id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
2,529 | https://bio-protocol.org/exchange/protocoldetail?id=2529&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Local pH Differences within Living Salmonella Cells by High-resolution pH Imaging Based on pH-sensitive GFP Derivative, pHluorin(M153R)
YM Yusuke V. Morimoto
NK Nobunori Kami-ike
KN Keiichi Namba
TM Tohru Minamino
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2529 Views: 6713
Edited by: Dennis Nürnberg
Reviewed by: Eunsook ParkRon Saar-Dover
Original Research Article:
The authors used this protocol in 20-Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
20-Dec 2016
Abstract
The bacterial flagellar type III protein export apparatus is composed of a transmembrane export gate complex and a cytoplasmic ATPase complex. The export apparatus requires ATP hydrolysis and the proton motive force across the cytoplasmic membrane to unfold and transport flagellar component proteins for the construction of the bacterial flagellum (Minamino, 2014). The export apparatus is a proton/protein antiporter that couples the proton flow with protein transport through the gate complex (Minamino et al., 2011). A transmembrane export gate protein, FlhA, acts as an energy transducer along with the cytoplasmic ATPase complex (Minamino et al., 2016). To directly measure the proton flow through the FlhA channel that is coupled with the flagellar protein export, we have developed an in vivo pH imaging system with high spatial and pH resolution (Morimoto et al., 2016). Here, we describe how we measure the local pH near the export apparatus in living Salmonella cells (Morimoto et al., 2016). Our approach can be applied to a wide range of living cells. Because local pH is one of the most important parameters to monitor cellular activities of living cells, our protocol would be widely used for diverse areas of life sciences.
Keywords: Intracellular pH Local pH Fluorescence microscopy Bacteria Bacterial flagellum Proton motive force Type III protein export
Background
The proton channel activities of transmembrane proton channel complexes have been detected as reduction in cytoplasmic pH of bacterial cells (Morimoto et al., 2010; Che et al., 2014; Furukawa et al., 2017). However, to measure the proton channel activity of membrane complexes in living cells in detail, precise measurements of the local cytoplasmic pH are required. A derivative of the green fluorescence protein (GFP), pHluorin, with excitation at wavelengths of 410 and 470 nm and emission at 508 nm is a useful probe to measure the cytoplasmic pH in living cells (Miesenböck et al., 1998). This probe enables us to measure the intracellular pH precisely and quantitatively because the fluorescent intensity ratio of the two excitation wavelengths R410/470 shows a remarkable pH dependence. pHluorin can be fused genetically to a target protein to monitor the local pH around the protein. However, proteolytic cleavage often removes pHluorin from its fusion protein, not only causing a poor signal-to-noise ratio but also leading to the wrong interpretations of the data. We have found that the mutation M153R in pHluorin significantly stabilizes its fusion products while retaining the marked pH dependence of the 410/470 nm excitation ratio of the fluorescence intensity (Morimoto et al., 2011). We therefore used pHluorin(M153R) to develop a method to measure the local cytoplasmic pH in living bacterial cells in a highly quantitative and precise manner (Morimoto et al., 2016).
Materials and Reagents
1.5 ml microcentrifuge tubes
Glass test tubes (IWAKI, catalog number: A-18P )
Double-sided tape (NICHIBAN, catalog number: NW-5 )
24 x 32 mm coverslips (thickness: 0.12-0.17 mm) (Matsunami Glass, catalog number: C024321 )
18 x 18 mm coverslips (thickness: 0.12-0.17 mm) (Matsunami Glass, catalog number: C018181 )
Pipette tips
Filter paper (Toyo Roshi Kaisha, ADVANTEC, catalog number: 00011090 )
Salmonella YVM1004 strain (pHluorin(M153R)-fliG) (Morimoto et al., 2011)
Salmonella YVM1049 strain (∆fliH-fliI flhB(P28T) pHluorin(M153R)-fliG) (Morimoto et al., 2016)
Salmonella SJW1103 strain (wild type for motility and chemotaxis) (Yamaguchi et al., 1984)
Salmonella SJW1368 strain (∆(cheW-flhD); flagellar master operon mutant) (Ohnishi et al., 1994)
pYVM008 (pTrc99A/pHluorin(M153R)-FliG) (Morimoto et al., 2016)
Purified pHluorin(M153R)-FliG-His6 protein in PBS
Note: The pHluorin(M153R)-FliG-His protein is purified by nickel-nitrilotriacetic acid (Ni-NTA) affinity chromatography from the soluble fractions of E. coli BL21(DE3) cells overexpressing pHluorin(M153R)-FliG-His as described by Minamino et al. (2000).
Ampicillin sodium salt (Wako Pure Chemical Industries, catalog number: 014-23302 )
Gramicidin (Thermo Fisher Scientific, catalog number: G6888 )
Potassium benzoate (Wako Pure Chemical Industries, catalog number: 164-19342 )
Bacto tryptone (BD, BactoTM, catalog number: 211705 )
Yeast extract (BD, BactoTM, catalog number: 212750 )
Sodium chloride (NaCl) (Wako Pure Chemical Industries, catalog number: 192-13925 )
Bacto agar (BD, BactoTM, catalog number: 214010 )
Potassium dihydrogen phosphate (KH2PO4) (Wako Pure Chemical Industries, catalog number: 164-22635 )
Dipotassium hydrogen phosphate (K2HPO4) (Wako Pure Chemical Industries, catalog number: 164-04295 )
Ethylenediamine-N,N,N’,N’-tetraacetic acid disodium salt dihydrate (2NA) (EDTA) (Dojindo, catalog number: N001 )
LB medium (see Recipes)
TB medium (see Recipes)
LB agar plate (see Recipes)
Motility buffer (see Recipes)
Equipment
pH meter (Beckman Coulter, model: Φ34 )
Shaking incubator (30 °C, at 200 rpm) (TAITEC, model: BR-40LF )
Spectrophotometer (able to measure OD600) (Shimadzu, model: UV-1800 )
Centrifuge (able to hold 1.5 ml tubes, spin at 6,000 x g) (TOMY SEIKO, model: MX-305 )
Single channel pipettes (1,000 µl, 100 µl) (PIPETMAN® Classic; Gilson, models: P1000 and P100 )
Inverted fluorescence microscope (Olympus, model: IX71 ) (see Figure 1)
150x oil immersion objective lens (Olympus, model: UApo150XOTIRFM , NA1.45)
Electron-multiplying charge-coupled device (EMCCD) camera (Hamamatsu Photonics, model: C9100-02 )
Excitation filter (Omega Optical, model: 400AF30 )
Excitation filter (Olympus, model: BP470-490 )
Emission filter (Omega Optical, model: 520DF40 )
High-speed wavelength switcher (Sutter Instrument, model: Lambda DG-4 )
Dichroic mirror (Semrock, model: FF510-Di01-25x36 )
Software
MetaMorph (Molecular Devices)
ImageJ (National Institutes of Health, https://imagej.nih.gov/ij/)
IGOR Pro (WaveMetrics)
Microsoft Excel (Microsoft)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Morimoto, Y. V., Kami-ike, N., Namba, K. and Minamino, T. (2017). Determination of Local pH Differences within Living Salmonella Cells by High-resolution pH Imaging Based on pH-sensitive GFP Derivative, pHluorin(M153R). Bio-protocol 7(17): e2529. DOI: 10.21769/BioProtoc.2529.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
253 | https://bio-protocol.org/exchange/protocoldetail?id=253&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
The Method of the Body Bending Assay Using Caenorhabditis elegans
M Mikiro Nawa
MM Masaaki Matsuoka
Published: Vol 2, Iss 17, Sep 5, 2012
DOI: 10.21769/BioProtoc.253 Views: 20219
Original Research Article:
The authors used this protocol in Aug 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2012
Abstract
This protocol is useful to obtain clear and repeatable data to know the motor function of a worm by counting the number of body thrash in M9 buffer. The thrashing assay is useful for observation of the effect of loss of motor neurons such as VA or VB neuron.
Materials and Reagents
KH2PO4 (Wako Chemicals USA, catalog number: 169-04245 )
Na2HPO4 (Wako Chemicals USA, catalog number: 197-02865 )
NaCl (Wako Chemicals USA, catalog number: 191-01665 )
M9 buffer (see Recipes)
Equipment
Sterile NGM agar plate with a 35 mm diameter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nawa, M. and Matsuoka, M. (2012). The Method of the Body Bending Assay Using Caenorhabditis elegans. Bio-protocol 2(17): e253. DOI: 10.21769/BioProtoc.253.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Neuroscience > Sensory and motor systems
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,530 | https://bio-protocol.org/exchange/protocoldetail?id=2530&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Mouse Cardiac Neural Crest Cells and Their Differentiation into Smooth Muscle Cells
XW Xia Wang
SA Sophie Astrof
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2530 Views: 8237
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Cardiac neural crest cells (CNCCs) originate at the dorsal edge of the neural tube between the otic pit and the caudal edge of the 3rd somite, and migrate into the pharyngeal arches and the heart. We have shown that fibronectin (Fn1) plays an important role in the development of the CNCC by regulating the differentiation of CNCCs into vascular smooth muscle cells around pharyngeal arch arteries (Wang and Astrof, 2016). This protocol describes the isolation of CNCCs from the neural tube and from the caudal pharyngeal arches, and the differentiation of neural crest-derived cells into smooth muscle cells. This protocol was adapted from (Newgreen and Murphy, 2000; Pfaltzgraff et al., 2012).
Keywords: Cardiac neural crest Vascular smooth muscle cells Neural tube Pharyngeal arch Differentiation
Background
Previous published protocols described the isolation of neural crest cells from the neural tube. However, neural crest cells in the region of the neural tube between the otic pit and the 3rd somite include neural crest cell populations that contribute to a number of different cell types; for example, vagal neural crest cells also originate from this region. In this protocol, we modified the conventional method for the isolation of cardiac neural crest cells. Instead of using the neural tube, we used the caudal pharyngeal arch region at embryonic day (E) 9.5 (22-25 somite stage). This is prior to differentiation of cardiac neural crest cells into vascular smooth muscle cells. It is common for neural crest cultures to contain contaminating mesenchymal cell types, which often express smooth muscle genes. To identify neural crest-derived cells, we isolated neural crest cells from embryos resulting from the following cross: Fn1flox/flox;ROSAmTmG/mTmG female mice x Fn1+/−;Tfap2αIRESCre/+ male mice. In 50% of the progeny from this cross, neural crest cells are lineage-labeled by the expression of GFP, so we could easily identify neural crest cells by their GFP expression without the need for cell sorting (Wang and Astrof, 2016). Additional Cre-expressing strains that can be used are Wnt1-Cre2 (Lewis et al., 2013) and P3ProCre (Li et al., 2000) transgenic strains, e.g., (Wang and Astrof, 2016). All experimental procedures were approved by the Institutional Animal Care and Use Committee of Thomas Jefferson University and conducted in accordance with federal guidelines for humane care of animals.
Materials and Reagents
12 mm round glass coverslips (Electron Microscopy Sciences, catalog number: 72231-01 )
24-well plates (Corning, Falcon®, catalog number: 353047 )
Nunc 4-well dishes untreated (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 144444 )
35 cm Petri dish (Corning, Falcon®, catalog number: 353001 )
1.5 ml centrifuge tube
Sterile transfer pipet (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: PP89SB )
Glass pipet (Fisher Scientific, model: 13-678-6A )
Parafilm
Glass slide
0.2 μm syringe filter unit
Pregnant mice
Dulbecco’s phosphate-buffered saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 ), for dissection of embryos and for cell culture
Trypsin (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
4% PFA prepared in 1x PBS
0.1% Triton X-100 in 1x PBS
Phosphate-buffered saline (PBS)
Donkey serum (Sigma-Aldrich, catalog number: D9663-10ML )
Anti-GFP antibody (Aves Labs, catalog number: GFP-1020 )
Anti-αSMA antibody (Sigma-Aldrich, catalog number: SAB2500963 )
Anti-calponin antibody (Abcam, catalog number: ab46794 )
Donkey anti-goat IgG (H+L) secondary antibody, Alexa Fluor® 555 conjugate (Thermo Fisher Scientific, catalog number: A-21432 )
Donkey anti-rabbit IgG (H+L) secondary antibody, Alexa Fluor® 647 conjugate (Thermo Fisher Scientific, catalog number: A-31573 )
Alexa Fluor® 488 AffiniPure F(ab’)2 fragment donkey anti-chicken IgY (IgG) (H+L) (Jackson ImmunoResearch, catalog number: 703-546-155 )
ProLong Gold Antifade Mountant with DAPI (Thermo Fisher Scientific, InvitrogeTM, catalog number: P36931 )
Collagenase and dispase (Roche Diagnostics, catalog number: 10269638001 )
Glacial acetic acid
Collagen I (Corning, catalog number: 354249 )
DMEM-low glucose (Thermo Fisher Scientific, GibcoTM, catalog number: 11885076 )
Neurobasal medium (Thermo Fisher Scientific, GibcoTM, catalog number: 21103049 )
Chicken embryo extract (MP Biomedicals, catalog number: 092850145 )
Penicillin/Streptomycin (Pen/Strep) (Mediatech, catalog number: 30-001-CI )
N2-supplement (Thermo Fisher Scientific, GibcoTM, catalog number: 17502048 )
B27-supplement (Thermo Fisher Scientific, GibcoTM, catalog number: 17504044 )
Retinoic acid (Sigma-Aldrich, catalog number: R2625 )
Ethanol
2-Mercaptoethanol (Thermo Fisher Scientific, GibcoTM, catalog number: 21985023 )
Fibroblast growth factor-basic (bFGF) (Sigma-Aldrich, catalog number: F0291 )
Tris pH 7.6
Insulin-like growth factor 1 (IGF-1) (R&D Systems, catalog number: 291-G1 )
Fetal bovine serum (FBS) (Gemini Bio-Products, catalog number: 100-125 )
DMEM-high glucose (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
Collagenase/dispase stock solution (see Recipes)
Collagen I working solution (see Recipes)
Neural crest self-renewal medium (see Recipes)
Differentiation medium (see Recipes)
Equipment
Autoclave
Biological safety hood (Thermo Fisher Scientific, Thermo ScientificTM, model: 1300 Series Class II, Type A2 )
Scissors (Fisher Scientific, model: 13-804-6 )
Forceps 9 cm (Fine Science Tool, model: 14060-09 )
Forceps 0.1 x 0.06 mm (Fine Science Tool, model: 11251-23 )
Forceps 11 cm (Fine Science Tool, model: 11254-20 )
EdgeGARD® horizontal flow hood (The Baker Company, model: EdgeGARD® HF )
Flat bench
Dissection microscope and light source (Carl Zeiss, model: Stemi 2000-C )
Humidified, 37 °C tissue culture incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: HeracellTM 150i )
Fluorescence microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, X. and Astrof, S. (2017). Isolation of Mouse Cardiac Neural Crest Cells and Their Differentiation into Smooth Muscle Cells. Bio-protocol 7(17): e2530. DOI: 10.21769/BioProtoc.2530.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Myofiber
Cell Biology > Cell isolation and culture > Cell differentiation
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,531 | https://bio-protocol.org/exchange/protocoldetail?id=2531&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
In vivo Priming of T Cells with in vitro Pulsed Dendritic Cells: Popliteal Lymph Node Assay
Songjie Cai
MF Masayuki Fujino
LL Lina Lu
XL Xiao-Kang Li
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2531 Views: 11288
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
One-way mixed lymphocyte reaction (MLR) is a classic tool to measure how T cells react to external stimuli. However, MLR is an in vitro reaction system, which shows different response intensity compared with in vivo trails sometimes due to the lack of cytokines, tissue matrix and other immune response associated factors. The following popliteal lymph node assay (PLNA) protocol is designed to test the T cells antigen-specific reaction in vivo by using ovalbumin (OVA) specific reacted transgenic mouse OT-1 and OT-2.
Keywords: Mixed lymphocyte reaction (MLR) Popliteal lymph node assay (PLNA) Antigen presenting cells (APC) Dendritic cells (DC) Flow cytometry Ovalbumin antigen OT-1 OT-2
Background
In transplantation, autoimmune and infection studies, one-way mixed lymphocyte reaction (MLR) is a helpful parameter to assess whether T-cell proliferation is increased or inhibited in response to antigen present cells (APC) or other external stimuli. This is a classic functional test, which demonstrates how the T-cell is affected by the test reagents, such as immune-suppress drug (Hou et al., 2015; Zhang et al., 2015), negative cell or exosome vaccines (Ma et al., 2016; Cai et al., 2017).
However, this system has some limits due to the fact that it is in vitro immune reaction system. In vivo immune reaction is affected by bio-microenvironment, such as cytokines, chemokines, hormones secretion, tissue matrix and other unknown bio-factors.
Herein, the popliteal lymph node assay (PLNA) was designed as an in vivo tool to test the increased or decreased immune response by using an ovalbumin (OVA) antigen-specific reaction system (Bhatt et al., 2014; Cai et al., 2017).
Materials and Reagents
Gloves, mask and lab coat
Pipette tips
10 μl (FUKAEKASEI and WATSON, catalog number: 110-207C )
200 μl (FUKAEKASEI and WATSON, catalog number: 110-705C )
1 ml (FUKAEKASEI and WATSON, catalog number: 110-706C )
27 G needle (Terumo Medical, catalog number: NN-2732R )
24-well tissue culture plate (Greiner Bio One International, CELLSTAR®, catalog number: 662160 )
Nylon fiber column T (Wako Pure Chemical Industries, catalog number: 147-06721 )
21 G needle (Terumo Medical, catalog number: NN-2138R )
Nylon mesh, 70 μm (AS ONE, catalog number: PA-70μ )
Culture dish
3.5 ml (Greiner Bio One International, CELLSTAR®, catalog number: 627170 )
10 ml (Greiner Bio One International, CELLSTAR®, catalog number: 664160 )
BD Falcon® disposable transfer pipets, 3 ml (Corning, Falcon®, catalog number: 357524 )
10 ml serological pipette (Greiner Bio One International, CELLSTAR®, catalog number: 607180 )
Falcon® 15 ml conical centrifuge tubes (Corning, Falcon®, catalog number: 352097 )
1.5 ml round-bottom micro tube (FUKAEKASEI and WATSON, catalog number: 131-715C )
Aluminum foil (Mitsubishi)
C57BL6/Nslc (B6) mice
70% ethanol (Wako Pure Chemical Industries, catalog number: 324-00037 )
Crashed ice and carrier
Recombinant Murine GM-CSF (PeproTech, catalog number: 315-03 )
Recombinant Murine IL-4 (PeproTech, catalog number: 214-14 )
Recombinant Murine IFN-γ (PeproTech, catalog number: 315-05 )
EndoGrade® Endotoxin-free ovalbumin (Hyglos, catalog number: 321000 )
Distilled water (Thermo Fisher Scientific, GibcoTM, catalog number: 15230162 )
Phosphate-buffered saline (PBS; 10x), pH 7.2 (Thermo Fisher Scientific, GibcoTM, catalog number: 70013073 )
CellTraceTM Violet Cell Proliferation Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: C34557 )
CellTraceTM CFSE Cell Proliferation Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: C34554 )
APC anti-mouse CD4 Antibody (BioLegend, catalog number: 100516 )
APC Rat IgG2a, κ Isotype Ctrl Antibody (isotype) (BioLegend, catalog number: 400511 )
PE anti-mouse CD8a Antibody (BioLegend, catalog number: 100708 )
PE Rat IgG2a, κ Isotype Ctrl Antibody (isotype) (BioLegend, catalog number: 400507 )
RPMI-1640 (Wako Pure Chemical Industries, catalog number: 189-02025 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 26140079 )
100x penicillin-streptomycin-glutamine (Thermo Fisher Scientific, catalog number: 10378016 )
100x MEM non-essential amino acids solution (Thermo Fisher Scientific, GibcoTM, catalog number: 11140 )
100 mM sodium pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11360070 )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Complete medium (see Recipes)
Equipment
Sanyo Bio clean bench (Panasonic Healthcare, catalog number: MCV-B131F )
CO2 incubator (Panasonic Healthcare, catalog number: MCO-5ACUV-PJ )
Autoclave (TOMY SEIKO, model: ES-315 )
Tweezers (Weller, catalog number: 4SA )
Centrifuge (Beckman Coulter, catalog number: Allegra X-12 )
Water bath (Tokyo Rikakikai, EYELA, model: NTT-2000 )
Dissecting instrument start set (NATSUME SEISAKUSHO, Nazme, catalog number: E-16-F )
Flow cytometer (Beckman Coulter, model: Gallios )
Software
FlowJo V.10.0.8. (FlowJo, LLC)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cai, S., Fujino, M., Lu, L. and Li, X. (2017). In vivo Priming of T Cells with in vitro Pulsed Dendritic Cells: Popliteal Lymph Node Assay. Bio-protocol 7(17): e2531. DOI: 10.21769/BioProtoc.2531.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Cell Biology > Cell-based analysis > Extracellular microenvironment
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,532 | https://bio-protocol.org/exchange/protocoldetail?id=2532&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ubiquitin Proteasome Activity Measurement in Total Plant Extracts
Suayib Üstün
FB Frederik Börnke
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2532 Views: 8363
Edited by: Marisa Rosa
Reviewed by: Jinping ZhaoNoelia Foresi
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
The fine-tuned balance of protein level, conformation and location within the cell is vital for the dynamic changes required for a cell to respond to a given stimulus. This requires the regulated turnover of damaged or short-lived proteins through the ubiquitin proteasome system (UPS). Thus, the protease activity of the proteasome is adjusted to meet the current demands of protein degradation via the UPS within the cell. We describe the adaptation of an intramolecular quenched fluorescence assay utilizing substrate-mimic peptides for the measurement of proteasome activity in total plant extracts. The peptide substrates contain donor-quencher pairs that flank the scissile bond. Following cleavage, the increase in dequenched donor emission of the product is subsequently measured over time and used to calculate the relative proteasome activity.
Keywords: Proteasome Immunity Plant defense Targeted proteolysis Fluorogenic substrate
Background
The ubiquitin proteasome system (UPS) is the major protein degradative machinery in eukaryotic cells and as such the UPS is essential for the regulation of many cellular processes, including signaling, cell cycle, vesicle trafficking, and immunity. Proteins destined for turnover are marked by the covalent attachment of ubiquitin and then degraded by the 26S proteasome. The 26S proteasome is composed of two subparticles, the 20S core protease (CP) that compartmentalizes the protease active sites and the 19S regulatory particle that recognizes and translocates appropriate substrates into the CP lumen for breakdown. Proteasome activity is modulated in order to maintain proteostasis in response to fluctuating internal and external conditions. We have recently shown that the UPS is involved in several aspects of plant immunity and a range of plant and animal pathogens subvert the UPS to enhance their virulence (Üstün et al., 2013; Üstün et al., 2014; Üstün and Börnke, 2015; Üstün et al., 2016). In plants, proteasome activity is strongly induced during basal defense and adapted bacterial pathogens can interfere with this induction using specific virulence factors. This protocol describes an assay to assess the relative chymotrypsin-like proteolytic activity of the proteasome in total plant extracts using a fluorogenic substrate. This assay is carried out in a 96-well format using a plate reader and thus is amendable to medium to high throughput and can easily be modified to measure additional proteolytic activities of the proteasome by exchanging the substrate accordingly.
Materials and Reagents
Pipette tips
1.5 ml microcentrifuge tubes
Black walled 96-well plates for proteasome activity measurements (Corning, catalog number: 3603 )
Clear 96-well plates for protein measurements (Greiner Bio One International, catalog number: 655101 )
Plant material (the protocol is optimized for leaf samples from Nicotiana benthamiana, Capsicum annuum and Arabidopsis thaliana but can also be applied to other plant species or tissues)
Murashige and Skoog (MS) agar (Sigma-Aldrich)
Sucrose (MP Biomedicals, catalog number: 04821713 )
Liquid nitrogen (N2)
Bio-Rad Protein Assay Kit II (Bio-Rad Laboratories, catalog number: 5000002 )
Proteasome substrate
Suc-LLVY-AMC (chymotrypsin-like activity substrate) (Sigma-Aldrich, catalog number: S6510 )
Note: Other proteolytic activities of the proteasome can be measured using the same protocol by using appropriate substrates (Z-ARR-AMC for measuring the trypsin-like activity [Bachem, catalog number: I-1125.0050 ] and Z-LLE-AMC for the determination of the peptidylglutamyl-peptide-hydrolyzing [PGPH] activity of the 20S proteasome [Bachem, catalog number: I-1945.0005 ]).
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Adenosine 5’-triphosphate disodium salt hydrate (ATP) (Sigma-Aldrich, catalog number: A3377 )
4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid, N-(2-Hydroxyethyl)piperazine-N’-(2-ethanesulfonic acid) (HEPES) (Sigma-Aldrich, catalog number: H3375 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 60377 )
1,4-Dithiothreitol (DTT) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15508013 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Proteasome substrate solution (see Recipes)
Extraction buffer (see Recipes)
Proteasome lysis/assay buffer (see Recipes)
Equipment
Pipettes
pH-meter
Cork borer 0.7 cm diameter (Sigma-Aldrich, catalog number: Z165220 )
Overhead stirrer (Heidolph Instruments, model: RZR 1 )
Cooled microcentrifuge (4 °C)
Adjustable thermoblock for 96-well plates (Eppendorf, model: ThermoMixer® C )
Plate reader spectrophotometer (Absorbance, Fluorescence) (e.g., BioTek Instruments, model: Synergy HT )
Software
Gen5 software (Biotek Instruments)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Üstün, S. and Börnke, F. (2017). Ubiquitin Proteasome Activity Measurement in Total Plant Extracts. Bio-protocol 7(17): e2532. DOI: 10.21769/BioProtoc.2532.
Üstün, S., Sheikh, A., Gimenez-Ibanez, S., Jones, A., Ntoukakis, V. and Börnke, F. (2016). The proteasome acts as a hub for plant immunity and is targeted by Pseudomonas type III effectors. Plant Physiol 172(3): 1941-1958.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Degradation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,533 | https://bio-protocol.org/exchange/protocoldetail?id=2533&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Quantification of Plant Extracellular Vesicles
BR Brian D. Rutter
KR Katie L. Rutter
Roger W. Innes
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2533 Views: 20029
Edited by: Marisa Rosa
Reviewed by: Sibongile Mafu
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Extracellular vesicles (EVs) play an important role in intercellular communication by transporting proteins and RNA. While plant cells secrete EVs, they have only recently been isolated and questions regarding their biogenesis, release, uptake and function remain unanswered. Here, we present a detailed protocol for isolating EVs from the apoplastic wash of Arabidopsis thaliana leaves. The isolated EVs can be quantified using a fluorometric dye to assess total membrane content.
Keywords: Arabidopsis thaliana Extracellular vesicles EVs Apoplastic wash DiOC6 Fluorometric quantification
Background
Extracellular vesicles (EVs) are membrane-bound structures that mediate the cell-to-cell transfer of proteins, lipids and genetic material. Interest in mammalian EVs has grown over the years due to their ability to transfer RNA and modulate immune responses. Mammalian EVs are routinely isolated for study from the medium of cultured cells, as well as a growing list of biological fluids (Colombo et al., 2014). Plant EVs are also thought to have a role in the immune response but are comparatively understudied (An et al., 2007; Davis et al., 2016). This is due, in large part, to the absence of a method of isolation.
While plant EVs have been observed since 1967 using transmission electron microscopy, methods for their isolation were not developed until 2009 (Halperin and Jensen, 1967). Regente et al. (2009) isolated small (50-200 nm in diameter) vesicle-like structures from water-imbibed sunflower (Helianthus annuus) seeds. We modified the methods presented in Regente et al. (2009) to isolate vesicles from the apoplastic wash of Arabidopsis thaliana rosettes. To determine which conditions induce or impair EV secretion, we also designed a method for staining the EV pellet with 3,3’-dihexyloxacarbocyanine iodide (DIOC6(3)), a fluorescent lipophilic dye. In the absence of sophisticated forms of nanoparticle tracking, this relatively simple approach quantifies the total membrane content and can be used to indirectly measure the concentration of EVs (Rutter and Innes, 2017). For more precise measurements, and to assess the size distributions of EVs, nanoparticle tracking can be used. Our protocols enable the study of plant EV content and composition, as well as the pathways and conditions that mediate EV biogenesis and release.
Materials and Reagents
MicroporeTM surgical tape (3M, catalog number: 1530-1 )
Clear plastic domes (Hummert International, catalog number: 11-3348 )
30 ml needle-less syringes (BD, catalog number: 309650 )
50 ml conical tubes (VWR, catalog number: 89039-656 )
Pipette tips
Paper towels
250 ml plastic bottles (w/out cap) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3120-0250 )
15 ml conical tube (VWR, catalog number: 89039-668 )
1.5 ml microcentrifuge tubes (VWR, catalog number: 20170-038 )
10 ml syringe
5 ml needle-less syringes (BD, catalog number: 309646 )
Acrodisc 0.45 μm syringe filter (Pall, catalog number: 4454 )
Note: An Acrodisc 0.22 μm filter (Pall, catalog number: 4192 ) can also be used if one is concerned about bacterial contamination.
Pryme PCR 8 strip 0.2 ml tubes (MIDSCI, catalog number: AVSST )
Kim-wipes (KCWW, Kimberly-Clark, catalog number: 34120 )
COSTAR EIA/RIA Plate, 96 well, half area, no lid, flat bottom, non-treated, black polystyrene plate (Corning, Costar®, catalog number: 3694 )
5.8 ml transfer pipets (Thermo Fisher Scientific, catalog number: 222-1S )
Petri dishes, 100 x 15 mm (VWR, catalog number: 25384-302 )
Arabidopsis seeds
Bleach (Austin’s, catalog number: 90000360 )
PRO-MIX PGX Biofungicide potting mix (Premier Tech Horticulture, catalog number: 10382RG )
OptiprepTM density gradient medium (Sigma-Aldrich, catalog number: D1556 )
Murashige Skoog basal salt mixture (Sigma-Aldrich, catalog number: M5524 )
Sodium hydroxide (NaOH) pellets (Avantor Performance Materials, MACRON, catalog number: 7708-10 )
Potassium hydroxide (KOH) pellets (Fisher Scientific, catalog number: P250-500 )
Agar (Sigma-Aldrich, catalog number: 05040 )
MES hydrate (Sigma-Aldrich, catalog number: M8250 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C1016 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
Hydrochloric acid (HCl) (EMD Millipore, catalog number: HX0603-3 )
3,3’-Dihexyloxacarbocyanine iodide (DiOC6(3)) (Thermo Fisher Scientific, InvitrogenTM, catalog number: D273 )
Plant protease inhibitor cocktail (Sigma-Aldrich, catalog number: P9599 )
2,2’-Dipyridyl disulfide (DPDS) (Sigma-Aldrich, catalog number: 149225 )
0.5x Murashige and Skoog agar (see Recipes)
Vesicle isolation buffer (VIB) (see Recipes)
20 mM Tris-HCl, pH 7.5 (see Recipes)
DiOC6 staining solution (see Recipes)
Vesicle resuspension buffer (see Recipes)
Equipment
Metal forceps
Scissors
Stainless steel tweezers, type 3 (Techni-Tool, catalog number: 758TW474 )
Scale
1 L plastic beakers
Titanium French press coffee maker, 24 fl oz (Snow Peak, catalog number: CS-111 )
Vacuum chamber, 0.20 Cu. Ft. (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F42031-0000 )
Vacuum pump, 3.5 CFM (Ideal Vacuum Products, catalog number: P101532 )
JA-14 fixed-angle rotor (Beckman Coulter, model: JA-14, catalog number: 339247 )
Pipettes
MJ research PTC-200 thermal cycler (MJ Research, catalog number: 8252-30-0001 )
Fluorometric microplate reader
Note: We use an AppliskanTM fluorometric plate reader (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 5230000 ) to measure DiOC6 fluorescence, but any fluorometer capable of detecting multiple wavelengths could work.
SW 41 Ti rotor, swinging bucket, titanium, 6 x 13.2 ml, 41,000 rpm, 288,000 x g (Beckman Coulter, model: SW 41 Ti, catalog number: 331362 )
Thickwall polycarbonate centrifuge tubes (3.5 ml, 13 x 51 mm) (Beckman Coulter, catalog number: 349622 )
Thinwall, Ultra-ClearTM 13.2 ml, 14 x 89 mm ultracentrifuge tubes (Beckman Coulter, catalog number: 344059 )
TLA100.3 fixed-angle rotor (Beckman Coulter, model: TLA-100.3, catalog number: 349481 )
Avanti J-26S XP centrifuge (Beckman Coulter, model: Avanti J-26S XPI , catalog number: B22989)
Fluorescent light microscope
Growth chamber
Ice bucket (schuett-biotech, Spongex, catalog number: 3.680 052 )
Optima TLX ultracentrifuge (Beckman Coulter, model: OptimaTM TLX , catalog number: 361545)
Nanoparticle trackers (Particle Metrix, model: ZetaView® , or Malvern Instruments, model: Nanosight NS300 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Rutter, B. D., Rutter, K. L. and Innes, R. W. (2017). Isolation and Quantification of Plant Extracellular Vesicles. Bio-protocol 7(17): e2533. DOI: 10.21769/BioProtoc.2533.
Rutter, B. D. and Innes, R. W. (2017). Extracellular vesicles isolated from the leaf apoplast carry stress-response proteins. Plant Physiol 173(1): 728-741.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Organelle isolation
Plant Science > Plant cell biology > Intercellular communication
Cell Biology > Organelle isolation > Extracellular vesicle
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,534 | https://bio-protocol.org/exchange/protocoldetail?id=2534&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Predator Odor-induced Freezing Test for Mice
SO Shintaro Otsuka
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2534 Views: 7998
Edited by: Soyun Kim
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
The innate fear response is an emotional response that does not require any previously acquired conditioning. One of the standard methods to analyze the innate fear response is a 2,4,5-trimethylthiazoline (TMT)-induced freezing test. TMT is an odor originally isolated from anal secretion of the red fox. Acute TMT exposure has been shown to induce robust freezing behavior in rats and mice (Wallace and Rosen, 2000; Galliot et al., 2012). Here, I show how to expose mice to TMT and how to analyze their freezing behavior.
Keywords: Fear Freezing Innate Predator TMT Odor
Background
To escape detection by predators, many mammalian species, including rodents, have developed innate fear responses triggered by odor stimuli that indicate the presence of predators (Takahashi et al., 2005). The predator’s odorous substance, such as excretion and fur particles, triggers anxiety in the rodent without direct contact and induces avoidance or freezing behavior, depending on the circumstances. For example, if a mouse is not able to run away from the source of the odor (e.g., confined to a small box), the mouse freezes. If the mouse can run away, they will avoid the source of the odor rather than freeze (Hacquemand et al., 2010; Johnston et al., 2012). TMT (2,4,5-trimethylthiazoline), a component of fox feces, is the most used synthesizable reagent for inducing innate fear in rodents (Vernet-Maury et al., 1984). Wallace et al. found that innate fear responses of rats can be quantified by measuring the freezing duration when the animals are exposed to TMT in a small confined space. They also found that innate fear responses to TMT do not induce conditioned learning. This finding indicates that different neural pathways are activated during TMT exposure from those activated during conventional footshock-induced fear responses. Lesion studies have shown that the regions associated with the innate fear responses include the medial/central nucleus of the amygdala and the bed nucleus of the stria terminalis (BNST) (Fendt et al., 2003; Müller and Fendt, 2006). Here, I present conventional methods for measuring TMT-induced fear responses in the mouse.
Materials and Reagents
Kimwipe (1.5 x 2 cm)
Plastic bag
Gloves
Disposable circular test chamber with a transparent lid (13 cm in diameter, 10 cm in height)
Note: Transparent lid is required for video tracking. I purchased the opaque chambers (B-313, Tokyo Garasu Kikai) and modified their lids to be transparent. However totally transparent chamber could be utilized alternately.
C57BL/6J from Charles River Laboratories, 14 weeks old
2,5-Dihydro-2,4,5-trimethylthiazoline (TMT) (Contech, catalog number: 13267 )
Note: Contech no longer manufactures TMT. Obtain from other vendors (e.g., ChemSpider, catalog number: 231591 ).
80% ethanol
5% ammonium hydroxide
Equipment
Charge-coupled device (CCD) camera (Logicool, model: HD WEBCAM C270 )
Fume hood (Safety cabinet)
Walls (Cardboard, 30 x 35 cm)
Pipetman pipette (P10, Gilson)
Software
ImageFZ (ImageJ plugin; Shoji et al., 2014; http://www.mouse-phenotype.org/)
Note: Although I had used ImageFZ in the work, this software supports for only old OS (Windows XP/7 and Mac OS 9). For the compatibility with later Windows OS, a standalone software, FreezeAnalyzerForAVI (http://www.yuzaki-lab.org/publication/software) can be used as an alternative (compatible with Windows XP/7/8.1/10).
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Otsuka, S. (2017). Predator Odor-induced Freezing Test for Mice. Bio-protocol 7(17): e2534. DOI: 10.21769/BioProtoc.2534.
Fendt, M., Endres, T. and Apfelbach, R. (2003). Temporary inactivation of the bed nucleus of the stria terminalis but not of the amygdala blocks freezing induced by trimethylthiazoline, a component of fox feces. J Neurosci 23(1): 23-28.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,535 | https://bio-protocol.org/exchange/protocoldetail?id=2535&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Rodent Brain Vessels
CC Cristina Carvalho
P Paula I. Moreira
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2535 Views: 8220
Reviewed by: Pasquale Pellegrini
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
The prevalence of neurodegenerative diseases is increasing worldwide. Cerebrovascular disorders and/or conditions known to affect brain vasculature, such as diabetes, are well-known risk factors for neurodegenerative diseases. Thus, the evaluation of the brain vasculature is of great importance to better understand the mechanisms underlying brain damage. We established a protocol for the isolation of brain vessels from rodents. This is a simple, non-enzymatic isolation protocol that allows us to perform comparative studies in different animal models of disease, helping understand the impact of several pathological conditions on brain vasculature and how those alterations predispose to neurodegenerative conditions.
