Edited by: Xi Feng
Reviewed by: Edel HennessyJingang Huang
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
Transplantation of embryonic cortical tissue for repairing the damaged brain has provided a potential therapy for brain injury and diseases. The grafted tissue can successfully survive and participate in reestablishing the functional neural circuit of the host brain. Transplantation surgery can be combined with fluorescently labeled transgenic mice to evaluate the reconstruction of neuronal network (Falkner et al., 2016) and the repopulation of a subset of cortical cells. By using this approach, we have shown that infiltrating cells from host brain can restore the microglial population in the graft tissue (Wang et al., 2016). This protocol describes the detailed procedure of the transplantation surgery in mice, including establishing a lesion model in the host brain, preparing the embryonic cortical graft, and transplanting the embryonic cortical graft to adult brain.
Keywords: Transplantation Embryonic cortical tissue Host Adult brain Graft
Background
Most neurons in adult brain are post mitotic cells and are not capable of regenerating new daughter cells, this results in a limited ability of self-repairing of adult brain after suffering from brain injury or diseases. Replacing the damaged brain tissue with embryonic neural graft is one of the potential effective therapies to repair the damaged neural pathways in the adult brain (Tuszynski, 2007). Much attention has been drawn to this field of study since the 1970s (Das and Altman, 1972; Bjorklund and Stenevi, 1979) and remarkable successes have been achieved during the last three decades. These studies have shown that neurons in grafted tissue can successfully survive in host brain and develop efferent projections to reestablish synaptic connections between the host and donor neurons (Gaillard and Roger, 2000; Gaillard et al., 2004; Gaillard, 2007; Gaillard et al., 2007; Falkner et al., 2016). Electrophysiological evidence suggests that the grafted neurons develop functional connections in the host cortices of adult animals (Gaillard and Domballe, 2008; Santos-Torres et al., 2009; Jimenez-Diaz et al., 2011) and the data of behavioral tests indicate that the damaged functions can be partially restored after transplantation (Plumet et al., 1993; Riolobos et al., 2001; Gaillard et al., 2007). Our recent study suggests that there is an interactive relationship between the host brain and the transplanted tissue. The transplanted tissue provides neurons to repair the damaged circuit, and host brain can restore the microglial population in the grafted tissue (Wang et al., 2016). However, the survival and differentiation of other essential cell subsets (such as astrocyte and oligodendrocyte) and their roles and functions in the grafted tissue remain undetermined. We hope the approach we described here can be combined with other cutting-edge techniques to reveal the mechanism underlying the reconstructing process between the host brain and transplanted tissue.
Materials and Reagents
Double-edge razor blade (SHANGHAI RAZOR BLADE, catalog number: 74-s , or Gillette, catalog number: PLATINUM-PLUS® )
Microsurgical blade (Salvin Dental Specialties, catalog number: 6900 )
Superglue (cyanoacrylate, Products of ALTECO CHEMICAL, catalog number: SG-12 )
Gelfoam (Zhejiang AOKI Medical Dressing or Pfizer, catalog number: AZL0009034201 )
24-well cell culture plate (Corning, NY)
90 mm culture dish (Guangzhou Jet Bio-Filtration, catalog number: TCD010090 )
Filter paper (Autoclaved)
Toothpick (Autoclaved)
Surgical sutures (Yangzhou Jinhuan Medical Apparatus Factory, material: silk, size: 5-0 UPS standard)
1 ml Insulin syringe (Shandong Weigao Group Medical Polymer, catalog number: B-D328404Z or BD, catalog number: 328404 )
5 ml plastic transfer pipette (Sterilized)
Mice
Note: Mice of both sexes at the age of 3-4 months are highly recommended to be used as host mice (recipient) in this protocol, and the fetus at the Embryonic day 14 (E14) or E15 (both genders) is used as donor, the strain of mice is depended on the purpose of study.
75% ethanol (Tianjin Fuyu Fine Chemical)
Erythromycin ointment (paraffin based lubricant is also recommended)
Iodine tincture
Ketamine (Fujian Gutian Parma, catalog number: H35020148 )
Xylazine (Sigma-Aldrich, catalog number: X1251-1G )
Sodium chloride (NaCl) (Beichen fangzheng, Tianjin; or Sigma-Aldrich, catalog number: S5886 )
Potassium chloride (KCl) (Haiguang, Tianjin; or Sigma-Aldrich, catalog number: P5405 )
Potassium phosphate monobasic (KH2PO4) (The sixth chemical plant, Tianjin; or Sigma-Aldrich, catalog number: P5655 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S9763 )
Calcium chloride (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C7902 )
Magnesium sulfate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: 63138 )
Na+-HEPES (Sigma-Aldrich, catalog number: H7006 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S5767 )
Note: This product has been discontinued.
Glucose
Urethane (Sigma-Aldrich, catalog number: 94300 )
Ketamine-Xylazine mixture (KX) (see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
Hanks balanced salt solution (HBSS) (see Recipes)
Urethane solution (see Recipes)
Equipment
Dental drill (SEASHIN PRECISION, catalog number: STRONG 90 )
Curved scissors, cutting edge: 14 mm, material: stainless steel (Fine Science Tools, catalog number: 14084-09 )
Heating pad (Tme, model: JR-1/2 DC )
Dissecting microscope (Olympus, model: SZ61 )
Straight scissors, cutting edge: 14 mm, material: stainless steel (Fine Science Tools, catalog number: 14085-09 )
Thin-tipped forceps (Fine Science Tools, model: Dumont #5 )
Straight forceps (VETUS, catalog number: ST-14 )
Curved forceps (Fine Science Tools, model: Dumont #5/45 )
Custom-made steel plate (see Figure 1B)
Compressed air (Sunto, catalog number: ST1005 )
Biosafety cabinet (Jiangsu Sujing Group, model: BCM-1300A )
Refrigerator
Software
ImageJ software (http://rsb.info.nih.gov/ij)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, C., Gao, H. and Zhang, S. (2017). Transplantation of Embryonic Cortical Tissue into Lesioned Adult Brain in Mice. Bio-protocol 7(12): e2360. DOI: 10.21769/BioProtoc.2360.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Stem Cell > Embryonic stem cell > Cell transplantation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,361 | https://bio-protocol.org/exchange/protocoldetail?id=2361&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Social Observation Task in a Linear Maze for Rats
XM Xiang Mou
DJ Daoyun Ji
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2361 Views: 6372
Edited by: Soyun Kim
Reviewed by: Qing YanMarina Allerborn
Original Research Article:
The authors used this protocol in 15-Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
15-Oct 2016
Abstract
Animals often learn through observing their conspecifics. However, the mechanisms of them obtaining useful knowledge during observation are beginning to be understood. This protocol describes a novel social observation task to test the ‘local enhancement theory’, which proposes that presence of social subjects in an environment facilitates one’s understanding of the environments. By combining behavior test and in vivo electrophysiological recording, we found that social observation can facilitate the observer’s spatial representation of an unexplored environment. The task protocol was published in Mou and Ji, 2016.
Keywords: Hippocampus Place cell Social observation Local enhancement
Background
Social learning is defined as acquiring new knowledge through observing or interacting with others (Heyes and Galef, 1996; Bandura, 1997; Meltzoff et al., 2009). One form of social learning utilized by many species is the so-called ‘local enhancement’ (Heyes and Galef, 1996): an animal’s understanding of an environment is facilitated by the presence of other social subjects in the same environment. Animals achieve local enhancement possibly by heightened attention, acquiring environmental attributes such as safety or food availability, or other unspecified means (Zajonc, 1965; Heyes and Galef, 1996; Zentall, 2006). The hypothesis predicts that the presence of social subjects in an environment impacts other animals’ neural processing of information related to the environment, therefore facilitate their understanding of the environment.
It has been shown that spatial information of an environment is represented by hippocampal place cells (O’Keefe and Dostrovsky, 1971; Wilson and McNaughton, 1993; Burgess and O’Keefe, 2003) in rodents and humans. Place cells become active at specific locations of a given environment, called place fields. We asked how an observer’s place cell sequence representing an environment can be influenced by another rat navigating in the environment, even if the observer is located in a physically different environment. This protocol is designed to explore the neural basis of such local enhancement effect of social observation. Specifically, we monitored the hippocampus place cells in observer rats as they stayed in a small box while a demonstrator rat was running on a separate, nearby linear track, and then later when observer rats were running the same track themselves. Our results show that observer’s place cell sequences during track running also appeared in the box during observation, but only when a demonstrator was present on the track. Observer’s running speed, number of run laps and place cells’ specificity are significantly higher than those in control animals.
Materials and Reagents
3-6 month old male Long Evans rats, 450-550 g
4x diluted sweetened condensed milk (Eagle Brand) are used for reward
70% ethanol for cleaning the maze between daily training sessions
Equipment
A 2-m long linear track made of galvanized steel (Figures 1A and 1B)
A small 25 (length) x 25 (width) x 40 (height) cm box. Three sides of the box has opaque, high (40 cm) walls, leaving only one side open toward the track (Figure 1C)
Milk wells located at the two ends of the linear track. Milk reward was remotely delivered by syringe and tubing from behind a curtain
Curtain separating the experimenter and recording setup (Figure 1D)
A 60 (length) x 60 (width) x 100 (height) cm rest box. The rest box was placed ~1 m away from the track. Animals were placed in a ceramic plate (20 cm in diameter) on top of a 30-cm tall flower pot, located at the center of the enclosed rest box for resting (Figure 1E)
The animal’s position was tracked by red and green LED mounted over on the head. Position data were recorded by a ceiling camera at 33 Hz
In vivo extracellular recording equipment is described earlier in Mou and Ji, 2016. Tetrode recording was made by a Digital Lynx acquisition system (Neuralynx, model: Digital Lynx Acquisition System ). Spikes from single neurons were sampled at 32 kHz and online-filtered between 600 Hz and 9 kHz. Local field potentials (LFPs) were sampled at 2 kHz and online-filtered between 0.1-1 kHz
Figure 1. Social observation apparatus. A. Schematic depiction of the recording setting; B. Linear track; C. Observation box; D. Curtain; E. Flower pot in a rest box.
Software
Customized MATLAB script
Procedure
Note: All experimental procedures followed the guidelines by the National Institute of Health and were approved by the Institutional Animal Care and Use Committee at Baylor College of Medicine.
3-6 month-old male Long Evans rats, weighted between 450 g to 550 g, are housed 2-3 per cage and handled daily for ~7 days.
After the acclimation period, demonstrator rats are food restricted to 85-90% of their baseline body weight before experiment. In the meantime, they are trained to run the linear track back and forth for milk reward for at least one week. Training session takes place once a day and lasted about 20 min. An adult rat can achieve satisfactory behavioral performance (continuous run back and forth without prolonged pause) within 2-3 days.
While demonstrator rats are being trained, non-trained naïve rats are implanted with hyperdrive that contains 15 independently movable tetrodes and one reference electrode. Tetrodes target the right dorsal hippocampal CA1 region (coordinates: anteroposterior -3.8 mm, mediolateral 2.4 mm relative to bregma). During surgery, all tetrodes are placed right above the surface of exposed brain tissue without touching it. Then tetrodes are advanced individually to reach dorsal CA1 area. Since the dorsal CA1 area is not flat, the final depths vary among individual tetrodes, but approximately 2 mm below the dura. The reference tetrode is placed in white matter above dorsal CA1 pyramidal cell layer, approximately 1.7 mm below the dura.
After having fully recovered from surgery (typically within 3 days), the implanted rats are food deprived to 85-90% of their baseline weight.
During the following 3-4 weeks after implantation, tetrodes are slowly advanced to the CA1 pyramidal layer until sharp-wave ripples signal were observed (Figure 2). The reference tetrode is placed in the white matter above the CA1. Recordings are not conducted within 24 h after tetrodes movement.
Figure 2. A representative LFP sharp-wave ripple
Pre-recording training phase: Each rat is placed in the observation box for 2 or 3 days, 15-30 min each day. For a group of implanted rats, there is a well-trained demonstrator running on the track in this pre-recording phase. For the other group of implanted rats, the track is left empty without a demonstrator.
Recording procedure: The recording starts and lasts for 6-12 consecutive days after pre-recording training. The recording procedure is depicted in Figure 3. A typical recording took ~2 h. Each recording consists of three sessions.
Figure 3. Schematic of daily recording procedure. The Pre- and Post-box sessions were configured with various conditions.
For the group of rats that have watched a well-trained demonstrator in the pre-recording training phase, on the first recording day:
The implanted rats first stay in the observation box while a well-trained demonstrator is running the linear track for 15 min (Pre-box session).
Then the implanted rat runs the linear track for the first time (Track session).
Then the implanted rat stays in the observation box again while the well-trained demonstrator is running the track (Post-box session).
Note: The recorded rats have never been exposed to the track before the first recording day.
In each of the following days, the Pre-box and Post-box session is set up in various ways as the following, while the Track session remains the same. Each condition is recorded for 1-3 days.
Empty-track: removing the demonstrator from the track.
No-track: removing both the track and demonstrator.
Naïve-demo: replacing the demonstrator with a naïve demonstrator that have never been exposed to the track.
Toy-car: replacing the demonstrator with a toy car remotely controlled by the experimenter behind the curtain. The car is maneuvered to move at a speed comparable to a rat’s. The toy car stops when it reaches the end of the track then reverses its direction.
Blocked-view: implanted rats stay in the box but with the view blocked while a well-trained demonstrator is running on the track. In this condition, the observation box is rotated 180° such that the opening side now is facing a nearby wall of the room 20 cm away. The implanted rat in the box can not see either the track or the demonstrator, but has access to the auditory and olfactory information associated with the demonstrator.
For the other group of rats that have seen only the empty track in the pre-recording training, the Pre-box and Post-box sessions on the first day are under Empty-track condition. In the following days, the Pre-box and Post-box sessions are replaced by Trained-demo and other conditions as described above.
Data analysis
We tracked animals’ positions using the red and green LED mounted on their heads. Position data were recorded by a ceiling camera and analyzed off-line using customized MATLAB script. The observer rats’ behavior in the Track session was quantified by mean running speed and number of running laps per trajectory (one running direction, Figure 4A). Our data show that both parameters in the observer rats after watching the well-trained demonstrator were significantly greater than those watching the empty track during pre-recording training phase.
All extracellular recording data, including spike timestamps, LFPs, were digitized and analyzed off-line using customized MATLAB routines (MATLAB routines are available upon reasonable request). After watching well-trained demonstrator, observer rats’ place cell firing appeared to be less dispersed than those watching Empty-track. Place cells’ firing sparsity measured by spatial information was significantly greater in the former group (Figure 4B). Taken together, our data suggest an improvement in understanding of a novel environment measured by track-running performance and place field development. Detailed analysis can be found in Mou and Ji, 2016.
Figure 4. Experience in the box improved behavioral performance and novel place field development on the track. A. Mean running speed and number of laps per trajectory in Track sessions of first two days (Day1, Day2) for the Trained-demo (N = 9) and Empty-track (N = 5) rats; B. Spatial information for all active cells under each condition (Trained-demo, Empty-track) on each day (Day1, Day2). Number on top of each bar: the number of cells. There was a significant main effect between the conditions (F(1,791) = 21, p = 0, Two-way ANOVA), but not between days (F(1,791) = 1.4, p = 0.25). Reproduced from Mou and Ji, 2016 with permission.
Acknowledgments
The authors would like to thank the entire Ji lab for help on constructing and configuring the apparatus, and for suggestions on preparation of the manuscript. This work was supported by grants NIMH R01MH106552, Simons Foundation 273886 to D.J.
References
Bandura, A. (1997). Social learning theory. General Learning Press.
Burgess, N. and O’Keefe, J. (2003). Neural representations in human spatial memory. Trends Cogn Sci 7(12): 517-519.
Heyes, C. M. and Galef Jr, B. G. (1996). Social learning in animals: the root of culture. Academic Press.
Meltzoff, A. N., Kuhl, P. K., Movellan, J. and Sejnowski, T. J. (2009). Foundations for a new science of learning. Science 325(5938): 284-288.
Mou, X and Ji, D. (2016). Social observation enhances cross-environment activation of hippocampal place cell patterns. eLife 5: e18022.
O’Keefe, J. and Dostrovsky, J. (1971). The hippocampus as a spatial map. Preliminary evidence from unit activity in the freely-moving rat. Brain Res 34(1):171-175.
Wilson, M. A. and McNaughton, B. L. (1993). Dynamics of the hippocampal ensemble code for space. Science 261(5124): 1055-1058.
Zajonc, R. B. (1965). Social facilitation. Science 149(3681): 269-274.
Zentall, T. R. (2006). Imitation: definitions, evidence, and mechanisms. Anim Cogn 9(4): 335-353.
Copyright: Mou and Ji. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Mou, X. and Ji, D. (2017). Social Observation Task in a Linear Maze for Rats. Bio-protocol 7(13): e2361. DOI: 10.21769/BioProtoc.2361.
Mou, X and Ji, D. (2016). Social observation enhances cross-environment activation of hippocampal place cell patterns. eLife 5: e18022.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,362 | https://bio-protocol.org/exchange/protocoldetail?id=2362&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Simple and Rapid Assay for Measuring Phytoalexin Pisatin, an Indicator of Plant Defense Response in Pea (Pisum sativum L.)
LH Lee A. Hadwiger
KT Kiwamu Tanaka
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2362 Views: 7073
Reviewed by: Ayelign M. Adal
Original Research Article:
The authors used this protocol in 14-Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
14-Oct 2013
Abstract
Phytoalexins are antimicrobial substance synthesized in plants upon pathogen infection. Pisatin (Pisum sativum phytoalexin) is the major phytoalexin in pea, while it is also a valuable indicator of plant defense response. Pisatin can be quantitated in various methods from classical organic chemistry to Mass-spectrometry analysis. Here we describe a procedure with high reproducibility and simplicity that can easily handle large numbers of treatments. The method only requires a spectrophotometer as laboratory equipment, does not require any special analytical instruments (e.g., HPLC, mass spectrometers, etc.) to measure the phytoalexin molecule quantitatively, i.e., most scientific laboratories can perform the experiment.
Keywords: Pisatin Phytoalexin Nonhost resistance Plant defense response Pea
Background
Plants have host resistance and nonhost resistance depending upon the nature of plant-pathogen interactions. Host resistance is mostly controlled by R genes and less durable, whereas nonhost resistance is generally a multi-gene trait and more durable in comparison with host resistance (Gill et al., 2015; Lee et al., 2017). The pea plant has served as a model system for research on the signals that trigger the nonhost defense response when challenged by incompatible pathogens that fall outside that species’ host range (Hadwiger, 2008). An indicator of this response in peas is the induction of a secondary metabolism to the isoflavonoid, pisatin. Pisatin has strong antifungal properties but its presence is a valuable indicator of plant defense response. Pisatin can be quantitated in various ways from classical organic chemistry procedures (Schwochau and Hadwiger, 1969) to Mass-spec analysis (Seneviratne et al., 2015). However, a procedure with high reproducibility and simplicity is described herein that can easily handle large numbers of treatments. The targeted tissue is the inside layer of an immature pea pod, called endocarp. This pristine cuticle-free tissue is capable of responding rapidly to candidate microbes or elicitor compounds to generate the pea defense response. The exposed epidermal layer of cells can be monitored for light microscope-visible or stained cellular component changes. The overall changes that culminate in pisatin accumulations can be determined by immersing the pod half in 5 ml of hexane for 4 h in the dark and subsequently allowing the decanted hexane to evaporate in the air flow of a hood. The residue remaining is dissolved in 1 ml of 95% alcohol and read at OD309 using a spectrophotometer: 1 OD309 = 43.8 µg pisatin/ml in 1 cm pathlength (Cruickshank and Perrin, 1961; Perrin and Cruickshank, 1965; Teasdale et al., 1974). This reading minus the background control tissue and the characteristic UV spectrum are essentially free from other hexane soluble components of the pea tissue. This protocol was used in our recent publications (Hadwiger and Tanaka, 2014 and 2017; Tanaka and Hadwiger, 2017).
Materials and Reagents
Spatula–smooth narrow tip and smooth glass rod
Plastic Petri dishes (60 x 15 mm) (Corning, catalog number: 351007 )
Plastic container with wet Kimwipes inside for humidity
Paper towel or Kimwipe
Immature pea pods (1.5-2.0 cm in length) grown in sand and clay pots at 65-70 F under greenhouse conditions and freshly harvested (use within 3 h of applying a treatment). Remove calyx and retain briefly in sterile water (Figure 1). Endocarp will be used for the assay (see Note 1 in detail)
Glass vials 30 ml
Candidate elicitor solutions best dissolved in deionized water (For exceptions see Procedure 1)
DMSO
Hexane
95% ethanol
Equipment
Adjustable pipettes (P-200 and P-1000 and corresponding tips)
Flask 500 ml with 5 ml dispenser top or 5 ml pipet for dispensing hexane
Glass beakers, 30 ml
Room temperature dark cabinet space for pathogen or elicitor treatments (as described in step 3b)
UV spectrometer (Shimadzu, model: UV160 )
1 cm Pathlength quartz cuvettes (Sigma-Aldrich, catalog number: C5178 )
Note: This product has been discontinued.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hadwiger, L. A. and Tanaka, K. (2017). A Simple and Rapid Assay for Measuring Phytoalexin Pisatin, an Indicator of Plant Defense Response in Pea (Pisum sativum L.). Bio-protocol 7(13): e2362. DOI: 10.21769/BioProtoc.2362.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Host-microbe interactions
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,363 | https://bio-protocol.org/exchange/protocoldetail?id=2363&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Active Cdk5 Immunoprecipitation and Kinase Assay
AB Andrew N. Bankston
LK Li Ku
YF Yue Feng
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2363 Views: 9037
Edited by: Pengpeng Li
Reviewed by: Liang Liu
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Cdk5 activity is regulated by the amounts of two activator proteins, p35 and p39 (Tsai et al., 1994; Zheng et al., 1998; Humbert et al., 2000). The p35-Cdk5 and p39-Cdk5 complexes have differing sensitivity to salt and detergent concentrations (Hisanaga and Saito, 2003; Sato et al., 2007; Yamada et al., 2007; Asada et al., 2008). Cdk5 activation can be directly measured by immunoprecipitation of Cdk5 with its bound activator, followed by a Cdk5 kinase assay. In this protocol, buffers for cell lysis and immunoprecipitation are intended to preserve both p35- and p39-Cdk5 complexes to assess total Cdk5 activity. Cells are lysed and protein concentration is determined in the post-nuclear supernatant. Cdk5 is immunoprecipitated from equal amounts of total protein between experimental groups. Washes are then performed to remove extraneous proteins and equilibrate the Cdk5-activator complexes in the kinase buffer. Cdk5 is then incubated with histone H1, a well-established in vitro target of Cdk5, and [γ-32P]ATP. Reactions are resolved by SDS-PAGE and transferred to membranes for visualization of H1 phosphorylation and immunoblot of immunoprecipitated Cdk5 levels. We have used this assay to establish p39 as the primary activator for Cdk5 in the oligodendroglial lineage. However, this assay is amenable to other cell lineages or tissues with appropriate adjustments made to lysis conditions.
Keywords: Kinase assay Cdk5 Western blot Immunoblot Radiation
Background
Although Cdk5 is typically associated with neuronal function, recent work has demonstrated that Cdk5 also regulates oligodendroglia progenitor cell (OPC) development (Tang et al., 1998; Miyamoto et al., 2007 and 2008). Cdk5 function is critical for OPC migration and differentiation, and loss of Cdk5 results in CNS hypomyelination (Miyamoto et al., 2007 and 2008; He et al., 2010; Yang et al., 2013). However, molecular mechanisms that regulate Cdk5 function in neurons and OLs remain elusive. The activity of Cdk5 is controlled by the available amounts of two activator homologs, p35 and p39 (Tsai et al., 1994; Zheng et al., 1998; Humbert et al., 2000). The defects in embryonic brain development and perinatal lethality observed in mice lacking both p35 and p39 were nearly identical to defects in the Cdk5-null mice (Ohshima et al., 1996; Ko et al., 2001), indicating that p35 and p39 are the sole activators of Cdk5 in the brain. We uncovered that in contrast to the major role of p35 in activating Cdk5 in neurons, p39 is the primary Cdk5 activator in oligodendrocytes (OLs), where p35 expression is negligible. Using this active Cdk5 immunoprecipitation and kinase assay, we demonstrated that Cdk5 activity is almost completely ablated in OLs with siRNA-mediated p39 knockdown. Previous work established the differing sensitivity of p35 and p39 to high detergent and salt concentrations (Hisanaga and Saito, 2003; Sato et al., 2007; Yamada et al., 2007; Asada et al., 2008). Based on those reports, this protocol was developed to try and preserve both p35- and p39-Cdk5 complexes to measure total Cdk5 activity regardless of activator. Our work further showed that p39 is essential for OL differentiation and myelin repair, with upregulation of p35 masking the loss of p39 function during myelin development. Measuring Cdk5 activity from cells, in combination with immunoblots for Cdk5 target phosphorylation, provides a tool to identify novel regulators of Cdk5 activation.
Materials and Reagents
Cell lifter (Corning, catalog number: 3008 )
Corning sterile 60 mm cell culture dishes (Corning, catalog number: 3261 )
Corning sterile 100 mm cell culture dishes (Corning, catalog number: 3262 )
15 ml conical tubes (Denville Scientific, catalog number: C1018-P )
Micro slides (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4951PLUS4 )
Micro cover glass (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 25X54I24901 )
1.7 ml tubes (Denville Scientific, SlipTechTM, catalog number: C19033 )
50 ml conical tubes (Denville Scientific, catalog number: 1005513 )
Nitrocellulose or PVDF membrane (GE Healthcare, catalog number: RPN82D or 10600021 )
Autoclaved micropipette tips (Denville Scientific, Woodpecker ReloadsTM, catalog numbers: P2102-NB , P2101-N , P2109 )
X-ray film (Denville Scientific, Hyblot ES®, catalog number: E3218 )
Trypan blue (Sigma-Aldrich, catalog number: 302643 )
BCA Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23235 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Antibody against Cdk5 (Santa Cruz C-8) (Santa Cruz Biotechnology, catalog number: sc-173 )
Antibody against Cdk5 (Cell Signaling Technology, catalog number: 2506 )
Rabbit IgG antibody (Vector Laboratories, catalog number: I-1000 )
Goat anti-rabbit-horseradish peroxidase (HRP) (Jackson ImmunoResearch, catalog number: 111-035-003 )
10 mM ATP (Thermo Fisher Scientific, catalog number: PV3227 )
Cdk5/p25, active complex (EMD Millipore, catalog number: 14-516 )
[γ-32P]ATP (PerkinElmer, catalog number: BLU002Z250UC )
Histone H1 (EMD Millipore, catalog number: 14-155 )
12% polyacrylamide gel (Bio-Rad Laboratories, catalog number: 4561043 )
Enhanced Chemiluminescence Reagent Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 32106 )
Tris/Glycine/SDS buffer (Bio-Rad Laboratories, catalog number: 1610732 )
Methanol (Sigma-Aldrich, catalog number: 34860 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S7907 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Tris base (Sigma-Aldrich, catalog number: RDD008 )
Concentrated HCl (Sigma-Aldrich, catalog number: 295426 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: EDS )
Sodium hydroxide (NaOH) tablets (Sigma-Aldrich, catalog number: S8045 )
Ethylene glycol-bis(β-aminoethyl ether)-N,N,N’,N’-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E3889 )
3-(N-morpholino)propanesulfonic acid (MOPS) (Sigma-Aldrich, catalog number: RDD003 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Sodium fluoride (NaF) (Sigma-Aldrich, catalog number: S7920 )
NP-40/IGEPAL® CA-630 (Sigma-Aldrich, catalog number: I3021 )
Polymethyl sulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
100% ethanol (Sigma-Aldrich, catalog number: E7023 )
Pepstatin (Sigma-Aldrich, catalog number: P4265 )
Leupeptin (Sigma-Aldrich, catalog number: L2884 )
Aprotinin (Sigma-Aldrich, catalog number: A1153 )
Protein A Sepharose CL-4B (GE Healthcare, catalog number: 17-0780-01 )
Pre-activated sodium orthovanadate (100 mM Na3VO4) (New England Biolabs, catalog number: P0758L )
10% BrijTM-35 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 28316 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Magnesium acetate (MgOAc) (Sigma-Aldrich, catalog number: M5661 )
Tween-20 (Sigma-Aldrich, catalog number: P1379 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
1x transfer buffer (see Recipes)
10x phosphate-buffered saline (PBS) (see Recipes)
1x phosphate-buffered saline (PBS) (see Recipes)
2 M Tris-HCl (pH 7.5) (see Recipes)
50 mM Tris-HCl (pH 7.5) (see Recipes)
5 M NaCl (see Recipes)
0.5 M EDTA (pH 8.0) (see Recipes)
0.5 M EGTA (pH 8.0) (see Recipes)
1 M MOPS (pH 7.0) (see Recipes)
1 M MgCl2 (see Recipes)
1 M NaF (see Recipes)
20% NP-40 (see Recipes)
100 mM PMSF (see Recipes)
1 mg/ml pepstatin A (see Recipes)
1 mg/ml leupeptin (see Recipes)
1 mg/ml aprotinin (see Recipes)
50% slurry of Protein A Sepharose CL-4B (see Recipes)
Cdk5 lysis buffer (stock) (see Recipes)
Cdk5 lysis buffer (working) (see Recipes)
Cdk5 kinase buffer (stock) (see Recipes)
Cdk5 kinase buffer (washes) (see Recipes)
Cdk5 kinase buffer (assay) (see Recipes)
MOPS dilution buffer (see Recipes)
5x reaction buffer (see Recipes)
50 mM magnesium acetate buffer (MgOAc) (see Recipes)
1x phosphate-buffered saline/0.1% Tween-20 (PBS-T) (see Recipes)
5x Laemmli buffer (see Recipes)
0.2% bromophenol blue (see Recipes)
Equipment
Hemacytometer (Hausser Scientific, catalog number: 3100 )
PIPETMAN ClassicTM pipets (Gilson, model: P10, catalog number: F144802 )
PIPETMAN ClassicTM pipets (Gilson, model: P20, catalog number: F123600 )
PIPETMAN ClassicTM pipets (Gilson, model: P200, catalog number: F123601 )
PIPETMAN ClassicTM pipets (Gilson, model: P1000, catalog number: F123602 )
Refrigerated tabletop centrifuge for 15 ml conical tubes (Jouan, model: CT422 )
Tabletop centrifuge for 1.5 ml tubes in a 4 °C cold room (Eppendorf, model: 5415 D )
Inverted light microscope (Olympus, model: CK30 )
Certified Geiger counter (W.B. Johnson Instruments, model: GSM-110 )
Plexiglass shielding (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 6700-1812 )
Phosphorimaging cassette (Thomas Scientific, catalog number: C993J84)
Manufacture: bioWORLD, catalog number: 43121008-1 .
Autoradiography cassette (Denville Scientific, catalog number: E3122 )
500 ml glass bottles (Corning, PYREX®, catalog number: 1397-500 )
Software
GraphPad Prism (GraphPad Software)
ImageJ (https://imagej.nih.gov/ij)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Bankston, A. N., Ku, L. and Feng, Y. (2017). Active Cdk5 Immunoprecipitation and Kinase Assay. Bio-protocol 7(13): e2363. DOI: 10.21769/BioProtoc.2363.
Bankston, A. N., Li, W., Zhang, H., Ku, L., Liu, G., Papa, F., Zhao, L., Bibb, J. A., Cambi, F., Tiwari-Woodruff, S. K. and Feng, Y. (2013). p39, the primary activator for cyclin-dependent kinase 5 (Cdk5) in oligodendroglia, is essential for oligodendroglia differentiation and myelin repair. J Biol Chem 288(25): 18047-18057.
Download Citation in RIS Format
Category
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,364 | https://bio-protocol.org/exchange/protocoldetail?id=2364&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Tumorigenicity Assay in Nude Mice
FD Feng Du
XZ Xiaodi Zhao
DF Daiming Fan
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2364 Views: 20365
Edited by: Antoine de Morree
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Tumorigenicity refers to the ability of cultured cells to develop viable tumors in immune-deficient animals. The goal of this protocol is to illustrate tumorigenicity assay by subcutaneous tumor-cell-transplantation in nude mice. Target cells are transplanted to 6-week-old nude mice subcutaneously and the tumor growth is monitored over a period of observation or treatment. When tumor grows to a pre-determined size or by the end of the limited period, the nude mice will be euthanatized and the xenograft will be removed for further examination.
Keywords: Tumorigenicity Nude mice Tumor cell transplantation Tumor xenograft model
Background
With high incidence and mortality, tumor is one of the leading causes of death and is a major public health problem. Extensive studies are conducted every year to explore tumor pathogenesis and anti-tumor therapy. In the process of cancer research, tumorigenicity assay in nude mice is a widely used experiment to monitor tumor growth in vivo (Giovanella et al., 1974). The most commonly used animal system for tumorigenicity assay is athymic nude mouse (Petricciani et al., 1973) where malignant cells can be transplanted either subcutaneously or subrenal-capsularly (van Meir, 1997). For cells with relatively low ability of tumorigenicity, take rate can be improved by irradiation (30-60 Gy) or implantation in Matrigel (Pretlow et al., 1991). Tumorigenicity assay provides a means of generating human cell derived tumor tissues for measurement of tumor cell malignancy and evaluation for anti-tumor drug efficacy.
Materials and Reagents
0.1-20 ml pipette tips (Eppendorf, catalog number: 22492012 )
5-200 ml pipette tips (Eppendorf, catalog number: 22492039 )
50-1,000 ml pipette tips (Eppendorf, catalog number: 22492055 )
Cell culture disc (75-cm2) (Corning, catalog number: 430641 )
Falcon 15 ml conical centrifuge tubes (Corning, catalog number: 430791 )
Counting slides (Bio-Rad Laboratories, catalog number: 1450011 )
Eppendorf tubes (1.5 ml) (Eppendorf, catalog number: 0030120086 )
Tuberculin syringe (1 ml) (BD, catalog number: 300841 )
BD 1 ml syringe (BD, catalog number: 309628 )
BD PrecisionGlide needle (25 G, 0.5 x 40 mm) (BD, catalog number: 301808 )
Female athymic nude mice (6-8 week old, Fourth Military Medical University, Experimental Animal Center, BALB/c)
Phosphate buffered saline (PBS) pH 7.4 (Thermo Fisher Scientific, GibcoTM, catalog number: C10010500BT )
Trypsin-EDTA (0.25%) (Thermo Fisher Scientific, GibcoTM, catalog number: 25200072 )
Ethanol (Tianjin Fuyu Fine Chemical, catalog number: 20160916 )
RPMI 1640 medium (Thermo Fisher Scientific, GibcoTM, catalog number: C11875500BT )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10099141 )
Penicillin-streptomycin (5,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15070063 )
L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Complete 1640 medium (see Recipes)
Equipment
2-20 μl pipettes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4641060N )
20-200 μl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4641080N )
100-1,000 μl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4641100N )
Water-Jacketed CO2 incubators (Thermo Fisher Scientific, model: Model 3100 Series , catalog number: 3131)
Clean bench (Thermo Fisher Scientific, model: HeraguardTM ECO )
Centrifuge (Eppendorf, model: 5424 R )
Automated cell counter (Bio-Rad Laboratories, model: T20TM )
Microscope (Olympus, models: CX23 and BX53 )
Caliper (Mitutoyo, catalog number: 530-118 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Du, F., Zhao, X. and Fan, D. (2017). Tumorigenicity Assay in Nude Mice. Bio-protocol 7(13): e2364. DOI: 10.21769/BioProtoc.2364.
Zhao, X. D., Lu, Y. Y., Guo, H., Xie, H. H., He, L. J., Shen, G. F., Zhou, J. F., Li, T., Hu, S. J., Zhou, L., Han, Y. N., Liang, S. L., Wang, X., Wu, K. C., Shi, Y. Q., Nie, Y. Z. and Fan, D. M. (2015). MicroRNA-7/NF-kappaB signaling regulatory feedback circuit regulates gastric carcinogenesis. J Cell Biol 210(4): 613-627.
Download Citation in RIS Format
Category
Cancer Biology > Cancer stem cell > Animal models
Cell Biology > Cell Transplantation > Allogenic Transplantation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,365 | https://bio-protocol.org/exchange/protocoldetail?id=2365&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Oxidative Stress Assays (arsenite and tBHP) in Caenorhabditis elegans
Collin Yvès Ewald
JH John M. Hourihan
TB T. Keith Blackwell
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2365 Views: 11720
Edited by: Peichuan Zhang
Reviewed by: Tugsan TezilMichael Enos
Original Research Article:
The authors used this protocol in 13-Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
13-Jan 2017
Abstract
Cells and organisms face constant exposure to reactive oxygen species (ROS), either from the environment or as a by-product from internal metabolic processes. To prevent cellular damage from ROS, cells have evolved detoxification mechanisms. The activation of these detoxification mechanisms and their downstream responses represent an overlapping defense response that can be tailored to different sources of ROS to adequately adapt and protect cells. In this protocol, we describe how to measure the sensitivity to oxidative stress from two different sources, arsenite and tBHP, using the nematode C. elegans.
Keywords: Hydrogen peroxide ROS Xenobiotics SKN-1 DAF-16
Background
Reactive oxygen species (ROS) are small molecules that can damage DNA, proteins, lipids and other cellular components. Systemic levels of ROS induce irreversible cellular damage, which has been implicated in the etiology of aging and age-related diseases, such as Alzheimer’s disease, atherosclerosis, and diabetes. Furthermore, environmental toxins such as pollutants, smoke, chemicals, radiation, and xenobiotics significantly induce ROS formation. To protect against oxidative damage, cells have evolved complex mechanisms that detoxify ROS. Interestingly, long-lived animals show an enhancement of these protective mechanisms, implicating their importance for healthy aging.
The multicellular organism C. elegans has been instrumental in elucidating the molecular mechanisms that protect against ROS (Blackwell et al., 2015). In C. elegans, the major ROS detoxification mechanisms are initiated by the transcription factor SKN-1, the orthologue of the Nrf (nuclear factor-erythroid-related factor) proteins (Blackwell et al., 2015). Exposing C. elegans to either the metalloid sodium arsenite (As) or tert-Butyl hydroperoxide (tBHP; an organic peroxide) activates SKN-1, which promotes survival. Although overlapping sets of genes are upregulated by SKN-1 in response to As or tBHP, there are also condition-specific gene sets that tailor the oxidative stress response (Oliveira et al., 2009). Moreover, the expression of almost all detoxification genes in response to As depends on SKN-1, whereas the induction of several genes upon tBHP-treatment is also independent of SKN-1 (Oliveira et al., 2009), suggesting the activation of other oxidative stress response transcription factors. How different ROS sources are sensed and integrated is not well understood, but recently a mechanism has been elucidated for how As-induced ROS are generated and sensed by the cell (Hourihan et al., 2016).
Treating C. elegans with As activates the BLI-3/NADPH oxidase complex to produce localized pools of ROS, which modify a cysteine in the IRE-1 kinase and induce the SKN-1-dependent antioxidant response leading to lifespan extension (Hourihan et al., 2016). Further supporting the function of localized ROS levels as cell signals, recent work has identified a novel regulator of aging, MEMO-1, which increases resistance to As toxicity and facilitates lifespan extension in a BLI-3- and SKN-1-dependent manner (Ewald et al., 2017).
Taken together, oxidative stress responses can be induced directly, by exogenously added ROS sources such as tBHP, or as a secondary response to a chemical (such as As) or other stress leading to increased ROS levels. These two ROS sources elicit common, but also distinct downstream stress-response genes and protection mechanisms. Here, we describe the protocols for both ROS sources to assess C. elegans survival under these oxidative stress conditions.
Part I. Protocol for As stress tolerance assay
Materials and Reagents
Pipette tips
24-well plates (Multiwell Culture Plate 24 well fl. NUNC, clear)
C. elegans strains (available at Caenorhabditis Genetics Center [CGC] https://cbs.umn.edu/cgc/home)
Nematode growth medium (NGM) culturing C. elegans plates (He, 2011) seeded with bacteria (OP50) grown overnight (300 μl OP50 per plate)
M9 buffer (Physiological buffer for C. elegans; [He, 2011])
Sodium arsenite solution volumetric, 0.05 M NaAsO2 (Honeywell International, catalog number: 35000 )
Agar (He, 2011)
Phosphate buffer (He, 2011)
Calcium chloride (CaCl2) (He, 2011)
Magnesium sulfate (MgSO4) (He, 2011)
Cholesterol (He, 2011)
Equipment
Pipettes
Stereomicroscope
Worm pick
Procedure
Day 0 (Monday): Using the worm pick (Figure 1), transfer larval 4 stage (L4) worms onto fresh NGM culturing plate (He, 2011). Store these worms overnight at 20 °C.
Note: You need about 50 L4 worms per strain; e.g., 10-12 for each of the triplicates with As and for the control condition (M9 buffer only).
Figure 1. Material for the As-survival assay
Day 1 (Tuesday): Put 50 μl of M9 buffer into each well of a 24-well plate. See Figure 2 for loading scheme. Place 10-12 one-day-old worms into the M9 (Figure 3 and Video 1). You need 3 wells per strain for As and 1 well for M9 buffer as a control. When all worms are set, fill wells with either 450 μl of 5.56 mM As (for a final concentration of 5 mM As dissolved in M9) or M9.
Score every hour for worm survival. (Exploded animals need to be excluded from the statistics.)
Important: The 5 mM As in M9 dilution must be prepared fresh directly before you put it into the wells.
Figure 2. Loading scheme for the As response assay. WT = wild type, Mut = mutant.
Figure 3. Transferring worms into the drop of M9 buffer in the 24-well plates
Note: When transferring worms into the 50 μl M9 buffer drop in the well, worms may become injured by scratching the worms off the worm pick. Check and exclude non-moving worms (Video 1) before filling up wells with the As solution.
Video 1. Loading C. elegans into 24-well plates for the arsenite oxidative stress assay. 10-12 C. elegans were transferred into a well of the 24-well plate that contains a 50 μl drop of M9. Worms should be freely trashing. Exclude non-moving worms (marked in Figure 3) before filling up wells with the As solution.
Data analysis
For As-assay, the estimates of the survival functions are calculated by using the product-limit (Kaplan-Meier) method (Figure 4 and Table 1). The log-rank (Mantel-Cox) method is used to test the null hypothesis and calculate P-values. Data were analyzed using JMP statistical software from SAS.
Figure 4. Survival plot of As-assay. Loss-of-function mutation in skn-1 (green curve) makes these animals more sensitive to 5 mM As, whereas reduction-of-function mutation in daf-2 (red curve) makes animals more resistant to 5 mM As (Ewald et al., 2015). For statistical details, please see Table 1.
Table 1. Statistics for As-assay
Part II. Protocol for tBHP oxidative stress assay
Materials and Reagents
Pipette tips
6 cm Petri dishes (He, 2011)
Protective gloves
Luperox® TBH70X, tert-Butyl hydroperoxide solution 70% in H2O (Sigma-Aldrich, catalog number: 458139 )
Note: tert-Butyl hydroperoxide (tBHP) is an organic peroxide widely used in a variety of oxidation processes. tBHP has an advantage over hydrogen peroxide in that it is less labile. However, tBHP plates should be stored in an airtight container and used within 24 h. tBHP is normally supplied as a 69-70% aqueous solution.
Safety Warning: tert-Butyl hydroperoxide is an exceptionally dangerous chemical that is highly reactive, flammable and toxic. It is corrosive to skin and mucous membranes and causes respiratory distress when inhaled.
Nematode growth medium (NGM) culturing C. elegans plates (He, 2011) seeded with bacteria (OP50) grown overnight (300 μl OP50 per plate)
Agar (He, 2011)
Phosphate buffer (He, 2011)
Calcium chloride (CaCl2) (He, 2011)
Magnesium sulfate (MgSO4) (He, 2011)
Cholesterol (He, 2011)
Equipment
Pipettes
Face mask
Safety goggles
Worm pick
Fume hood
Stereomicroscope
Software
SAS JMP statistical software
Procedure
Day 0 (Monday): Pick L4 worms onto fresh NGM culturing plate (He, 2011) seeded with OP50 bacteria.
Note: You need 60 L4 worms per strain; 20 worms per tBHP plate, triplicates.
Day 1 (Tuesday): Prepare tBHP plates (see Recipe 1).
Place agar in dH2O to get a 4% agar solution (100 ml agar = 6 plates) and heat up to solve. Let agar solution cool down (50-60 °C) until you can hold it with your hand and hold it against your wrist, put gloves on, then add all solutions (phosphate buffer, CaCl2, MgSO4, and cholesterol). Shake this briefly to avoid the formation of CaSO4 precipitate and in the end the tBHP in the fume hood. Pour the plates by hand (equal amounts, so that bottom is filled). Place the plates in an airtight box to seal them, and they will be ready for use the next day.
Day 2 (Wednesday): Pick 20 two-day-old adults onto the tBHP plates (Figure 5). Remember to wear protective gloves, safety goggles, and face mask.
Figure 5. Materials for the tBHP-survival assay
Important: Worms will try to run off the plate (Figure 6). Hence, for the first two hours you need to shuffle worms back into the center of the plate. Therefore, immediately after you put the worms on the tBHP plates, start looking at your first plates again for ‘escaping worms’. We typically assay 4 strains in parallel allowing enough time to shuffle worms back into the center of all 12 plates in a reasonable time.
Score survival every hour. (Exclude exploded animals from the statistics.)
Figure 6. Scoring tBHP plates. A. Shows starting place of worms with a scoop of OP50 bacterial food that attracts them so that they stay a little bit longer in the center of the plate. B. Shows how worms start to run off the plates after several minutes. They try to get away from the tBHP in the plate and usually run off the agar onto the plastic of the petri dish, where they dry out. After two hours, wild-type worms on tBHP will cease crawling around.
Data analysis
For tBHP assay, the estimates of survival functions are calculated by using the product-limit (Kaplan-Meier) method (Figure 7 and Table 2). The log-rank (Mantel-Cox) method is used to test the null hypothesis and calculate P-values. Data were analyzed using JMP statistical software from SAS.
Figure 7. Survival plot of tBHP-assay. RNAi knockdown of daf-2 (red curve) makes wild-type animals more resistant to 15.4 mM tBHP compared to wild-type animals treated with L4440 empty vector control RNAi (Ewald et al., 2015).
Table 2. Statistics for tBHP-assay
Notes
We want to note that while the protocols described here work reproducibly well, many variations have previously been described, including whether the animals have been provided with food. Different variations can be found in papers from (An and Blackwell, 2003; Tullet et al., 2008; Oliveira et al., 2009; Wang et al., 2010; Robida-Stubbs et al., 2012). The protocols described here are based upon and optimized from this previous work, and have recently been used in (Ewald et al., 2015; Steinbaugh et al., 2015; Hourihan et al., 2016; Ewald et al., 2017).