Keywords: Blood-brain barrier Cerebrovascular and neurodegenerative disorders Isolated brain vessels Non-enzymatic isolation protocol Rodents
Background
The brain is highly dependent on a constant supply of oxygen and nutrients that arrive through a vast network of blood vessels. The blood-brain barrier (BBB), mainly composed of microvascular endothelial cells that line cerebral microvessels along with periendothelial structures, which include pericytes, astrocytes and a basement membrane (Saraiva et al., 2016; Librizzi et al., 2017), guarantees the control of an homeostatic environment, necessary to maintain the health of brain cells. Thus, the study of how certain pathologies that can interfere with the integrity of cerebrovasculature is of great importance. Indeed, strong evidence from clinical, imaging, epidemiological and neuropathological studies confirmed over the past two decades that the presence of cerebrovascular disease has a pivotal role in Alzheimer disease (AD) and other dementias associated with aging (Chui et al., 2006; Schneider et al., 2007; Gorelick et al., 2011; Wharton et al., 2011; Yarchoan et al., 2012; Bennett et al., 2013; DeCarli, 2013; Toledo et al., 2013; Yates et al., 2014). Besides the low number of papers dedicated to the study of isolated brain vessels, the isolation protocols used in those studies present some inconsistencies rendering difficult the comparison and interpretation of the published observations. With this protocol, we intend to offer a standardized procedure to help researchers working in this field. This protocol was adapted from a previous protocol described by McNeill et al. (1999) and used in our laboratory to isolate total (arterial and venous) brain vessels from rodents (Figures 1 and 4) (Carvalho et al., 2010; Carvalho et al., 2013; Plácido et al., 2017).
Figure 1. Evaluation of the activity of the mitochondrial enzymatic complexes of mice brain vessels. Mitochondrial complexes I-III (A), II-III (B) and IV (C) were determined in vessels isolated from the brains of 11-month-old male wild type (WT; C57BL6/129S), type 2 diabetes-like mice (WT mice exposed to 20% sucrose solution during 7 months) and triple transgenic mice for Alzheimer disease (3xTg-AD, B6;129-Psen1 Tg(APPSwe,tauP301L)1Lfa/Mmjax). A significant decrease in the activity of mitochondrial complexes I-III was observed in brain vessels isolated from 3xTg-AD and type 2 diabetes-like mice. Also, a significant decrease in the activity of complex IV was observed in brain vessels isolated from 3xTg-AD mice. Data shown represent mean ± SEM from 6-8 pools of n = 3. Statistical significance: *P < 0.05; **P < 0.01 when compared with WT mice. Statistical significance was determined using the paired Student’s t-test and Kruskal-Wallis test for multiple comparisons, followed by the posthoc Dunn test (GraphPad Prism 5). These graphs have been previously published in Journal of Alzheimer’s Disease (DOI: 10.3233/JAD-130005) with permission from IOS Press.
Materials and Reagents
50 ml Oak Ridge polysulfone centrifuge tubes w/screw caps (Thermo Fisher Scientific, catalog number: 3115-0050 )
Eppendorf microtubes 1.5 ml (VWR, catalog number: 700-5239 )
PIPETMAN TIPS Diamond–ECOPACKTM D1000 (Gilson, catalog number: F161670 )
PIPETMAN TIPS Diamond–ECOPACKTM D200 (Gilson, Catalog number: F161930 )
PIPETMAN TIPS Diamond–ECOPACKTM D10 (Gilson, catalog number: F161630 )
Stainless steel surgical blades (Swann Morton, catalog number: 0308 )
Rodent brain
Note: This protocol has only been tested with brains from male young and mature (3- and 12-month-old) Wistar rats and wild type, type 2 diabetes-like and triple transgenic for Alzheimer disease (3xTg-AD) mice (11-month-old). Nevertheless, we believe that this protocol can be applied to different strains, ages and sex, though the amount of obtained sample can be a limiting factor.
Ice
Distilled water
Isoflurane (Lab. Vitória, Portugal)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S7907 )
Dextran from Leuconostoc mesenteroides (Sigma-Aldrich, catalog number: 31398 )
Phosphate buffer (0.01 M) (see Recipes)
Dextran (16%) (see Recipes)
Equipment
50 ml FisherbrandTM reusable glass low-form Griffin beakers (Fisher Scientific, catalog number: FB10050 )
Bone cutting forceps (Aesculap, catalog number: FO611R )
Centrifuge (Refrigerated Centrifuge) (Sigma Laborzentrifugen, model: SIGMA 3-16K )
Curved fine tip forceps (Aesculap, catalog number: FB401R )
Heidolph mechanical overhead stirrers, Brinkmann (Heidolph Instruments, model: RZR 1 )
Laboratory bottles, narrow mouth, with screw cap (VWR, catalog number: 215-1594 )
Micropipette PIPETMAN L (Light) type P200L (Gilson, catalog number: FA10005 )
Micropipette PIPETMAN L (Light) type P1000L (Gilson, catalog number: FA10006 )
Nickel/SS Lab spatulas with 1.63” Flat Rounded Ends (Cole-Parmer, catalog number: EW-06369-05 )
Petri dish with cover 60 x 15 mm (Corning, catalog number: 70165-60 )
Potter-Elvehjem with PTFE pestle and glass tube (DWK Life Sciences, Kimble®, catalog number: 886000-0023 )
Precision scale (Mettler-Toledo International, model: AE240 )
Precision balance PLE-N (KERN, model: PLE-N )
Scalpel handle (Aesculap, catalog number: BB084R stainless)
Soft hair brush, 3 mm dia. (CONTROLS, catalog number: 86-D1672 )
Swing-out rotor (Sigma Laborzentrifugen, catalog number: 11133 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Carvalho, C. I. and I. Moreira, P. (2017). Isolation of Rodent Brain Vessels. Bio-protocol 7(17): e2535. DOI: 10.21769/BioProtoc.2535.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Blood brain barrier
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,536 | https://bio-protocol.org/exchange/protocoldetail?id=2536&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Peroxisome Motility Measurement and Quantification Assay
Jeremy Metz
Inês G. Castro
Michael Schrader
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2536 Views: 7032
Edited by: Pengpeng Li
Reviewed by: Thirupugal Govindarajan
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Organelle movement, distribution and interaction contribute to the organisation of the eukaryotic cell. Peroxisomes are multifunctional organelles which contribute to cellular lipid metabolism and ROS homeostasis. They distribute uniformly in mammalian cells and move along microtubules via kinesin and dynein motors. Their metabolic cooperation with mitochondria and the endoplasmic reticulum (ER) is essential for the β-oxidation of fatty acids and the synthesis of myelin lipids and polyunsaturated fatty acids. A key assay to assess peroxisome motility in mammalian cells is the expression of a fluorescent fusion protein with a peroxisomal targeting signal (e.g., GFP-PTS1), which targets the peroxisomal matrix and allows live-cell imaging of peroxisomes. Here, we first present a protocol for the transfection of cultured mammalian cells with the peroxisomal marker EGFP-SKL to observe peroxisomes in living cells. This approach has revealed different motile behaviour of peroxisomes and novel insight into peroxisomal membrane dynamics (Rapp et al., 1996; Wiemer et al., 1997; Schrader et al., 2000). We then present a protocol which combines the live-cell approach with peroxisome motility measurements and quantification of peroxisome dynamics in mammalian cells. More recently, we used this approach to demonstrate that peroxisome motility and displacement is increased when a molecular tether, which associates peroxisomes with the ER, is lost (Costello et al., 2017b). Silencing of the peroxisomal acyl-CoA binding domain protein ACBD5, which interacts with ER-localised VAPB, increased peroxisome movement in skin fibroblasts, indicating that membrane contact sites can modulate organelle distribution and motility. The protocols described can be adapted to other cell types and organelles to measure and quantify organelle movement under different experimental conditions.
Keywords: Peroxisome motility Live-cell imaging Organelle cooperation Membrane contact GFP-PTS1 ACBD5 ACBD4
Background
An important feature of eukaryotic cells is the presence of membrane-bound compartments (organelles), which create distinct optimised environments to promote various metabolic reactions required to sustain life. For the entire cell to function as a unit, coordination and cooperation between specialized organelles must take place. This requires a dynamic spatial organization, which allows the movement of organelles to areas of greatest metabolic need, the positioning of organelles in those areas, and the interaction with other compartments, which permits metabolic cooperation and communication amongst organelles. This is often mediated through interorganellar membrane contacts, whereby two organelles come into close apposition (Prinz, 2014; Eisenberg-Bord et al., 2016).
Peroxisomes are multifunctional organelles that play pivotal cooperative roles in the metabolism of cellular lipids and reactive oxygen species (ROS) and are thus essential for human health and development (Islinger and Schrader, 2011; Wanders et al., 2015; Waterham et al., 2016). Peroxisomes interact with many organelles involved in cellular lipid metabolism such as the endoplasmic reticulum (ER), mitochondria, lipid droplets or lysosomes (Schrader et al., 2013 and 2015). We revealed that the peroxisomal tail-anchored membrane proteins ACBD5 and ACBD4 directly interact with tail-anchored VAPB at the ER (Costello et al., 2017a; 2017b and 2017c). This interaction links both organelles together and allows transfer of lipids between them (Costello et al., 2017b; Hua et al., 2017). Whereas in plants and yeast, peroxisomes move along the actin cytoskeleton by interacting with myosin motors (Jedd and Chua, 2002; Fagarasanu et al., 2009), in mammalian cells (and filamentous fungi), peroxisomes use microtubules and dynein/kinesin motors to distribute uniformly within the cell and to reach new neighbourhoods (Schrader et al., 1996 and 2003; Guimaraes et al., 2015; Lin et al., 2016). We also found that ACBD5-VAPB interaction, which tethers peroxisomes to the ER, influences peroxisome motility (Costello et al., 2017b). Using the peroxisome motility measurement and quantification assay, we showed that loss of ACBD5, which resulted in reduced peroxisome-ER association, also increased peroxisome movement (Costello et al., 2017b). Our data indicate that organelle contact sites can modulate peroxisome (organelle) distribution and motility.
Peroxisomes are highly versatile organelles, which respond to environmental stimuli with changes in their number, size, and enzyme composition (Islinger et al., 2010). Certain stress conditions, in particular in plants, can lead to changes in the motile behaviour of peroxisomes and altered distribution (Rodríguez-Serrano et al., 2009). There is currently great interest in the measurement of peroxisome (organelle) motility and its quantification in order to understand the fundamental principles of organelle distribution, its regulation and role in organelle interaction and metabolic cooperation. Understanding these mechanisms is not just important for comprehending fundamental physiological processes but also for understanding pathogenic processes in disease etiology (Ferdinandusse et al., 2017; Yagita et al., 2017).
Materials and Reagents
10 cm culture dishes (Greiner Bio One International, catalog number: 664160 )
Microporation tips
15 ml centrifuge tubes (Greiner Bio One International, catalog number: 188271 )
1.5 ml microcentrifuge tubes (Greiner Bio One International, catalog number: 616201 )
3.5 cm round glass bottom dishes (Cellview, Greiner Bio One International, catalog number: 627861 )
Serological pipettes, 10 ml (Greiner Bio One International, catalog number: 607180 )
Mammalian cell line of interest, here: human skin fibroblasts (see Note 1)
Peroxisome marker (fluorescent reporter with a C-terminal peroxisomal targeting signal, e.g., EGFP-SKL plasmid [Schrader et al., 2000])
Optional: siRNA for silencing of candidate genes/proteins in mammalian cells, here: ACBD5 (Ambion, catalog number: s40666 ); control scrambled siRNA (GE Healthcare Dharmacon, catalog number: D-001206-14-05 ) (50-100 µM stock) (in sterile, RNase/DNase-free water or buffer supplied by manufacturer)
70% (v/v) ethanol
TrypLETM Express solution (1x) (Thermo Fisher Scientific, GibcoTM, catalog number: 12604013 ) (store at 4 °C)
Immersion oil (Olympus, catalog number: IMMOIL-F30CC )
Dulbecco’s modified Eagle medium (DMEM) high glucose (4.5 g/L) (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 ) for complete growth medium for cell culture of human skin fibroblasts
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10082147 )
Penicillin/streptomycin solution (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Sodium chloride (NaCl)
Potassium chloride (KCl)
Sodium phosphate dibasic (Na2HPO4)
Potassium phosphate dibasic (K2HPO4)
Complete growth medium for cell culture of human skin fibroblasts (see Recipes)
Phosphate-buffered saline (1x PBS) (see Recipes)
Equipment
Pipetting aid (Greiner Bio One International, model: Sapphire MAXIPETTE, catalog number: 847070 )
Class II biological safety cabinet/tissue culture hood (Faster, model: SafeFAST Top 209-D, catalog number: F00000050000 ) (see Note 2)
Humidified CO2 incubator (95% air, 5% CO2, 37 °C) (Thermo Fisher Scientific, Thermo ScientificTM, model: HeracellTM 240i , catalog number: 510263330)
Inverted light microscope (phase contrast) (ZEISS, model: Primo VertTM )
37 °C water bath (Grant Instruments, model: JBA12 )
TC20TM Automated Cell Counter (Bio-Rad Laboratories, catalog number: 145-0101 )
Vacuum aspiration system (Fisher Scientific, catalog number: 11636620)
Manufacturer: INTEGRA Biosciences, catalog number: 158320 .
Table top centrifuge equipped with a swing-out rotor for 15-ml conical tubes (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM BiofugeTM StratosTM , catalog number: 75005282)
Microcentrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM PicoTM 17 , catalog number: 75002491)
Microporator Neon® Transfection System (Thermo Fisher Scientific, InvitrogenTM, catalog number: MPK5000S )
Spinning disk microscope with controlled temperature-CO2 chamber and objective warmer
Note: An Olympus IX81 microscope (Olympus, model: IX81 ) equipped with a Yokogawa CSUX1 spinning disk (Yokogawa Electric, model: CSU-X1 ) head, CoolSNAP HQ2 CCD camera (Photometrics, model: CoolSNAP HQ2 ) and a UPlanSApo 60x/1.35 oil objective was used. Image acquisition was performed using a 488 nm solid state laser at 20% of max. intensity.
Software
VisiView software (Visitron Systems, Germany)
Fiji (ImageJ)
Custom Python data analysis pipeline
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Metz, J., Castro, I. G. and Schrader, M. (2017). Peroxisome Motility Measurement and Quantification Assay. Bio-protocol 7(17): e2536. DOI: 10.21769/BioProtoc.2536.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Live-cell imaging
Cell Biology > Cell-based analysis > Organelle motility
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,537 | https://bio-protocol.org/exchange/protocoldetail?id=2537&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purifying Properly Folded Cysteine-rich, Zinc Finger Containing Recombinant Proteins for Structural Drug Targeting Studies: the CH1 Domain of p300 as a Case Example
YK Yong Joon Kim
SK Stefan Kaluz
AM Anil Mehta
EW Emily Weinert
SR Shannon Rivera
Erwin G. Van Meir
Published: Sep 5, 2017
DOI: 10.21769/BioProtoc.2537 Views: 12219
Reviewed by: Alessandro Didonna
Download PDF
Ask a question
Favorite
Cited by
Abstract
The transcription factor Hypoxia-Inducible Factor (HIF) complexes with the coactivator p300, activating the hypoxia response pathway and allowing tumors to grow. The CH1 and CAD domains of each respective protein form the interface between p300 and HIF. Small molecule compounds are in development that target and inhibit HIF/p300 complex formation, with the goal of reducing tumor growth. High resolution NMR spectroscopy is necessary to study ligand interaction with p300-CH1, and purifying high quantities of properly folded p300-CH1 is needed for pursuing structural and biophysical studies. p300-CH1 has 3 zinc fingers and 9 cysteine residues, posing challenges associated with reagent compatibility and protein oxidation. A protocol has been developed to overcome such issues by incorporating zinc during expression and streamlining the purification time, resulting in a high yield of optimally folded protein (120 mg per 4 L expression media) that is suitable for structural NMR studies. The structural integrity of the final recombinant p300-CH1 has been verified to be optimal using one-dimensional 1H NMR spectroscopy and circular dichroism. This protocol is applicable for the purification of other zinc finger containing proteins.
Keywords: p300 CBP HIF CH1 Cysteine Zinc finger Hypoxia Recombinant protein purification
Background
The growth of solid tumors is associated with the development of hypoxic areas due to inappropriate vascular irrigation. In response to a hypoxic microenvironment, tumor cells overexpress Hypoxia Inducible Factors (HIF), a family of heterodimeric transcription factors (Semenza, 2002; Brat and Van Meir, 2004; Kaur et al., 2005). HIFs bind to p300, a transcriptional coactivator, to form a complex that induces HIF target genes, thereby activating the hypoxia response pathway and promoting tumor growth (Kasper and Brindle, 2006; Liu, 2008). The binding domains involved with the HIF/p300 protein-protein interface are the cysteine-histidine-rich region 1 (CH1) domain of p300 and the C-terminal activating domain (CAD) of HIF-1α (Dames et al., 2002; Freedman et al., 2002). The hypoxia response pathway facilitates tumor growth under oxygen limiting conditions. Inhibiting this pathway is a goal for targeted anti-cancer therapy (Post et al., 2004; Belozerov and Van Meir, 2006; Mooring, 2011; Tan et al., 2011; Mun et al., 2012; Wilkins et al., 2016). Small molecule compounds have recently been developed to bind to p300-CH1 and inhibit p300/HIF complexation, inhibiting the hypoxia response pathway and reducing tumor growth (Shi et al., 2012; Yin et al., 2012; Burroughs et al., 2013). Furthermore, the p300-CH1 domain has been reported to interact with over 30 additional transcription factors related to cancer and other diseases (Kasper and Brindle, 2006).
This protocol has been developed to purify the p300-CH1 peptide with the purity and structural integrity necessary to conduct structural NMR studies for studying protein-protein and protein-ligand interactions. p300-CH1 poses many challenges for recombinant protein purification, as it contains three zinc fingers and 9 total cysteine residues. p300-CH1 has been reported to be structurally compromised without a 3:1 stoichiometric ratio of zinc (De Guzman et al., 2005). Without zinc, cysteine residues typically found at zinc fingers can form unwanted disulfide linkages that are thermodynamically more stable than cysteine-zinc interactions. Proteins without zinc cations occupying their native zinc fingers are prone to oxidation and readily form disulfide linkages, resulting in unwanted protein conformations and protein aggregation.
Introducing zinc (II) to a protein purification protocol is complicated by the fact that zinc (II) interacts with certain buffer salts, reducing agents, and hydroxide ions to form precipitates. Unwanted zinc (II) precipitation can prevent the formation of crucial zinc fingers and even leach out existing zinc fingers to denature the protein. In addition, the reducing agents and buffer salts that precipitate with zinc may be unavailable to serve their respective purposes for the purification. Zinc (II) cations form white ZnOH precipitates with neutral to alkaline buffer conditions (pH 7.0 and above). Zinc (II) also forms precipitates with phosphate buffer and thiol reducing agents (BME and DTT). The buffers and reagents used for the purification procedure must be carefully selected to be compatible with zinc. As a precaution, zinc stocks and zinc containing solutions must be pH adjusted with zinc present to verify that ZnOH precipitates do not form during purification. This is especially important in purifying high yields of properly folded zinc-finger containing proteins.
The purification protocol has been designed with the following strategies to minimize oxidation and maximize yield:
1. Occupy cysteine residues with zinc (II) throughout the protocol
2. Streamline the duration of expression and cleavage
3. Use reducing agents whenever possible
The protocol successfully overcomes issues of reagent compatibility and oxidation, yielding 120 mg of purified recombinant p300-CH1 from a 4 L bacterial culture. Concentration of recombinant p300-CH1 was measured by UV-Vis absorbance at a wavelength of 280 nm. The extinction coefficient of p300-CH1 is calculated to be 5,690 L mol-1 cm-1 by ExPASy ProtParam tool (Shi et al., 2012). According to circular dichroism and 1H NMR, the purified p300-CH1 recombinant protein product is optimally folded without the need for any further modification post-purification. The protocol and its strategies can be applied to other cysteine containing proteins systems to improve yield and purity.
Materials and Reagents
14 ml polypropylene round-bottom tube (Corning, Falcon®, catalog number: 352057 )
1.7 ml polypropylene microcentrifuge tube (Posi-Click Eppendorf) (Denville Scientific, catalog number: C2170 )
Polypropylene micropipette tips
50 ml polypropylene conical bottom tube (Corning, catalog number: 430291 )
Two-sided disposable plastic cuvettes 10 mm (VWR, catalog number: 97000-586 )
250 ml wide-mouth plastic bottle (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: N411-0250 )
15 ml polypropylene conical bottom tube (Corning, catalog number: 430052 )
Chemically competent E. coli (One Shot® BL21 Star (DE3)) (Thermo Fisher Scientific, InvitrogenTM, catalog number: C601003 ); store at -80 °C
pGEX-6P-1 plasmid expression vector (GE Healthcare, catalog number: 28-9546-48 ) containing GST-p300-CH1 domain cDNA
Note: The p300-CH1 insert was isolated from a Thrombin-site containing expression vector (pGEX-2T vector containing p300-CH1 insert) (http://web.expasy.org/protparam/) using BamHI and EcoRI restriction enzymes. The insert was cloned into the pGEX-6P-1 vector.
Ice
LB Miller broth powdered (Fisher Scientific, catalog number: BP1426-2 )
Ampicillin sodium salt powdered (Sigma-Aldrich, catalog number: A9518 )
Note: Prepare 100 mM stock (1,000x) in deionized water. Filter sterilize and store at -20 °C.
Plasmid DNA Extraction Miniprep Kit (GeneJET) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: K0502 )
BamHI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FD0054 ); store at -20 °C
Restriction enzyme buffer FastDigest (10x; 5x 1 ml) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: B64 ); store at -20 °C
EcoRI restriction enzyme FastDigest (800 µl, 1 reaction/1 µl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FD0274 ); store at -20 °C
Quick-Load 1 kb DNA ladder (New England Biolabs)
5x nucleic acid loading buffer (10 ml, premixed) (Bio-Rad Laboratories, catalog number: 1610767 )
Deionized water
Acrylamide electrophoresis gels (Criterion TGX Precast Gels; 18 well comb, 30 µl loading volume per well, 1.0 mm thickness, 4-20% gel percentage) (Bio-Rad Laboratories, catalog number: 5671094 )
Agar powdered (Fisher Scientific, catalog number: BP24662 )
1x TAE running buffer
Ethidium bromide (10 mg/ml) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15585011 )
Glycerol 100% (EMD Millipore, catalog number: GX0185 )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) powdered (Gold Bio, catalog number: I2481C100 )
Note: Prepare 10 ml of 1 M (10,000x) stock in deionized water and store at -20 °C.
Zinc chloride (ZnCl2), 99.999% trace metals basis powdered (Sigma-Aldrich, catalog number: 229997 )
Note: Prepare as 100 mM stock in deionized water.
Bleach
Liquid nitrogen
DNase I (2,000 U/ml; 1 ml) (New England Biolabs, catalog number: M0303S ); store at -80 °C
RNase A (1 ml, 1 mg/ml) (Bioo Scientific, catalog number: 344005 )
4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride (PEFA-BLOC) powdered (Biosynth, catalog number: A-5440 )
Benzamidine HCl, > 99% powdered (RPI, catalog number: B12000-100.0 )
Glutathione agarose beads (10 ml 50% slurry in 0.05% sodium azide solution) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 16100 )
HRV 3C Cysteine Protease PreScission Site (1 mg lyophilized) (AG Scientific, catalog number: H-1192 )
Note: Prepare as 2 mg/ml in Prescission Protease buffer, and store as 50 µl aliquots; store at -80 °C.
Coomassie Brilliant Blue G-250 (Bio-Rad Laboratories, catalog number: 1610406 )
Ethylenediaminetetraacetate acid disodium salt (EDTA)
Tris base (White Crystals or Crystalline Powder/Molecular Biology) (Fisher Scientific, catalog number: BP152 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: BP358-10 )
Sodium hydroxide (NaOH) (BioUltra, for molecular biology, 10 M in H2O) (Sigma-Aldrich, catalog number: 72068 )
Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (powder, ≥ 98% purity, 10 g) (Sigma-Aldrich, catalog number: C4706 )
Tris-d11
DTT-d10
Acidic resuspension buffer (pH 6.3) (see Recipes)
Alkaline resuspension buffer (pH 8.0) (see Recipes)
HRV3C PreScission Site Protease buffer (pH 8.0) (see Recipes)
10% (v/v) deuterated Buffer for NMR (pH 8.0) (see Recipes)
LB Miller medium (see Recipes)
Equipment
Variable Micropipets (Edvotek, catalog numbers: 591 , 5911 , 5921 )
Large silicone non-stick kitchen spatula
Orbital shaker (FormaOrbital Shaker, Thermo Electron)
Autoclave (STERIS, model: SV-120 )
Benchtop shaker (Jeio Tech, Lab Companion, model: SK-300 )
Centrifuge (Beckman Coulter, model: Avanti J-20XP )
Centrifuge rotor with 250 ml rotor cavities (16,000 rpm rotor) (Beckman Coulter, model: J-LITE® JLA-16.250 )
2 L glass flask (Corning, PYREX®, catalog number: 4980-2L )
-80 °C freezer
High pressure homogenizer (Avestin, model: EmulsiFlex-C5 )
Fisher Scientific Isotherm Model 900 cooler (Fisher Scientific, model: Model 900 )
Ultracentrifuge (Beckman Coulter, model: OptimaTM XE-90K )
Ultracentrifuge rotor with 50 ml rotor cavities (Beckman Coulter, model: SW 40 Ti )
Vertical rotating wheel (Labquake Tube Shaker Rotisserie) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: C415110 )
Benchtop centrifuge (Thermo Fisher Scientific, model: SorvallTM ST 16 , catalog number: 75004240)
Swinging bucket rotor with 400 ml rotor cavities (Thermo Fisher Scientific, Thermo ScientificTM, model: TX-400 , catalog number: 75003629)
Protein electrophoresis apparatus (Bio-Rad Laboratories, model: CriterionTM Cell , catalog number: 1656001)
Spectropolarimeter (JASCO, model: J-810 ; 163-900 nm)
Spectrophotometer (Eppendorf, model: BioPhotometer® plus , catalog number: 952000006)
600 MHz NMR spectrometer (Varian, INOVA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Cancer biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,538 | https://bio-protocol.org/exchange/protocoldetail?id=2538&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Leaf Clearing Protocol to Observe Stomata and Other Cells on Leaf Surface
Nidhi Sharma
Published: Sep 5, 2017
DOI: 10.21769/BioProtoc.2538 Views: 17437
Edited by: Scott A M McAdam
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
In this protocol, leaves are cleared and fixed in an ethanol and acetic acid solution, and mounted in Hoyer’s solution. The cleared leaves are imaged under differential interference contrast (DIC) microscope. This protocol is beneficial for studying stomata, hair cells, and other epidermal cells in plants.
Keywords: Leaf clearing Stomata DIC microscopy Hoyer’s solution
Background
There are multiple ways to observe stomata and other epidermal cells such as hair cells on plant leaf surface. Traditionally a clear nail polish or wood glue is applied to the leaf surface and let dry. The leaf is peeled and observed under the microscope. Alternatively, scotch tape is applied to the leaf and removed to observe an imprint of the leaf surface. These traditional methods can be used for thicker leaves that are sturdy but the images are generally not of the highest quality. Small and delicate leaves such as Arabidopsis leaves require a more advanced method. A fresh Arabidopsis or Brachypodium leaf may also be observed directly under the microscope; however, the thickness and pigments in the leaf pose difficulties in viewing the stomata and other epidermal cells clearly. This protocol describes a method clearing of leaves for visualizing stomata including other epidermal cells and obtaining good quality images for publishing in peer-reviewed journals (Anderson, 1954).
Materials and Reagents
Multi-well plates (Greiner Bio One International, catalog number: 665102 )
Parafilm (Bemis, catalog number: PM996 )
Microscope slides, 25 x 75 x 1.0 mm (Fisher Scientific, catalog number: 12-550-A3 )
Cover slips (Fisher Scientific, catalog number: 12-544D )
Aluminium foil
Arabidopsis or Brachypodium leaf
Note: You may cut the Brachypodium leaf into 1 cm pieces to fit into wells.
Ethanol (Sigma-Aldrich, catalog number: 459844 )
Acetic acid (Sigma-Aldrich, catalog number: AX0077-1 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 221473 )
Gum Arabic (Sigma-Aldrich, catalog number: 30888-1KG )
Chloral hydrate (Sigma-Aldrich, catalog number: C8383 )
Glycerol (Sigma-Aldrich, catalog number: G5516-1L )
Note: Sterile is not required.
Distilled water
Clearing solution (see Recipes)
1 N KOH (see Recipes)
Hoyer’s solution (see Recipes)
Equipment
Fume hood
Forceps (Fisher Scientific, catalog number: 22-327379 )
Microscope (Leica, model: Leica DM6 B )
1 L glass beaker (Sigma-Aldrich, catalog number: Z169161 )
Magnetic stirrer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: S194615 )
Software
MS Excel
(https://support.office.com/en-us/article/STDEV-function-51fecaaa-231e-4bbb-9230-33650a72c9b0)
Note: Calculate Standard Deviation in MS Excel.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sharma, N. (2017). Leaf Clearing Protocol to Observe Stomata and Other Cells on Leaf Surface. Bio-101: e2538. DOI: 10.21769/BioProtoc.2538.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell isolation
Cell Biology > Cell imaging > Fixed-tissue imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,539 | https://bio-protocol.org/exchange/protocoldetail?id=2539&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Molybdenum Blue-based Quantification of Total Phosphate and Polyphosphate in Parachlorella
SO Shuhei Ota
SK Shigeyuki Kawano
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2539 Views: 10073
Edited by: Maria Sinetova
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Inorganic phosphorus is a non-renewable resource and an essential element for life on Earth. Organisms such as algae, protists, and animals can store phosphate (Pi) through uptake of Pi as polyphosphate (poly-P), which is a linear polymer of orthophosphate residues linked by high-energy phosphoanhydride bonds. Here, we describe procedures for extraction of total phosphate and poly-P from Parachlorella cells and quantification of orthophosphate based on molybdenum blue assay. The present method may be applicable for other microalgae.
Keywords: Alga Chlorella Parachlorella Phosphorus Polyphosphate Molybdenum blue reaction
Background
Biological phosphorus recovery is a particularly attractive form of nutrient recycling. Algae can accumulate phosphate (Pi), and Pi-enriched algal biomass can be used as biofertilizer (Solovchenko et al., 2016). In a previous study, Ota et al. (2016) revealed the relationship between electron dense bodies and poly-P dynamics under sulfur-deficient (-S) conditions in Parachlorella kessleri. Parachlorella is a genus of green algae in the class Trebouxiophyceae, characterized by a rigid cell wall and an asexual, non-motile life cycle. The protocol presented here allows extraction of total Pi and polyphosphate (poly-P) from Chlorella and quantification of inorganic phosphorus based on molybdenum blue reaction, which is a standard method used to quantify orthophosphate. The theoretical background of the molybdenum blue reaction was reviewed previously by Nagul et al. (2015).
Materials and Reagents
Pipette tips for 10 µl, 200 µl and 1,000 µl (Labcon, catalog numbers: 1161-965 , 1065-960 , 1168-960 )
15-ml conical centrifuge tubes (FUKAEKASEI and WATSON, catalog number: 1332-015S )
2-ml microtubes (SARSTEDT, catalog number: 72.695.500 )
Aluminum foil (Mitsubishi Aluminum, 0.012 mm thick)
96-well microplates, non-treated surface (Asahi Glass, catalog number: 1860-096 )
Microplate seal (qPCR seal) (4titude, catalog number: 4ti-0560 )
Parachlorella kessleri (National Institute for Environmental Studies, catalog number: NIES-2152 )
TAP medium (without agar; see http://mcc.nies.go.jp/02medium.html)
Sodium hypochlorite (available chlorine, min. 5.0%) (Wako Pure Chemical Industries, catalog number: 197-02206 )
Glass beads, acid-washed 425-600 µm (Sigma-Aldrich, catalog number: G8772 )
Ethanol (99.5% v/v) (Wako Pure Chemical Industries, catalog number: 057-00456 )
Potassium peroxodisulfate (K2S2O8) (Kishida Chemical, catalog number: 310-63931 )
Antimony potassium tartrate trihydrate (C8H4K2O12Sb2·3H2O) (Alfa Aesar, catalog number: A13766 )
L-Ascorbic acid (Wako Pure Chemical Industries, catalog number: 012-04802 )
Hexaammonium heptamolybdate tetrahydrate ((NH4)6Mo7O24·4H2O) (Wako Pure Chemical Industries, catalog number: 016-06902 )
Phosphate ion standard solution (NaH2PO4 in water) (Wako Pure Chemical Industries, catalog number: 168-17461 )
Sulfuric acid (Wako Pure Chemical Industries, catalog number: 195-04706 )
Ammonium molybdate tetrahydrate solution (see Recipes)
Equipment
Micro-spatula (AS ONE, catalog number: 6-524-06 )
Pipettes for 10 µl, 200 µl and 1,000 µl (Eppendorf, model: Research® plus )
Microtube mixer (TOMY SEIKO, model: MT-360 )
Autoclave (TOMY SEIKO, model: LSX-300 )
Centrifuge, swing rotor (TOMY SEIKO, model: LC-121 )
Refrigerated microcentrifuge (TOMY SEIKO, model: MX-300 )
Microplate reader (BioTek Instruments, model: EPOCH )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ota, S. and Kawano, S. (2017). Extraction and Molybdenum Blue-based Quantification of Total Phosphate and Polyphosphate in Parachlorella. Bio-protocol 7(17): e2539. DOI: 10.21769/BioProtoc.2539.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
254 | https://bio-protocol.org/exchange/protocoldetail?id=254&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Polyadenylated RNA Sampling
EH Eliane Hajnsdorf
Published: Vol 2, Iss 17, Sep 5, 2012
DOI: 10.21769/BioProtoc.254 Views: 10477
Original Research Article:
The authors used this protocol in Jan 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2012
Abstract
Polyadenylation is a post-transcriptional modification of RNA occurring in prokaryotes, eukaryotes and organelles. However, the function and extent of bacterial polyadenylation are in marked contrast to those of eukaryotic poly(A) tails. In fact, the long poly(A) tails of eukaryotic mRNAs play an important role in their exportation to the cytoplasm and promote mRNA stability and translation, whereas the short bacterial tails facilitate RNA decay. One of the obstacles encountered by investigators studying bacterial polyadenylation is the scarcity of polyadenylated RNAs. The method described here allows reverse transcription and PCR amplification of the whole population of polyadenylated RNAs provided that the poly(A) tails are long enough to hybridize to oligo dT30 sequence. To this end utilization of exoribonucleases deficient strains may be useful.
Keywords: Polyadenylation Bacteria Poly(A) tails RNA degradation Gene expression
Materials and Reagents
Kit SMART cDNA (BD Biosciences, catalog number: PT3041-1 )
Sfi I restriction enzyme
pDNR-LIB (BD Biosciences, catalog number: PT3508-5 )
Jet sorb kit (Genomed)
Escherichia coli XLI Blue cells
Wild-type bacteria or bacteria deficient in 3’-->5’ exoribonucleases (see Reference 1)
Phenol (MP) chloroform (Merck KGaA)
T4 DNA ligase (New England Biolabs)
ATP (Promega Corporation)
Powerscript reverse transcriptase
Ethanol
Potassium chloride
LB medium
Buffer 1 (see Recipes)
Buffer 2 (see Recipes)
Equipment
Beckman centrifuge
JA20 rotor
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > RNA extraction
Molecular Biology > RNA > Transcription
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,540 | https://bio-protocol.org/exchange/protocoldetail?id=2540&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for Establishing a Multiplex Image-based Autophagy RNAi Screen in Cell Cultures
JJ Jennifer Jung
Christian Behrends
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2540 Views: 8255
Edited by: Arsalan Daudi
Reviewed by: Aswad Khadilkar
Original Research Article:
The authors used this protocol in 14-Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
14-Feb 2017
Abstract
Autophagy is a recycling pathway, in which intracellular cargoes including protein aggregates and bacteria are engulfed by autophagosomes and subsequently degraded after fusion with lysosomes. Dysregulation of this process is involved in several human diseases such as cancer or neurodegeneration. Hence, advancing our understanding of how autophagy is regulated provides an opportunity to explore druggable targets and subsequently develop treatment strategies for these diseases. To identify novel autophagy regulators, we developed an image-based phenotypic RNAi screening approach using autophagic marker proteins at endogenous levels (Jung et al., 2017). In contrast to previously performed autophagy screens, this approach does not use overexpressed, tagged autophagy marker proteins but rather detects autophagic structures at endogenous levels. Furthermore, we monitored early and late phases of autophagy in parallel while other screens employed only a single autophagosome marker mostly GFP-LC3B. Here, we describe this multiplex screening protocol in detail and discuss general considerations about how to establish image-based siRNA screens.
Keywords: siRNA screen Immunostaining Immunofluorescence Autophagy
Background
Autophagy is an intracellular quality and quantity control pathway by which diverse cytosolic material such as pathogens, organelles or parts thereof, proteins and other macromolecules are engulfed by double membrane structures coined autophagosomes and delivered for bulk lysosomal degradation upon fusion of autophagosomes with lysosomes. Formation of autophagosomes and their maturation to autolysosomes is a highly regulated process. Among the AuTophaGy-related (ATG) genes initially identified in yeast is the ubiquitin-like protein Atg8, which exerts its function in a highly localized manner through its reversible conjugation to the phospholipid phosphatidylethanolamine (PE) located in the recipient autophagosome. Human cells contain six ATG8 family members that can be grouped into two subfamilies: i) microtubule-associated proteins 1A/1B light chain 3A (LC3A), LC3B and LC3C and ii) γ-aminobutyric acid receptor-associated protein (GABARAP), GABARAPL1 and GABARAPL2 (Slobodkin and Elazar, 2013). Given the fact that yeast only harbors one Atg8 isoform, it is unclear whether LC3 and GABARAP proteins are functionally redundant or have unique properties. Members of the GABARAP family have been suggested to function late in autophagy, potentially promoting sealing of IMs or fusion of autophagosomes with lysosomes while LC3-proteins are believed to coordinate the expansion of autophagosomes, thus acting earlier than GABARAP proteins in the pathway (Weidberg et al., 2010). Importantly, overexpression or knockdown of one family member was shown to affect the expression levels of the other LC3 and GABARAP proteins (Weidberg et al., 2010). Therefore, our recent study (Jung et al., 2017) aimed to develop a screening platform for monitoring human ATG8 proteins (i.e., LC3B and GABARAP) at endogenous levels. This distinguishes our approach from other performed genome wide autophagy siRNA screens, in which overexpression of a GFP-tagged version of LC3B was employed (Orvedahl et al., 2011; McKnight et al., 2012). Besides LC3B and GABARAP, we additionally included autophagy marker proteins for the initiation and maturation of autophagosomes such as WIPI2 (WD repeat domain phosphoinositide-interacting protein 2), ATG12 and STX17 (syntaxin 17), respectively. WIPI2 is recruited to phagophores by binding to the phospholipid phosphatidylinositol 3-phosphate (PI3P). Upon PI3P-binding, WIPI2 recruits the mammalian ATG8 lipidation complex comprised of the subunits ATG16L1, ATG5 and ATG12. Subsequently, LC3B is conjugated to PE and in turn can recruit several human ATG8-binding proteins including cargo receptors such as p62 (also known as SQSTM1), which lead to autophagy cargo engulfment. Fusion of autophagosomes with lysosomes requires the SNARE protein STX17. STX17 localizes to closed autophagosomes and associates with SNAP29 and VAMP8 on lysosomes (Ktistakis and Tooze, 2016). Finally, intraluminal components are lysosomally degraded. Application of several autophagic marker proteins such as ATG12, WIPI2 and STX17 in addition to LC3B and GABARAP potentially allows the elucidation of genes specific for early and late phases of the autophagic process. The identification of various known as well as enigmatic autophagy proteins verified our screening approach (Jung et al., 2017).
Materials and Reagents
Pipette tips
10 cm tissue culture dishes (Corning, Falcon®, catalog number: 353003 )
384-well imaging plates, CellCarrier-384 Black (PerkinElmer, catalog number: 6007550 )
Cell culture microplate, 96-well, v-bottom (Greiner Bio One International, catalog number: 651180 )
Disposable reagent reservoirs, 25 ml, sterile (VWR, catalog number: 613-1174 )
Disposable reagent reservoirs, 100 ml, sterile (VWR, catalog number: 613-1172 )
Aluminum sealing ape 96 100/CS (Corning, catalog number: 6570 )
U2OS cells (ATCC, RRID:CVCL_0042)
Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 41966029 )
Fetal bovine serum (FBS) qualified, E.U.-approved, South America origin (Thermo Fisher Scientific)
Penicillin-streptomycin (P/S) (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
L-Glutamine 200 mM (Thermo Fisher Scientific, catalog number: 25030024 )
0.25% trypsin/EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Dimethylsulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
siRNA library (GE Healthcare, Dharmacon, Cherry-picked library of siRNA pools for the proteins of interest)
Control siRNAs
Non-targeting control siRNA (GE Healthcare Dharmacon, catalog number: D-001810-10-20 )
siRNAs for autophagy modulation:
ATG12 (GE Healthcare Dharmacon, catalog number: J-010212-07 )
PIK3C3 (GE Healthcare Dharmacon catalog number: J-005250-09 )
RAB7A (GE Healthcare Dharmacon, catalog number: J-010388-07 )
Raptor siRNA sequence: GAUGAGGCUGAUCUUACAGUU (MWG)
Water DNase/RNase free, sterile (Thermo Fisher Scientific, GibcoTM, catalog number: 10977035 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 31434 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541-500G )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: 71640-250G )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5379-100G )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190094 )
Poly-L-lysine solution (Sigma-Aldrich, catalog number: P4707-50ML )
Optimal modified Eagle’s medium (Opti-MEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 31985062 )
Lipofectamine RNAiMax (Thermo Fisher Scientific, InvitrogenTM, catalog number: 13778150 )
Paraformaldehyde (PFA) 4% in PBS (Santa Cruz Biotechnology, catalog number: sc-281692 )
Triton X-100 (VWR, catalog number: 28817.295 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7906-100G )
Anti-ATG12 (Cell Signaling Technology, catalog number: 2010 )
Anti-GABARAP (Abcam, catalog number: ab109364 )
Anti-LC3B (MBL International, catalog number: PM036 )
Anti-STX17 (Sigma-Aldrich, catalog number: HPA001204 )
Anti-WIPI2 (Abcam, catalog number: ab105459 )
Alexa Fluor 488 goat anti-rabbit IgG (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11008 )
Alexa Fluor 488 goat anti-mouse IgG (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11001 )
CellMask Deep red stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: H32721 )
DRAQ5 (Cell Signaling Technology, catalog number: 4084S )
Phosphate-buffered saline (PBS, pH 7.4) (see Recipes)
Note: Plan ahead and order the total amount of reagents needed for the whole screen to avoid running out of any reagent while actually performing the screen.
Equipment
Pipette
Cell culture Incubator (37 °C, 5% CO2)
Centrifuge 5810R (Eppendorf, model: 5810 R , catalog number: 5811000010), rotor A-4-62 with well plate centrifugation inlays (Eppendorf, catalog number: 5810711002)
Cell culture sterile bench
Automated dispenser (MicroFill 96-/384-Well Microplate Dispenser) (BioTek Instruments, model: AF1000A )
12-channel multichannel pipette (30-300 µl) (NeoLab, catalog number: E-1945)
Manufacturer: Eppendorf, model: Research® plus .
12-channel multichannel pipette (10-100 µl) (NeoLab, catalog number: E-1943)
Manufacturer: Eppendorf, model: R esearch® plus .
Selma pipetting robot 96/25 µl (Analytik Jena, CyBio®, catalog number: OL7001-26-211 ) with 384-well plate adaptor (Analytik Jena, CyBio®, catalog number: OL7001-24-976 )
TipTray 96; 25 µl, PCR certified, sterile (Analytik Jena, CyBio AG, catalog number: OL3800-25-733-P )
Neubauer counting chamber (Marienfeld-Superior, catalog number: 0640110 )
Opera LX High Content Screening System with a 60x water-immersion objective and a robotic plate handler II 230 consisting of:
Opera LX 488/561/640 Microscope (PerkinElmer)
Water Objective 63x (PerkinElmer)
Plate handler II 230 (PerkinElmer)
Note: The Opera LX is discontinued.
Software
Excel (Microsoft)
Prism 4 (GraphPad)
Barcode generator (http://barcode.tec-it.com/de)
Acapella High Content Imaging Analysis Software (PerkinElmer)
Procedure
Note: All steps before cell fixation require processing under a sterile bench.
Maintaining U2OS cells
Culture U2OS cells in DMEM, supplemented with 10% FBS, 2 mM glutamine as well as 1% P/S and incubated in a humidified cell culture incubator at 37 °C and 5% CO2.
Frequently (~two times a week) passage cells after attaining approximately 80% confluency using 0.25% trypsin/EDTA.
For long-term storage freeze cells at -150 °C in FBS containing 10% DMSO.
Note: Freeze enough cell aliquots at the same time to perform the entire screen from one batch.
Prepare enough 10 cm tissue culture dishes with U2OS cells to have sufficient cells of 70-80% confluency for the planned siRNA screen at the assay day. For two 384-well plates, one 10 cm dish should be sufficient.
Reverse siRNA transfection of U2OS cells (Figure 1A)
Figure 1. Scheme of the siRNA screening procedure. A. Lyophilized siRNAs in 96-well plates are solubilized and then diluted with water to receive a Stock2 plate containing siRNAs with a concentration of 1 µM, which is combined with a Lipofectamine RNAiMax-Opti-MEM-Mix (Lipo plate) and transferred to a 384-well imaging plate. U2OS cells are added prior to incubation of the 384-well plates. Finally, cells are fixed, immunostained and imaged followed by image and data analysis. B and C. It is recommended to avoid using the outer rim of the 96 (B) or 384 (C) well plates indicated by black wells to prevent edge effects.
Resuspend lyophilized siRNA pools (Stock1 plate)
Bring ordered 96-well plates containing the lyophilized siRNAs (0.1 nmol) from -80 °C storage to sterile bench after short centrifugation.
Equip pipetting robot (Selma) with new tips.
Dispense 15 µl RNase free water in every well of a 96-well v-bottom plate using a multi-channel pipette (H2O plate).
With the automated pipetting robot resuspend the lyophilized siRNA by transferring 10 µl RNase free water from the H2O plate into the siRNA containing 96-well plates from Dharmacon to obtain a 10 µM stock siRNA solution (Stock1 plate). Mix well by pipetting up and down using the automated pipetting robot in the ‘mixing cycles’ mode.
Notes:
Be careful to arrange the control siRNAs properly amongst the screening siRNAs (e.g., randomly across the plate but at least one control per lane) while ordering the 96-well plates with lyophilized siRNAs. Thereby, an extra step is avoided where the siRNAs have to be rearranged in a suitable sequence/order for the screen.
Do not use the outer rim of 96-well plates (A1-A12, H1-H12, B1, C1, …, B12, C12, …) to avoid edge effects (Figure 1B, black edges).
Especially whilst using the automated pipetting robot constantly check the orientation of your plate. Always position the well A1 in one specific corner and remember the orientation. Most 96-well plates contain one notched corner for easier orientation.
Discard H2O plate or also use for dilution of Stock2 plate when directly proceeding with protocol.
Cover Stock1 plate with an aluminum seal and store at -80 °C or proceed with protocol.
Count U2OS cells with Neubauer counting chamber
Wash every 10 cm dish containing U2OS cells with 2 ml sterile PBS (see Recipes). Then, add 1.5 ml trypsin per dish and incubate for approximately 5 min at room temperature until the cells are detached.
Block trypsin activity by addition of 8 ml DMEM supplemented with 10% FBS, 2 mM glutamine but without P/S (DMEM(-)P/S).
Pool all cells for the screening assay in one flask (e.g., common sterile 15 ml or 50 ml Falcons).
Transfer 10 µl of the pooled cell solution into a Neubauer counting chamber and count cells under a light microscope.
Dilute U2OS cells with DMEM(-)P/S to obtain a cell density of 7.14 x 104 cells/ml (1,500 cells in 21 µl).
Note: Perform the cell counting before the 384-well imaging plate preparation to reassure the necessary number of cells is available.
Dilute siRNAs from Stock1 plate to obtain a 1 µM working solution in a Stock2 plate.
The amounts described here are sufficient for one full 384-well imaging plate loaded in quadruplicates. If more 384-well imaging plates are necessary for the screen, adjust the amounts accordingly.
Dispense 15 µl H2O in every well of a 96-well v-bottom plate using a multi-channel pipette (H2O plate).
With the automated pipetting robot using the ‘sample dilution’ mode pipette 9 µl RNase free water from the H2O plate and then add 1 µl from the Stock1 plate into the same tips and release both together in a new 96-well v-bottom plate to obtain a siRNA working solution of 1 µM (Stock2 plate). Mix well by pipetting up and down using the ‘mixing cycles’.
Prepare reverse siRNA transfected U2OS cells in 384-well imaging plates with a final siRNA concentration of 30 nM.
Transfer 30 µl poly-L-lysine into every well of a 384-well imaging plate using a multi-channel pipette and incubate for at least 1 h at room temperature. Remove the poly-L-lysine from the 384-well imaging plate using a multi-channel pipette and discard. Let the 384-well imaging plate dry for a couple of minutes.
Mix 3,382 µl Opti-MEM with 38 µl Lipofectamine RNAiMax and place in reservoir (Lipo-Opti-Mix). For each 384-well this corresponds to 8.9 µl Opti-MEM and 0.1 µl Lipofectamine RNAiMax. The excess amount is prepared to assure enough liquid for the automated pipetting robot.
Transfer 50 µl Lipo-Opti-Mix in every well of a 96-well v-bottom plate using a multi-channel pipette (Lipo plate). Again, do not use the outer rim (Figures 1B and 1C).
Equip automated pipetting robot with new tips.
With the automated pipetting robot using the ‘sample dilution’ mode absorb 9 µl Lipo-Opti-Mix from the Lipo plate and subsequently 0.9 µl siRNA from the Stock2 plate into the same tips and release into the first replicate well of the 384-well imaging plate (Figure 1C, green wells).
Note: Again, check the orientation of your plate.
Repeat 3 times to receive quadruplicates from one siRNA pool on the 384-well imaging plate (Figure 1C, grey wells).
Incubate siRNA-Lipo-Opti-Mix in 384-well imaging plate for 20 min at room temperature.
Dispense 21 µl DMEM(-)P/S including 1,500 U2OS cells per well (total volume 11.76 ml for one 384 plate) from a reservoir into each well of the 384-well imaging plate using a multi-channel pipette. Ensure that the liquid dropped to the well bottom or gently centrifuge plate if necessary. Gentle mixing by slowly pipetting up and down with a multi-channel pipette is possible but usually not necessary. While mixing, use new tips for every siRNA. 96- and 384-well plates can be centrifuged at 161 x g with the appropriate plate inlays for centrifuges.
Note: Given that cells quickly sink onto the reservoir bottom (only approximately 1 min equal distribution), mix cells in the reservoir regularly.
Dispense 30 µl DMEM(-)P/S into each well of the 384-well edge (Figure 1C, black wells) using a multi-channel pipette to avoid edge effects.
Incubate 384-well imaging plate in cell culture incubator for 72 h.
Fixation and Immunostaining of cells
Discard liquid from 384-well plates in proper cell culture waste.
U2OS cells in the 384-well plates are fixed with 50 µl 4% PFA per well for 15 min at room temperature pipetted with a multi-channel pipette. Discard liquid in PFA waste in sealed glass bottles and check department instructions for proper waste disposal as suggested by the EH&S Chemical Waste Program.
Wash cells for three times with 100 µl self-made PBS per well using a multi-channel pipette. Remove the PBS by turning the plate upside-down on top of a sink.
Store plate containing 100 µl PBS per well at 4 °C or directly continue immunostaining protocol.
Discard liquid.
Using a multi-channel pipette, permeabilize cells with 50 µl 0.5% Triton X-100 in PBS per well and incubate for 10 min at room temperature. Discard liquid.
Block cells with 100 µl 1% BSA in PBS per well transferred with a multi-channel pipette and incubate for 1 h at room temperature. Discard liquid.
With an automated dispenser, wash cells once with 100 µl self-made PBS per well. Discard liquid.
Prepare primary antibody solution (either anti-ATG12 1:50; anti-GABARAP 1:200; anti-LC3B 1:800; anti-STX17 1:250; or anti-WIPI2 1:500 in 0.1% BSA in PBS) and distribute 20 µl per well with a multi-channel pipette. Incubate cells for 1 h at room temperature and then discard liquid.
Note: Every 384-well plate is only stained with one primary antibody.
With an automated dispenser, wash cells for three times with PBS as described above.
Prepare secondary antibody solution (anti-rabbit or anti-mouse Alexa Flour 488, 1:1,000 in 0.1% BSA in PBS) and distribute 20 µl per well with a multi-channel pipette. Incubate cells for 1 h at room temperature and then discard liquid.
Prepare cytoplasmic staining solution (HSC CellMask Deep red stain 1:25,000,000 in 0.1% BSA in PBS) and distribute 20 µl per well with a multi-channel pipette. Incubate cells for 1 h at room temperature and then discard liquid.
Prepare nuclear staining solution (DRAQ5, 1:5,000 in 0.1% BSA in PBS) and distribute 20 µl per well with a multi-channel pipette. Incubate cells for 10 min at room temperature and then discard liquid.
With an automated dispenser, wash cells for three times with PBS as described above.
After the third wash, distribute 100 µl sterile PBS per well with a multi-channel pipette and seal the 384-well imaging plate with an aluminum seal to avoid exposure to light. Store plate at 4 °C until image acquisition.
Note: This last step is performed with a multi-channel pipette and sterile PBS to prolong storability of the imaging plates.
Data analysis
Image acquisition
Choose the 60x water-immersion objective on a PerkinElmer’s Opera High Content Screening System microscope to receive a resolution suitable for intracellular spot detection.
Note: Phagophores and autophagosomes are detected as intracellular spots with the microscope.
Adjust the necessary laser intensity and plane height according to the used antibody.
Note: Acquire images sequentially, first in the 488-channel and then in the 633-channel.
Set the plate layout and select the number and distribution of fields per well.
Note: For U2OS cells 24 fields per well for 4 wells will approximately add up to more than 1,000 cells in all the images.
Save the settings.
Set parameters for the Opera robotic plate handler (e.g., the location of the plates in the plate holder) and save settings to sequentially measure more than one plate.
Label your plates with individual bar codes for each plate using http://barcode.tec-it.com/de. Print the bar codes and glue them onto the plates.
Place all 384-well imaging plates into the plate holders.
Note: Be aware of the proper orientation of the plate.
Start bulk measurement with the saved settings to automatically image one plate after another with help of the robotic arm.
Remove plates from stacker and keep at 4 °C or discard.
Shut down the Opera microscope.
Image analysis
Open the Acapella High Content Imaging Analysis Software and load your image analysis script for spot detection.
Set the general parameters, e.g., 488 equals channel one, where intracellular spots are detected, 633 equals channel two, where nuclei and cytoplasm are detected, according to the actual measurement.
Set script parameters including contrast, area and the detection algorithm to properly segment nuclei, cytoplasm and spots in every cell. See Figure 2 for example images.
Figure 2. Image segmentation. Example images for proper image segmentation of the nuclei (left), the cytoplasm (middle) and the spots (right). Spots represent phagophores stained with anti-WIPI2 antibody. Scale bars = 40 µm.
Save all settings and load these parameters into the script next time.
Run the analysis for a couple of images (well mode), which are obtained from assay specific control siRNAs and check the output results. Perform minor adjustments to the parameters if necessary (e.g., contrast can slightly vary for plates immunostained on different days).
Note: Especially in the script preparation phase always compare the output results with a manual count of your acquired images. Manual counting means that a person actually counts the number of spots by hand. If the image quantification output results don’t match your own manual count, adjust the parameters until you are satisfied with the output result.
Run the script in batch mode for the all the images in the whole 384-well imaging plate and save the output results as Excel file.
Representative example images for all the different antibody stainings are shown in Jung et al., 2017.
Candidate determination
Average raw data of quadruplicates for every siRNA in Excel (in this assay the number of spots) and calculate the standard deviation.
Normalize the output results (number of spots) per siRNA to non-targeting control siRNA for every 384-well plate. See Table 1 for an imaginary data example.
Table1. Imaginary data example for the staining with LC3B based on Jung et al. (2017), to explain data normalization and candidate selection. Number of spots were quantified using the Acapella Software. For normalization, the number of spots of every siRNA was divided by the number of spots of the non-targeting control siRNA. This yielded a fold change of 3.2 or 0.3 for the positive or negative control siRNAs, respectively. Furthermore, the target siRNAs 2 and 3 would have been selected as candidates for LC3B, according to the standard deviation criterion. As example the average standard deviation for LC3B was approximately 23%, a selected increasing or decreasing candidate siRNA comprises a fold-change of 1.46 or higher (1.0 + 2 x 23%) or 0.54 or lower (1.0 - 2 x 23%), respectively.
Compare the fold-change of all tested siRNAs from all plates with each other.
Classify candidate siRNAs with your selected method e.g., the standard deviation criteria. Here, siRNAs, whose fold-change differ for two or three standard deviations from the normalized sicon (WIPI2 and ATG12 = 3; LC3B, GABARAP and STX17 = 2) are selected as candidates. See Table 1 for an imaginary data example.
Excel can also be used to order and rank the candidates according to the fold-change difference to elucidate the top candidates.
Prism 4 (GraphPad) was applied to generate diagrams and for statistical analysis (ANOVA).
Representative example graphs are shown in Jung et al., 2017.
Perform a deconvolution screen with four individual siRNAs per gene for your top candidates using the same procedure as for the siRNA pool screen described above.
Classify validated candidates, which differ in the standard deviation criterion as above for three out of four siRNAs per gene.
Exclude toxic siRNAs, which showed obvious changes in number of cells as well as in the intensity and area of the nucleus or of the cytoplasm. Remove genes with more than one cytotoxic siRNA for further analysis.
General considerations for screening approaches
Think about the proper cell line for the screening approach. The human osteosarcoma cell line used for this image-based autophagy screen is adherent and provides a big cytoplasm, which makes this cell line appropriate for immunostaining and imaging. Furthermore, autophagy can be induced as well as inhibited in U2OS cells. In addition, siRNA transfection is very efficient in this cell line. According to these properties, U2OS cells are well suited for an image-based autophagy siRNA screen. We assume that e.g., HeLa, A549 or LN229 cells would also be suitable for this screening approach.
Using your method of choice including immunofluorescence, immunoblot or RT-qPCR, check that your assay control siRNAs actually provide an efficient knockdown of the intended target genes and induce the expected phenotype in your chosen cell line.
Elucidate the number of cells per well necessary for a good but not crowded well coverage with your chosen cell line (e.g., ~80% well coverage). As explanation, a lot of empty space in between cells might cause long image acquisition times and image analysis artefacts. Usage of too many cells might cause them to grow on top of each other, which again might introduce image analysis artefacts. To determine the proper cell number, transfect cells with control siRNAs and use several different cell densities (e.g., 500-10,000 cells per well). Perform staining, imaging and analysis to determine the proper number of cells for seeding.
Elucidate the suitable transfection reagent and siRNA (different companies) for your application. Therefore, transfect U2OS cells with different transfection reagents and assay control siRNAs. Perform staining, imaging and analysis to determine the best transfection reagent, which does not interfere with the selected screening pathway (autophagy in this case). Also, different amounts of the selected transfection reagent can be used for optimal knockdown efficiencies.
In this image-based autophagy screen immunofluorescence staining of proteins at endogenous levels with antibodies is applied. To reduce costs the highest possible antibody dilution with a detectable immunofluorescence signal should be determined. Therefore, seed U2OS cells in your imaging plate and stain using a dilution series of your antibody. Perform imaging and analysis to determine the lowest amount of antibody necessary. The dilution series can also be performed with secondary antibodies, the nuclear and the cytoplasm stain.
While determining the proper ‘wet lab’ screening condition, start the script development. Elucidate the correct parameters to detect your phenotype, in this case number of spots. Always compare the number of spots calculated by the script with the actual pictures for a few randomly selected images to make sure that the script is counting properly.
Apply normalization techniques thoroughly (for example, normalization per plate to non-targeting control siRNAs) and carefully select the criteria to define candidates. The 2-3 times fold-change of the aberration of standard deviations is often applied. Other potential methods are Z- and B-score normalization, especially for genome-wide siRNA screens.
Imply cytotoxicity measures into the script, since toxic siRNAs can result in false positive hits. For example, compare number of cells and other general criteria such as area and intensity of the nucleus and the cytoplasm and remove siRNAs with an obvious aberration.
Apply statistics to control your screening conditions and off-target effects such as the correlation of output results between repetitions or between individual and pool siRNAs, respectively.
Think about and establish downstream assays to mechanistically validate your candidates. Typical methods to study autophagy modulation include GFP/RFP-based autophagy flux assays and immunoblot analysis with autophagy markers such as LC3B or p62. Further on, localization of the candidate protein as well as co-localization of the candidate with early and late autophagic markers can be determined by confocal microscopy.
Recipes
Phosphate-buffered saline (PBS, pH 7.4)
137 mM NaCl
2.7 mM KCl
9 mM Na2HPO4
3 mM KH2PO4
Acknowledgments
This protocol was adapted and modified from Jung et al., 2017, eLife. This work was supported by the Deutsche Forschungsgemeinschaft (DFG) within the framework of the Munich Cluster for Systems Neurology (EXC1010 SyNergy), the Collaborative Research Center (CRC1177) and the European Research Council (ERC, 282333-XABA).
References
Jung, J., Nayak, A., Schaeffer, V., Starzetz, T., Kirsch, A. K., Muller, S., Dikic, I., Mittelbronn, M. and Behrends, C. (2017). Multiplex image-based autophagy RNAi screening identifies SMCR8 as ULK1 kinase activity and gene expression regulator. Elife 6.
Ktistakis, N. T. and Tooze, S. A. (2016). Digesting the expanding mechanisms of autophagy. Trends Cell Biol 26(8): 624-635.
McKnight, N. C., Jefferies, H. B., Alemu, E. A., Saunders, R. E., Howell, M., Johansen, T. and Tooze, S. A. (2012). Genome-wide siRNA screen reveals amino acid starvation-induced autophagy requires SCOC and WAC. EMBO J 31(8): 1931-1946.
Orvedahl, A., Sumpter, R., Jr., Xiao, G., Ng, A., Zou, Z., Tang, Y., Narimatsu, M., Gilpin, C., Sun, Q., Roth, M., Forst, C. V., Wrana, J. L., Zhang, Y. E., Luby-Phelps, K., Xavier, R. J., Xie, Y. and Levine, B. (2011). Image-based genome-wide siRNA screen identifies selective autophagy factors. Nature 480(7375): 113-117.
Weidberg, H., Shvets, E., Shpilka, T., Shimron, F., Shinder, V. and Elazar, Z. (2010). LC3 and GATE-16/GABARAP subfamilies are both essential yet act differently in autophagosome biogenesis. EMBO J 29(11): 1792-1802.
Copyright: Jung and Behrends. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Jung, J. and Behrends, C. (2017). Protocol for Establishing a Multiplex Image-based Autophagy RNAi Screen in Cell Cultures. Bio-protocol 7(17): e2540. DOI: 10.21769/BioProtoc.2540.
Jung, J., Nayak, A., Schaeffer, V., Starzetz, T., Kirsch, A. K., Muller, S., Dikic, I., Mittelbronn, M. and Behrends, C. (2017). Multiplex image-based autophagy RNAi screening identifies SMCR8 as ULK1 kinase activity and gene expression regulator. Elife 6.
Download Citation in RIS Format
Category
Cancer Biology > Cell death > Immunological assays
Molecular Biology > RNA > RNA interference
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,541 | https://bio-protocol.org/exchange/protocoldetail?id=2541&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Staining of Membrane Receptors with Fluorescently-labeled DNA Aptamers for Super-resolution Imaging
Maria Angela Gomes de Castro
CH Claudia Höbartner
FO Felipe Opazo
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2541 Views: 8681
Edited by: Gal Haimovich
Reviewed by: Shalini Low-NamAnca Flavia Savulescu
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
One of the most prominent applications of fluorescent super-resolution microscopy is the study of nanodomain arrangements of receptors and the endocytic pathway. Staining methods are becoming crucial for answering questions on the nanoscale, therefore, the use of small and monovalent affinity probes is of great interest in super-resolution microscopy with biological samples. One kind of affinity probe is the aptamer. Aptamers are single DNA or RNA sequences that bind with high affinity to their targets and due to their small size they are able to (i) place the fluorophore in close proximity to the protein of interest and (ii) bind to most of the protein of interest overcoming the steric hindrance effect, resulting in better staining density. Here we describe a detailed protocol with which to stain live cells using aptamers and to image them with Stimulated Emission Depletion (STED) microscopy. In this protocol, the stainings were performed with commercially available aptamers that target the epidermal growth factor receptor (EGFR), the human epidermal growth factor receptor 2 (HER2 or ErbB2) and the ephrin type-A receptor 2 (Epha2). Since aptamers can be coupled to most of the popular fluorophores, we believe that the procedure presented here can be extended to the large majority of the current super-resolution microscopy techniques.
Keywords: Microscopy Super-resolution STED Aptamers Affinity probes
Background
Recent advances in super-resolution imaging techniques have led to the search for more accurate methodologies to tag cellular elements. Diffraction unlimited imaging instruments provide excellent resolutions, however standard sample staining methodologies, such as immunostaining, lack the necessary precision for the detection of cellular elements. Due to their large dimension (~15 nm in length) and high molecular weight (~150 kDa), antibodies can poorly penetrate into biological samples. Additionally, the primary/secondary antibody complex places the fluorophores at approximately 25 nm away from the target, compromising the detection accuracy. Moreover, due to the large size of the primary/secondary antibody complex, a smaller fraction of the targets can be labelled due to the steric hindrance (Fornasiero and Opazo, 2015). This leads to lower labelling density, a crucial parameter for super-resolution microscopy, especially in recognizing and describing nanostructures. To circumvent these problems, small affinity probes that bind to single targets (monovalently) such as aptamers, affibodies or nanobodies have been tested in recent years (Rothbauer et al., 2006; Opazo et al., 2012; Ries et al., 2012) and are becoming valuable tools for super-resolution microscopy. Nanobodies, affibodies and aptamers have a relatively small linear size (~3 nm, ~2 nm and ~3 nm, respectively). This property allows them to place the fluorescent dye in close proximity to the target, penetrate samples in a more efficient manner and bind to a higher fraction of target proteins, bypassing the effect of steric hindrance observed by antibodies (Ries et al., 2012; Mikhaylova et al., 2015). In a previous study we made a systematic comparison between three commercially available aptamers and antibodies that target the epidermal growth factor receptor (EGFR), the human epidermal growth factor receptor 2 (HER2 or ErbB2) and the ephrin type-A receptor 2 (Epha2). Our results showed that aptamers were able to find more epitopes (resulting in higher labeling density). As a consequence, several structural features of the subcellular components that were imaged became more apparent. Among these, the inner lumen and the complex morphology of endocytic organelles were visible. For these reasons, smaller imaging tools are becoming the preferred choice over antibodies, in order to improve the quality of an immunolabeling super-resolution approach and allow a more precise description the localization and the distribution of membrane receptors (Gomes de Castro et al., 2017).
Materials and Reagents
Biospin 6 column (Micro Bio-SpinTM P-6 Gel Columns, Tris Buffer) (Bio-Rad Laboratories, catalog number: 7326222 )
Cell culture 12-well plates (Thermo Fisher Scientific, catalog number: 150628 )
18 mm diameter round glass coverslips (Gerhard Menzel, catalog number: CB00180RA1 )
15 ml tubes
PCR tubes
Parafilm M
Soft paper tissue
Gloves
Microscopy glass slides
2 ml tubes
Vacuum filtration (e.g., VWR® Vacuum Filtration Systems, Standard Line) (VWR, catalog number: 10040-436 )
0.2 µm syringe filter
Transfer pipette
The images shown in Figure 1 are from aptamers against human:
EGFR (5’-SH-EGFR aptamer-3’, seq # 2369-27-02, 50 mer)
ErbB2 (5’-SH-ErbB2 aptamer-3’, seq # 1194 ± 35, 40 mer)
Epha2 (5’-SH-EphA2 aptamer-3’, seq # 2176-01-01, 76 mer)
Note: They were produced by Aptamer Sciences, Inc., South Korea and supplied by AMS Biotechnology, Europe. All three aptamers contain the chemical modification 5-(N-benzylcarboxyamide)-2’-deoxyuridine (5-BzdU) in unrevealed locations.
Triethylammonium acetate buffer pH 7.0, 1 M (TEAA) (AppliChem, catalog number: A3846 )
Maleimide Atto647N dye (Atto-TEC, catalog number: AD 647N-41 )
Dimethyl sulfoxide, anhydrous (DMSO) (Sigma-Aldrich, catalog number: 276855 )
Sodium chloride (NaCl)
Ethanol
1x Dulbecco’s phosphate buffered saline (1x DPBS) (Sigma-Aldrich, catalog number: D8662 )
Acetonitrile
Trypsin-EDTA solution (Lonza, catalog number: 17-161E )
Ultrapure DNase- and RNase-free distilled water (Carl Roth, catalog number: T143.2 )
Tris (2-carboxyethyl) phosphine hydrochloride (TCEP) (Sigma-Aldrich, catalog number: C4706 )
Sodium hydroxide (NaOH)
DMEM, high glucose medium, no glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 11960044 )
Fetal bovine serum (FBS) (Biochrom, catalog number: S 0615 )
L-Glutamine 200 mM (Lonza, catalog number: BE17-605E )
Penicillin/streptomycin 10,000 U/ml, each (Lonza, catalog number: 17-602E )
RPMI 1640 medium, no glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 21870076 )
Poly-L-lysine (PLL) (Sigma-Aldrich, catalog number: P5899-5MG )
Sodium phosphate dibasic (Na2HPO4)
Potassium phosphate monobasic (KH2PO4)
Potassium chloride (KCl)
Magnesium chloride hexahydrate (MgCl2·6H2O)
Salmon sperm DNA, sheared, 10 mg/ml (Thermo Fisher Scientific, catalog number: AM9680 )
Dextran sulfate sodium salt (Sigma-Aldrich, catalog number: 31404 )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: P6148 )
Glycine (Sigma-Aldrich, catalog number: G8898 )
Mowiol® (Sigma-Aldrich, catalog number: 81381 )
1 M Tris (2-carboxyethyl) phosphine hydrochloride stock solution (TCEP) (see Recipes)
Complete DMEM medium (see Recipes)
Complete RPMI medium (see Recipes)
Poly-L-lysine (PLL) stock solution (see Recipes)
5x phosphate buffer saline (5x PBS) (see Recipes)
25 mM MgCl2 solution (5x MgCl2) (see Recipes)
Blocking solution (see Recipes)
4% paraformaldehyde (PFA) (see Recipes)
Quenching solution (see Recipes)
Mowiol® (see Recipes)
(Optional) Buffer A (see Recipes)
(Optional) Buffer B (see Recipes)
Equipment
Microcentrifuge (e.g., Eppendorf, model: 5415 or similar)
Nucleosil 100-5 C18 column
(Optional) Dionex DNAPac PA200 4 x 250 mm column
Hemocytometer
Cell culture hood
Thermal cycler
Aluminum metal plate (length x width x thickness [cm]: e.g., 20 x 12 x 2)
Cell culture incubator
Half-curved-forceps
Oven
STED microscope, Leica pulsed STED setup composed by a True Confocal System (TCS) STED SP5 (Leica Microsystems, model: Leica TCS SP5 ) fluorescence microscope equipped with a 100x 1.4 NA HCX PL APO oil objective (Leica Microsystems, Germany)
Pulsed laser (PicoQuant, Germany)
Sapphire tunable laser (Mai Tai Broadband, Spectra-Physics, USA)
Glass beaker
Magnetic stirrer
Lab coat, eye protection
Software
ImageJ (http://imagej.nih.gov/ij/docs/index.html)
MATLAB (MathWorks, Massachusetts, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gomes de Castro, M. A., Höbartner, C. and Opazo, F. (2017). Staining of Membrane Receptors with Fluorescently-labeled DNA Aptamers for Super-resolution Imaging. Bio-protocol 7(17): e2541. DOI: 10.21769/BioProtoc.2541.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fixed-cell imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,542 | https://bio-protocol.org/exchange/protocoldetail?id=2542&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Rearing of Culex spp. and Aedes spp. Mosquitoes
EK Elizabeth Kauffman
AP Anne Payne
MF Mary A. Franke
Michael A. Schmid
EH Eva Harris
LK Laura D. Kramer
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2542 Views: 14620
Edited by: Alka Mehra
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Mosquito-transmitted pathogens cause major public health problems and contribute substantially to the global burden of disease. Aedes mosquitoes transmit dengue, Zika, yellow fever, and Chikungunya viruses; Culex mosquitoes transmit West Nile, Japanese encephalitis, and Saint Louis encephalitis viruses, among others. Experiments utilizing laboratory-reared colonized mosquitoes can address many issues such as vector biology, vector competence, vector-pathogen interaction, and vector control. The establishment of healthy and standardized mosquito colonies requires generation and implementation of protocols, attention to detail, and an understanding of the factors that affect mosquito fitness, such as temperature and humidity, nutrient quality and availability, population density, blood feeding and mating behavior, and egg-laying requirements. Here, we present a standard protocol for the rearing of Culex spp. and Aedes spp. mosquitoes and maintenance of the mosquito colony.
Keywords: Mosquito Egg Larva Pupa Adult Colony Blood-feeding Aedes Culex
Background
Mosquitoes undergo complete metamorphosis with four life stages: egg, larva, pupa, and adult. The immature stages are always aquatic. Successful maintenance of mosquitoes in the laboratory depends on providing conditions that are optimal for each developmental stage. These requirements will vary with species, and in fact, many mosquito species, such as Cx. restuans, have not been colonized successfully in the lab. Colony maintenance is a labor-intensive process requiring time and attention to detail in handling and record keeping. When standard protocols are successful, the fitness of the mosquitoes is maintained and their suitability for repeatable experimentation is optimal. This protocol is designed for colonization and maintenance of fresh water Culex species and container-breeding Aedes species. It has been used successfully with Cx. pipiens, Cx, quinquifasciatus, Cx. tarsalis, Ae. aegypti, Ae. albopictus, Ae. triseriatus, and Ae. japonicus, among others.