Recipes
tBHP plates
100 ml 4% agar dissolved in dH2O
2.5 ml phosphate buffer
100 μl CaCl2
100 μl MgSO4
160 μl cholesterol
214 μl tBHP [Stock = 70%] hence, final concentration = 15.4 mM
Acknowledgments
We thank the Blackwell and Ewald lab for developing and refining these assays. Picture and movie credit for Nadine Herrmann and Eline Jongsma (ETH Zurich).
References
An, J. H. and Blackwell, T. K. (2003). SKN-1 links C. elegans mesendodermal specification to a conserved oxidative stress response. Genes Dev 17(15): 1882-1893.
Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y. and Isik, M. (2015). SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radic Biol Med 88(Pt B): 290-301.
Ewald, C. Y., Hourihan, J. M., Bland, M. S., Obieglo, C., Katic, I., Moronetti Mazzeo, L. E., Alcedo, J., Blackwell, T. K. and Hynes, N. E. (2017). NADPH oxidase-mediated redox signaling promotes oxidative stress resistance and longevity through memo-1 in C. elegans. Elife 6.
Ewald, C. Y., Landis, J. N., Porter Abate, J., Murphy, C. T. and Blackwell, T. K. (2015). Dauer-independent insulin/IGF-1-signalling implicates collagen remodelling in longevity. Nature 519(7541): 97-101.
He, F. L. (2011). Common worm media and buffers. Bio-protocol Bio101: e55.
Hourihan, J. M., Moronetti Mazzeo, L. E., Fernandez-Cardenas, L. P. and Blackwell, T. K. (2016). Cysteine sulfenylation directs IRE-1 to activate the SKN-1/Nrf2 antioxidant response. Mol Cell 63(4): 553-566.
Oliveira, R. P., Porter Abate, J., Dilks, K., Landis, J., Ashraf, J., Murphy, C. T. and Blackwell, T. K. (2009). Condition-adapted stress and longevity gene regulation by Caenorhabditis elegans SKN-1/Nrf. Aging Cell 8(5): 524-541.
Robida-Stubbs, S., Glover-Cutter, K., Lamming, D. W., Mizunuma, M., Narasimhan, S. D., Neumann-Haefelin, E., Sabatini, D. M. and Blackwell, T. K. (2012). TOR signaling and rapamycin influence longevity by regulating SKN-1/Nrf and DAF-16/FoxO. Cell Metab 15(5): 713-724
Steinbaugh, M. J., Narasimhan, S. D., Robida-Stubbs, S., Moronetti Mazzeo, L. E., Dreyfuss, J. M., Hourihan, J. M., Raghavan, P., Operana, T. N., Esmaillie, R. and Blackwell, T. K. (2015). Lipid-mediated regulation of SKN-1/Nrf in response to germ cell absence. Elife 4.
Tullet, J. M., Hertweck, M., An, J. H., Baker, J., Hwang, J. Y., Liu, S., Oliveira, R. P., Baumeister, R. and Blackwell, T. K. (2008). Direct inhibition of the longevity-promoting factor SKN-1 by insulin-like signaling in C. elegans. Cell 132(6): 1025-1038.
Wang, J., Robida-Stubbs, S., Tullet, J. M., Rual, J. F., Vidal, M. and Blackwell, T. K. (2010). RNAi screening implicates a SKN-1-dependent transcriptional response in stress resistance and longevity deriving from translation inhibition. PLoS Genet 6(8).
Copyright: Ewald et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Ewald, C. Y., Hourihan, J. M. and Blackwell, T. K. (2017). Oxidative Stress Assays (arsenite and tBHP) in Caenorhabditis elegans. Bio-protocol 7(13): e2365. DOI: 10.21769/BioProtoc.2365.
Ewald, C. Y., Hourihan, J. M., Bland, M. S., Obieglo, C., Katic, I., Moronetti Mazzeo, L. E., Alcedo, J., Blackwell, T. K. and Hynes, N. E. (2017). NADPH oxidase-mediated redox signaling promotes oxidative stress resistance and longevity through memo-1 in C. elegans. Elife 6.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling > Stress response
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,366 | https://bio-protocol.org/exchange/protocoldetail?id=2366&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Thermal Stability of Heterotrimeric pMHC Proteins as Determined by Circular Dichroism Spectroscopy
AF Anna Fuller
AW Aaron Wall
MC Michael D Crowther
AL Angharad Lloyd
AZ Alexei Zhurov
AS Andrew K. Sewell
DC David K. Cole
Konrad Beck
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2366 Views: 8272
Edited by: Jia Li
Reviewed by: Ana Santos AlmeidaPalash Kanti Dutta
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
T cell receptor (TCR) recognition of foreign peptide fragments, presented by peptide major histocompatibility complex (pMHC), governs T-cell mediated protection against pathogens and cancer. Many factors govern T-cell sensitivity, including the affinity of the TCR-pMHC interaction and the stability of pMHC on the surface of antigen presenting cells. These factors are particularly relevant for the peptide vaccination field, in which more stable pMHC interactions could enable more effective protection against disease. Here, we discuss a method for the determination of pMHC stability that we have used to investigate HIV immune escape, T-cell sensitivity to cancer antigens and mechanisms leading to autoimmunity.
Keywords: Peptide-MHC stability Circular dichroism Thermal stability T-cells Peptide vaccines Recombinant protein Protein folding
Background
The ability of CD8+ T-cells to respond to foreign invaders or dysregulated self is dependent on stable pMHC class I (pMHCI) presentation at the cell surface. Structurally, MHCI molecules form a peptide binding groove formed of two parallel α helices with a floor of β sheets at the interface between the α1 and α2 domains (Latron et al., 1992). The peptide binding groove has primary peptide binding pockets (B and F) that tightly interact with specific amino acids towards the N- and C-terminals of bound peptides. Although these pockets can accommodate a range of amino acids, they exhibit preferences for certain side chains that have been characterized using structural and biochemical approaches (Parker et al., 1992). This information has been used to generate so called ‘heteroclitic’ peptides in which natural peptides that have poor MHC-anchors can be modified with amino acids that bind optimally to MHC for vaccination (Cole et al., 2010). Moreover, pMHC stability has been linked to HIV immune escape (Bronke et al., 2013) and the selection of autoreactive T-cell clones (Yin et al., 2011). Thus, understanding the mechanisms that control pMHC stability is important for therapeutic design and understanding complex human diseases. Here, we developed a protocol to accurately determine pMHC stability using circular dichroism spectroscopy. We have used this technique, together with structural, biophysical and cellular experiments, to provide new insight into the molecular factors that determined T-cell antigen recognition in the context of a range of human diseases (Kløverpris et al., 2015; Knight et al., 2015; Motozono et al., 2015; Cole et al., 2016; Jones et al., 2016; Cole et al., 2017).
Materials and Reagents
Cellulose nitrate 0.45 µm filter papers (Sartorius, catalog number: 11306-47-N )
1.2 µm glass microfiber filters (GE Healthcare, catalog number: 1822-070 )
10 ml plastic syringes, Luer slip BD Plastipak (BD, catalog number: 302188 )
25 G needle (BD, catalog number: 300600 )
1 ml plastic syringes, Luer slip BD Plastipak (BD, catalog number: 303172 )
1.5 ml microcentrifuge tubes
Amicon centrifugal concentrating tubes 4 ml MWCO 10 kDa (Merck, catalog number: UFC801096 )
Phosphate buffered saline (PBS) made up from Dulbecco A tablets (137 mM NaCl, 3 mM KCl, 8 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.3) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: BR0014G )
Ultrapure water (> 18 MΩ cm) for buffer preparations
Bolt® Bis-Tris 4-12% precast gels (Thermo Fisher Scientific, InvitrogenTM, catalog number: NW04120BOX )
BlUeye prestained protein markers (Geneflow, catalog number: S6-0024 )
Quick Coomassie Stain (Generon, catalog number: GEN-QC-STAIN-3L )
Ethanol absolute (200 Proof)
Nitric acid (HNO3), 70%
Equipment
Reusable bottle top filtration device (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: DS0320-5045 )
Vacuum pump such as KNF Neuberger Vaccum Pump (KNF Neuberger, catalog number: 049268/018121 )
500 ml clear Duran bottles (Duran, catalog number: GL 45 )
Liquid Chromatography system, with a 2 ml injection loop, and a fraction collector; we use the ÄKTA pure 25 L with an F9-R fraction collector (GE Healthcare, model: ÄKTA pure 25 L )
Size exclusion chromatography column; we use a Superdex 200 Increase 10/300 GL column, bed volume 24 ml (GE Healthcare, catalog number: 28990944 )
Benchtop refrigerated micro-centrifuge capable of 14,000 x g (e.g., Eppendorf, model: 5418 R )
Far-UV spectrophotometer with a bandwidth < 1.8 nm and quartz cuvettes. We use a single-beam Beckman DU 800 instrument with microcells that allow measurements with volumes of 50 to 100 μl (Beckman Coulter, model: DU® 800 )
A far-UV circular dichroism (CD) spectrometer with a temperature controlled cell holder. We use an AVIV Model 215 instrument (Aviv Biomedical, model: Aviv Model 215 ) with a single cell Peltier controlled cell holder, or make use of the Module B end-station spectrophotometer at the B23 Synchrotron Radiation CD (Diamond Light Source, model: B23 ) Beamline at the Diamond Light Source (Jávorfi et al., 2010; Cole et al., 2016). Alternative instruments are available from Applied Photophysics Ltd (Leatherhead, U.K.), JASCO Inc. (Easton, MD), and Olis Inc. (Bogart, GA)
Strain free sealable quartz cuvettes of appropriate path length fitting the CD instrument’s cell holder. We use Teflon stoppered Hellma Suprasil cells of various thickness, mostly 0.1-cm
A well-ventilated chemical fume hood should be accessible for cleaning cuvettes with HNO3
Software
An analysis software that can import the CD data files and allows curve fitting to a user defined set of equations is required. We use Origin version 7.5 and later (OriginLab Corp., Northampton, MA), but many other programs. e.g., Igor Pro, MATLAB, Micromath Scientist, SigmaPlot, etc. will work
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fuller, A., Wall, A., Crowther, M. D., Lloyd, A., Zhurov, A., Sewell, A. K., Cole, D. K. and Beck, K. (2017). Thermal Stability of Heterotrimeric pMHC Proteins as Determined by Circular Dichroism Spectroscopy. Bio-protocol 7(13): e2366. DOI: 10.21769/BioProtoc.2366.
Download Citation in RIS Format
Category
Immunology > Immune cell staining > Immunodetection
Cell Biology > Cell staining > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,367 | https://bio-protocol.org/exchange/protocoldetail?id=2367&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Qualitative and Quantitative Assay for Detection of Circulating Autoantibodies against Human Aortic Antigen
BV Brent Veerman
Ritu Chakravarti
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2367 Views: 9390
Edited by: Jia Li
Reviewed by: Porkodi Panneerselvam
Original Research Article:
The authors used this protocol in July 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
July 2015
Abstract
Increased amount of autoantibodies in human sera are the hallmark of autoimmune diseases (Wang et al., 2015). In case of known antigen, detection of autoantibodies is done using laboratory based methods. However, in most autoimmune diseases, knowledge of self-antigen is still vague. We have developed an ELISA-based quantitative assay to detect the presence of autoantibodies as well as to measure the circulating autoantibodies in the sera of patients suffering from large vessel vasculitis (LVV), an autoimmune disease (Chakravarti et al., 2015). Using this assay, we detected the increase in anti-aortic antibodies in LVV patient’s sera. We have further verified the results by independent biochemical techniques and found the specificity to be > 94% (Chakravarti et al., 2015). This method can be uniquely modified to suit any autoimmune, in particular organ specific, disease and thus has wider applications in the detection and quantification of autoantibodies.
Keywords: ELISA Autoantigen Autoantibody Vasculitis Serum Autoimmune disease
Background
There are about 80-100 autoimmune diseases wherein immune cells recognize a self-protein as a foreign antigen, and get activated to generate humoral response. Though the trigger for most autoimmune diseases remains a mystery, presence of higher levels of antibodies in the patient’s sera is very common (Wang et al., 2015). Some of the examples include antibodies against neutrophil cytoplasmic antigens in small vessel vasculitis, myelin basic protein in multiple sclerosis, glutamate decarboxylase in type 1 diabetes etc. (Wang et al., 2015). Limited knowledge of autoantigen in most autoimmune diseases presents a challenge for both the detection of disease as well as understanding the pathogenesis. However, ability to detect autoantibodies in the sera provides a diagnostic and prognostic advantage. Discovering a reliable autoantigen in autoimmune diseases are needed to make better clinical decisions. LVV is a spectrum of autoimmune diseases affecting aorta or its primary branch vessels. Like many others, its etiology and cure are not known (Buttgereit et al., 2016). We have developed a qualitative and quantitative assay to detect the presence of autoantibody in the human sera targeting against the human aortic antigen. Our assay provides a tool to find autoantigen in any affected/damaged tissue and in any disease model. We looked for the presence of autoantigen in the human thoracic aortic aneurysms using patients’ sera and tested the specificity of the assay by comparing the sera obtained from related subsets of autoimmune or non-immune diseases. We utilized discarded aortic tissues from aortic reconstruction surgeries and made soluble extracts of aorta to set up the assay (Figure 1). Using this method we performed a high throughput screen for detecting autoantibody in more than 100 sera against aortic antigen (Chakravarti et al., 2015).
Figure 1. Schematic Flow Diagram of ELISA to detect autoantibody in human tissue lysates. Step-by-step outline of the method used to detect and quantify autoantibodies present in the sera against antigen present in tissue.
Materials and Reagents
5 ml sterile polystyrene round bottom tubes (Corning, Falcon®, catalog number: 352008 )
1.5 ml Eppendorf tubes (USA Scientific, catalog number: 1615-5500 )
15 ml centrifuge tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339650 )
Greiner 96 well, F-Bottom, clear microplate (Greiner Bio One International, catalog number: 655001 )
200 μl pipette tip (USA Scientific, catalog number: 1111-1700 )
1,250 μl pipette tip (USA Scientific, catalog number: 1112-1720 )
Immulon 2 HB: high affinity protein binding plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3455 )
Paper towel
Human Specimen
Note: Human tissue explant as well as sera should be collected under institutionally approved IRB protocol.
Protease
Phosphatase inhibitor (PhosSTOP) (Roche Diagnostics, catalog number: 04906837001 )
Protein Assay dye (Bio-Rad Laboratories, catalog number: 5000006 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9418 )
Phosphate-buffered saline-Tween (PBS-T) (Fisher Scientific, catalog number: BP293810 )
Antibodies:
Anti-Human IgG (used at 1:5,000) (Thermo Fisher Scientific, Invitrogen, catalog number: 31135 )
HRP-conjugated secondary antibodies (used at 1:3,000) (Bio-Rad Laboratories, catalog numbers: 1706516 )
Ultra-TMB (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 34029 )
2 N HCl (Fisher Scientific, catalog number: SA431-500 )
Tris buffer, pH 7.4 (Fischer Scientific, catalog number: BP152-1 )
Sodium chloride (NaCl) (Sigma-Aldrich, product number: S9888 )
Triton X-100 (Bio-Rad Laboratories, catalog number: 1610407 )
Sodium orthovanadate (Sigma-Aldrich, catalog number: S6508 )
Sodium fluoride (Sigma-Aldrich, catalog number: 919 )
Glycerophosphate (Sigma-Aldrich, catalog number: G9422 )
Sodium pyrophosphate (Sigma-Aldrich, catalog number: P8010 )
Non-fat dry milk powder (Bio-Rad Laboratories, catalog number: 1706404 )
Cell lysis buffer (see Recipes)
Blocking buffer (see Recipes)
Equipment
2-20 μl pipettes (Alkali Scientific, catalog number: P9280-20U )
20-200 μl pipettes (Alkali Scientific, catalog number: P9280-200U )
Scissors (Fisher Scientific, catalog number: 08-951-20 )
Table top centrifuge (Labnet International, model: PrismRTM R, catalog number: C2500-R )
Orbital shaker (Benchmark Scientific, model: BT302 )
Refrigerator
Plate reader (BMG LABTECH, model: FLUstar Omega )
Homogenizer (Thomas Scientific, model: SCILOGEX D160 )
Software
MS Excel
GraphPad Prism 7
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Veerman, B. and Chakravarti, R. (2017). Qualitative and Quantitative Assay for Detection of Circulating Autoantibodies against Human Aortic Antigen. Bio-protocol 7(13): e2367. DOI: 10.21769/BioProtoc.2367.
Download Citation in RIS Format
Category
Immunology > Antibody analysis > Antibody detection
Biochemistry > Protein > Quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,368 | https://bio-protocol.org/exchange/protocoldetail?id=2368&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of a Cellular Reporter for Functional BRD4 Inhibition
Sara Sdelci
SK Stefan Kubicek
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2368 Views: 6039
Edited by: Yanjie Li
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
The ubiquitously expressed bromodomain-containing protein 4 (BRD4) is an epigenetic reader, which recruits transcriptional regulatory complexes to acetylated chromatin. Because of its role in enhancing proliferation, BRD4 has become a therapeutic target in oncology, as the inhibition of this protein leads to the reduction of the growth of many tumours. Even though BRD4 is more and more studied, its mechanism of action has not been fully described yet. Therefore, we aimed at generating a cellular reporter system to monitor BRD4 inhibition. Such reporter can be potentially used in high throughput chemical and genetic screenings, in order to uncover new possible BRD4 functional pathways. The deeper understanding of the mechanism of action of BRD4 activity will certainly help in developing new therapy strategies for those cancers so called BRD4-dependent.
Keywords: Cellular chromatin reporters Epigenetic Chromatin reorganization Heterochromatinization BRD4
Background
Research in the epigenetic field has recently highlighted the central role of BRD4 in cancer progression. BRD4 is an acetyl-lysine reader of the BET (bromodomain and extraterminal domain) family (Dey et al., 2003; Filippakopoulos et al., 2012; Wang et al., 2012) able to bind to acetylated histones at promoter and enhancer regions (Dey et al., 2003; Filippakopoulos et al., 2012; Nagarajan et al., 2014). The mechanism of action of this epigenetic reader consists in the activation of gene promoters and enhancers by recruiting several transcription factors, cofactors and RNA polymerase II (RNApol II), which results in modulating, mostly enhancing, the transcription of certain target genes. The BRD4-histone module has been described to play a key role regulating cell cycle progression (Dey et al., 2003; Wu and Chiang, 2007; Yang et al., 2008; Devaiah and Singer, 2013) and genomic structure and stability (Wu and Chiang, 2007; Floyd et al., 2013); for those reasons, BRD4 has frequently been associated with cancer development and progression (Yang et al., 2008; Zuber et al., 2011; Nagarajan et al., 2014; Wu et al., 2015).
Chromatin reporter cell lines have been already developed in order to identify modulators of position effect variegation (Tchasovnikarova et al., 2015) or to discover new chromatin-targeting compound (Johnson et al., 2008; Best et al., 2011; Wang et al., 2013). In contrast to previous approaches, we wanted to develop a protocol for the generation of a reporter cell line able to monitor the BRD4-dependent heterochromatization of a generic reporter. To achieve that, we used a common retroviral vector carrying an RFP (Red Fluorescent Protein) gene, and selected clones that integrated it in fully repressed genomic regions specifically reactivated by BRD4 inhibition. The haploid nature of the cell line used (KBM7 [Andersson et al., 1995]), makes the reporter easily amenable not only to chemical screens, but also to genetic screens. Both methods can be used for the identification of new BRD4 direct and functional partners, and results from these approaches will provide further insights into BRD4 biology.
Materials and Reagents
Pipette tips
6-well plates, tissue culture treated (Corning, Costar®, catalog number: 3506 )
15 ml Falcon® conical centrifuge tube (Corning, Falcon®, catalog number: 352196 )
0.45 μm syringe filters (VWR, catalog number: 514-8021 )
24-well plates, tissue culture treated (STARLAB INTERNATIONAL, catalog number: CC7682-7524 )
96-well plates, tissue culture treated (Corning, catalog number: 3598 )
Viewplate-96 black, optically clear bottom, tissue culture treated, sterile, 96-Well with lid (PerkinElmer, catalog number: 6005182 )
10 cm plates, tissue culture treated (Corning, catalog number: 430167 )
293T cell line (ATCC, catalog number: CRL-3216 )
KBM7 cell line (Chronic Myeloid Leukaemia) (Horizon Discovery, catalog number: C628 )
Fluorescent reporter vector (LZRS-RFP-ires-ZEO retroviral vector, a gift from S. Nijman Lab, Ludwig Cancer Research, Oxford)
Packaging vector (e.g., pCMV-Gag-Pol retroviral vector, Addgene, catalog number: 14887 ; pCMV-VSV-G envelope vector, Addgene, catalog number: 8454 )
DMEM media (Thermo Fisher Scientific, GibcoTM, catalog number: 41965039 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10500064 )
Lipofectamine 2000 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668019 )
Opti-MEM
IMDM media (Thermo Fisher Scientific, GibcoTM, catalog number: 21980032 )
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190094 )
(S)-JQ1 (MedChemExpress, catalog number: HY-13030 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Equipment
Pipettes (Gilson)
Cell culture centrifuge (Sigma Laborzentrifugen, model: 3-18K , catalog number: 10290)
FACS (BD, BD Bioscience, model: BD FACSCALIBUR )
FACS sorter (BD, BD Biosciences, model: BD FACSAria )
Fluorescence microscope (PerkinElmer, model: HH12000000 )
Cell culture hood (Thermo Fisher Scientific, model: HerasafeTM KS , catalog number: 51022515)
Cell culture incubator (Eppendorf, model: Galaxy® 170 R , catalog number: CO170R-230-1000)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sdelci, S. and Kubicek, S. (2017). Generation of a Cellular Reporter for Functional BRD4 Inhibition. Bio-protocol 7(13): e2368. DOI: 10.21769/BioProtoc.2368.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Protein
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,369 | https://bio-protocol.org/exchange/protocoldetail?id=2369&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Novel Mouse Skin Graft Model of Vascular Tumors Driven by Akt1
Thuy L. Phung
SA Sriram Ayyaswamy
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2369 Views: 10232
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
To investigate whether endothelial Akt1 activation is sufficient to induce vascular tumor formation in the skin, we have developed a skin graft model in which a skin fragment from transgenic donor mice with inducible and endothelial cell-specific overexpression of activated Akt1 (myrAkt1) is grafted into the skin of wild type recipient mice. The donor skin successfully engrafts after two weeks and, more importantly, vascular tumor develops at the site of transgenic skin graft when myrAkt1 expression is turned on. This skin graft model is a novel approach to investigate the biological impact of a key signal transduction molecule in a temporal, localized and organ-specific manner.
Keywords: Vascular tumors Akt Skin graft Hemangioma Animal model
Background
Our research focuses on investigating the role of Akt1 in vascular tumor development. To determine whether the activation of Akt1 in endothelial cells is sufficient to drive de novo vascular tumor formation, we have developed and published a skin graft model of vascular tumor (Phung et al., 2015). We developed the current protocol of grafting skin from transgenic mice onto the skin of wild type mice because this is a way to study the localized and skin-specific effects of the overexpression of constitutively active Akt1 in the vasculature. We have observed that overexpression of Akt1 in the systemic vasculature leads to generalized edema in the lungs and skin, resulting in premature death of transgenic animals within days due to massive pulmonary edema. A procedure to graft transgenic skin onto wild type host mouse allows one to examine the long-term effects of Akt1 overexpression in only the transgenic skin vasculature without the lethality associated with systemic Akt1 overexpression. In our studies, we are particularly interested in investigating the long-term effects of Akt1 in the skin vasculature on the development of vascular tumors based on the hypothesis that hyperactivation of Akt1 in endothelial cells is sufficient to induce vascular tumor formation, thus demonstrating the endothelial cell-autonomous effects of Akt1 in these tumors.
In the model, skin from double transgenic mice with inducible expression of activated Akt1 (myrAkt1) in endothelial cells is grafted onto the back of immunodeficient nu/nu recipient mice. Since myrAkt1 expression is inducible, we can turn off myrAkt1 expression at will by giving the animals tetracycline in their drinking water, and we can turn on myrAkt1 expression by removing tetracycline from the water. A detailed description of the myrAkt1 double transgenic mice has been published (Sun et al., 2005). A schematic of the construction of these mice is shown (Figure 1). Using the skin graft model, we were able to demonstrate that expression of myrAkt1 in endothelial cells is sufficient for the development of vascular tumor. The procedural steps of this model are described below.
Figure 1. myrAkt1 double transgenic mouse model. The VE-Cad:tTA mouse line contains the VE-cadherin promoter cloned upstream of the tetracycline-regulated transcriptional activator (tTA) gene. VE-cadherin promoter is mainly active in endothelial cells. The TET:myrAkt1 line carries a constitutively activated Akt1 with an HA tag (myrAk1) under the control of the tetracycline responsive promoter (TET). To suppress myrAkt1 expression in the double transgenic mice, 1.5 mg/ml tetracycline with 5% sucrose is given to the mice in their drinking water. To turn on myrAkt1 expression, the mice are given pure water without tetracycline. In this system, double transgenic mice express myrAkt1 in endothelial cells, and the expression of myrAkt1 can be regulated with tetracycline (Reference: Sun JF, Phung T, Shiojima I, Felske T, Upalakalin JN, Feng D, Kornaga T, Dor T, Dvorak AM, Walsh K, Benjamin LE. Microvascular patterning is controlled by fine-tuning the Akt signal. Proc Natl Acad Sci USA 2005; 02: 128-33).
Materials and Reagents
Sterile surgical gloves
10 mm skin punch biopsy instrument (Acu-Punch Biopsy Punch 10 mm) (Acuderm, catalog number: P1025 ) (Figure 2)
Figure 2. A 10-mm punch biopsy instrument
Ethilon non-absorbable nylon suture, 5-0 PC-3 (Ethicon, catalog number: 1965G )
Sterile surgical towel drape (Steri-Drape) (3M, catalog number: 1010 )
Sterile surgical gauze (4 x 4 Gauze 8 Ply) (COVIDIEN, DermaceaTM, catalog number: 441001 )
Alcohol pads (WebCol Alcohol Prep) (COVIDIEN, catalog number: 6818 )
Donor mice (females, 6-8 weeks old transgenic mice, see reference for the generation of transgenic mice: Sun JF, Phung T, Shiojima I, Felske T, Upalakalin JN, Feng D, Kornaga T, Dor T, Dvorak AM, Walsh K, Benjamin LE. Microvascular patterning is controlled by fine-tuning the Akt signal. Proc Natl Acad Sci U S A 2005; 102: 128-33)
Recipient mice (females, 6-8 weeks old nu/nu mice from Charles River Laboratories, catalog number: 490 )
Isoflurane (Sigma-Aldrich, catalog number: CDS019936 )
Phosphate buffered saline (PBS), 1x sterile solution (AMRESCO, catalog number: K812 )
Equipment
Needle holder (Halsey serrated jaws) (Roboz Surgical Instrument, catalog number: RS-7841 )
Fine single-toothed forceps (Micro dissecting tweezers Pattern 7) (Roboz Surgical Instrument, catalog number: RS-5047 )
Surgical scissors (Micro dissecting scissors) (Roboz Surgical Instrument, catalog number: RS-5910 )
Electric hair shaver (Wahl Battery Operated Compact Travel Trimmer)
Warming plate (Ala Science, catalog number: TCW220x120 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Phung, T. L. and Ayyaswamy, S. (2017). A Novel Mouse Skin Graft Model of Vascular Tumors Driven by Akt1. Bio-protocol 7(13): e2369. DOI: 10.21769/BioProtoc.2369.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Animal models
Cell Biology > Tissue analysis > Tissue imaging
Cancer Biology > General technique > Tumor formation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
237 | https://bio-protocol.org/exchange/protocoldetail?id=237&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Alkaline Phosphatase
Fanglian He
Published: Jul 20, 2012
DOI: 10.21769/BioProtoc.237 Views: 41530
Download PDF
Ask a question
Favorite
Cited by
Abstract
Alkaline phosphatase removes 5' phosphate groups from vector so that prevents self-ligation of the vector and facilitates the ligation of other DNA fragments into the vector.
Materials and Reagents
Vector DNA
Restriction enzymes (New England Biolabs)
Alkaline phosphatase: Calf intestinal alkaline phosphatase (CIP) (New England Biolabs, catalog number: M0290 ) or Shrimp Alkaline Phosphatase (SAP) (Promega Corporation, catalog number: M8201 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,370 | https://bio-protocol.org/exchange/protocoldetail?id=2370&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
EAE Induction by Passive Transfer of MOG-specific CD4+ T Cells
YT Yuki Tanaka*
YA Yasunobu Arima*
KH Kotaro Higuchi
TO Takuto Ohki
ME Mohamed Elfeky
MO Mitsutoshi Ota
DK Daisuke Kamimura
MM Masaaki Murakami
*Contributed equally to this work
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2370 Views: 11750
Reviewed by: Andrés Alloatti
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Experimental autoimmune encephalomyelitis (EAE) is an animal model of multiple sclerosis (MS), which is a chronic inflammatory disease of the central nervous system (CNS). It is characterized by focal demyelination and inflammatory responses mediated by myelin-specific autoreactive CD4+ T cells. Using a passive transfer model of EAE in mice, we have demonstrated that regional specific neural signals by sensory-sympathetic communications create gateways for immune cells at specific blood vessels of the CNS, a phenomenon known as the gateway reflex (Arima et al., 2012; Tracey, 2012; Arima et al., 2013; Sabharwal et al., 2014; Arima et al., 2015b). Here we describe protocols for passive transfer model of EAE using freshly isolated (MOG)-specific CD4+ T cells or periodically restimulated MOG-specific CD4+ T cell lines, which are suitable for tracking pathogenic CD4+ T cells in vivo, particularly in the CNS (Ogura et al., 2008; Arima et al., 2012 and 2015b).
Keywords: Experimental autoimmune encephalomyelitis Pathogenic CD4+ T cells Myelin oligodendrocyte glycoprotein Gateway reflex Passive transfer
Background
It is widely accepted that autoreactive CD4+ T cells play a significant role in the pathogenesis of MS and EAE (Reboldi, 2009; International Multiple Sclerosis Genetics et al., 2011; Steinman, 2014), which are chronic inflammatory diseases of the CNS. The CNS is protected by the blood-brain barrier (BBB), which limits immune cell infiltration from the periphery (Liu et al., 2012). Until recently, where and how CD4+ T cells enter the CNS from the peripheral blood was unclear. Although EAE can be induced by immunization of animals with CNS-autoantigens emulsified in complete Freund’s adjuvant (CFA) and pertussis toxin (PTx) (Andreasen et al., 2009; Lu et al., 2016), unwanted systemic inflammation occurs by injection of CFA and PTx, which potentially affects the integrity of the BBB (Schellenberg et al., 2012; Marbourg et al., 2017). Alternatively, we recommend a passive transfer EAE model, in which activated CD4+ T cells specific for MOG are injected into naïve mice without treatments with CFA or PTx. Using this passive transfer EAE model, we have identified the dorsal vessels of the fifth lumbar (L5) cord as an initial gateway for autoreactive CD4+ T cells to reach the CNS (Arima et al., 2012). Mechanistically, gravity-mediated constant activation of sensory neurons in the soleus muscles induces sympathetic nerve activation that connects to the L5 dorsal vessels. The resulting noradrenaline secretion at the vessels enhances NF-κB activity, leading to the production of chemokines that recruit the CNS autoreactive CD4+ T cells (Arima et al., 2012). This sensory-sympathetic communication driven by anti-gravity responses through the soleus muscles is called ‘gravity-gateway reflex’ (Arima et al., 2012; Tracey, 2012; Sabharwal et al., 2014). In addition, this passive transfer EAE model enabled us to discover that other neural activators such as weak electric stimulation or pain sensation create unique gateways for immune cells at different sites (Arima et al., 2015a and 2015b). Here, we describe detailed protocols for the passive transfer EAE model using MOG-specific CD4+ T cells, which are suitable for tracking autoreactive CD4+ T cells in vivo. Although protocols for EAE have been reported (Racke, 2001), we particularly focus on the passive transfer EAE models and describe the methods in detail. The protocols here induce a transient EAE, in which after adoptive transfer, paralyzed tail (score 1) is expected to appear around 7 days, the clinical signs peak around 10-14 days with score 2 (uneven gait) to 2.5 (one paralyzed rear leg), and then the clinical symptoms will disappear around 20-25 days (Arima et al., 2015b). In this remission phase, the mice look healthy. However, activated monocytes remain in the spinal cords, and paralysis returns upon specific neural activation including pain sensation (Arima et al., 2015b).
Materials and Reagents
Three-way connector (TERUMO Medical, catalog number: TS-TR1K )
1 ml syringe (TERUMO Medical, catalog number: SS-01T )
Needle (25 G x 1) (TERUMO Medical, catalog number: NN-2525R )
Needle (27 G x ¾) (TERUMO Medical, catalog number: NN-2719S )
Cell strainer (100 μm) (Corning, Falcon®, catalog number: 352360 )
50 ml polypropylene conical tube (Corning, Falcon®, catalog number: 352070 )
2.5 ml syringe (TERUMO Medical, catalog number: SS-02SZ )
10 cm dish (Corning, catalog number: 430167 )
Needle (18 G x 1 ½) (TERUMO Medical, catalog number: NN-1838R )
96-well U-bottom plate (Corning, catalog number: 3799 )
Nylon wool
20 ml syringe
MACS LS columns (Miltenyi Biotec, catalog number: 130-042-401 )
C57BL/6 mouse (Japan SLC)
M. Tuberculosis H37 RA (BD, catalog number: 231141 )
MOG peptide 35-55 (MEVGWYRSPFSRVVHLYRNGK) (Sigma-Aldrich), stock solution = 4 mg/ml
Incomplete Freund’s adjuvant (IFA) (Sigma-Aldrich, catalog number: F5506 )
Isoflurane (Pfizer)
Pertussis toxin from Bordetella pertussis (PTx) (Sigma-Aldrich, catalog number: P7208-50UG )
CD4 (L3T4) Microbeads, mouse (Miltenyi Biotec, catalog number: 130-049-201 )
Saline (Otsuka Pharmaceutical Factory, catalog number: 0815 )
Mouse IL-1β (BioLegend, catalog number: 575102 ), stock solution = 10 μg/ml
Mouse IL-23 (BioLegend, catalog number: 589002 ), stock solution = 10 μg/ml
Human IL-6 (Toray, order-made) stock solution = 100 μg/ml (Commercially available mouse IL-6 will work)
CellBanker (Takara Bio, Clontech, catalog number: CB021 )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: A4514 )
DDW
EDTA-2Na
Fetal bovine serum (FBS) (GE Healthcare, HyCloneTM, catalog number: SH30910.03 )
RPMI medium 1640 basic (1x) (Thermo Fisher Scientific, GibcoTM, catalog number: C11875500BT )
Penicillin/streptomycin (Sigma-Aldrich, catalog number: P4333-100ML )
2-mercaptoethanol (NACALAI TESQUE, catalog number: 21417 )
Iscove’s modified Dulbecco’s medium (Sigma-Aldrich, catalog number: I3390-500ML )
GlutaMAX-1 (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 35050061 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9625-5KG )
Potassium chloride (KCl) (Wako Pure Chemical Industries, catalog number: 163-03545 )
Sodium hydrogen phosphate (Na2HPO4) (Wako Pure Chemical Industries, catalog number: 197-02865 )
Potassium dihydrogen phosphate (KH2PO4) (Wako Pure Chemical Industries, catalog number: 169-04245 )
Red blood cell (RBC) lysis buffer (see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
MACS buffer (see Recipes)
RP10 medium (see Recipes)
Nylon wool column (see Recipes)
IM20 medium (see Recipes)
Equipment
X-ray irradiator (Hitachi, model: MBR-1520R ) or equivalent
Scissors (BONIMED, catalog number: 669-060-72 )
Micro-dissecting scissors (Karl Hammacher, catalog number: HSB 014-11 )
Angled serrated tip forceps (Karl Hammacher, catalog number: HSC 187-11 )
Pipet-aid (Corning, Falcon®, catalog number: 357471 )
Glass syringe (Tsubasa Industry, 5 ml, lock type), autoclaved
Centrifuge (Hitachi, model: CF7D2 )
Cell culture incubator, 37 °C, 5% CO2 (Panasonic Healthcare, model: MCO-175 )
Multichannel pipette
Water bath
Autoclave
Part I. Passive transfer method with MOG-specific CD4+ T cells isolated from MOG immunized mice
Procedure
MOG immunization in mice (Figure 1)
Figure 1. Making emulsion and immunization in C57BL/6 mice. A. MOG peptide (35-55) and CFA mixed at 1:1 and emulsified; B. Tail base immunization with 200 μg/100 μl emulsion.
Take sufficient volume (2 ml for 30 mice) of 4 mg/ml MOG peptide (35-55) in one glass syringe, take the same volume of CFA in the other glass syringe, and connect two syringes with a two- or three-way connector. Then, emulsify the two solutions by pushing plungers of the two syringes until the MOG/CFA solution becomes white, uniform emulsion (about 50 strokes).
Note: CFA is prepared by mixing 10 ml IFA and 2 vials of 10 mg M. Tuberculosis H37 RA.
Move all the emulsion to one-side of the glass syringe, unlock the other empty glass syringe, and attach a new disposable 1-ml syringe to the open side of the connector.
Load the emulsion to the 1-ml syringe, and put a 25 G x 1 needle for immunization.
Anesthetize a mouse with isoflurane. It is easier for injections if the body of the mouse is fixed in a restrainer (optional). Intravenously administer (i.v.) 200 ng/200 μl PTx to the tail vein of C57BL/6 mice (6-8 weeks old) with 27 G x ¾ needle, followed by immunization by subcutaneous administration (s.c.) of 200 μg/100 μl MOG peptide emulsified in CFA at tail base on day 0. Perform the PTx injection and MOG immunization on the same day.
Inject i.v. 200 ng/200 μl PTx on days 2 and 7.
Separation of CD4+ T cells from MOG immunized mice by using CD4 Microbeads.
Collect spleens from MOG immunized mice (30 mice) on day 9 or 10.
Homogenize the spleens on a cell strainer attached to a 50-ml tube using a plunger from a 2.5 ml syringe (7-8 spleens/tube, total four strainers and four 50-ml tubes are used for 30 mice). Add plain RPMI medium up to 50 ml during homogenization.
Centrifuge the tubes (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the cell pellet in 10 ml/tube (4 tubes if 30 mice are used) of RBC lysis buffer (see Recipe 1) and incubate on ice for about 1 min.
Add plain RPMI medium up to 50 ml/tube.
Centrifuge the tubes (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the pellet in 1 ml/tube of MACS buffer (see Recipe 2).
Add 100 μl/tube of CD4 MACS beads and incubate on ice for 30 min.
Add plain RPMI medium up to 50 ml/tube.
Centrifuge the tubes (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the pellet in 5 ml/tube MACS buffer (4 tubes if 30 mice are used). Use the same number of MACS LS columns as that of 50-ml tubes used. Apply the cell suspension to MACS LS columns (5 ml/column). Refer to the manufacturer guide for the use of MACS LS columns.
Wash the column with 3 ml/column of MACS buffer twice.
Note: Do not discard the flow-through cells, which are used as antigen-presenting cells.
Elute the CD4 positive selected cells with 5 ml/column MACS buffer and pool the eluted fractions to a 50 ml tube.
Centrifuge the tubes (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the CD4+ T cells in 20 ml RP10 medium (see Recipe 3) and adjust to 8 x 106 cells/ml.
Irradiation of splenocytes
Collect the flow-through cells obtained in the STEP 12 of the previous section.
Centrifuge the flow-through cells depleted of CD4+ T cells (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the cells in 10 ml of RP10 medium.
Irradiate the cells at 35 Gy, centrifuge (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the cells in 20 ml of RP10 medium and adjust to 2 x 107 cells/ml.
In vitro restimulation and adoptive transfer
Co-culture 4 x 107 cells CD4+ T cells and 1 x 108 irradiated splenocytes in 10 ml RP10 medium in a 10-cm dish containing 2 ng/ml IL-23 and 25 μg/ml MOG peptide for 2 days.
Add 10 ml RP10 medium in each dish on day 1.
Collect the cells by pipetting up and down on day 2, centrifuge (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the cells in 10 ml RP10 medium pre-warmed at 37 °C and add the suspension to a nylon wool column (see Recipe 4) (Video 1).
Note: Put an 18 G x 1 ½ inches needle to a nylon wool column, and stand the column in a 50 ml tube without a cap. To equilibrate the column, add 20 ml RP10 medium pre-warmed at 37 °C until the medium spreads uniformly in nylon wool. Incubate the nylon wool column with the co-cultured cells in a CO2 incubator (37 °C, 20 min). After 20 min, elute the cells with 30 ml RP10 medium.
Video 1. Making a nylon wool column. 20 ml of RP10 medium are added to nylon wool and stirred until the medium uniformly spreads in the wool.
Centrifuge the eluted cells (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the pellets in 1 ml MACS buffer.
Add 100 μl/tube of CD4 MACS beads and incubate on ice for 30 min.
Add plain RPMI medium up to 50 ml/tube.
Centrifuge the tubes (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the pellet in 10 ml/tube MACS buffer and apply the suspensions to two MACS columns (5 ml/column).
Wash with 3 ml/column MACS buffer twice.
Elute the CD4 positive selected cells with 5 ml/column MACS buffer and pool the eluted fractions to a 50 ml tube.
Centrifuge the tube (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the eluted CD4+ T cells in sterile saline.
Note: Resuspended volume should not exceed the maximal volume of i.v. injection allowed in the ethics guideline of your institute.
Inject 1.5 x 107 cells/mouse, i.v.
Note: Usually, 6-8 mice can be injected using 30 spleens.
Measure clinical scores as described previously (Ogura et al., 2008; Huseby et al., 2001; Arima et al., 2012 and 2015b).
Part II. Passive transfer model with MOG-specific T cells lines
Passive transfer EAE can also be induced using a MOG-specific T cell line generated by periodical antigen stimulations in vitro. Once the T cell line is established, this method is useful to reduce the number of mice used to induce the transfer EAE.
Procedure
MOG immunization
Perform MOG immunization in the same way as Part I. A. MOG immunization in mice, except for the number of mice to be immunized. Usually, 3-4 mice are sufficient to obtain MOG-specific T cells lines.
Culture and passage of T cell lines
Collect inguinal lymph nodes (iLNs) from MOG immunized mice (3-4 mice) on day 9 or 10 (Figure 2).
Figure 2. The location of the inguinal lymph nodes (iLN). iLN of the immunized C57BL/6 mouse.
Homogenize the iLNs on a cell strainer in a 50 ml tube using the plunger from a 2.5 ml syringe.
Centrifuge the tubes (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the cell pellet in 10 ml/tube RBC lysis buffer (see Recipe 1) and incubate on ice for 1 min.
Add plain RPMI medium up to 50 ml/tube.
Centrifuge the tubes (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Resuspend the cells in 2 ml IM20 medium (see Recipe 5).
Filter the cells using a cell strainer.
Count the cells.
Seed 2.5 x 105 cells/well/200 μl iLN cells in the presence of 4 μg/ml MOG peptide, 0.5 ng/ml IL-1β, 5 ng/ml IL-6 and 0.5 ng/ml IL-23 in 96-well U-bottom plates for 10 to 14 days.
Proceed to step C1.
T cell preparation
Collect CD4+ T-cell-rich iLN cells from 96U plates in a 10-cm dish by gently pipetting 2 to 3 times using a multichannel pipette.
Collect the cells into 50 ml tubes and centrifuge (600 x g, 5 min, 4 °C).
Aspirate the supernatant and resuspend the T cells in 5 ml IM20 medium.
Count the cells and adjust the concentration to 2.5 x 105 cells/ml.
Irradiation of splenocytes
Collect the spleens of naive C57BL/6 mice and homogenize using the plunger from a 2.5 ml syringe.
Add plain RPMI medium up to 50 ml/tube and centrifuge (600 x g, 5 min, 4 °C).
Aspirate the supernatant and add 1 ml/spleen RBC lysis buffer.
Add plain RPMI medium up to 50 ml and centrifuge (600 x g, 5 min, 4 °C).
Irradiate the cells at 35 Gy, centrifuge (600 x g, 5 min, 4 °C) and aspirate the supernatant.
Suspend the irradiated splenocytes in 10 ml IM20 medium, count and adjust the concentration to 2.5 x 106 cells/ml.
In vitro stimulation
Mix 2.5 x 105 cells/ml CD4+ T-cell-rich iLN cells and 2.5 x 106 cells/ml irradiated splenocytes at 1:1.
Seed the cells at 200 μl/well containing 4 μg/ml MOG peptide, 0.5 ng/ml IL-1β, 5 ng/ml IL-6 and 0.5 ng/ml IL-23 in 96-well U-bottom plates.
Incubate the co-cultured cells at 37 °C, 5% CO2 for 10-14 days.
Repeat steps C1 to E3 to enrich the percentage of MOG-specific CD4+ T cells from total iLN cells (Figure 3). Use fresh irradiated splenocytes in each repeating cycle.
Notes:
T cells can be frozen after step E3 in CellBanker or equivalent solution at -80 °C. When thawing, use a 37 °C water bath, and wash the cells in plain RPMI medium. Then, the T cell line can be used for culture (start from step E1).
Typically, more than 95% of live cells will be CD4+ T cells after four rounds of in vitro stimulation (Figure 3).
Figure 3. Representative FACS plots of a T cell line. Most living cells (> 95%) are CD4+ T cells (CD19- T cell receptor (TCR)β+CD90.2+CD4+ T cells) after 5 days of the fourth round of in vitro stimulation (Procedure E). Irradiated splenocytes can be seen as forward scatter (FSC)low, side scatter (SSC)low dead cells.
Adoptive transfer of T cell lines
Set up culture the same way as ‘E. In vitro stimulation’.
Note: Do not forget to add 4 μg/ml MOG peptide, 0.5 ng/ml IL-1β, 5 ng/ml IL-6 and 0.5 ng/ml IL-23.
Seed these cells at 200 μl/well in 96-well U-bottom plates (about 5 plates for 1 mouse).
Incubate the co-cultured cells in 37 °C, 5% CO2 for 2 days.
Collect the cells from the 96-well U-bottom plates in a 10-cm dish by gently pipetting 2 to 3 times with a multichannel pipette.
Collect the cells in 50 ml tubes and centrifuge (600 x g, 5 min, 4 °C).
Aspirate the medium and resuspend the cells in 1 ml plain RPMI medium.
Count the cells and adjust the concentration to 2.5-3.75 x 107/ml.
Note: Count only living cells.
Inject 1-1.5 x 107 cells i.v. into C57BL/6 mice.
Measure clinical scores as described previously (Huseby et al., 2001; Ogura et al., 2008; Arima et al., 2012 and 2015b).