Since most diseases transmitted by mosquitoes are BSL-2 and BSL-3 biological agents, experimental research with these vectors requires containment based on established guidelines (Benedict et al., 2004) as well as cooperation with institutional biosafety committees. Work with non-indigenous species also requires containment that assures no escape will occur. The Arbovirus Insectary Facility, Wadsworth Center, New York State Department of Health in Albany, NY consists of connecting arthropod BSL-2 (ABSL-2) and ABSL-3 labs. Mosquito rearing is carried out in the ABSL-2 facility under ABSL-2 guidelines. These containment guidelines are important to prevent escape of mosquitoes into the surrounding environment, preventing introduction of new species. Mosquitoes that will be infected with virus for experimental purposes are transferred into the ABSL-3 facility and handled following arthropod ABSL-3 guidelines. The mosquitoes are transferred into the ABSL-3 lab via a pass-through chamber that can be accessed from only one side at a time.
See references (Gerberg et al., 1994; Higgs and Beaty, 1996; Higgs, 2005; Imam et al., 2014) for additional information on mosquito rearing and containment.
Materials and Reagents
Clear polystyrene cups, disposable, capacity 250 ml, height 7.5 cm, bottom diameter 5 cm, top diameter 8.5 cm (e.g., Solo, clear plastic cup, 9 oz, https://www.solocup.com/products/clear-plastic-cup/)
Wooden applicator sticks
Oviposition dish for Aedes spp.: black plastic dish (ramekin), approximately 10 cm width x 5 cm height (e.g., Portion cup, black plastic soufflé, WebstaurantStore Food Service and Supply, catalog number: 127P400B )
Note: The dish is half-filled with distilled water, and brown seed germination paper (Anchor Paper Company, 38-lb regular weight creped seed germination paper) or a fluted coffee filter with bottom removed is placed partially submerged around the edges.
Plastic bag
Damp sponge
Transfer pipets, 1 ml, polyethylene, disposable (Biologix, catalog number: 30-0135 )
Paper towel
Mosquito emergence jars (Mosquito Breeder) (BioQuip, catalog number: 1425 )
Note: The apparatus consists of two plastic 1-liter (L) jars that can be screwed together. Water and mosquito larvae are placed in the bottom jar, and emerging adults fly into the upper portion. A mesh hole is provided on top for respiration and food. The BioQuip breeder is equipped with a funnel between the upper and lower units, but in our insectary, better viability of the adults has been achieved by removing the funnel.
Mosquito-holding cartons, created from 0.5- or 1-L ice cream cartons or white food containers with lids (Solo, catalog number: KH16A-J8000 , https://www.solocup.com/; available also from Amazon.com). See Note 1 for details on how to modify for mosquito containers
Fish net, 10 cm, with fine-mesh netting
T-175 flasks (e.g., NuncTM Non-treated Flasks, Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 178883 )
Cotton coil (e.g., Fantasea 100 % Cotton Coil/12 M per Bag (FSC501), available at Amazon.com)
Petri dish cover
15-ml conical centrifuge tube
Natural hog sausage casing, available in coils of approximately 32-35 mm diameter, in brine, available at local butcher shops or on-line
Note: Store in air tight container at 4 °C for up 6 months. Do not freeze.
Gloves
0.22 µm Nalgene vacuum filter unit
Tulle fabric
Duct tape
Gorilla glue (Gorilla Glue Company, Cincinnati, Ohio), or other polyurethane adhesive that expands slightly as it dries
Culex spp. and Aedes spp. Mosquitoes
Larval food: Kaytee Koi’s Choice Premium Fish Food (available at pet supply stores such as PetSmart or Petco, or at Amazon.com)
Note: Prepare by grinding in coffee grinder or blender, store in aliquots at -20 °C for up to 6 months. Another brand of koi premium fish food could be substituted.
Sugar cubes (e.g., Domino Dots sugar cubes)
Defibrinated chicken blood for Culex rearing (100 ml, Colorado Serum, catalog number: 31143 ); defibrinated sheep blood for Aedes rearing (100 ml, Colorado Serum, catalog number: 31123 )
Note: Store at 4 °C and use within 2 weeks.
Bleach
Ethyl alcohol 190 proof (PHARMCO-AAPER, UN1170; http://www.pharmcoaaper.com)
Sucrose (Avantor Performance Materials, J.T. Baker®, catalog number: 4072-07 )
70% ethanol (see Recipes)
10% sucrose solution (see Recipes)
50% sucrose solution (see Recipes)
Equipment
Grinder for preparation of larval food (coffee grinder or blender)
Flask, side-arm filtering, 2 L capacity
Mosquito cages, collapsible, aluminum frame, aluminum 20 x 20 mesh, nylon feeding hammock, access through knitted polyester stockinette sleeve; sizes 30 cm3, 46 cm3, or 60 cm3 (BioQuip, catalog number: 1450 )
Larval flats, 35.6 cm length x 27.9 cm width x 8.3 cm height (Sterilite, catalog number: 1963 )
Note: Maximum liquid capacity 1 L to prevent spillage during transport.
Glove box, side entry, acrylic, size 30 x 24 x 24 inches (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: H50026-0000 )
Spray bottle
Water bath
Freezer
1-L glass bottle
Magnetic stir plate
Dissecting microscope (e.g., Carl Zeiss, model: Stemi 2000 )
Battery-powered aspirator (Clarke, catalog number: 13500 )
Note: It consists of a handheld ‘flashlight’ aspirator body operating off two D-cell batteries, a 16-cm length x 1.25 cm diameter inlet tube, which connects via a stopper into a collecting tube (5 cm height x 2.5 cm diameter) screened on one end.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kauffman, E., Payne, A., Franke, M. A., Schmid, M. A., Harris, E. and Kramer, L. D. (2017). Rearing of Culex spp. and Aedes spp. Mosquitoes. Bio-protocol 7(17): e2542. DOI: 10.21769/BioProtoc.2542.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,543 | https://bio-protocol.org/exchange/protocoldetail?id=2543&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Multicolor Stimulated Emission Depletion (STED) Microscopy to Generate High-resolution Images of Respiratory Syncytial Virus Particles and Infected Cells
Masfique Mehedi*
MS Margery Smelkinson*
JK Juraj Kabat
Sundar Ganesan
PC Peter L. Collins
UB Ursula J. Buchholz
*Contributed equally to this work
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2543 Views: 8866
Reviewed by: Angela CoronaKristin Shingler
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
Human respiratory syncytial virus (RSV) infection in human lung epithelial A549 cells induces filopodia, cellular protrusions consisting of F-actin, that extend to neighboring uninfected cells (Mehedi et al., 2016). High-resolution imaging via stimulated emission depletion (STED) microscopy revealed filamentous RSV particles along these filopodia, suggesting that filopodia facilitate RSV cell-to-cell spread (Mehedi et al., 2016). In this protocol, we describe how to fix, permeabilize, immunostain, and mount RSV-infected A549 cells for STED imaging. We show that STED increases resolution compared to confocal microscopy, which can be further improved by image processing using deconvolution software.
Keywords: RSV A549 STED microscopy Filopodia Cell-to-cell spread Immunofluorescence Confocal microscopy
Background
RSV forms pleomorphic virus particles, with a predominance of long filaments about 100 nm in diameter and up to about 10 µm in length (Bachi and Howe, 1973; Mehedi et al., 2016). High-resolution light microscopy techniques are key to visualizing the interactions between RSV infected cells and virus particles. In a recent study, we used super-resolution fluorescence microscopy to study RSV cell-to-cell spread in human lung epithelial A549 cells.
STED microscopy is one of the super-resolution microscopy techniques that have been developed to circumvent the limitations imposed by the ~200 nm diffraction barrier of light (Hell and Wichmann, 1994; Westphal et al., 2008). STED is based on confocal fluorescence microscopy and employs a pair of lasers, namely a pulsed excitation source and a photon depletion source. The excitation pulse is focused on the sample and excites the fluorescent dye therein. The excitation laser is superimposed with a doughnut-shaped STED depletion laser that quenches excited dye molecules except for the doughnut hole at the very center of the excitation focus, so that emission occurs only from the narrow center. Narrowing the excitation focal point in this way allows for images to be taken at resolutions far below the diffraction limit, e.g., typically 30-80 nm. While STED imaging relies on efficient dye depletion, image resolution and intensity are limited by photobleaching inflicted upon the dye. To address these two contrasting, yet key issues that arise with STED imaging, optimal sample preparation, most notably dye selection and signal intensity optimization, are crucial. STED enabled us to state conclusively that RSV was attached to filopodia rather than merely in the vicinity, and to precisely enumerate viral particles. Here, we describe how samples were prepared for multicolor STED imaging including dye selection, fixation procedure, imaging parameters, and deconvolution. We show how STED and STED deconvolution can improve lateral resolution both qualitatively and quantitatively.
Materials and Reagents
Aerosol resistant pipette tips
20 µl (Thermo Fisher Scientific, catalog number: 21-402-551 )
200 µl pipette tips (Thermo Fisher Scientific, catalog number: 02-682-255 )
1,000 µl pipette tips pipette tips (Thermo Fisher Scientific, catalog number: 21-402-582 )
T225 cm2 flask with canted neck (Corning, Costar®, catalog number: 3001 )
Microscope slides (super clean) (Scientific Device Laboratory, catalog number: 022 )
Sterile 12 mm circle untreated cover glasses; thickness 0.13-0.17 mm (Carolina Biological Supply, catalog number: 633029 )
50 ml conical tube
24-well cell culture plate (Corning, Costar®, catalog number: 3524 )
The cell line of interest (human respiratory epithelial A549 cells [ATCC, catalog number: CCL-185 ])
Recombinant wild type RSV (A2 strain, GenBank KT992094) (virus stock with known virus titer, see Notes)
TryLE Select cell dissociation reagent, stored at room temperature (Thermo Fisher Scientific, GibcoTM, catalog number: 12563 )
Bovine serum albumin (BSA) standard (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23210 )
Anti-RSV F protein mouse monoclonal antibody (mAb) (Abcam, catalog number: ab43812 )
Anti-beta-tubulin (9F3) rabbit mAb (Cell Signaling Technology, catalog number: 2128 )
Goat anti-mouse Alexa Fluor 488 (AF488) (Thermo Fisher Scientific, catalog number: A11029 )
Goat anti-rabbit IgG-Atto 647N (Sigma-Aldrich, catalog number: 40839 )
Rhodamine phalloidin (CYTOSKELETON, catalog number: PHDR1 )
ProLong Gold Antifade Mountant (Thermo Fisher Scientific, InvitrogenTM, catalog number: P36930 )
Ultrapure methanol free formaldehyde prepared from paraformaldehyde (PFA) 16% solution, EM Grade (Polysciences, catalog number: 18814 )
F-12 medium without additives, which is sold commercially as Ham’s F-12 nutrient mix (Thermo Fisher Scientific, GibcoTM, catalog number: 11765054 )
Fetal bovine serum (FBS) (GE Healthcare, HyCloneTM, catalog number: SH30071.03 )
L-Glutamine 200 mM (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Dulbecco’s phosphate buffer saline (DPBS) (Thermo Fisher Scientific, catalog number: 14190 )
Triton X-100 (BioUltra, ~10% in H2O, Sigma-Aldrich, catalog number: 93443 )
Trypan blue 0.4% solution (Lonza, catalog number: 17-942E )
F-12 complete medium (see Recipes)
4% PFA (see Recipes)
0.05% Triton X-100 (see Recipes)
3% BSA (see Recipes)
Equipment
Pipettes (Mettler-Toledo, RAININ, model: Pipet-Lite XLS )
Humidified CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Steri-CultTM )
Centrifuge (Beckman Coulter, model: Allegra 25R )
Leica TCS SP8 STED 3X system (Leica Microsystems, model: Leica TCS SP8 STED 3X ) equipped with:
A white light excitation laser
592 nm, 600 nm, 775 nm depletion lasers
HC PL APO 100x/1.40 oil STED white objective
Gated HyD hybrid detectors
Hemocytometer (Marienfeld-Superior, catalog number: 0680030 )
Dumont NOC tweezer (Electron Microscopy Sciences, catalog number: 0103-NOC-PO-1 )
Software
Images were acquired using LAS X software (version 3.1.1.15751) (Leica Microsystems)
Images were deconvolved using Huygens deconvolution software (Huygens Essentials version 16.10.1.p3, Scientific Volume Imaging BV, Hilversum, The Netherlands)
PRISM software version 7
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mehedi, M., Smelkinson, M., Kabat, J., Ganesan, S., Collins, P. L. and Buchholz, U. J. (2017). Multicolor Stimulated Emission Depletion (STED) Microscopy to Generate High-resolution Images of Respiratory Syncytial Virus Particles and Infected Cells. Bio-protocol 7(17): e2543. DOI: 10.21769/BioProtoc.2543.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Microbiology > Microbe-host interactions > In vivo model
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,544 | https://bio-protocol.org/exchange/protocoldetail?id=2544&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Purification of a Mammalian P2X7 Receptor from Sf9 Insect Cells
Akira Karasawa
TK Toshimitsu Kawate
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2544 Views: 11706
Edited by: Arsalan Daudi
Reviewed by: Ching Yao YangSaswata Sankar Sarkar
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
The P2X7 receptor is an extracellular ATP-gated ion channel found only in eukaryotes (Bartlett et al., 2014). Due to its unique properties among P2X receptors, such as formation of a large conductance pore, the P2X7 receptor has been implicated in devastating diseases like chronic pain (North and Jarvis, 2013). However, mechanisms underlying the P2X7 specific properties remain poorly understood, partly because purification of this eukaryotic membrane protein has been challenging. Here we describe a detailed protocol for expressing and purifying a mammalian P2X7 receptor using an insect cell-baculovirus system. The P2X7 receptor is expressed in Sf9 insect cells as a GFP fusion protein and solubilized with a buffer containing Triton X-100 detergent. The P2X7-GFP fusion protein is then purified in a buffer containing dodecyl maltoside using Strep-Tactin affinity chromatography. Following enzymatic cleavage of the attached GFP and Strep-tag by thrombin, the P2X7 receptor is isolated using size exclusion chromatography. This method typically yields ~2 mg of purified protein from 6 L of Sf9 culture. Purified protein can be stored in a buffer containing 15% glycerol at 4 °C for at least 2 months and used for a variety of functional and structural studies (Karasawa and Kawate, 2016).
Keywords: P2X7 Sf9 Baculovirus expression system Eukaryotic membrane protein
Background
The P2X7 receptor is one of the seven subtypes of the purinergic P2X receptor family and has been a promising novel drug target for a wide range of diseases such as neurodegenerative disorders, epilepsy, and neuropathic pain (North and Jarvis, 2013; Bhattacharya and Biber, 2016). Despite the well-documented clinical relevance, mechanisms underlying P2X7 specific functions are unclear. For example, it remains controversial whether P2X7 itself converts into a large pore or if P2X7 activation leads to an opening of another large-conductance channel such as pannexin1 (Alves et al., 2014).To unambiguously unravel the P2X7 receptor specific mechanisms, it is desirable to investigate the properties of this membrane channel in vitro in the absence of other proteins. It is also extremely advantageous to capture snapshots of the P2X7 receptor conformations throughout its gating cycle using techniques like X-ray crystallography and cryo-electron microscopy. However, purification of eukaryotic membrane proteins is nontrivial due to low expression levels and instability in detergents. Furthermore, complex folding mechanisms and necessary post-translational modifications force researchers to use eukaryotic host cells, which is time and cost consuming. Though several laboratories have established their own protocols for purifying eukaryotic membrane proteins using insect cells (Karakas et al., 2011; Hattori and Gouaux, 2012), it is often challenging to mimic experimental conditions simply based on the methods reported in research papers, which normally lack tips and special notes due to space limitation. This protocol aims to provide an in-depth guide for expressing and purifying eukaryotic membrane proteins using an insect cell/baculovirus system. Based on this protocol, we have successfully purified milligram quantities of a mammalian P2X7 receptor, which we used to determine its crystal structures (Karasawa and Kawate, 2016).
Materials and Reagents
Generic pipette tips (VWR, catalog numbers: 613-0741 , 613-2133 , 613-0746 )
Petri dish, 100 x 15 mm sterile disposable, polystyrene (VWR, catalognumber: 470175-016)
Manufacturer: Akro-Mils/Myers Industries, catalog number: 2900 .
Conical bottom 15 mland 50 mlpolypropylene tubes (Greiner Bio OneInternational, catalog numbers: 188280 , 227270 )
Tube, with snap-on cap, polypropylene, 1.5 ml, 11 x 38 mm (BeckmanCoulter, catalog number: 357448 )
Neptune Microcentrifuge Tubes with Attached Flat Caps1.5 ml, 2 ml (Biotix,catalog numbers: 4445.X , 3765.X )
Greiner CELLSTAR multi well culture plates 6 wells (TC treated with lid)(Greiner Bio One International, catalog number: 657160 )
Syringe filter PVDF 0.22 μm 13 mm diameter (CELLTREAT ScientificProducts, catalog number: 229742 )
Corning 150 ml vacuum filter/storage bottle system, 0.22 µm, sterile(Corning, catalog number: 431154 )
Amicon Ultra-4 Centrifugal Filter Units MWCO 100 kDa (EMD Millipore,catalog number: UFC810024 )
Superdex 200 increase 10/300 GL (GE Healthcare, catalognumber: 28990944 )
Syringe (BD, catalog numbers: 329464 and 305559 )
CELLSTAR SerologicalPipettes 2, 5, 10, 25, 50 ml (GreinerBio One International, catalog numbers: 710107 , 606107 , 607107 , 760107 , 768180 )
Sf9 cells (Thermo Fisher Scientific, GibcoTM, catalog number: 11496015 )
pNGFP-FB3 vector (developed in the Kawate lab) harboring a P2X7 receptorgene
Note: In this protocol, panda P2X7 gene (NCBI Reference Sequence:XP_002913164.2) is used.
MAX Efficiency DH5α competent cells (Thermo Fisher Scientific, InvitrogenTM,catalog number: 18258012 )
MAX Efficiency DH10Bac competent cells (Thermo Fisher Scientific, InvitrogenTM,catalog number: 10361012 )
Liquid nitrogen (Airgas, catalog number: NI180LT230 )
Nitrogen gas (Airgas, catalog number: NIHP300 )
Sf-900 III serum free media (Thermo Fisher Scientific, GibcoTM,catalog number: 12658027 )
SOC medium (Quality Biological, catalog number: 340-031-671 )
E.Z.N.A. Plasmid Mini Kit (Omega Bio-tek, catalog number: D6942-02 )
Phenol-chloroform (Sigma-Aldrich, catalog number: 77618 )
Chloroform (Avantor PerformanceMaterials, J.T. Baker®, catalog number: 9257-02 )
100% ethanol (DeconLabs, catalog number: V1016TP )
HyClone penicillin-streptomycin 100x solution (GE Healthcare, HyCloneTM, catalog number: SV30010 )
StrepTactin SepharoseHigh Performance (GE Healthcare, catalog number: 28-9355-99 )
Human-Thrombin (Haematologic Technologies, catalog number: HCT-0020 )
Cellfectin II (Thermo Fisher Scientific, InvitrogenTM, catalognumber: 10362100 )
FuGENE 6 (Promega, catalog number: E2691 )
jetPRIME (Polyplus-transfection, catalog number: 114-15 )
Difco agar granulated (BD, DifcoTM, catalog number: 214530 )
Bacto tryptone (BD, BactoTM, catalog number: 211705 )
Bacto yeast extract (BD, BactoTM, catalog number: 212750 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S641-212 )
Kanamycin sulfate (Thermo Fisher Scientific, GibcoTM, catalognumber: 15160054 )
Gentamicin (Thermo Fisher Scientific, GibcoTM, catalognumber: 15710064 )
Tetracycline (Sigma-Aldrich, catalog number: 87128 )
Bluo-gal (Teknova, catalog number: B1210 )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (EMD Millipore, catalognumber: 420322 )
Polyethylenimine (Polysciences, catalog number: 23966-1 )
Sodium hydroxide (NaOH) (Fisher Scientific, catalog number: BP359-212 )
Phosphate buffered saline (PBS) (Fisher Scientific, catalog number: BP399-20 )
Leupeptin hemisulfate salt (Sigma-Aldrich, catalog number: L2884 )
Aprotinin (Geno Technology, G-Bioscience, catalog number: 786-046 )
Pepstatin (Enzo Life Sciences, catalog number: ALX-260-085-M100 )
Phenylmethylsulfonyl fluoride (EMD Millipore, catalog number: 52332-25G )
Triton X-100 (Anatrace, catalog number: T1001 )
Tris-base (VWR, catalog number: 97061-794 )
EDTA(Sigma-Aldrich, catalog number: EDS )
n-Dodecyl-β-D-Maltopyranoside (Anatrace, catalog number: D310 )
Hydrochloric acid (HCl) (VWR, BDH®, catalog number: BDH7204-4 )
d-Desthiobiotin (Sigma-Aldrich, catalog number: D1411 )
Glycerol (Alfa Aesar, catalog number: A16205 )
LB-Bac plate (seeRecipes)
Polyethylenimine (see Recipes)
Resuspension buffer (seeRecipes)
Solubilization buffer(see Recipes)
Washing buffer (seeRecipes)
Elution buffer (seeRecipes)
SEC buffer (see Recipes)
Equipment
Baker SterilGARDR II Biological safety Cabinet SG-600 (The Baker, model: Baker SterilGARDR II SG 600 )
Isotemp digital-control water baths (Fisher Scientific, model: Model 2310 )
Corning 250 ml polycarbonate Erlenmeyer flask with vent cap (Corning, catalog number: 431144 )
Innova 44 shaker (Eppendorf, New BrunswickTM, model: Innova® 44 , catalog number: M1282-0000)
Hemocytometer (Daigger Scientific, catalog number: EF16034F )
Vortex Genie 2 (Scientific Industries, model: Vortex Genie 2 , catalog number: SI-0236)
Evosf1 microscope (10x objective at 40% gain)
1 L Bottle with screw-on cap, polypropylene, 97 x 167 mm (Beckman Coulter, catalog number: 355676 )
JS-4.2 rotor (Beckman Coulter, model: JS-4.2 , catalog number: 339080)
Bottle assembly, polypropylene, 250 ml, 62 x 120 mm (Beckman Coulter, catalog number: 356011 )
JA-14 rotor (Beckman Coulter, model: JA-14 , catalog number: 339247)
Original Pipet-Aid pipette controller (DRUMMOND Scientific, catalog number: 4-000-110 )
4635 Cell disruption vessel (Parr Instrument, model: 4635 Cell Disruption Vessel )
Bottle, assembly, polycarbonate, 70 ml, 38 x 102 mm, 1-1/2 x 4 in, Aluminum Cap (Beckman Coulter, catalog number: 355622 )
Type 45 Ti rotor (Beckman Coulter, model: Type 45 Ti , catalog number: 339160)
Thomas pestle tissue grinder assemblies with serrated pestles 10 ml (Thomas Scientific, catalog number: 3431E15 )
500 ml plastic beaker
NanoDrop 2000 (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 , catalog number: ND-2000)
Centrifuge 5810R (Eppendorf, model: 5810 R , catalog number: 5811000428)
Centrifuge 5424 (Eppendorf, model: 5424 , catalog number: 022620401)
J6-MI High-capacity centrifuge (Beckman Coulter, model: J6-MI , catalog number: 360291)
Adaptor (Beckman Coulter, catalog number: 356096 )
Avanti J-25I floor-model, refrigerated centrifuge (Beckman Coulter, model: Avanti J-25I ,catalog number: 363106)
Optima LE-80K (Beckman Coulter, model: OptimaTM LE-80K , catalog number: 365668)
Optima TLX (Beckman Coulter, model: OptimaTM TLX , catalog number: 361544)
TLA-100.3 Rotor (Beckman Coulter, model: TLA-100.3 , catalog number: 349481)
Adapter, delrin, tube, 11 mm dia (Beckman Coulter, catalog number: 355919 )
AKTA purifier (GE Healthcare, model: ÄKTApurifier 10 , catalog number: 28406264)
Econo-Pac chromatography columns (Bio-Rad Laboratories, catalog number: 7321010EDU )
End caps, micro Bio-Spin chromatography columns (Bio-Rad Laboratories, catalog number: 7311660EDU )
Mettler Toledo–XP204–Analytical Balance (Mettler-Toledo International, model: XP204S/M , catalog number: 11130054)
OHAUS Harvard Trip Balances (OHAUS, catalog number: 80000005 )
Milli-Q Reference Water Purification System (EMD Millipore, catalog number: Z00QSV0WW )
SevenEasy pH meter (Mettler-Toledo International, catalog number: 51302819 )
Corning 500 ml polycarbonate Erlenmeyer flask with vent cap (Corning, catalog number: 431145 )
Corning 2 L polycarbonate Erlenmeyer flask with vent cap (Corning, catalog number: 431255 )
5 x 7 Inch Top PC-420D stirring plate (Corning, catalog number: 6798-420D )
Magnetic stir bars
Gravity and vacamatic sterilizers Amsco EAGLE SERIES 3000 (AMSCO, catalog number: 213415 )
Fraction collector Frac-950 (GE Healthcare, model: Frac-950, catalog number: 18608300 )
Refrigerator (Panasonic Biomedical, model: MPR-1411 )
Steadystir digital S56 (Fisher Scientific, catalog number: 14-359-756 ) or an equivalent homogenizer
Note: This product has been discontinued.
F-500BAF, Ice maker (Hoshizaki America, model: F-500BAF )
Globe Scientific Ice Bucket with Lid (Globe scientific, catalog number: IBB003P )
C1000 Touch Thermal cycler (Bio-Rad Laboratories, catalog number: 1851148 )
EVOS FL Imaging System (Thermo Fisher Scientific, catalog number: AMF4300 )
EVOS Light Cube, GFP (Thermo Fisher Scientific, catalog number: AMEP4651 )
Software
Vector NTI software 11.5 (Thermo Fisher Scientific)
Procedure
Sf9 culture (perform in a tissue culture hood except for centrifugation steps)
Sf9 cells in a cryo-vial are stored in liquid nitrogen.
Thaw an aliquot (1-2 ml) of stock Sf9 insect cells (stored in liquid nitrogen) in a 37 °C water bath and resuspend into 10 ml Sf-900 III medium.
Spin down the cells at 125 x g for 5 min, remove the medium by pipetting, and gently resuspend the cells in a 15 ml conical tube with 10 ml Sf900 III medium by pipetting up and down.
Transfer the cells into a 250 ml flask and add 15 ml of Sf900 III to make a 25 ml cell suspension.
Incubate the cells in a temperature controlled shaker at 27 °C and at 125 rpm.
Monitor the cell density every day by manually counting the number of cells using a hemocytometer.
When the cell density reaches 3.0-3.5 x 106 cells/ml (normally within 24-48 h), split the cells with Sf-900 III medium to make another 20 ml culture at 0.7 x 106 cells/ml.
Incubate the cells in a temperature controlled shaker at 27 °C and at 125 rpm.
After repeating the steps A6-A8 for 2-3 times, the doubling time should become approximately 24 h. Maintain Sf9 cultures at 0.5-3.5 x 106 cell/ml in a 250 ml flask and grow up in a larger flask for P2 virus infection.
Preparation of bacmids
The pNGFP-FB3 vector (Figure 1) harbors STREP tag, EGFP, thrombin recognition site, multiple cloning site (MCS) and a stop codon. The P2X7 receptor gene is subcloned between BamHI and XhoI sites.
Figure 1. Vector map of pNFGP-FB3. This figure is created using Vector NTI software (Thermo Fisher Scientific).
Incubate 25 μl of DH10Bac competent cells with ~100-250 ng of pNGFP-FB3[P2X7] on ice for 30 min.
Heat shock the cells for 45 sec at 42 °C and put them on ice for 2 min.
Add 500 μl of SOC medium into the cells and shake in a temperature controlled incubator at 225 rpm at 37 °C for 4 h.
Harvest the cells by centrifugation at 20,000 x g for 1 min and plate them on a LB-Bac plate (see Recipes) (add ~50 μl SOC medium if necessary).
Incubate the LB-Bac plate for 2 days at 37 °C.
Pick up a white colony (Figure 2), inoculate 8 ml of LB-Bac medium, and culture in a temperature controlled incubator at 225 rpm at 37 °C overnight.
Figure 2. Colonies of DH10Bac transformants. The picture was taken 2 days after transformation with the pNFGP-FB3-P2X7 construct.
Harvest the cells by centrifugation at 2,500 x g for 10 min.
Resuspend the cells with 200 μl of ‘Solution 1’ in Plasmid mini kit (Omega Bio-Tek).
Add 200 μl of ‘Solution 2’ in Plasmid mini kit (Omega Bio-Tek) and mix by flipping the tube several times.
Add 270 μl of ‘Solution 3’ in Plasmid mini kit (Omega Bio-Tek) and mix by flipping the tube several times.
Harvest the bacmid containing solution by centrifugation at 20,000 x g for 10 min (save supernatant) and place it into a new 1.5 ml tube.
Add 700 μl of phenol-chloroform and mix well by vortexing the tube for a few seconds.
Centrifuge at 20,000 x g for 2 min and transfer the upper layer (Figure 3) into a new 1.5 ml tube.
Figure 3. Phase separation after centrifugation at step B14. The upper layer includes bacmids.
Add 700 μl of chloroform and mix well by vortexing for a few seconds.
Centrifuge at 20,000 x g for 2 min and transfer the upper layer into a 2.0 ml tube.
Add 1.4 ml of 100% ethanol and mix well by vortexing for a few seconds.
Chill the tube at -20 °C for 15 min.
Harvest the bacmid by centrifugation at 20,000 x g for 15 min at 4 °C.
Rinse the bacmid containing pellet with 1 ml 70% ethanol.
Aspirate the 70% ethanol and dry the bacmid containing pellet in a tissue culture hood for 30 min.
Resuspend the bacmid with 50 μl sterile Milli-Q water in a tissue culture hood. Store bacmids at -20 °C.
Virus production
Plate Sf9 cells at 0.4 x 106 cells/well into a 6-well tissue culture plate.
Incubate the plate at 27 °C for 1 h (Figure 4).
Figure 4. Sf9 cells in 6-well plate before transfection. Image was taken using an Evosf1 microscope (10x objective at 40% gain).
In the meantime, mix 5 μl of bacmid solution, 10 μl of polyethylenimine solution (see Recipes), and 100 μl of Sf-900 III medium.
Incubate the mixture for 15 min at room temperature and add to the wells of the previously plated 6-well plate by pipetting dropwise.
Incubate the plate at 27 °C for 6-7 days. GFP fluorescence was observed 7 days after transfection using an Evosf1 microscope (10x objective; 10% gain; Ex: 470/22 Em: 525/50) (Figure 5).
Figure 5. GFP fluorescence from Sf9 cells expressing GFP-P2X7. GFP fluorescence 7 days after transfection. Image was obtained using an Evosf1 microscope (10x objective; 10% gain; Ex: 470/22 Em: 525/50). Scale bar = 400 μm.
Collect the P1 virus containing media and filter sterilize using a 0.22 μm filter. Store the P1 virus at 4 °C.
Inoculate 200 ml of Sf9 cells at 1.0 x 106 cells/ml with 100 μl of P1 virus.
Culture the cells in a temperature controlled incubator at 125 rpm for 3 days at 27 °C.
Collect the P2 virus containing media by centrifugation at 2,500 x g for 10 min. Filter sterilize the P2 virus using a 0.22 μm filter and store at 4 °C.
Expression of P2X7 in Sf9 cells
Set up 1 L Sf9 culture at 0.5 x 106 cells/ml and let them grow for 3 days at 125 rpm at 27 °C.
Split the 1 L culture into 6 L (final density at 0.5 x 106 cells/ml). Add 7.5 ml/L of penicillin-streptomycin and culture in a temperature controlled shaker for 3 days at 125 rpm at 27 °C.
When the cell density reaches 4.0 x 106 cells/ml, infect the Sf9 cells with 30 ml/L P2 virus. Culture at 27 °C for 24 h.
Shift the temperature from 27 °C to 18 °C and culture for another 48 h before harvesting.
Purification of P2X7 (perform all the steps at 4 °C or on ice)
Transfer the GFP-P2X7 expressing cells into 1 L centrifuge bottles and spin down at 2,000 x g for 10 min (JS-4.2 rotor).
After removing the culture media by decanting, resuspend the cells with ~20 ml/bottle of the resuspension buffer (see Recipes). Pellet should be yellow/green (Figure 6). Combine and transfer the cell suspensions into a 250 ml centrifuge bottle.
Figure 6. Cell pellet after centrifugation (step E2)
Harvest the cells by centrifugation at 3,800 x g for 10 min (JA-14 rotor).
Carefully remove the resuspension buffer using a pipette and resuspend the cells with 200 ml of a fresh resuspension buffer.
Break the cells by nitrogen cavitation using a cell disruption vessel (600 psi for 20 min; see Videos 1 and 2). Vessel should be incubated at 4 °C after nitrogen loading.
Video 1. Filling nitrogen gas into the vessel
Video 2. Collecting the lysates after 20 min incubation
Sediment cell debris by centrifugation at 12,700 x g for 10 min (JA-14 rotor).
Transfer the supernatant into three 70 ml ultracentrifuge tubes and balance them using the resuspension buffer. It is critical to balance the centrifuge tubes precisely and to fill it up to the shoulder of the tubes (Figure 7).
Figure 7. Cell lysates in the ultracentrifuge tubes (step E7). Two tubes need to be balanced precisely.
Centrifuge at 185,000 x g for 1 h (Ti-45 rotor).
Remove the supernatant, resuspend the membrane fraction (pellet, Figure 8) with 2 ml/tube PBS.
Figure 8. Collected membrane fraction after ultracentrifugation (step E9)
Transfer the membrane fraction into a Dounce homogenizer (total volume is 8-12 ml; see Video 3).
Video 3. Transfer the membrane fraction into a Dounce homogenizer
Set the homogenizer at ~900 rpm and homogenize the membrane fraction with five strokes going up and down (see Video 4).
Video 4. Resuspension of the membrane fraction with a Dounce homogenizer
Solubilize the homogenized membrane fraction with ~350 ml of the solubilization buffer (see Recipes) by stirring at 300 rpm for 1 h.
Transfer the supernatant into six 70 ml ultracentrifuge tubes and balance them using the solubilization buffer.
Centrifuge at 185,000 x g for 1 h (Ti-45 rotor).
Pool the supernatant (Figure 9) into a 500 ml beaker. Add 6 ml of Strep-Tactin resin pre-equilibrated with the solubilization buffer, and stir at 200 rpm for 60 min.
Figure 9. Separated soluble fraction after ultracentrifugation (step E15)
Harvest the resin by centrifugation at 2,500 x g for 5 min in a 50 ml tube and transfer into two 25 ml gravity columns.
Wash the resin with 20 ml of the washing buffer (see Recipes) for each column.
Elute the GFP-P2X7 protein with elution buffer (see Recipes; Figure 10).
Figure 10. GFP-P2X7 bound to Strep resin
Concentrate the eluted GFP-P2X7 down to 1 ml using a 100 kDa-cutoff spin column. Measure the protein concentration using a spectrophotometer.
Digest the GFP-P2X7 with thrombin (25:1 [w/w]) overnight. In the meantime, equilibrate a Superdex 200 column with the SEC buffer (see Recipes) using an FPLC.
Remove aggregated protein by centrifugation at 264,360 x g for 10min.
Inject the protein into the Superdex 200 column and collect the peak fractions.
Data analysis
Quality of the purified P2X7 receptor can be analyzed by SEC and SDS-PAGE (Figure 11). Figure 11A shows a representative SEC profile with a single P2X7 peak, suggesting that the purified P2X7 receptor is monodisperse. A representative SDS-PAGE gel image (Figure 11B) verifies the chemical purity of this sample.
Figure 11. Characterization of purified P2X7. Representative SEC profile (A) and a gel image (B) of purified P2X7.
Notes
Even a slightly higher concentration of gentamicin may be too toxic to DH10Bac cells. Use it exactly at 6.7 μg/ml.
Cellfectin II (Thermo Fisher Scientific: 10362100), FuGENE 6 (Promega: E2691), and jetPRIME (polyplus, 114-15) could be also used for bacmid transfection.
P2 virus should be always prepared fresh. Noticeable reduction of P2X7 receptor expression is observed with the usage of more than one week old virus.
Temperature shift from 27 °C to 18 °C increases the expression level of P2X7 by more than four fold.
Overgrown cells (> 5.0 x 106 cells/ml) result in low infection. Sf9 cells should be maintained within 30 passages (about 2 months).
ESF921 medium (Expression system: 96-001-01) can also be used for Sf9 cell culture.
Inclusion of glycerol in both elution and SEC buffers is necessary for avoiding aggregation of P2X7.
Recipes
LB-Bac plate (1 L)
10 g tryptone
5 g yeast extract
5 g NaCl
50 μg/ml kanamycin, 6.7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml Bluo-gal, and 40 μg/ml IPTG
MilliQ H2O to make it 1 L
Polyethylenimine
Dissolve 1 g polyethylenimine in 900 ml MilliQ water
Adjust the pH to 7.0 with NaOH
Volume up to 1 L with MilliQ water
Filter sterilize using a 0.22 μm filter and store at 4 °C
Resuspension buffer
1x PBS
0.5 μg/ml leupeptin
2 μg/ml aprotinin
0.5 μg/ml pepstatin
0.5 mM PMSF
Solubilization buffer
1x PBS
2% TritonX-100
Washing buffer
100 mM Tris
150 mM NaCl
1 mM EDTA
0.5 mM Dodecyl-maltoside
Adjust pH to 8.0 with HCl
Elution buffer
100 mM Tris
150 mM NaCl
1 mM EDTA
0.5 mM Dodecyl-maltoside
2.5 mM d-Desthiobiotin
15% glycerol
Adjust pH to 8.0 with HCl
SEC buffer
50 mM Tris
150 mM NaCl
15% glycerol
0.5 mM Dodecyl-maltoside
Adjust pH to 7.4 with HCl
Acknowledgments
We thank K. Michalski and P. Nguyen for critical comments. This protocol was adapted from our previous work (Karasawa and Kawate, 2016). This work was supported by the National Institutes of Health (GM114379 and NS072869).
References
Alves, L. A., de Melo Reis, R. A., de Souza, C. A., de Freitas, M. S., Teixeira, P. C., Neto Moreira Ferreira, D. and Xavier, R. F. (2014). The P2X7 receptor: shifting from a low- to a high-conductance channel - an enigmatic phenomenon? Biochim Biophys Acta 1838(10): 2578-2587.
Bartlett, R., Stokes, L. and Sluyter, R. (2014). The P2X7 receptor channel: recent developments and the use of P2X7 antagonists in models of disease. Pharmacol Rev 66(3): 638-675.
Bhattacharya, A. and Biber, K. (2016). The microglial ATP-gated ion channel P2X7 as a CNS drug target. Glia 64(10): 1772-1787.
Hattori, M. and Gouaux, E. (2012). Molecular mechanism of ATP binding and ion channel activation in P2X receptors. Nature 485(7397): 207-212.
Karakas, E., Simorowski, N. and Furukawa, H. (2011). Subunit arrangement and phenylethanolamine binding in GluN1/GluN2B NMDA receptors. Nature 475(7355): 249-253.
Karasawa, A. and Kawate, T. (2016). Structural basis for subtype-specific inhibition of the P2X7 receptor. Elife 5.
North, R. A. and Jarvis, M. F. (2013). P2X receptors as drug targets. Mol Pharmacol 83(4): 759-769.
Copyright: Karasawa and Kawate. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Karasawa, A. and Kawate, T. (2017). Expression and Purification of a Mammalian P2X7 Receptor from Sf9 Insect Cells. Bio-protocol 7(17): e2544. DOI: 10.21769/BioProtoc.2544.
Karasawa, A. and Kawate, T. (2016). Structural basis for subtype-specific inhibition of the P2X7 receptor. Elife 5.
Download Citation in RIS Format
Category
Microbiology > Heterologous expression system > Baculovirus
Biochemistry > Protein > Expression
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,545 | https://bio-protocol.org/exchange/protocoldetail?id=2545&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Reactive Oxygen Species (ROS) in Cyanobacteria Using the Oxidant-sensing Probe 2’,7’-Dichlorodihydrofluorescein Diacetate (DCFH-DA)
R Rajneesh
JP Jainendra Pathak
AC Ananya Chatterjee
Shailendra P. Singh
Rajeshwar P. Sinha
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2545 Views: 23789
Edited by: Dennis Nürnberg
Reviewed by: Pooja Saxena
Original Research Article:
The authors used this protocol in Jul 2010
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2010
Abstract
Reactive oxygen species (ROS) are cell signaling molecules synthesized inside the cells as a response to routine metabolic processes. In stress conditions such as ultraviolet radiation (UVR), ROS concentration increases several folds in the cells that become toxic for the cell survival. Here we present the method for in vivo detection of ROS by using an oxidant-sensing probe 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA) in cyanobacteria. This method provides reliable, simple, rapid and cost effective means for detection of ROS in cyanobacteria.
Keywords: Reactive oxygen species 2’,7’-Dichlorodihydrofluorescein diacetate Cyanobacteria Ultraviolet radiation Oxidative damage
Background
Cyanobacteria are the most ancient oxygenic photoautotrophs; they play an important role in the biomass production in both aquatic and terrestrial ecosystems and serve as source of various value-added products (Vaishampayan et al., 2001; Häder et al., 2007; Fischer, 2008). In recent years the depletion of the ozone layer has resulted in an increase in solar ultraviolet radiation (UVR) influx, which is harmful to all organisms residing on Earth including cyanobacteria (Holzinger and Lutz, 2006). The UVR harms cyanobacteria directly by acting on DNA/proteins or indirectly through oxidative damage from reactive oxygen species (ROS) (He and Häder, 2002). In plants, algal and mammalian cells various fluorescence and chemiluminescence methods have been used for detecting ROS (Crow, 1997; He and Häder, 2002; Soh, 2006; Wu et al., 2007; Palomero et al., 2008).
2’,7’-Dichlorodihydrofluorescein diacetate (DCFH-DA) is a non-fluorescent, cell-permeable dye which is hydrolyzed intracellularly into its polar, but non-fluorescent form DCFH on the action of cellular esterases and thus is retained in the cell. Oxidation of DCFH by the action of intracellular ROS and other peroxides turns the molecule into its highly fluorescent form 2’,7’-dichlorofluorescein (DCF) that can be detected by various fluorescent methods (He and Häder, 2002; Rastogi et al., 2010; Singh et al., 2014) (Figure 1). Although DCFH-DA is widely used for the detection of ROS, it should be noted, however, that the dye cannot be used as an indicator for a specific form of ROS (Marchesi et al., 1999).
Figure 1. Mechanism of action of DCFH-DA probe inside the cell (Adapted from He and Häder, 2002)
Materials and Reagents
2 ml RNase, DNase free microcentrifuge tube (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM12425 )
Glass microscope slides (Fisher Scientific, catalog number: 12-544-4 )
Glass microscope coverslips (Fisher Scientific, catalog number: S17525B )
Millipore membrane filter (EMD Millipore, catalog number: HAWP04700 )
Cuvette (fluorescence spectroscopy) 3 ml (Hellma, catalog number: 101-QS )
Cyanobacterial cells e.g., Nostoc sp. strain HKAR-2
Note: Nostoc sp. strain HKAR-2, an autotrophic, filamentous and heterocystous cyanobacterium, was grown under axenic conditions in nitrogen-free liquid BGA medium (Safferman and Morris, 1964) at 20 ± 2 °C under continuous white light (12 ± 2 Wm-2) to an OD750 of 0.8 to 0.9 (exponential growth phase) which was measured using quartz cuvette in a spectrophotometer.
Nail varnish (Lakme)
Potassium phosphate dibasic anhydrous (K2HPO4)
Potassium phosphate monobasic (KH2PO4)
2’,7’-Dichlorodihydrofluorescein diacetate (DCFH-DA) (Sigma-Aldrich, catalog number: D6883 )
100% ethanol (Sigma-Aldrich, catalog number: 459836 )
50 mM phosphate buffer (see Recipes)
2 mM 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA) stock solution (see Recipes)
Equipment
Glass Petri-dishes (Corning, catalog number: 3160-102 )
Measuring cylinder
295 nm UV cut-off filter (Ultraphan, Digefra, Munich, Germany) to facilitate the desired wavebands of UV-B (280-315 nm), UV-A (315-400 nm) and PAR (400-700 nm)
UV-treatment chamber fitted with UV-B (Philips Ultraviolet-B TL 40 W: 12, Philips Lighting, model: TL 40W/12 RS SLV/25 ), UV-A (Philips Ultraviolet-A TL 40 W: 12, Philips Lighting, model: TL-K 40W/10-R UV-A ) and PAR (55.08 ± 9.18 μmol m-2 sec-1) (OSRAM L 36 W: 32 Lumilux de luxe warm white and Radium NL 36 W: 26 Universal white, Germany) lamps
Glass rod (Fisher Scientific, catalog number: 11-380A )
Magnetic stirrer (REMI ELECTROTECHNIK, model: 2 MLH )
Refrigerated centrifuge (REMI ELECTROTECHNIK, model: CM-12 PLUS )
Shaker
Fluorescence microscope (Nikon eclipse Ni fluorescence microscope processed by NIS Elements (BR))
Fluorescence spectrophotometer (Agilent Technologies, model: Cary Eclipse )
Spectrophotometer (Hitachi High-Technologies, model: U-2900 , Double beam spectrophotometer)
Quartz cuvette (3.5 ml) (Cole-Parmer, JENWAY, catalog number: 035 028 )
Software
NIS-Elements (BR) imaging software (Nikon)
SigmaPlot 11 software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rajneesh, , Pathak, J., Chatterjee, A., Singh, S. P. and Sinha, R. P. (2017). Detection of Reactive Oxygen Species (ROS) in Cyanobacteria Using the Oxidant-sensing Probe 2’,7’-Dichlorodihydrofluorescein Diacetate (DCFH-DA). Bio-protocol 7(17): e2545. DOI: 10.21769/BioProtoc.2545.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,546 | https://bio-protocol.org/exchange/protocoldetail?id=2546&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Construction of a Single Transcriptional Unit for Expression of Cas9 and Single-guide RNAs for Genome Editing in Plants
XT Xu Tang
ZZ Zhaohui Zhong
XZ Xuelian Zheng
YZ Yong Zhang
Published: Vol 7, Iss 17, Sep 5, 2017
DOI: 10.21769/BioProtoc.2546 Views: 12506
Edited by: Rainer Melzer
Reviewed by: Alberto Carbonell
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
The CRISPR (clustered regularly interspaced short palindromic repeats)-associated protein9 (Cas9) is a simple and efficient tool for genome editing in many organisms including plant and crop species. The sgRNAs of the CRISPR/Cas9 system are typically expressed from RNA polymerase III promoters, such as U6 and U3. In many transformation events, more nucleotides will increase the difficulties in plasmid construction and the risk of wrong integration in genome such as base-pair or fragment missing (Gheysen et al., 1990). And also, in many organisms, Pol III promoters have not been well characterized, and heterologous Pol III promoters often perform poorly (Sun et al., 2015). Thus, we have developed a method using single transcriptional unit (STU) CRISPR-Cas9 system to drive the expression of both Cas9 and sgRNAs from a single RNA polymerase II promoter to achieve effective genome editing in plants.
Keywords: CRISPR Cas9 Genome editing Single transcriptional unit (STU) Ribozyme
Background
The sgRNA of the CRISPR-Cas9 system is mainly promoted by the small nuclear RNA promoters such as U6 and U3. Although it has been tested with prospered efficiency in many cases, it also has some limitations: (1) it is hard to achieve coordinated and/or inducible expression of Cas9 and the sgRNAs; (2) manipulating multiple sgRNAs for multiplexed gene editing can be tedious, requiring multiple Pol III promoters. The traditional RNA polymerase II promoter can’t be used in driving sgRNA expression, extra nucleotides will be added to the 5’- and 3’-ends of gRNA by RNA polymerase II and may interrupt the normal gRNA function. Additionally, RNAs transcribed by RNA polymerase II are exported rapidly into the cytoplasm while nuclear localization is required for the CRISPR-Cas9/gRNA duplex to access the genome editing (Lei et al., 2001). To overcome these obstacles, we use the ribozyme’s self-catalyzed cleavage to release the precise processing mature sgRNA under a RNA polymerase II promoter which drives expression of both Cas9 and sgRNA (named STU CRISPR-Cas9 system, Figure 1). Compared to the traditional small nuclear RNA promoters used in sgRNA expression, our STU CRISPR-Cas9 system has some advantages: (1) it’s shorter and easier in vector construction, and it will increase the transformation efficiency under some circumstances; (2) it only needs extra ribozyme flanking sequence (shorter than any RNA polymerase III promoter we are currently using) for multiple sgRNAs expression;(3) it has shown higher deletion efficiency induced by double sgRNAs. Thus, the STU CRISPR-Cas9 system driven by a single RNA polymerase II promoter can replace the traditional CRISPR-Cas9 system now we are using whether in vivo or in vitro if appropriate promoters are chosen.
Figure 1. Schematic illustration of the single transcription unit (STU) CRISPR-Cas9 system. Once transcribed by a Pol II promoter, the STU CRISPR-Cas9 primary transcripts will undergo self-cleavage by hammerhead ribozyme (RZ) to release the mature Cas9 mRNA and sgRNA. The Cas9 mRNA is terminated with a synthetic polyA (pA) sequence to facilitate translation, The RZ sequence (in blue) and its target sequence (in black) are illustrated.
Materials and Reagents
0.2 ml PCR tubes (Biosharp, catalog number: BS-02-P )
1.5 ml Eppendorf tubes (Biosharp, catalog number: BS-15-M )
Pipette tips (Biosharp, catalog numbers: BS-10-T , BS-200-T , BS-1000-T )
Competent E. coli DH5α cells (Homemade)
pTX171 plasmids (Addgene, catalog number: 89258 )
pTX172 plasmids (Addgene, catalog number: 89259 )
BsaI (New England Biolabs, catalog number: R0535L )
Deionized water (sterile)
Agarose (Biowest, catalog number: 111860 )
Ethidium bromide (Solarbio Life Scientific, catalog number: E1020 )
AxyPrepTM DNA Gel Extraction Kit (Corning, Axygen®, catalog number: AP-GX-250 )
T4 DNA ligase (New England Biolabs, catalog number: M0202L )
dNTPs mixture (Tiangen Biotech, catalog number: CD117-11 )
Taq DNA polymerase (Tiangen Biotech, catalog number: ET101-01-02 )
Q5® High-Fidelity DNA polymerase (New England Biolabs, catalog number: M0491L )
AxyPrepTM Plasmid Miniprep Kit (Corning, Axygen®, catalog number: AP-MN-P-250 )
Kanamycin (Solarbio Life Scientific, catalog number: K8020 )
TAE electrophoresis buffer (see Recipes)
Tris (Solarbio Life Scientific, catalog number: T8060 )
Acetic acid (Kelong)
0.5 M EDTA (Solarbio Life Scientific, catalog number: E1170 )
LB medium (see Recipes)
Tryptone (Oxoid, catalog number: LP0042 )
Yeast extract (Oxoid, catalog number: LP0021 )
Sodium chloride (NaCl) (Kelong)
Equipment
Pipettes (Dragon-Lab)
Heating block (Hangzhou Allsheng Instruments, model: MK-20 )
Thermal cycler (Thermo Fisher Scientific, Thermo ScientificTM, model: ArktikTM Thermal Cycler )
Water bath (Yongguangming, model: DZKW-S-4 )
Microcentrifuge (Eppendorf, model: 5424 )
DNA electrophoresis apparatus (Bio-Rad Laboratories, model: Mini-Sub® Cell GT Systems )
NanoDrop (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tang, X., Zhong, Z., Zheng, X. and Zhang, Y. (2017). Construction of a Single Transcriptional Unit for Expression of Cas9 and Single-guide RNAs for Genome Editing in Plants. Bio-protocol 7(17): e2546. DOI: 10.21769/BioProtoc.2546.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,547 | https://bio-protocol.org/exchange/protocoldetail?id=2547&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Drosophila Fecal Sampling
C Christine Fink
JF Jakob von Frieling
MK Mirjam Knop
TR Thomas Roeder
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2547 Views: 8995
Edited by: Jihyun Kim
Reviewed by: Abhijit Kale
Original Research Article:
The authors used this protocol in Nov 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2013
Abstract
Fecal sampling is a non-invasive method which raises the possibility to study the development and the changes in the microbial community throughout different time points of a fly population or throughout different treatments. This method allows precise manipulation to trigger the fly’s physiology by nutritional interventions, bacterial infections or other stressors.
As in most other animals, the intestinal microbiota is essential for a healthy fly-life. Because Drosophila only harbors a relative simple bacterial community with a small variety of round about 8 to 10 different species, it is rather easy to build up the microbial community and to investigate microbial changes after treatment.
Another positive effect using the fly’s feces is that bacteria that are not part of the intestinal microbiome, for example Wolbachia, can be excluded directly from the analysis because they are not excreted.
Using this method, the generated datasets may reflect a good paradigm to study microbiome associated diseases in a simple fly model or furthermore, to test drugs in a high-throughput approach.
Keywords: Drosophila Intestine Microbiome Fecal sampling DNA isolation
Background
Until now, studies aiming to characterize the intestinal microbiome in the fruit fly Drosophila melanogaster used whole flies or dissected intestines as sources for bacterial DNA isolation. The main idea using feces sampling is to enable analyzing the dynamics of the intestinal microbiome in response to different treatments such as nutritional interventions or drug administration in the same cohort of flies. We were able to demonstrate that all general bacteria species, which are known to be important members of the Drosophila microbiome can be detected in fecal samples (Chandler et al., 2011; Wong et al., 2011; Matos and Leulier, 2014). Although whole fly samples are apparently the most convenient sources to generate microbiome data, several drawbacks are faced with this approach including contamination with surface bacteria or with intracellular bacteria such as Wolbachia spec (Saridaki and Bourtzis, 2010; Clark et al., 2005). Using feces as a source for microbiome data acquisition, these contaminations can be excluded almost completely, and, most importantly, the same cohorts of flies can be analyzed several times during the course of a complex experimental setup, thus unleashing the full potential of Drosophila genetics for microbiome studies.
Materials and Reagents
Note: For full name of the abbreviations in the text, please see Table S1 in Supplemental file.
Filter tips, 0.5-10 µl, super slim, surface optimized (NERBE PLUS, catalog number: 07-613-8300 )
Filter tips, 0-200 µl, super slim, surface optimized (NERBE PLUS, catalog number: 07-662-8300 )
Filter tips, 0.5-10 µl, super slim, surface optimized (NERBE PLUS, catalog number: 07-695-8300 )
Empty and clean Drosophila vials (NERBE PLUS, catalog number: 11-881-0052 )
Cellulose plugs (NERBE PLUS, catalog number: 11-881-1010 )
0.22 μm sterilize filter filtropur (SARSTEDT, catalog number: 83.1826.001 )
1.5 ml reaction tubes (SARSTEDT, catalog number: 72.690.001 )
2 ml collecting tube
Sterile spin swabs (Greiner Bio One International, catalog number: 420180 )
X-tracta Tips (Biozym Scientific, catalog number: 615935 )
Nitrogen (AIR LIQUIDE Deutschland, catalog number: I4001S10R2A001 )
PowerSoil DNA isolation kit (NEW: Quiagen DNeasy PowerSoil Kit) (QIAGEN, catalog number: 12888 )
Note: Attention this kit was from MOBIO in the past, also called Power Soil Kit!
70% ethanol diluted from 100% ethanol (Carl Roth, catalog number: 9065 )
Proteinase K (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EO0491 )
Phusion® Hot Start DNA polymerase (Thermo Fisher Scientific, catalog number: F540L )
Crystal-Agarose (BIOLABPRODUCTS, catalog number: 16-005-805 )
100 bp DNA ladder (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15628019 )
GeneRuler 50 bp DNA ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SM0371 )
qPCR Bio SYBR-Hi-ROX (NIPPON Genetics, catalog number: PB20.12-20 )
Deoxynucleotide triphosphates (dNTPs) (Promega, catalog number: U1330 )
Oligo dT 7 primer (custom made, order from Thermo Fisher Scientific)
Oligonucleotides for target genes for use in qPCR (custom made, order from Thermo Fisher Scientific, use [20 µM])
RT-PCR grade water (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9935 )
MinElute Gel Extraction Kit (QIAGEN, catalog number: 28604 )
Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32851 )
Agencourt AMPure XP (Beckman Coulter, catalog number: A63882 )
Fly medium (see Recipes)
Cornmeal (Mühle Schlingemann, catalog number: DAV-17080 )
Brewer’s yeast (Leiber, catalog number: 17001636 )
Glucose (Carl Roth, catalog number: 6780 )
Agar-agar (Carl Roth, catalog number: 5210 )
Sugar beat syrup (Kanne Brottrunk, catalog number: 2201 )
Sugar molasses (Biohof Heidelicht, catalog number: 013aa )
Preservatives for fly medium:
Nipagin/Methyl 4-hydroxybenzoate (Sigma-Aldrich, catalog number: H5501 )
Propionic acid (Carl Roth, catalog number: 6026 )
10x phosphate-buffered saline (PBS) (see Recipes)
Sodium chloride (NaCl) (Carl Roth, catalog number: P029 )
Potassium chloride (KCl) (Carl Roth, catalog number: 6781 )
Potassium phosphate monobasic (KH2PO4) (Carl Roth, catalog number: P018 )
Di-sodium hydrogen phosphate dihydrate (Carl Roth, catalog number: 4984 )
10x TBE (Tris-Borat-EDTA) buffer (see Recipes)
Tris (Carl Roth, catalog number: 4855 )
Borate acid (Carl Roth, catalog number: 6943 )
Na2EDTA (Carl Roth, catalog number: X986 )
Equipment
Eppendorf Research® plus, single-channel, variable, 0.1-2.5 µl, dark grey (Eppendorf, catalog number: 3120000011 )
Eppendorf Research® plus, single-channel, variable, 0.5-10 µl, light grey (Eppendorf, catalog number: 3120000020 )
Eppendorf Research® plus, single-channel, variable, 2-20 µl, yellow (Eppendorf, catalog number: 3120000038 )
Eppendorf Research® plus, single-channel, variable, 100-1,000 µl, blue (Eppendorf, catalog number: 3120000062 )
Autoclave
Sterile bench (NuAire, model: NU-437-400E )
Anesthetizing pistol (Blowgun) (GENESE Scientific, model: 54-104 )
Dumont forceps #5 (Fine Science Tools, catalog number: 11252-20 )
Scissors (Bioform, model: B37e )
Vortexer (Scientific Industries, model: Vortex Genie 2 , catalog number: SI-0256)
Vortex adapter (MO BIO, catalog number: 13000-V1 )
Thermomixer (Eppendorf, model: Thermomixer Comfort )
Centrifuge (Eppendorf, model: 5424 )
Qubit 3.0 Fluorometer (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q33216 )
Sensoquest labcycler (BIOLABPRODUCTS, catalog number: 11-011-101-096 )
NanoDrop 3300 Fluorometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 3300, catalog number: ND-3300 )
25 °C incubator (AQUALYTIC, model: TC 140 G , catalog number: 438210)
StepOne qPCR cycler (Thermo Fisher Scientific, catalog number: 4376357 )
Gel DocTM XR+ Gel Documentation System (Bio-Rad Laboratories, model: Molecular Imager® Gel DocTM XR+, catalog number: 1708195 )
Wide Mini-Sub® Cell GT Horizontal Electrophoresis System, 15 x 10 cm tray, with PowerPacTM Basic Power Supply (Bio-Rad Laboratories, catalog number: 1640301 )
Agilent Bioanalyzer (Agilent Technologies, model: 2100 Bioanalyzer , catalog number: G2939BA)
Water bath
1.5 L beaker
Software
MOTHUR v1.23.1
R statistics package v.2.13.1 (R_Development_Core_team, 2011)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fink, C., von Frieling, J., Knop, M. and Roeder, T. (2017). Drosophila Fecal Sampling. Bio-protocol 7(18): e2547. DOI: 10.21769/BioProtoc.2547.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,548 | https://bio-protocol.org/exchange/protocoldetail?id=2548&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Assays for Eukaryotic Leading/Lagging Strand DNA Replication
GS Grant Schauer
JF Jeff Finkelstein
MO Mike O’Donnell
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2548 Views: 8833
Edited by: Gal Haimovich
Reviewed by: Vamseedhar RayaproluDavid Paul
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
The eukaryotic replisome is a multiprotein complex that duplicates DNA. The replisome is sculpted to couple continuous leading strand synthesis with discontinuous lagging strand synthesis, primarily carried out by DNA polymerases ε and δ, respectively, along with helicases, polymerase α-primase, DNA sliding clamps, clamp loaders and many other proteins. We have previously established the mechanisms by which the polymerases ε and δ are targeted to their ‘correct’ strands, as well as quality control mechanisms that evict polymerases when they associate with an ‘incorrect’ strand. Here, we provide a practical guide to differentially assay leading and lagging strand replication in vitro using pure proteins.
Keywords: Eukaryotic DNA replication Replisome assay CMG helicase DNA polymerase RFC clamp loader PCNA sliding clamp Leading strand Lagging strand
Background
Using pure proteins from Saccharomyces cerevisiae, our lab was the first to reconstitute a functional eukaryotic DNA replisome, a ~2 MDa complex that includes the 11-subunit CMG helicase (complex of Cdc45, Mcm2-7, GINS heterotetramer), the 4-subunit DNA polymerase (Pol) ε, the 4-subunit Pol α-primase, the PCNA (Proliferating Cell Nuclear Antigen) clamp homotrimer ring shaped processivity factor that encircles duplex DNA, the 5-subunit clamp loader RFC (Replication Factor C) that uses ATP to open and close the PCNA sliding clamp ring onto primed sites for polymerase processivity, and the RPA (Replication Protein A) heterotrimeric single-strand DNA binding protein that removes secondary structure obstacles to DNA polymerase progression. In our initial studies we discovered that Pol ε is targeted to CMG on the leading strand after priming by Pol α-primase, while Pol δ is targeted to PCNA clamps on the lagging strand primed sites (Georgescu et al., 2014; Langston et al., 2014). We next reconstituted a functional coupled leading/lagging strand replisome which included the 4-subunit Pol α-primase and 3-subunit Pol δ, in which we demonstrated that Pol ε is inactive on the lagging strand and Pol ε is inactive on the leading strand (Georgescu et al., 2015). Interestingly, the Pol α-primase, which lacks proofreading activity, was active with CMG on both strands, but when either Pol ε or Pol δ are present, which both contain a proofreading 3’-5’ exonuclease for high fidelity synthesis, they take over from the low fidelity Pol α-primase on either strand. However, Pol ε and Pol δ only performed optimal synthesis when on their respective correct strands (Georgescu et al., 2015). In a subsequent study we characterized the unprecedented quality control mechanisms that exclude these polymerases from incorrect strands, a job that bacterial replisomes do not need to do because they utilize identical polymerases for both strands (Schauer et al., 2017). We found that on the lagging strand, Pol ε is excluded from primed sites by competition with the RFC clamp loader for the primer terminus, while CMG binds and protects Pol ε from RFC inhibition on the leading strand. In contrast Pol δ is preferentially targeted to PCNA on lagging strand primed sites through a tight binding affinity to PCNA clamps that is over 20-fold greater than the PCNA affinity to Pol ε and is unaffected by competition by the RFC clamp loader (Schauer et al., 2017). Interestingly, no stabilizing interaction with CMG exists for Pol δ (Schauer et al., 2017). Furthermore, Pol δ is less stable on a completed DNA than when idling at a primer terminus or extending a primer. Specifically, Pol δ is known to be stable for over a half hour with PCNA, consistent with its high processivity, but upon completing replication of a section of DNA, and bumping into a completed dsDNA region, it dissociates rapidly (i.e., < 1 min) from PCNA-DNA in a process referred to as collision release (Langston and O’Donnell, 2008; Langston et al., 2014).This inherent instability of Pol δ-PCNA upon completing replication may serve as a quality control to destabilize Pol δ-PCNA on the leading strand because Pol δ-PCNA is much faster than CMG unwinding and will be in a constant state of having completed DNA and collision with CMG (Schauer et al., 2017). Destabilization of Pol δ-PCNA when there is no more DNA to be extended should not be taken to mean that Pol δ instantly ejects from PCNA. For example, Pol δ-PCNA remains on DNA for a few seconds to fill-in short gaps upon RNA removal at 5’ ends of Okazaki fragments (Stodola and Burgers, 2016).
In interrogating these various activities, we observed that CMG does not load onto small (100-200 bp) rolling circle replication substrates, which are often used to study replisome behavior in bacterial systems. Thus, we turned to linear DNA fork assays as an alternative to address biochemical mechanisms in eukaryotic replication. These assays enable one to easily separate leading from lagging strand replication activity by synthesis of a long linear DNA that has no dC in one strand, and thus no dG in the other strand. By doing so, one can specifically monitor leading or lagging strand synthesis depending on the radioactive deoxyribonucleoside triphosphate (dNTP) used in the assay.
Materials and Reagents
Razor blade
1.57 mm OD polyethylene tubing (e.g., Clay Adams® Intramedic®, BD, catalog number: 427431 )
Sephadex microcentrifuge columns (Illustra Microspin G-25) (GE Healthcare, catalog number: 27-5325-01 )
Plastic wrap (e.g., Fisherbrand Clear Plastic Wrap, Fisher Scientific, catalog number: 22-305654 )
C-fold paper towels (e.g., Scott paper towels, KCWW, Kimberly-Clark, catalog number: 01510 )
Positively charged nylon DNA blotting membrane (Hybond-N+, 30.0 x 50.0 cm) (GE Healthcare, catalog number: RPN3050B )
Chromatography transfer paper (Whatman 3MM, 46.0 x 57.0 cm) (GE Healthcare, catalog number: 3030-917 )
Syringe tip (e.g., B-D 18 G 1 ½ PrecisionGlide® Needle) (BD, catalog number: 305196 )
phiX174 virion DNA, 1 mg/ml (New England Biolabs, catalog number: N3023L )
Phi29 DNA polymerase (New England Biolabs, catalog number: M0269S )
100 mM dNTP (deoxynucleotide triphosphate) set (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0181 )
1 μM CMG (Cdc45 Mcm2-7 Gins) helicase (see Georgescu et al. [2014] for purification details)
pUC19, 1 mg/ml (New England Biolabs, catalog number: N3041L )
BsaI-HF with CutSmart buffer (New England Biolabs, catalog number: R3535L )
‘blockLd’ oligo*
‘blockLg’ oligo*
‘Pr1B’ oligo*
‘160Ld’ oligo*
‘91Lg’ oligo*
‘Fork primer’ oligo*
Nucleotide-biased template (synthesized by Biomatik, Wilmington DE)*
*Note: See Supplementary file 1.
T4 ligase, including 10x ligase buffer (New England Biolabs, catalog number: M0202M )
100 mM ATP (GE Healthcare, catalog number: 27-2056-01 )
0.5 M EDTA, disodium salt (Sigma-Aldrich, catalog number: E5134 )
5 M NaCl (Sigma-Aldrich, catalog number: S9888 )
Sepharose 4B size exclusion chromatography resin (GE Healthcare, catalog number: 17012001 )
1 kb MW marker (New England Biolabs, catalog number: N3232L )
Ethidium bromide (EthBr, 10 mg/ml) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15585011 )
T4 kinase and 10x T4 kinase buffer (New England Biolabs, catalog number: M0201L )
32P-γ-ATP, 3,000 Ci/mmol, 3.3 μM (PerkinElmer, catalog number: BLU002A )
Type XI low-melt agarose (Sigma-Aldrich, catalog number: A3038 )
Note: This product has been discontinued.
BtsCI (New England Biolabs, catalog number: R0647L )
β-Agarase I (New England Biolabs, catalog number: M0392L )
3 M sodium acetate (CH3COONa), pH 5.2 (Sigma-Aldrich, catalog number: S2889 )
Isopropanol (Sigma-Aldrich, catalog number: 190764 )
Glycogen, molecular biology grade (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0561 )
Ethanol (Sigma-Aldrich, catalog number: E7023 )
1 μM RFC (Replication Factor C; see Georgescu et al. [2014] for purification details)
5 μM PCNA (Proliferating Cellular Nuclear Antigen; see Georgescu et al. [2014] for purification details)
2 μM Pol ε (see Georgescu et al. [2014] for purification details)
2 μM Pol δ (see Georgescu et al. [2014] for purification details)
2 μM Pol α (see Georgescu et al. [2014] for purification details)
20 μM RPA (Replication Protein A; see Georgescu et al. [2014] for purification details)
32P-α-dCTP, 3,000 Ci/mmol, 3.3 μM (PerkinElmer, catalog number: BLU013H )
32P-α-dGTP, 3,000 Ci/mmol, 3.3 μM (PerkinElmer, catalog number: BLU514H )
LE agarose (BioExpress, GeneMate, catalog number: E-3120-500 )
10 N sodium hydroxide (NaOH) (Fisher Scientific, catalog number: SS255 )
Glycerol
Xylene cylanol
Tris-HCl, pH 8.0
Tris base (RPI, catalog number: T60040-500.0 )
Boric acid (RPI, catalog number: B32050-5000.0 )
Sodium citrate
1-Butanol
Tris-acetate, pH 7.5
Bovine serum albumin (BSA) (New England Biolabs, catalog number: B9000S )
Tris(2-carboxyethyl)phosphine (TCEP) pH 7.5
100 mM dithiothreitol (DTT) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0861 )
Potassium glutamate
Magnesium acetate
1% SDS
6x gel loading dye (see Recipes)
TE buffer, pH 8.0 (see Recipes)
10x TBE (Tris/Borate/EDTA; see Recipes)
DNA elution buffer (see Recipes)
20x SSC (see Recipes)
1-Butanol saturated water (see Recipes)
5x TDBG (see Recipes)
10x MK (see Recipes)
dA/dC mix (see Recipes)
dT/dG mix (see Recipes)
T/G/C mix (see Recipes)
Stop solution (see Recipes)
Alkaline running buffer (see Recipes)
Equipment
Heating block (e.g., VWR, catalog number: 12621-084 )
Fraction collector (e.g., Gilson, model: F203B )
Variable mode gel imager (e.g., GE Typhoon)
UV-vis spectrophotometer (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 )
Vacuum dessicator (e.g., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 5309-0250 )
UV light box
UV blocking face shield (e.g., Sigma-Aldrich, catalog number: F8142 )
Note: This product has been discontinued.
Microcentrifuge
Conductivity meter (e.g., Radiometer Medical, model: CDM 80 )
Temperature controlled water bath with microcentrifuge tray (e.g., LabX, model: Lauda E100 and Brinkman 30x x 1.5 ml)
Manufacturer: LAUDA-Brinkmann, model: E100 .
Phosphorimaging screen (GE Healthcare)
Phosphor imager (e.g., GE Typhoon)
A heavy weight
Note: We use giant lead blocks that we found; a ~50 lb dumbell would work.
Computer with ImageJ and spreadsheet software (e.g., Apache Open Office) installed
1 x 30 cm glass column (e.g., glass Econo-Columns®) (Bio-Rad Laboratories, catalog number: 7371032 )
100 ml agarose gel electrophoresis apparatus
Styrofoam box large enough to fit 100 ml agarose gel electrophoresis apparatus
Electrophoresis power supply (e.g., Pharmacia Biotech, catalog number: EPS 3500 XL )
Analytical balance
Protective plexiglass samples shield
20 x 14 cm horizontal agarose gel electrophoresis apparatus (C.B.S. Scientific, catalog number: SGU-014T-02 )
Software
ImageJ (https://imagej.nih.gov/ij/docs/menus/analyze.html#gels)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Schauer, G., Finkelstein, J. and O’Donnell, M. (2017). In vitro Assays for Eukaryotic Leading/Lagging Strand DNA Replication. Bio-protocol 7(18): e2548. DOI: 10.21769/BioProtoc.2548.
Download Citation in RIS Format
Category
Biochemistry > Protein > Activity
Molecular Biology > DNA > DNA synthesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,549 | https://bio-protocol.org/exchange/protocoldetail?id=2549&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stereotaxic Adeno-associated Virus Injection and Cannula Implantation in the Dorsal Raphe Nucleus of Mice
PC Patrícia A. Correia
SM Sara Matias
ZM Zachary F. Mainen
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2549 Views: 18111
Edited by: Neelanjan Bose
Reviewed by: Juan Mauricio Garré
Original Research Article:
The authors used this protocol in 14-Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
14-Feb 2017
Abstract
Optogenetic methods are now widespread in neuroscience research. Here we present a detailed surgical procedure to inject adeno-associated viruses and implant optic fiber cannulas in the dorsal raphe nucleus (DRN) of living mice. Combined with transgenic mouse lines, this protocol allows specific targeting of serotonin-producing neurons in the brain. It includes fixing a mouse in a stereotaxic frame, performing a craniotomy, virus injection and fiber implantation. Animals can be later used in behavioral experiments, combined with optogenetic manipulations (Dugué et al., 2014; Correia et al., 2017) or monitoring of neuronal activity (Matias et al., 2017).
The described procedure is a fundamental step in both optogenetic and fiber photometry experiments of deep brain areas. It is optimized for serotonin neurons in the DRN, but it can be applied to any other cell type and brain region. When using transgenic mouse lines that express functionally relevant levels of optogenetic tools or reporter lines, the virus injection step can be skipped and the protocol is reduced to the cannula implantation procedure.
Keywords: Adeno-associated virus Optogenetic probes Serotonin Dorsal raphe nucleus Stereotaxic surgery Optical cannula
Background
With the advent of optogenetic methods, the use of optical fibers and genetically encoded probes to manipulate or monitor brain activity has rapidly expanded. Optogenetic tools are particularly useful to study neuromodulatory systems, as they are usually characterized by clusters of neurons located in deep brain regions, with long and wide projections to a multitude of brain areas. Virus injections and fiber cannula implantations have been previously described for diverse areas in the brain (e.g., ventral tegmental area [Tsai et al., 2009], locus coeruleus [Carter et al., 2010]).