Data analysis
The clinical symptoms of EAE are evaluated as follows: grade 1, paralyzed tail; grade 2, uneven gait; grade 2.5, one paralyzed rear leg; grade 3, rear limb paralysis; grade 4, paralyzed front and rear legs; and grade 5, moribund (Huseby et al., 2001; Ogura et al., 2008; Arima et al., 2012 and 2015b).
Recipes
Red blood cell (RBC) lysis buffer (500 ml)
4.41 g NH4Cl
500 ml DDW, then autoclave
Phosphate buffered saline (PBS)
1.46 g NaCl
1.86 g KCl
3.5 g Na2HPO4
3.4 g KH2PO4
MACS buffer (1,000 ml)
950 ml PBS
1.86 g EDTA-2Na
Add 50 ml heat-inactivated FBS after autoclaving
RP10 medium (500 ml)
500 ml RPMI medium 1640 basic
50 ml heat-inactivated FBS
5 ml 100x penicillin/streptomycin
1.86 μl 2-mercaptoethanol
Nylon wool column
Nylon wool (1.2 g) is unraveled with a brush, put into a 20 ml syringe, and sterilized by autoclave
IM20 medium (600 ml)
500 ml Iscove’s modified Dulbecco’s medium
100 ml FBS
5 ml GlutaMAX-1 (100x)
1.8 μl 2-mercaptoethanol
5 ml 100x penicillin/streptomycin
Acknowledgments
We appreciate the excellent technical assistance provided by Ms. Ezawa, and Ms. Nakayama, and thank Ms. Fukumoto for her excellent secretarial assistance. We thank Dr. P. Karagiannis (CiRA, Kyoto University, Kyoto, Japan) for carefully reading the manuscript and important discussion. The protocol Part I was used in our previous reports (Arima, 2012 and 2015b; Mori, 2014). This work was supported by KAKENHI (D. K., Y. A., T. A., and M. M.), Takeda Science Foundation (M. M.), Institute for Fermentation Osaka (M. M.), Mitsubishi Foundation (M. M.), Mochida Memorial Foundation for Medical and Pharmaceutical Research (D. K.), Suzuken Memorial Foundation (Y. A.), Japan Prize Foundation (Y. A.), Ono Medical Research Foundation (Y. A.), Kanzawa Medical Research Foundation (Y. A.), Kishimoto Foundation (Y. A.), Nagao Takeshi Research Foundation (Y. A.), Japan Multiple Sclerosis Society (Y. A.), Kanae Foundation (Y. A.), Tokyo Medical Research Foundation (M. M. and Y. A.), Uehara Memorial Foundation (Y. A.), Japan Brain Foundation (Y. A.), Kao Foundation（Y. A.), Nagao Memorial Fund（Y. T.), Suzuken Memorial Foundation (D. K.), Suhara Memorial Foundation (D. K.), Yasuda Memorial Foundation (D. K.), and Novartis Pharma Research Grants (D. K.).
References
Andreasen, C., Powell, D. A. and Carbonetti, N. H. (2009). Pertussis toxin stimulates IL-17 production in response to Bordetella pertussis infection in mice. PLoS One 4(9): e7079.
Arima, Y., Harada, M., Kamimura, D., Park, J. H., Kawano, F., Yull, F. E., Kawamoto, T., Iwakura, Y., Betz, U. A., Marquez, G., Blackwell, T. S., Ohira, Y., Hirano, T. and Murakami, M. (2012). Regional neural activation defines a gateway for autoreactive T cells to cross the blood-brain barrier. Cell 148(3): 447-457.
Arima, Y., Higuchi, K., Nishikawa, N., Stofkova, A., Ohki, T., Kamimura, D. and Murakami, M. (2015a). Pain is an inducer for relapse in multiple sclerosis models via a regional neural signal. Clin Exp Neuroimmunol 6: 343-344.
Arima, Y., Kamimura, D., Atsumi, T., Harada, M., Kawamoto, T., Nishikawa, N., Stofkova, A., Ohki, T., Higuchi, K., Morimoto, Y., Wieghofer, P., Okada, Y., Mori, Y., Sakoda, S., Saika, S., Yoshioka, Y., Komuro, I., Yamashita, T., Hirano, T., Prinz, M. and Murakami, M. (2015b). A pain-mediated neural signal induces relapse in murine autoimmune encephalomyelitis, a multiple sclerosis model. Elife 4.
Arima, Y., Kamimura, D., Sabharwal, L., Yamada, M., Bando, H., Ogura, H., Atsumi, T. and Murakami, M. (2013). Regulation of immune cell infiltration into the CNS by regional neural inputs explained by the gate theory. Mediators Inflamm 2013: 898165.
Huseby E. S., Sather, B., Huseby, P. G. and Goverman, J. (2001). Age-dependent T cell tolerance and autoimmunity to myelin basic protein. Immunity 14: 471-481.
International Multiple Sclerosis Genetics, C., Wellcome Trust Case Control, C., Sawcer, S., Hellenthal, G., Pirinen, M., Spencer, C. C., Patsopoulos, N. A., Moutsianas, L., Dilthey, A., Su, Z., Freeman, C., Hunt, S. E., Edkins, S., Gray, E., Booth, D. R., Potter, S. C., Goris, A., Band, G., Oturai, A. B., Strange, A., Saarela, J., Bellenguez, C., Fontaine, B., Gillman, M., Hemmer, B., Gwilliam, R., Zipp, F., Jayakumar, A., Martin, R., Leslie, S., Hawkins, S., Giannoulatou, E., D'Alfonso, S., Blackburn, H., Martinelli Boneschi, F., Liddle, J., Harbo, H. F., Perez, M. L., Spurkland, A., Waller, M. J., Mycko, M. P., Ricketts, M., Comabella, M., Hammond, N., Kockum, I., McCann, O. T., Ban, M., Whittaker, P., Kemppinen, A., Weston, P., Hawkins, C., Widaa, S., Zajicek, J., Dronov, S., Robertson, N., Bumpstead, S. J., Barcellos, L. F., Ravindrarajah, R., Abraham, R., Alfredsson, L., Ardlie, K., Aubin, C., Baker, A., Baker, K., Baranzini, S. E., Bergamaschi, L., Bergamaschi, R., Bernstein, A., Berthele, A., Boggild, M., Bradfield, J. P., Brassat, D., Broadley, S. A., Buck, D., Butzkueven, H., Capra, R., Carroll, W. M., Cavalla, P., Celius, E. G., Cepok, S., Chiavacci, R., Clerget-Darpoux, F., Clysters, K., Comi, G., Cossburn, M., Cournu-Rebeix, I., Cox, M. B., Cozen, W., Cree, B. A., Cross, A. H., Cusi, D., Daly, M. J., Davis, E., de Bakker, P. I., Debouverie, M., D'Hooghe M, B., Dixon, K., Dobosi, R., Dubois, B., Ellinghaus, D., Elovaara, I., Esposito, F., Fontenille, C., Foote, S., Franke, A., Galimberti, D., Ghezzi, A., Glessner, J., Gomez, R., Gout, O., Graham, C., Grant, S. F., Guerini, F. R., Hakonarson, H., Hall, P., Hamsten, A., Hartung, H. P., Heard, R. N., Heath, S., Hobart, J., Hoshi, M., Infante-Duarte, C., Ingram, G., Ingram, W., Islam, T., Jagodic, M., Kabesch, M., Kermode, A. G., Kilpatrick, T. J., Kim, C., Klopp, N., Koivisto, K., Larsson, M., Lathrop, M., Lechner-Scott, J. S., Leone, M. A., Leppa, V., Liljedahl, U., Bomfim, I. L., Lincoln, R. R., Link, J., Liu, J., Lorentzen, A. R., Lupoli, S., Macciardi, F., Mack, T., Marriott, M., Martinelli, V., Mason, D., McCauley, J. L., Mentch, F., Mero, I. L., Mihalova, T., Montalban, X., Mottershead, J., Myhr, K. M., Naldi, P., Ollier, W., Page, A., Palotie, A., Pelletier, J., Piccio, L., Pickersgill, T., Piehl, F., Pobywajlo, S., Quach, H. L., Ramsay, P. P., Reunanen, M., Reynolds, R., Rioux, J. D., Rodegher, M., Roesner, S., Rubio, J. P., Ruckert, I. M., Salvetti, M., Salvi, E., Santaniello, A., Schaefer, C. A., Schreiber, S., Schulze, C., Scott, R. J., Sellebjerg, F., Selmaj, K. W., Sexton, D., Shen, L., Simms-Acuna, B., Skidmore, S., Sleiman, P. M., Smestad, C., Sorensen, P. S., Sondergaard, H. B., Stankovich, J., Strange, R. C., Sulonen, A. M., Sundqvist, E., Syvanen, A. C., Taddeo, F., Taylor, B., Blackwell, J. M., Tienari, P., Bramon, E., Tourbah, A., Brown, M. A., Tronczynska, E., Casas, J. P., Tubridy, N., Corvin, A., Vickery, J., Jankowski, J., Villoslada, P., Markus, H. S., Wang, K., Mathew, C. G., Wason, J., Palmer, C. N., Wichmann, H. E., Plomin, R., Willoughby, E., Rautanen, A., Winkelmann, J., Wittig, M., Trembath, R. C., Yaouanq, J., Viswanathan, A. C., Zhang, H., Wood, N. W., Zuvich, R., Deloukas, P., Langford, C., Duncanson, A., Oksenberg, J. R., Pericak-Vance, M. A., Haines, J. L., Olsson, T., Hillert, J., Ivinson, A. J., De Jager, P. L., Peltonen, L., Stewart, G. J., Hafler, D. A., Hauser, S. L., McVean, G., Donnelly, P. and Compston, A. (2011). Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. Nature 476(7359): 214-219.
Liu, W. Y., Wang, Z. B., Zhang, L. C., Wei, X. and Li, L. (2012). Tight junction in blood-brain barrier: an overview of structure, regulation, and regulator substances. CNS Neurosci Ther 18(8): 609-615.
Lu, K. W., Hsu, C. K., Hsieh, C. L., Yang, J. and Lin, Y. W. (2016). Probing the effects and mechanisms of electroacupuncture at ipsilateral or contralateral ST36-ST37 acupoints on CFA-induced inflammatory pain. Sci Rep 6: 22123.
Marbourg, J. M., Bratasz, A., Mo, X. and Popovich, P. G. (2017). Spinal cord injury suppresses cutaneous inflammation: implications for peripheral wound healing. J Neurotrauma 34(6): 1149-1155.
Mori, Y., Murakami, M., Arima, Y., Zhu, D., Terayama, Y., Komai, Y., Nakatsuji, Y., Kamimura, D. and Yoshioka, Y. (2014). Early pathological alterations of lower lumbar cords detected by ultrahigh-field MRI in a mouse multiple sclerosis model. Int Immunol 26(2): 93-101.
Ogura, H., Murakami, M., Okuyama, Y., Tsuruoka, M., Kitabayashi, C., Kanamoto, M., Nishihara, M., Iwakura, Y. and Hirano, T. (2008). Interleukin-17 promotes autoimmunity by triggering a positive-feedback loop via interleukin-6 induction. Immunity 29(4): 628-636.
Racke, M. K. (2001). UNIT 9.7 Experimental Autoimmune Encephalomyelitis (EAE). Curr Protoc in Neurosci.
Reboldi, A., Coisne, C., Baumjohann, D., Benvenuto, F., Bottinelli, D., Lira, S., Uccelli, A., Lanzavecchia, A., Engelhardt, B. and Sallusto, F. (2009). C-C chemokine receptor 6-regulated entry of TH-17 cells into the CNS through the choroid plexus is required for the initiation of EAE. Nat Immunol 10(5): 514-523.
Sabharwal, L., Kamimura, D., Meng, J., Bando, H., Ogura, H., Nakayama, C., Jiang, J. J., Kumai, N., Suzuki, H., Atsumi, T., Arima, Y. and Murakami, M. (2014). The Gateway Reflex, which is mediated by the inflammation amplifier, directs pathogenic immune cells into the CNS. J Biochem 156(6): 299-304.
Schellenberg, A. E., Buist, R., Del Bigio, M. R., Toft-Hansen, H., Khorooshi, R., Owens, T. and Peeling, J. (2012). Blood-brain barrier disruption in CCL2 transgenic mice during pertussis toxin-induced brain inflammation. Fluids Barriers CNS 9(1): 10.
Steinman, L. (2014). Immunology of relapse and remission in multiple sclerosis. Annu Rev Immunol 32: 257-281.
Tracey, K. J. (2012). Immune cells exploit a neural circuit to enter the CNS. Cell 148(3): 392-394.
Copyright: Tanaka et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Tanaka, Y., Arima, Y., Higuchi, K., Ohki, T., Elfeky, M., Ota, M., Kamimura, D. and Murakami, M. (2017). EAE Induction by Passive Transfer of MOG-specific CD4+ T Cells. Bio-protocol 7(13): e2370. DOI: 10.21769/BioProtoc.2370.
Arima, Y., Kamimura, D., Atsumi, T., Harada, M., Kawamoto, T., Nishikawa, N., Stofkova, A., Ohki, T., Higuchi, K., Morimoto, Y., Wieghofer, P., Okada, Y., Mori, Y., Sakoda, S., Saika, S., Yoshioka, Y., Komuro, I., Yamashita, T., Hirano, T., Prinz, M. and Murakami, M. (2015b). A pain-mediated neural signal induces relapse in murine autoimmune encephalomyelitis, a multiple sclerosis model. Elife 4.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Immunology > Inflammatory disorder > Multiple sclerosis
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,371 | https://bio-protocol.org/exchange/protocoldetail?id=2371&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assaying Glycogen and Trehalose in Yeast
YC Yuping Chen
BF Bruce Futcher
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2371 Views: 9374
Edited by: Gal Haimovich
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Organisms store carbohydrates in several forms. In yeast, carbohydrates are stored in glycogen (a multi-branched polysaccharide) and in trehalose (a disaccharide). As in other organisms, the amount of stored carbohydrate varies dramatically with physiological state, and accordingly, an assay of stored carbohydrate can help reveal physiological state. Here, we describe relatively easy and streamlined assays for glycogen and trehalose in yeast that can be applied either to a few samples, or in a moderately high-throughput fashion (dozens to hundreds of samples).
Keywords: Glycogen Trehalose Yeast Storage carbohydrate Cell cycle
Background
Glycogen and trehalose are the two storage carbohydrates of yeast and many other organisms. In yeast, both these storage carbohydrates accumulate when the medium starts to be depleted and the rate of cell growth decreases. Methods for assaying storage carbohydrates in yeast date back at least to 1956 (Trevelyan and Harrison, 1956a and 1956b), and have been updated many times since (e.g., [Becker, 1978; Quain, 1981; Schulze et al., 1995; Parrou and Francois, 1997; Plata et al., 2013], among others). There are three basic steps in assaying these two storage carbohydrates: first, lysing or permeabilizing the cells; second, freeing glucose from the glycogen or trehalose; and third, assaying the resulting glucose.
Cells can be lysed mechanically (Schulze et al., 1995), but this is inevitably somewhat tedious and time-consuming, and tends to require larger numbers of cells. Cells can be permeabilized by alkali, but glycogen forms large, multi-branched granules, and can be difficult to extract, and so some protocols use both an alkali and an acid extraction (Trevelyan and Harrison, 1956a and 1956b; Quain, 1981). However, alkali treatment alone extracts the vast majority of the glycogen (and probably all of the trehalose) (Becker, 1978; Quain, 1981; Parrou and Francois, 1997); and it may allow enzymes such as amyloglucosidase access to the interior of the permeabilized cell, where it can liberate glucose from any residual glycogen, and alkali extraction alone is much easier than a dual alkali/acid extraction. Therefore, like Becker, and Parrou and Francois, we use only an alkali extraction. However, it is possible that this may fail to assay a relatively small amount of acid-extractable glycogen (Quain, 1981).
In older assays (e.g., [Trevelyan and Harrison, 1956a and 1956b]), glucose was released and/or assayed by purely chemical methods. However, these were relatively non-specific, and also assayed glucose present in other molecules, such as cell wall glucans. Therefore more modern methods use enzymes to liberate glucose from specific polysaccharides; e.g., amyloglucosidases are used to liberate glucose from glycogen (Becker, 1978), and trehalases are used to liberate glucose from trehalose (Parrou and Francois, 1997). A challenge to these methods is that some enzymes are contaminated with other activities. For instance, Parrou and Francois found that some amyloglucosidases were contaminated with trehalases. Therefore either purer enzymes need to be used, or less pure enzymes need to be used under conditions that inhibit the unwanted activities. Here, like Parrou and Francois, we use Aspergillus niger α-amyloglucosidase, which may also contain a trehalase activity (Parrou and Francois, 1997), depending on the specific preparation of enzyme, but we use it at high temperature (55 °C to 57 °C), approximately the optimum temperature for this enzyme, where the trehalase is inactive (Parrou and Francois, 1997).
Finally, the enzymatically-released glucose must be assayed. There are many well-developed assays for glucose. We use the glucose oxidase/peroxidase/o-dianisidine reagent of the Sigma-Aldrich glucose oxidase kit, which produces oxidized o-dianisidine, which has a pink/purple color, easily assayed by absorbance at 540 nm.
Our procedure is adapted from that of Parrou and Francois (1997). However, at most steps, we use smaller volumes of reagents, which make the assay easier in some respects. The small volumes allow us to adapt the procedure to 96-well microtitre dishes, which allows the assay to become moderately high-throughput. We give two procedures, one for 2 ml screw-capped tubes, and one for 96-well microtitre dishes.
Materials and Reagents
Protective eye wear/safety glasses/face shield
Pipette tips
2 ml screw cap tubes with o-ring (e.g., SARSTEDT, catalog number: 72.694.406 or 72.694.217 )
Microplate sealing tape (e.g., Corning aluminum tape, Corning, catalog number: 6570 )
QuickSeal Foil PCR Self Adhesive Seal (Biosero)
Or 4titude PCR Foil Seal (4titude, catalog number: 4ti-0550 )
Or Peelable heat-sealing foil seals and a heat sealer
For 96 well microtitre plate assay
a.Polypropylene, round-bottom 96-well plates, 360 microlitre capacity (e.g., Corning, catalog number: 3359 )
b.Polystyrene, flat-bottom 96-well plates (for plate reader) (e.g., Corning, catalog numbers: 3370 and 3915 )
Yeast cells
Note: This protocol has been developed for S. cerevisiae. It has not been tried with other species of yeast, but should work.
Milli-Q or double-distilled water
Glucose assay kit (Sigma-Aldrich, catalog number: GAGO-20 )
Sulphuric acid
Glacial acetic acid
NaAcetate trihydrate*
Aspergillus niger α-amyloglucosidase (Biochemika, ~70 U/mg) (Sigma-Aldrich, catalog number: 10115 )
Alternatively: 120 U/mg, may be higher purity (Sigma-Aldrich, catalog number: 10113 ).
Porcine trehalase (about 2.3 U/ml) (Sigma-Aldrich, catalog number: T8778 )
Concentrated H2SO4 (sulfuric acid)*
Sodium carbonate anhydrous (Na2CO3)*
1 M acetic acid (see Recipes)*
0.2 M NaAcetate, pH 5.2 (see Recipes)
0.2 M NaAcetate, ~pH 8 (see Recipes)
For 96 well microtitre plate assay
Concentrated amyloglucosidase buffer (see Recipes)
Concentrated trehalase buffer (see Recipes)
Trehalase dilution buffer (0.1 M NaAcetate, pH 5.7) (see Recipes)
9 N H2SO4 (see Recipes)
0.25 M Na2CO3 (see Recipes)
Note: *Reagents from any qualified company are suitable for this experiment.
Equipment
Roller or shaker for growing yeast
Adjustable micropipettes, volumes from 2 to 500 μl
Spectrophotometer and cuvettes
Centrifuge (room temperature or chilled) for volumes of 5 to 15 ml
Microcentrifuge for 1.5 and 2 ml tubes
Vortex mixer
pH meter
Water bath (95 °C)
Water bath or air incubator, 57 °C and 37 °C
Glass pipet
Fume hood
For 96-well plate assay
Centrifuge and adaptors for microtitre plates
Multichannel pipettes
Plate reader
Note: All those items can be ordered from any qualified company.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, Y. and Futcher, B. (2017). Assaying Glycogen and Trehalose in Yeast. Bio-protocol 7(13): e2371. DOI: 10.21769/BioProtoc.2371.
Download Citation in RIS Format
Category
Microbiology > Microbial metabolism > Carbohydrate
Biochemistry > Carbohydrate > Glycogen
Biochemistry > Carbohydrate > Disaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,372 | https://bio-protocol.org/exchange/protocoldetail?id=2372&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Reduced and Total Glutathione Content in Extremophilic Microalga Galdieria phlegrea
Giovanna Salbitani
Claudia Bottone
Simona Carfagna
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2372 Views: 21218
Edited by: Dennis Nürnberg
Reviewed by: Antoine Danon
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
Glutathione is an important molecule involved in the primary and secondary metabolism of all organisms. The Glutathione redox status is an indicator of the cellular redox state. Therefore, it is important to have precise methods on hand to determine the glutathione redox status in the cell. In this protocol, we describe an improved spectrophotometric method to estimate the content of reduced (GSH) and oxidized (GSSG) forms of glutathione in the extremophilic microalga Galdieria phlegrea.
Keywords: Microalgae Galdieria phlegrea Glutathione Glutathione reductase Redox state
Background
Glutathione (γ-L-glutamyl-L-cysteinyl-glycine) is an essential tripeptide existing in all known organism, ranging from bacteria to humans (Frendo et al., 2013). It is involved in several different cell protective roles (Figure 1). Glutathione is considered an excellent antioxidant molecule having redox signalling function. It is also involved in response to abiotic and biotic stress, and implicated in the primary metabolism (C, N, S metabolism) of the cell (Noctor et al., 2012; Hernández et al., 2015; Salbitani et al., 2015).
In plant cells, the ratio between the reduced and oxidized forms of glutathione (GSH/GSSG) plays a significant part in signalling and in the activation of numerous defence mechanisms (Foyer and Noctor, 2012; Salbitani et al., 2015). The GSH/GSSG redox state, which is normally tightly controlled, may transiently shift towards a slightly more oxidized value during a stress condition (Tausz et al., 2004).
In the past, some researchers have developed and modified spectrophotometric methods to determine the GSH and GSSG in several organism (Anderson, 1985; Bashir et al., 2013). Here we describe a protocol for a simple glutathione determination, optimized on the extremophilic microalga Galdieria phlegrea. The method illustrated is based on the reaction of GSH with the thiol reagent DTNB (5,5-dithiobis(2-nitrobenzoic acid)) to form GSSG and TNB (5-thionitrobenzoic acid), which is detected spectrophotometrically at 412 nm (Giustarini et al., 2013).
Figure 1. Glutathione redox cycle. Reduced glutathione (GSH) is a tripeptide composed of cysteine, glutamic acid and glycine, which plays a key role in the control of signalling processes, detoxification and various other cell processes. Glutathione disulfide (GSSG) is the oxidized form of glutathione. It is reduced to GSH in presence of NADPH by the glutathione reductase (GR). The glutathione peroxidase (GP) converts hydrogen peroxide to water.
Materials and Reagents
Disposable plastic cuvettes (1.5 ml) (BRAND, catalog number: 759150 )
5-sulfosalicylic acid hydrate (Sigma-Aldrich, catalog number: 390275 )
L-glutathione reduced (GSH) (Sigma-Aldrich, catalog number: G6013 )
5,5-dithiobis(2-nitrobenzoic acid) (DTNB, Ellman’s reagent) (Sigma-Aldrich, catalog number: D8130 )
β-Nicotinamide adenine dinucleotide phosphate, reduced tetra(cyclohexylammonium) salt (NADPH) (Sigma-Aldrich, catalog number: N5130 )
Glutathione reductase (GR) (Sigma-Aldrich, catalog number: G3664 )
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S8282 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S7907 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E5134 )
Reaction buffer (see Recipes)
Equipment
Bench centrifuge (Thermo Electron Corporation, model: IEC CL30 )
French pressure cell press (Aminco Resources, model: FA-078 )
Superspeed centrifuge (Thermo Fisher Scientific, model: SorvallTM RC-5C Plus )
Vortex mixer (Troemner, catalog number: TY-LP-945302 )
Spectrophotometer (Cole-Parmer, Jenway, model: 7315 )
pH-meter (Mettler-Toledo International, model: FE20 )
Optical microscope (leitz laborlux K)
Bϋrker chamber (BRAND, catalog number: 719520 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Salbitani, G., Bottone, C. and Carfagna, S. (2017). Determination of Reduced and Total Glutathione Content in Extremophilic Microalga Galdieria phlegrea. Bio-protocol 7(13): e2372. DOI: 10.21769/BioProtoc.2372.
Download Citation in RIS Format
Category
Plant Science > Phycology > Physiology
Plant Science > Plant biochemistry > Other compound
Cell Biology > Cell signaling > Stress response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,373 | https://bio-protocol.org/exchange/protocoldetail?id=2373&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dense sgRNA Library Construction Using a Molecular Chipper Approach
JC Jijun Cheng
WP Wen Pan
JL Jun Lu
Published: Vol 7, Iss 12, Jun 20, 2017
DOI: 10.21769/BioProtoc.2373 Views: 9768
Edited by: Gal Haimovich
Reviewed by: Kabin Xie
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Genetic screens using single-guide-RNA (sgRNA) libraries and CRISPR technology have been powerful to identify genetic regulators for both coding and noncoding regions of the genome. Interrogating functional elements in noncoding regions requires sgRNA libraries that are densely covering, and ideally inexpensive, easy to implement and flexible for customization. We present a Molecular Chipper protocol for generating dense sgRNA libraries from genomic regions of interest. This approach utilizes a combination of random fragmentation and a Type III restriction enzyme to derive a dense coverage of sgRNA library from input DNA.
Keywords: Molecular chipper sgRNA library CRISPR-Cas9 Non-coding genome Reporter screen
Background
Genome editing using Streptococcus pyogenes (sp) Cas9 and sgRNA libraries is a powerful tool to screen for functional genetic regulators in mammalian cells by generating biallelic loss-of-function sequence alterations (Wiedenheft et al., 2012; Mali et al., 2013; Koike-Yusa et al., 2014; Shalem et al., 2014; Wang et al., 2014; Zhou et al., 2014). Cas9 binds sgRNA, which can be designed to target Cas9 toward a defined locus in the genome. The nuclease activity of Cas9 cuts target DNA locus, leading to double-stranded DNA breaks, which upon DNA repair through non-homologous end-joining pathway frequently results in short deletions at the locus of interest.
The powerful genomic editing capacity of the CRISPR-Cas9 system has led to the use of sgRNA libraries to interrogate protein-coding genes as well as noncoding regions. Several sgRNA libraries for protein-coding genes and/or limited numbers of non-coding genes have been reported in functional screening, through sgRNA enrichment, to identify genes and networks regulating specific cellular functions (Koike-Yusa et al., 2014; Shalem et al., 2014; Wang et al., 2014; Zhou et al., 2014; Canver et al., 2015; Sanjana, 2016). Several non-coding sgRNA libraries consisting of 703-18,000 sgRNAs densely covering regulatory regions of genes of interest, such as BCL11A, Tdgf1a and drug-resistance regulating genes, were also reported in gene-specific functional screens for distal and proximal regulating elements (Canver et al., 2015; Rajagopal et al., 2016; Korkmaz et al., 2016; Sanjana, 2016). These sgRNA libraries were all produced by careful bioinformatics design, oligonucleotide synthesis on microarray, and cloning of oligonucleotide pool(s) into vectors. This synthetic approach has been very useful, but requires computational expertise for genome-wide sgRNA design and expensive microarray synthesis, and thus is challenging for most laboratories.
Enzymatically generated sgRNA libraries covering regions of repetitive genomic sequences or loci are useful for CRISPR-Cas9 imaging of genomic sequences or loci (Lane et al., 2015). Due to lack of high-density (~111 bp), such sgRNA libraries are not reported in screening for functional non-coding regions. Another enzymatic method was reported to generate high-density (~20 bp) sgRNA library from cDNA (Arakawa, 2016). This type of sgRNA library consists of cell source-specific, differentially expressed sequences, thus, was neither reported for applications in functional screening.
Without prior knowledge of the locations of critical noncoding-element-containing regions, functional mapping of noncoding genomic regions requires sgRNA libraries that densely populate regions of interest. The ideal method requires flexibility for adjusting the scale of sgRNA production to easily cope with this need. We describe here a detailed protocol of the Molecular Chipper approach that processes any input DNA piece(s) to generate a near base-resolution sgRNA library densely covering the input DNA of interest.
Materials and Reagents
Pipette tips (prefer ones with filters to minimize contamination, such as those from Denville Scientific)
Tubes (Denville Scientific, catalog number: C2170 )
Petri dishes (Corning, Falcon®, catalog number: 351029 )
NEB 5-alpha Electrocompetent E. coli (New England Biolabs, catalog number: C2989K )
Retroviral vector pSUPER-CRISPR that contains and a puromycin selection marker and a U6 promoter to drive expression of sgRNA that is cloned at BamHI-HindIII sites (for details, see Cheng et al., 2016b).
Note: Please write us to request for this material.
T4 DNA ligase at 2000,000 U/ml (New England Biolabs, catalog number: M0202T ). Use in ligations where T4 DNA ligase is required in excess within a small volume, such as that described in step 2
T4 DNA ligase at 400,000 U/ml (New England Biolabs, catalog number: M0202S )
T4 polynucleotide kinase (New England Biolabs, catalog number: M0201S )
Distilled water (AmericanBio, catalog number: AB02123-00500 )
QIAquick PCR Purification Kit (QIAGEN, catalog number: 28104 )
Agarose (AmericanBio, catalog number: AB00972 )
Ethidium bromide, 10 mg/ml (Sigma-Aldrich, catalog number: E1510 )
3 M sodium acetate, pH 5.2
100% ethanol (AmericanBio, catalog number: AB00515-00500 )
70% ethanol (AmericanBio, catalog number: AB04010-00500 )
1 kb plus DNA standard (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10787018 )
Agarose, low melting point (AmericanBio, catalog number: AB00981 )
10 bp DNA standard (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10821015 )
NEBNext End Repair Module (New England Biolabs, catalog number: E6050S )
10,000x SYBR Safe DNA Gel Stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: S33102 )
QIAEX II Gel Extraction Kit (QIAGEN, catalog number: 20021 )
QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704 )
EcoP15I-adaptor oligonucleotide pair: sense aaaactcgagcagcagtggatccG and anti-sense /5phos/Cggatccactgctgctcgag (Integrated DNA Technologies; 25 nmole DNA oligo scale; Standard desalting purification). The anti-sense oligo has a 5’-phosphase modification
100 bp DNA standard (New England Biolabs, catalog number: N3231S )
EcoP15I enzyme (New England Biolabs, catalog number: R0646L )
PCI: Phenol:Chloroform:Isoamyl Alcohol 25:24:1, saturated with TE (10 mM Tris, pH 8.0, 1 mM EDTA) (Sigma-Aldrich, catalog number: P2069-100ML )
Phenol, saturated with Tris, pH 7.5 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 17914 )
Chloroform (AmericanBio, catalog number: AB00350-00500 )
PCI (Phenol:chloroform:isoamyl alcohol 25:24:1), Tris saturated (Roche Diagnostics, catalog number: 03117944001 )
3’ sgRNA backbone adaptor oligo nucleotide pair: sense /5phos/nngttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-tttttttaagctttat and anti-sense ataaagcttaaaaaaagcaccgactcggtgccactttttcaagttgataac-ggactagccttattttaacttgctatttctagctctaaaac (Integrated DNA Technologies, 100 nmole DNA oligo scale, Standard desalting purification). The -sense oligo has a 5’-phosphase modification
BamHI-HF enzyme (New England Biolabs, catalog number: R3136S )
HindIII-HF enzyme (New England Biolabs, catalog number: R3104S )
MiniElute Gel Extraction kit (QIAGEN, catalog number: 28604 )
LB medium (Thermo Fisher Scientific, InvitrogenTM, catalog number: 12795027 )
QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27104 )
Oligo nucleotide used in Sanger sequencing of cloned-sgRNA: ctccctttatccagccctca (Intergatred DNA Technologies, 25 nmole DNA oligo scale, Standard desalting purification)
Ampicillin (AmericanBio, catalog number: AB00115-00100 )
Tris base (Sigma-Aldrich, catalog number: T6066 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: EDS-100G )
Glacial acetic acid (Sigma-Aldrich, catalog number: 695092 )
Agar (AmericanBio, catalog number: AB01185-00500 )
50x TAE gel running buffer (see Recipes)
Equipment
Pipettes
37 °C water bath (Fisher Scientific, model: Model 215 , catalog number: 15-462-15Q)
NanoDrop 2000 (Thermo Fisher Scientific, model: NanoDropTM 2000 , catalog number: ND-2000)
Microcentrifuge (Eppendorf, model: 5254 , catalog number: 022620444)
S220 Focused-ultrasonicator and sonication vials (COVARIS, model: S220 )
Gel Illuminator (UltraSlim LED Illuminator, Maestrogen, catalog number: SLB-01W )
IncuBlock heating block (Danville Scientific, model: I-0259 , catalog number: 08302)
Gel electrophoresis system (Thermo Fisher Scientific, Thermo ScientificTM, model: OwlTM EasyCastTM B1A , catalog number: B1A)
Electroporation System (Bio-Rad Laboratories, model: Gene Pulser XcellTM, catalog number: 1652660 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cheng, J., Pan, W. and Lu, J. (2017). Dense sgRNA Library Construction Using a Molecular Chipper Approach. Bio-protocol 7(12): e2373. DOI: 10.21769/BioProtoc.2373.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,374 | https://bio-protocol.org/exchange/protocoldetail?id=2374&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Formaldehyde Fixation of Extracellular Matrix Protein Layers for Enhanced Primary Cell Growth
Natalia V. Andreeva
Alexander V. Belyavsky
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2374 Views: 8314
Reviewed by: Yanjie LiHui Zhu
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
Coating tissue culture vessels with the components of the extracellular matrix such as fibronectin and collagens provides a more natural environment for primary cells in vitro and stimulates their proliferation. However, the effects of such protein layers are usually rather modest, which might be explained by the loss immobilized proteins due to their weak non-covalent association with the tissue culture plastic. Here we describe a simple protocol for a controlled fixation of fibronectin, vitronectin and collagen IV layers by formaldehyde, which substantially enhances the stimulation of primary cell proliferation by these extracellular proteins.
Keywords: Mesenchymal stem cells Fibronectin Vitronectin Collagen IV Formaldehyde Fixation
Background
The components of the extracellular matrix (ECM) such as fibronectin, laminin, vitronectin and collagens are often used for coating tissue culture vessels since they provide a more natural environment for primary cells in vitro and stimulate their proliferation (Sawada et al., 1987; Rajaraman et al., 2013). However, the observed stimulation of cell proliferation by these protein layers is usually fairly modest. This might be explained by their weak non-covalent association with the tissue culture plastic resulting in delamination and loss of immobilized protein molecules. Recently, it has been shown that the retention of ECM produced by the cells might be significantly increased by covalent immobilization of fibronectin to the plastic surface (Prewitz et al., 2013). However, ECM production is cumbersome and may be difficult to standardize. We have demonstrated that simple formaldehyde fixation under controlled conditions of layers formed by the selected individual ECM proteins can substantially enhance positive effects of these proteins on cell proliferation (Andreeva et al., 2016). Here we describe a detailed protocol of culture plastic coating and formaldehyde fixation for three individual components of ECM, namely fibronectin, vitronectin and collagen IV. Although we did not test the effects of controlled fixation with other protein constituents of the ECM, the positive results obtained with our protocol for three proteins of vastly differing molecular and biological properties provide sufficient reasons to assume the general applicability of the described procedure for enhancing proliferation stimulatory properties of a wider range of ECM proteins.
Materials and Reagents
3.5 cm cell culture dish (Greiner Bio One International, CELLSTAR®, catalog number: 627160 )
Sterile pipette filter tips 200 and 1,000 μl (Greiner Bio One International, catalog numbers: 739288 and 740288 , respectively)
Parafilm M (Sigma-Aldrich, catalog number: P7668 )
15 ml centrifuge tube (Greiner Bio One International, CELLSTAR®, catalog number: 188261 )
50 ml centrifuge tube (Greiner Bio One International, CELLSTAR®, catalog number: 227261 )
1.8 ml round bottom cryogenic tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 375418 )
0.22 μm syringe filter (GVS, catalog number: 1213641 )
10 and 20 ml syringes (SFM Hospital Products, catalog numbers: 534235 and 534236 , respectively)
2 and 10 ml Serological pipets (Greiner Bio One International, CELLSTAR®, catalog numbers: 710180 and 607107 , respectively)
Phosphate-buffered saline (PBS), pH 7.4 tablets (Thermo Fisher Scientific, GibcoTM, catalog number: 18912014 )
Paraformaldehyde (Sigma-Aldrich, catalog number: 76240 )
Note: This product has been discontinued.
Sodium hydroxide (NaOH), 10 M (Sigma-Aldrich, catalog number: 72068 )
Fibronectin human (Imtek, catalog number: H Fne-C )
Vitronectin human (Imtek, catalog number: H Vne-C )
Collagen IV bovine (Imtek, catalog number: B C44-C )
Acetic acid (Sigma-Aldrich, catalog number: 695092 )
Ethanol 96% (Sigma-Aldrich, catalog number: 24105 )
Note: This product has been discontinued.
Sterile distilled water
1x phosphate-buffered saline (PBS) pH 7.4 (see Recipes)
Formaldehyde solution (see Recipes)
Human fibronectin solution (prepare freshly) (see Recipes)
Human vitronectin solution (prepare freshly) (see Recipes)
Bovine collagen IV solution (prepare freshly) (see Recipes)
Equipment
Pipette controller (Corning, catalog number: 4091 )
Automatic single-channel pipettes, 20-200 and 100-1,000 μl (Gilson-compatible)
Magnetic hot plate stirrer (Sigma-Aldrich, catalog number: Z168580 )
Magnetic stirring bar, 7 x 2 mm (Fisher Scientific, FisherbrandTM, catalog number: 14-513-63 )
Laminar flow tissue culture hood
Note: This item can be ordered from any qualified company.
Refrigerator with interior power outlets
Note: This item can be ordered from any qualified company.
CO2 incubator (Sanyo, catalog number: MCO-18AIC )
Note: This product has been discontinued. Possible substitute: Panasonic Healthcare, model: MCO-18AC.
Centrifuge 5810 R (Eppendorf, model: 5810 R , catalog number: 5811000320)
Autoclave
Note: This item can be ordered from any qualified company.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Andreeva, N. V. and Belyavsky, A. V. (2017). Formaldehyde Fixation of Extracellular Matrix Protein Layers for Enhanced Primary Cell Growth. Bio-protocol 7(13): e2374. DOI: 10.21769/BioProtoc.2374.
Download Citation in RIS Format
Category
Biochemistry > Protein > Structure
Cell Biology > Cell viability > Cell proliferation
Stem Cell > Adult stem cell > Mesenchymal stem cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,375 | https://bio-protocol.org/exchange/protocoldetail?id=2375&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Microvesicle Isolation from Rat Brain Extract Treated Human Mesenchymal Stem Cells
JL Ji Yong Lee
SC Seong-Mi Choi
HK Han-Soo Kim
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2375 Views: 10380
Edited by: Xi Feng
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
Microvesicle (MVs) are submicron-sized membranous vesicles that are either actively released from cells via secretory compartments or shed from cell surface membranes. MVs are generated by many cell types and serve as vehicles that transfer biological information (e.g., protein, mRNA, and miRNA) to distant cells, thereby affecting their gene expression, proliferation, differentiation, and function. Although their physiological functions are not clearly defined, recent studies have shown their therapeutic potential for tissue repair and regeneration. While MVs can be isolated readily from mesenchymal stem cells (MSCs) and other cell types from various sources, the yield of MVs under conventional culture condition in vitro is one of the limiting factors for both the in vivo functional study as well as in vitro molecular analysis. Here, we provide a protocol to increase the yield of microvesicles by preconditioning MSCs with rat brain extract.
Keywords: Mesenchymal stem cell Microvesicle Extracellular vesicles Sucrose gradient Diafiltration Tissue regeneration
Background
Generation of neural stem cells or neural cells by direct reprogramming or utilization of mesenchymal stem cells for cell replacement therapy is potential options for neurodegenerative diseases (Adib et al., 2015). Recent studies have demonstrated that microvesicles derived from MSCs represent a novel and safe alternative to other cell replacement approaches to enhance tissue regeneration such as neuronal regeneration, immune modulation, angiogenesis in brain injury (Kim et al., 2013; Porro et al., 2015; Lee et al., 2016). Little is known about how external signals derived from damaged tissues can affect the quantity and composition of microvesicles. The contents and quantities of such functional secretome of MSCs can be significantly changed in response to their microenvironment (Qu et al., 2007). For example, ischemic brain extracts or hypoxia are known to induce the synthesis of a number of cytokines and growth factors that are beneficial to the tissue regeneration process (Chen et al., 2007; Shin et al., 2014). In the present study, normal and ischemic brain extracts as a form of brain injury signal were employed to increase the yields as well as to modulate the molecular composition of MVs from MSCs that can be beneficial for their clinical application. Indeed, the quantity of MVs in conditioned medium of MSCs was greatly increased by the treatment of normal brain extracts or ischemic brain extracts. The current protocol was mainly based on previously described methods (Choi et al., 2007; Kim et al., 2012) with a few modifications including reagents, recipes. The yield and composition of microvesicles can be significantly modulated by preconditioning of producing cells by physical, chemical or biological means. As an example, we utilized brain extract to stimulate MSCs to simulate signal for brain tissue damage and the final products (MVs) can be a potent specific therapy for brain tissue repair and regeneration. This protocol may provide a clue to develop better strategies to obtain higher yields of MVs with stronger therapeutic potential from various cell sources.
Materials and Reagents
4-0 surgical suture
0.2 µm syringe filters (Sartorius, catalog number: 17823-K )
0.45 µm syringe filters (Sartorius, catalog number: 16555-K )
Falcon tubes 50 ml (Corning, Falcon®, catalog number: 352070 )
Falcon tubes 15 ml (Corning, Falcon®, catalog number: 352099 )
T75 culture flasks (SPL LIFE SCIENCES, catalog number: 70075 )
Polyallomer tube 38 ml (Beckman Coulter, catalog number: 344058 , for gradient formation and fractionation)
Polyallomer tube 13.2 ml (Beckman Coulter, catalog number: 344059 , for gradient formation and fractionation)
8-week-old male Sprague-Dawley rat (Koatech)
Human adipose tissue-derived MSCs (from 2 healthy female donors, passage 4) provided from Yonsei cell therapy center or adipose derived stem cells purchased from Lonza (Lonza, catalog number: PT-5006 )
Isoflurane (Hana Pharm, Korea)
80% N2O
20% O2
Ketamine
Xylazine
Bradford protein assay kit I (Bio-Rad Laboratories, catalog number: 5000001 )
Dulbecco’s phosphate buffered saline (DPBS) (Biowest, catalog number: L0615-500 )
Trypsin/EDTA (0.05%, phenol red) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 25300054 )
Trypan blue solution 0.4% (in normal saline) (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
DMEM low glucose (GE Healthcare, HycloneTM, catalog number: SH30021.01 )
Penicillin/streptomycin (5,000 U/ml) (GE Healthcare, HycloneTM, catalog number: SV30010 )
Fetal bovine serum (FBS) (GE Healthcare, HycloneTM, catalog number: SH30071.03 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
10 mM Tris-HCl (WHITLAB, catalog number: BTH-9274 )
Sucrose (Sigma-Aldrich, catalog number: S9378 )
EDTA (Bio-Rad Laboratories, catalog number: 1610729 )
OptiPrepTM (Alere Technologies, Axis-Shield Density Gradient Media, catalog number: 1114542 )
MSC culture media (see Recipes)
Sucrose dilution buffer (see Recipes)
Sucrose cushion (see Recipes)
OptiPrepTM solution (see Recipes)
Equipment
Surgical scissors–Straight sharp/blunt 12 cm (Fine Science Tools, catalog number: 14001-12 )
Narrow pattern forceps–Curved 12 cm, 2 x 1.25 mm (Fine Science Tools, catalog number: 11003-12 )
Iris scissors–Large loops, angled (Fine Science Tools, catalog number: 14107-09 )
Scalpel handle with scalpel (Fine Science Tools, catalog numbers: 10011-00 , 10003-12 )
Bone rongeur (JEUNG DO BIO & PLANT, catalog number: H-2041-1 )
Adult rat brain matrix (Kent Scientific, catalog number: RBMS-300C )
Tissue grinders (WHEATON, catalog number: 357546 )
Pipettes
10 ml serological pipettes (SPL LIFE SCIENCES, catalog number: 91010 )
Ice bucket
Centrifuge (Eppendorf, model: 5804 )
Minimate TFF capsule system with a 100 kDa membrane (Pall, catalog number: OA100C12 )
Glass Pasteur pipettes (Fisher Scientific, catalog number: 13-678-20A )
37 °C, 5% CO2 cell culture incubator (Eppendorf, model: Galaxy® 170 S )
Inverted microscope (Olympus, model: CKX41 )
Hemocytometer
Ultracentrifuge (Beckman Coulter, model: OptimaTM XPN-100 )
Rotor: SW41Ti (Beckman Coulter, catalog number: 331362 )
Rotor: SW32Ti (Beckman Coulter, catalog number: 369650 )
Peristaltic pump (Poong Lim Tech, catalog number: PP-150 )
Masterflex L/S Easy-Load II head for Precision Tubing, PPS/CRS (Cole-Parmer, catalog number: EW-77200-50 )
Feed reservoir (100 ml or 500 ml)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lee, J. Y., Choi, S. and Kim, H. (2017). Microvesicle Isolation from Rat Brain Extract Treated Human Mesenchymal Stem Cells. Bio-protocol 7(13): e2375. DOI: 10.21769/BioProtoc.2375.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Mesenchymal stem cell
Cell Biology > Cell isolation and culture > Cell differentiation
Cell Biology > Cell-based analysis > Transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,376 | https://bio-protocol.org/exchange/protocoldetail?id=2376&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bacterial Survival in Dictyostelium
RR Regin Rønn*
XH Xiuli Hao*
FL Freja Lüthje
NG Nadezhda A. German
XL Xuanji Li
FH Fuyi Huang
JK Javan Kisaka
DH David Huffman
HA Hend A. Alwathnani
YZ Yong-Guan Zhu
Christopher Rensing
*Contributed equally to this work
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2376 Views: 7816
Edited by: Valentine V Trotter
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
We performed an assay to test the ability of different E. coli strains to survive inside amoebal cells after ingestion. In the assay we incubated bacteria together with cells of Dictyostelium discoideum for six hours. After co-incubation most of the uningested bacteria were removed by centrifugation and the remaining uningested bacteria were killed by gentamicin. Gentamicin is used because it does not penetrate into eukaryotic cells allowing the ingested bacteria to survive the antibiotic treatment, whereas bacteria outside the amoebal cells are killed.
Keywords: Bacteria Amoebae Protozoa Protists Grazing Digestion resistance
Background
Bacteria have evolved several different strategies to avoid or resist protozoan predation (Rønn et al., 2012). Mechanisms that reduce chance of ingestion such as increased cell size, aggregation, biofilm formation and increased swimming speed are well documented (Matz and Kjelleberg, 2005; Rønn et al., 2012) whereas mechanisms that allow bacteria to resist digestion in protozoan food vacuoles after ingestion are less studied (Gong et al., 2016). Here we describe a method to investigate the ability of bacterial strains to survive after ingestion by the social amoeba Dictyostelium discoideum. We used this assay to investigate if copper resistant E. coli have higher chance of survival after ingestion than bacteria without copper resistance (Hao et al., 2016). We studied copper resistance because it is known that macrophages, which are phagocytotic cells with an important role in the immune system of vertebrates, use copper to kill bacteria in the phagosome (Hodgkinson and Petris, 2012). We hypothesized that this killing mechanism originally evolved in free-living protozoa long before multicellular life arose and hence copper resistance could be a factor that protects bacteria against protozoan predation.
The assay is a modification of the Gentamicin protection assay used for evaluation of the ability of macrophages to kill bacteria (see e.g., Kaneko et al., 2016) and it utilizes that gentamicin is not able to penetrate into eukaryotic cells. In the original assay the number of internalized bacterial cells in the macrophages is determined at two time points. First, macrophages are incubated with bacteria for a given time period and after this co-incubation the uningested bacteria are removed and the number of internalized bacteria is estimated. Second measurement is taken after macrophages are incubated without extracellular bacteria to allow them to digest the internalized bacteria. The ratio between these two estimates is a measure of the bacterial survival rate.
Rapid digestion of some of our strains led to reduced reliability of estimates of the disappearance rate and made the original procedure unsuitable for use with Dictyostelium. We therefore modified the procedure so that we only estimated the number of surviving internalized bacteria at one time point after co-incubation of bacteria and amoebae for 6 h. This estimate reflects an equilibrium between ingestion and digestion rate of bacteria. It should be noted that this will only allow comparison of the digestion rate of different bacterial strains if it can be assumed that the bacteria are consumed with similar rates. In our case we had evidence that the different E. coli strains were taken up by the amoebae to the same extent and therefore we used the assay as an indicator of digestion rate. The assay will still be useful even if it cannot be assumed that bacteria are ingested at the same rate but of course it should be interpreted accordingly. It must also be noted that the procedure can only be used with bacteria that are sensitive to gentamicin.
Materials and Reagents
Pipettes and sterile tips
Sterile centrifuge tubes (e.g., Falcon® 50 ml conical centrifuge tubes)
Sterile cell culture flasks (e.g., 25 cm2 Nunc® EasYFlasksTM)*
24 well, cell culture plates, flat bottom (Corning, Costar®–or similar)
Sterile 1.5 ml Eppendorf tubes
50 ml Falcon tubes (Corning®–or similar)
Sterile filters (0.2 µm) for sterile filtration (Corning)
Dictyostelium discoideum AX4 (or other axenic strain; can be obtained at the Dicty Stock Center, Northwestern University, Chicago, IL, USA)
Bacterial cultures*
Gentamicin (Sigma-Aldrich, catalog number: G1264 )
Dihydrostreptomycin sulfate (Sigma-Aldrich, catalog number: PHR1517 )
Triton X-100 (Sigma-Aldrich, catalog number: 93443 )
OxoidTM tryptone (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: LP0042 )
OxoidTM yeast extract (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: LP0021 )
Sodium phosphate dibasic heptahydrate (Na2HPO4·7H2O) (Sigma-Aldrich, catalog number: S9390 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 435570 )
Note: This product has been discontinued.
Glucose (Sigma-Aldrich, catalog number: G8270 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C5670 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 310166 )
Note: This product has been discontinued.
Agar
Sterile HL5 medium (see Recipes)
SorC buffer (see Recipes)
Sterile Luria Broth (LB) (see Recipes)
Agar plates with Luria agar (see Recipes)
*Note: This protocol describes the procedure we used to compare survival rate of different E. coli strains, but other bacteria may be used. It is a requirement that the bacteria are sensitive to gentamicin.
Equipment
Pipette
Laminar flow hood (Heraeus, model: Air HLB 2472 )
125 ml Erlenmeyer flasks
Rotary shaker for incubation at 22 °C
37 °C constant incubator (Thermo Fisher Scientific)*
Rotary shaker for incubation at 37 °C*
Benchtop centrifuge for Eppendorf tubes (cooled at 4 °C) (Eppendorf, model: 5424 R )
Centrifuge for 50 ml Falcon tubes (HERMLE LABORTECHNIK, model: Z 326 K )
Spectrophotometer and respective cuvettes (600 nm)
Autoclave (STIK, model: MJ-Series )
Vortex mixer (Scientific Industries, model: Vortex-Genie 2 , catalog number: SI-0236)
pH meter and calibration buffers
Inverted microscope (Olympus, model: CKX31 )**
Microscope (Nikon Instruments, model: ECILPSE 80i)
Neubauer hemocytometer blood count with double counting chamber (Gizmo Supply, Germany)
*Note: Incubators set at 37 °C are necessary for work with E. coli but if other bacteria are used, growth temperature conditions should of course be modified accordingly.
**Note: An inverted microscope is very useful for inspection of culture flasks and cell culture plates during the experiment.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rønn, R., Hao, X., Lüthje, F., German, N. A., Li, X., Huang, F., Kisaka, J., Huffman, D., Alwathnani, H. A., Zhu, Y. and Rensing, C. (2017). Bacterial Survival in Dictyostelium. Bio-protocol 7(13): e2376. DOI: 10.21769/BioProtoc.2376.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Microbiology > Microbe-host interactions > Protista
Cell Biology > Cell viability > Cell proliferation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,377 | https://bio-protocol.org/exchange/protocoldetail?id=2377&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Live Imaging of Myogenesis in Indirect Flight Muscles in Drosophila
DS Dagan Segal
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2377 Views: 8685
Edited by: Antoine de Morree
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
The indirect flight muscles (IFMs) are the largest muscles in the fly, making up the bulk of the adult thorax. IFMs in Drosophila are generated during pupariation by fusion of hundreds of muscle precursor cells (myoblasts) with larval muscle templates (myotubes). Prominent features, including the large number of fusion events, the structural similarity to vertebrate muscles, and the amenability to the powerful genetic techniques of the Drosophila system make the IFMs an attractive system to study muscle cell fusion. Here we describe methods for live imaging of IFMs, both in intact pupae, and in isolated IFMs ex-vivo. The protocols elaborated upon here were used in the manuscript by (Segal et al., 2016).
Keywords: Myoblast fusion Live imaging Indirect flight muscle Drosophila Muscle ex-vivo culture
Background
While Drosophila embryonic muscles have long been an established model system for the study of muscle development (Volk, 1999; Chen and Olson, 2004; Abmayr et al., 2008; Richardson et al., 2008) the adult Drosophila indirect flight muscles (IFMs), which form during pupal stages, have emerged in recent years as a complementary system to address cell-biological processes during myogenesis (Dutta, 2006; Oas et al., 2014; Weitkunat et al., 2014; Shwartz et al., 2016). Their large size, ample fusion events, structural similarity to vertebrate muscles, and amenability to powerful genetic techniques of the Drosophila system make the IFMs an attractive system to study muscle development. Historically, study of IFM development has been limited compared to embryonic muscle for several reasons. First, classic genetic approaches are difficult to implement in IFMs due to functional requirements earlier in development for many of the genes potentially involved in muscle development in the adult and to the syncytial nature of muscles, which restricts the usefulness of clonal analysis. Relatively recent advances in the available tools utilizing the GAL4-UAS system allow circumvention of these limitations, by expressing RNAi in a tissue specific manner. The power of this approach was demonstrated in a comprehensive screen for genes involved in pupal myogenesis (Schnorrer et al., 2010), and has been successfully implemented in several recent studies of myoblast fusion in IFMs (Mukherjee et al., 2011; Gildor et al., 2012; Dhanyasi et al., 2015; Segal et al., 2016). In addition, the technical challenges associated with dissection, accessibility, and visualization of IFMs have been overcome by advances in techniques and technology (Weitkunat and Schnorrer, 2014; Segal et al., 2016). This protocol is an expanded version of the methods used in the manuscript by (Segal et al., 2016), and is intended to contribute to the growing repertoire of techniques for study of IFMs. Here we describe methods for live imaging of IFMs, both in intact pupae, and in isolated IFMs ex-vivo. While previous work focused on stages of myotube growth via fusion (18-22 h after puparium formation [APF], 25 °C), these methods are readily applicable to other stages of IFM myogenesis, starting at 12 h APF onwards. Imaging of intact pupae can be suitable for studies of developmental processes which span several hours, while imaging of ex-vivo cultures is intended to better visualize finer structural details and dynamic behaviors over shorter time periods (e.g., 1 h). Parts of this protocol are variations on (Weitkunat and Schnorrer, 2014).
Materials and Reagents
Glass single frosted microscope slides (Thermo Fisher Scientific, catalog number: 421-004T )
Cover slip
Custom-made plexiglass slide with round opening in center (will serve as basis for viewing chamber)
Note: The opening should be 1.25 cm in diameter.
Double-sided tape
Kim-wipes
Toothpick
8-well chamber slide (μ-slide) (ibidi, catalog number: 80826 )
200 μl and 1,000 μl pipette tips
Sylgard silicone plates, stained with charcoal (Dow Corning, catalog number: 3097358-1004 )
1 cm Minutian pins for silicon plate (Fine Science Tools, catalog number: 26002-10 )
Flies expressing muscle-specific fluorescent markers (e.g., mef2-GAL4> UAS-CD8-GFP)
Schneider’s medium
Fetal bovine serum (FBS)
BD Matrigel matrix growth factor, reduced (Corning, catalog number: 354230 )
Halocarbon oil
Equipment
Thin paint brush
Forceps (Dumont 55) (Fine Science Tools, catalog number: 11255-20 )
Vannas Spring scissors, 2.5 mm Cutting Edge (Fine Science Tools, catalog number: 15001-08 )
Confocal microscopy system (e.g., ZEISS, model: LSM 780 ) equipped with an inverted microscope and a 40x water immersion objective
200 μl and 1,000 μl pipette
125 ml Erlenmeyer flask
25 °C incubator to grow flies (Elcon company, custom-made)
Vials with fly food to raise and collect flies
37 °C incubator for matrigel solidification (Thermo Fisher Scientific, Thermo ScientificTM, model: HeracellTM 150i )
Oxygen tank with attached rubber tube
Binocular dissecting microscope (Nikon Instruments, model: SMZ645 )
Fluorescent binocular microscope (Leica, model: Leica MZ16F )
Software
Zen Black software (ZEISS)
Microsoft Excel
R Statistical software (can be downloaded at: https://www.r-project.org/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Segal, D. (2017). Live Imaging of Myogenesis in Indirect Flight Muscles in Drosophila. Bio-protocol 7(13): e2377. DOI: 10.21769/BioProtoc.2377.
Download Citation in RIS Format
Category
Neuroscience > Peripheral nervous system > Flight muscle
Cell Biology > Tissue analysis > Tissue isolation
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,378 | https://bio-protocol.org/exchange/protocoldetail?id=2378&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Photothrombotic Induction of Capillary Ischemia in the Mouse Cortex during in vivo Two-Photon Imaging
RU Robert G. Underly
AS Andy Y. Shih
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2378 Views: 8957
Edited by: Pengpeng Li
Reviewed by: Zinan Zhou
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
Photothrombosis of blood vessels refers to the activation of a circulating photosensitive dye with a green light to induce clotting in vivo (Watson et al., 1985). Previous studies have described how a focused green laser could be used to noninvasively occlude pial arterioles and venules at the brain surface (Schaffer et al., 2006; Nishimura et al., 2007; Shih et al., 2013). Here we show that small regions of the capillary bed can similarly be occluded to study the ischemic response within the capillary system of the mouse cerebral cortex. The advantage of this approach is that the ischemic zone is restricted to a diameter of approximately 150-250 μm. This permits higher quality two-photon imaging of degenerative processes that would be otherwise difficult to visualize with models of large-scale stroke, due to excessive photon scattering. A consequence of capillary occlusion is leakage of the blood-brain barrier (BBB). Here, through the use of two-photon imaging data sets, we show how to quantify capillary leakage by determining the spatial extent and localization of intravenous dye extravasation.
Keywords: Blood-brain barrier Photothrombosis Ischemia Two-photon imaging Capillary Stroke
Background
Numerous animal models exist to induce ischemia on a large scale via occlusion major cerebral arteries (Carmichael, 2005). However, there are some aspects of stroke that are not accessible to in vivo two-photon imaging. In regions experiencing more severe ischemia, cells swell due to ionic imbalance, and this edematous process contributes to increased light scattering, greatly reducing the quality and depth of in vivo two-photon imaging. A smaller zone of ischemia would reduce photon scattering, and still allow neurovascular changes associated with ischemia to be more clearly visualized over time in vivo.
We recently showed that spatially restricted regions of ischemia could be generated by focused photothrombotic irradiation of the cortical capillary bed (Underly et al., 2017). Capillary occlusions were highly reproducible, could be targeted to specific locations, and initiated at precise times through a cranial imaging window. The resulting ischemic zone occupied less than 1% of the area accessible through a typically cranial window (Figures 1D and 1E), allowing multiple strokes to be examined in one window.
Here, we describe the steps involved in inducing photothrombotic occlusion in a small region of the capillary bed during in vivo two-photon imaging. We build upon a previous protocol in which individual cortical penetrating arterioles were occluded, rather than capillaries (Taylor and Shih, 2013). We also demonstrate the analysis of BBB leakage produced as a consequence of capillary occlusion using Imaris, a 3-D visualization software.
Materials and Reagents
Filter paper (GE Healthcare, catalog number: 1001-0155 )
Cotton swabs (Fisher Scientific, catalog number: 23-400-119 )
Cover glass (thickness: No. 0) (Thomas Scientific, catalog number: 6661B40 )
0.3 ml insulin syringes (BD, catalog number: 328438 )
Petri dish
An adult mouse of any common laboratory strain, ~25 to 35 g in weight
Isoflurane (Patterson Veterinary Supply, catalog number: 07-806-3204 )
Manufacturer: Zoetis, catalog number: 10015516 .
Phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: P4417-50TAB )
Agarose type 3-A (Sigma-Aldrich, catalog number: A9793 )
Fluorescein-dextran (2 MDa; 5% w/v in saline) (Sigma-Aldrich, catalog number: FD2000S )
Rose Bengal (1.25% w/v in saline) (Sigma-Aldrich, catalog number: 330000-1G )
Buprenorphine hydrochloride (Buprenex®) (Patterson Veterinary Supply, catalog number: 07-891-9756 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653-1KG )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333-500G )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C1016-100G )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266-100G )
Glucose (Sigma-Aldrich, catalog number: G8270 )
HEPES (Sigma-Aldrich, catalog number: H7006 )
Artificial cerebral spinal fluid (ACSF) (see Recipes)
Equipment
Heating pad with feedback regulation (FHC, catalog number: 40-90-2-07 )
Heating pad control system (FHC, catalog number: 40-90-8D )
Rectal Thermistor Probe (FHC, catalog number: 40-90-5D-02 )
Isoflurane vaporizer (Datex-Ohmeda, model: IsoTec4 )
Induction chamber (VetEquip, catalog number: 941444 )
Dental drill (Osada, model: EXL-M40 )
Auxiliary equipment for two-photon microscope (Sutter Moveable Objective System [Taylor and Shih, 2013])
Objective lens 4x, 0.16 NA (Olympus, model: UPLSAPO )
Objective lens 20x, 1.0 NA, Water immersion (Olympus, model: XLUMPlanFI )
Green laser 532 nm (Beta Electronics, model: MGM20 ). Details for how the green laser line is directed into the Sutter MOM imaging beam path was described in a separate protocol (Taylor and Shih, 2013)
Computer specifications (for Imaris)
16 GB RAM
3.3 GHz CPU
AMD Radeon RX 480 4GB or better
1280 x 1024 Resolution Monitor
Software
Imaris (Bitplane)
Imaris 7.6 (or current)
Imaris Batch Module
Fiji software (https://imagej.net/Fiji/Downloads)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Underly, R. G. and Shih, A. Y. (2017). Photothrombotic Induction of Capillary Ischemia in the Mouse Cortex during in vivo Two-Photon Imaging. Bio-protocol 7(13): e2378. DOI: 10.21769/BioProtoc.2378.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Two-photon microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,379 | https://bio-protocol.org/exchange/protocoldetail?id=2379&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of NO and CSF Levels Produced by Bacillus subtilis
Sebastián Cogliati
Facundo Rodriguez Ayala
Carlos Bauman
Marco Bartolini
Cecilia Leñini
Juan Manuel Villalba
Federico Argañaraz
Roberto Grau
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2379 Views: 7851
Edited by: Jyotiska Chaudhuri
Reviewed by: Sanjib Kumar GuhaTugsan Tezil
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
The cell-to-cell communication and division of labour that occurs inside a beneficial biofilm produce significant differences in gene expression compared with the gene expression pattern of cells grew under planktonic conditions. In this sense, the levels of NO (nitric oxide) and CSF (Competence Sporulation Stimulating Factor) produced in Bacillus subtilis cultures have been measured only under planktonic growth conditions. We sought to determine whether NO and/or CSF production is affected in B. subtilis cells that develop as a biofilm. To measure the production levels of the two prolongevity molecules, we grew B. subtilis cells under planktonic and biofilm supporting condition.
Keywords: Bacillus subtilis Planktonic growth Biofilm NO CSF
Background
NO is a key signalling molecule, playing a role in a variety of biological processes in vertebrates (Kerwin et al., 1995). C. elegans is unable to produce its own NO but is able to incorporate the NO produced by B. subtilis (Cabreiro and Gems, 2013; Gusarov et al., 2013; Kim, 2013; Clark and Hodgkin, 2014). Most organisms produce NO through aerobic conversion of L-arginine to L-citrulline in a reaction catalysed by the enzyme NO synthetase encoded by the nos gene (Sudhamsu and Crane, 2009). E. coli strains, several of which are routinely used to feed worms (OP50, HB101) (Cabreiro and Gems, 2013; Kim, 2013; Clark and Hodgkin, 2014), are not proficient in aerobic NO production because they lack a functional copy of nos (Sudhamsu and Crane, 2009). However, E. coli can produce NO under anaerobic/microaerophilic conditions by a series of biochemical reactions associated with the anaerobic respiratory chain of the bacterium (Corker and Poole, 2003). In such case, E. coli might find permissive conditions for NO production in the oxygen-depleted environment of the worm intestine. Bacteria produced-NO in worm gut that freely diffuses through the plasma membrane is oxidized to nitrate and nitrite, and thus, the concentration of nitrate and nitrite are directly proportional to the level of NO production (Gusarov et al., 2013) and can be determined using a colorimetric assay.
Intra- and interspecific quorum sensing (QS) constitutes molecules that bacteria use in nature to communicate with each other and with cells of different kingdoms (Shapiro, 1998; Ben Jacob et al., 2004; Parsek and Greenberg, 2005; Bassler and Losick, 2006). B. subtilis QS pentapeptide CSF (Competence Sporulation Stimulating Factor, also named PhrC) (Lazazzera et al., 1997) was previously reported to contribute to intestinal homeostasis by activating key survival pathways of the host (p38 MAP kinase and protein kinase B) and by inducing cytoprotective heat shock proteins (Hsps) (Fujiya et al., 2007; Willians, 2007). These effects of CSF (Willians, 2007) depend on its uptake by the protein OCTN2, a host cell membrane transporter of organic cations present in the apical face of epithelial cells (Fujiya et al., 2007). To quantify bacteria-produced CSF, promoters are commonly fused to heterologous reporter genes that encode enzymes that can be quantified using highly sensitive assays. Typically, incorporation to B. subtilis of a reporter lacZ gene, encoding β-galactosidase (β-gal) to the promoter region of a gene of interest, can be used to determine the level of CSF produced by this probiotic bacterium. When used in this manner, the Pcsf-lacZ fusion is integrated into the chromosome at the non-essential amyE locus. The basic colorimetric assay described here is the simplest and less expensive assay for quantifying β-gal activity. The cells are lysed and an aliquot of the extract is mixed with the reaction substrate, O-nitrophenyl-β-D-galactopyranoside (ONPG). When the yellow product becomes visible, the optical densities of the samples are determined spectrophotometrically.
Materials and Reagents
Pipette tips
Petri dishes 60 x 15 mm 500/cs (Fisher Scientific, catalog number: FB0875713A )
Sterile 150 x 20 mm-culture tube (Sigma-Aldrich, catalog number: C1048 )
Sterile 150 x 16 mm-culture tube (Science Lab Supplies, catalog number: 6135-5-012 )
1.5 ml tube
Amicon Ultra 0.5 ml centrifugal filters MWCO 10 kDa (Sigma-Aldrich, catalog number: Z677108)
Manufacture: EMD Millipore, catalog number: UFC501096 .
Amicon Ultra centrifugal filter units Ultra-4, MWCO 30 kDa (Sigma-Aldrich, catalog number: Z648035)
Manufacture: EMD Millipore, catalog number: UFC803024 .
Cryovial (Simport, catalog number: T310-2A )
96-well solid plate (Colorimetric assay) (Cayman Chemical, catalog number: 400014 )
96-well cover sheet (Cayman Chemical, catalog number: 400012 )
Derivative of B. subtilis NCIB31610
Bacillus subtilis NCIB3610 and JH642 (Bacillus Genetic Stock Center, catalog numbers: 3A1 and 1A96 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Bacto peptone (BD, BactoTM, catalog number: 211677 )
Nitrate/Nitrite Colorimetric Assay Kit (Cayman Chemical, catalog number: 780001 )
Nitrate/Nitrite assay buffer (Cayman Chemical, catalog number: 780022 )
Nitrate Reductase Enzyme Preparation (Cayman Chemical, catalog number: 780010 )
Nitrate Reductase Cofactor Preparation (Cayman Chemical, catalog number: 780012 )
Nitrate Standard (Cayman Chemical, catalog number: 780016 )
Griess Reagent R1 (Cayman Chemical, catalog number: 780018 )
Griess Reagent R2 (Cayman Chemical, catalog number: 780020 )
Luria Bertani broth (Sigma-Aldrich, catalog number: L3522 )
Luria Bertani broth with agar (Sigma-Aldrich, catalog number: L2897 )
Agar (Sigma-Aldrich, catalog number: A1296 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P2222 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P9791 )
MOPS (Sigma-Aldrich, catalog number: M9381 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: M1880 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C3881 )
Manganese(II) chloride (MnCl2·2H2O) (EMD Millipore, catalog number: 1059340100 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Iron(III) chloride hexahydrate (FeCl3·6H2O) (Sigma-Aldrich, catalog number: 236489 )
Glutamate (Sigma-Aldrich, catalog number: 49621 )
Tryptophan (Sigma-Aldrich, catalog number: T0254 )
Phenylalanine (Sigma-Aldrich, catalog number: P2126 )
Chloramphenicol (Sigma-Aldrich, catalog number: C0378 )
100% ethanol (Sigma-Aldrich, catalog number: E7023 )
Cholesterol (Sigma-Aldrich, catalog number: C8667 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S3139 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Lysozyme from chicken egg white (Sigma-Aldrich, catalog number: L6876 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
O-nitrophenyl-β-D-galactopyranoside (Sigma-Aldrich, catalog number: N1127 )
Sodium carbonate (Na2CO3) (Sigma-Aldrich, catalog number: 223484 )
10 N NaOH
Nematode growth medium (NGM) broth (see Recipes)
MSgg medium (see Recipes)
5 mg/ml chloramphenicol (see Recipes)
5 mg/ml cholesterol (see Recipes)
1 M MgSO4 (see Recipes)
1 M CaCl2 (see Recipes)
Phosphate buffer (see Recipes)
Z buffer (see Recipes)
10 mg/ml lysozyme solution (see Recipes)
10% Triton X-100 solution (see Recipes)
O-nitrophenyl-β-D-galactopyranoside (ONPG) 4.5 mg/ml (see Recipes)
1.2 M Na2CO3 (see Recipes)
50% glycerol (see Recipes)
100 mM MOPS pH = 7 (see Recipes)
Equipment
Erlenmeyer flask (Fisher Scientific, catalog number: FB5006000 )
Pipettor (Gilson, catalog number: F167300 )
Glass pipette
Refrigerated incubator (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 51028064 ; Fisher Scientific, catalog number: 37-20 )
Note: The product “Fisher Scientific, catalog number: 37-20 ” has been discontinued.
Water bath (AQUA® LYTIC incubator 37 °C)
Freezers (-20 °C; So-Low Environmental Equipment) (Siemens, model: So-Low Ultra C85-22 )
Autoclave (Tuttnauer, model: Model 6690 )
Stirring hotplate (Corning, catalog number: 6795-620 )
Centrifuge (Eppendorf, model: 5430 )
Tabletop centrifuge (Eppendorf, model: 5424 )
Molecular Dynamics Model SpectraMAX 340 PC microplate reader (Molecular Devices, model: SpectraMAX 340PC384 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cogliati, S., Rodriguez Ayala, F., Bauman, C., Bartolini, M., Leñini, C., Villalba, J. M., Argañaraz, F. and Grau, R. (2017). Determination of NO and CSF Levels Produced by Bacillus subtilis. Bio-protocol 7(13): e2379. DOI: 10.21769/BioProtoc.2379.
Download Citation in RIS Format
Category
Microbiology > Microbial signaling > Secondary messenger
Microbiology > Microbial biofilm > Biofilm culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,380 | https://bio-protocol.org/exchange/protocoldetail?id=2380&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ex vivo Ooplasmic Extract from Developing Drosophila Oocytes for Quantitative TIRF Microscopy Analysis
Imre Gáspár
Anne Ephrussi
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2380 Views: 7856
Edited by: Jihyun Kim
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Understanding the dynamic behavior and the continuously changing composition of macromolecular complexes, subcellular structures and organelles is one of areas of active research in both cell and developmental biology, as these changes directly relate to function and subsequently to the development and homeostasis of the organism. Here, we demonstrate the use of the developing Drosophila oocyte to study dynamics of messenger ribonucleoprotein complexes (mRNPs) with high spatiotemporal resolution. The combination of Drosophila genetics with total internal reflection (TIRF) microscopy, image processing and data analysis gives insight into mRNP motility and composition dynamics with unprecedented precision.
Keywords: Ooplasmic extract Intracellular motility TIRF microscopy Oocyte ex vivo assay
Background
Intracellular transport is one of the fundamental processes in living cells. Almost everything within the cell–ions, molecules, complexes, organelles–is transported actively such that the local entropy is reduced. Although in recent years we have gained considerable understanding of the mechanisms underlying these transport process, most of our knowledge comes from in vitro and cell culture studies. In these simplified systems, it is difficult to establish whether the full potential of the transport regulatory processes is utilized. Tissues, organs, organoids and organisms, on the other hand, are often too complex to be studied efficiently with spatiotemporal resolution sufficient to match the scale of these transport processes. To combine the advantages of the bottom-up and top-down approaches, techniques have been developed that, while preserving complexity, make these processes more accessible. One example is the preparation of mass cytoplasmic extract from ambiphian (e.g., Xenopus laevis) oocytes and embryos to study cell divisions (Lohka and Masui, 1983; Murray, 1991; Sawin and Mitchison, 1991). We have recently shown that in cytoplasmic drops–i.e., non-purified cytoplasm directly extracted from the cell–released from single Drosophila embryos mitotic activity of the contained nuclei continues, allowing the probing of spindle properties by simple physical and chemical perturbations (Telley et al., 2012 and 2013). Here, we describe a similar ex vivo preparation technique based on ooplasm of developing Drosophila egg-chambers. This method allows the study of intracellular transport processes (squash assay), such as the transport of localizing oskar mRNPs (Gaspar et al., 2017).
Materials and Reagents
Coverslip stand for 5-10 coverslips (e.g., Wash-N-Dry, Diversified Biotech, catalog number: WSDR-1000 )
Gloves
A small plastic Petri dish or the cap of a 50 ml Falcon tube (~30 mm diameter)
15 x 20 cm black plastic plate
High precision coverslips (e.g., Marienfeld Precision Cover Glass, 22 x 22 mm, Marienfeld-Superior, catalog number: 0107052 )
X-ray film (e.g., Amersham HyperfilmTM ECL, GE Healthcare, catalog number: 28906835 )
Double-sided adhesive tape (e.g., Tesa Doubleband Photostrip, Tesa, catalog number: 05338-00 )
Cheesecloth
A fly line or a cross that yields females of the appropriate genotype (see Note 1)
Dry, granular baker’s yeast (e.g., Lesaffre Saf-Instant®)
Halocarbon oil (e.g., Voltalef 10S, VWR, catalog number: 24627.188 )
100% ethanol (e.g., EMD Millipore, catalog number: 100983 )
~5% dichlorodimethylsilane (DCDMS) in heptane (e.g., Silanization Solution, Sigma-Aldrich, catalog number: 85126 )
PIPES (e.g., Sigma-Aldrich, catalog number: P3768 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (e.g., EMD Millipore, catalog number: 105833 )
EGTA (e.g., Sigma-Aldrich, catalog number: E3889 )
HEPES (e.g., Sigma-Aldrich, catalog number: H3375 )
Potassium chloride (KCl) (e.g., EMD Millipore, catalog number: 104936 )
Dextran sulfate, MW ~10 kDa (e.g., Sigma-Aldrich, catalog number: D4911 )
Agar (e.g., from Pro-BIO)
Dry yeast (e.g., from Volk Klaus)
Soya powder (e.g., from Ruckemann)
Sirup (e.g., from Ruckemann)
Malt extract (e.g., from Baeko Rhei)
Corn powder (e.g., from Ruckemann)
Propionic acid (e.g., VWR, catalog number: ACRO447231000)
Manufacturer: Acros Organics, catalog number: 447231000 .
Nipagin (e.g., Sigma-Aldrich, catalog number: H5501 )
BRB80 (see Recipes)
1% injection buffer (1% IB) (see Recipes)
Cornmeal agar (see Recipes)
Equipment
Standard fly husbandry equipment (e.g., vials with cornmeal agar–see Recipes, 25 °C incubator with humidity controller, brushes, CO2 station, etc.)
3-9 well dissection plate (e.g., Corning, catalog number: 7220-85 )
Vacuum desiccator (e.g., SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F42025-0000 )
Dumont #5 forceps (e.g., Fine Science Tools, catalog number: 11252-20 )
Dumont #55 forceps (e.g., Fine Science Tools, catalog number: 11255-20 )
Custom made coverslip holder for microscopy (Figure 1)
Figure 1. Vacuum desiccator loaded with the coverslip holder and the silane reservoir. After replacing the lid of the device, apply vacuum by opening the vacuum valve and the water tap. Once the vacuum is formed–i.e., you can lift the entire device by the lid–close the vacuum valve and the water tap.
Zooming stereomicroscope with 5-40x (or higher) magnification (e.g., Carl Zeiss, model: STEMI SV 11 )
Sharp tungsten needles with handles (e.g., Fine Science Tools, catalog numbers: 10130-20 and 26018-17 )
Total Internal Reflection Fluorescent (TIRF) microscope equipped with a high NA objective and a high sensitivity detector (Leica Microsystems, model: Leica AF7000 )
Note: We use a Leica 7000 wide-field TIRF microscope with a 100x 1.46 NA oil immersion objective and a Photometrics Evolve Roper 512 EMCCD camera.
Software
Microscope controller software (e.g., Leica LASAF)
ImageJ/FIJI
Custom-made particle detector and tracker plug-in for ImageJ (available to download under https://github.com/Xaft/xs/blob/master/_xs.jar)
R (preferentially with RStudio), for data analysis
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gáspár, I. and Ephrussi, A. (2017). Ex vivo Ooplasmic Extract from Developing Drosophila Oocytes for Quantitative TIRF Microscopy Analysis. Bio-protocol 7(13): e2380. DOI: 10.21769/BioProtoc.2380.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling > Ligand
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,381 | https://bio-protocol.org/exchange/protocoldetail?id=2381&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Spinal Cord Preparation from Adult Red-eared Turtles for Electrophysiological Recordings during Motor Activity
Peter C Petersen
Rune W Berg
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2381 Views: 11496
Reviewed by: Hélène M. LégerJingli Cao
Original Research Article:
The authors used this protocol in 18-Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
18-Oct 2016
Abstract
Although it is known that the generation of movements is performed to a large extent in neuronal circuits located in the spinal cord, the involved mechanisms are still unclear. The turtle as a model system for investigating spinal motor activity has advantages, which far exceeds those of model systems using other animals. The high resistance to anoxia allows for investigation of the fully developed and adult spinal circuitry, as opposed to mammals, which are sensitive to anoxia and where using neonates are often required to remedy the problems. The turtle is mechanically stable and natural sensory inputs can induce multiple complex motor behaviors, without the need for application of neurochemicals. Here, we provide a detailed protocol of how to make the adult turtle preparation, also known as the integrated preparation for electrophysiological investigation. Here, the hind-limb scratch reflex can be induced by mechanical sensory activation, while recording single cells, and the network activity, via intracellular-, extracellular- and electroneurogram recordings. The preparation was developed for the studies by Petersen et al. (2014) and Petersen and Berg (2016), and other ongoing studies.
Keywords: Adult turtle Integrated preparation ex vivo Spinal cord Electrophysiology Intracellular and extracellular recordings Single units Electroneurogram Scratch reflex Central pattern generator
Background
The investigation of spinal electrophysiology has traditionally been associated with mechanical complications due to the many moving parts and the flexibility of the spine. To circumvent this issue, the spinal cord has often been dissected out of the column and moved to a chamber where stable electrophysiological recordings can be performed. Nevertheless, this procedure has shortcomings, for instance, it is complicated to properly activate the motor circuitry especially if multiple motor behaviors are to be investigated. Furthermore, the absence of blood supply and lack of oxygen has serious ramifications on the health and integrity of the circuitry. An experimental model, which can circumvent all these issues, is the turtle preparation (Keifer and Stein, 1983). Here, one can study not only the fully developed vertebrate spinal cord, but also several different types of complex motor behaviors without the need of neuro-active substances such as glutamate agonists, 5HT, and dopamine. Since the neurons in the turtle central nervous system are able to perform anaerobic metabolism, the integrity of the circuit remains for much longer than in the mammalian experiments. Last, the turtle carapace organization allows stabile multi-electrode recordings of unprecedented quality. Here, we provide a detailed protocol for setting up the integrated adult turtle preparation, sometimes called the ex vivo preparation (Guzulaitis et al., 2014), with intact spinal motor network. The preparation provides the opportunity for measurements of the central pattern generator in the lumbar spinal segments (Figure 1), which is similar to the lumbar spinal cord of mammals and other animals (Walloe et al., 2011). This preparation includes the spinal segments D3-S2 en bloc. Measurements of the scratch reflex can be performed entirely in the absence of chemical anesthesia. Intracellular, as well as high-density extracellular recordings, can be acquired in the spinal cord concurrent with both ipsilateral and contralateral electroneurogram recordings of muscle nerves (ENG). The scratch reflex is induced by mechanically touching the ventral side of the carapace and therefore identical or close to a natural behavior. A smaller version of the integrated turtle preparation was introduced by Keifer and Stein (1983) and subsequently adapted and modified (Currie and Lee, 1997; Alaburda and Hounsgaard, 2003; Alaburda et al., 2005; Berg et al., 2007 and 2008; Kolind et al., 2012; Vestergaard and Berg, 2015). The present preparation was developed for the study by Petersen et al. (2014) and Petersen and Berg (2016) where electrode arrays are inserted perpendicularly into the lumbar spinal cord (Berg et al., 2009).
The preparation steps can be split into two parts, typically performed over two days. First part can be performed without a microscope. All procedures of the first part are completed over 3 h. The first 2 h to induce anesthesia and the last hour for dissection. The procedures of the second part can be performed at a setup using a microscope and will take about an hour to complete.
Figure 1. The integrated adult-turtle preparation with implanted electrodes. A. Schematic of the placement of the silicon probes in the spinal cord; B. The preparation with three silicon probes and intracellular glass electrode. Suction electrodes for electroneurogram recordings are attached (pointing from top and bottom and right and left). C-D. Close up of the spinal cord with silicon probes and intracellular glass electrode (only inserted in the spinal cord in D). The tips of suction electrodes are also visible. Modified from Petersen and Berg (2016) with permission. E. The spinal cord after the silicon probes have been retracted. Blue DiD markings are visible from the first and third shank (8 markings for each of the probes, highlighted with arrows).
Materials and Reagents
Scalpel handle #3 (Fine Science Tools, catalog number: 10003-12 ) with scalpel blade #15 (Fine Science Tools, catalog number: 10015-00 )
Cast cutter blade: BSN 2.5” stainless steel sectioned blade (BSN medical, catalog number: 480-4183-145 )
Plastic bag, 5 L size
Gloves
45 mm Rotary cutter blades (WorldKitchen, OLFA, catalog number: RB45-5 )
Cyanoacrylate adhesive (Panacol, catalog number: Cyanolit® 202 )
Plexiglas plate: 80 x 15 x 2 mm
Paper towel
100 mm or 120 mm Petri dishes (VWR, catalog number: HECH41042024 or HECH41042030 )
Earmuff (PeltorTM OptimeTM 98 Earmuff) (3M, catalog number: 10093045080912 )
Syringe needle 27 G, 31 mm (BD, catalog number: 305136 )
Red eared turtles (Trachemys scripta elegans, Nasco, Fort Atkinson, WI, USA) of weight 300-500 g and of both sexes were used in this procedure
Crushed ice
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P5405 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich)
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: 208337 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: 21115 )
Glucose (Sigma-Aldrich, catalog number: G7021 )
Ringer’s solution (98% O2/2% CO2) (see Recipes)
Ringer’s solution (95% O2/5% CO2) (see Recipes)
Equipment
Scissors
Large scissors (Fine Science Tools, catalog number: 14014-17 )
Fine scissors (Fine Science Tools, catalog number: 14090-09 )
Fine serrated scissors (Fine Science Tools, catalog number: 14058-11 )
Forceps:
Dumont #5 forceps (Fine Science Tools, catalog number: 11251-10 )
Dumont #5 fine forceps (Fine Science Tools, catalog number: 11254-20 )
Dumont #7 curved forceps (Fine Science Tools, catalog number: 11271-30 )
Toothed tissue forceps (Fine Science Tools, catalog number: 11022-15 )
Serrated Graefe forceps (Fine Science Tools, catalog number: 11051-10 )
Pliers: Liston Gross Anatomy Bone Cutters (Fine Science Tools, catalog number: 16104-19 )
Course and fine Rongeurs: Lempert Rongeurs (Fine Science Tools, catalog number: 16004-16 ) and Friedman-Pearson Rongeurs (Fine Science Tools, catalog number: 16221-14 )
Perfusion system: Custom-designed air-pressure system/outlet connected to the inlet of a 1 L Pyrex glass bottle with lid. The outlet of the bottle is connected to a flow meter and to a 21 G 5 mm syringe needle (BD, catalog number: 305129 )
Cast saw cutter (Atlas International, American Orthopaedic, catalog number: T-CC-100 )
Pyrex glass griffin beaker 1 L (Corning, PYREX®, catalog number: 1000-1L )
Open Plexiglas container, Dimensions: 200 x 150 x 25 mm (D x W x H), Plexiglas thickness: 3 mm. Custom built
Extracellular recordings: 64 channel Berg64-probe from Neuronexus. 8 shanks, each with 8 staggered recording-sites distanced 30 µm vertically, designed for ventral horn recordings from the turtle (Neuronexus, BERG A8X8-5MM-200-160 PROBE)
Intracellular recordings: Glass pipettes pulled with a P-1000 Sutter Instruments and filled with a mixture of 0.9 M potassium acetate and 0.1 M KCl. For histological verification 4% w/v biocytin can be added to the mixture (Biocytin, Sigma-Aldrich, catalog number: B4261 )
Nerve recordings: Electroneurogram (ENG) recordings can be performed with suction electrodes
Procedure
Note: The surgical procedures comply with Danish legislation and were approved by the controlling body under the Ministry of Justice.
First part of the preparation
Anesthetization
To induce hypothermic analgesia, the turtle is submerged in crushed ice in a bucket. Full induction of anesthesia takes about two hours.
Ringer’s solution
Prepare 2 L of cold Ringer’s solution (see Recipes) (5 °C) for the first day. Cold Ringer’s solution is used to keep the turtle anesthetized during the preparation.
Initial surgery and perfusion
Tools: Toothed Tissue Forceps, large pliers, large scissors, small scissors, cast saw cutter, cast cutter blade, perfusion system, plastic bag, gloves.
Prepare perfusion-system: Fill the glass bottle with 500 ml Ringer’s solution and close the lid. Connect the bottle to a compressed air system/outlet.
Turn on the compressed air and let the perfusion-system run for 30 sec with a flow above 120 ml/h as measured with the flow meter. Stop the flow.
Take the turtle from the ice bath. Two conditions must be met to ensure that the turtle is fully anesthetized: 1) Its eyes must be closed and 2) No pedal withdrawal reflex response. Proceed, when the anesthesia is confirmed.
Pull out the head of the turtle with the toothed Tissue Forceps to allow for decapitation.
Hold the head in place with the large pliers (Figure 2), and cut the neck with the large scissors.
Figure 2. Decapitation of anaesthetized turtle. Head is held in place with the toothed tissue forceps and large pliers. The large pair of scissors is used for the decapitation.
Crush the head with the large pliers and dispose of it in the plastic bag.
Note: Now that the turtle is decapitated the dissection can begin. In the next steps, you will perfuse the cardiovascular system with cold Ringer’s solution, by injecting Ringer’s solution through the heart of the turtle. This removes blood and cools the nervous tissue.
Place the turtle on its back, and use the cast saw cutter to make a square opening in the plastron. The location of the four cuts is shown in Figure 3. The two cuts, orthogonal to the spinal cord, are oriented along the edges of the two central scutes (smaller plates). Keep the minimum distance between the cuts, parallel to the midline, above 5 cm. Make sure that the square cutout plastron is completely released with the cast saw cutter before continuing. Verify this by gently pushing on the inner corners of the cut-out plastron, if the square piece moves freely it is sufficient.
Figure 3. The square cut in the plastron has been performed. Gently push in the inner corners of the square cut-out plastron to verify that it is released.
Lift up the cutout plastron with the Graefe forceps and use the scalpel to carve it free from the soft tissue.
Gently lift up the pericardium, the fine ‘pellicle’ containing the heart, with the Graefe forceps and cut it open with the fine scissors, to get access to the heart (Figure 4).
Figure 4. The internal view of the window hole in the plastron of the turtle. The heart is marked by the circle and the right atrium by the arrow.
Locate the ventricle and the atriums of the heart (the heart and the right atrium is marked by a yellow circle and an arrow in Figure 4). Cut a hole in the right atrium (located on the left and highlighted in Figures 4 and 5) with the fine scissors, and insert the perfusion needle into the center of the left part of the ventricle (Figure 5). Adjust the flow to a range around 75-130 ml/h, accordingly to the heart rate: When inserting the perfusion needle into the heart, the heart rate should increase dramatically at first, but stabilize at a pace around 20-40 bpm. If the heart rate is not in this range adjust the flow accordingly: increase the flow if a lower heart rate is observed, and decrease the flow if the heart is pumping too fast.
Note: Perfuse the turtle for about 10 min. Monitor the perfusion by checking outflowing liquid from the right atrium; as this becomes colorless the perfusion of the turtle is complete.
Figure 5. The perfusion needle is inserted into the left part of the ventricle of the heart. The right atrium and ventricle are marked by the arrow and the circle respectively.
Rostral and the caudal cuts of the carapace
Tools: Cast saw cutter.
Perform a rostral and a caudal transverse cut in the carapace orthogonal to the spinal cord. Place the turtle with the carapace facing upwards (dorsal side up). Figures 18 and 19 show the spinal segments and associated nerves. The central pattern generator is located in the spinal segments D8-D10 (Mortin and Stein, 1989; Mui et al., 2012; Hao et al., 2014), and the sensory input for the scratch reflex comes from every segment from D3 to S2 (Figure 18, excluding caudal scratching). In order to keep the sensory input to the network intact, the rostral cut is made between D2 and D3. The caudal cut is done between S2 and Ca1. The two cuts are seen in Figure 6. D2-D3 is located halfway along the 2nd central scutes and S2-Ca1 halfway along the 5th central scute (Mortin and Stein, 1990). It is important that the cuts are a) orthogonal to the spinal cord, b) performed in one cut all the way from the midline of the carapace to the cut edge of the plastron, since the perfusion through the spinal column must be sealed tight. The caudal cut should be angled perpendicular to the curvature of the carapace.
Figure 6. Performing the rostral cut. The caudal cut has already been done. The rostral cut is done along the center of the first central scute, and the caudal cut along the center of the fifth central scute.
When the two cuts have been made, the carapace is separated from the remains of the caudal part of the plastron. This separation is obtained with two diagonal cuts at the corners of the squared window in the plastron (the two yellow lines in Figure 7).
Figure 7. The rostral cut at the ventral side (through the plastron). The two diagonal cuts are highlighted in yellow.
Removing the internal organs, the plastron and the hind legs
Tools: Large scissors, 1 L beaker with cold Ringer’s solution.
Hold up the turtle with the caudal part upwards.
Take the large scissors and cut the internal organs free of the carapace by cutting the thin membrane holding the organs in place along the inner side of the carapace from below and up (Figure 8). It is easier to cut along the carapace when the internal organs hang loose. Try to maintain the organ block in one piece when removing it.
Figure 8. The internal organs are cut free along the inside of the carapace
Cut the large head retraction muscle that inserts along the spine, and cut the remaining organs free along the carapace as far up as possible.
Pull back one of the hind legs. Make an incision with the large scissors in the soft skin along the plastron (Figure 9). Begin from the diagonal cut made previously in the plastron, and aim towards the leg. Cut the thigh bone (femur) about 1 cm from the carapace (Figure 10).
Figure 9. Cutting the soft skin along the plastron
Figure 10. Cutting the thigh bone
Repeat step A5d for the other hind leg.
Cut the plastron and the caudal end of the carapace free without damaging the spinal cord. The preparation is now left in a Petri dish in cold Ringer’s solution (Figure 11).