Targeting the dorsal raphe nucleus (DRN, the main source of serotonin projections to the forebrain) can be complex, given its deep anatomical location below the aqueduct and the superior sagittal sinus. Using standard surgical procedures might cause extensive bleeding and low success rate, resulting in small sample sizes (Ranade and Mainen 2009; Cohen et al., 2015). Optogenetic studies targeting the DRN have been previously described (Dugué et al., 2014; Liu et al., 2014; Qi et al., 2014; McDevitt et al., 2014; Ogawa et al., 2014; Pollak Dorocic et al., 2014; Weissbourd et al., 2014; Miyazaki et al., 2014; Fonseca et al., 2015; Cohen et al., 2015; Li et al., 2016; Correia et al., 2017; Matias et al., 2017), but a detailed and efficient surgery protocol is lacking. Here we present a protocol to target viral transduction to serotonin-producing neurons in the DRN and perform optical fiber implantation with an angled approach, to avoid the superior sagittal sinus. When performing exclusively viral transduction, it is not essential to use an angled approach (Qi et al., 2014; McDevitt et al., 2014; Ogawa et al., 2014; Pollak Dorocic et al., 2014; Weissbourd et al., 2014). The protocol described here can be used for diverse optogenetic procedures, such as photostimulation, photoinhibition, or fiber photometry.
Materials and Reagents
Surgical drape
Quartz pipettes (Quartz with filament OD 1.0 mm, ID 0.5 mm, 7.5 cm length) (Sutter Instrument, catalog number: QF100-50-7.5 )
Petri dish
Parafilm (BRAND, catalog number: 701605 )
Absorbable sponges (Spongostan Dental, Ferrosan Medical Devices) (Ethicon, catalog number: MS0005 )
Cotton swabs (Henry Schein, catalog number: 100-6015 )
Bone scraper (Fine Science Tools, catalog number: 10075-16 )
Surgical blade (Swann Morton, catalog number: 0301 )
Needles (30 G) (BD, catalog number: 304000 )
Cleaning wipes (Kimwipes, Kimtech) (KCWW, Kimberly-Clark, catalog number: 34120 )
Stitching kit and sutures (Vicryl) (Ethicon, catalog number: MPV494H )
SERT-Cre C57BL/6 mice (Slc6a4tm1(cre)Xz, THE JACKSON LABORATORY, catalog number: 014554 ) and WT C57BL/6 mice (littermates control)
Virus AAV2.9.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (1013 GC/ml) for photostimulation or AAV2/1-Syn-Dio-GCaMP6s (1013 GC/ml) for fiber photometry (University of Pennsylvania Vector Core)
Sterile saline 0.9% NaCl (B. Braun Melsungen)
Isoflurane (4% induction and 0.5-1% for maintenance, Vetflurane, Virbac)
Analgesic (e.g., Dolorex, Butorphanol, http://www.dolorex.info/dolorex/dolorex.asp, 10 mg/ml, injectable solution, Intervet, Schering-Plough Animal Health)
Betadine 10% (Lainco S.A.)
Lidocaine 2% (Braun 20 mg/ml) (B. Braun Melsungen, catalog number: RVG 56836 )
Eye ointment (e.g., Vidisic, Carbomer 980, https://www.hpra.ie/img/uploaded/swedocuments/2122630.PA0555_006_001.6a418525-a1b3-46ca-af2c-402404b85680.000001Product%20leaflet%20approved%201.140331.pdf, Bausch & Lomb)
Distilled water
Gentamicin 0.3% (Sigma-Aldrich, catalog number: 48760 )
Dental acrylic (Pi-Ku-Plast HP 36, Bredent, catalog numbers: 54000213 and 54000215 )
Veterinary wound powder (Battle, catalog number: 2281 )
Super Bond C&B (Sun Medical, catalog number: P021E/0A )
Equipment
Anesthesia system for isoflurane (Matrx by Midmark, model: VIP 3000® )
Heating pad
Stereotaxic frame (KOPF INSTRUMENTS, model: Model 902 )
Mouse adaptor for gas anesthesia (KOPF INSTRUMENTS, model: Model 923-B )
Electric clipper for cutting mouse hair (WAHL Clipper, model: 5540 )
Pipette puller (Sutter Instruments, model: P-2000 )
Scissors (Fine Science Tools, catalog number: 14088-10 )
Fine tip forceps (Fine Science Tools, catalog number: 11242-40 )
Suture scissors (Fine Science Tools, catalog number: 12001-13 )
Scalpel handle (Fine Science Tools, catalog number: 10003-12 )
Colibri retractor (Fine Science Tools, catalog number: 17000-02 )
Sterile glass beaker
Dental drill (Midwest Tradition PB Handpieace Non-Fiber Optic, DENTSPLY International, catalog number: 790044 )
Drill bits (CARBIDE BUR FG 1/4) (Henry Schein, catalog number: 101-7864 )
Suction tool to aspirate viral solution into the pipette (Sigma-Aldrich, catalog number: A5177-5EA )
Picospritzer (Parker Hannafin, model: Picospritzer III )
Optical fiber (200 μm core diameter, 0.48 NA, 4-5 mm) housed inside a connectorized implant (M3, Doric lenses)
Zygomatic ear cups, serrated (KOPF INSTRUMENTS, model: Model 921 )
Microscope (Leica Microsystems, model: Leica MZ6 )
Procedure
The surgery setup consists of a stereotaxic frame connected to a gas anesthesia system, situated on top of a surgery table. A heating pad covered by a surgical drape is placed on the stereotaxic frame, below the mouse mask (where the animal will be placed). The picospritzer for the virus injection is located on a shelf, close to the surgery table. The microscope is attached to the wall, allowing movements in different angles. The aseptic surgical field is the disinfected skin and exposed surgical wound. All materials necessary for surgery (including the dental drill) are within reach around the stereotaxic frame.
Preparation for surgery
Get a glass pipette using the pipette puller and mark it in three locations (upper and lower limit of 1 μl total volume–5.9 mm in these pipettes–plus one mark half way).
Set the right arm of the stereotaxic frame at 32° (the injection is performed with an angled approach from the back to avoid breaking the superior sagittal sinus).
Check isoflurane level in the anesthesia system and fill it if needed.
Place the Super Bond dispensing dish at 4 °C.
Fill up one pipette with virus using the suction tool and store it in the fridge (place the pipette inside a Petri dish and cover with Parafilm).
Prepare a 25 ml glass beaker with 10 ml saline and add small pieces of absorbable sponges.
Turn on the heating pad (37 °C).
Mouse preparation
Weight the mouse (SERT-Cre or WT).
Anesthetize mouse in the isoflurane induction chamber (4%, 1 L/min).
Place animal in the anesthesia mask.
Give analgesic (e.g., Dolorex 10 mg/ml, dilute 1:20 in saline and use 0.1 ml per 25 g of animal) subcutaneously, after anesthesia induction.
Shave the head, from the eyes to behind the ears (Figure 1A).
Place the mouse on the heating pad, fix it in the stereotaxic frame and adjust isoflurane to 0.5-1% while monitoring the mouse’s breathing rate.
Anesthesia is confirmed by absence of a response to a toe pinch (monitor toe pinch response every 20 min during surgery).
Use cotton swabs to clean the head with betadine, distilled water, and then betadine.
Inject 0.1 ml Lidocaine under the surface of the scalp to provide local analgesia.
Protect eyes from light: put eye ointment (e.g., Vidisic, 2 mg/ml) and cover them.
Figure 1. Mouse preparation for craniotomy. A. Shaved area of the mouse head; B. Mouse placed in the stereotaxic frame with zygomatic ear cups, depicting head incision with cleaned skull. C. Alignment of the skull, using two needles mounted on the stereotaxic holder. D. Super bond layer applied to the skull, exposing bregma mark.
Incision and craniotomy
Make incision from anterior to posterior (between the eyes to back of the skull) (Figure 1B).
Swab incision with a cotton swab dipped in saline.
Scrape away tissues on top of skull with a scraper.
Clean skull with a cotton swab dipped in distilled water.
Note: Steps C3-C4 are crucial for implantation. It is optional to use a Colibri retractor to expose the surgical field.
If using zygomatic ear cups, align the skull (make it flat) in the anterior-posterior and medial-lateral axis using two needles mounted on a stereotaxic holder in the left arm (Figure 1C). In the case of ear bars, just focus on the anterior-posterior (bregma-lambda) alignment.
Estimate and mark bregma location.
Make sure skull is clean (without blood, fur or tissue) and dry (use a dry cotton swab to absorb any distilled water or blood).
Cut thin marks into bone with a scalpel (improves adhesion of super bond to the skull) and dry well the skull using a compressed air duster.
Get Super Bond container from fridge and prepare the mixture, following instructions (see Recipes).
Apply a thin layer of Super Bond on the skull, using the brush. It is crucial to leave bregma mark exposed (Figure 1D). Do not apply Super Bond on the skin.
Note: It is important to be fast performing steps C9-C10. If Super Bond is applied to the skin, clean it immediately, using forceps to gently remove it.
Using one needle mounted on a stereotaxic holder in the right arm (32° angled), mark bregma and calculate target coordinates (DRN is -4.7 AP, -2.9 DV from bregma), using the following equation.
Note: This equation is used to calculate the corrected target coordinates after having a defined angle for the implantation. When no angle is used in the stereotaxic arm, it is enough to sum the coordinates of the target to the coordinates read in the stereotaxic frame while touching bregma. However, when using an angle, the target coordinates need to be corrected to account for such angle, using simple trigonometry.
Mark target position.
Perform craniotomy around the target mark (drill through Super Bond) and remove the dura using a 30 G needle. If any bleeding occurs, use a cotton swab to clean the blood and use a piece of absorbable sponge to stop the bleeding.
Cover craniotomy with a wet sponge in saline.
Virus injection
Get the virus from fridge and mount the pipette on the stereotaxic holder in the right arm.
Position the pipette containing the virus so that its tip touches bregma and calculate the target coordinates.
Remove wet sponge from the craniotomy.
Move the right arm to the target anterior-posterior position. Then start penetration in the brain.
Inject the virus using picospritzer set at 2,000 msec for the period and 1.0 msec for the pulse duration.
Injection is performed in six different points around the target (Figure 2). Two anterior-posterior locations (100 μm anterior to target, 100 μm posterior to target) and three points along the dorsal-ventral axis: 1) 100 μm above the target, 2) target, 3) 100 μm below the target. Inject approximately 1/6 of the viral volume in each point.
Note: Wait 5 min between removing the pipette from each anterior-posterior location.
When injections are finished, pull the arm up. If fiber cannula implantation is to be performed, do not remove the right arm from the stereotaxic frame. Replace the stereotaxic holder with the cannula fiber holder.
Cover craniotomy with a wet sponge in saline.
Figure 2. Virus injection in the dorsal raphe nucleus. Injection is performed with an angled approach (32°), in six different points (black circles) around the target (blue circle). We observed that the viral spread within the DRN is low (when compared with other brain areas), thus we use six points of injection to guarantee a wider spread of the viral particles within the DRN.
Optical fiber implantation
Mount the fiber on the stereotaxic holder in the right arm.
Position the fiber tip on bregma and calculate target coordinates.
Remove wet sponge from the craniotomy and keep it wet with saline (Figure 3A).
In case of additional check for exact fiber location (see Data analysis section), apply a fluorescent dye (e.g., DiI) to the fiber sides before implantation, using a syringe with a 30 G needle (be careful and do not cover the tip of the fiber).
Move the right arm to the anterior-posterior target position (Figure 3B).
Insert the fiber slowly into the dorsal-ventral position (Figure 3C). For optogenetic experiments (not for fiber photometry) a 180 μm retraction along the dorsal-ventral axis is recommended for the final target.
Note: Before reaching the final target, apply eye ointment in the craniotomy (just enough to cover the space between the fiber and the skull). Alternatively, agarose gel (1%, 10 mg in 1 ml water, Sigma-Aldrich) can be used to cover the craniotomy.
Figure 3. Optical fiber implantation in the DRN. A. Fiber mounted in stereotaxic holder and positioned in bregma; B. Fiber positioned on the surface of the brain, in the DRN; C. Fiber implanted in the dorsal-ventral position of the DRN.
Finalization and post-operative care
Apply dental acrylic, in small quantities each time, until fiber implant is firmly fixed to skull.
Note: After the acrylic is dry and hard, remove any sharp edges (with the drill if necessary).
Suture wound, with approximately two sutures in the back and two in the front.
Remove the fiber cannula holder and place the cap on the optical fiber.
Prepare and apply a mixture of wound powder and 0.3% gentamicin above the sutures and head skin.
Inject 0.5-1 ml of warm sterile saline subcutaneously.
Remove mouse from the stereotaxic frame and let it recover on the heating pad.
Once the mouse is locomoting, transfer it to its home cage.
Monitor the mouse daily for the first four postsurgical days.
After surgery, animals are single housed. Photostimulation or recordings of neural activity with fiber photometry can start 2-3 weeks post-surgery, but if necessary, behavioral training can start 5 days after surgery.
Data analysis
Viral expression and fiber location can be analyzed using standard histological analysis (please refer to Correia et al., 2017 or Matias et al., 2017 for data examples). To be able to check the exact fiber location, consider applying a fluorescent dye (e.g., DiI) to the fiber sides before implantation (be careful and do not cover the tip of the fiber).
Notes
If the virus pipette is clogged before injection, put a saline drop around it and generate some pulses with the picospritzer to unclog it. If this does not work, it might be necessary to perform a fine cut on the tip. In the former option, do not forget to re-mark bregma and adjust the target coordinates.
For head-fixed experiments (Matias et al., 2017), a head-bar needs to be fixed to the skull. In this case, we recommend applying Super Bond only after the fiber cannula implantation step. Once the fiber cannula is held at the target location, apply Super Bond above the skull and place the head-bar above bregma. Then cover it with more Super Bond and finally, once it is dry, apply dental acrylic above all implants and Super Bond.
Recipes
Super bond C&B
Use the super bond kit to prepare one small spoon of polymer L-type clear, four drops of monomer and one drop of catalyst. Stir gently and apply immediately (< 2 min) using the brush. It is very important to apply the super bond immediately after preparation. Keep the dispensing dish at 4 °C before using (recommended temperature range of the dish is 10-16 °C) and clean it immediately after usage.
Acknowledgments
This protocol was used to obtain the data published in eLife (Correia PA, Lottem E, Banerjee D, Machado AS, Carey MR, Mainen ZF. 2017. Transient inhibition and long-term facilitation of locomotion by phasic optogenetic activation of serotonin neurons. eLife 6:e20975. Doi: 10.7554/eLife.20975 and Matias S, Lottem E, Dugué G, Mainen ZF. 2017. Activity patterns of serotonin neurons underlying cognitive flexibility. eLife, 6:e20552). All procedures were reviewed and performed in accordance with the Champalimaud Centre for the Unknown Ethics Committee guidelines, and approved by the Portuguese Veterinary General Board (Direcção Geral de Veterinária, approval 0421/000/000/2016). This work was supported by Fundação para a Ciência e Tecnologia (fellowship SFRH / BD/33277/2007 to PAC and SFRH/BD/43072/2008 to SM), European Research Council (Advanced Investigator Grants 250334 and 671251 to ZFM), and the Champalimaud Foundation (ZFM).
References
Carter, M. E., Yizhar, O., Chikahisa, S., Nguyen, H., Adamantidis, A., Nishino, S., Deisseroth, K. and de Lecea, L. (2010). Tuning arousal with optogenetic modulation of locus coeruleus neurons. Nat Neurosci 13(12): 1526-1533.
Cohen, J. Y., Amoroso, M. W. and Uchida, N. (2015). Serotonergic neurons signal reward and punishment on multiple timescales. Elife 4.
Correia, P. A., Lottem, E., Banerjee, D., Machado, A. S., Carey, M. R. and Mainen, Z. F. (2017). Transient inhibition and long-term facilitation of locomotion by phasic optogenetic activation of serotonin neurons. Elife 6.
Dugué, G. P., Lorincz, M. L., Lottem, E., Audero, E., Matias, S., Correia, P. A., Lena, C. and Mainen, Z. F. (2014). Optogenetic recruitment of dorsal raphe serotonergic neurons acutely decreases mechanosensory responsivity in behaving mice. PLoS One 9(8): e105941.
Fonseca, M. S., Murakami, M. and Mainen, Z. F. (2015). Activation of dorsal raphe serotonergic neurons promotes waiting but is not reinforcing. Curr Biol 25(3): 306-315.
Li, Y., Zhong, W., Wang, D., Feng, Q., Liu, Z., Zhou, J., Jia, C., Hu, F., Zeng, J., Guo, Q., Fu, L. and Luo, M. (2016). Serotonin neurons in the dorsal raphe nucleus encode reward signals. Nat Commun 7: 10503.
Liu, Z., Zhou, J., Li, Y., Hu, F., Lu, Y., Ma, M., Feng, Q., Zhang, J. E., Wang, D., Zeng, J., Bao, J., Kim, J. Y., Chen, Z. F., El Mestikawy, S. and Luo, M. (2014). Dorsal raphe neurons signal reward through 5-HT and glutamate. Neuron 81(6): 1360-1374.
Matias, S., Lottem, E., Dugue, G. P. and Mainen, Z. F. (2017). Activity patterns of serotonin neurons underlying cognitive flexibility. Elife 6.
McDevitt, R. A., Tiran-Cappello, A., Shen, H., Balderas, I., Britt, J. P., Marino, R. A., Chung, S. L., Richie, C. T., Harvey, B. K. and Bonci, A. (2014). Serotonergic versus nonserotonergic dorsal raphe projection neurons: differential participation in reward circuitry. Cell Rep 8(6): 1857-1869.
Miyazaki, K. W., Miyazaki, K., Tanaka, K. F., Yamanaka, A., Takahashi, A., Tabuchi, S. and Doya, K. (2014). Optogenetic activation of dorsal raphe serotonin neurons enhances patience for future rewards. Curr Biol 24(17): 2033-2040.
Ogawa, S. K., Cohen, J. Y., Hwang, D., Uchida, N. and Watabe-Uchida, M. (2014). Organization of monosynaptic inputs to the serotonin and dopamine neuromodulatory systems. Cell Rep 8(4): 1105-1118.
Pollak Dorocic, I., Furth, D., Xuan, Y., Johansson, Y., Pozzi, L., Silberberg, G., Carlen, M. and Meletis, K. (2014). A whole-brain atlas of inputs to serotonergic neurons of the dorsal and median raphe nuclei. Neuron 83(3): 663-678.
Qi, J., Zhang, S., Wang, H. L., Wang, H., de Jesus Aceves Buendia, J., Hoffman, A. F., Lupica, C. R., Seal, R. P. and Morales, M. (2014). A glutamatergic reward input from the dorsal raphe to ventral tegmental area dopamine neurons. Nat Commun 5: 5390.
Ranade, S. P. and Mainen, Z. F. (2009). Transient firing of dorsal raphe neurons encodes diverse and specific sensory, motor, and reward events. J Neurophysiol 102(5): 3026-3037.
Tsai, H. C., Zhang, F., Adamantidis, A., Stuber, G. D., Bonci, A., de Lecea, L. and Deisseroth, K. (2009). Phasic firing in dopaminergic neurons is sufficient for behavioral conditioning. Science 324(5930): 1080-1084.
Weissbourd, B., Ren, J., DeLoach, K. E., Guenthner, C. J., Miyamichi, K. and Luo, L. (2014). Presynaptic partners of dorsal raphe serotonergic and GABAergic neurons. Neuron 83(3): 645-662.
Copyright: Correia et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Correia, P. A., Matias, S. and Mainen, Z. F. (2017). Stereotaxic Adeno-associated Virus Injection and Cannula Implantation in the Dorsal Raphe Nucleus of Mice. Bio-protocol 7(18): e2549. DOI: 10.21769/BioProtoc.2549.
Correia, P. A., Lottem, E., Banerjee, D., Machado, A. S., Carey, M. R. and Mainen, Z. F. (2017). Transient inhibition and long-term facilitation of locomotion by phasic optogenetic activation of serotonin neurons. Elife 6.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
255 | https://bio-protocol.org/exchange/protocoldetail?id=255&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ex vivo Co-culture of Lymphoid Tissue Stromal Cells and T Cells
Ming Zeng
A Ashley T. Haase
Published: Vol 2, Iss 17, Sep 5, 2012
DOI: 10.21769/BioProtoc.255 Views: 10681
Original Research Article:
The authors used this protocol in Jan 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2012
Abstract
Stromal cells within lymphoid tissues produce IL-7, which is critical for the survival and function of T cells. This protocol is to be used to isolate primary human lymphoid tissue stromal cells to study their impact on the survival of T cells in an ex vivo co-culture system.
Materials and Reagents
RPMI-1640 medium (Life Technologies, catalog number: 11875-093 )
Fetal bovine serum (FBS) (GEMBIO, catalog number: 900-108 )
Antibiotic-Antimycotic (Life Technologies, catalog number: 15240-062 )
Anti-CD45RA (Dako, catalog number: M0754 )
Anti-activated caspase-3 (Cell Signaling Technology, catalog number: 9665 )
Anti-CD3 (AbD Serotec, catalog number: MCA1477 )
Anti-IL-7 (R&D Systems, catalog number: MAB207 )
Streck's tissue fixative (Streck Laboratories, catalog number: 265138 )
TritonX-100 (Sigma-Aldrich, catalog number: X-100 )
CellMicroSieves ( BioDesign Inc. of New York, catalog number: N100S )
Alexa Fluor 488 donkey anti-rabbit IgG (Life Technologies, InvitrogenTM, catalog number: A-21206 )
Alexa Fluor 568 Donkey Anti-Mouse IgG (Life Technologies, InvitrogenTM, catalog number: A10037 )
Alexa Fluor 647 Chicken Anti-Rat IgG (Life Technologies, InvitrogenTM, catalog number: A-21472 )
Dimethylsulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Phosphate-BufferedSaline(PBS)(LifeTechnologies,InvitrogenTM,catalog number: 10010-023 )
Complete RPMI-1640 culture medium (see Recipes)
Note: The experimental protocols used here for human tissue samples had full IRB approval (Institutional Review Board: Human Subjects Committee, Research Subjects’ Protection Program, University of Minnesota) and informed written consent was obtained from individual patients, or the legal guardians of minors, for the use of tissue in research applications prior to the initiation of surgery.
Equipment
Biological Safety Cabinet
Chamber slides (Thermo Fisher Scientific, catalog number: 154526 )
Centrifuges
Water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,550 | https://bio-protocol.org/exchange/protocoldetail?id=2550&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bioluminescence Monitoring of Neuronal Activity in Freely Moving Zebrafish Larvae
SK Steven Knafo
AP Andrew Prendergast
OT Olivier Thouvenin
SF Sophie Nunes Figueiredo
Claire Wyart
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2550 Views: 9127
Edited by: Geoff Lau
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
The proof of concept for bioluminescence monitoring of neural activity in zebrafish with the genetically encoded calcium indicator GFP-aequorin has been previously described (Naumann et al., 2010) but challenges remain. First, bioluminescence signals originating from a single muscle fiber can constitute a major pitfall. Second, bioluminescence signals emanating from neurons only are very small. To improve signals while verifying specificity, we provide an optimized 4 steps protocol achieving: 1) selective expression of a zebrafish codon-optimized GFP-aequorin, 2) efficient soaking of larvae in GFP-aequorin substrate coelenterazine, 3) bioluminescence monitoring of neural activity from motor neurons in free-tailed moving animals performing acoustic escapes and 4) verification of the absence of muscle expression using immunohistochemistry.
Keywords: GFP-Aequorin-opt Zebrafish Bioluminescence Coelenterazine Escape response
Background
Unlike fluorescent genetically encoded calcium indicators (GECIs) (Grienberger and Konnerth, 2012), such as the GCaMP family, the bioluminescent indicator GFP-aequorin (Shimomura et al., 1962) does not require light excitation and therefore opens new avenues for monitoring neural activity in moving animals, including flies (Martin et al., 2007), mice (Rogers et al., 2007) and zebrafish larvae (Naumann et al., 2010). However, efficient use of GFP-aequorin remains challenging to achieve in zebrafish larvae, restricting its widespread use as a calcium indicator. The limitation lies in the fact that bioluminescence signals originating from a single muscle fiber are so large they constitute a major pitfall. Once absence of muscle expression is verified for a given transgenic line, bioluminescence signals emanating from neurons only are very small. To overcome these limitations, we developed a codon-optimized variant of GFP-aequorin for zebrafish larvae, achieved selective expression in motor and sensory neurons using existing transgenic lines, modified coelenterazine soaking protocol in order to conduct experiments at 4 days post-fertilization, created a behavioral bioluminescence assay for monitoring neuronal activity during acoustic evoked stereotyped escape responses in zebrafish larvae.
Materials and Reagents
Microscope slide 76 x 26 x 1.1 mm (VINCENT LEERMIDDELEN SCIENTIFIC, catalog number: 29201316 )
Cover glass Knittel Glass 24 x 60 mm
Zebrafish larvae Adult AB and and Tüpfel long fin (TL) strains of Danio rerio aged between 0 and 4 dpf (day post fertilization) were used for this study; transgenic lines used in this protocol (available on request): Tg(mnx1:gal4)icm11;Tg(UAS:GFP-aequorin-opt)icm09
Mammalian GFP-aequorin sequence (provided by Dr. Ludovic Tricoire, Université Pierre et Marie Curie, Paris, France, see text file in Supplement file 1)
PT2 14xUAS plasmid (provided by Pr. Koichi Kawakami, National Institute of Genetics, Mishima, Japan, map can be downloaded at http://kawakami.lab.nig.ac.jp/trans.html)
Instant Ocean® salts
Methylene blue
Fixation solution (4% PFA) paraformaldehyde, powder 95% (Sigma-Aldrich, catalog number: 158127 )
NGS (Abcam, catalog number: ab7481 )
DMSO (Sigma-Aldrich, catalog number: D8418 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 18912014 )
Chicken anti-GFP primary antibody (Abcam, catalog number: ab13970 )
Alexa Fluor 488 goat anti-chicken IgG (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11039 )
Mounting Medium for fluorescence (Vector Laboratories, catalog number: H-1000 )
Coelenterazine-h (Biotium, catalog number: 10111 )
Propylene glycol
Cyclodextrine
Agarose
‘Blue water’ (see Recipes)
Blocking solution (see Recipes)
Incubation solution (see Recipes)
Washing solution (see Recipes)
Equipment
Wave generator (Agilent Technologies, catalog number: 33210A )
Audio amplifier (Lepai, catalog number: LP-2020A )
Upright confocal microscope (Olympus, model: FV1000 )
850 nm LED (Effisharp, Effilux, France, EFFI-sharp_CM_850_2)
Long-pass 780 filter (Asahi Spectra USA, catalog number: ZIL0780 )
Long-pass 810 filter (Asahi Spectra USA, catalog number: XIL0810 )
Diffuser (Thorlabs, catalog number: DG10-120-B )
High-speed infrared sensitive camera (Mikrotron, catalog number: Eosens MC1362 )
Objective Nikkor 50 mm f/1.8D (Nikon, Japan)
Photomultiplier tube (PMT) (Hamamatsu Photonics, catalog number: H7360-02 )
Acquisition card (National Instruments, catalog number: PCI 6602 )
Band-pass filter (525 nm/50 nm) (ZEISS, catalog number: 489038-8002-000 )
Short-pass filter (670 nm) (Asahi Spectra USA, catalog number: XVS0670 )
2-Ohm speaker
TTL chronogram generator (RD Vision, France, EG Chrono)
Black cardboard box protecting the setup from residual photons in the room
Standard equipment for molecular biology
Sonicator (Emerson Electric, Branson, model: B1510-DTH )
Software
Hiris video software (RD Vision, France)
MATLAB (The MathWorks, catalog number: R2012b)
Procedure
Generation of the codon-optimized Tg(UAS:GFP-aequorin-opt) transgenic line
Generate a codon-optimized sequence, GFP-aequorin-opt, for expression in zebrafish from original sequence of mammalian GFP-aequorin (we used to online tool freely available made by Integrated DNA Technology: https://eu.idtdna.com/CodonOpt, original and optimized DNA sequences provided in Supplement file 2).
Subclone GFP-aequorin-opt into a PT2 14xUAS plasmid.
Inject the UAS:GFP-aequorin-opt construct in the Tg(mnx1:gal4)icm11 embryos to generate the Tg(mnx1:gal4;UAS:GFP-aequorin-opt)icm09 double transgenic line. Injection mix is composed as follows: 2 µl ADN (120 ng/µl) + 2 µl ARN transposase (175 ng/µl) + 1 µl KCl 2 M +1 µl 2% phenol red, complete to 10 µl with MilliQ H2O.
Maintain adult AB and Tüpfel long fin (TL) strains of Danio rerio on a 14/10 h light cycle and water is maintained at 28.5 °C, conductivity at 500 μS and pH at 7.4.
Raise embryos in ‘blue water’ (3 g of Instant Ocean® salts and 2 ml of methylene blue at 1% in 10 L of osmosed water, see Recipes) at 28.5 °C during the first 24 h before screening for GFP expression.
Characterization of GFP-aequorin expression with immunohistochemistry
Fix 4 dpf larvae in 4% PFA for 4 h at 4 °C followed by 3 x 5 min washes in PBS.
Block larvae for 1 h in blocking solution (see Recipes) (agitation required).
Incubate larvae with the primary antibody (anti-GFP, dilution 1:500) over night at 4 °C in incubation solution (see Recipes) (agitation required).
Wash three times for 5 min in washing solution (see Recipes), then incubate larvae in the dark with the secondary antibody (Alexa Fluor 488 goat anti-chicken IgG, dilution1:1,000) in PBST (agitation required) for 2 h at RT.
Wash three times for 5 min in PBST, then mount larvae on a slide with mounting medium and image on a standard upright confocal microscope (Olympus FV-1000).
Perform negative IHC controls by omitting the primary antibody.
Image the entire immunostained Tg(mnx1:gal4;UAS:GFP-aequorin-opt)icm09 larvae to confirm selective expression of GFP-aequorin-opt in spinal motor neuron populations and absence from muscle fibers. We noted more prominently primary dorsal motor neurons but also intermediate and ventral secondary motor neurons (Figure 1) without any expression in the muscles and only very limited expression in the brain and hindbrain.
Figure 1. Expression pattern of GFP-aequorin-opt in motor neurons. Fluorescent image (upper panel) and immunohistochemistry for GFP (lower panel) in a 4 dpf Tg(mnx1:gal4;UAS:GFP-aequorin-opt) double transgenic zebrafish larva showing selective expression in spinal motor neurons (arrowhead: dorsal primary, arrow: ventral secondary motor neurons), and strictly no expression in muscle fibers (white arrow in the upper panel).
Soaking of larvae in coelenterazine solution
Prepare 10 mM stock solution from lyophilized coelenterazine-h: e.g.,
For 250 µg of coelenterazine-h, final volume is 60 µl (M = 407.5 g/M).
Add propylene glycol to (25% of final volume, e.g., 15.4 µl).
Sonicate cyclodextrine at 45% (4.5 g in 10 ml).
Add cyclodextrine (75% of final volume, e.g., 46 µl).
Prepare 60 µM coelenterazine-h soaking solution from stock:
Dilute stock solution in ‘blue water’ (e.g., 6 µl in 1 ml for 10 embryos).
Dechorionate embryos at 1 day post-fertilization under optical magnification.
Soak dechorionated embryos overnight at 26 °C (e.g., 100 µl for each embryo, use 48-well plate sealed with paraffin).
Renew 60 µM soaking solution at 2 days post-fertilization. Embryos are maintained in the dark.
Perform behavioral experiments at 4 days post-fertilization (total soaking time is 72 h).
Monitoring neuronal activity with bioluminescence
Build a lightproof setup for bioluminescence assay (Figure 2)
Figure 2. Bioluminescence setup for escapes. A. Signals emitted from spinal motor neurons in Tg(mnx1:gal4;UAS:GFP-aequorin-opt) double transgenic zebrafish larvae at 4 dpf were recorded using a photomultiplier tube under infrared illumination during active behaviors elicited by an acoustic stimulus. B. Picture of the setup showing every component: 1: high-speed camera; 2: 50 mm objective; 3: IR 850 nm LED; 4: Diffuser; 5: Long-pass filters; 6: photomultiplier tube.
Using black boards, create a 1 m square lightproof box.
Infrared light illumination is provided by an 850 nm LED mounted with 2 long-pass 780 and 810 filters and a diffuser.
Video acquisition is performed at 1,000 Hz using a high-speed infrared sensitive camera at 320 x 320 pixels resolution controlled by the video software (Hiris®).
Photons are counted with a photomultiplier tube located under the larva arena and sent to an acquisition card. A band-pass filter (525 nm/50 nm) and a short-pass filter (670 nm) are placed between the larva and the PMT.
A custom application-programming interface synchronizes the video acquisition with the photon count and the stimulus delivery using a 30 trials batched TTL chronogram.
Run the bioluminescence assay one larva at a time
Place larva in a circular (2 cm diameter) 3D-printed arena (larva can also be head-embedded in 1.5% low-melting point agarose with the tail free to move).
Place the larva in the arena and attach the arena to a small 2-Ohm speaker.
Deliver sinusoidal stimuli (5 cycles, 500 Hz) produced by the waveform generator and audio amplifier through a 2-Ohm speaker attached to the larva arena.
Adjust intensity to the lowest value reliably eliciting an escape response (between 0.5 and 5 V usually).
Each trial consists in a 500 msec baseline followed by a 10 msec acoustic stimulus and 1,990 msec subsequent recording.
Assays consist of 30 trials with 1-min inter-trial intervals to reduce habituatio.
Data analysis
Kinematics analysis (blue trace in Figure 3, right panel)
Using a custom MATLAB algorithm (see Supplement file 3), manually locate the base and tip of the tail. The tail is subsequently automatically tracked.
The tail angle is computed for each frame and filtered using median filtering (window size = 10).
The start of the movement is determined as the first frame followed by 3 with a differential tail angle value above 0.08 degree in our conditions.
The end of the movement is determined as the last of 20 frames with a differential tail angle value below 0.1 degree in our conditions.
Local minimal and maximal values of the tail angle occur at least 2 msec apart and 1° above the 5 msec preceding value.
Automated movement categorization is determined as follows: ‘escapes’ for all movements with maximum values of tail angle > 45° and number of cycles > 1; ‘slow swims’ for all movement with maximum values of tail angle < 25° and number of cycles > 1.
Bioluminescence recording and analysis (green trace in Figure 3B)
Photons are counted at 1 kHz (temporal resolution of 1 msec) and then binned every 10 msec.
The signal is filtered using a running average with a window size of 10, giving a typical signal-to-noise ratio (SNR) for active movements of 50 to 1.
Noise is extrapolated from a linear fit of the cumulative photon count before the stimulus and subtracted from the signal.
The start and end of the bioluminescent signal are computed respectively as the first time point followed by 3 points with a value above 0.4 photons/10 msec and below 0.2 photons/10 msec from this first point bioluminescence value.
The time-to-peak is calculated between the start and the peak of the bioluminescent signal while the decay coefficient is derived from the one-term exponential fit between the peak and the end of the signal.
Figure 3. Example of kinematics and bioluminescence data for an escape response. A. 4 dpf larva in the head-embedded setup with the tail tracked (red dots) in transmitted IR light. B. Superimposed, and color-coded according to delay from stimulus, behaviors elicited by an acoustic stimulus; C. Example traces of typical bioluminescence signals and tail angle observed for an escape response; D. Example of a color-coded slow swim and (E) corresponding bioluminescence signal and tail angle traces for comparison with escapes.
Notes
Soaking in coelenterazine is key to obtaining a good signal-to-noise ratio for bioluminescence: pay attention to soaking conditions (incubation temperature, hour of coelenterazine renewal, keep the wells of the plate air-tight).
Noise due to ambient light must be tested before running the behavioral experiment; make sure the box is completely lightproof.
The Tg(UAS:GFP-aequorin-opt) zebrafish line is freely available to all users that request it.
Recipes
‘Blue water’
3 g of Instant Ocean® salts and 2 ml of 1% methylene blue in 10 L of ultrapure water
Blocking solution
10% NGS
1% DMSO
0.5% Triton X-100
in 0.1 M PBS
Incubation solution
1% NGS
1% DMSO
0.5% Triton X-100
in 0.1% PBS
Washing solution
0.1 M PBST with 0.5% Triton X-100
Acknowledgments
We would like to thank Dr. Ludovic Tricoire (University Pierre et Marie Curie, France) for providing the original GFP-aequorin sequence, Dr. Tom Auer and Dr. Filippo Del Bene (Institut Curie, France) for providing the mnx1 construct and Prof. Koichi Kawakami (NIG, Japan) for providing the PT2 14xUAS plasmid. We are indebted to RD Vision for developing the custom API to synchronize photon collection and video acquisition. We thank Bogdan Buzurin and Natalia Maties for fish care. SK received a PhD fellowship from Inserm and Assistance Publique–Hôpitaux de Paris. This work received financial support from the Institut du Cerveau et de la Moelle épinière with the French program ‘Investissements d’avenir’ ANR-10-IAIHU-06, the ENP Chair d’excellence, the Fondation Bettencourt Schueller (FBS), the City of Paris Emergence program, the ATIP/Avenir junior program from INSERM and CNRS, the NIH Brain Initiative grant no. 5U01NS090501 and the European Research Council (ERC) starter grant ‘OptoLoco’ #311673.
References
Grienberger, C. and Konnerth, A. (2012). Imaging calcium in neurons. Neuron 73(5): 862-885.
Martin, J. R., Rogers, K. L., Chagneau, C. and Brulet, P. (2007). In vivo bioluminescence imaging of Ca2+ signalling in the brain of Drosophila. PLoS One 2(3): e275.
Naumann, E. A., Kampff, A. R., Prober, D. A., Schier, A. F. and Engert, F. (2010). Monitoring neural activity with bioluminescence during natural behavior. Nat Neurosci 13(4): 513-520.
Rogers, K. L., Picaud, S., Roncali, E., Boisgard, R., Colasante, C., Stinnakre, J., Tavitian, B. and Brulet, P. (2007). Non-invasive in vivo imaging of calcium signaling in mice. PLoS One 2(10): e974.