Figure 11. The preparation lying in a Petri dish without plastron and legs
Clean off excessive blood from the preparation by quickly rinsing it in cold Ringer’s solution (about 50 ml) and place it in a 1 L beaker with cold Ringer’s solution when done.
Clear the spinal column
Tools: Graefe forceps, curved forceps, scalpel.
The muscles and connective tissue covering the vertebra has to be removed carefully with a scalpel and forceps. The muscles tissue is carefully scraped off until the vertebra is fully exposed while leaving the nerves intact (Figure 12A).
Figure 12. The exposed spinal segments S1-Ca1 and the rostral transection. A. Ca1 and more caudal segments are all flexible segments, while D10 and more rostral segments are joined with the carapace. The yellow square highlights the segments. B. Rostral transection of the spinal cord with the rotary cutter blade to make the vertebra smoother, such that the tubing makes a tight seal. Area indicated by the yellow square, and location of second cut compared with the initial cut is indicated by the parallel lines.
Transection the spinal cord
Tools: Sharpened rotary cutter blade mounted in the cast saw cutter.
To minimize damage to the spinal tissue, a special sharpened rotary cutter blade (Olfa, rotary cutter blade 45 mm) has been produced to transect the spinal cord with the cast saw cutter. At the spinal transection, the spinal cord retracts slightly into the spinal column. Therefore, perform the transection of the spinal cord in a firm and quick movement to get a smooth cut surface.
Mount the rotary cutter blade in the cast saw cutter.
Insert the edge of the blade into the cold Ringer’s solution in the Petri dish for ten seconds to cool it down. This will improve the quality of the spinal transection.
Perform the rostral transection of the spinal cord about 1-1.5 mm from the previous cut. The transection must be perpendicular to the spinal cord (Figure 12B).
Rotate the preparation 180° in the coronal plane and mount it in the clamp.
Perform the caudal transection of the spinal cord. The second cut provides an improved perfusion.
Put the preparation back in the glass beaker in Ringer’s solution.
Attaching the Plexiglas plate to the preparation
Tools: Cyanoacrylate adhesive, Plexiglas plate, Petri dish with lid, ice, scalpel, perfusion system, paper towel.
Put a layer of ice in the largest Petri dish and place the smaller Petri dish on top of the ice, facing upwards, and fill it with cold Ringer’s solution.
Place the preparation in the cold Ringer’s solution with the rostral end facing upwards.
Dry the cut rostral carapace edge with a paper towel.
Apply a thin layer of cyanoacrylate adhesive along the cut edge that will be the area of contact with the rostral Plexiglas plate (Figure 13). Be careful not to get adhesive into the spinal column, which will obstruct the flow of Ringer’s solution.
Figure 13. Applying adhesive to the rostral cut of the preparation. Put a fine line of adhesive along the cut corresponding to the contact area of the Plexiglas plate.
Gently place the rostral Plexiglas plate on the preparation centered with the small hole over the cut spinal cord (Figure 14). Keep it firmly in place for about 30 sec. If the adhesive does not harden, apply some drops of Ringer liquid on the glue, which will help harden, while holding the plate in place.
Figure 14. Attaching the rostral Plexiglas plate to the preparation
Lift up the preparation and place an extra line of glue along the line of contact between the dorsal carapace and the Plexiglas. Leave it to dry for one minute before continuing.
Mounting the preparation to the Plexiglas container
Tools: Cyanoacrylate adhesive, Plexiglas container, paper towel.
Take the Plexiglas container and place glue at the four contact points of the caudal carapace.
Gently place the turtle preparation in the Plexiglas container (Figure 15). Keep it in place for about 30 sec.
Figure 15. Preparation mounted with adhesive upside down in the custom Plexiglas container
Gently fill the Plexiglas container with Ringer’s solution. The liquid will help harden the adhesive.
Place the preparation in a larger plastic container and immerse it completely in Ringer’s solution.
The procedures of the first part are now complete. Leave the preparation overnight in a refrigerator.
Second part of the preparation
Setup the spinal vertebral foramen perfusion
Mount the steel tube and a silicone gasket to the hole in the Plexiglas plate. Press the gasket against the D4 vertebra, and push in the steel tube to obtain a tight seal (Figure 16). Connect the tube to a raised container with Ringer’s solution. Maintain a perfusion flow above 300 ml/h by adjusting the relative vertical position of the container with Ringer’s solution.
Figure 16. Steel tube and silicone gasket pressing against the rostral end of the spinal column allowing Ringer’s solution to flow in the spinal column
Dissecting out the nerves for electroneurogram recordings
Tools: Finely serrated scissors, fine scissors, Graefe forceps, Dumont #5 forceps and Dumont #7 curved forceps. Other needs: 2 L of Ringer’s solution.
Identify the motor nerves originating from D8-S2 and dissect them free for ENG-recordings (Figures 17A and 18). Figures 18 and 19 show the location of the nerves and corresponding muscles respectively: Hip-flexor, Hip Extensor, three Knee-extensors (FT-KE, IT-KE and AM-KE), dD8 and HR-KF (Mortin and Stein, 1990). Muscle tissue along nerves should be dissected free to minimize noise in the ENG recordings. The nerves are robust but can easily be damaged during the dissection without obvious visible signs.
Gently cut out the muscle tissue and free the nerves. A good technique to free the nerves from surrounding tissue is to place the tip of the fine scissors in the tissue close to the nerve and pull the sharp edge distally along the nerve.
Note: Figures 1B-1E show the finished preparation, mounted in the Plexiglas container and immersed in Ringer’s solution. The nerves dissected free are clearly visible as white branches originating at the spinal cord and going towards the hind limb muscles. Glass electrodes are used for the ENG recordings. Apply a slight negative pressure, and prepare the glass opening to fit the respective nerves you want to record.
Figure 17. Electrophysiological recordings and histological verification. A. Intracellular and ENG recordings; B. Rastergram of ~200 extracellular units recorded with high density silicon probes; C. Histological verification of the location of shanks of the silicon probe; D. DiD is painted on the electrode before implant. ChAT and Nissl stains are applied as markers for motoneurons and neurons respectively. Sagittal and coronal slices in respectively C and D. Scale bars = 500 µm. Adapted from Petersen and Berg (2016).
Figure 18. The sensory and motor nerves along the spinal cord. Adapted from Petersen et al. (2014) with permission.
Figure 19. Major muscle groups of the hind-limb. Hip flexor, Hip Extensor, Knee Extensors (FT-KE, IT-KE, AM-KE) and Knee flexor (HR-KF, extend across both the hip- and the knee-joint). Reproduced from Bakker and Crowe (1982) with permission.
Preparation for extracellular and intracellular recordings
Tools: Fine forceps, fine Rongeur, fine scalpel, syringe needle tip (size: 27 G).
Using the fine Rongeur, open the spinal column on the ventral side along the segments D8-D10. Gently remove the dura mater with scalpel and forceps. For each insertion site for the silicon probes, open the pia mater with longitudinal cuts along the spinal cord with the tip of a bent syringe needle tip (size 27 G). Perform the cuts parallel to the ventral horn between the ventral roots, as superficial as possible (Figure 1E). This completes the procedures to make the integrated preparation. Figure 17 shows example electrophysiological recordings and histology (Petersen and Berg, 2016).
Recipes
Ringer’s solution (98% O2/2% CO2)
120 mM NaCl
5 mM KCl
15 mM NaHCO3
2 mM MgCl2
3 mM CaCl2
20 mM glucose
Demineralized water
The solution is saturated with 98% O2/2% CO2, by aeration for 30 min to obtain pH level of 7.6
Ringer’s solution (95% O2/5% CO2)
100 mM NaCl
5 mM KCl
30 mM NaHCO3
2 mM MgCl2
3 mM CaCl2
10 mM glucose
Demineralized water
The solution is saturated with 95% O2/5% CO2, by aeration for 30 min to obtain pH level of 7.6
Note: Either Ringer’s solutions can be used in this protocol.
Acknowledgments
Funded by the Novo Nordisk Foundation (RB), the Danish Council for Independent Research Medical Sciences (RB and PP) and the Dynamical Systems Interdisciplinary Network, University of Copenhagen. Thanks to J. K. Dreyer and J. Hounsgaard for reading and commenting an earlier version of the manuscript.
References
Alaburda, A. and Hounsgaard, J. (2003). Metabotropic modulation of motoneurons by scratch-like spinal network activity. J Neurosci 23(25): 8625-8629.
Alaburda, A., Russo, R., MacAulay, N. and Hounsgaard, J. (2005). Periodic high-conductance states in spinal neurons during scratch-like network activity in adult turtles. J Neurosci 25(27): 6316-6321.
Bakker, J. G. M. and Crowe, A. (1982). Multicyclic scratch reflex movements in the terrapin Pseudemys scripta elegans. J Comp Physiol 145:477-484.
Berg, R. W., Alaburda, A. and Hounsgaard, J. (2007). Balanced inhibition and excitation drive spike activity in spinal half-centers. Science 315(5810): 390-393.
Berg, R. W., Chen M. T., Huang, H. C., Hsiao, M. C. and Cheng, H. (2009). A method for unit recording in the lumbar spinal cord during locomotion of the conscious adult rat. J Neurosci Methods 182(1): 49-54.
Berg, R. W., Ditlevsen, S. and Hounsgaard, J. (2008). Intense synaptic activity enhances temporal resolution in spinal motoneurons. PLoS One 3(9): e3218.
Currie, S. N. and Lee, S. (1997). Glycinergic inhibition contributes to the generation of rostral scratch motor patterns in the turtle spinal cord. J Neurosci 17(9): 3322-3333.
Guzulaitis, R., Alaburda, A. and Hounsgaard, J. (2014). Dense distributed processing in a hindlimb scratch motor network. J Neurosci 34(32): 10756-10764.
Hao, Z. Z., Meier, M. L. and Berkowitz, A. (2014). Rostral spinal cord segments are sufficient to generate a rhythm for both locomotion and scratching but affect their hip extensor phases differently. J Neurophysiol 112(1): 147-155.
Keifer, J. and Stein, P. S. (1983). In vitro motor program for the rostral scratch reflex generated by the turtle spinal cord. Brain Res 266(1): 148-151.
Kolind, J., Hounsgaard, J. and Berg, R. W. (2012). Opposing effects of intrinsic conductance and correlated synaptic input on Vm-fluctuations during network activity. Front Comput Neurosci 6: 40.
Mortin, L. I. and Stein, P. S. (1989). Spinal cord segments containing key elements of the central pattern generators for three forms of scratch reflex in the turtle. J Neurosci 9(7): 2285-2296.
Mortin, L. I. and Stein, P. S. (1990). Cutaneous dermatomes for initiation of three forms of the scratch reflex in the spinal turtle. J Comp Neurol 295(4): 515-529.
Mui, J. W., Willis, K. L., Hao, Z. Z. and Berkowitz, A. (2012). Distributions of active spinal cord neurons during swimming and scratching motor patterns. J Comp Physiol A Neuroethol Sens Neural Behav Physiol 198(12): 877-889.
Petersen, P. C. and Berg. R. W. (2016). Lognormal firing rate distribution reveals prominent fluctuation-driven regime in spinal motor networks. eLife 18805.
Petersen, P. C., Vestergaard, M., Jensen, K. H. and Berg, R. W. (2014). Premotor spinal network with balanced excitation and inhibition during motor patterns has high resilience to structural division. J Neurosci 34(8): 2774-2784.
Vestergaard, M. and Berg, R. W. (2015). Divisive gain modulation of motoneurons by inhibition optimizes muscular control. J Neurosci 35(8): 3711-3723.
Walloe, S., Nissen, U. V., Berg, R. W., Hounsgaard, J. and Pakkenberg, B. (2011). Stereological estimate of the total number of neurons in spinal segment D9 in the red-eared turtle. J Neurosci 31(7): 2431-2435.
Copyright: Petersen and Berg . This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Petersen, P. C. and Berg, R. W. (2017). Spinal Cord Preparation from Adult Red-eared Turtles for Electrophysiological Recordings during Motor Activity. Bio-protocol 7(13): e2381. DOI: 10.21769/BioProtoc.2381.
Petersen, P. C. and Berg. R. W. (2016). Lognormal firing rate distribution reveals prominent fluctuation-driven regime in spinal motor networks. eLife 18805.
Download Citation in RIS Format
Category
Neuroscience > Sensory and motor systems > Spinal cord
Neuroscience > Neuroanatomy and circuitry > Spinal Cord
Cell Biology > Tissue analysis > Electrophysiology
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,382 | https://bio-protocol.org/exchange/protocoldetail?id=2382&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Endpoint or Kinetic Measurement of Hydrogen Sulfide Production Capacity in Tissue Extracts
CH Christopher Hine
JM James R. Mitchell
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2382 Views: 10013
Edited by: Neelanjan Bose
Reviewed by: Tanxi Cai
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Hydrogen sulfide (H2S) gas is produced in cells and tissues via various enzymatic processes. H2S is an important signaling molecule in numerous biological processes, and deficiencies in endogenous H2S production are linked to cardiovascular and other health complications. Quantitation of steady-state H2S levels is challenging due to volatility of the gas and the need for specialized equipment. However, the capacity of an organ or tissue extract to produce H2S under optimized reaction conditions can be measured by a number of current assays that vary in sensitivity, specificity and throughput capacity. We developed a rapid, inexpensive, specific and relatively high-throughput method for quantitative detection of H2S production capacity from biological tissues. H2S released into the head space above a biological sample reacts with lead acetate to form lead sulfide, which is measured on a continuous basis using a plate reader or as an endpoint assay.
Keywords: Hydrogen sulfide production capacity H2S Endpoint assay Continuous assay Liver Lead acetate Lead sulfide
Background
Hydrogen sulfide (H2S) gas is produced endogenously by at least three different enzymes in mammals (CGL, CBS, 3-MST) with a range of tissue and cell-type distributions. H2S functions as a gasotransmitter and effector molecule (Wang, 2012) in a wide range of biological functions related to metabolism (Módis et al., 2013), stress resistance (Hine et al., 2015), and redox biology (Dickhout et al., 2012). Reduced H2S is linked to cardiovascular problems including hypertension in rodents (Yang et al., 2008) and cardiac hypertrophy in man (Polhemus et al., 2014). Increased H2S can also cause pathology, for example in rodent pancreatitis (Bhatia et al., 2005). Thus, accurate and quantitative detection of H2S from biological sources could facilitate a better understanding of its biological effects as well as its potential use as a clinical biomarker.
Techniques to measure absolute concentrations of H2S present in biological samples, along with their pros and cons, have been reviewed extensively (Olson, 2012; Wang, 2012; Hartle and Pluth, 2016; Takano et al., 2016). For example, free and sulfane-bound H2S pools can be measured in biological samples including serum or tissue homogenates ex vivo using headspace GC-MS, which is highly sensitive and selective, but requires expensive equipment. Nonetheless, due to the volatility of H2S, its interaction with other biological macromolecules and its breakdown into different sulfur-containing compounds, quantitative detection of steady-state free H2S levels in vivo remains challenging (Olson, 2009).
An alternate approach is to measure the capacity of a tissue homogenate or extract to produce H2S in a reaction mixture containing optimized levels of substrate and cofactor, thus allowing for H2S detection methods that are specific but less sensitive. An example is the methylene blue method in which H2S in solution is trapped by lead acetate to form lead sulfide, which upon conversion to methylene blue can be easily read in a standard spectrophotometer (Stipanuk and Beck, 1982; Ikeda et al., 2017). The pros and cons that must be taken into account with each method are based on the question being asked, the biological system and tissue being studied, the relative need for sensitivity, selectivity, or speed, and the cost and resources of the investigator.
Here, we describe an inexpensive, rapid, and moderately high throughput methodology for measuring H2S production capacity in extracts of relatively small amounts of biological material. This method is based on the reaction of H2S present in the headspace above a biological sample with lead acetate to form the black precipitate lead sulfide, a technique used throughout the past 100 years to detect H2S and H2S-producing bacteria (McBride and Edwards, 1914; Kuester and Williams, 1964; Zhang and Weiner, 2014). Previously, we used this method to detect changes in H2S production capacity as a function of diet or genetic background in a variety of biological samples including yeast, worms, flies, and rodent tissues/organs including liver (Hine et al., 2015; Mitchell et al., 2016; Nikonorova et al., 2017). Here, we present an optimized procedure to measure H2S production capacity in mammalian liver via (B) an end-point assay using Whatman paper-embedded lead acetate, or (C) a kinetic assay using agar-embedded lead acetate. As the liver is a strong producer of H2S in mammalian systems via the enzyme cystathionine gamma lyase (CGL) (Kabil et al., 2011), we feel this is a good starting point for researchers to understand and confidently develop this protocol for their own research questions. Furthermore, this procedure can be easily adapted to other biological samples and organisms, although the procedure may need to be optimized by the investigator in order to obtain suitable results.
Materials and Reagents
Petri dish
1.5 ml RNase-free disposable pellet pestles and 1.5 ml tubes (Fisher Scientific, catalog number: 12-141-368 )
Disposable razor blades
8-strip well format tubes (Denville Scientific)
Hard/rigid plastic dissecting platform/sheet
Plastic wrap
Filter paper (703 Style Whatman)
96-well plates with lid (Corning, catalog number: 3370 )
Gloves and proper personal protective equipment
15 ml centrifuge tube
Flash frozen mouse livers
De-ionized water
Phosphate buffered saline (PBS), pH 7.4 (Fisher Scientific, catalog number: BP24384 )
Liquid nitrogen
Ice
Dry ice
5x passive lysis buffer (Promega, catalog number: E1941 )
BCA Protein Assay Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23227 )
L-cysteine (Sigma-Aldrich, catalog number: C7352 )
Pyridoxal 5’-phosphate hydrate (Sigma-Aldrich, catalog number: P9255 )
Lead(II) acetate trihydrate (Sigma-Aldrich, catalog number: 316512 )
Agarose (HS Molecular Biology Grade) (Denville Scientific, catalog number: CA3510-8 , or use similar)
Note: This product has been discontinued.
1x passive lysis buffer (see Recipes)
20 mM lead(II) acetate trihydrate (see Recipes)
H2S reaction mixture (see Recipes)
1% agarose gel with 100 mM lead(II) acetate trihydrate (see Recipes)
Equipment
Liquid nitrogen flask (Thermo flask 2122) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2122 )
Forceps
Scale (OHAUS, catalog number: EP214C )
Pipettes and tips (single use and multichannel for pipetting between 2 µl to 5 ml)
-80 °C freezer
Motorized tissue grinder (Fisher Scientific, catalog number: 12-1413-61 )
37 °C water bath
Micro-centrifuge (VWR, model: Galaxy 16DH )
UV-Vis plate reader (BioTek Instruments, model: Synergy 2 )
Large glass Pyrex baking dish (> 100 ml)
Glass flask (> 100 ml capacity)
Vacuum oven (VWR, catalog number: 89508-424 )
Incubator (VWR, model: 1500E )
Digital camera (Kodak, model: KODAK EASYSHARE C182 )
Vortex mixer (Scientific Industries, model: Vortex-Genie 2 , catalog number: SI-0236)
Computers (HP Pavilion dv6 and Lenovo IdeaPad)
Heat block cube (9.5 x 7.5 x 5 cm), or other heavy object with approximate dimensions
Software
GraphPad Prism 7
Microsoft Excel
ImageJ
Gen5
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hine, C. and Mitchell, J. R. (2017). Endpoint or Kinetic Measurement of Hydrogen Sulfide Production Capacity in Tissue Extracts. Bio-protocol 7(13): e2382. DOI: 10.21769/BioProtoc.2382.
Download Citation in RIS Format
Category
Cell Biology > Tissue analysis > Tissue isolation
Cell Biology > Cell signaling > Second messenger
Biochemistry > Other compound > Hydrogen sulfide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,383 | https://bio-protocol.org/exchange/protocoldetail?id=2383&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Vaginal HSV-2 Infection and Tissue Analysis
MI Marie Beck Iversen
SP Søren Riis Paludan
CH Christian Kanstrup Holm
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2383 Views: 9207
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
The vaginal murine HSV-2 infection model is very useful in studying mucosal immunity against HSV-2 (Overall et al., 1975; Renis et al., 1976; Parr and Parr, 2003). Histologically, the vagina of Depo-Provera-treated mice is lined by a single layer of mucus secreting columnar epithelial cells overlying two to three layers of proliferative cells. Even though this is morphologically different from the human vagina, it closely resembles the endocervical epithelium, which is thought to be the primary site of HSV-2 infection in women (Parr et al., 1994; Kaushic et al., 2011). In the protocol presented here, mice are pre-treated with Depo-Provera before intra-vaginal inoculation with HSV-2. The virus replicates in the mucosal epithelium from where it spreads to and replicates in the CNS including the spinal cord, brain stem, cerebrum and cerebellum. Cytokine responses can be detected in vaginal washings using ELISA or in vaginal tissues using qPCR. Further, the recruitment of leukocytes to the vagina can be determined by flow cytometry. The model is suitable for research of both innate and adaptive immunity to HSV-2 infection.
Keywords: Immunology Vaginal infection Mucosal immunology Virus infection in vivo model
Background
Vaginal infection with HSV-2 has been studied in various animal models, such as rabbits, hamsters, guinea pigs, mice and monkeys with viral replication at the peripheral site and retrograde transport of virus to the neurons (Nahmias et al., 1971; Overall et al., 1975; Renis, 1977; Stanberry et al., 1982; Roizman et al., 2013). There are several pros and cons regarding the different animal models in terms of susceptibility to infection, latency, spontaneous reactivation of HSV-2 and availability of animals, especially with regard to the accessibility of knockout animals, which have been very useful in studies of immune responses to infection. The vaginal epithelium in the genital tract undergoes significant hormonal changes during the menstrual cycles, and both susceptibility to HSV-2 and the nature of the induced immune responses are regulated and affected by sex hormones (Kaushic et al., 2011). Mice are more susceptible to vaginal HSV-2 infection during pregnancy and during the diestrus stage of the murine estrus cycle, when progesterone levels are the highest (Overall et al., 1975; Baker and Plotkin, 1978; Gallichan and Rosenthal, 1996). Pre-treatment of mice with Depo-Provera, a long-lasting commercial progesterone induces the diestrus stage and increases susceptibility to vaginal HSV-2 infection by 100-fold (Parr et al., 1994; Kaushic et al., 2003).
During the progression of intra-vaginal (i.vag.) HSV-2 infection in mice, the virus initially infects the vaginal epithelial cells in patches that involve the full thickness of the epithelium layer, and the underlying stroma is usually free of infection. The infected epithelial cells are shed off into the vaginal lumen (apical side) and infect the rest of the epithelium. The virus can spread horizontally within the epithelial layers to the epidermis and hair follicles, which results in loss of hair and development of skin lesions (Parr and Parr, 2003; Zhao et al., 2003). Vaginal HSV-2 infection and the resulting replication of the virus seem to be restricted to the vaginal epithelium, with no spread via viremia, as the virus generally cannot be isolated from systemic organs, blood or lymph nodes upon genital HSV infection (Overall et al., 1975; Renis et al., 1976; Podlech et al., 1996; Zhao et al., 2003). HSV-2 reaches dorsal root ganglia (DRG) via sensory neurons that innervate the site of infection, and from there the virus can spread further to the lumbar part of the spinal cord, brain stem and finally the brain (Renis et al., 1976; Georgsson et al., 1987; Podlech et al., 1996; Parr and Parr, 2003). HSV-2 can also spread to parasympathetic neurons via Para-cervical ganglia (major autonomic ganglia) of the bladder and rectum, which can cause retention of urine and feces (Parr and Parr, 2003).
Materials and Reagents
Note: All of the items mentioned in section “Materials and Reagents” can be ordered from any qualified company.
Pipette tips
Tissue culture plates (58 x 15 mm) (Thermo Fisher Scientific)
Super Frost+ slides (Thermo Fisher Scientific)
TC flask T25 (SARSTEDT)
70 µm pore size mesh (BD Falcon)
40 µm pore size mesh (BD Falcon)
96-well flat bottom plates (NUNC)
96-well round bottom plates (NUNC)
Safety lock Eppendorf tubes
Stainless steel beads, 5 mm (QIAGEN)
Tissue processing/embedding cassettes (Sigma-Aldrich)
Scalpels (Swann Morton)
Flow-count beads (Beckman Coulter)
Vero cells
L929 cells
Mouse strain: C57BL/6 mice
Notes:
The genetic background of different mouse strains can influence studies and it has been observed that different mouse strains, C57BL/6, BALB/c, SJL/J, PL/J and A/J have different susceptibilities to HSV. C57BL/6 and BALB/c mice are moderately susceptible to HSV, whereas A/J, PL/J and SJL/J mice strains are highly susceptible (Lopez, 1975; Kastrukoff et al., 2012). It has also been observed that 129Sv background mice produce higher amounts of type I and type III IFN compared to C57BL/6 in response to genital HSV-2 infection, nevertheless no difference in viral titer is observed in the vagina after HSV-2 infection (Ank, 2008).
The vaginal HSV-2 infection model is based on pre-treatment with depo-provera. The pre-treatment with progesterone is an artificial intervention but is required for a reproducible enhanced susceptibility to HSV-2 infection in C57BL/6 mice.
Virus strain: HSV-2 333 strain (laboratory isolate, Stanberry et al., 1982)
Vesicular stomatitis virus (VSV/V10) (Indiana Strain) (ATCC, catalog number: VR-158 )
Phosphate buffered saline solution (PBS) (Sigma-Aldrich)
Depo-Provera (Pfizer)
Isoflourane (Piramal Critical Care)
DMEM (with no supplement of antibiotics or FSC) (Lonza)
Penicillin-streptomycin (Thermo Fisher Scientific)
Fetal calf serum (FCS) (In Vitro Technologies)
0.2% human immunoglobulin (ZLB Behring)
0.03% methylene blue (Sigma-Aldrich)
2% formaldehyde (Sigma-Aldrich)
Ethanol (Sigma-Aldrich)
Xylene (Sigma-Aldrich)
Methanol (Sigma-Aldrich)
0.5% hydrogen peroxide (H2O2) (Sigma-Aldrich)
10 mM Tris
0.5 mM EGTA (pH 9.0)
50 mM NH4Cl
Polyclonal rabbit anti-HSV-2 (Agilent Technologies, Dako, catalog number: GA521 ) (1:100)
HRP-conjugated secondary antibody (Agilent Technologies, Dako, catalog number: P044801-2 ) (1:200)
3,3’-diaminobenzidine (Kem-En-Tec)
Mayer’s or Harris’s hematoxylin solution (Sigma-Aldrich)
Eukitt reagent (Eukitt, O. Kindler)
Collagenase/dispase (1 mg/ml) (Roche Diagnostics)
DNase 1 (2 mg/ml) (Roche Diagnostics)
Ethylenediaminetetraacetate acid disodium salt (EDTA) (0.02%)
Anti-mouse CD16/CD32 Ab (eBioscience)
IgG, 1 g/ml (Jackson ImmunoResearch)
Anti-mouse antibodies (BD Pharmingen):
CD45-APC (clone 30-F11)
NK1.1-FITC (clone PK136)
Nk1.1-PE (clone PK136)
CD11b-PE (clone M1/70)
Ly-6g-APC (clone 1A8)
APC RAT IgG2b, κ Isotype
FITC RAT IgG2a, κ Isotype
PE RAT IgG2a, κ Isotype
7-AAD (Live/dead cell marker)
TRIzol (Invitrogen)
DEPC water
Chloroform (Sigma-Aldrich)
Isopropanol
Invitrogen Ambion DNA free kit
Bovine serum albumin (BSA) (Sigma-Aldrich)
0.05% saponin (Thermo Fisher Scientific)
0.2% gelatin (Thermo Fisher Scientific)
0.3% Triton X-100 (Thermo Fisher Scientific)
ELISA kits (R&D Systems)
RNase free water (Roche Diagnostics)
Oligo (dT) (Roche Diagnostics)
Expand reverse transcriptase (Roche Diagnostics)
Buffer A (see Recipes)
Buffer B (see Recipes)
Buffer C (see Recipes)
FACS buffer (see Recipes)
Equipment
Pipettes
8 arm multipipette
Microtome (Leica)
Microwave oven
Rocking platform
Humidity chamber
Mortar/pestle
Centrifuge
UV-light
Light microscopy
Homogenizer/shaker
Incubator
qPCR platform of choice
NanoDrop
Flow cytometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Iversen, M. B., Paludan, S. R. and Holm, C. K. (2017). Vaginal HSV-2 Infection and Tissue Analysis. Bio-protocol 7(13): e2383. DOI: 10.21769/BioProtoc.2383.
Download Citation in RIS Format
Category
Immunology > Mucosal immunology > Genitourinary tract
Microbiology > in vivo model > Viruses
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,384 | https://bio-protocol.org/exchange/protocoldetail?id=2384&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Targeted Knockout Mutants in Arabidopsis thaliana Using CRISPR/Cas9
FH Florian Hahn
ME Marion Eisenhut
OM Otho Mantegazza
Andreas P. M. Weber
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2384 Views: 23738
Edited by: Jihyun Kim
Original Research Article:
The authors used this protocol in 0 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
0 2017
Abstract
The CRISPR/Cas9 system has emerged as a powerful tool for gene editing in plants and beyond. We have developed a plant vector system for targeted Cas9-dependent mutagenesis of genes in up to two different target sites in Arabidopsis thaliana. This protocol describes a simple 1-week cloning procedure for a single T-DNA vector containing the genes for Cas9 and sgRNAs, as well as the detection of induced mutations in planta. The procedure can likely be adapted for other transformable plant species.
Keywords: CRISPR/Cas9 Genome editing Arabidopsis thaliana Plants Knockout
Background
The CRISPR/Cas9 system (Cas9) provides a simple and widely applicable approach to modify genomic regions of interest and has therefore become the tool of choice for genome editing in plants and other organisms (Schiml and Puchta, 2016). The system relies on the bacterial Cas9 nuclease from Streptococcus pyogenes (Cas9), which can be directed by a short artificial single guide RNA molecule (sgRNA) towards a genomic DNA sequence (Jinek et al., 2012), where it creates a double strand break (DSB). These DSBs are then repaired by the innate DNA repair mechanism of the plant cell. Here, two main pathways can be distinguished (Salomon and Puchta, 1998). (i) DNA molecules with high homology to the DSB site can be used as repair template. This homology directed repair (HDR) approach can be exploited to introduce specific sequences at the site of the DSB (Schiml et al., 2014; Baltes and Voytas, 2015). However, due to low integration rates of these sequences, HDR mediated gene editing in plants remains challenging. (ii) An easier and more efficient approach is the use of the non-homologous end joining (NHEJ) repair pathway of the plant, which is the dominant repair pathway in most plants, such as Arabidopsis thaliana (Arabidopsis). Since NHEJ is error-prone, small insertions or deletions (indels) of a few base pairs (bp) occur often at the DSB site, leading to frameshift mutations and gene knockouts (Pacher and Puchta, 2016). Here, we provide a detailed protocol for targeted gene knockout in the model plant Arabidopsis including a simple 1-week cloning protocol for a plant vector system containing the Cas9 and sgRNA, and then Arabidopsis transformation and detection of mutations.
Materials and Reagents
1.5 ml microcentrifuge tubes (SARSTEDT, catalog number: 72.690.001 )
200 µl PCR tubes (Labomedic, catalog number: 2081644AA )
Petri dishes (SARSTEDT, catalog number: 82.1472 )
2 ml microcentrifuge tubes (SARSTEDT, catalog number: 72.691 )
20 µl pipette tips (SARSTEDT, catalog number: 70.1116 )
200 µl pipette tips (SARSTEDT, catalog number: 70.760.012 )
1,000 µl pipette tips (SARSTEDT, catalog number: 70.762.010 )
Agrobacterium tumefaciens (A. tumefaciens) strain GV3101::pMP90
Arabidopsis thaliana seeds (Col-0)
Vectors (see Figure 1)
Figure 1. Vector maps of pUB-Cas9 (A) and pFH6 (B). pFH6 is used to integrate the 20 bp target sequence upstream of the sgRNA scaffold and under the control of the Arabidopsis U6-26 RNA polymerase III promoter. The whole sgRNA cassette is then transferred via Gibson cloning into the binary T-DNA vector pUB-Cas9 (contains the Cas9 gene under the control of the Ubiquitin10 promoter) for plant transformation. Maps were generated using SnapGene Viewer (http://www.snapgene.com/products/snapgene_viewer/).
Plant T-DNA Cas9 vector pUB-Cas9 (GenBank accession number KY080691), containing a Chlamydomonas reinhardtii codon-optimized ubiquitously (UBIQUITIN10 promoter) expressed Cas9 gene, a kanamycin resistance cassette for bacterial selection and a hygromycin resistance cassette as plant selection marker (Hahn et al., [2017]; available at Addgene, catalog number: 86556 )
sgRNA subcloning vector pFH6 (GenBank accession number KY080689) containing the Arabidopsis U6-26 promoter, the integration site for the 20 bp protospacer sequence, the sgRNA scaffold and an ampicillin resistance cassette (Hahn et al. [2017]; available at Addgene, catalog number: 86555 )
Note: pFH6 contains an additional 9 bp fragment (GTCCCTTCG) between the 3’ end of the U6-26 promoter and the protospacer integration site. In several experiments, we could show that this does not affect gene editing activity. However, we have also cloned a new version of the subcloning vector without the additional fragment (pFH6_new), which shows high cleavage activity in preliminary experiments and can be obtained from us. This version only contains an additional guanine (G) between the 3’ end of the U6-26 promoter and the protospacer integration site, which allows the integration of any 20 bp protospacer without restriction of G as first bp (compare e.g., Fauser et al. [2014]). The cloning strategy for pFH6_new is analogous to the one described in this protocol, the only difference is that the forward primer for cloning your 20 bp protospacer sequence contains a different overlap and lacks the need for an initial G at the beginning (ATTG-N20, compare procedure section).
Competent Escherichia coli (E. coli) cells (e.g., Mach1TM competent cells, Thermo Fisher Scientific, InvitrogenTM, catalog number: C862003 )
BbsI-HF + CutSmart buffer (New England Biolabs, catalog number: R3539S )
Distilled H2O
Plasmid mini prep kit and agarose gel extraction kit (e.g., GeneMATRIX 3 in 1–Basic DNA Purification Kit, Roboklon, catalog number: E3545 )
T4 DNA ligase with 10x ligation buffer (New England Biolabs, catalog number: M0202S )
Ampicillin (Amp) (Carl Roth, catalog number: K029.2 )
Primers (see Table 1)
Table 1. List of oligonucleotides
5x Green GoTaq Reaction buffer (Promega, catalog number: M791A )
dNTPs (10 mM each) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0192 )
GoTaq G2 polymerase (Promega, catalog number: M7841 ) or other standard PCR polymerase
HindIII-HF + CutSmart buffer (New England Biolabs, catalog number: R3104S )
KpnI-HF + CutSmart buffer (New England Biolabs, catalog number: R3142S )
Phusion High-Fidelity polymerase (New England Biolabs, catalog number: M0530S ) or other proofreading polymerases
Gibson Assembly Cloning Kit (New England Biolabs, catalog number: E5510S )
Kanamycin sulfate (Kan) (Carl Roth, catalog number: T832.4 )
Rifampicin (Rif) (Molekula, catalog number: 32609202 )
Gentamycin sulfate (Gent) (Carl Roth, catalog number: 0233.3 )
Hygromycin B (Hyg) (Carl Roth, catalog number: CP12.2 )
T7 Endonuclease I (optional; New England Biolabs, catalog number: M0302S )
LB medium (agar plates and liquid), supplemented with 200 μg/ml ampicillin (see Recipes)
LB medium (agar plates and liquid), supplemented with 30 μg/ml kanamycin sulfate (see Recipes)
YEP medium (agar plates and liquid), supplemented with 150 μg/ml rifampicin, 50 μg/ml gentamycin sulfate, 50 μg/ml kanamycin (see Recipes)
½ MS medium agar plates, supplemented with 33.3 μg/ml hygromycin B (see Recipes)
Equipment
Agarose gel electrophoresis equipment (e.g., VWR, Peqlab, model: PerfectBlueTM Gel System Mini M, catalog number: 700-0434 )
Bacteria plate incubators (28 °C, 37 °C, e.g., Memmert, model: IN55 ) and shaker (28 °C, 37 °C; e.g., Eppendorf, New BrunswickTM, model: Innova® 44 , catalog number: M1282-0002)
Heating blocks (e.g., Eppendorf, model: Thermomixer Compact , catalog number: T1317-1EA)
PCR cycler (e.g., Thermo Fisher Scientific, Applied BiosytemsTM, model: VeritiTM 96-well Thermal Cycler, catalog number: 4375786 )
10 µl pipette (e.g., Pipetman Neo P10N, Gilson, catalog number: F144562 )
20 µl pipette (e.g., P20N, Gilson, catalog number: F144563 )
200 µl pipette (e.g., P200N, Gilson, catalog number: F144565 )
1,000 µl pipette (e.g., P1000N, Gilson, catalog number: F144566 )
Plant growth chamber (e.g., CLF Plant Climatics, Percival Scientifici, model: AR-66L )
Software
SerialCloner
Cas-OFFinder
4Peaks software
MUSCLE (Optional)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hahn, F., Eisenhut, M., Mantegazza, O. and Weber, A. P. M. (2017). Generation of Targeted Knockout Mutants in Arabidopsis thaliana Using CRISPR/Cas9. Bio-protocol 7(13): e2384. DOI: 10.21769/BioProtoc.2384.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,385 | https://bio-protocol.org/exchange/protocoldetail?id=2385&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Multiplex Gene Editing via CRISPR/Cas9 System in Sheep
YN Yiyuan Niu
YD Yi Ding
XW Xiaolong Wang
YC Yulin Chen
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2385 Views: 10483
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Sheep is a major large animal model for studying development and disease in biomedical research. We utilized CRISPR/Cas9 system successfully to modify multiple genes in sheep. Here we provide a detailed protocol for one-cell-stage embryo manipulation by co-injecting Cas9 mRNA and RNA guides targeting three genes (MSTN, ASIP, and BCO2) to create genetic-modified sheep. Procedure described sgRNA design, construction of gRNA-Cas9 plasmid, efficient detection in fibroblast, embryos and sheep, and some manipulative technologies. Our findings suggested that the CRISPR/Cas9 method can be exploited as a powerful tool for livestock improvement by targeting multiple genes that are in charge of economically significant traits simultaneously.
Keywords: Cas9 Sheep MSTN BCO2 ASIP
Background
Zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) have been used to modify many cell lines and organisms in the past. The recent CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated) technology development provides an efficient tool for genome modifying of targeting loci. This system has an advantage of modifying multiple loci at the same time. Sheep with specific gene modifications may contribute to breeding. The results demonstrate the first detailed evidence of large animal modification in sheep.
Materials and Reagents
Pipette tips
Centrifuge tubes
6-well culture plate
HiBindTM DNA Mini Column
Sheep (Healthy ewes [3-5 years old] were selected about 160)
PGL3-U6-gRNA vector (Addgene, catalog number: 51133 )
pUC57-T7-gRNA vector (Addgene, catalog number: 51132 )
E. coli DH5α competent cells
Cas9 mRNA in vitro transcription vector (Addgene, catalog number: 44758 )
T vector (Takara Bio, catalog number: D103A )
Bsal enzyme(New England Biolabs, catalog number: R3535 )
DNA Gel Extraction Kit (Corning, catalog number: D205-04 )
T4 ligase (New England Biolabs)
Ampicillin
EndoFree Plasmid Maxi Kit (QIAGEN, catalog number: 12362 )
Primers
M13R (-47) primer
5’-CGCCAGGGTTTTCCCAGTCACGAC-3’
Primers for amplifying the selected potential off-target loci, designed by Primer5 software.
Ethanol
Ice acetic acid (Guangzhou Chemical Reagent Factory, catalog number: CB39-GR-0.5L )
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM)
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM)
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM)
Lipofectamine3000 reagent (Thermo Fisher Scientific, InvitrogenTM)
Opti-MEM medium (Thermo Fisher Scientific, GibcoTM)
Blasticidine S hydrochloride
Universal Genomic DNA Kit (CWBIO, catalog number: CW2298M )
KOD-Plus-Neo
PCR cleanup kit (AppliChem, catalog number: A7089,1000 )
T7EI
Agarose
TCM199 medium (Thermo Fisher Scientific, GibcoTM)
Quinn’s Advantage Cleavage Medium and Blastocyst Medium (Sage Biopharma)
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific)
REPLI-g Single Cell Kit (QIAGEN, catalog number: 150343 )
D2000 DNA marker
Tris
Ethylenediaminetetraacetate acid (EDTA)
Agar powder
Tryptone
Yeast extract
Sodium chloride (NaCl)
50x TAE (see Recipes)
LB medium (see Recipes)
Equipment
Pipettes
37 °C water bath
Thermal cycler (Bio-Rad thermocycler)
DNA electrophoresis apparatus
Microcentrifuge
Eppendorf FemtoJect system
Olympus micromanipulation system ON3 (Olympus, model: ON3 SERIES )
Microinjection device
Biopsy forceps (Olympus, model: FB-11K-1 )
Software
Primer5 software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Niu, Y., Ding, Y., Wang, X. and Chen, Y. (2017). Multiplex Gene Editing via CRISPR/Cas9 System in Sheep. Bio-protocol 7(13): e2385. DOI: 10.21769/BioProtoc.2385.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Mutagenesis
Molecular Biology > RNA > Transfection
Cell Biology > Cell engineering > CRISPR-cas9
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,386 | https://bio-protocol.org/exchange/protocoldetail?id=2386&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Demonstration and Quantification of Neutrophil Extracellular Trap Formation
Dongsheng Jiang
MS Mona Saffarzadeh
KS Karin Scharffetter-Kochanek
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2386 Views: 15726
Reviewed by: Benoit StijlemansMeenal Sinha
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
In the recent decade, neutrophil extracellular traps (NETs) have been identified and confirmed as a new anti-microbial weapon of neutrophils. In this protocol, we describe easy methods to demonstrate NET formation by immunofluorescence staining of extracellular chromatin fiber with anti-DNA/Histone H1 antibody and quantification of NETs by using a non-cell-permeable DNA specific dye Sytox orange.
Keywords: NETs (neutrophil extracellular traps) Neutrophil Sytox orange DNA/Histone H1
Background
Neutrophils constitute the largest, evolutionary conserved fraction of circulating leukocytes. They set up the first defence line against pathogens by various mechanisms including the formation of neutrophil extracellular traps (NETs). During this process, activated neutrophils expel chromatin fibers from the nucleus. Invading pathogens are then trapped within the network of chromatin and killed by highly concentrated, NET-entangled antimicrobial proteins, such as myeloperoxidase (MPO) and elastase (Brinkmann et al., 2004). However, NETs are a double-edged sword; the unrestrained NET formation from over-activated neutrophils can also contribute to severe tissue damage, for instance by the cytotoxic effect of histone components of NETs (Saffarzadeh et al., 2012). One example of a pathological condition in which neutrophils are over-activated and have enhanced capacity to form NETs is systemic lupus erythematosus. The levels of antibodies against double-stranded DNA as well as other components of NETs are elevated in sera of lupus patients (Knight and Kaplan, 2012; Yu and Su, 2013). Affected skin and kidneys from lupus patients are infiltrated by netting neutrophils, which cause endothelial cell damage, a critical step in the pathogenesis of lupus and other neutrophil over-activation syndromes (Villanueva et al., 2011).
Different methods have been used for NET detection and quantification, including immunocytochemistry (Brinkmann et al., 2010), fluorescent dyes, flow cytometry, and ELISA. Immunocytochemistry with DAPI and DNA/histone was the best method for NET qualification and quantification, since decondensation of the nucleus indicates NET formation. Picogreen dye is a sensitive method to quantify NET-DNA concentration (Saffarzadeh et al., 2012; Tanaka et al., 2015), while Sytox orange is a fast and easy method for NET quantification. Flow cytometric analysis by measuring the signal for labeled-DNA/histone antibody, or myeloperoxidase-DNA based ELISA are useful methods for detection and quantification of NETs in pathological samples such as serum or peritoneal fluid of patients (Caudrillier et al., 2012).
In this protocol, we provide the details for the demonstration of NET formation by fluorescent immunostaining for chromatin fiber with anti-DNA/histone H1 antibody, which has a very high affinity for decondensed chromatin in NETs in comparison to DAPI or Hoechst (Saffarzadeh et al., 2012). Furthermore, we describe a quick method for NET quantification with Sytox orange, a non-cell-permeable DNA specific dye staining extracellular DNA content (Williams et al., 1999; Yost et al., 2009), by fluorescence intensity measured by a microplate reader. This protocol has been applied successfully in our recent studies, whereby we show that antibody- or complement-induced phagocytosis triggers rapid NET formation (Saffarzadeh et al., 2014), and more importantly, mesenchymal stem cells suppress NET formation from over-activated neutrophils (Jiang et al., 2016).
Materials and Reagents
Pipette tips (Greiner Bio One International, Ultratip)
Tube 50 ml (SARSTEDT, catalog number: 62.547.254 )
Syringe 10 ml (B. Braun medical, catalog number: 4606108V-02 )
Needle 26 G x ½” (B. Braun medical, catalog number: 4665457-02 )
Pre-Separation filters (30 µm) (Miltenyi Biotec, catalog number: 130-041-407 )
Millicell EZ Slide 8-well glass (EMD Millipore, catalog number: PEZGS0816 )
96-well, black, flat bottom plate, sterile, with lid (Corning, catalog number: 3916 )
C57BL/6J mice at preferred age of 8-12 weeks, both male and female are suitable for this protocol (THE JACKSON LABORATORY, catalog number: 000664 )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 )
0.5 M EDTA, sterile (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575020 )
Histopaque-1077 (Sigma-Aldrich, catalog number: 10771 )
Histopaque-1119 (Sigma-Aldrich, catalog number: 11191 )
Optional: FITC-conjugated mouse anti-human CD15 antibody (Clone VIMC6) (Miltenyi Biotec, catalog number: 130-081-101 )
Optional: FITC-conjugated mouse IgM isotype control (Miltenyi Biotec, catalog number: 130-093-178 )
Optional: MACSxpress neutrophil isolation kit, human (Miltenyi Biotec, catalog number: 130-104-434 )
Optional: MACSxpress erythrocyte depletion kit, human (Miltenyi Biotec, catalog number: 130-098-196 )
Mouse neutrophil isolation kit (Miltenyi Biotec, catalog number: 130-097-658 )
Optional: Propidium iodide (PI) staining solution (BD, BD Biosciences, catalog number: 556463 )
Phorbol 12-myristate 13-acetate (PMA) (Sigma-Aldrich, catalog number: P8139 )
Note: Dissolve in DMSO to make 1 mg/ml stock, and store the aliquots at -20 °C.
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
16% (w/v) paraformaldehyde (PFA), methanol-free (Thermo Fisher Scientific, catalog number: 28908 )
Purified mouse anti-DNA/Histone H1 antibody (EMD Millipore, catalog number: MAB3864 )
Note: Make aliquots and store at -20 °C.
4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI) (Thermo Fisher Scientific, InvitrogenTM, catalog number: D1306 )
Alexa Fluor 555-conjugated goat anti-mouse IgG secondary antibody (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-21422 )
Optional: APC-conjugated rat anti-mouse Ly6G (Gr-1) antibody (Clone RB6-8C5) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 17-5931-82 )
Optional: APC-conjugated rat IgG2b Isotype control (Clone eB149/10H5) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 17-4031-82 )
Optional: purified rat anti-mouse Ly6G antibody (Clone RB6-8C5) (Abcam, catalog number: ab25377 )
Optional: purified rabbit anti-human CD15 antibody (Clone SP159) (Novus Biologicals, catalog number: NBP2-21754 )
Purified goat anti-human/mouse myeloperoxidase/MPO antibody (R&D Systems, catalog number: AF3667 )
Purified mouse IgG2a isotype control (Clone C1.18.4) (BD, BD Biosciences, catalog number: 550339 )
Purified rabbit anti-human/mouse neutrophil elastase antibody (Abcam, catalog number: ab68672 )
Sytox orange nucleic acid stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: S11368 )
Fetal bovine serum (FBS) (Biochrom, catalog number: S 0615 )
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: S2002 )
RPMI 1640 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 21875034 )
GlutaMAX (Thermo Fisher Scientific, catalog number: 35050038 )
MEM non-essential amino acids (NEAA) (Thermo Fisher Scientific, GibcoTM, catalog number: 11140035 )
Penicillin/streptomycin (Biochrom, catalog number: A 2213 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Goat serum (Sigma-Aldrich, catalog number: G9023 )
Fluorescence mounting medium (Agilent Technologies, DAKO, catalog number: S302380-2 )
FACS buffer (can be kept at 4 °C for 2 weeks) (see Recipe 1)
R1 medium (prepared media can be kept at 4 °C for 2 weeks) (see Recipe 2)
Blocking buffer (prepare fresh) (see Recipe 3)
Antibody diluent (prepare fresh) (see Recipe 4)
Equipment
Pipettes
Centrifuge
Optional: MACSxpress Separator (Miltenyi Biotec, catalog number: 130-098-308 )
Optional: MACSmixTM Tube Rotator (Miltenyi Biotec, catalog number: 130-090-753 )
Humidified cell culture incubator set to 37 °C and 5% CO2
Orbital shaker, such as Heidolph Unimax 1010 (Heidolph Instruments, model: Unimax 1010 , catalog number: 543-12310-00)
Fluorescent microscope, such as Zeiss Axiophot microscope with an AxioCam digital color camera and AxioVision software v4.7 (Carl Zeiss, model: Axiophot )
AxioCam digital color camera
Microplate reader that can measure the absorbance and emission of Sytox orange at 547 nm and 570 nm, respectively, such as Mithras LB940 (BERTHOLD TECHNOLOGIES, model: Mithras LB 940 )
Optional: Flow cytometer (to check the purity of isolated neutrophils) FACS Canto II (BD, BD Biosciences, model: BD FACSCANTO II ) with FACSDiva software
Software
AxioVision software
Optional: FACSDiva software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jiang, D., Saffarzadeh, M. and Scharffetter-Kochanek, K. (2017). In vitro Demonstration and Quantification of Neutrophil Extracellular Trap Formation. Bio-protocol 7(13): e2386. DOI: 10.21769/BioProtoc.2386.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Neutrophil
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,387 | https://bio-protocol.org/exchange/protocoldetail?id=2387&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of the Effects of Local and Systemic Iron Excess on Lateral Root Initiation in Arabidopsis thaliana
GL Guangjie Li
LZ Lin Zhang
Weiming Shi
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2387 Views: 10400
Edited by: Marisa Rosa
Reviewed by: Manjula Mummadisetti
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Root system architecture depends on nutrient availability. A symptom of iron (Fe) toxicity in plants is stunted root growth, yet little is known about the effects of excess Fe on lateral root (LR) development. To better understand how nutrient signals are integrated into root developmental programs, we investigated the morphological response of Arabidopsis thaliana root systems to Fe by testing homogeneous supply and localized Fe supply treatment.
Keywords: Arabidopsis Fe toxicity Lateral root Localized iron supply Homogeneous iron supply
Background
A localized supply of nutrients regulates lateral root elongation and/or lateral root density in Arabidopsis thaliana. Lateral root formation is affected by nutrients at different developmental stages (e.g., initiation versus elongation) and in a nutrient-specific manner (Li et al., 2011; Giehl et al., 2012). Iron toxicity as a syndrome in plants is typically associated with an excessive amount of the ferrous form (the Fe2+ ion) in the soil (Vigani, 2012). Iron toxicity symptoms vary with cultivars and are characterized by a reddish-brown, purple bronzing, yellow, or orange discoloration of the lower leaves and a stunted root growth. The presence of the Fe2+ ion is increased by low pH and anoxic conditions, and there is an increasing presence in vertically lower strata (Becker and Asch, 2005; Li et al., 2016). We describe a detailed pipeline used for localized iron supply in Arabidopsis grown in vitro which we validated in Arabidopsis (Li et al., 2015a; 2015b and 2016).
Materials and Reagents
Eppendorf tubes (1.5 ml)
Sterile tips
Plastic wrap (Bemis, catalog number: PM996 )
130 x 130 x 12 mm square plastic plates (self-made, see Figure 1)
130 x 13 x 2 mm glass strip (self-made, see Figure 1)
Figure 1. Square plastic plates used for treatment
Arabidopsis thaliana seeds (DR5:GUS lines, Col-0 background)
Distilled water
Ethanol (Sinopharm Chemical Reagent, catalog number: 80176961 )
Sodium hypochlorite (NaClO) (Sinopharm Chemical Reagent, catalog number: 80010428 )
Sodium dodecyl sulfate, sodium salt (SDS) (Sinopharm Chemical Reagent, catalog number: 30166428 )
Potassium phosphate monobasic (KH2PO4) (Sinopharm Chemical Reagent, catalog number: 10017618 )
Sodium nitrate (NaNO3) (Sinopharm Chemical Reagent, catalog number: 10019918 )
Magnesium sulfate (MgSO4) (Sinopharm Chemical Reagent, catalog number: 10013018 )
Calcium chloride (CaCl2) (Sinopharm Chemical Reagent, catalog number: 20011160 )
Ferrous sulfate (FeSO4·7H2O) (Sinopharm Chemical Reagent, catalog number: 10012116 )
Ethylene diamine tetraacetic acid (EDTA) (Sinopharm Chemical Reagent, catalog number: 10009717 )
Boric acid (H3BO3) (Sinopharm Chemical Reagent, catalog number: 10004818 )
Manganese sulfate (MnSO4) (Sinopharm Chemical Reagent, catalog number: LB2208102 )
Zinc chloride (ZnCl2) (Sinopharm Chemical Reagent, catalog number: 10023828 )
Copper sulfate (CuSO4) (Sinopharm Chemical Reagent, catalog number: 10008216 )
Sodium molybdate (Na2MoO4) (Sinopharm Chemical Reagent, catalog number: 10019818 )
Sucrose (Sinopharm Chemical Reagent, catalog number: 10021418 )
MES hydrate (Sigma-Aldrich, catalog number: M8250 )
Agar-agar (Sigma-Aldrich, catalog number: A7002 )
Seed sterilization solution (see Recipes)
Normal growth medium (see Recipes)
Fe-supplemented medium and the control medium (see Recipes)
Control medium (see Recipes)
Equipment
Glass bottles (Schott Duran glass bottle, 500 ml capacity or higher)
Incubation chamber (23 ± 1 °C, under fluorescent lamps at 100 μmol/m2/sec, 16-h-light/8-h-dark)
pH meter (Mettler-Toledo International, model: FE20K )
Autoclave (TOMY DIGITAL BIOLOGY, model: SX-500 )
Refrigerator (Haier, model: BCD-648WDBE )
Flow hood (Suzhou Antai Air-tech, model: SW-CJ-1F(D) )
Vortex
Tweezers
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Li, G., Zhang, L. and Shi, W. (2017). Determination of the Effects of Local and Systemic Iron Excess on Lateral Root Initiation in Arabidopsis thaliana. Bio-protocol 7(13): e2387. DOI: 10.21769/BioProtoc.2387.
Li, G., Song, H., Li, B., Kronzucker, H. J. and Shi, W. (2015). Auxin Resistant1 and PIN-FORMED2 Protect Lateral Root Formation in Arabidopsis under Iron Stress. Plant Physiol 169(4): 2608-2623.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant physiology > Phenotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,388 | https://bio-protocol.org/exchange/protocoldetail?id=2388&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Behavioral and Functional Assays for Investigating Mechanisms of Noxious Cold Detection and Multimodal Sensory Processing in Drosophila Larvae
Atit A. Patel
Daniel N. Cox
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2388 Views: 8734
Edited by: Jihyun Kim
Reviewed by: Adler R. Dillman
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
To investigate cellular, molecular and behavioral mechanisms of noxious cold detection, we developed cold plate behavioral assays and quantitative means for evaluating the predominant noxious cold-evoked contraction behavior. To characterize neural activity in response to noxious cold, we implemented a GCaMP6-based calcium imaging assay enabling in vivo studies of intracellular calcium dynamics in intact Drosophila larvae. We identified Drosophila class III multidendritic (md) sensory neurons as multimodal sensors of innocuous mechanical and noxious cold stimuli and to dissect the mechanistic bases of multimodal sensory processing we developed two independent functional assays. First, we developed an optogenetic dose response assay to assess whether levels of neural activation contributes to the multimodal aspects of cold sensitive sensory neurons. Second, we utilized CaMPARI, a photo-switchable calcium integrator that stably converts fluorescence from green to red in presence of high intracellular calcium and photo-converting light, to assess in vivo functional differences in neural activation levels between innocuous mechanical and noxious cold stimuli. These novel assays enable investigations of behavioral and functional roles of peripheral sensory neurons and multimodal sensory processing in Drosophila larvae.
Keywords: Nociception Noxious cold Multimodal sensory processing Calcium imaging Optogenetics Drosophila
Background
The capacity to sense and respond appropriately to environmental cues is one of the most fundamental aspects shared among the metazoans. Sensing potentially harmful stimuli, such as noxious temperature, chemical or mechanical insults, and responding appropriately is crucial for avoiding incipient damage that can lead to injury or death. Typically, upon sensing nociceptive stimuli an animal produces a set of avoidance behaviors that either mitigate or allow the animal to escape the noxious stimulus. Elucidating molecular, cellular, and behavioral level mechanisms in processing nociceptive stimuli is of great interest as there is potential for the identification and development of novel therapeutic interventions for aberrant sensory processing, which can lead to neuropathic pain. Sensory and behavioral responses to noxious chemical, mechanical and heat stimuli have been elucidated in Drosophila melanogaster larvae and adults, however, noxious cold detection has only recently been discovered in larvae (Im and Galko, 2012; Gorczyca et al., 2014; Guo et al., 2014; Mauthner et al., 2014; Turner et al., 2016). Drosophila larvae exhibit a distinct set of aversive behaviors in responses to noxious cold stimuli with the predominant cold-evoked response displaying as a bilateral anterior-posterior full body contraction (CT) (Turner et al., 2016). This behavioral response is mediated by class III md sensory neurons (Turner et al., 2016), which intriguingly have also been implicated in gentle touch mechanosensation revealing multimodality in these neurons (Tsubouchi et al., 2012; Yan et al., 2013). The Transient Receptor Potential (TRP) channels Pkd2, NompC, and Trpm are required for mediating noxious cold-evoked behavior and behavioral selection in response to innocuous mechanical vs. noxious cold stimuli is dependent upon class III neural activation levels providing insight into the mechanisms underlying cold nociception and multimodal sensory processing (Turner et al., 2016).
Materials and Reagents
Kimwipe (KCWW, Kimberly-Clark, catalog number: 34155 )
25 x 75 mm microscope slide (Globe Scientific, catalog number: 1301 )
22 x 22 mm No.1 thickness coverslip (Globe Scientific, catalog number: 1401-10 )
24 x 50 mm No. 1 thickness coverslip (Genesee Scientific, catalog number: 29-118 )
Pyrex 9 well glass spot plates (Fisher Scientific, catalog number: 13-748B)
Manufacturer: Corning, PYREX®, catalog number: 7220-85 .
Amber glass dropper bottles (Fisher Scientific, FisherbrandTM, catalog number: 02-983B )
Bel-ArtTM SP SciencewareTM wide mouth color-code safety labeled wash bottles (Fisher Scientific, catalog number: 22-288654)
Manufacturer: SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F11646-3739 .
Bel-ArtTM SP Scienceware Trigger Sprayers with 53 mm adapters (Fisher Scientific, catalog number: 01-189-100)
Manufacturer: SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F11620-0050 .
Polypropylene vials (Genesee Scientific, catalog number: 32-120 )
Droso-Plugs, Narrow vials (Genesee Scientific, catalog number: 59-200 )
Drosophila stocks:
ChETA: y1 w*; wgSp-1/CyO, P{Wee-P.ph0}BaccWee-P20; P{20XUAS-CHETA.YFP}attP2/TM6C, Sb1 Tb1 (Bloomington Drosophila Stock Center, catalog number: 36495 )
CaMPARI: w*; P{UAS-CaMPARI}attP40 (Bloomington Drosophila Stock Center, catalog number: 58761 )
GCaMP6 (medium variant): w1118; PBac{20XUAS-IVS-GCaMP6m}VK00005 (Bloomington Drosophila Stock Center, catalog number: 42750 )
Class III md neuron driver: GAL419-12 and GAL4nompC (Bloomington Drosophila Stock Center, catalog numbers: 36369 and 36361 ) (Turner et al., 2016)
Class IV md neuron driver: GAL4pp1.9 and GAL4477 (Turner et al., 2016)
Control strain: w1118 (Bloomington Drosophila Stock Center, catalog number: 3605 )
All trans-Retinal (ATR) (Sigma-Aldrich, catalog number: R2500 )
Halocarbon oil #700 (LabScientific, catalog number: FLY-7000 )
Ethyl ether anhydrous (Fisher Scientific, catalog number: E138-500 )
NutriSoy, Soy Flour (Genesee Scientific, catalog number: 62-115 )
Yellow cornmeal (Genesee Scientific, catalog number: 62-101 )
Drosophila agar type II (Genesee Scientific, catalog number: 66-104 )
Inactive dry yeast (Genesee Scientific, catalog number: 62-107 )
Dry molasses (Genesee Scientific, catalog number: 62-119 )
O-phosphoric acid (Fisher Scientific, catalog number: A242-212 )
Propionic acid (Fisher Scientific, catalog number: A258-500 )
Drosophila media (see Recipes)
Equipment
Cold plate assay
Brush (Craft Smart® round brush set golden taklon) (Michaels Stores, model: Size 3, catalog number: 10408282 )
Nikon body plus lens combination (Nikon, model: D5300 ) and AF-S Nikkor 18-55 mm DX VRII (Nikon, model: AF-S DX )
Tripod for mounting DSLR
Cold plate cooler (TE Technology, model: CP-031 )
Cold plate temperature controller (TE Technology, model: TC-720 )
Cold plate power supply (TE Technology, model: PS-12-8.4A )
Infrared thermometer (Fluke, model: Fluke 62 MAX )
Aluminum plate–Laminated aluminum shim (Global Equipment, catalog number: WBB512969 )
Notes:
Cut the shim to 7.5 by 11.5 mm at 0.22 mm thickness.
Paint the plate with black spray paint for high contrast.
Black spray paint–12 oz. black flat general purpose spray paint (Rust-Oleum)
In vivo GCaMP assay
PE120 Peltier stage (Linkam Scientific Instruments, Linkam Scientific, model: PE120 )
T95 system controller (including T95 linkpad and PE95) from (Linkam Scientific Instruments, Linkam Scientific, model: T95 )
Laser confocal microscope capable of imaging GFP (Carl Zeiss, model: LSM 780 )
Optogenetic dose response assay
D5300 DSLR (Nikon, model: D5300 )
Adapters for mounting Nikon DSLR onto Zeiss microscopes: T2-adapter for Nikon F (Carl Zeiss, model: T2-adapter, catalog number: 416009-0000-000 ) and Adapter 60N–T2 1.0x (Carl Zeiss, model: Adapter 60N, catalog number: 426103-0000-000 )
Glass plate: 10 x 15 x 0.1 cm
CaMPARI Ca2+ integrator assay
Photo-conversion filter cube
612/69 BrightLine bandpass filter, 25 mm (IDEX Health & Science, Semrock, catalog number: FF01-612/69-25 )
440 nm BrightLine SWP edge filter, 25 mm (IDEX Health & Science, Semrock, catalog number: FF01-440/SP-25 )
562 BrightLine dichroic beamsplitter, 25.2 x 35.6 mm (IDEX Health & Science, Semrock, catalog number: FF562-Di03-25x36 )
Axio Zoom.V16 (ZEISS, model: Axio Zoom.V16 ) with Illuminator HXP200c lamp (Carl Zeiss, model: HXP 200C )
Light touch stimulus: Nickel plated pin holder (Fine Science Tools, catalog number: 26018-17 ) with mounted single fine paint brush bristle
Noxious cold stimulus: TE technology cold plate cooler described in cold plate assay
Drosophila media preparation
Adventurer Pro II Analytical/Precision Balance (Ohaus, model: AX2202 )
FastPette V2 Pipette Controller (Labnet International, catalog number: P2000 )
10ml Serological Pipets (Genesee Scientific, catalog number: 12-104 )
Droso-Filler, Narrow (Genesee Scientific, catalog number: 59-168 )
Avantco Induction Range (Avantco Equipment, model: IC3500 )
Stainless Stock Pot with lid (Thunder Group, catalog number: SLSPS020 )
Narrow Fly Vial Reload Tray (Genesee Scientific, catalog number: 59-207 )
Software
ImageJ (https://imagej.nih.gov/ij/)
Video to video converter (http://www.videotovideo.org/)
Zeiss Zen Blue Lite (https://www.zeiss.com/microscopy/us/products/microscope-software/zen-lite.html)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Patel, A. A. and Cox, D. N. (2017). Behavioral and Functional Assays for Investigating Mechanisms of Noxious Cold Detection and Multimodal Sensory Processing in Drosophila Larvae. Bio-protocol 7(13): e2388. DOI: 10.21769/BioProtoc.2388.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Cell Biology > Cell imaging > Fluorescence
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,389 | https://bio-protocol.org/exchange/protocoldetail?id=2389&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Delayed-matching-to-place Task in a Dry Maze to Measure Spatial Working Memory in Mice
Xi Feng
KK Karen Krukowski
TJ Timothy Jopson
SR Susanna Rosi
Published: Vol 7, Iss 13, Jul 5, 2017
DOI: 10.21769/BioProtoc.2389 Views: 8142
Edited by: Soyun Kim
Reviewed by: Edel Hennessy
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
The delayed-matching-to-place (DMP) dry maze test is a variant of DMP water maze (Steele and Morris, 1999; Faizi et al., 2012) which measures spatial working/episodic-like learning and memory that depends on both hippocampal and cortical functions (Wang and Morris, 2010; Euston et al., 2012). Using this test we can detect normal aging related spatial working memory decline, as well as trauma induced working memory deficits. Furthermore, we recently reported that fractionated whole brain irradiation does not affect working memory in mice (Feng et al., 2016). Here we describe the experimental setup and procedures of this behavioral test.
Keywords: DMP dry maze Working memory Behavior Mouse
Background
The reference-memory water maze (RMW) was originally used to measure spatial reference memory in rats. In this task animals are trained to find a hidden platform in a fixed location under opaque water by using distal clues outside of the water maze (Morris, 1981). Over the years it has evolved into various tasks, that allow probe trials, over training, reverse learning and an on-demand platform (Morris et al., 1982; Morris et al., 1990; Spooner et al., 1994; Lipp and Wolfer, 1998). Later the Morris lab developed a delayed matching-to-place (DMP) water maze that requires frequently updated, ‘delayed’ memory of escape locations in an unchanging environment (Steele and Morris, 1999). These variations of Morris water maze (MWM) are widely used in the neuroscience field to study spatial cognitive functions that involve different brain regions in both rats and mice (Vorhees and Williams, 2006). The main concern for these tests is that forced swimming might induce stress for animals (Vorhees and Williams, 2014). To exclude this limitation, Faizi et al. (2012) designed a dry maze based on the principles of the DMP water maze. The DMP dry maze is believed to measure the same working/episodic-like memory as the DMP water maze with a less intense test paradigm for both the experimenter and test subjects.
Materials and Reagents
Paper towels (Renown, catalog number: REN06116-WB )
Red paper towels (KCWW, Kimberly-Clark, catalog number: 05930 )
C57BL/6J male adult mice (3-18 months of age)
Note: C57BL/6J male adult mice (3-18 months of age) housed in a room with reversed light cycle for at least two weeks prior to test. Behavior experiment is conducted during the dark cycle (7 AM-7 PM, see Note 1).
70% ethanol (v/v in ddH2O) in a spray bottle
Equipment
A well-lit (1,200 lux) behavior room isolated from noises and a close-by holding room (Figure 1A)
White shower curtains (Figures 1B and 1C)
Two large visual clues (Figures 1B and 1C)
A Polystyrene circular DMP dry maze platform (Diameter = 122 cm, thickness = 1.2 cm) with 40 escape holes (D = 5 cm)
Note: 16 holes on the outer ring, 16 on the middle ring and 8 holes on the inner ring with distance of 50, 35 and 20 cm to the center of platform, respectively (Figure 1B). ABS tubes (Inner diameter = 52 mm, outer diameter = 60 mm) are attached to each escape hole which allows easy attach and detach of the escape tube (Figure 1D). It is important to use black or dark colored escape tube so mice would prefer to enter. In addition, dark color minimizes the chance of leaving visual clues around escape holes over time.
A 3” ABS plug (NIBCO, catalog number: 5818 )
Escape tube assembled using black ABS pipes (2”, NIBCO, catalog numbers: C5806-2 and C5807-V Figure 1E) with a removable plug (to be attached to escape holes) at the other end (NIBCO, catalog number: 5818 , Figure 1F). When connected to the escape hole, the resulting depth from the top pf maze to the floor of escape tube is about 8 cm
A metal stand to support the platform to 90 cm above the floor (Figure 1 D)
A small non-transparent transfer box
Note: We use a pipette tip box without the lid (Figure 1I).
Fish net with extended handle or a similar item (Figure 1I)
Timer
Speakers capable of playing at 85 dB or louder (Figure 1B)
Noise-cancelling headphones or similar items (Figure 1I)
Overhead camera (GigE, catalog number: XCFS-BC6o# )
A computer (with Windows 7 64bit Professional) connected to the camera
Figure 1. Platform and room setup. A. Sketch of the behavior room and holding room layout; B. A picture showing the details of platform layout and visual clues on two sides of the platform; C. A picture of visual clues on other two sides; D. A picture showing the bottom of platform; E-H. Pictures to show the escape tube, an escape hole and how they are connected; I. Other items needed for the task.
Software
Recording and tracking software (Noldus, Ethovision XT v 11.5.1026)
Audio file of a recorded tone at 960 Hz with > 90 sec length (audio file 1)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Feng, X., Krukowski, K., Jopson, T. and Rosi, S. (2017). Delayed-matching-to-place Task in a Dry Maze to Measure Spatial Working Memory in Mice. Bio-protocol 7(13): e2389. DOI: 10.21769/BioProtoc.2389.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,390 | https://bio-protocol.org/exchange/protocoldetail?id=2390&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Non-invasive Protocol for Kinematic Monitoring of Root Growth under Infrared Light
FB François Bizet
LD Lionel X. Dupuy
AB Anthony Glyn Bengough
AP Alexis Peaucelle
IH Irène Hummel*
MB Marie-Béatrice Bogeat-Triboulot*
*Contributed equally to this work
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2390 Views: 8377
Reviewed by: Igor Cesarino
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
Phenotyping the dynamics of root responses to environmental cues is necessary to understand plant acclimation to their environment. Continuous monitoring of root growth is challenging because roots normally grow belowground and are very sensitive to their growth environment. This protocol combines infrared imaging with hydroponic cultivation for kinematic analyses. It allows continuous imaging at fine spatiotemporal resolution and disturbs roots minimally. Examples are provided of how the procedure and materials can be adapted for 3D monitoring and of how environmental stress may be manipulated for experimental purposes.
Keywords: Hydroponics Infrared imaging Kinematics Root growth Time-lapse
Background
The use of kinematic analyses for the monitoring of growth and tropisms in plants dates back to the end of the 19th century, with early studies from Julius von Sachs and Whilhelm Pfeffer. The widespread use of photography during the 20th century led to easier and continuous monitoring through ‘streak photography’ (List, 1969; Erickson and Silk, 1980). In the 90s, new digital cameras and informatics tools enabled the development of automatic tracking algorithms used for particle image velocimetry. RootFlowRT (Van der Weele et al., 2003), Kineroot (Basu et al., 2007), RootTrace (French et al., 2009), GrowthTracer (Iwamoto et al., 2013) and Kymorod (Bastien et al., 2016) are among many recent examples of software dedicated to the monitoring of root growth. However, all particle image velocimetry methods rely on the use of identifiable image texture patterns in each successive picture. Historically, these patterns were marked on the root using ink or graphite particles (see Sharp et al., 1988 and Merret et al., 2010 for examples). Two difficulties arise from this approach: Firstly, the markings spread during organ (root) growth, inducing loss of resolution after a few hours. Secondly, the physical marking process may stress the organ due to some combination of exposure to small forces, to light or to temperature changes, or to slight drying of the organ surface. In roots such handling effects may cause temporary slowing of growth for a period of minutes to hours. The use of infrared light (840-850 nm) has the double benefit of not influencing root growth, whilst also generating image texture patterns readily tracked using particle image velocimetry.
Materials and Reagents
Clear flexible tubing (VWR, catalog number: 228-0708 )
Plastic sealing tape (Terostat VII, Teroson) (Rubans de Normandie, catalog number: 7TE )
Growing roots of hydroponically-grown plants. Adventitious roots grow on poplar woody cuttings partially immersed in Hoagland half strength nutrient solution (Sigma-Aldrich, catalog number: H2395 )
Note: The present protocol was initially designed for monitoring the growth of a plagiotropic poplar root (Bizet et al., 2015). The protocol is adaptable for any plant species that tolerates hydroponic or in vitro cultivation (see step D3).
Equipment
Transparent Plexiglass® growth monitoring chamber (specially built, size 12 cm long x 5 cm large x 6 cm height), with holes on one side for nutrient solution inflow and outflow (Figure 1)
Figure 1. Custom made transparent Plexiglass® growth monitoring chamber
Water pump (e.g., a small aquarium pump, for instance, Newa, model: NJ600 , aquarium shop)
Temperature-controlled dark room (range 21-23 °C)
Note: The whole system requires about 1 m2 of laboratory working space.
Air pump (e.g., an aquarium pump with airstone, for instance JBL, model: Prosilent a300 , aquarium shop)
Stone diffuser (e.g., JBL, model: Prosilent Aeras Micro S2 , aquarium shop)
Small plastic reservoir tank (buffer tank, few litres capacity, size 12 x 20 x 40 cm3)
Note: A plastic bucket would suit.
Modified digital camera (see Procedure A, for how to remove the infrared filter)
Note: Most reflex camera should work fine as long as it is possible to do infrared conversion and to computer-control them using manufacturer’s software or free software such as Digicamcontrol (list of supported cameras: http://digicamcontrol.com/cameras). Light sensitivity and captor size should also be considered for best image quality.
Infrared lamp (840-850 nm) (Pearl, catalog number: KT4243-907 )
Extension tube (Kenko, AF 12/20/36 mm for Nikon)
Optical rail equipped with a translation stage (Edmund Optics, catalog number: 59-263 )
Knuckle with knob and thread adaptor (Edmund Optics, catalog numbers: 53-887 and 58-988 )
Macro objective (Nikkor 60/2.8 D ASF)
Software
Software for image analysis (e.g., Kineroot from Basu et al., 2007)
Fiji (https://fiji.sc)
Rawtherapee (http://rawtherapee.com)
Digicamcontrol (http://digicamcontrol.com)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bizet, F., Dupuy, L. X., Bengough, A. G., Peaucelle, A., Hummel, I. and Bogeat-Triboulot, M. (2017). Non-invasive Protocol for Kinematic Monitoring of Root Growth under Infrared Light. Bio-protocol 7(14): e2390. DOI: 10.21769/BioProtoc.2390.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > General
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,391 | https://bio-protocol.org/exchange/protocoldetail?id=2391&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Non-radioactive LATS in vitro Kinase Assay
AH Audrey W. Hong
KG Kun-Liang Guan
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2391 Views: 11305
Edited by: Ralph Bottcher
Reviewed by: Hsin-Yi Chang
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
This protocol describes a method to directly measure LATS activity by an in vitro kinase assay using YAP as a substrate.
Keywords: LATS Phosphorylation in vitro kinase assay Hippo pathway YAP
Background
Large tumor suppressor 1/2 (LATS1/2) are protein kinases and core components of the Hippo pathway, which regulates organ size and tissue homeostasis. LATS kinase is activated by phosphorylation on its hydrophobic motif (HM, Thr 1079 for LATS1 and Thr 1041 for LATS2). As a result, Western blotting with phosphoantibody recognizing LATS at HM provides an indirect way to assess LATS kinase activity (Data analysis, Figure 1). In addition, active LATS phosphorylates and inhibits the transcription co-activator Yes-associated protein (YAP) at Ser 127, leading to YAP binding to 14-3-3 and cytoplasmic retention (Zhao et al., 2007). Using YAP as a substrate in LATS in vitro kinase assay provides a method to directly assess LATS kinase activity. Through this assay, we were able to show that serum starvation and sorbitol-induced osmotic activate LATS (Yu et al., 2012; Hong et al., 2017) and further lead to YAP Ser 127 phosphorylation (Data analysis, Figure 2).
Materials and Reagents
Pipette tips
10 cm plates
1.5 ml Eppendorf tube
Dialyzer (EMD Millipore, catalog number: 71507-3 )
pGEX-KG-GST-YAP plasmid (Addgene, catalog number: 33052 )
BL21(DE3) competent cells (Agilent Technologies, catalog number: 230134 )
HEK293A cells
LB broth (Fisher Scientific, catalog number: BP1426-2 )
Carbenicillin disodium salt (Sigma-Aldrich, catalog number: 205805-250MG )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sigma-Aldrich, catalog number: I5502 )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010049 )
Protease inhibitor cocktail tablet (Roche Diagnostics, catalog number: 11873580001 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626-5G )
Dithiothreitol (DTT) (Bio-Rad Laboratories, catalog number: 1610611 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
Glutathione Sepharose 4B (GE Healthcare, catalog number: 17075601 )
Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437028 )
Phosphatase inhibitor mini tablet (Thermo Fisher Scientific, Thermo ScientificTM , catalog number: 88667 )
Protein A/G magnetic beads (Thermo Fisher Scientific, Thermo ScientificTM , catalog number: 88802 )
Kinase buffer (New England Biolabs, catalog number: B6022S )
Cold ATP (Sigma-Aldrich, catalog number: A2383 )
Sorbitol (Fisher Scientific, catalog number: S459-500 )
Antibodies
Lats1 antibody (Cell Signaling Technology, catalog number: 3477S )
pYAP S127 antibody (Cell Signaling Technology, catalog number: 4911S )
pLATS-HM antibody (Cell Signaling Technology, catalog number: 8654S )
GAPDH antibody (Santa Cruz Biotechnology, catalog number: sc-25778 )
GST antibody (Sigma-Aldrich, catalog number: SAB4200237 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3294 )
Tris-base (Fisher Scientific, catalog number: BP152-10 )
L-glutathione reduced (Sigma-Aldrich, catalog number: G4251 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-10 )
Glycerol (Fisher Scientific, catalog number: G33-1 )
Sodium lauryl sulfate (SDS) (Fisher Scientific, catalog number: S529-500 )
Bromophenol blue (Bio-Rad Laboratories, catalog number: 1610404 )
Sodium fluoride (NaF) (Acros Organics, catalog number: 424325000 )
EDTA (Mediatech, catalog number: 46-034-CI )
NP-40 substitute (Sigma-Aldrich, catalog number: 74385 )
Elution buffer (see Recipes)
Dialysis buffer (see Recipes)
4x SDS sample buffer (see Recipes)
Mild lysis buffer (see Recipes)
TBS buffer (see Recipes)
Equipment
Pipettes
Spectrophotometer (Biochrom, model: Biochrom WPA Biowave II )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM , model: SorvallTM RC 6 Plus)
Sonic dismembrator (Sonicator) (Fisher Scientific, model: Model 505 )
Bench-top centrifuge (Denville Scientific, model: Denville 300D , catalog number: C0265-24)
Magnetic rack (Thermo Fisher Scientific, catalog number: 12321D )
Shaker (Eppendorf, New BrunswickTM, model: Excella® E24 )
Heat block
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hong, A. W. and Guan, K. (2017). Non-radioactive LATS in vitro Kinase Assay. Bio-protocol 7(14): e2391. DOI: 10.21769/BioProtoc.2391.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Protein
Biochemistry > Protein > Activity
Cell Biology > Cell signaling > Phosphorylation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,392 | https://bio-protocol.org/exchange/protocoldetail?id=2392&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Ustilago bromivora Strains from Infected Spikelets through Spore Recovery and Germination
JB Jason Bosch
AD Armin Djamei
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2392 Views: 7332
Edited by: Arsalan Daudi
Reviewed by: Hiroyuki Hirai
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
Ustilago bromivora is a biotrophic smut fungus infecting Brachypodium sp. It is closely related to the barley-infecting smut Ustilago hordei, and related to the well-studied, gall-inducing model pathogen Ustilago maydis. Upon flowering, the spikelets of U. bromivora-infected plants are filled with black fungal spores. While it is possible to directly use this spore material to infect Brachypodium seeds, in many cases it is more useful to isolate individual strains of U. bromivora for a genetically homogenous population. This protocol describes how to collect and germinate the spores of U. bromivora on plate in order to obtain strains derived from a single cell.
Keywords: Brachypodium distachyon Ustilago bromivora Biotrophic interaction Plant pathogen Filamentous fungus Head smut
Background
Ustilago maydis infecting maize (Zea mays) has long been established as a model system for studying biotrophic pathogens (Brefort et al., 2009). This has led to many discoveries concerning the nature of biotrophic interactions but has limitations due to the practical difficulties of working with maize in the laboratory. The same is true for the model fungus Ustilago hordei infecting barley (Hordeum vulgare) (Laurie et al., 2012). In contrast to these crop plants, the model grass Brachypodium distachyon has a small genome, undemanding growth conditions and is amenable to genetic manipulation (Draper et al., 2001). B. distachyon has also been used to study non-host resistance to Puccinia striiformis f. sp. tritici due to the genetic complexity of its usual host, wheat (An et al., 2016). Recently, we have described Ustilago bromivora, a smut fungus related to U. maydis, which is able to infect Brachypodium sp. and proposed this as a new model system for studying biotrophic interactions (Rabe et al., 2016).
During infection of Brachypodium sp. by U. bromivora, no visible symptoms can be detected for most of the infection. The only visible symptom of infection occurs during flowering when the plant produces spikelets that are filled with black, fungal spores. These spores can be used to directly infect new seeds but contain genetically disparate fungal strains. For most purposes, a pure culture from a single cell is preferable as it can be cultured axenically, characterized and genetically manipulated before being used to infect further seeds. This protocol describes the process of germinating the U. bromivora spores in vitro. It bears similarities to spore germination protocols of other smut fungi, for example, U. maydis (Heinze, 2009; Nadal et al., 2016), but has been modified to account for differences in the host species and infected organs. Please be aware that U. bromivora shows a mating type bias leading to the survival of only one mating type (mat a) on plate after spore germination (Rabe et al., 2016). This means that it will require additional effort to generate the second mating type or the use of the strain which we have previously isolated.
Materials and Reagents
Paper bag (HERA, catalog number: 716P50 )
1.5 ml microcentrifuge tubes (SARSTEDT, catalog number: 72.690.001 )
Petri dish (SARSTEDT, catalog number: 82.1473.001 )
Micro-homogenizer (Carl Roth, catalog number: K994.1 )
Pipetman Diamond tips, D200 (Gilson, catalog number: F161931 )
Pipetman Diamond tips, D1000 (Gilson, catalog number: F161671 )
Glass beads (Sigma-Aldrich, catalog number: 18406 )
Copper sulfate (CuSO4) (AppliChem, catalog number: 131270 )
Ampicillin (Carl Roth, catalog number: K029.2 )
Tetracycline (Duchefa Biochemie, catalog number: T0150 )
Chloramphenicol (AppliChem, catalog number: A1806 )
Potato dextrose broth (BD, catalog number: 254920 )
Agar (BD, catalog number: 214040 )
PDAmp, Tet, ChlA plates (see Recipes)
Equipment
Scissors
Cooled incubator (ST) ST 1 (Pol-Eko Aparatura, catalog number: ST 1 )
Pipetman P1000 (Gilson, catalog number: F123602 )
Pipetman P200 (Gilson, catalog number: F123601 )
Vortex
HeraeusTM PicoTM 17 Microcentrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM PicoTM 17 , catalog number: 75002410)
Procedure
Harvest the infected spikelets from the plant by cutting them off using a pair of scissors. Figure 1 shows the appearance of the infected spikelets. Spikelets should be stored in a paper bag for ~10 days at 28 °C to dry out. They can then be stored at room temperature until use.
Figure 1. Spikelets of B. distachyon infected by U. bromivora. The black masses of fungal spores are clearly visible in both the hydrated (right) and dehydrated (left) spikelet. The scale bar represents approximately 1 cm. The image background of the spikelets was digitally removed.
Carefully grind the spikelets filled with spore material with a micro-homogenizer in 1.5 ml microcentrifuge tubes to break up the spikelet. The spores are very robust to survive harsh environments and will not be damaged by the grinding.
Add 500 µl ddH2O and continue to grind softly. It is best to use a rotating motion to grind the spikelet as pushing into the microcentrifuge tube will cause the liquid to splash out. The liquid will turn black as it is ground, indicating that the spores have been released and are properly suspended.
Incubate the ground spores in ddH2O for 1 h at room temperature to allow faster-germinating, contaminating, fungal spores to germinate. This will leave them more susceptible to the sterilisation treatment and reduce overall contamination levels.
Add 500 µl 3% CuSO4 and mix the solution either by pipetting up and down or by using a vortex. This will kill most, if not all, of the contaminating spores that have germinated but not the U. bromivora spores which can take up to 17 h to germinate.
Note: CuSO4 is a heavy metal and should be handled and discarded according to its MSDS.
Incubate the spore/CuSO4 mixture for 15 min at room temperature.
Centrifuge the spore mixture at 1,200 x g for 5 min. This will cause the spores to pellet. Carefully pour out the liquid and re-suspend the spores in 1 ml ddH2O.
Repeat step 7 three times but, on the third time, instead of re-suspending the spores in ddH2O, proceed to step 9.
Re-suspend the spores in 300 µl ddH2O with antibiotics (ampicillin, tetracycline and chloramphenicol). These will kill any non-fungal cells that might have survived the CuSO4 treatment.
Make a dilution series of the fungal spore suspension (100-10-4) in ddH2O with the three antibiotics.
Plate 100 µl of each dilution on a PDAmp, Tet, ChlA plate (see Recipes), spread using glass beads and incubate at 21 °C for several days to obtain colonies.
As U. bromivora spores contain tetrads, the original colonies should be singled out on PD plates (with or without antibiotics) to obtain colonies derived from a single cell.
Notes
While we have provided information on the specific equipment and reagents used, we have no reason to believe that it is essential to use them exactly. The equivalent equipment or reagents from other manufacturers should be just as suitable.
Recipes
PDAmp, Tet, ChlA plates
2.4% (weight/volume) potato dextrose broth
2.0% (weight/volume) agar
Note: Measure out the appropriate amount of potato dextrose broth and agar for the intended volume. Dissolve them in ddH2O then autoclave the mixture at 121 °C for 15 min. Once it has cooled to approximately 50 °C, add ampicillin, tetracycline and chloramphenicol to their final concentrations. Pour the mixture into Petri dishes (20 ml per 9 cm Petri dish) and wait ~20 min for it to set.
Acknowledgments
This protocol was developed in the Djamei laboratory and has had aspects contributed and/or changed by multiple members of the Djamei group. Due to this, the people listed as authors are not the only ones who have been involved in developing the protocol (for this see Rabe et al., 2016) but are merely the ones who have prepared it for publication. The research leading to these results has received funding from the European Research Council under the European Union’s Seventh Framework Programme (FP7/2007-2013)/ERC grant agreement No. [EUP0012 ‘Effectomics’], the Austrian Science Fund (FWF): [P27429-B22, P27818-B22, I 3033-B22], and the Austrian Academy of Science (OEAW).
References
An, T., Cai, Y., Zhao, S., Zhou, J., Song, B., Bux, H. and Qi, X. (2016). Brachypodium distachyon T-DNA insertion lines: a model pathosystem to study nonhost resistance to wheat stripe rust. Sci Rep 6: 25510.
Brefort, T., Doehlemann, G., Mendoza-Mendoza, A., Reissmann, S., Djamei, A. and Kahmann, R. (2009). Ustilago maydis as a pathogen. Annu Rev Phytopathol 47: 423-445.
Draper, J., Mur, L. A., Jenkins, G., Ghosh-Biswas, G. C., Bablak, P., Hasterok, R. and Routledge, A. P. (2001). Brachypodium distachyon. A new model system for functional genomics in grasses. Plant Physiol 127(4): 1539-1555.
Heinze, B. (2009). Comparative analysis of the maize smut fungi Ustilago maydis and Sporisorium reilianum. Philipps-Universitat Marburg.
Laurie, J. D., Ali, S., Linning, R., Mannhaupt, G., Wong, P., Guldener, U., Munsterkotter, M., Moore, R., Kahmann, R., Bakkeren, G. and Schirawski, J. (2012). Genome comparison of barley and maize smut fungi reveals targeted loss of RNA silencing components and species-specific presence of transposable elements. Plant Cell 24(5): 1733-1745.
Nadal, M., Takach, J., Andrews, D., and Gold, S. (2016). Mating and progeny isolation in the corn smut fungus Ustilago maydis. Bio Protoc: e1793.
Rabe, F., Bosch, J., Stirnberg, A., Guse, T., Bauer, L., Seitner, D., Rabanal, F. A., Czedik-Eysenberg, A., Uhse, S., Bindics, J., Genenncher, B., Navarrete, F., Kellner, R., Ekker, H., Kumlehn, J., Vogel, J. P., Gordon, S. P., Marcel, T. C., Munsterkotter, M., Walter, M. C., Sieber, C. M., Mannhaupt, G., Guldener, U., Kahmann, R. and Djamei, A. (2016). A complete toolset for the study of Ustilago bromivora and Brachypodium sp. as a fungal-temperate grass pathosystem. Elife 5.
Copyright: Bosch and Djamei. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Bosch, J. and Djamei, A. (2017). Isolation of Ustilago bromivora Strains from Infected Spikelets through Spore Recovery and Germination. Bio-protocol 7(14): e2392. DOI: 10.21769/BioProtoc.2392.
Rabe, F., Bosch, J., Stirnberg, A., Guse, T., Bauer, L., Seitner, D., Rabanal, F. A., Czedik-Eysenberg, A., Uhse, S., Bindics, J., Genenncher, B., Navarrete, F., Kellner, R., Ekker, H., Kumlehn, J., Vogel, J. P., Gordon, S. P., Marcel, T. C., Munsterkotter, M., Walter, M. C., Sieber, C. M., Mannhaupt, G., Guldener, U., Kahmann, R. and Djamei, A. (2016). A complete toolset for the study of Ustilago bromivora and Brachypodium sp. as a fungal-temperate grass pathosystem. Elife 5.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,393 | https://bio-protocol.org/exchange/protocoldetail?id=2393&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
[2-3H]Mannose-labeling and Analysis of N-linked Oligosaccharides
MS Marina Shenkman
NO Navit Ogen-Shtern
Gerardo Z. Lederkremer
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2393 Views: 6612
Edited by: Ralph Bottcher
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Modifications of N-linked oligosaccharides of glycoproteins soon after their biosynthesis correlate to glycoprotein folding status. These alterations can be detected in a sensitive way by pulse-chase analysis of [2-3H]mannose-labeled glycoproteins, with enzymatic removal of labeled N-glycans, separation according to size by HPLC and radioactive detection in a scintillation counter.
Keywords: N-linked oligosaccharide Mannose-labeling Endoplasmic reticulum associated degradation Glycosylation Mannosidase
Background
Following entry of a nascent polypeptide into the ER, it is subjected to several post-translational modifications, which are crucial for folding, maturation and quality control processes. The addition of the core oligosaccharide, Glc3Man9GlcNAc2 to produce N-linked glycoproteins is a very common modification and the first to occur (Benyair et al., 2011). Processing of the precursor N-glycan directs the glycoproteins to maturation and quality control machineries by creating recognition tags while in early secretory compartments (Tannous et al., 2015). At later stages, throughout the secretory pathway the core of the oligosaccharide serves as a platform for expansion of the sugar chains into complex glycans, the structures of which relate to the trafficking and function of the glycoproteins (Kamiya et al., 2012). Because the early N-linked glycan modifications reflect glycoprotein biosynthesis and quality control, the oligosaccharide processing has been the subject of many studies (Avezov et al., 2010; Hosokawa et al., 2010; Ninagawa et al., 2014; Ogen-Shtern et al., 2016). Glycoproteomic methods have greatly improved N-glycan characterization, but they do not allow the study of the dynamics of glycan processing in the early secretory pathway.
Here we describe a simplified pulse-chase method for the isolation and analysis of metabolically labeled N-linked oligosaccharides. The method includes radioactive labeling by [2-3H]Man followed by enzymatic removal of oligosaccharides by endo-beta-N-acetylglucosaminidase H (Endo H). Then, N-linked oligosaccharide isolation by molecular filtration and separation by high-performance liquid chromatography (HPLC), which discriminates between high-mannose glycan structures depending on their number of monosaccharide residues. The protocol allows analysis of the dynamics of N-linked glycan modification under different conditions, e.g., after drug treatment or modification of protein levels by overexpression or knockdown. Trimming to shorter species, Man5-6GlcNAc2, is a requirement for glycoprotein targeting to endoplasmic reticulum-associated degradation (ERAD) (Frenkel et al., 2003). Man1A (α1,2 mannosidase 1A ) appears to be involved in endoplasmic reticulum (ER) quality control and required for this trimming, as we present in an example. This is a surprising finding considering that the enzyme was thought to be located in the Golgi complex (Igdoura et al., 1999; Herscovics, 2001); a recent reevaluation locates it in quality control vesicles (Ogen-Shtern et al., 2016).