Shimomura, O., Johnson, F. H. and Saiga, Y. (1962). Extraction, purification and properties of aequorin, a bioluminescent protein from the luminous hydromedusan, Aequorea. J Cell Comp Physiol 59: 223-239.
Copyright: Knafo et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Knafo, S., Prendergast, A., Thouvenin, O., Figueiredo, S. N. and Wyart, C. (2017). Bioluminescence Monitoring of Neuronal Activity in Freely Moving Zebrafish Larvae. Bio-protocol 7(18): e2550. DOI: 10.21769/BioProtoc.2550.
Knafo, S., Fidelin, K., Prendergast, A., Tseng, P. B., Parrin, A., Dickey, C., Bohm, U. L., Figueiredo, S. N., Thouvenin, O., Pascal-Moussellard, H. and Wyart, C. (2017). Mechanosensory neurons control the timing of spinal microcircuit selection during locomotion. Elife 6.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Sensorimotor response
Neuroscience > Neuroanatomy and circuitry > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,551 | https://bio-protocol.org/exchange/protocoldetail?id=2551&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Primary Cultures of Embryonic Rat Hippocampal and Cerebrocortical Neurons
Ivan L. Salazar
Miranda Mele
MC Margarida V. Caldeira
Rui O. Costa
BC Bárbara Correia
Simone Frisari
Carlos B. Duarte
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2551 Views: 16852
Reviewed by: Kae-Jiun ChangEmmanuelle Berret
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
This protocol aims at standardizing the procedure to obtain primary cultures of hippocampal and cerebrocortical neurons for in vitro experiments. Cultures should be prepared from cells isolated during embryonic development when neuronal precursor cells are not yet fully differentiated. This helps increasing the quality and quantity of cells, while offering minimal cell death that often occurs during dissociation of differentiated neurons. Cells plated under the appropriate conditions, either in Petri-dishes or in multi-well plates, will develop and establish synaptic contacts over time since the neuronal culture medium provides the nutrients and trophic factors required for differentiation. In this protocol we describe the methodology for the preparation of both cortical and hippocampal neuronal cultures.
Keywords: Primary cultures Hippocampal neurons Cerebrocortical neurons Cell culture
Background
The present protocol describes the preparation of primary cultures of rat hippocampal and cerebrocortical neurons, using Neurobasal medium supplemented with NeuroCultTM SM1 (Chen et al., 2008). The composition of NeuroCultTM SM1 is based on the formulation of the B27 supplement (Brewer et al., 1993), but the former cocktail was found to improve the quality of neuronal cultures, in part by replacement of apo-transferrin with holo-transferrin (Chen et al., 2008). Furthermore, the chemical composition of NeuroCultTM SM1 was described in more detail in the original publication, allowing a better control of the experimental conditions. Neuronal cultures prepared with chemically defined culture media are characterized by the presence of a low percentage of astrocytes. The proliferation of astrocytes in cultures maintained for longer periods of time, in order to allow differentiation of neurons, is prevented by adding the chemical inhibitor of mitosis 5-Fluoro-2’-deoxyuridine.
Materials and Reagents
Petri dish, 55 mm Polysterene aseptic non-tissue culture treated (Labbox, catalog number: PDIP-06N-500 )
Petri dish, 150 mm glass soda-lime (DWK Life Sciences, Duran, catalog number: 23 755 52 )
15 ml conical tube (Corning, Falcon®, catalog number: 352096 )
5 ml glass pipetes (VWR, catalog number: 612-4124 )
10 ml glass pipetes (VWR, catalog number: 612-4125 )
50 ml conical tube (Corning, Falcon®, catalog number: 352070 )
Cell strainer 70 μm (Corning, Falcon®, catalog number: 352350 )
Poly-D-lysine-coated multi-well plate (see step 16 in ‘Procedures’ for instructions)
Coverslips #1.5 (e.g., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 1014355110NR15 ; for 10 mm coverslips)
Mixed cellulose ester filter, ME Range (ME 24), 0.2 μm pore size for filtration unit (GE Healthcare, Whatman, catalog number: 10406970 )
Acetate cellulose filters of Ø25 mm, 0.20 μm, sterile (FRILABO, catalog number: 1520012 )
Filtration unit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: DS0320-5033 )
Stericup-GV, 0.20 µm, PVDF, 500/1,000 ml, radio-sterilized (Merck, catalog number: SCGVU10RE )
Pregnant female Wistar rats (E17-E18 days gestation)
Trypan blue solution, 0.4% (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Poly-D-lysine hydrobomide (Sigma-Aldrich, catalog number: P7886 )
Boric acid (Merck, catalog number: 1001651000 )
Nitric acid (Applichem, catalog number: 133255.1612 )
Ethanol absolute 99.8+% (Fisher Scientific, catalog number: 10342652 )
5-Fluoro-2’-deoxyuridine (5-FDU) (Sigma-Aldrich, catalog number: F0503 )
Potassium chloride (KCl) (AppliChem, catalog number: 131494.1211 )
Potassium phosphate dibasic (K2HPO4) (Merck, catalog number: 1051041000 )
Sodium chloride (NaCl) (Applichem, catalog number: 131659.1211 )
Sodium bicarbonate (NaHCO3) (Acros Organics, catalog number: 123360010 )
Sodium phosphate dibasic dihydrate (Na2HPO4·2H2O) (Merck, catalog number: 1065800500 )
D(+)-Glucose monohydrate (VWR, catalog number: 24371.297 )
Sodium pyruvate (Sigma-Aldrich, catalog number: P5280 )
HEPES (Fisher Scientific, catalog number: BP310-1 )
Phenol red (Sigma-Aldrich, catalog number: P4758 )
Trypsin (Thermo Fisher Scientific, GibcoTM, catalog number: 27250018 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Minimum essential medium Eagle (MEM) (Sigma-Aldrich, catalog number: M0268 )
Neurobasal Medium® (Thermo Fisher Scientific, GibcoTM, catalog number: 21103049 )
NeuroCultTM SM1 Neuronal Supplement (STEMCELL Technologies, catalog number: 05711 )
L-Glutamine (Sigma-Aldrich, catalog number: G8540 ; Thermo Fisher Scientific, GibcoTM, catalog number: 25030024 )
Glutamate (Sigma-Aldrich, catalog number: G1626 )
Horse serum (Thermo Fisher Scientific, GibcoTM, catalog number: 16050122 )
Sodium hydroxide solution
Hanks’ balanced salt solution (HBSS) (see Recipes)
Trypsin solution (2 mg/ml) (see Recipes)
10% FBS (see Recipes)
Neuronal Plating Medium (see Recipes)
Supplemented neuronal culture medium (see Recipes)
Boric acid solutions (see Recipes)
Equipment
Large and small scissors
Forceps with straight tip (Fine Science Tools, model: Dumont #5 )
Forceps with curved tip (Fine Science Tools, model: Dumont #5 /45 forceps–Dumont standard tip)
Pipetboy (Integra Biosciences, model: PIPETBOY acu 2 )
Magnification glass
Laminar flow hood
Water-bath (Medingen Labortechnik, model: T100 )
Phase contrast inverted microscope equipped with a 10x objective (Nikon Instruments, model: Eclipse TS100 )
Hemocytometer (Marienfeld-Superior, catalog number: 0640010 )
Humidified incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Salazar, I. L., Mele, M., Caldeira, M., Costa, R. O., Correia, B., Frisari, S. and Duarte, C. B. (2017). Preparation of Primary Cultures of Embryonic Rat Hippocampal and Cerebrocortical Neurons. Bio-protocol 7(18): e2551. DOI: 10.21769/BioProtoc.2551.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell growth
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,552 | https://bio-protocol.org/exchange/protocoldetail?id=2552&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phagocytosis Assay of Necroptotic Cells by Cardiac Myofibroblasts
YH Yuma Horii
SM Shoichi Matsuda
KW Kenji Watari
AN Akiomi Nagasaka
HK Hitoshi Kurose
MN Michio Nakaya
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2552 Views: 7114
Edited by: Jia Li
Reviewed by: Suprabhat Mukherjee
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
In myocardial infarction (MI), a plenty of cardiomyocytes undergo necrosis and necroptosis due to the lack of oxygen and nutrients. The dead cardiomyocytes are promptly engulfed by phagocytes. When the dead cells are not engulfed, the noxious contents of the cells are released outside, and thus, induce inflammation, and obstruct the function of organs. Therefore, phagocytosis is crucial for maintaining homeostasis of organs. Herein, we describe a protocol of an in vitro phagocytosis assay of necroptotic cells.
Keywords: Phagocytosis assay Myofibroblast Engulfment Necrosis Myocardial infarction Isolation
Background
Previously, necrotic and necroptotic cells were believed to be eliminated only by cardiac macrophages in failed hearts. However, we found that cardiac myofibroblasts, which are responsible for tissue fibrosis, engulf dead cells after an MI (Nakaya et al., 2017). Herein, we provide a detailed protocol for an in vitro phagocytosis assay of necroptotic cells, employing L929 cells that undergo necroptosis by TNF-α stimulation in a caspase-3 inhibitor, Z-VAD-FMK.
Materials and Reagents
Pipette tips, 1,000 µl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2179-HR )
Pipette tips, 200 µl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2069-HR )
Pipette tips, 20 µl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2149P-HR )
Pipette tips, 10 µl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2140-HR )
Surgical tape (3M, catalog number: 1527-0 )
8-0 braided silk (NATSUME SEISAKUSHO, catalog number: M6-80B2 )
5-0 braided silk (NATSUME SEISAKUSHO, catalog number: ER12-50B1 )
10 ml syringe (TERUMO, catalog number: SS-10ESZ )
23-gauge needle (TERUMO, catalog number: NN-2332R )
50 ml tube (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339652 )
6 cm dish (Corning, catalog number: 430589 )
Surgical lancet (Akiyama Medical MFG, catalog number: FB10 )
70 µm EASYstrainerTM (Greiner Bio One International, catalog number: 542070 )
10-cm non-treated dish (Corning, catalog number: 430591 )
15 ml tube (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339650 )
8-well slide chamber (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 154534 )
Cover glass (Matsunami Glass, catalog number: C024601 )
0.22 µm Minisart® filter (Sartorius, catalog number: 16534-K )
Wild type C57BL/6JJmsSlc mouse (Japan SLC)
L929 cells (National Institutes of Biomedical Innovation, Health and Nutrition, Japanese Collection of Research Bioresources Cell Bank, catalog number: JCRB9003 )
Pentobarbital (Somnopentyl) (Kyoritsu Seiyaku, catalog number: SOM02-YA1312 )
Phosphate buffered saline (PBS) (NACALAI TESQUE, catalog number: 14249-95 )
Red blood cell (RBC) lysis buffer (Roche Diagnostics, catalog number: 11814389001 )
Trypsin/Ethylenediaminetetraacetic acid (EDTA) (NACALAI TESQUE, catalog number: 35554-64 )
Paraformaldehyde (PFA) (NACALAI TESQUE, catalog number: 26126-25 )
4’,6-Diamidino-2-phenylindole (DAPI) (Dojindo, catalog number: 340-07971 )
FluorSaveTM (Merck, catalog number: 345789 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153-100G )
Trypsin (Sigma-Aldrich, catalog number: T4799-5G )
Collagenase A (Roche Diagnostics, catalog number: 10103586001 )
Serum-free DMEM (NACALAI TESQUE, catalog number: 08458-16 )
Penicillin streptomycin (NACALAI TESQUE, catalog number: 09367-34 )
Dimethyl sulphoxide (DMSO) (Sigma-Aldrich, catalog number: D2650 )
CellTrackerTM Green 5-chloromethylfluorescein diacetate (CMFDA) dye (Thermo Fisher Scientific, InvitrogenTM, catalog number: C7025 )
Z-VAD-FMK (Z-Val-Aal-Asp(OMe)-CH2F) (PEPTIDE INSTITUTE, catalog number: 3188-v )
hTNF-α (PeproTech, catalog number: 300-01A )
Poly-L-lysine solution (Sigma-Aldrich, catalog number: P4707 )
Water (NACALAI TESQUE, catalog number: 06442-95 )
Fatal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437028 )
Collagenase A solution (see Recipes)
Culture medium (see Recipes)
10 mM CMFDA dye (see Recipes)
10 mM Z-VAD-FMK (see Recipes)
10 µg/ml hTNF-α solution (see Recipes)
8-well slide chamber coated with poly-L-lysine (see Recipes)
Equipment
Pipettes 1,000 µl (Gilson, catalog number: F123602 )
Pipettes 200 µl (Gilson, catalog number: F123601 )
Pipettes 20 µl (Gilson, catalog number: F123600 )
Pipettes 2 µl (Gilson, catalog number: F144801 )
Respirator (Shinano Manufacturing, catalog number: SN-480-7X2T )
Optical microscope (Olympus, model: SZX7 )
Surgical tools such as tweezers (tools can be purchased from NATSUME SEISAKUSHO and MEISTER)
Scissors (NATSUME SEISAKUSHO, catalog number: B-12 )
Clean bench (Panasonic Healthcare, model: MCV-B131S )
Water bath (TAITEC, model: Personal-11 )
Centrifuge (TOMY SEIKO, model: LC-200 )
CO2 incubator (SANYO, model: MCO-18AIC )
Fluorescence microscope (KEYENCE, model: BZ-9000 )
Software
BZ-II image analysis application (KEYENCE CORPORATION)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Horii, Y., Matsuda, S., Watari, K., Nagasaka, A., Kurose, H. and Nakaya, M. (2017). Phagocytosis Assay of Necroptotic Cells by Cardiac Myofibroblasts. Bio-protocol 7(18): e2552. DOI: 10.21769/BioProtoc.2552.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Macrophage
Immunology > Immune cell isolation > Macrophage
Cell Biology > Cell isolation and culture > Co-culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,553 | https://bio-protocol.org/exchange/protocoldetail?id=2553&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Assay to Determine Phagocytosis of Apoptotic Cells by Cardiac Macrophages and Cardiac Myofibroblasts
YH Yuma Horii
SM Shoichi Matsuda
KW Kenji Watari
AN Akiomi Nagasaka
HK Hitoshi Kurose
MN Michio Nakaya
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2553 Views: 9321
Edited by: Jia Li
Reviewed by: Shahzada Khan
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
In myocardial infarction (MI), a number of cardiomyocytes undergo apoptosis. These apoptotic cardiomyocytes are promptly engulfed by phagocytes. If the dead cells are not engulfed, their noxious contents are released outside, resulting in induction of inflammation. Therefore, the removal of these dead cells is necessary. However, the contribution of each phagocyte type to the removal of apoptotic cells in infarcted hearts remains unresolved. Here, we describe an in vitro protocol for a phagocytosis assay to compare the engulfment ability of cardiac macrophages and cardiac myofibroblasts.
Keywords: Phagocytosis assay Myofibroblast Engulfment Apoptosis Myocardial infarction
Background
It has long been believed that the apoptotic cells generated in failed hearts are eliminated by cardiac macrophages. However, we found that cardiac myofibroblasts, which are responsible for tissue fibrosis, also have the ability to engulf apoptotic cells after MI (Nakaya et al., 2017). The discovery prompted us to compare the engulfment ability of cardiac macrophages and cardiac myofibroblasts. Herein, we provide a detailed protocol for an in vitro phagocytosis assay to evaluate the extent of phagocytic engulfment.
Materials and Reagents
Pipette tips, 1,000 µl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2179-HR )
Pipette tips, 200 µl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2069-HR )
Pipette tips, 20 µl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2149P-HR )
Pipette tips, 10 µl (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2140-HR )
Surgical tape (3M, catalog number: 1527-0 )
8-0 braided silk (NATSUME SEISAKUSHO, catalog number: M6-80B2 )
5-0 braided silk (NATSUME SEISAKUSHO, catalog number: ER12-50B1 )
10 ml syringe (TERUMO, catalog number: SS-10ESZ )
23-gauge needle (TERUMO, catalog number: NN-2332R )
50 ml tube (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339652 )
6 cm dish (Corning, catalog number: 430589 )
Surgical lancet (Akiyama Medical MFG, catalog number: FB10 )
70 µm EASYstrainerTM (Greiner Bio One International, catalog number: 542070 )
10 cm non-treated dish (Corning, catalog number: 430591 )
15 ml tube (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339650 )
8-well slide chamber (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 154534 )
Frosted glass slides (Matsunami Glass, catalog number: S2112 )
Cover glass (Matsunami Glass, catalog number: C024601 )
40 µm EASYstrainerTM (Greiner Bio One International, catalog number: 542040 )
Aluminum foil
1.5 ml tube (BMBio, catalog number: BM-15 )
0.22 µm Minisart® filter (Sartorius, catalog number: 16534-K )
Wild type C57BL/6JJmsSlc mouse (Japan SLC)
Pentobarbital (Somnopentyl) (Kyoritsu Seiyaku, catalog number: SOM02-YA1312 )
Water (NACALAI TESQUE, catalog number: 06442-95 )
Phosphate buffered saline (PBS) (NACALAI TESQUE, catalog number: 14249-95 )
Red blood cell (RBC) lysis buffer (Roche Diagnostics, catalog number: 11814389001 )
Trypsin/Ethylenediaminetetraacetic acid (EDTA) (NACALAI TESQUE, catalog number: 35554-64 )
Fixable Viability Dye eFluorTM 780 (Thermo Fisher Scientific, eBioscienceTM, catalog number: 65-0865-14 )
Sevoflurane (Wako Pure Chemical Industries, catalog number: 193-17791 )
Paraformaldehyde (PFA) (NACALAI TESQUE, catalog number: 26126-25 )
4’,6-Diamidino-2-phenylindole (DAPI) (Dojindo, catalog number: 340-07971 )
FluorSaveTM (Merck, catalog number: 345789 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153-100G )
Trypsin (Sigma-Aldrich, catalog number: T4799-5G )
Collagenase A (Roche Diagnostics, catalog number: 10103586001 )
Serum-free DMEM (NACALAI TESQUE, catalog number: 08458-16 )
Fatal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437028 )
Penicillin-streptomycin (NACALAI TESQUE, catalog number: 09367-34 )
Dispase (Roche Diagnostics, catalog number: 04942078001 )
EDTA·2Na (Dojindo, catalog number: 345-01865 )
FITC-conjugated anti-Ly6C antibody (BioLegend, catalog number: 128006 )
PE-conjugated anti-Ly6G antibody (BioLegend, catalog number: 127607 )
APC-conjugated anti-F4/80 antibody (BioLegend, catalog number: 123116 )
PerCP/Cy5.5-conjugated anti-CD11b antibody (BioLegend, catalog number: 101230 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D2650 )
CellTrackerTM Green 5-chloromethylfluorescein diacetate (CMFDA) dye (Thermo Fisher Scientific, InvitrogenTM, catalog number: C7025 )
Poly-L-lysine solution (Sigma-Aldrich, catalog number: P4707 )
Dexamethasone (Sigma-Aldrich, catalog number: D1756-25MG )
Collagenase A solution (see Recipes)
Culture medium (see Recipes)
Dispase solution (see Recipes)
FACS buffer (see Recipes)
Primary antibodies (see Recipes)
8-well slide chamber coated with poly-L-lysine (see Recipes)
10 mM CMFDA dye (see Recipes)
10 mM dexamethasone (see Recipes)
Equipment
Pipettes 1,000 µl (Gilson, catalog number: F123602 )
Pipettes 200 µl (Gilson, catalog number: F123601 )
Pipettes 20 µl (Gilson, catalog number: F123600 )
Pipettes 2 µl (Gilson, catalog number: F144801 )
Respirator (Shinano Manufacturing, catalog number: SN-480-7X2T )
Optical microscope (Olympus, model: SZX7 )
Surgical tools such as tweezers and small scissors (tools can be purchased from NATSUME SEISAKUSHO and MEISTER)
Clean bench (Panasonic Healthcare, model: MCV-B131S )
Water bath (TAITEC, model: Personal-11 )
Centrifuge (TOMY SEIKO, model: LC-200 )
CO2 incubator (SANYO, model: MCO-18AIC )
Cell sorter (BD, BD Bioscience, model: FACSARIA III )
Fluorescence microscope (KEYENCE, model: BZ-9000 )
Software
BZ-II image analysis application (KEYENCE CORPORATION)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Horii, Y., Matsuda, S., Watari, K., Nagasaka, A., Kurose, H. and Nakaya, M. (2017). An Assay to Determine Phagocytosis of Apoptotic Cells by Cardiac Macrophages and Cardiac Myofibroblasts. Bio-protocol 7(18): e2553. DOI: 10.21769/BioProtoc.2553.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Macrophage
Immunology > Immune cell function > Macrophage
Cell Biology > Cell isolation and culture > Co-culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,554 | https://bio-protocol.org/exchange/protocoldetail?id=2554&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Lipidomic Analysis of Caenorhabditis elegans Embryos
HY Hung-Chi Yang
CH Cheng-Yu Hung
YP Yi-Yun Pan
SL Szecheng J Lo
DC Daniel Tsun-Yee Chiu
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2554 Views: 9234
Edited by: Neelanjan Bose
Reviewed by: Lu HanTanxi Cai
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Metabolomic is an emerging field of system biology. Lipidomic, a branch of metabolomic, aims to characterize lipophilic metabolites in biological systems. Caenorhabditis elegans (C. elegans) is a genetically tractable and versatile animal model for novel discovery of lipid metabolism. In addition, C. elegans embryo is simple and homogeneous. Here, we demonstrate detailed procedures of C. elegans culture, embryo isolation, lipid extraction and metabolomic data analysis.
Keywords: C. elegans Embryo Lipid LC-MS Untargeted metabolomic
Background
The metazoan model Caenorhabditis elegans (C. elegans) offer a unique platform to discover novel functions and biological roles of metabolic enzymes. Current studies of genomic, transcriptomic and proteomic have advanced our understanding to appreciate the complexity of metabolic networks in C. elegans (Watson et al., 2015). Metabolomic is an emerging tool of system biology aiming to determine small molecule metabolites within biological systems. A number of C. elegans studies have used different metabolomic approaches, including nuclear magnetic resonance (NMR) spectroscopy, gas/liquid chromatography coupled mass spectrometry (GC/LC-MS), to dissect the metabolic networks in whole worm (Atherton et al., 2008; Hughes et al., 2009; Castro et al., 2012; Patti et al., 2014; Morgan et al., 2015; Wang et al., 2015; Wan et al., 2017). Currently, there is no metabolomic-based approach to characterize the lipid metabolites in C. elegans embryos. In this study, LC-MS-based untargeted lipidomic method is chosen for several reasons. First, LC-MS is sufficiently sensitive to analyze small quantity of C. elegans embryos. Second, untargeted metabolomic provides an unbiased view of detectable metabolites, which is crucial to generate a large amount of information. Subsequently, a hypothesis can be formulated based on the global metabolomic analysis. Last but not least, C. elegans embryo is considered simple and homogeneous compared to the whole worm. Taken together, these technical advantages provide opportunities for in-depth analysis of lipid metabolism in developing C. elegans embryos.
Materials and Reagents
C. elegans culture
Aluminum foil
Autoclave tape (Fisher Scientific, catalog number: 15904 )
90 x 15 mm disposable plastic Petri dishes (China biotech corporation)
14 ml polypropylene round-bottom tubes (Corning, Falcon®, catalog number: 352059 )
15 ml centrifuge tubes (Corning, catalog number: 430791 )
50 ml centrifuge tubes (Corning, catalog number: 430829 )
250 ml NalgeneTM PPCO centrifuge bottles (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3120-0250 )
Microcentrifuge tube (Corning, Axygen®, catalog number: MCT-150-C )
Glass slide
0.3 mm diameter platinum/iridium wire (Shineteh Instruments)
0.22 μm pore size syringe filter unit (EMD Millipore, catalog number: SLGP033RB )
C. elegans N2 (wild type strain)
C. elegans control-RNAi (Mock) and G6PD-RNAi (Gi) adults and embryos
E. coli OP50 (University of Minnesota, C. elegans Genetics Center)
E. coli HT115(DE3) harboring control-RNAi (Mock) and G6PD-RNAi (Gi) plasmids
Note: The details of these plasmids, including design and construction, are described in a previous report (Yang et al., 2013).
Ultrawater
Bleach (NaOCl) (Clorox)
Sodium hydroxide (NaOH) (Merck, catalog number: 1064980500 )
M9 buffer
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 31434-5KG-R )
Agar (BioShop, catalog number: AGR001.1 )
Peptone (Oxoid, catalog number: LP0037 )
Potassium phosphate dibasic (K2HPO4) (Merck, catalog number: 1051041000 )
Potassium phosphate monobasic (KH2PO4) (Avantor Performance Materials, J.T. Baker, catalog number: 3246-05 )
Cholesterol (Sigma-Aldrich, catalog number: C8667-5G )
Ethanol (Sigma-Aldrich, catalog number: 32221-2.5L )
Note: This product has been discontinued.
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M2643-500G )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C3881-500G )
Tetracyclin-hydrochloride (Boehringer Mannheim)
Carbenicillin disodium salt (Sigma-Aldrich, catalog number: C1389-5G )
Ampicillin sodium salt (Sigma-Aldrich, catalog number: A9518-25G )
Isopropyl-b-D-thiogalactopyranoside (IPTG) (BioShop, catalog number: IPT001.50 )
LB broth (BD, DifcoTM, catalog number: 244610 )
Nematode growth medium (NGM) (see Recipes)
1 M KPI buffer pH 6.0 (see Recipes)
5 mg/ml cholesterol (see Recipes)
1 M MgSO4 (see Recipes)
1 M CaCl2 (see Recipes)
10 mg/ml tetracycline-hydrochloride (see Recipes)
25 mg/ml carbenicillin (see Recipes)
200 mg/ml ampicillin (see Recipes)
1 M IPTG (see Recipes)
C. elegans sample preparation
Falcon cell-strainer cap (12 x 75 mm) (Corning, Falcon®, catalog number: 352235 )
Pyrex glass tube (20 x 125 mm) (Corning, PYREX®, catalog number: 9826-20 )
Glass Pasteur pipettes (Kimble Chase Life Science, catalog number: 63A54 )
Glass organic solvent-resistant pipette tips (HBG, catalog number: 1010-19 )
Organic solvent-resistant polypropylene tip (Gilson, catalog number: F161110 )
Organic solvent-resistant polypropylene microcentrifuge tube (STARLAB INTERNATIONAL, catalog number: S1615-5500 )
HPLC vial (WATERS, catalog number: 186000272C )
Chloroform (LC grade) (Merck, catalog number: 1024444000 )
Methanol (HPLC grade) (Avantor Performance Materials, J.T. Baker, catalog number: 9093 )
Chromasolv grade water (H2O) (Sigma-Aldrich, Fluka ,catalog number: 39253-1L-R )
Chromasolv grade acetonitrile (ACN) (Avantor Performance Materials, J.T. Baker, catalog number: 9829-03 )
Chromasolv grade isopropanol (Sigma-Aldrich, Fluka, catalog number: 34965-2.5L )
Ammonium formate (Fluka, catalog number: 70221 )
Formic acid (Sigma-Aldrich, Fluka, catalog number: 56302 )
Equipment
Pyrex narrow mouth Erlenmeyer flasks (Corning, PYREX®, catalog number: 4980-1L )
Lamina flow hood (Chin-Chih H&W ENTERPRISE, catalog number: BSC-4 )
20 °C incubator (Firstek, catalog number: RI-560 )
37 °C incubator with shaker (Yihder, catalog number: LM-570RD )
Centrifuge (Beckman Coulter, model: Avanti® J-26XP )
Rotor (Beckman Coulter, model: JA-14 )
Stereomicroscope (Nikon Instruments, model: SMZ745 )
Stainless steel surgical blade (No. 10) and holder (Feather Safety Razor, Japan)
Vorterxer (Scientific Industries, model: Vortex-Genie 2 )
Centrifuge (Eppendorf, model: 5810 R )
High-capacity swing-bucket rotor with four 250 ml buckets (Eppendorf, model: A-4-62 )
-80 °C freezer
100 ml glass beaker (Corning, PYREX®, catalog number: 1000-100 )
Macropipette (Socorex, catalog number: 835.05 )
Sonicator (Sonics & Materials, model: VCX 400 )
Ultrasonic cleaner (Delta, model: DC200H )
Nitrogen gas spray unit for aluminum block bath evaporation head (TAITEC, model: DTU-2B )
Centrifuge (Eppendorf, model: 5427 R )
Acquity CSH C18 column (particle size of 1.7 μm, 2.1 x 100 mm) (WATERS, catalog number: 186002352 )
Ultra-performance liquid-chromatography (UPLC) system (WATERS, catalog numbers: 176001285 , 700003616 , 700002764 )
SYNAPT G1 HDMS system (WATERS)
Autoclave (Tomin Medical Equipment, catalog number: TM-328 )
4 °C cooling cabinet (Firstek, catalog number: CC-2 )
Software
MassLynx4.1 (WATERS)
Extended Statistics (EZinfo, WATERS)
MetaboAnalyst (http://www.metaboanalyst.ca)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yang, H., Hung, C., Pan, Y., Lo, S. J. and Chiu, D. T. (2017). Lipidomic Analysis of Caenorhabditis elegans Embryos. Bio-protocol 7(18): e2554. DOI: 10.21769/BioProtoc.2554.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Lipid measurement
Systems Biology > Metabolomics > Whole organism
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,555 | https://bio-protocol.org/exchange/protocoldetail?id=2555&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Uptake Assays to Monitor Anthracyclines Entry into Mammalian Cells
NB Nicolas Brosseau
EA Emil Andreev
Dindial Ramotar
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2555 Views: 6799
Edited by: Nicoletta Cordani
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Anthracyclines, such as doxorubicin and daunorubicin, are DNA damaging agents that autofluoresce and can be readily detected in cells. Herein, we developed suitable assays to quantify and localize daunorubicin in mammalian cells. These assays can be exploited to identify components that are involved in the uptake of anthracyclines.
Keywords: Influx transporters Anthracyclines Autofluorescent drugs FACS analysis Epifluorescence microscopy Fluoroskan reader
Background
The anthracyclines, such as doxorubicin and daunorubicin, act by damaging the DNA and are used for treating various types of cancers including acute myeloid leukemia. When cancer patients are given anthracyclines systemically, there are several factors limiting the amount of the drugs that reach the tumor sites (Chauncey, 2001; Deng et al., 2014; Riganti et al., 2015). In the tumor, the drug activity on the cancer cells is limited by poor drug uptake, excessive drug efflux as well as changes in the cellular targets. For several decades, it remains unclear how these DNA damaging agents enter cancer cells (Aouida et al., 2010; Cesar-Razquin et al., 2015; Zhang et al., 2015). To address this question, we developed three reliable in vitro assays to monitor daunorubicin accumulation into cells. Two of these assays are quantitative and required access to a Fluorescence-Activated Cell Sorting (FACS) caliber and a Fluoroskan instrumentation and the third is semi-quantitative using epifluorescence microscopy. Using these assays, we established that daunorubicin enter into cells in a time- and concentration-dependent manner and that each cell type showed a different rate of uptake, suggesting that an active process is involved in the uptake of anthracyclines (Andreev et al., 2016). We applied these assays and uncovered the organic cation transporter 1 (OCT1) as a key protein for the uptake of daunorubicin into the cells (Andreev et al., 2016). Modulating the level of OCT1 resulting in cells with altered uptake and sensitivity towards daunorubicin (Andreev et al., 2016). These assays provide hints that additional transporters exist to allow uptake of daunorubicin into the cells. We believe that these uptake assays can be exploited further to identify additional factors such as kinases (Tanaka et al., 2004; Ciarimboli and Schlatter, 2005; Zhou et al., 2005; Pelis et al., 2006; Filippo et al., 2011; Sprowl et al., 2016) that influence the rate of daunorubicin uptake. In this protocol, we describe three analyses to monitor the uptake of anthracyclines into cells.
Materials and Reagents
Mammalian cell culture containers for adherent cells (100 and 60 mm Petri dishes and T-75 flask)
100 mm Petri dishes (SARSTEDT, catalog number: 83.3902 )
60 mm Petri dishes (SARSTEDT, catalog number: 83.3901 )
T-75 flask (Corning, catalog number: 430641 )
Notes:
However, any other Petri dishes or flask suitable for your cell line may work.
Note that you can grow suspension cells in containers for adherent cells.
Eppendorf tubes
FACS tubes that will adapt to the flow cytometer:
Falcon 5 ml polystyrene round-bottom tube (Corning, Falcon®, catalog number: 352058 )
Microscope slides (UltiDent Scientific, catalog number: 170-7107A )
Note: Any microscope slide that fit on your microscope can be used.
Cover glass (UltiDent Scientific, catalog number: 170-C1818 )
Note: Any cover glass can be used. The best cover glasses are the #1.5, however #1.0 or #0 may be used if high quality images are not required (e.g., confocal microscopy).
Black clear flat bottom 96-well plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 165305 )
Mammalian adherent cells, for example, HeLa, HEK293 and TOV112D
Note: Suspension cells such as HL60 and K562 can be used, although the protocol would need to be adjusted.
Required complete culture media
DMEM (WISENT, catalog number: 319-005-EL )
1x RPMI 1640 (WISENT, catalog number: 350-000-CL )
Ovarian Surface Epithelial (OSE) (WISENT, catalog number: 316-030-CL )
Note: We used the above growth media depending on the cell line. Verify with the cell line suppliers to determine the optimal growth medium for the cells and the necessary supplements.
Fetal bovine serum (FBS) (WISENT, catalog number: 095150 )
Note: It is usually used at 10%, but some cell lines will require different concentrations. See with your cell line supplier.
Penicillin/streptomycin (WISENT, catalog number: 450-201-EL )
Note: It is usually supplied as a 100x stock and therefore must be diluted 1:100 in DMEM and RPMI1640.
Gentamycin Sulfate 50 mg/ml Solution (WISENT, catalog number: 450-135-XL ) supplied at 1,000x and must be diluted 1:1,000 in the media
Amphotericin B (Sigma-Aldrich, catalog number: A4888 ) used at 0.5 μg/ml in OSE
Note: We usually prepare a stock solution of 250 μg/ml and add 1 ml of to 500 ml of OSE.
Trypsin (0.05% or 0.25% in PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 25200072 )
Daunorubicin
Notes:
Provided by the pharmacy (Maisonneuve-Rosemont Hospital), but can be purchased from Sigma (Sigma-Aldrich, catalog number: 30450 ). Prepared at 5 mg/ml in sterile water to a final molar concentration of 8.87 mM.
Daunorubicin may be replaced by doxorubicin (Sigma-Aldrich, catalog number: D1515 ).
4% paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: P6148 ) solution in PBS
Mounting medium with DAPI (Vectashield, Vector Laboratories, catalog number: H-1200 )
Note: This component may be replaced by 50% glycerol (Bio Basic, catalog number: GB0232 ) containing 1 to 10 μg/ml Hoechst 33342 (Thermo Fisher Scientific, InvitrogenTM, catalog number: H1399 ).
Nail polish
Phosphate buffer saline (PBS) (see Recipes)
Sodium chloride (NaCl) (WISENT, catalog number: 600-082-IK )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P4504 )
Sodium phosphate dibasic (Na2HPO4) (Bio Basic, catalog number: S0404 )
Potassium phosphate monobasic (KH2PO4) (Bio Basic, catalog number: PB0445 )
Uptake buffer (see Recipes)
Sodium chloride (NaCl) (WISENT, catalog number: 600-082-IK )
HEPES pH 7.4 (Bio Basic, catalog number: HB0265 )
Glucose (WISENT, catalog number: 600-350-IK )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P4504 )
Potassium phosphate monobasic (KH2PO4) (Bio Basic, catalog number: PB0445 )
Calcium chloride (CaCl2) (Fisher Scientific, catalog number: C79-500 )
Magnesium sulfate (MgSO4) (Bio Basic, catalog number: MN1988 )
Equipment
Pipettes (any pipettes will do)
Incubator (any incubator is fine if it maintains 5% CO2 and moisture)
pH meter (any pH meter will work)
Eppendorf centrifuge (any centrifuge that can adapt 1.5 ml microcentrifuge tube)
Hemocytometer (any hemocytometer will do)
Flow cytometer (FACS)
Note: This protocol is using a FACS Calibur from Becton-Dickson (BD, model: FACS CaliburTM ).
Epifluorescence microscope (Olympus, model: BX53 )
Note: We use an Olympus BX53 , but any epifluorescence microscope with the required filter sets may be used (see in Procedure D for the required filters).
Fluoroskan Ascent (Thermo Fisher Scientific, Thermo ScientificTM, model: Fluoroskan AscentTM )
Software
ImageJ
Note: We used the one at the National institute of Health website; https://imagej.nih.gov/ij/.
CellQuest Pro either version 4.0.1 © 1994-2001 BDB or 5.2.1 © 1994-2005 BD
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Brosseau, N., Andreev, E. and Ramotar, D. (2017). Uptake Assays to Monitor Anthracyclines Entry into Mammalian Cells. Bio-protocol 7(18): e2555. DOI: 10.21769/BioProtoc.2555.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Genotoxicity
Cancer Biology > Genome instability & mutation > Cancer therapy
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,556 | https://bio-protocol.org/exchange/protocoldetail?id=2556&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Freeze-fracture-etching Electron Microscopy for Facile Analysis of Yeast Ultrastructure
TT Takuma Tsuji
TF Toyoshi Fujimoto
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2556 Views: 12957
Edited by: Dennis Nürnberg
Reviewed by: Chong He
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
We describe a streamlined method that enables the quick observation of yeast ultrastructure by electron microscopy (EM). Yeast cells are high-pressure frozen, freeze-fractured to cut across the cytoplasm, and freeze-etched to sublimate ice in the cytosol and the organelle lumen. The cellular structures delineated by these procedures are coated by a thin layer of platinum and carbon deposited by vacuum evaporation, and this platinum–carbon layer, or replica, is observed by transmission EM. The method differs from the deep-etching of pre-extracted samples in that intact live cells are processed without any chemical treatment. Lipid droplets made of unetchable lipid esters are observed most prominently, but other organelles–the nucleus, endoplasmic reticulum, Golgi, vacuoles, mitochondria–and their mutual relationships can be analyzed readily. It is of note that the entire procedure, from quick-freezing to EM observation, can be performed within a day.