To conclude, the protocol presented here enables the study of the dynamics of N-linked high-mannose glycan modifications, which has an important role in glycoprotein quality control and trafficking. The advantages of the method are its simplicity, high sensitivity of detection and unique information on the dynamics of N-glycan processing in the early secretory pathway.
Materials and Reagents
100 mm tissue culture dishes (Corning, catalog number: 430167 )
1.5 and 2 ml microcentrifuge tubes (Eppendorf)
Microcon Amicon Ultra 0.5 ml 30K or Centricon ultracel YM-30 (EMD Millipore, catalog number: UFC503024 )
Spherisorb NH2 column, 5 µm, 4.6 x 250 mm (WATERS, catalog number: PSS831115 )
HEK-293 cells (ATCC, catalog number: CRL-1573 )
Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 41965039 )
Dulbecco’s modified Eagle’s medium-glucose free (Sigma-Aldrich, catalog number: D5030 )
Fetal bovine serum (FBS) (Biological Industries, catalog number: 04-001-1A-US )
Fetal bovine serum (FBS), dialyzed (Biological Industries, catalog number: 04-011-1A-US )
Sodium pyruvate solution (100 mM) (Sigma-Aldrich, catalog number: S8636 )
Mannose, D-[2-3H(N)]- (Specific Activity: 15-30 Ci/mmol) (PerkinElmer, catalog number: NET570A )
Dulbecco’s phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: D1408 )
Protein A-Agarose beads, IPA 300 (REPLIGEN, catalog number: 10-1003 )
Rabbit polyclonal anti-H2 carboxy-terminal produced in our lab (Tolchinsky et al., 1996)
Endo Hf Kit (1,000,000 U/ml) (New England Biolabs, catalog number: P0703S )
Standard oligosaccharide mixture prepared by glycoprotein metabolic labeling with [14C] or [3H] and separation with endo H
Acetonitrile LiChrosolv (gradient grade for liquid chromatography) (Merck, catalog number: 100030 )
Phosphoric acid solution (49-51%, for HPLC) (Sigma-Aldrich, catalog number: 79607 )
Opti-Fluor scintillation fluid (PerkinElmer, catalog number: 6013199 )
Triton X-100 (BDH, catalog number: 306324N )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P2714 )
Sodium deoxycholate (Sigma-Aldrich, catalog number: 30970 )
Sodium dodecyl sulfate (SDS) (Bio-Rad Laboratories, catalog number: 1610301 )
Sodium phosphate (Na3PO4) (Sigma-Aldrich, catalog number: 342483 )
Buffer A (see Recipes)
Buffer D (see Recipes)
HPLC solvent (see Recipes)
Equipment
Eppendorf centrifuge (Eppendorf, model: 5415 D )
CO2 incubator
-80 °C freezer
LS 6500 Liquid Scintillation Counting systems (Beckman Coulter, model: LS 6500, catalog number: 510720 )
600E Multisolvent delivery System controller (HPLC) (WATERS, catalog number: WAT062710 )
Note: This product has been discontinued.
SpeedVac Concentrator 5301, incl. 48 x 1.5/2.0 ml fixed-angle rotor (Eppendorf, model: Concentrator 5301, catalog number: 5301 000.016 )
Frac-100 fraction collector (Amersham Biosciences, model: FRAC-100, catalog number: 18-1000-77 )
Vibra-Cell ultrasonic processors VCX 750 (Sonics and Materials, model: VCX 750 , catalog number: 690-003)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Shenkman, M., Ogen-Shtern, N. and Lederkremer, G. Z. (2017). [2-3H]Mannose-labeling and Analysis of N-linked Oligosaccharides. Bio-protocol 7(14): e2393. DOI: 10.21769/BioProtoc.2393.
Download Citation in RIS Format
Category
Biochemistry > Carbohydrate > Oligosaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,394 | https://bio-protocol.org/exchange/protocoldetail?id=2394&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analyzing the Properties of Murine Intestinal Mucins by Electrophoresis and Histology
RW Ran Wang
Sumaira Z. Hasnain
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2394 Views: 18828
Edited by: Andrea Puhar
Reviewed by: David A. CisnerosAna Santos Almeida
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Specialized secretory cells known as goblet cells in the intestine and respiratory epithelium are responsible for the secretion of mucins. Mucins are large heavily glycosylated proteins and typically have a molecular mass higher than 106 Da. These large proteins are densely substituted with short glycan chains, which have many important functional roles including determining the hydration and viscoelastic properties of the mucus gel that lines and protects the intestinal epithelium. In this protocol, we comprehensively describe the method for extraction of murine mucus and its analysis by agarose gel electrophoresis. Additionally we describe the use of High Iron Diamine-Alcian Blue, Periodic Acid Schiff’s-Alcian Blue and immune–staining methods to identify and differentiate between the different states of glycosylation on these mucin glycoproteins, in particular with a focus on sulphation and sialylation.
Keywords: Sialylation Sulphation Glycosylation Mucin Secreted mucin Stored mucin High Iron Diamine
Background
A layer of mucus protects the intestinal epithelium and primarily consists of mucins, water, proteins and inorganic salts. The viscous and gel-like properties of the mucus barrier, which enable it to physically protect and lubricate the mucous membranes, are conferred mainly by mucins. Mucins are large heavily glycosylated proteins and typically have a molecular mass higher than 106 Da. Mucins, however, are predominantly decorated with O-glycan sugars, which accounts for up to 80% of their molecular weight. The diverse site-specific and mucin-specific glycosylation patterns influence the properties of the mucin and therefore the mucus gel. It is well known that mucin glycosylation is altered in infection and disease (Arike et al., 2017; Hasnain et al., 2017). Here we describe methods to assess the amounts of intestinal mucins in murine models and assess the changes in glycosylation with a particular focus on sialylation and sulphation of mucins. Previous methods have not differentiated between mucins isolated from the secreted barrier or those stored within the goblet cells. Methods described here can be employed to assess the changes in secreted or goblet cell-stored mucins in each individual animal. Moreover, using high-iron diamine staining changes in amounts of mucins can also be correlated this with changes in mucin glycosylation.
Materials and Reagents
Pipette tips (Thermo Fisher Scientific, FinntipTM Pipette Tip)
19.5 gauge needle (BD, catalog number: 305187 )
Needles (BD PrecisionGlideTM Needle)
Nitrocellulose membrane (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88018 )
BIOMAXTM BML film (Carestream Health, catalog number: 876-1520 )
Microscope slides (Menzel Gläser, SuperFrost® Plus) (VWR, catalog number: 631-9483 )
Cover slips (Fisher Scientific, catalog number: 12-546-2 )
Histology cassettes, moulded lid (ProSciTech, catalog number: RCH40-W )
Biopsy Pads, 100% Reticulated Foam (Trajan Scientific and Medical, catalog number: BPBL )
Polystyrene cube
10 cm Petri dishes (Corning, catalog number: 430591 )
Transfer pipette, polyethylene (Sigma-Aldrich, catalog number: Z350826-500EA )
Cell scraper (VWR, catalog number: 734-0386 )
D-TubeTM dialyzers (Merck, UK)
C57BL/6 mice (Animal Resource Centre, WA, Australia)
100% ethanol (Sigma-Aldrich, catalog number: 443611 )
Non-sterile phosphate buffered saline (PBS) (Thermo Fisher Scientific, catalog number: 10010031 )
Urea (VWR, BDH®, catalog number: BDH4602 )
Guanidinium chloride (GuCl) (Sigma-Aldrich, catalog number: G3272 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E9884 )
Dithiothrethiol (DTT) (Melford Laboratories, catalog number: MB1015 )
Iodoacetamide (Sigma-Aldrich, catalog number: I6125 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Tris base (Roche Diagnostics, catalog number: 10708976001 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Sodium citrate (Sigma-Aldrich, catalog number: PHR1416 )
Periodic acid (Sigma-Aldrich, catalog number: P7875 )
Acetic acid (Sigma-Aldrich, catalog number: A9967 )
Sodium metabisulphite (Sigma-Aldrich, catalog number: 31448 )
Schiff’s reagent (Sigma-Aldrich, catalog number: 3952016 )
N,N-dimethyl-p-phenylenediamine (HCl) (Sigma-Aldrich, catalog number: D5004 )
N,N-dimethyl-M-phenylenediamine (HCl)2 (Sigma-Aldrich, catalog number: 219223 )
Iron(III) chloride (FeCl3) (Sigma-Aldrich, catalog number: 157740 )
Alcian blue 8GX (AB) (Sigma-Aldrich, catalog number: A5268 )
Tween-20 (Sigma-Aldrich, catalog number: P1379 )
Skimmed milk powder (Sigma-Aldrich, catalog number: 1443825 )
Odyssey® blocking buffer (LI-COR, catalog number: P/N 927-40000 )
Muc2 antibody: Muc2.3, Rabbit polyclonal antibody (made in house) or H300 Muc2, Rabbit polyclonal antibody (Santa Cruz Biotechnology, catalog number: sc-15334 )
Enhanced chemiluminescence substrate, Western Lightning® Plus-ECL (PerkinElmer, catalog number: NEL105001EA )
IRDye® 800CW Donkey anti-Rabbit IgG (H+L) (LI-COR, catalog number: P/N 925-32213 )
Peroxidase AffiniPure Donkey Anti-Rabbit IgG (H+L) (Jackson ImmunoResearch, catalog number: 711-035-152 )
Alkaline Phosphatase AffiniPure Goat Anti-Rabbit IgG (H+L) (Jackson ImmunoResearch, catalog number: 111-055-003 )
Haematoxylin (Sigma-Aldrich, catalog number: H3136 )
Nitro Blue Tetrazolium (Tablet) (Sigma-Aldrich, catalog number: N5514 )
Wax (MÜNZING, catalog number: CERETAN WE 3501 )
Xylene (Sigma-Aldrich, catalog number: 214736 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 484016 )
Pertex mounting medium (MEDITE, catalog number: 41-4012-00 )
10% neutrally buffered formalin (diluted from CONFIX PURPLE, 10% NBF X5 concentrate) (Australian Biostain, catalog number: ACFP )
Guanidinium chloride (GuCl) reduction buffer (see Recipes)
Loading buffer (see Recipes)
TAE buffer (see Recipes)
4x SSC buffer (see Recipes)
Periodic acid solution (see Recipes)
Sodium metabisulphite solution (see Recipes)
High Iron Diamine solution (see Recipes)
Alcian blue solution (see Recipes)
TBST buffer (see Recipes)
Milk blocking buffer (see Recipes)
Equipment
Curved tweezers
Pipettes (Eppendorf, model: Research® plus )
Spring scissor (Fine Science Tools, catalog number: 15018-10 )
Forceps (World Precision Instruments, catalog number: 501216 )
15 ml Falcon conical tube rotor (Beckman Coulter, model: C1015 )
Incubator
Electrophoresis gel tank (Figure 1) (Plaztek Scientific, catalog number: Wini-000 )
Electrophoresis power pack (Figure 1) (Select Bioproducts, model: BioVolt 250V )
Vacuum Blotting Unit with Bio-Rad Blotter (Figure 2) (Bio-Rad Laboratories, model: Model 785 )
Odyssey® CLx Imager (LI-COR, model: Odyssey® CLx )
Micro Spin tissue processor (STP) 120 (Microm UK Ltd.)
Micron Cool Cut HM355S microtome (Microm, model: HM355S )
Microtome blade MX35 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3052835 )
Water bath (Thermoline Scientific, catalog number: TWB-D-SERIES )
Olympus bright field microscope (Olympus Tokyo, Japan)
Figure 1. Electrophoresis gel tank (right) and electrophoresis power supply (left) for gel electrophoresis analyses of mucins
Figure 2. Vacuum Blotting Unit with vacuum blotter chamber (front) and vacuum pump (back)
Software
NIS-Elements software v.3.0 (Nikon, Tokyo, Japan)
Image StudioTM Lite software (LI-COR Biosciences)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, R. and Hasnain, S. Z. (2017). Analyzing the Properties of Murine Intestinal Mucins by Electrophoresis and Histology. Bio-protocol 7(14): e2394. DOI: 10.21769/BioProtoc.2394.
Download Citation in RIS Format
Category
Immunology > Mucosal immunology > Digestive tract
Cancer Biology > General technique > Biochemical assays
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,395 | https://bio-protocol.org/exchange/protocoldetail?id=2395&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Plasmodium Sporozoite Motility on Flat Substrates
HP Henriette L Prinz
JS Julia M Sattler
FF Friedrich Frischknecht
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2395 Views: 8524
Edited by: Alka Mehra
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Plasmodium sporozoites are the infectious, highly motile forms of the malaria parasite transmitted by Anopheles mosquitoes. Sporozoite motility can be assessed following the dissection of Anopheles salivary glands and isolation of sporozoites in vitro.
Keywords: Plasmodium Plasmodium berghei Sporozoites Salivary gland isolation Dissection Gliding motility Malaria Mosquitoes Anopheles
Background
Sporozoites of the phylum Plasmodium, the causative agent of malaria, are transmitted into the skin of their vertebrate host through the bite of an infectious mosquito. Sporozoite motility is a key prerequisite for parasite transmission and successful infection of the vertebrate host. Motility constitutes the first parasite mechanism that can be inhibited and is thus of interest for intervention strategies. Genetic modifications affecting gliding motility or motility modulating compounds can be readily investigated using 2D in vitro assays.
Part I: Isolation of salivary gland sporozoites
Materials and Reagents
15 ml conical centrifugation tube
Two 10 ml Petri dishes
Two 27 G needles
Two 1 ml syringes
Glass slide
1.5 ml plastic reaction tube
Disposable polypropylene pestles (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F19923-0001 )
Mosquitoes
Ice
RPMI (Thermo Fisher Scientific, GibcoTM, catalog number: 11835063 )
70% ethanol
1x PBS (Thermo Fisher Scientific, GibcoTM, catalog number: 18912014 )
Bovine serum albumin (BSA) (Carl Roth, catalog number: 8076 )
BSA/RPMI 3% (see Recipes)
Equipment
Vacuum pump
Styrofoam box
Forceps
Micropipette with disposable tips
Binocular microscope (ZEISS, model: Stemi 305 or a comparable binocular microscope from any other manufacturer e.g., Nikon, Olympus, Leica)
Light microscope with phase contrast 40x objective (ZEISS, model: Axio Lab.A1 or a similar device from any other manufacturer e.g., Nikon, Olympus, Leica)
Hemocytometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Prinz, H. L., Sattler, J. M. and Frischknecht, F. (2017). Plasmodium Sporozoite Motility on Flat Substrates. Bio-protocol 7(14): e2395. DOI: 10.21769/BioProtoc.2395.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell imaging
Cell Biology > Cell movement > Cell motility
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,396 | https://bio-protocol.org/exchange/protocoldetail?id=2396&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Gene Dosage Experiments in Enterobacteriaceae Using Arabinose-regulated Promoters
SB Sanchari Bhattacharyya
SB Shimon Bershtein
ES Eugene I Shakhnovich
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2396 Views: 6973
Reviewed by: Yoko Eguchi
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
This protocol is used to assay the effect of protein over-expression on fitness of E. coli. It is based on a plasmid expression of a protein of interest from an arabinose-regulated pBAD promoter followed by the measurement of the intracellular protein abundance by Western blot along with the measurement of growth parameters of E. coli cell expressing this protein.
Keywords: Gene-dosage toxicity Arabinose Protein abundance Western-blot Fitness Over-expression Plasmid
Background
Gene dosage experiments are crucial for understanding the effects of protein over-expression on fitness and determining the optimal levels of protein abundance. Several genes are toxic even when expressed at very low levels. It is therefore important to express the protein from a tightly regulated promoter to minimize leaky expression. Here we have elucidated conditions for expression of proteins under the well-characterized arabinose induced pBAD promoter, and designed protocols to measure the intracellular abundance and fitness of E. coli cells harboring the overexpression plasmid.
Materials and Reagents
Sterile tips
1.5 ml microfuge tubes (Corning, Axygen®, catalog number: MCT-175-C )
14 ml polypropylene tubes for bacterial culture (Corning, Falcon®, catalog number: 352059 )
50 ml tubes for bacterial culture (Corning, Falcon®, catalog number: 352070 )
Sterile needle for inoculation (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 253988 )
Honeycomb plates (Bioscreen, catalog number: 95025BIO )
Gene of interest cloned in pBAD/MCS-vector (https://www.embl.de/pepcore/pepcore_services/strains_vectors/vectors/bacterial_expression_vectors/popup_bacterial_expression_vectors/ obtained from European Molecular Biology Laboratory EMBL) using appropriate restriction sites in the multiple cloning site
E. coli BW27783 cells (CGSC, catalog number: 12119 )
LB/Agar plates
Ampicillin (Sigma-Aldrich, catalog number: A0166 )
Sodium phosphate buffer, pH 7.4
Tris-HCl pH 8.0
Pierce BCA protein assay kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23227 )
4x protein gel loading dye (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0007 )
Pre-cast 12% Bis-Tris SDS polyacrylamide gel (Bio-Rad Laboratories, catalog number: 3450123 )
Trans-blot Turbo midi nitrocellulose transfer packs (Bio-Rad Laboratories, catalog number: 1704158 )
Antibody raised against the protein of interest
Western-breeze Chromogenic Immunodetection kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: WB7105 for anti-rabbit)
M9 salts (BD, DifcoTM, catalog number: 248510 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: 230391 )
Thiamine (Sigma-Aldrich, catalog number: T1270 )
Casamino acid (AMRESCO, catalog number: J851 )
Glucose (Sigma-Aldrich, catalog number: G7021 )
L(+) arabinose (EMD Millipore, catalog number: 178680 )
10x Bugbuster reagent (Novagen, catalog number: 70921-3 )
Benzonase nuclease (EMD Millipore, catalog number: 70664 )
Supplemented M9 medium (see Recipes)
Lysis buffer (see Recipes)
L(+) arabinose solution (Concentrations used) (see Recipes)
Equipment
Pipettes
Incubator
Heated Orbital shaker
Centrifuge (Eppendorf, models: 5810 R and 5417 R )
Spectrophotometer (BioTek Instruments, model: PowerWave HT )
Rotator-mixer
Trans-Blot Turbo transfer system (Bio-Rad Laboratories, catalog number: 1704155 )
Bioscreen C (Growth Curves USA)
Software
ImageJ software
Procedure
For abundance measurement
Transform pBAD plasmid containing the gene of interest in to electro-competent BW27783 cells (see Notes, point #1), and spread on LB/Agar plates containing 100 µg/ml ampicillin. Incubate plates overnight at 37 °C.
Next day, pick a single colony from the plate and inoculate into 2 ml of supplemented M9 medium (see Recipes and Notes, point #2) containing 100 µg/ml of ampicillin. Grow overnight with shaking (250 rpm) at 37 °C in 14 ml polypropylene tubes.
Next day, dilute 500 µl of the overnight culture 1/100 in to 50 ml of fresh M9 medium containing 100 µg/ml of ampicillin and varying concentrations of arabinose (0-0.05%) (see Recipes), and grow for 4 h with shaking (250 rpm) at 37 °C.
After 4 h, measure OD600 of the cultures, and spin down in a table-top centrifuge at 3,000 x g for 15 min. Aspirate as much culture supernatant as possible. Store the cell pellets at -20 °C.
Prepare the lysis buffer, which is the buffer of choice (50 mM sodium phosphate buffer, pH 7.4, 10 mM Tris-HCl pH 8.0, etc.) supplemented with the detergent Bugbuster and Benzonase nuclease (see Recipes below). Based on the measured OD600 of the cultures, re-suspend the pellets in the prepared lysis buffer such that the final OD600 is 2.0 (see Notes, point #3). Allow the lysis to proceed for 20 min at room temperature on a rotator-mixer.
Following lysis, spin down the cell debris for 30 min at 7500 x g in a centrifuge that has been pre-chilled at 4 °C.
Separate the supernatant and quantify the total protein in each sample using the BCA assay kit using the manufacturer’s instructions.
Load 20 µl of the supernatants on a 12% Bis-Tris SDS polyacrylamide gel, after required dilution of the samples (see Notes, point #4).
Resolve the samples at a voltage gradient of 10 V/cm of gel.
Once the dye front has reached the base, the gel is ready to be transferred to a membrane for blotting. Use pre-assembled nitrocellulose membrane sandwiches (see Notes, point #5).
Following transfer, wash the membrane with water two times to remove transfer buffer components and weakly bound proteins. From this step onwards, use Invitrogen’s Western-breeze Chromogenic Immunodetection kit to develop the membrane.
For growth rate measurement
From step A2 above, dilute the overnight culture to a final OD600 of 0.01 (see Notes, point #3) into fresh M9 medium containing 100 µg/ml of ampicillin and varying concentrations of arabinose (see Recipes). Aliquot 150 µl of this into three wells of the honeycomb Bioscreen plate (see Notes, point #6). This serves as replicates for a single colony. To obtain standard error of biological replicates, inoculate 3 independent colonies, and subject each of them to varying arabinose concentration.
Aliquot 150 µl M9 medium into three independent wells. This serves as the background for OD measurements.
Measure OD600 values at 15 min intervals over a period of 12 h in Bioscreen C system at 37 °C with shaking (see Notes, point #6).
Data analysis
Use ImageJ software to evaluate the band intensities from the Western blot (For a complete tutorial, please visit ‘https://imagej.nih.gov/ij/docs/guide/146-30.html#toc-Subsection-30.13’).
Normalize the intensity by the total protein concentration obtained by BCA assay, and also scale up the values by the dilution factor. If the protein of interest is an endogenous E. coli protein, then calculate the fold-overexpression of the protein of interest based on the intensity obtained for untransformed BW27783 cells (set to 1). For a foreign protein, the expression level obtained with 0% arabinose should be set to 1.
Fit the growth curves obtained from Bioscreen C as OD vs. time (t) using the following 4-parameter Gompertz equation to obtain growth rate parameters (Adkar et al., 2017).
Where, K is the fold-increase over initial population at saturation, b is the shape factor and defined as b = ln(K)/(μ·exp(1)) where μ is the maximum growth rate, and the lag time λ is the time taken to achieve the maximum growth rate.
Make a plot of gene-dosage effect using measured growth rates and intracellular protein abundance (Figure 1) (see Notes, point #7).
Figure 1. Representative gene-dosage toxicity curves for E. coli Dihydrofolate Reductase (DHFR) expressed from pBAD-plasmid (Bhattacharyya et al., 2016). A. Plot of relative growth rate as a function of arabinose concentration; B. Plot of relative growth rate as a function of intracellular abundance of DHFR protein.
Notes
The transporter araE in E. coli helps in uptake of arabinose from the medium. However, as the expression of araE is all or none in WT E. coli cells (e.g., MG1655), induction with arabinose results in a heterogeneous population. BW27783 that is used in this protocol is a strain of E. coli MG1655 that has been engineered to constitutively express araE, resulting in a uniform and homogeneous uptake of arabinose (Khlebnikov et al., 2001).
The gene-dosage experiments can be done in any medium of choice (LB, M9, etc.). However over-expression of the protein of interest may show different phenotypes in different media conditions. For example as discussed in (Bhattacharyya et al., 2016), over-expression of E. coli Dihydrofolate Reductase (DHFR) was found to be toxic in supplemented M9 medium, but not in LB medium. We therefore suggest choosing the growth medium which allows the study of the phenotype of interest.
OD600 is defined for 1 cm path-length.
The typical amount of total protein from cell lysate loaded on to the gel was 5 μg. However, for higher levels of induction, dilution will be necessary. We therefore suggest doing a pilot experiment to find the necessary dilution.
Instead of pre-assembled nitrocellulose membrane sandwiches, one can prepare their own using pre-cut nitrocellulose membranes, blotting papers, and tris-glycine-methanol transfer buffer to perform this step successfully.
Bioscreen C is an absorbance based microplate reader that is used to measure growth curves of microorganisms (http://www.growthcurvesusa.com/description.html). As opposed to a conventional microplate reader, which can measure 96 wells at a time, honeycomb plates used in Bioscreen C have 100 wells, and two plates can be used at a time. The design of the honey comb plate ensures uniform temperature across the wells without any significant condensation/evaporation, thereby greatly reducing errors among replicates. However, it should be mentioned that in absence of Bioscreen C instrument, any conventional microplate reader or spectrophotometer with cuvette can also be used to perform this step successfully.
If it is desirable to find out the absolute amount of protein required to achieve a particular growth inhibition, it can be done by purifying the protein of interest, estimating its concentration and then using a known amount of the purified protein as a standard/reference to estimate the amount of protein from the crude lysate at each given induction level.
Recipes
Supplemented M9 medium (1 L)
11.28 g of M9 salts (Difco) (identical to the classical M9 salts recipe in Molecular Cloning by Maniatis)
1 ml 1 M MgSO4
5 µl 100 mM thiamine
10 ml 10% casamino acid
10 ml 20% glucose
Make up the volume to 1,000 ml, sterilize by filtration
Lysis buffer (10 ml)
1 ml 10x Bugbuster reagent
10 µl Benzonase nuclease
Make up the volume to 10 ml using buffer of choice
L(+) arabinose solution (concentrations used)
Start with 0.05%, and then do 4-fold serial dilution up to 1.22 x 10-5%, in addition to 0% arabinose
Acknowledgments
This work was funded by NIH RO1 GM111955.
References
Adkar, B. V., Manhart, M., Bhattacharyya, S., Tian, J., Musharbash, M. and Shakhnovich, E. I. (2017). Optimization of lag phase shapes the evolution of a bacterial enzyme. Nature Ecology & Evolution 1: 0149.
Bhattacharyya, S., Bershtein, S., Yan, J., Argun, T., Gilson, A. I., Trauger, S. A. and Shakhnovich, E. I. (2016). Transient protein-protein interactions perturb E. coli metabolome and cause gene dosage toxicity. Elife 5.
Khlebnikov, A., Datsenko, K. A., Skaug, T., Wanner, B. L. and Keasling, J. D. (2001). Homogeneous expression of the P(BAD) promoter in Escherichia coli by constitutive expression of the low-affinity high-capacity AraE transporter. Microbiology 147(Pt 12): 3241-3247.
Copyright: Bhattacharyya et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Bhattacharyya, S., Bershtein, S. and Shakhnovich, E. I. (2017). Gene Dosage Experiments in Enterobacteriaceae Using Arabinose-regulated Promoters. Bio-protocol 7(14): e2396. DOI: 10.21769/BioProtoc.2396.
Bhattacharyya, S., Bershtein, S., Yan, J., Argun, T., Gilson, A. I., Trauger, S. A. and Shakhnovich, E. I. (2016). Transient protein-protein interactions perturb E. coli metabolome and cause gene dosage toxicity. Elife 5.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Gene expression
Molecular Biology > DNA > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,397 | https://bio-protocol.org/exchange/protocoldetail?id=2397&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Type-specific Metabolic Labeling of Proteins with Azidonorleucine in Drosophila
IE Ines Erdmann
KM Kathrin Marter
OK Oliver Kobler
SN Sven Niehues
JB Julia Bussmann
AM Anke Müller
JA Julia Abele
ES Erik Storkebaum
UT Ulrich Thomas
Daniela C. Dieterich
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2397 Views: 7535
Edited by: Jyotiska Chaudhuri
Reviewed by: Manish ChamoliRosario Gomez-Garcia
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Advanced mass spectrometry technology has pushed proteomic analyses to the forefront of biological and biomedical research. Limitations of proteomic approaches now often remain with sample preparations rather than with the sensitivity of protein detection. However, deciphering proteomes and their context-dependent dynamics in subgroups of tissue-embedded cells still poses a challenge, which we meet with a detailed version of our recently established protocol for cell-selective and temporally controllable metabolic labeling of proteins in Drosophila. This method is based on targeted expression of a mutated variant of methionyl-tRNA-synthetase, MetRSL262G, which allows for charging methionine tRNAs with the non-canonical amino acid azidonorleucine (ANL) and, thus, for detectable ANL incorporation into nascent polypeptide chains.
Keywords: Metabolic labeling Click chemistry Drosophila melanogaster Proteomic profiling Protein synthesis
Background
The protein composition of any given cell is intimately linked to its state of differentiation and functionality. Changes in a cell’s proteome may reflect its response to cell-intrinsic cues or to signals originating from elsewhere inside the respective organism or its environment. In turn they are indicative of the significance of those signaling cues. Deciphering proteomes and their dynamics in a cell type-specific fashion has thus become a main focus in current research, reaching a better understanding of molecular events underlying physiological or pathophysiological processes. Any proteomic approach in this direction, however, is challenged by the heterogeneity of cell types that are interconnected within a tissue or organ of interest. In the brain, for instance, different types of neurons and glial cells form the networks required to control animal or human behavior. Moreover, it is well established that information processing within these networks leading to long-term memory is strictly dependent on de novo protein synthesis and degradation. While this has been exemplified for a number of neuronal proteins (e.g., immediate early gene proteins), it is obvious that proteins that are up- or down-regulated in just a limited number of cells (or even are regulated oppositely in different groups of cells) may easily escape conventional modes of detection, where cellular proteomes are averaged across entire brain areas.
A number of labeling methods for cellular proteomes have been published in the last two decades, e.g., using isotope-coded affinity tags (Gygi et al., 1999) or isobaric tags for relative and absolute quantification (Ross et al., 2004), quantitative proteomic analysis using samples from cells grown in 14N or 15N media (Washburn et al., 2002; MacCoss et al., 2003), and stable isotope labeling by amino acids in cell culture (Ong et al., 2002; Andersen et al., 2005). Moreover puromycin (Schmidt et al., 2009) and non-canonical amino acids, e.g., azidohomoalanine (AHA) or homopropargylglycine, in combination with click chemistry have been used to decipher cellular proteomes (Link et al., 2003; Link and Tirrell, 2003; Beatty et al., 2006; Dieterich et al., 2006; Link et al., 2006; Dieterich et al., 2010). All of these strategies, however, fail to uncover cell-type specific proteomes within tissue or organ samples. Most recently, novel strategies to resolve this issue have been reported for C. elegans and Drosophila (Elliott et al., 2014; Erdmann et al., 2015; Yuet et al., 2015). They have in common the use of either a mutated aminoacyl-tRNA synthetase or an orthogonal aminoacyl-tRNA synthetase/tRNA for tagging of newly synthesized proteins with food-supplied non-canonical amino acids. Specifically, we could show that upon cell type-specific expression of a mutant Methionyl-tRNA synthetase (MetRSL262G) as achieved by employing the well-established Gal4/UAS-system, the non-canonical amino acid ANL can be incorporated into proteins of selectable cell types in living Drosophila larvae and adult flies. An accompanying study by Niehues et al. (2015) used this method to show the causal involvement of mutated glycyl-tRNA synthetase in a model for the neurodegenerative Charcot Marie Tooth disease.
ANL-containing proteins can either be analyzed in protein extracts by using biochemistry and mass spectrometry or can be visualized in situ by fluorescence microscopy (Erdmann et al., 2015; Niehues et al., 2015). For more information see ‘Click Chemistry (CuAAC) and detection of tagged de novo synthesized proteins’. The following protocol details the metabolic labeling of proteins in larvae and adult flies with ANL.
Materials and Reagents
Fly vials (e.g., VWR, catalog number: 734-2254 )
Fly vial plugs (e.g., Carl Roth, catalog number: PK13.1 )
Gal4 activator strains of choice (e.g., C57-Gal4 for muscle-specific expression [from Ulrich Thomas, Magdeburg, Germany], elavC155-Gal4 for pan-neuronal expression [from Bloomington stock center, Bloomington, Indiana, USA], repo-Gal4 for glial expression [from Christian Klämbt, Münster, Germany])
UAS-dMetRSL262G effector strains [available at request from Daniela C. Dieterich & Ulrich Thomas]. As described in Erdmann et al. (2015) various lines expressing dMetRSL262G either tagged with 3xmyc or EGFP are available
Note: We traditionally use ONM. The standard corn meal medium has also been successfully used in Niehues et al. (2015) for ANL labeling, thus, we anticipate that other media can be used as well without any limitations.
Otto-normal-medium (ONM, see Recipes)
Agar-Agar (Carl Roth, catalog number: 5210 )
Semolina (local food store)
Mashed raisins (local food store)
Baker’s yeast (local food store)
Sugar beet sirup (local food store)
Honey (local food store)
Tap water
20% (w/v) Nipagin (see Recipes)
Methyl-4-hydroxybenzoate (Merck, catalog number: 106757 )
Propyl-4-hydroxybenzoate (Merck, catalog number: 107427 )
100 % ethanol (Th. Geyer, catalog number: 2246 )
200 mM ANL stock solution (for the synthesis of ANL see [Link et al., 2007; Ngo et al., 2009; Erdmann et al., 2015]) (see Recipes)
Equipment
Beaker (kitchen/household grade)
Immersion blender (kitchen/household grade)
Paintbrush (art supplies)
Fly incubator (e.g., SANYO, model: MIR-553 )
Hotplate (kitchen/household grade)
Pot (kitchen/household grade)
Tablespoon (kitchen/household grade)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Erdmann, I., Marter, K., Kobler, O., Niehues, S., Bussmann, J., Müller, A., Abele, J., Storkebaum, E., Thomas, U. and Dieterich, D. C. (2017). Cell Type-specific Metabolic Labeling of Proteins with Azidonorleucine in Drosophila. Bio-protocol 7(14): e2397. DOI: 10.21769/BioProtoc.2397.
Download Citation in RIS Format
Category
Biochemistry > Protein > Labeling
Systems Biology > Proteomics > Whole organism
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,398 | https://bio-protocol.org/exchange/protocoldetail?id=2398&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mapping RNA Sequences that Contact Viral Capsid Proteins in Virions
C. Cheng Kao
EC Ella Chuang
JF James Ford
JH Jie Huang
RP Ram Podicheti
DR Doug B. Rusch
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2398 Views: 7696
Edited by: Longping Victor Tse
Reviewed by: Weiyan Jia
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
We have adapted the methodology of CLIP-seq (Crosslinking-Immunoprecipitation and DNA Sequencing) to map the segments of encapsidated RNAs that contact the protein shells of virions. Results from the protocol report on the RNA sequences that contact the viral capsid.
Keywords: Protein-RNA interaction RNA virus Viral capsid Virion assembly CLIP-Seq
Background
Positive-sense RNA viruses include pathogens of all life forms. Viruses with icosahedral shapes have the viral coat proteins form a protective shell around the RNA genome (Stockley et al., 2013). In the phage MS2 and the plant-infecting Brome mosaic virus (BMV), the coat protein preferentially contacts specific RNA sequences (Ni et al., 2013; Hoover et al., 2016; Rolfsson et al., 2016). These contacts could regulate the timing of RNA release during infection, viral gene expression, and viral RNA replication (Hoover et al., 2016). Identification of the capsid-RNA interactions could thus provide insights into the regulations of viral infection and provide means to inhibit viral infection. With this in mind, we have developed a method to identify the capsid-RNA contacts in purified virions using a combination of UV crosslinking, RNA fragmentation, selective precipitation of the coat protein, and next-generation sequencing of the cDNAs made from RNA fragments. The protocol below was developed for BMV virions.
Materials and Reagents
Note: All solutions should be made using sterile water with resistivity of better than 18.3 MΩ and analytical grade reagents.
Pipette tips (Corning, catalog number: 4154 )
6-well clear polystyrene flat-bottomed tissue culture plate (Corning, Falcon®, catalog number: 351146 )
Polyallomer centrifuge tubes (Beckman Coulter, catalog number: 344060 )
Polypropylene microcentrifuge tubes and tips that are certified to be Ribonuclease free
iBlotTM PVDF membrane (0.2 μm) (Thermo Fisher Scientific, InvitrogenTM, catalog number: IB401001 )
Razor blade (GEM, catalog number: RB-GEM-080014 )
0.22 μm filter (EMD Millipore, catalog number: SCGPU05RE )
Zymo RNA Clean & Concentrator (ZYMO RESEARCH, catalog number: R1015 )
BMV virions purified using cesium chloride density gradients and suspended in SAMA buffer
Note: High purity BMV virions can be obtained as described in Vaughan et al. (2014). The virions are kept in an acidic buffer because pH affects the swelling of the BMV virions and can change the CP-RNA interaction.
10x Fragmentation Reagent and Stop Solution: 200 mM EDTA (pH 8.0) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM8740 )
PierceTM Protein A/G magnetic beads (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88847 )
Anti-BMV CP antibody
Note: This is a polyclonal antiserum we generated in rabbits immunized with highly purified BMV capsid protein.
NuPAGE® Novex® 4-12% Bis-Tris Gel, NuPAGE® MES-SDS running buffer (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0321BOX )
1x MES SDS running buffer
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
0.1% Ponceau-S (Sigma-Aldrich, catalog number: P3504 )
Protease K (Fungal) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 25530015 )
T4 Polynucleotide Kinase (New England Biolabs, catalog number: M0201L )
Small RNA kit (Illumina, catalog number: RS-200-0036 )
1.8x SPRI beads (Beckman Coulter, catalog number: 41105518 )
SPRIselect reagent (Beckman Coulter, catalog number: B23317 )
Sodium hydroxide (NaOH) (Avantor Performance Materials, Macron, catalog number: 7680 )
HT1 buffer (Component of the NexSeq 500 kit) (Illumina, catalog number: FC-404-2005 )
Sodium acetate, Na(OAc) (EMD Millipore, catalog number: 106268 )
Magnesium acetate tetrahydrate, Mg(OAc)2·4H2O (Sigma-Aldrich, catalog number: M0631 )
Glacial acetic acid (EMD Millipore, catalog number: AX0073-9 )
Ethanol, absolute (Decon Labs, catalog number: 2716 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Tris base (Sigma-Aldrich, catalog number: T6066 )
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
Sodium dodecyl sulfate, sodium salt (SDS) (EMD Millipore, catalog number: 7910-OP )
Glycerol (VWR, BDH®, catalog number: BDH1172 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Ethylenediaminetetraacetic acid (EDTA) (Fisher Scientific, catalog number: BP120 )
SAMA buffer (see Recipes)
3 M sodium acetate (pH 5.2) (see Recipes)
IP binding buffer (see Recipes)
IP wash buffer (see Recipes)
4x Laemmli sample buffer (see Recipes)
PK buffer (see Recipes)
Equipment
Ultraviolet Cross-linker (UVP, model: CL-1000 , catalog number: 95-0174-01)
Beckman Coulter Ultima Max-XP ultracentrifuge (Beckman Coulter, model: OptimaTM Max-XP , catalog number: 393315)
DynaMag-2 (Thermo Fisher Scientific, catalog number: 12321D )
SureLock X Mini-gel electrophoresis system (Thermo Fisher Scientific, InvitrogenTM, catalog number: El0001 )
iBlot® Dry Blotting System (Thermo Fisher Scientific, model: iBlotTM 2, catalog number: IB21001 )
Agilent 2200 Tape station (Agilent Technology, model: Agilent 2200 )
Miseq or NexSeq500 (Illumina, model: NexSeqTM 500 )
Software
Mapping program: bowtie2 ver. 2.2.6
Graphing program: JBrowse ver. 1.12.1
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kao, C. C., Chuang, E., Ford, J., Huang, J., Podicheti, R. and Rusch, D. B. (2017). Mapping RNA Sequences that Contact Viral Capsid Proteins in Virions. Bio-protocol 7(14): e2398. DOI: 10.21769/BioProtoc.2398.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > RNA
Microbiology > Microbial biochemistry > Protein
Biochemistry > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,399 | https://bio-protocol.org/exchange/protocoldetail?id=2399&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Separation of Plant 6-Phosphogluconate Dehydrogenase (6PGDH) Isoforms by Non-denaturing Gel Electrophoresis
Francisco J Corpas
LF Larisse de Freitas-Silva
NG Nuria García-Carbonero
AC Alba Contreras
FT Fátima Terán
CR Carmelo Ruíz-Torres
José M. Palma
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2399 Views: 8486
Reviewed by: Amit Dey
Original Research Article:
The authors used this protocol in Feb 2009
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2009
Abstract
6-Phosphogluconate dehydrogenase (6PGDH; EC 1.1.1.44) catalyzes the third and irreversible reaction of the pentose phosphate pathway (PPP). It carries out the oxidative decarboxylation of the 6-phosphogluconate to yield ribulose-5-phosphate, carbon dioxide and NADPH. In higher plants, 6PGDH has several subcellular localizations including cytosol, chloroplast, mitochondria and peroxisomes (Corpas et al., 1998; Krepinsky et al., 2001; Mateos et al., 2009; Fernández-Fernández and Corpas, 2016; Hölscher et al., 2016). Using Arabidopsis thaliana as plant model and sweet pepper (Capsicum annuum L.) fruits as a plant with agronomical interest, this protocol illustrates how to prepare the plant extracts for the separation of the potential 6PGDH isoforms by electrophoresis on 6% polyacrylamide non-denaturing gels. Thus, this method allows detecting three 6PGDH isoforms in Arabidopsis seedlings and two 6PGDH isoforms in sweet pepper fruits.
Keywords: NADPH Non-denaturing polyacrylamide gel electrophoresis Pentose phosphate pathway 6-Phosphogluconate dehydrogenase
Background
Non-denaturing gel electrophoresis is a powerful technique that allows separating native proteins. Their mobility depends of protein size, shape and net charge. In these analytical conditions, the protein preserves its activity and in combination with a specific staining method, it allows to separate the presence of potential isoforms. This approach has been widely used in the case of the family of superoxide dismutases. However, to our knowledge, there are not many papers that analyze the presence of different isoforms of 6PGDH activity in plant tissues (Corpas et al., 1998; Mateos et al., 2009). This straight method may be very useful for researchers working with plant 6PGDHs.
Materials and Reagents
10-cm-diameter Petri dishes
Arabidopsis thaliana ecotype Columbia seeds (originally obtained from NASC, Nottingham Arabidopsis Stock Center)
Sweet green pepper fruits were provided by Syngenta Seeds S.A. (El Ejido, Spain)
70% (v/v) ethanol
0.1% (w/v) SDS
Commercial Bleach
Murashige and Skoog medium (Sigma-Aldrich, catalog number: M5524 )
Phyto-agar (Duchefa Biochemie, catalog number: P1001 )
Sucrose (Sigma-Aldrich, catalog number: 84097 )
Bio-Rad Protein Assay (Bio-Rad Laboratories, catalog number: 5000006 )
Bovine serum albumin (BSA) Fraction V (Roche Diagnostics, catalog number: 10735078001 )
Tris (AMRESCO, catalog number: 0497 )
Ethylenediaminetetraacetic acid, disodium salt, dihydrate (Na2-EDTA) (Sigma-Aldrich, catalog number: E5134 )
Triton X-100 (AMRESCO, catalog number: 0694 )
Glycerol (AMRESCO, catalog number: E520 )
Dithiothreitol (DTT) (Roche Diagnostics, catalog number: 10708984001 )
30% acrylamide/Bis solution, 19:1 (Bio-Rad Laboratories, catalog number: 1610154 )
4x gel buffer
Glycine (AMRESCO, catalog number: 0167 )
Ammonium persulfate
TEMED
β-Nicotinamide adenine dinucleotide phosphate, sodium salt, hydrate (NADP) (Sigma-Aldrich, catalog number: N0505 )
Magnesium chloride, hexahydrate (MgCl2·7H2O) (EMD Millipore, catalog number: 442615 )
Nitroblue tetrazolium (NBT) (AMRESCO, catalog number: 0329-1G )
Phenazine methosulfate (PMS) (Sigma-Aldrich, catalog number: P9625 )
6-Phosphogluconic acid, trisodium salt (6PG) (Sigma-Aldrich, catalog number: P7877 )
Glacial acetic acid (Fisher Scientific)
Grinding buffer (see Recipes)
Non-denaturing polyacrylamide gel electrophoresis (PAGE) on 6% acrylamide gel (see Recipes)
Staining solution (see Recipes)
Stop solution (see Recipes)
Equipment
Plant Growth cabinet (Panasonic Biomedical, model: MLR-352-PE )
Porcelain mortar and pestle
Refrigerated centrifuge
Vertical Slab gels Electrophoresis System (Bio-Rad Laboratories, model: Mini-PROTEAN® Electrophoresis Cell )
Software
ImageJ program (https://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Corpas, F. J., de Freitas-Silva, L., García-Carbonero, N., Contreras, A., Terán, F., Ruíz-Torres, C. and Palma, J. M. (2017). Separation of Plant 6-Phosphogluconate Dehydrogenase (6PGDH) Isoforms by Non-denaturing Gel Electrophoresis. Bio-protocol 7(14): e2399. DOI: 10.21769/BioProtoc.2399.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant physiology > Metabolism
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
24 | https://bio-protocol.org/exchange/protocoldetail?id=24&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A General EMSA (Gel-shift) Protocol
RC Ran Chen
Published: Feb 5, 2011
DOI: 10.21769/BioProtoc.24 Views: 62779
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
An electrophoretic mobility shift assay (EMSA), also referred to as mobility shift electrophoresis, a gel shift assay, gel mobility shift assay, band shift assay, or gel retardation assay, is a common technique used to study protein-DNA or protein-RNA interactions. The control lane (the DNA/RNA probe without protein present) will contain a single band corresponding to the unbound DNA or RNA fragment. If the protein is capable of binding to the fragment, the lane with protein present will contain another band that represents the larger, less mobile complex of nucleic acid probe bound to the protein, which is 'shifted' up on the gel (since it has moved more slowly). Here, a protocol to carry out an EMSA assay is described.
Keywords: EMSA Gel-shift Binding
Materials and Reagents
DTT (Promega Corporation, catalog number: V3151 )
Poly-dIdC (Sigma-Aldrich, catalog number: P4929-10UN )
32P-labeled probe
Note: Oligo DNA probe can be synthesized ordered from IDT, a DNA synthesis company, then labeled by yourself.
BSA (Sigma-Aldrich, catalog number: 05470-5G )
General chemicals (Sigma-Aldrich)
5x binding buffer (see Recipes)
10x TBE buffer (see Recipes)
Equipment
Plates
Spacers
Clamps
Saran wrap
Whatman paper (GE Healthcare)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, R. (2011). A General EMSA (Gel-shift) Protocol. Bio-101: e24. DOI: 10.21769/BioProtoc.24.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA-protein interaction
Biochemistry > Protein > Interaction > EMSA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
240 | https://bio-protocol.org/exchange/protocoldetail?id=240&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Primer Extension Analysis Using AMV Reverse Transcriptase
Harald Putzer
Published: Vol 2, Iss 14, Jul 20, 2012
DOI: 10.21769/BioProtoc.240 Views: 10237
Original Research Article:
The authors used this protocol in Dec 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2011
Abstract
Primer extension analysis is a useful method to determine the transcription start point or a processing site on an RNA molecule. It can also allow a quantitative measurement of an RNA species.
Keywords: 5' end mapping Reverse Transcription Primer extension
Materials and Reagents
AMV reverse transcriptase from the avian myeloblastosis virus (Finnzyme, catalog number: F570 ) (other reverse transcriptases can also be used, by adapting the reaction buffer)
T4 polynucleotide kinase + 10x reaction buffer (Biolabs, catalog number: M0201 )
RNasin Plus RNase inhibitor (Promega Corporation, catalog number: N2611 )
Glycogen (Acros organics, catalog number: 422950010 )
NaCl
Tris-HCl (pH 7.5)
EDTA
MgCl2
EtOH
dATP,dCTP,dGTP,dTTP (Promega Corporation, catalog number: U120D , U121D , U122D , U123D )
γ-32P ATP (3,000 Ci/mmole, 10 μCi/μl) (PerkinElmer, catalog number: BLU502A )
DTT (Promega Corporation, catalog number: P117B )
5x ss-Hybridization buffer (see Recipes)
1.25x RT buffer (see Recipes)
Equipment
Incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Putzer, H. (2012). Primer Extension Analysis Using AMV Reverse Transcriptase. Bio-protocol 2(14): e240. DOI: 10.21769/BioProtoc.240.
Download Citation in RIS Format
Category
Molecular Biology > RNA > Transcription
Molecular Biology > RNA > qRT-PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
what is the template need to be used in this protocla and alse the primer used?
1 Answer
4 Views
Oct 3, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,400 | https://bio-protocol.org/exchange/protocoldetail?id=2400&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Aldicarb-induced Paralysis Assay to Determine Defects in Synaptic Transmission in Caenorhabditis elegans
Kelly H. Oh
HK Hongkyun Kim
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2400 Views: 8882
Edited by: Neelanjan Bose
Reviewed by: LU HANManish Chamoli
Original Research Article:
The authors used this protocol in 14-Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
14-Feb 2017
Abstract
Aldicarb treatment causes an accumulation of acetylcholine in the synaptic cleft of the neuromuscular junction, resulting in sustained muscle activation and eventually paralysis. Aldicarb-induced paralysis assay is an easy and fast method to determine whether synaptic transmission of a C. elegans mutant of interest is altered. This assay is based on the correlation of the rate of neurotransmitter release with the rate of paralysis. In this protocol, we describe a method for simultaneously assessing the aldicarb sensitivity of animals with different genotypes.
Keywords: Aldicarb C. elegans Acetylcholinesterase Synaptic transmission
Background
Synaptic transmission is initiated by arrival of action potential at presynaptic terminals, which in turn results in the release of neurotransmitters. The released neurotransmitters bind to and activate postsynaptic receptors (Sudhof, 2013). C. elegans locomotion is controlled by acetylcholine-releasing excitatory motor neurons and GABA (γ-aminobutyric acid)-releasing-inhibitory motor neurons (Richmond and Jorgensen, 1999; Zhen and Samuel, 2015). Acetylcholine released from cholinergic motor neurons activates acetylcholine receptors on the muscle membrane, leading to muscle excitation and contraction. Acetylcholinesterase breaks down acetylcholine in the synaptic cleft and thus terminates neurotransmission. Aldicarb is an acetylcholinesterase inhibitor. In the presence of aldicarb, acetylcholine continues to accumulate, causing persistent muscle contraction and eventual paralysis. Mutant animals with decreased levels of synaptic transmission are resistant to the paralyzing effect of aldicarb because acetylcholine more slowly accumulates in the synaptic cleft of these animals than that of wild type animals. Conversely, mutant animals with increased levels of synaptic transmission, and as a result, a faster accumulation of acetylcholine, are more sensitive to the paralyzing effect of aldicarb than wild-type animals (Rand, 2007). Thus, by comparing the time-course of aldicarb-induced paralysis, it is possible to infer the relative efficiency of synaptic transmission. However, it is necessary to note that this assay does not necessarily demonstrate that abnormal aldicarb sensitivity is a result of a presynaptic defect. For example, a defect in post-synaptic acetylcholine receptor function may also result in resistance to aldicarb (Loria et al., 2004). Thus, the aldicarb-induced paralysis assay should be considered as the first step in investigating the involvement of synaptic transmission, and further corroborated by other means, such as electrophysiological analysis (Richmond, 2006).
Materials and Reagents
60 mm Petri dish (Genesee Scientific, catalog number: 32-105G )
90% platinum, 10% iridium wire (Tritech Research, catalog number: PT-9010 )
Copper rings (PlumbMaster, catalog number: 17668 )
E. coli OP50 (University of Minnesota, Caenorhabditis Genetic Center)
Aldicarb (ChemService, catalog number: N-11044 )
Ethanol (Ethyl alcohol, 190 proof, ACS-USP grade) (PHARMCO-AAPER, catalog number: 111000190 )
Cholesterol (Sigma-Aldrich, catalog number: C3045 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C3306 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Potassium phosphate, monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5379 )
Potassium phosphate, dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P8281 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Bacto-agar (BD, BactoTM, catalog number: 214040 )
Bacto-peptone (BD, BactoTM, catalog number: 211820 )
100 mM aldicarb stock solution (see Recipes)
5 mg/ml cholesterol (see Recipes)
1 M CaCl2 stock solution (see Recipes)
1 M MgSO4 stock solution (see Recipes)
1 M KPO4, pH 6.0 stock solution (see Recipes)
Nematode growth medium (NGM) agar plates (see Recipes)
Nematode growth medium (NGM) agar plate containing aldicarb (see Recipes)
Equipment
Forceps
Rotator
Autoclave
2 L flask
Magnetic stir bar
Microscope (Leica Microsystems, model: Leica MZ6 ) with KL 200 LED light source (Leica Microsystems, model: KL 200 LED )
Software
GraphPad Prism 6.0, RRID:SCR_002798
Procedure
For the routine maintenance of worms, see Stiernagle, T. Maintenance of C. elegans (Stiernagle, 2006).
Prepare NGM agar plates containing 1 mM aldicarb (see Recipes) at least one day before the assay and store at 4 °C until use. Regular NGM agar plates for the routine maintenance should be seeded with OP50 E. coli and be available before the assay.
Pick 30-40 L4 stage wild-type N2 and mutants of interest onto separate NGM plates seeded with OP50 E. coli (but not containing aldicarb), and culture them at 20 °C for 20 to 24 h.
Use forceps to pick up a copper ring and dip into 70% ethanol. Flame the copper ring for a few seconds and immediately place it on the aldicarb-containing NGM agar plate. The copper ring will be lightly embedded in the agar surface of the plate (Figure 1). This will corral worms inside the ring. Place 3 copper rings on each assay plate and add 10 μl of OP50 E. coli (OD600 = 1.2) at the center of the ring. Bacteria help keep the worms around the center of the ring. Let the plates dry for 30 min. Three genotypes can be assayed on the same plate.
Figure 1. A representative image of a copper ring embedded agar plate. Three copper rings are placed on a 60 mm NGM agar plate, and 10 μl of OP50 is added at the center of the ring.
Transfer 20-30 worms of each genotype from step 3 to the center of each ring. Record the number of worms placed in each ring. Stagger worm transfer every 2-3 min so that all 3 genotypes are examined within a 10-min interval.
Observe the worms in a 10-min interval. If there are worms not moving, then gently prod their heads with a platinum wire until they move (Videos 1 and 2). If they fail to move their head in response to even harsh touch, then remove them from the plate and record. Continue until no worm is left. Make sure that all of the worms are accounted for throughout the assay.
Video 1. A video recording of responses of worms with different genotypes in the presence of aldicarb. The video (120 frames) was recorded for 4 min after 50 min incubation on an aldicarb plate. * indicates the paralyzed worms. WT: wild-type animals, slo-1: slo-1(eg142lf), mutant: an uncharacterized mutant.
Video 2. A video recording shows paralyzed worms that do not respond to harsh touch
Data analysis
Software: Prism 6.0
Use ‘Survival analysis’ function to plot the survival graph (Figure 2). At least 20 worms of each genotype are used per assay. Repeat the assay two more times on different days (total 3 trials) and report the summary of the statistics as shown in Tables 1A and 1B.
Figure 2. Survival curve for aldicarb-induced paralysis assay. Wild-type, slo-1(ky399 gain-of-function) and slo-1(eg142 loss-of-function) mutant animals were simultaneously tested for aldicarb sensitivity in a copper ring-embedded assay plate (adapted from Oh et al., 2017).
Table 1A. Median survival time of C. elegans exposed to aldicarb (Median survival unit is minutes. The number in parenthesis is sample number)
Table 1B. P values of Log-rank test
Statistical analysis: The log-rank test is used to analyze the data. Prism software returns overall curve comparison results. However, pair-wise comparisons can be performed to compare 2 specific groups. Statistically significant P-values need to be adjusted for multiple comparisons if more than 2 pair-wise comparisons are performed. A Bonferroni corrected threshold is used to determine statistically significant P-values (http://www.graphpad.com/guides/prism/6/statistics/index.htm?survival_curves.htm). In this example, 3 comparisons, N2 vs. slo-1(ky399), N2 vs. slo-1(eg142), and slo-1(ky399) vs. slo-1(eg142), are performed and P-values for each comparison is obtained. If threshold for statistical significance is set at a P-value of 0.05, then any P-value that is less than the corrected threshold, i.e., 0.05 divided by 3, is considered statistically significant in this example.
Notes
As per standard scientific procedure, the experimenter should be blinded to the genotypes of the test worms. Ideally a colleague should place the worms (procedure step 5) and label the worms to prevent the experimenter from identifying the genotypes. For mutants with obvious phenotypes, an additional mutant with a similar phenotype, which is unrelated to the study of interest, may be added.
The resolution of differential sensitivity can be changed by varying the concentration of aldicarb. For example, mutants that have higher rates of neurotransmission than wild type worms may be better distinguishable at a lower concentration of aldicarb (e.g., 0.5 mM), which increases the time for the worms to get paralyzed.
Recipes
100 mM aldicarb stock solution
Dissolve 100 mg of aldicarb in 5.25 ml of 70% ethanol at room temperature
Store at 4 °C
Note: We have stored the stock up to 2 weeks and have not tried longer storage.
5 mg/ml cholesterol
Add 250 mg of cholesterol in 50 ml of 95 % ethanol and mix by rotating on a rotator at room temperature. It takes a few hours to dissolve. Store at room temperature
1 M CaCl2 stock solution
Dissolve 14.7 g of CaCl2·2H2O in 100 ml ddH2O and autoclave for 30 min at 121 °C. Store at room temperature
1 M MgSO4 stock solution
Dissolve 12.04 g of MgSO4 in 100 ml ddH2O and autoclave for 30 min at 121 °C. Store at room temperature
1 M KPO4, pH 6.0 stock solution
Make 500 ml of 1 M KH2PO4 (monobasic) and 250 ml of 1 M K2HPO4 (dibasic) solution. While measuring pH of 1 M KH2PO4 (pH is below 5), add and stir 1 M K2HPO4 slowly until pH reaches 6.0. It will take less than 250 ml of K2HPO4 to reach pH 6.0. Aliquot the solution and autoclave for 30 min at 121 °C. Store at room temperature
Nematode growth medium (NGM) agar plate
Add 3 g of NaCl, 16 g of Bacto-agar, and 2.5 g of Bacto-peptone in a 1 L of ddH2O in a 2 L flask with magnetic stir bar
Autoclave for 30 min at 121 °C
Let the NGM agar cool to 55 to 60 °C while stirring on a stirrer, Add 1 ml of 5 mg/ml cholesterol, 1 ml of 1 M CaCl2, 1 ml of 1 M MgSO4, and 25 ml of 1 M KPO4, pH 6.0 while stirring
Dispense 10 ml per 60 mm Petri dish and let them solidify without perturbation
Nematode growth medium (NGM) agar plate containing aldicarb
For aldicarb-containing NGM plates, add aldicarb solution to a desired final concentration along with cholesterol, CaCl2, MgSO4, and 1 M KPO4, pH 6.0 when NGM agar medium is cooled to 55 to 60 °C
For 1 mM aldicarb, add 1 ml of 100 mM aldicarb for 100 ml of NGM. Pour 10 ml per 60 mm Petri dish and let them dry for at least 1 day. Plates can be stored at 4 °C
Note: We have used plates stored at 4 °C for up to 2 weeks without any issue.
Acknowledgments
The protocol has been adapted from Oh et al. (2017), eLife 6: e24733. This work was supported, in part, by a grant from the National Institute of Health.
References
Loria, P. M., Hodgkin, J. and Hobert, O. (2004). A conserved postsynaptic transmembrane protein affecting neuromuscular signaling in Caenorhabditis elegans. J Neurosci 24(9): 2191-2201.
Oh, K. H., Haney, J. J., Wang, X., Chuang, C. F., Richmond, J. E. and Kim, H. (2017). ERG-28 controls BK channel trafficking in the ER to regulate synaptic function and alcohol response in C. elegans. Elife 6.
Rand, J. B. (2007). Acetylcholine. WormBook 30: 1-21.
Richmond, J. E. (2006). Electrophysiological recordings from the neuromuscular junction of C. elegans. WormBook 6: 1-8.
Richmond, J. E. and Jorgensen, E. M. (1999). One GABA and two acetylcholine receptors function at the C. elegans neuromuscular junction. Nat Neurosci 2(9): 791-797.
Stiernagle, T. (2006). Maintenance of C. elegans. WormBook 11: 1-11.
Sudhof, T. C. (2013). Neurotransmitter release: the last millisecond in the life of a synaptic vesicle. Neuron 80(3): 675-690.
Zhen, M. and Samuel, A. D. (2015). C. elegans locomotion: small circuits, complex functions. Curr Opin Neurobiol 33: 117-126.
Copyright: Oh and Kim. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Oh, K. H. and Kim, H. (2017). Aldicarb-induced Paralysis Assay to Determine Defects in Synaptic Transmission in Caenorhabditis elegans. Bio-protocol 7(14): e2400. DOI: 10.21769/BioProtoc.2400.
Oh, K. H., Haney, J. J., Wang, X., Chuang, C. F., Richmond, J. E. and Kim, H. (2017). ERG-28 controls BK channel trafficking in the ER to regulate synaptic function and alcohol response in C. elegans. Elife 6.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Neuroscience > Cellular mechanisms > Intracellular signalling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,401 | https://bio-protocol.org/exchange/protocoldetail?id=2401&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ciberial Muscle 9 (CM9) Electrophysiological Recordings in Adult Drosophila melanogaster
BE Benjamin A. Eaton
Rebekah E. Mahoney
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2401 Views: 6855
Edited by: Jihyun Kim
Reviewed by: Alexandros C. Kokotos
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
The complexity surrounding presynaptic recordings in mammals is a significant barrier to the study of presynaptic mechanisms during neurotransmission in the mammalian central nervous system (CNS). Here we describe an adult fly neuromuscular junction (NMJ), the ciberial muscle 9 (CM9) NMJ, which allows for the recording of both evoked (EPSPs) and spontaneous postsynaptic excitatory potentials (mEPSPs) at a mature glutamatergic synapse. Combined with CM9-specific genetic technologies, the CM9 NMJ provides a powerful experimental system to better understand the regulation of neurotransmitter release at a mature synapse.
Keywords: Drosophila Aging Neuromuscular junction Neurotransmission
Background
A significant hurdle in defining changes in presynaptic function during aging has been due to the lack of a simple model system for performing the electrophysiological recordings necessary to thoroughly characterize the release of neurotransmitter from the presynaptic nerve terminal. Existing rodent models suffer from the significant cost issues associated with aging studies and the technical difficulty of using electrophysiological recordings on single defined nerve terminals with consistent release parameters. To overcome these obstacles, we have pioneered a model synaptic system in the adult Drosophila for analyzing the effects of age on presynaptic function during neurotransmission, the CM9 NMJ located on the fly proboscis (Rawson et al., 2012; Mahoney et al., 2014; Mahoney et al., 2016) (Figure 4A). Briefly, the presynaptic arbor of the CM9 motor neuron (MN) converges upon the 15 muscle fibres of the CM9 muscle to form 35 individual distinct innervations (Rawson et al., 2012). The CM9 MN has been shown to be necessary for the contraction of the CM9 muscle and is the only source of glutamatergic input for the CM9 muscle (Kimura et al., 1986; Gordon and Scott, 2009). Given the highly-conserved nature of the mechanisms underlying synaptic vesicle (SV) release between flies and mammals, and the resemblance to the central synapses found in the mammalian CNS, this makes the CM9 NMJ a powerful model for investigating presynaptic function.
Materials and Reagents
Sterile disposable filter (0.22 μm pore size, aPES membrane 19.6 cm2 CA membrane) (such as Corning® 250 ml Vacuum Filter/Storage Bottle System, Corning, catalog number: 430767 )
Borosilicate glass capillary with filament (OD 1.50 mm, ID 0.86 mm) (Sutter Instrument, catalog number: BF150-86-10 )
Borosilicate glass capillary without filament (OD 1.50 mm, ID 0.86 mm) (Sutter Instrument, catalog number: B150-86-10 )
Silver wire (A-M Systems, catalog number: 782000 )
Diamond coated bench stone (such as DMT 8 in Dia-Sharp bench stone)
Drawn out P200 tip
10 ml syringe (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: S7510-10 )
Minutien pins (Fine Science Tools, catalog number: 26002-10 )
Fine paint brush
Flies of desired genotype and age
Note: UAS constructs can be driven within the CM9 motor neuron via the use of the E49-Gal4 driver (E49-Gal4 from Ulrike Heberlein’s Gal4 collection).
50% Bleach
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333-500G )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653-250G )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: 21115-250ML )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: 63069-500ML )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S5761-500G )
Trehalose (Sigma-Aldrich, catalog number: T9531-25G )
HEPES (Sigma-Aldrich, catalog number: H3375-25G )
Sucrose (Sigma-Aldrich, catalog number: 84097-250G )
Modified hemolymph like solution (HL3.1) (see Recipes)
Equipment
Vannas spring scissors–2 mm cutting edge (Fine Science Tools, catalog number: 15000-03 )
Tungsten Dissecting needle, 125 mm, Ultra fine (Roboz Surgical Instrument, catalog number: RS-6063 )
Micro Dissecting needle holder, 5 ¼” (Roboz Surgical Instrument, catalog number: RS-6060 )
Fine forceps (such as Dumont #5CO, Fine Science Tools, catalog number: 11295-20 and Dumont #3, Fine Science Tools, catalog number: 11231-30 )
Dissecting stereoscopic zoom microscope (such as ZEISS, model: SteREO Discovery.V8 )
Narrow Format Manipulator Systems (such as Sutter Instrument, model: ROE-200 )
Horizontal Micropipette puller (such as programmable Flaming/Brown type micropipette puller, Sutter Instrument, model: P-97 ) with platinum filament
Micro Forge electrode polisher (such as NARISHIGE, model: MF-900 )
Upright confocal microscope (such as Olympus, model: BXS1WI ) with 10x and 40x water objectives
Power lab 4/30 digital converter (ADInstruments, model: ML866 )
Neuroprobe amplifier 1600 (A-M Systems, model: Model 1600 , catalog number: 680100)
Stimulator (Digitimer, model: DS2A )
Labchart 7 (ADInstruments)
Software
Prism 6 (GraphPad software)
Mini Analysis (comparable version 6.0.3, Synaptosoft Inc.)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Eaton, B. A. and Mahoney, R. E. (2017). Ciberial Muscle 9 (CM9) Electrophysiological Recordings in Adult Drosophila melanogaster. Bio-protocol 7(14): e2401. DOI: 10.21769/BioProtoc.2401.
Mahoney, R. E., Rawson, J. M. and Eaton, B. A. (2014). An age-dependent change in the set point of synaptic homeostasis. J Neurosci 34(6): 2111-2119.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Synaptic physiology
Cell Biology > Cell signaling > Intracellular Signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,402 | https://bio-protocol.org/exchange/protocoldetail?id=2402&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Determination of Poly-β-hydroxybutyrate in Synechocystis sp. PCC 6803
YZ Yvonne Zilliges
RD Ramon Damrow
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2402 Views: 8279
Edited by: Maria Sinetova
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Cyanobacteria synthesize a variety of chemically-different, high-value biopolymers such as glycogen (polyglucose), poly-β-hydroxybutyrate (PHB), cyanophycin (polyamide of arginine and aspartic acid) and volutin (polyphosphate) under excess conditions. Especially under unbalanced C to N ratios, glycogen and in some cyanobacterial genera also PHB are massively accumulated in the progression of the general nitrogen stress response. Several different technologies have been established for in situ and in vitro PHB analysis from different microbial sources. In this protocol, a rapid and reliable spectrophotometric method is described for PHB quantification in the cyanobacterium Synechocystis sp. PCC 6803 upon nitrogen deprivation as described in (Damrow et al., 2016).
Keywords: Cyanobacteria Synechocystis PHB Nitrogen deprivation
Background
Non-diazotrophic cyanobacteria such as Synechocystis sp. PCC 6803 respond to the lack of combined nitrogen sources by bleaching, a process known as chlorosis (Allen and Smith, 1969). This acclimation response is characterized by four major structural and morphological changes: (i) a massive accumulation of electron-dense glycogen inclusions (approx. 40 nm in diameter) between the thylakoid layers accompanied by (ii) the degradation of the phycobilisome antenna complexes, (iii) the disassembling of the thylakoid membrane layers including a reduction by number and packing density, and (iv) the formation of distinct electron-transparent PHB granules (approx. 400-500 nm in diameter) (Damrow et al., 2016). The physiological function of cyanobacterial PHB metabolism, synthesized just in a few species, is quite opaque due to the absence of both catabolic enzymes and evident phenotype of PHB-deficient mutants (Beck et al., 2012; van der Woude et al., 2014; Damrow et al., 2016; Namakoshi et al., 2016).
Facing the world’s trash and global warming crisis, the demands for durable, recyclable, biodegradable, and synthetic-alternative plastics such as PHB is enormous and focus attention to cyanobacterial producers (Asada et al., 1999; Ansari and Fatma, 2016). Various different techniques are published for the analysis of PHB molecules (for updated review see [Godbole, 2016]). We are presenting a combination of hydrolytic degradation of PHB to 3-hydroxybutyrate (3-HB) in alkaline regime, and a coupled colorimetric enzymatic assay. Here the coupling with a phenazine methosulphate-p-iodonitrotetrazolium violet (PMS-INT) system directs the enzymatic redox reaction of both NADH oxidation and 3-HB reduction by the 3-hydroxybutyrate dehydrogenase (HBDH) and thus precludes an interfering backward reaction. This rapid spectrophotometric quantification of PHB just needs very simple lab equipment, is not much time-consuming, and is yet both reliable and reproducible.
Materials and Reagents
Pipette tips
1.5 ml centrifuge tubes (Eppendorf® Safe-Lock microcentrifuge tubes) (Eppendorf, catalog number: 0030120086 )
15 ml centrifuge tubes (TubeSpin® Bioreactor 15) (TPP Techno Plastic Products, catalog number: 87015 )
50 ml centrifuge tubes (TubeSpin® Bioreactor 50) (TPP Techno Plastic Products, catalog number: 87050 )
Synechocystis sp. PCC 6803 cells (Pasteur culture collection of cyanobacteria) (Institut Pasteur, catalog number: PCC 6803 )
Crushed ice
Bi-distilled water
0.5 N sodium hydroxide (NaOH) (Carl Roth, catalog number: 9356.1 )
1 N hydrochloric acid (HCl-ROTIPURAN® 37%) (Carl Roth, catalog number: X942.1 )
50 mM Tris-hydrochloride, pH 8.5 (PUFFERAN® ≥ 99%) (Carl Roth, catalog number: 9090.3 )
20 mM β-Nicotinamide adenine dinucleotide (NADH/H+), reduced disodium salt (Sigma-Aldrich, catalog number: N9785 )
Note: This product has been discontinued.
1 mM β-Nicotinamide adenine dinucleotide (NAD+), reduced disodium salt (Sigma-Aldrich, catalog number: N0632 )
5 mM phenazine methosulfate (PMS) (Sigma-Aldrich, catalog number: P9625 )
5 mM p-Iodonitrotetrazolium violet (INT) (Sigma-Aldrich, catalog number: I8377 )
1 mM (R)-3-hydroxybutyric (R-3-HB) (Sigma-Aldrich, catalog number: 54920 ) with a molar mass of 104.10 g/mol
15 U/ml 3-hydroxybutyrate dehydrogenase (3-HBDH) grade II from Rhodobacter spheroides (Roche Diagnostics, catalog number: 10127833001 )
BG11 stock solution ‘+N’; autoclaved (use 1:100) (see Recipes)
Sodium nitrate (NaNO3 ≥ 99%, p.a., ACS, ISO) (Carl Roth, catalog number: A136.1 )
Calcium chloride dihydrate (CaCl2·2H2O ≥ 99%, p.a., ACS) (Carl Roth, catalog number: 5239.1 )
Citric acid (C6H8O7 ≥ 99.5%, p.a., ACS, anhydrous) (Carl Roth, catalog number: X863.1 )
Magnesium sulfate heptahydrate (MgSO4·7H2O ≥ 99%, p.a., ACS) (Carl Roth, catalog number: P027.1 )
Ethylenediamine tetraacetic acid disodium salt dehydrate (EDTA ≥ 99%, p.a., ACS) (Carl Roth, catalog number: 8043.2 )
BG110 stock solution ‘-N’; autoclaved (use 1:100) (see Recipes)
Calcium chloride (CaCl2·2H2O ≥ 99%, p.a., ACS) (Carl Roth, catalog number: 5239.1 )
Citric acid (C6H8O7 ≥ 99.5%, p.a., ACS, anhydrous) (Carl Roth, catalog number: X863.1 )
Magnesium sulfate (MgSO4·7H2O ≥ 99%, p.a., ACS) (Carl Roth, catalog number: P027.1 )
Ethylenediamine tetraacetic acid disodium salt dehydrate (EDTA ≥ 99%, p.a., ACS) (Carl Roth, catalog number: 8043.2 )
Trace Metal Mix for BG11; sterile filtrated (use 1:1,000) (see Recipes)
Boric acid (H3BO3) (≥ 99.8%, p.a., ACS, ISO) (Carl Roth, catalog number: 6943.2 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O ≥ 99%, p.a.) (Carl Roth, catalog number: T881.3 )
Zinc sulfate heptahydrate (ZnSO4·7H2O ≥ 97%, extra pure) (Carl Roth, catalog number: 7316.1 )
Sodium molybdate dihydrate (Na2MoO4·2H2O), ≥ 99.5% (Sigma-Aldrich, catalog number: M1651 )
Cupric(II) sulfate pentahydrate (CuSO4·5H2O ≥ 99%, Ph.Eur., BP) (Carl Roth, catalog number: P025.1 )
Cobalt(II) nitrate hexahydrate (Co(NO3)2·6H2O) (Sigma-Aldrich, catalog number: 203106 )
Extra solutions for BG11; sterile filtrated (use 1:1,000) (see Recipes)
Ammonium iron(III) citrate (Carl Roth, catalog number: 9366.1 )
Potassium phosphate dibasic (K2HPO4 ≥ 98%, Ph.Eur., BP) (Carl Roth, catalog number: T875.1 )
Sodium carbonate carbonate monohydrate (Na2CO3·H2O ≥ 99.5%, p.a., ACS) (Carl Roth, catalog number: 2597.2 )
Buffer solution for BG11; autoclaved (use 1:200) (see Recipes)
1 M HEPES buffer (pH 8.0) (PUFFERAN® ≥ 99.5%) (Carl Roth, catalog number: 9105.4 )
BG11 (‘+N’) medium (see Recipes)
BG110 (‘-N’) medium (see Recipes)
Equipment
Wide-neck 500 ml Erlenmeyer flasks (Carl Roth, DURAN®, catalog number: C150.1 )
Personal protective equipment (PPE)
Note: These should be worn at all times when dealing with concentrated acids and alkali. See Note 3.
Safety glasses (Sekuroka®-safety glasses EN166) (Carl Roth, catalog number: Y254.1 )
Lab coat (Sekuroka®-lab coats) (Carl Roth, catalog number: T413.1 )
Gloves (Rotiprotect®-nitrile evo) (Carl Roth, catalog number: CPX7.1 )
Pipette set (Rainin Pipet-Lite LTS Starter Kit L-STARTXLS+) (Mettler-Toledo International, catalog number: 17014406 )
Ice bucket
Laminar flow bench (Thermo Fisher Scientific, Thermo ScientificTM, model: MSC-AdvantageTM Class II , catalog number: 51028225)
Analytical balance (Mettler-Toledo International, model: XS105 )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM BiofugeTM Primo R , catalog number: 75005440)
Light meter (LI-COR, model: LI-189 )
Incubator (Infors, model: Multitron Pro , ‘Algae Special’)
UV-Vis spectrophotometer (Analytic Jena, model: Specord® 50 PLUS )
Bench pH/mV/°C meter (pH 1,000 L, pHenomenal®) (VWR, catalog number: 662-1422 )
Thermomixer (Biometra, model: ThermoShaker TS1 , catalog number: 846-051-500)
Vortex shaker (VWR, Peqlab, model: peqTWIST )
Autoclave (Systec, model: Systec VX-150 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zilliges, Y. and Damrow, R. (2017). Quantitative Determination of Poly-β-hydroxybutyrate in Synechocystis sp. PCC 6803. Bio-protocol 7(14): e2402. DOI: 10.21769/BioProtoc.2402.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Biochemistry > Other compound > Poly-β-hydroxybutyrate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,403 | https://bio-protocol.org/exchange/protocoldetail?id=2403&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
The Sulfur Oxygenase Reductase Activity Assay: Catalyzing a Reaction with Elemental Sulfur as Substrate at High Temperatures
PR Patrick Rühl
AK Arnulf Kletzin
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2403 Views: 6371
Edited by: Dennis Nürnberg
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
The sulfur oxygenase reductase (SOR) reaction is a dioxygen-dependent disproportionation of elemental sulfur (S0), catalyzed at optimal temperatures between 65 °C and 85 °C. Thiosulfate and sulfite are formed as oxidized products as well hydrogen sulfide as reduced product. External co-factors are not required. Usually, the SOR assay is performed in a milliliter scale in S0-containing Tris-buffer at high temperatures followed by colorimetric product quantification. In order to make the SOR assay more sensitive and better reproducible, several modifications were implemented compared to the original SOR assay (Kletzin, 1989). Here we present the modified SOR assay and the following quantification of the reaction products.
Keywords: Sulfur oxygenase reductase Elemental sulfur Thermozyme Sulfur disproportionation Thiosulfate Sulfite Hydrogen sulfide
Background
Sulfur oxygenase reductases (SOR) catalyze a dioxygen-dependent disproportionation of elemental sulfur with sulfite, thiosulfate and hydrogen sulfide as detectable products. The initially found SORs were derived from hyperthermophilic, sulfur-oxidizing Archaea and Bacteria. The reported temperature optima were between 65 °C and 85 °C and the pH optima between pH 5 and pH 7.4 (Emmel et al., 1986; Kletzin, 1989; Sun et al., 2003; Pelletier et al., 2008). Surprisingly, SORs derived from the mesophilic bacterium Halothiobacillus neapolitanus (Veith et al., 2012) and the alkalihalophilic Thioalkalivibrio paradoxus (Rühl et al., 2017) also had temperature optima of around 80 °C at pH 8.4 and pH 9.0, respectively. Most SORs can be produced in E. coli by heterologous gene expression and only the first descriptions of the enzyme were derived from proteins purified from their native sources (Emmel et al., 1986; Kletzin, 1989; Pelletier et al., 2008). Today, sor genes are found in approximately 35 different Bacteria and Archaea (Rühl et al., 2017).
Usually, SORs have a stoichiometry between 4:1 and 10:1 of oxidized (thiosulfate and sulfite) and reduced products (hydrogen sulfide). The oxidation and reduction reactions could not be separated by site-directed mutagenesis, although the product stoichiometries may vary (Veith et al., 2012). So far, the only exception is the Thioalkalivibrio paradoxus SOR with stoichiometries of 100-1,000:1, which makes the enzyme an oxygenase with almost no reductase activity (Rühl et al., 2017). The thiosulfate:sulfite ratio increases with temperature and pH (Kletzin, 1989; Veith et al., 2012; Rühl et al., 2017). Therefore, the bulk of the thiosulfate is most likely formed rapidly by a non-enzymatic reaction between sulfur and sulfite at pH values above 6 and temperatures exceeding 70 °C.
The original SOR activity assay (Kletzin, 1989; Urich et al., 2004) involves shaking of an aliquot of the enzyme in a buffer containing elemental sulfur at the given reaction temperature coupled to the colorimetric determination of the amount of products at different time points. Product determination is also possible using HPLC (e.g., Rethmeier et al., 1997). However the number of samples that can be processed per day is higher using the colorimetric assays because of the longer time required for each HPLC run. Specific SOR activities were in the range of 10 U/mg of protein for the Acidianus ambivalens SOR and 40 U/mg for the Halothiobacillus enzyme, both determined with the original enzyme assay.
After developing several modifications, the activity assay became more sensitive, resulting in higher product formation and lower amount of the required enzyme together with a reduced incubation time of the enzyme assay (Table 1). The original assay (Kletzin, 1989) was performed in stoppered glass vials with the enzyme being added at room temperature prior to incubation. All vials were transferred simultaneously to a shaking bath with preheated heating liquid. In order to stop the reaction, the vials were transferred sequentially into an ice bath. Urich et al. (2004) modified the procedure for the use of 1.5 ml plastic reaction vials and thermomixers but kept the order of the steps. In the modified procedure, the enzyme solution is added last to the 0 min time point immediately before transfer of the entire set of vials to an ice bath. Thus, all vials remain at the assay temperature for exactly the same time minimizing background effects. Here we describe the modified SOR activity assay and the quantification of its three reaction products.
Table 1. Incubation conditions for the original and modified SOR enzyme assays
Materials and Reagents
Safe-lock reaction vials, 1.5 ml (SARSTEDT, catalog number: 72.690.001 )
Micro cuvettes, polystyrene (SARSTEDT, catalog number: 67.742 )
37% [wt/vol] formaldehyde (Merck, catalog number: 104003 )
Double deionized water (ddH2O; 18.2 MΩ at 25 °C)
Tris(hydroxymethyl)aminomethane (Tris base) (Carl Roth, catalog number: 5429.2 )
32% [wt/vol] hydrochloric acid (HCl) (Carl Roth, catalog number: P074.4 )
Tween 20 (Carl Roth, catalog number: 9127.2 )
Sulfur flower (AppliChem, catalog number: A1687 )
Note: This product has been discontinued; alternative product: Merck, catalog number: 107983 .
Methylene blue (Merck, catalog number: 115943 )
Sodium thiosulfate pentahydrate (Merck, catalog number: 106513 )
Fuchsine (Merck, catalog number: 105226 )
Sulfuric acid (Carl Roth, catalog number: 9316.2 )
Sodium sulfite (Merck, catalog number: 106657 )
Zinc acetate dihydrate (Merck, catalog number: 108802 )
Acetic acid (Carl Roth, catalog number: 3738.5 )
Dimethyl-4-phenylenediamine dihydrochloride (Merck, catalog number: 103067 )
Iron-(III)-chloride hexahydrate (Carl Roth, catalog number: 7119.1 )
20% [wt/vol] ammonium sulfide solution (Sigma-Aldrich, catalog number: A1925 )
Note: This product has been discontinued; alternative product: Merck, catalog number: 105442 .
SOR assay buffer (see Recipes)
Methylene blue solution (see Recipes)
Sodium thiosulfate solution (1 mM) (see Recipes)
Fuchsine solution (see Recipes)
Sodium sulfite solution (1 mM) (see Recipes)
Zinc acetate solution (see Recipes)
Dimethyl-4-phenylenediamine dihydrochloride solution (see Recipes)
Iron-(III)-chloride solution (see Recipes)
Ammonium sulfide solution (1 mM) (see Recipes)
Equipment
Polypropylene Griffin beaker 250 ml (Carl Roth, catalog number: 2875.1 )
Pipettes L20, L200, L1000 (Abimed LABMATE Optima)
Note: This product has been discontinued; alternative product: Gilson, catalog number: F167350 .
Magnetic stirrer (e.g., IKAMAG RET; IKA)
Thermomixer basic (shaking heat block; CellMedia, Elsteraue, Germany)
pH meter (Xylem, WTW, model: inoLab pH 720 ) with SenTix 41 pH electrode (Xylem, WTW, catalog number: 103635 )
Note: The product “Xylem, WTW, model: inoLab pH 720 ” has been discontinued.
Centrifuge Heraeus Pico 17 Microcentrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM PicoTM 17 , catalog number: 75002410)
Spectrophotometer (e.g., Beckmann Coulter, model: DU-640 )
Ultrasound device (Emerson Electric, Branson, model: Sonifier 250 , catalog number: 100-132-868) equipped with a macrotip
Software
Microsoft Excel 365 (Microsoft)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rühl, P. and Kletzin, A. (2017). The Sulfur Oxygenase Reductase Activity Assay: Catalyzing a Reaction with Elemental Sulfur as Substrate at High Temperatures. Bio-protocol 7(14): e2403. DOI: 10.21769/BioProtoc.2403.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,404 | https://bio-protocol.org/exchange/protocoldetail?id=2404&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Glioma Induction by Intracerebral Retrovirus Injection
Ravinder K Verma
Fanghui Lu
Qing Richard Lu
Published: Vol 7, Iss 14, Jul 20, 2017
DOI: 10.21769/BioProtoc.2404 Views: 9383
Reviewed by: Emilie ViennoisKathrin Sutter
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Glioblastoma (GBM) is the most common primary brain cancer in adults and has a poor prognosis. It is characterized by a high degree of cellular infiltration that leads to tumor recurrence, atypical hyperplasia, necrosis, and angiogenesis. Despite aggressive treatment modalities, current therapies are ineffective for GBM. Mouse GBM models not only provide a better understanding in the mechanisms of gliomagenesis, but also facilitate the drug discovery for treating this deadly cancer. A retroviral vector system that expresses PDGFBB (Platelet-derived growth factor BB) and inactivates PTEN (Phosphatase and tensin homolog) and P53 tumor suppressors provides a rapid and efficient induction of glioma in mice with full penetrance. In this protocol, we describe a simple and practical method for inducing GBM formation by retrovirus injection in the murine brain. This system gives a spatial and temporal control over the induction of glioma and allows the assessment of therapeutic effects with a bioluminescent reporter.
Keywords: Glioma Retrovirus Intracerebral injection Murine model PDGFBB PTEN P53
Background
Glioblastoma (GBM) is the most aggressive malignant brain tumor and unfortunately is also almost always fatal. Despite advances in multiple therapeutic modalities, no effective therapy has been developed to cure GBM. The mechanisms underlying this disease remain poorly understood. Animal models have been a very important tool to define the GBM pathogenesis and test for gene or drug therapeutics. Several mouse models have been developed with the aim to produce a disease which mimics the human disease as closely as possible and exhibits similar molecular, genetic and histological character. The prominently used models are xenograft (Hingtgen et al., 2008) models where human tumor cell lines can be transplanted orthotopically in brain as well as ectopically in subcutaneous area in immunocompromised mice, providing an advantage of having a large tumor mass in a brief period. Genetically engineered mice models (GEMM) with specific gain-of oncogenic activities or loss of tumor suppressor pathways, which resemble perturbations in the most frequently dysregulated pathways in GBM, results in formation of gliomas in rodents. Genetic perturbations in GEMM models often include the gain-of-function mutations in oncogenic factors such as EGFR, PI-3K, and Ras (Holland et al., 2000; Zhu et al., 2009), and PDGF amplification (Assanah et al., 2006), as well as the loss-of-function in tumor suppressors such as NF1 (Zhu et al., 2005), TP53 (p53) (Zheng et al., 2008), Ink4a/ARF (Holland, 2001), PTEN (Holland et al., 1998 and 2000). The use of viral vectors (Ikawa et al., 2003; Hambardzumyan et al., 2009; Marumoto et al., 2009; Friedmann-Morvinski et al., 2012) such as retrovirus, lentivirus and adenovirus carrying oncogenes and/or targeting tumor suppressors has been a convenient and effective approach to induce brain tumor formation in rodents. There is a need for testing multiple different tumor models for therapeutics since different subtypes of gliomas have varied genetic profiles and clinical responses to drug treatment.
GBM have been classified into four subtypes depending upon their gene expression pattern and molecular signature, namely, Mesenchymal, Neural, Proneural and Classical tumors (Verhaak et al., 2010). The Proneural subtype of GBM predominantly involves mutations/loss in oncogene P53 and amplification of PDGFRα with loss of PTEN seen across all the subtypes (Verhaak et al., 2010; Lei et al., 2011). To closely imitate the human Proneural subtype, Lei et al. (2011) devised a GBM model by inducing PTEN and P53 deletion and PDGFBB overexpression in the progenitor cells of the white matter region of adult murine brain through retrovirus inoculation (Lei et al., 2011). We have successfully used this retrovirus-induced GBM model in mice ranging in age from day 2 to 3-month-old adult mice with remarkable reproducibility (Lu et al., 2016). This model develops gliomas with full penetrance within 3-4 weeks which in contrast to other GEMM models, which take a significantly longer time.
Materials and Reagents
Materials needed for culture and virus packaging
Culture dishes 10 cm diameter (Corning, Falcon®, catalog number: 353003 )
0.45 µm size filter (Corning® bottle-top vacuum filter system 500 ml) (Corning, catalog number: 430512 )
38 ml open-end tubes (Beckman Coulter, catalog number: 344058 )
50 ml screw capped tubes (Corning, Falcon®, catalog number: 352098 )
15 ml screw capped conical tubes (Corning, Falcon®, catalog number: 352196 )
Round bottom 5 ml tubes (Beckman Coulter, catalog number: 344057 )
Parafilm
Vector system
Retroviral vector carrying PDGFB-IRES-Cre
Retroviral packaging plasmid pEco (Clontech, catalog number: PT3749-5 )
Note: We use a two-vector system for retrovirus production. One is a retroviral vector carrying PDGFB-IRES-Cre, which overexpresses PDGFB and Cre, and another is a retroviral packaging plasmid, which provides gag, pol and env to produce VSV-G pseudotyped retrovirus. We use commercially available DNA transfection reagents for 293T HEK transfection to produce the retrovirus.
Low passaged 293T HEK cells (P6-P14)
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11960044 )
Fetal bovine serum (FBS) (Atlanta Biologicals, catalog number: S11550 )
L-glutamate (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Sodium pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11360070 )
Trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25300054 )
Transfection agent: Polyjet (SignaGen Laboratories, catalog number: SL100688 )
20% sucrose in HBSS (Hank’s Balanced Salt Solution) (Thermo Fisher Scientific, GibcoTM, catalog number: 14025134 )
Complete media for 293T cells (D10 culture media) (see Recipes)
Materials needed for titration of retrovirus
24-well plate
Isolated MEF cells (105 cells/well)
CAG-Rosa-tdTomato reporter mice (THE JACKSON LABORATORY, catalog number: 007909 )
Concentrated virus
Poly-L-lysine (Sigma-Aldrich, catalog number: P7890 ), 0.05 mg/ml prepared in sterile tissue-culture grade water, filter sterilized
Sterile tissue culture grade water (Sigma-Aldrich, catalog number: W3500 )
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11960044 )
Fetal bovine serum (FBS) (Atlas Biologicals, catalog number: S11550 )
L-glutamate (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Sodium pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11360070 )
Complete media for MEF cells (D10 culture media) (see Recipes)
Materials needed for intracranial stereotaxic injection
1 cc syringes (BD, catalog number: 309659 ) and 30 G needles (BD, catalog number: 305128 )
Autoclaved cotton tips
Animals
Ptenfl/fl (THE JACKSON LABORATORY, catalog number: 006440 )
Trp53fl/fl (THE JACKSON LABORATORY, catalog number: 008462 )
Notes:
These mouse stains were crossed with a reporter line Rosa-tmLuciferase (THE JACKSON LABORATORY, catalog number: 005125 ) which has a firefly luciferase gene inserted at the ROSA26 locus (Durkin et al., 2013). This bioluminescent reporter will help to track the tumor growth and evaluate candidate therapeutic regimens. The mice were maintained on a mixed C57Bl/6; 129Sv; CD-1 background.
Obtain appropriate animal use protocol from Institutional Animal Care and Use Committee (IACUC) before the animal work.
Polybrene (1 µg/ml) (Sigma-Aldrich, catalog number: 107689 )
Isoflurane (Piramal®) for inhalational anesthesia (2-3% for induction), or Intraperitoneal Route: ketamine (Ketaset®, NDC 0856-2013-01) + xylazine (Anased® 20 mg/ml, Santa Cruz Biotechnology, catalog number: sc-362950Rx ) combination
Buprenorphine (Buprenex® 0.3 mg/ml): Dilution 1 ml of Buprenex + 9.0 ml D5W for use in mice
Sterile phosphate buffered saline
70% ethanol
Chlorhexidine (BactoShield® CHG 2% Surgical Scrub) (STERIS, catalog number: 132224 )
Isopropanol (Priority Care®, Isopropyl Alcohol 70%) (FIRST PRIORITY, catalog number: MS070PC )
GLUture® Topical Tissue Adhesive (Abbott, catalog number: 32046-04-01 )
Artificial Tears Lubricant Ophthalmic Ointment (Henry Schein, catalog number: 18581 )
Ketamine and xylazine combination (see Recipes)
Equipment
Equipment needed for ultracentrifugation concentration
Pipettes
Sterile working hood
Ultracentrifuge (Beckman Coulter, model: Optima XPN-90 or equivalent)
Shaker
Rotors:
SW 32 Ti (Beckman Coulter, catalog number: 369650 )
SW 55 Ti (Beckman Coulter, catalog number: 342196 )
Equipment needed for titration of retrovirus
Biosafety hood
Neubauer cell counting chamber
Equipment needed for surgery
Stereotaxic device (RWD Life Science, catalog number: 68502 with mouse adapter: RWD Life Science, catalog number: 68010 )
Micro-drill (RWD Life Science, catalog number: 78001 ) to make a burr hole in the skull with appropriate drill bits (RWD Life Science, catalog number: 78002 )
Autoclaved surgical pack composed of scissors, forceps, cotton swabs and tips, applicators, scalpel blade holder
10 μl Hamilton syringe (Hamilton, catalog number: 7659-01 ) with 30 G blunt-end needle (Hamilton, catalog number: 7803-07 )
Incubator or heating pad
Timer
Biobubble or sterile working place
Surgical site Marker (MEDTRONIC, DevonTM, catalog number: 31145793 )
Anesthesia Machine (Ohmeda, model: Excel 210SE or equivalent)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Verma, R. K., Lu, F. and Lu, Q. R. (2017). Glioma Induction by Intracerebral Retrovirus Injection. Bio-protocol 7(14): e2404. DOI: 10.21769/BioProtoc.2404.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Animal models
Cancer Biology > Tumor immunology > Animal models
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.