Keywords: Freeze-fracture Etching Electron microscopy Quick freezing Lipid droplet Organelle Yeast
Background
Budding yeast (Saccharomyces cerevisiae) is probably the most frequently used model organism, and application of a wide assortment of experimental techniques and the presence of sophisticated genome-wide databases have significantly facilitated research advancement (Botstein and Fink, 2011). The microscopic imaging of yeast, however, is not always carried out in a satisfactory manner due to its relatively small size and round shape. The presence of the cell wall is a problem for conventional electron microscopy (EM) in particular, because it hampers the penetration of reagents used in sample preparation. Freeze-substitution EM of quick-frozen yeast is currently considered the best method for ultrastructural observation (Giddings et al., 2001), but the method has drawbacks, namely, the membrane structures are not clearly visible, some cellular components may not be retained during the substitution process in organic solvents, and the procedure takes at least several days before observation is possible.
In a recent study to examine lipophagy in stationary-phase yeast, we used freeze-fracture-etching to analyze the yeast ultrastructure (Tsuji et al., 2017). Canonical freeze-fracture EM has been used to observe wide areas of membranes in two dimensions. By adding the etching process after freeze-fracturing, the cellular ultrastructure–the lipid droplets and interorganellar relationships in particular–was readily observed. Deep-etching combined with quick-freezing has been used successfully to analyze the cytoskeleton in pre-extracted samples (Heuser and Salpeter, 1979). The method described here is different in that intact live cells are quick-frozen and processed, thereby preserving the membrane organelles. Furthermore, with slight modification, the distribution of proteins and lipids on the nanoscale can also be analyzed (Cheng et al., 2014).
Materials and Reagents
200 mesh EM grid (Electron Microscopy Sciences, catalog number: M200-CR )
50 mesh EM grid (Electron Microscopy Sciences, catalog number: G50-Cu )
Polyvinyl formvar (Nisshin EM, catalog number: 602 )
Copper foil: 20 μm in thickness (Nilaco, catalog number: CU-113213 )
10 μl pipette tip (Thermo Fisher Scientific, catalog number: 3510 )
Aluminum disc: 3 mm in diameter and 0.3 mm in thickness (Engineering Office M. Wohlwend, catalog number: 242 )
Platinum-carbon (Pt/C) (Leica Microsystems, catalog number: 16771798 )
Carbon (C) (Leica Microsystems, catalog number: 16771797 )
Saccharomyces cerevisiae
Acetone (CH3COCH3) (KANTO KAGAKU, catalog number: 01026-70 )
Liquid nitrogen
Household bleach (6% sodium hypochlorite)
Equipment
50-100 ml flask (IWAKI, catalog numbers: 4980FK50 , 4980FK100 )
Razor blade (Feather, catalog number: FAS-10 )
Forceps (EM Japan, catalog number: T7330 )
Hole puncher (Carla Craft, catalog number: SD-15-3 )
Incubator shaker (TAITEC, catalog number: BR-22FP )
High-pressure freezing machine (Bal-Tec, model: HPM 010 )
Freeze-fracture apparatus (Balzers, model: BAF400 )
Electron beam gun (Balzers, model: EK552 )
Crystal thickness monitor (Balzers, model: QSG 301 )
Stereoscopic microscope (Leica Microsystems, model: Leica MZ6 )
Transmission electron microscope (JEOL, model: JEM-1011 )
Procedure
The outline of the method is depicted in Figure 1.
Figure 1. The outline of the method. After ‘quick-freezing’ of yeasts, the cytoplasm is exposed by ‘fracturing’ of frozen cells with cooled knife. The ‘etching’ procedure induces sublimation of water in the cytosol and the organelle lumen. This makes lipid droplets stand out because lipid esters in the lipid droplet core do not sublimate. Vacuum evaporation of platinum and carbon onto the surface makes a ‘replica’ of the cellular ultrastructure.
Quick freezing
Prepare round-shaped copper discs of 3 mm in diameter using a hole puncher. Clean the discs by soaking them in acetone (Figures 2A and 2B).
Concentrate yeast cells by centrifugation at 1,500 x g for 1 min.
Place yeast cells on an EM grid (200 mesh) by dipping the grid into a pellet or spreading ~0.6 μl of pellet on the grid using a pipette tip (Figure 2B).
Figure 2. Tools used for quick-freezing and freeze-fracture-etching. A. Copper foil (20 μm thick). The left portion (arrow) has already been used to prepare round-shaped discs. B. The sample sandwich subjected to quick-freezing: a 200 mesh EM grid impregnated with yeast cells is placed between a 20-μm-thick copper disc and an aluminum disc. C. A specimen table of Balzers BAF400. The sample sandwiches are placed in the two round indentations (arrows).
Sandwich the EM grid impregnated with yeast cells between a 20-μm-thick copper foil and a flat aluminum disc (Figure 2B) (see Note 1).
Quick-freeze yeast cells using an HPM 010 high-pressure freezing machine (or a similar device) according to the manufacturer’s instructions.
Keep the frozen samples in liquid nitrogen until they are transferred to the cold specimen stage of a freeze-fracture apparatus.
Freeze-fracturing and etching
Mount the frozen sample onto a specimen table of the freeze-fracture apparatus (Figures 2C and 3). Here, the procedure for the Balzers BAF400 will be described, but it can easily be adapted to other devices.
Figure 3. Freeze-fracture apparatus (BAF400) for freeze-fracture-etching. Electron beam guns for carbon and platinum deposition are located at 80° and 20° to the specimen surface, respectively. Specimen table is set on the temperature-controlled specimen stage.
Transfer the specimen table to the pre-cooled specimen stage of the freeze-fracture apparatus (Figure 3). The specimen stage needs to be cooled below -120 °C before this transfer.
Keep the specimen temperature at -120 °C for 10 min, and then at -102 °C for 3 to 5 min by using the temperature controller of the specimen stage.
Cool the knife to the lowest-possible temperature (e.g., near the temperature of liquid nitrogen).
After the vacuum reaches below ~5 x 10-7 mbar, fracture the specimens at -102 °C by separating the copper disc from the aluminum disc using the pre-cooled knife (see Note 2).
Keep the fractured specimens at -102 °C for another 2 min to induce sublimation of water from the fractured surface.
Evaporate platinum-carbon (Pt/C) and carbon (C) onto the specimen using the electron beam gun. First, evaporate 2 to 4 nm of Pt/C at an angle of 20° to the specimen surface, then 10 nm of C at an angle of 80°. Rotate the specimen stage at maximum speed during evaporation. Control the thickness of the Pt/C and C deposition using a crystal thickness monitor (Figure 3).
Break the vacuum, bring the specimen into the atmosphere, and transfer the freeze-fracture replicas to household bleach to digest biological materials for more than 2 h.
Rinse the replicas with water.
Mount the replicas on the formvar-coated EM grids under a stereoscopic microscope. The formvar-coated EM grids are prepared by a standard protocol (Slot and Geuze, 2007).
Observe the replicas by transmission EM (see Note 3).
Data analysis
Yeast cells are fractured in a random manner. Roughly speaking, approximately 70 to 80% of the yeast cells are freeze-fractured along the plasma membrane. For analysis of cytoplasmic organelles, the rest of the cells showing the cross-fractured cytoplasm are selected. Within the cytoplasm, lipid droplets are invariably cross-fractured and observed as round protruding structures whereas other organelles may be either freeze-fractured along the limiting membrane to show the convex or concave surface, or cross-fractured to reveal the internal structure (Figure 4).
Figure 4. Freeze-fracture-etching EM of yeast in the stationary phase. A. The plasma membrane (PM) and the vacuolar membrane show the two-dimensional freeze-fractured plane whereas the lipid droplet (LD) is cross-fractured. A number of small vesicles (arrows) are also observed. CW: cell wall. B. Two LDs adhere to the vacuolar membrane (arrowheads). A cross-fractured mitochondrion (MT) is observed. Scale bars = 0.2 μm.
Damage to the cellular ultrastructure may occur when ice crystals form due to improper operation of the high-pressure freezing machine or the freeze-fracture apparatus, or by poor handling of frozen samples, for example, failure to keep samples in liquid nitrogen. Suboptimal replicas may form as a result of unsatisfactory vacuum evaporation. Samples exhibiting these problems can be readily identified by EM and should be excluded from further analyses.
In most experiments, three replicates, prepared by independent quick-freezing and freeze-fracture-etching sessions, are analyzed for each yeast specimen.
Notes
Liquid (or culture medium) must be kept to a minimum volume so that it will not spread to the outer side of the copper foil, which would result in improper freezing.
The knife must be cooled to the coldest possible temperature before fracturing samples.
EM grids must be completely dried before EM observation.
Acknowledgments
The condition of the etching procedure was modified from Heuser and Salpeter (1979). The authors thank Dr. John E. Heuser for his kind advice on technical details. This study was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of the Government of Japan to TF (25111510, 15H02500, 15H05902) and TT (15K18954, 17K15544).
References
Botstein, D. and Fink, G. R. (2011). Yeast: an experimental organism for 21st Century biology. Genetics 189(3): 695-704.
Cheng, J., Fujita, A., Yamamoto, H., Tatematsu, T., Kakuta, S., Obara, K., Ohsumi, Y. and Fujimoto, T. (2014). Yeast and mammalian autophagosomes exhibit distinct phosphatidylinositol 3-phosphate asymmetries. Nat Commun 5: 3207.
Giddings, T. H., Jr., O’Toole, E. T., Morphew, M., Mastronarde, D. N., McIntosh, J. R. and Winey, M. (2001). Using rapid freeze and freeze-substitution for the preparation of yeast cells for electron microscopy and three-dimensional analysis. Methods Cell Biol 67: 27-42.
Heuser, J. E. and Salpeter, S. R. (1979). Organization of acetylcholine receptors in quick-frozen, deep-etched, and rotary-replicated Torpedo postsynaptic membrane. J Cell Biol 82(1): 150-173.
Tsuji, T., Fujimoto, M., Tatematsu, T., Cheng, J., Orii, M., Takatori, S. and Fujimoto, T. (2017). Niemann-Pick type C proteins promote microautophagy by expanding raft-like membrane domains in the yeast vacuole. Elife 6: e25960.
Slot, J. W. and Geuze, H. J. (2007). Cryosectioning and immunolabeling. Nat Prot 2: 2480-2491.
Copyright: Tsuji and Fujimoto. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Tsuji, T. and Fujimoto, T. (2017). Freeze-fracture-etching Electron Microscopy for Facile Analysis of Yeast Ultrastructure. Bio-protocol 7(18): e2556. DOI: 10.21769/BioProtoc.2556.
Tsuji, T., Fujimoto, M., Tatematsu, T., Cheng, J., Orii, M., Takatori, S. and Fujimoto, T. (2017). Niemann-Pick type C proteins promote microautophagy by expanding raft-like membrane domains in the yeast vacuole. Elife 6: e25960.
Download Citation in RIS Format
Category
Cell Biology > Cell structure > Cell organelle
Cell Biology > Cell imaging > Electron microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,557 | https://bio-protocol.org/exchange/protocoldetail?id=2557&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Method for Multiplexing CRISPR/Cas9 in Saccharomyces cerevisiae Using Artificial Target DNA Sequences
RG Rachael M. Giersch
Gregory C. Finnigan
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2557 Views: 11260
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Genome manipulation has become more accessible given the advent of the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) editing technology. The Cas9 endonuclease binds a single stranded (single guide) RNA (sgRNA) fragment that recruits the complex to a corresponding genomic target sequence where it induces a double stranded break. Eukaryotic repair systems allow for the introduction of exogenous DNA, repair of existing mutations, or deletion of endogenous gene products. Targeting of Cas9 to multiple genomic positions (termed ‘multiplexing’) is achieved by the expression of multiple sgRNAs within the same nucleus. However, an ongoing concern of the CRISPR field has been the accidental targeting of Cas9 to alternative (‘off-target’) DNA locations within a genome. We describe the use (dubbed Multiplexing of Cas9 at Artificial Loci) of installed artificial Cas9 target sequences into the yeast genome that allow for (i) multiplexing with a single sgRNA; (ii) a reduction/elimination in possible off-target effects, and (iii) precise control of the placement of the intended target sequence(s).
Keywords: CRISPR/Cas9 Budding yeast Multiplexing Genome DNA editing sgRNA
Background
The CRISPR (Clustered Regularly Interspaced Palindromic Repeats) mechanism has evolved in prokaryotes as a primitive adaptive immune system with the capability to edit any genome with great precision (Jinek et al., 2012; Sorek et al., 2013). This biotechnology requires the use of an endonuclease (Cas9) from S. pyogenes (or othologous species), a single RNA ‘guide’ sequence, and exogenous donor DNA (if needed). In only a few years, CRISPR/Cas9 has been utilized in numerous research laboratories in both academic and industry settings to target DNA sequences within any genome (Doudna and Charpentier, 2014). A variety of research areas including basic research, biofuels, agriculture, genetic disorders, and human pathogens/disease have begun harnessing this technology to address important scientific questions (Estrela and Cate, 2016; Demirci et al., 2017; Men et al., 2017). Recent work in S. cerevisiae has piloted the development of novel CRISPR-based applications including automated genomic engineering (Si et al., 2017), chromosome splitting (Sasano et al., 2016), and the use of nuclease-dead Cas9 (dCas9) to modulate gene expression (Jensen et al., 2017). While this editing system has proved extremely useful, a number of concerns are still being actively addressed. These include off-target effects–the propensity of Cas9 to accidentally target additional genomic positions (Cho et al., 2014; Zhang et al., 2015), the required cloning step(s) needed to generate multiple sgRNAs for Cas9 multiplexing (Ryan and Cate, 2014), and the safety and application of Cas9-based ‘gene drives’ (DiCarlo et al., 2015). Our methodology addresses some of these issues by engineering artificial Cas9 target site(s) within the yeast genome. We describe (i) the selection of the artificial sequences used to multiplex Cas9; (ii) the cloning strategies used to construct plasmids harboring the unique target sites flanking several genes including Cas9 itself; (iii) integration of these constructs into a single yeast genome in successive steps, and (iv) editing using expressed Cas9, sgRNA, and donor DNA to demonstrate proof of concept. This system allows for seamless, marker-less, multi-loci genomic editing with only a single sgRNA. We envision this method could be useful for synthetic genome construction, yeast library generation, and simultaneous manipulation of related genes within a common genetic or signaling pathway.
Materials and Reagents
Pipette tips (LTS tips 1,000 μl, 250 μl, 20 μl, Mettler-Toledo, Rainin, catalog numbers: GPS-L1000 , GPS-L250 , and GPS-L10 )
Tubes (Axygen Microtubes 1.5 ml clear, homo-polymer, boil-proof) (Corning, Axygen®, catalog number: MCT-150-C )
Disposable sterile plastic 15 ml (Corning, Falcon®, catalog number: 352099 ) and 50 ml (Corning, Falcon®, catalog number: 352098 ) conical centrifuge tubes
Disposable glass test tubes (20 x 150 mm) (Fisher Scientific, catalog number: 14-958K )
Kimble Kim-Kap test tube closures (Fisher Scientific, catalog number: 14-957-91C)
Manufacturer: DWK Life Sciences, Kimble®, catalog number: 7366020 .
Plastic Petri dish (100 x 15 mm size) (VWR, catalog number: 25384-088 )
0.5 mm glass beads (Bio Spec Products, catalog number: 11079105 )
Yeast strains
SF838-1Dα (MATα ura3-52 leu2-3,122 his4-519 ade6 pep4-3 gal2) (Univ. of Oregon; Rothman and Stevens, 1986)
THS4218 (SF838-1Dα; HIS4 his3Δ::HygR) used for in vivo plasmid assembly and recovery (Univ. of California, Berkeley; Finnigan and Thorner, 2015)
BY4741 (MATα his3∆1 ura3∆0 leu2∆0 met15∆0) (Univ. of California, Berkeley; Brachmann et al., 1998) for construction of all yeast strains tested
One Shot® TOP10 chemically competent E. coli (Thermo Fisher Scientific, InvitrogenTM, catalog number: C404003 )
Note: See (Finnigan and Thorner, 2015) for propagation and preparation of TOP10 seed cultures.
Plasmid containing prGalL-Cas9-CYC1(t) used as template DNA for construction of Cas9-containing cassettes (Addgene, catalog number: 43804) from (DiCarlo et al., 2013)
Plasmid containing prSNR52-sgRNA-SUP4(t) (Addgene, catalog number: 43803 ; synthesized de novo by Genscript) (DiCarlo et al., 2013)
ssDNA: deoxyribonucleic acid sodium salt from salmon testes (boiled for 10 min and cooled on ice prior to each use of a 10 mg/ml stock solution in water) (Sigma-Aldrich, catalog number: D1626 )
Zymolyase® 100T from Arthrobacter leuteus (25 mg/ml) (Amsbio, catalog number: 120493-1 ) in 50% glycerol stock (certified ACS grade) (Fisher Scientific, catalog number: G33 )
Appropriate restriction enzyme(s) for digestion
NotI-HF (New England Biolabs, catalog number: R3189 )
DpnI (New England Biolabs, catalog number: R0176 )
BamHI-HF (New England Biolabs, catalog number: R3136 )
XhoI (New England Biolabs, catalog number: R0146 )
QIAquick gel extraction kit (QIAGEN, catalog number: 28706 )
T4 DNA ligase (New England Biolabs, catalog number: M0202 )
GeneJET plasmid miniprep kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: K0503 )
KOD hot start DNA polymerase (EMD Millipore, catalog number: 71086-3 , distributed by VWR, catalog number: 80511-384)
Custom DNA oligonucleotide primers (25-100 nmol concentration; Integrated DNA Technologies)
GeneJet PCR purification kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: K0701 )
Ethidium bromide (Sigma-Aldrich, catalog number: E8751 )
Agarose powder (U.S. Biotech Sources, catalog number: G01PD-500 )
Hygromycin, used at 300 μg/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 10687010 )
G418 sulfate (Geneticin), used at 200 μg/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 11811031 )
D-(+)-Raffinose pentahydrate (20% stock in water, filter sterilized, not autoclaved) (Sigma-Aldrich, catalog number: R7630 ). Filtered using disposable cellulose nitrate filter (0.2 μm filter size) (Corning, catalog number: 430186 )
Sucrose (20% stock in water, filter sterilized, not autoclaved) (Fisher Scientific, catalog number: S3 )
1 M lithium acetate dihydrate (CH3COOLi·2H2O, reagent grade) (Sigma-Aldrich, catalog number: L6883 )
50% PEG: Poly (ethylene glycol), BioXtra avg. molecular weight 3,350 (Sigma-Aldrich, catalog number: P4338 )
Ampicillin (final concentration of 100 μg/ml) (RPI, catalog number: A40040-100.0 )
Kanamycin (final concentration of 50 μg/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 11815024 )
Yeast extract (BD, BactoTM, catalog number: 212750 )
Peptone (BD, BactoTM, catalog number: 211677 )
Dextrose (20% stock in water) (Thermo Fisher Scientific, catalog number: D16 )
D-(+)-Galactose (20% stock in water, filter sterilized, not autoclaved) (Sigma-Aldrich, catalog number: G0750 )
Tryptone (BD, BactoTM, catalog number: 211705 )
Sodium chloride (NaCl, certified ACS grade ≥ 99.0%) (Fisher Scientific, catalog number: S271 )
Potassium chloride (KCl, BioXtra ≥ 99.0%) (Sigma-Aldrich, catalog number: P9333 )
Magnesium chloride hexahydrate (MgCl2·6H2O, BioXtra ≥ 99.0%) (Sigma-Aldrich, catalog number: M2670 )
Magnesium sulfate solution (MgSO4, molecular biology grade) (Sigma-Aldrich, catalog number: M3409 )
SuperPure agar, bacteriological grade (US Biotech Sources, catalog number: A01PD-500 )
Yeast nitrogen base minus amino acids and minus ammonium sulfate (Sigma-Aldrich, catalog number: Y1251 )
Ammonium sulfate ((NH4)2SO4 certified ACS grade ≥ 99.0%) (Fisher Scientific, catalog number: A702 )
‘Almost complete’ amino acid mixture
Adenine HCl (Sigma-Aldrich, catalog number: A9795 ), 20 mg/L
Arginine (Sigma-Aldrich, catalog number: A5131 ), 20 mg/L
Tyrosine (Sigma-Aldrich, catalog number: T3754 ), 30 mg/L
Isoleucine (Sigma-Aldrich, catalog number: I2752 ), 30 mg/L
Phenylalanine (Sigma-Aldrich, catalog number: P2126 ), 50 mg/L
Glutamic acid (Sigma-Aldrich, catalog number: G1251 ), 100 mg/L
Aspartic acid (Sigma-Aldrich, catalog number: A9256 ), 100 mg/L
Threonine (Sigma-Aldrich, catalog number: T8625 ), 200 mg/L
Serine (Sigma-Aldrich, catalog number: S4500 ), 400 mg/L
Valine (Sigma-Aldrich, catalog number: V0500 ), 150 mg/L
Methionine (Sigma-Aldrich, catalog number: M9625 )
Lysine (Sigma-Aldrich, catalog number: L5626 )
Histidine (Sigma-Aldrich, catalog number: H8125 )
Leucine (Sigma-Aldrich, catalog number: L8000 )
Uracil (Sigma-Aldrich, catalog number: U0750 )
5-Fluoroorotic acid (5-FOA) (Oakwood Products, catalog number: 003234 )
Sodium hydroxide (NaOH certified ACS grade ≥ 97.0%) (Fisher Scientific, catalog number: S318 )
Tris base, molecular biology grade ≥ 99.8% (Fisher Scientific, catalog number: BP152 )
Glacial acetic acid (certified ACS grade) (Fisher Scientific, catalog number: A38 )
Ethylenediaminetetraacetic acid (EDTA 99%-101%) (Fisher Scientific, catalog number: S311 )
Ultrapure sterile water (Millipore Sigma, Milli-Q water purification system)
YPD liquid media (see Recipes)
YPGal (see Recipes)
SOC medium (see Recipes)
YPD plates (with appropriate drugs optional) (see Recipes)
Synthetic drop-out plates/media (see Recipes)
5-FOA plates (see Recipes)
LB plates (with appropriate drug included) (see Recipes)
TAE buffer (see Recipes)
Equipment
Pipettes (Rainin, Pipet-Lite LTS, 1,000 μl, 250 μl, 20 μl, and 2 μl sizes)
PCR machine (MJ Research PTC-200 Peltier Thermo Cycler, dual 30-well alpha blocks) (MJ Research, model: PTC-200 )
Centrifuge (Eppendorf microcentrifuge) (Eppendorf, model: 5415 D , catalog number: 022621408)
Eppendorf rotor (for 24 x 1.5/2 ml) (Eppendorf, model: F-45-24-11 , catalog number: 022636502)
Vortexing adaptor (Microtube foam insert for Fisher Vortex Genie 2 mixer) (Scientific Industries, model: Vortex Genie 2 , catalog number: 504-0234-00)
Ice maker (Hoshizaki American)
Water bath (Thermomix circulating water bath, Model B, type 852 013/5)
DNA gel electrophoresis apparatus (HE 33 Mini Submarine Unit) (GE Healthcare, catalog number: 80-6052-45 )
ChemiDoc UV transilluminator (Bio-Rad Laboratories, model: ChemiDocTM XRS+, catalog number: 1708265 )
Incubator rotator (Labquake shaker) (Labindustries, model: T-415-110 )
Incubators (VWR, model: Model 1535 )
Autoclave (Univ. of California, Barker Hall)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Giersch, R. M. and Finnigan, G. C. (2017). Method for Multiplexing CRISPR/Cas9 in Saccharomyces cerevisiae Using Artificial Target DNA Sequences. Bio-protocol 7(18): e2557. DOI: 10.21769/BioProtoc.2557.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > DNA cloning
Molecular Biology > DNA > Chromosome engineering
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,558 | https://bio-protocol.org/exchange/protocoldetail?id=2558&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Differentiation of Myeloid-derived Suppressor Cells from Murine Bone Marrow and Their Co-culture with Splenic Dendritic Cells
GM Giada Mondanelli
CV Claudia Volpi
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2558 Views: 11002
Edited by: Ivan Zanoni
Reviewed by: Meenal Sinha
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Myeloid-derived suppressor cells (MDSCs) possess the ability to suppress the immune response, and to amplify the regulatory properties of other immune cells, i.e., dendritic cells. Here we describe a protocol in which MDSCs were differentiated from murine bone marrow cells, and CD11c+ dendritic cells were purified from murine spleens. MDSCs and CD11c dendritic cells can be co-cultured and the immunoregulatory phenotype of the MDSCs-conditioned dendritic cells could be assessed by means of a specific functional in vivo experiment, i.e., a skin test as a measure of the delayed-type hypersensitivity reaction toward a poorly immunogenic antigen.
Keywords: Myeloid-derived suppressor cells Dendritic cells Co-culture
Background
The myeloid-derived suppressor cells (MDSCs) are a group of myeloid cells comprised of precursor of macrophages, granulocytes, dendritic cells and myeloid cells at earlier stages of differentiation (Youn et al., 2008) accumulating in large numbers in lymphoid tissues of tumor-bearing mice as well as in mice with infectious diseases, sepsis and trauma. The main feature of these cells is their ability to suppress T cell responses in Ag-specific and/or nonspecific fashion. These cells are now considered as one of the major cell type responsible for tumor-associated immune defects; main factors implicated in MDSC-mediated immune suppression include high expression of Arg1 (Marvel and Gabrilovich, 2015). Arginase 1 (Arg1) and indoleamine 2,3-dioxygenase 1 (IDO1) are immunoregulatory enzymes catalyzing the degradation of L-arginine (L-Arg) and L-tryptophan (L-Trp), respectively, resulting in local amino acid deprivation. In addition, unlike Arg1, IDO1 is also endowed with non-enzymatic signaling activity in dendritic cells (DCs) (Mondanelli et al., 2017). In addition to their inherent immunosuppressive activity, MDSCs might amplify regulatory properties of other immune cells, particularly in tumor microenvironments. Although some mechanisms underlying MDSC-macrophage interaction have been established (Ugel et al., 2015), the cross-talk between MDSCs and DCs is still unclear (Ostrand-Rosenberg et al., 2012); to fill this gap, we have developed this protocol and we demonstrated that Arg1+ MDSCs confer to DCs an IDO1-dependent, immunosuppressive phenotype via Arg1 metabolites (i.e., polyamines such as putrescine and spermidine) (Mondanelli et al., 2017). The Arg and Trp immunoregulatory pathways are functionally integrated, this integration occurring both intra- (i.e., DCs) and inter-cellularly (MDSCs and DCs) (Mondanelli et al., 2017).
Materials and Reagents
Petri dishes (Corning, Falcon®, catalog number: 351029 )
15 ml Falcon tubes (Corning, Falcon®, catalog number: 352096 )
Cell strainers (Corning, Falcon®, catalog number: 352340 )
5 ml sterile pipettes (Corning, Falcon®, catalog number: 357543 )
10 ml sterile pipettes (Corning, Falcon®, catalog number: 357551 )
200 µl sterile tips (Biotix, Neptune®, catalog number: 2102 NS )
1,000 µl sterile tips (Biotix, Neptune®, catalog number: 2372 S )
24-well plates (Corning, Falcon®, catalog number: 353047 )
50 ml Falcon tubes (Corning, Falcon®, catalog number: 352070 )
10 ml syringe (Terumo Medical, catalog number: SS+10S21381 )
1 ml syringe with 26 G ½ needle (Terumo Medical, catalog number: SS+01H26131 )
2 ml syringe plunger (Terumo Medical, catalog number: SS-02S2238 )
6-well plates (Corning, Falcon®, catalog number: 353046 )
Permeable support for 24-well plate with 0.4 μm translucent high density PET membrane (Corning, Falcon®, catalog number: 353495 )
LS columns (Miltenyi Biotec, catalog number: 130-042-401 )
MS columns (Miltenyi Biotec, catalog number: 130-042-201 )
Pasteur pipette (Sigma-Aldrich, catalog number: Z627992-1000EA )
C57BL/6 female mice, 6 weeks old (C57BL/6NCrl) (Charles River Laboratories, catalog number: 027 )
RPMI 1640 medium (Thermo Fisher Scientific, catalog number: 11875093 )
FCS (Thermo Fisher Scientific, catalog number: A3160801 )
L-Glutamine (Thermo Fisher Scientific, catalog number: 25030024 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
HEPES (Thermo Fisher Scientific, catalog number: 15630056 )
2-Mercaptoethanol (Thermo Fisher Scientific, GibcoTM, catalog number: 31350010 )
Trypan blue (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Bovine serum albumin (BSA) (Rockland Immunochemicals, catalog number: BSA-50 )
Ethylenediaminetetraacetate acid (EDTA) (AppliChem, catalog number: 131669.1211 )
CD11b MicroBeads, human and mouse (Miltenyi Biotec, catalog number: 130-049-601 )
CD11c MicroBeads UltraPure, mouse (Miltenyi Biotec, catalog number: 130-108-338 )
HBSS, no calcium, no magnesium (Thermo Fisher Scientific, catalog number: 14170088 )
Sodium chloride (NaCl) (CARLO ERBA Reagents, catalog number: 479687 )
Tris (Bio-Rad Laboratories, catalog number: 1610719 )
Potassium chloride (KCl) (CARLO ERBA Reagents, catalog number: 471177 )
Recombinant murine GMCSF (PeproTech, catalog number: 315-03 )
Recombinant murine IL-4 (PeproTech, catalog number: 214-14 )
Collagenase from Clostridium histolyticum (Sigma-Aldrich, catalog number: C5138-1G )
Histodenz (Sigma-Aldrich, catalog number: D2158-100G )
Nor-NOHA (Cayman Chemicals, catalog number: 10006861 )
MACS buffer (see Recipes)
RPMI medium (see Recipes)
TCCM (see Recipes)
Collagenase 100 U/ml and 400 U/ml (see Recipes)
Nycodenz (see Recipes)
Nycodenz buffer (see Recipes)
Equipment
Scissor (Isolab Laborgeräte, catalog number: 048.25.130 )
Sterile biosafety cabinet
P20L pipette (Pipetman L) (Gilson, catalog number: FA10003M )
P200L pipette (Pipetman L) (Gilson, catalog number: FA10005M )
P1000L pipette (Pipetman L) (Gilson, catalog number: FA10006M )
Pipet controller (Corning, Falcon®, catalog number: 357471 )
Centrifuge (Eppendorf, model: 5810 R )
Incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: BB15 )
-80 °C freeze (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM 88000 Series )
Light microscope (ZEISS Primostar)
MiniMACS separator (Miltenyi Biotec, catalog number: 130-042-102 )
MidiMACS separator (Miltenyi Biotec, catalog number: 130-042-302 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mondanelli, G. and Volpi, C. (2017). Differentiation of Myeloid-derived Suppressor Cells from Murine Bone Marrow and Their Co-culture with Splenic Dendritic Cells. Bio-protocol 7(18): e2558. DOI: 10.21769/BioProtoc.2558.
Download Citation in RIS Format
Category
Immunology > Immune cell differentiation > MDSC
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,559 | https://bio-protocol.org/exchange/protocoldetail?id=2559&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Protein S-nitrosothiols (SNOs) in Plant Samples on Diaminofluorescein (DAF) Gels
MR Marta Rodríguez-Ruiz
PM Paulo T. Mioto
José M. Palma
Francisco J. Corpas
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2559 Views: 7225
Reviewed by: Swetha ReddyWenrong He
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
In plant cells, the analysis of protein S-nitrosothiols (SNOs) under physiological and adverse stress conditions is essential to understand the mechanisms of Nitric oxide (NO)-based signaling. We adapted a previously reported protocol for detecting protein SNOs in animal systems (King et al., 2005) for plant samples. Briefly, proteins from plant samples are separated via non-reducing SDS-PAGE, then the NO bound by S-nitrosylated proteins is released using UV light and, finally, the NO is detected using the fluorescent probe DAF-FM (Rodriguez-Ruiz et al., 2017). Thus, the approach presented here provides a relatively quick and economical procedure that can be used to compare protein SNOs content in plant samples and provide insight in NO-based signaling in plants.
Keywords: Nitric oxide S-nitrosothiols S-nitrosation S-nitrosylation
Background
Nitric oxide (NO) is a free radical which can interact with a diverse array of biomolecules including proteins, lipids, and nucleic acids. In the case of proteins, one of the most relevant post-translational modifications (PTMs) is the covalent attachment of an NO group to the thiol (-SH) side chain of cysteine (Cys) present in peptides or proteins. This modification generates a family of NO-derived molecules called S-nitrosothiols (SNOs) which are important compounds in both animal and plant systems (Foster et al., 2003; Lindermayr and Durner, 2009; Astier et al., 2011; Broniowska and Hogg, 2012). Although this PTM is often designated as S-nitrosylation, the more appropriate term is S-nitrosation. It is difficult to detect, quantify and identify protein SNOs in plant systems. While there are several techniques to detect SNOs such as chemiluminescence, the biotin switch method, mass spectrometry, fluorescence detection, and antibody detection (against S-nitrosocysteine) (Kettenhofen et al., 2007; Foster, 2012; Devarie-Baez et al., 2013; Diers et al., 2014; Barroso et al., 2016; Mioto et al., 2017) many of these techniques require tedious sample preparation procedures that are time consuming and require sophisticated, expensive equipment.
Materials and Reagents
10-cm-diameter polystyrene Petri dishes (Fisher Scientific, catalog number: 12654785 )
Parafilm M All-Purpose Paraffin Wax Film (Bemis, catalog number: PM996 )
Sweet green pepper fruits were provided by Syngenta Seeds S.A. (El Ejido, Spain)
Note: This company grows pepper plants in experimental glass-covered greenhouses under optimal conditions of light, temperature and humidity.
Arabidopsis thaliana ecotype Columbia seeds (originally obtained from NASC, Nottingham Arabidopsis Stock Center)
Ethanol (Fisher Scientific, catalog number: 10517694 )
Commercial Bleach (20%)
Murashige and Skoog medium (Sigma-Aldrich, catalog number: M5524 )
Sucrose (Sigma-Aldrich, catalog number: 84097 )
Phyto-agar (Sigma-Aldrich, catalog number: P8169-100G )
Bio-Rad Protein Assay Dye Reagent (Bio-Rad Laboratories, catalog number: 5000006 )
Bovine serum albumin (BSA) Fraction V (Roche Diagnostics, Sigma-Aldrich, catalog number: 10735078001 )
4-20% Precast TGX Mini-Protean gel (Bio-Rad Laboratories, catalog number: 4561093 )
Ascorbate (AsA) (Sigma-Aldrich, catalog number: A7631-25G )
Copper(I) chloride (CuCl) (Sigma-Aldrich, catalog number: 651745-5G )
N-ethylmaleimide (NEM) (Sigma-Aldrich, catalog number: E3876-5G )
Dithiothreitol (DTT) (Roche Diagnostics, catalog number: 10708984001 )
Reduced glutathione (GSH) (Sigma-Aldrich, catalog number: G4251-5G )
β-Mercaptoethanol (ME) (Sigma-Aldrich, catalog number: M6250-10ML )
Tris (AMRESCO, catalog number: 0497 )
Ethylenediaminetetraacetic acid, disodium salt, dihydrate (Na2-EDTA) (Sigma-Aldrich, catalog number: E5134 )
Triton X-100 (AMRESCO, catalog number: 0694 )
Glycerol (AMRESCO, catalog number: E520 )
Sodium dodecyl sulfate (SDS; electrophoresis grade)
Bromophenol blue (Sigma-Aldrich, catalog number: B0126-25G )
3-Amino,4-aminomethyl-2’,7’-difluorescein (DAF-FM) (Sigma-Aldrich, catalog number: D2196 )
Grinding buffer (see Recipes)
Sample treatment buffer (2x) (see Recipes)
Standard running buffer for SDS-PAGE containing 1 mM EDTA (see Recipes)
Gel staining solution (see Recipes)
Equipment
Set of Gilson micropipettes (Gilson, P10, P20 and P100)
Plant growth cabinet (Panasonic Biomedical, model: MLR-352-PE )
Porcelain mortar and pestle (VWR, catalog numbers: 410-0110 and 410-0120 , respectively)
Refrigerated centrifuge Hettich Mikro 220R (Hettich Lab Technology, model: Mikro 220 R , catalog number: 2205)
Vertical Slab gels Electrophoresis System (Bio-Rad Laboratories, model: Mini-PROTEAN®, catalog number: 1658003EDU )
Standard UV-transilluminator (302-312 nm), used in molecular biology laboratory
Molecular Imager PharosFX system (Bio-Rad Laboratories, model: PharosFXTM, catalog number: 1709460 )
Note: This product has been discontinued.
EvolutionTM 201 UV-visible spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: EvolutionTM 201 , catalog number: 912A0890)
Software
ImageJ (free application available in https://imagej.net/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rodríguez-Ruiz, M., Mioto, P. T., Palma, J. M. and Corpas, F. J. (2017). Detection of Protein S-nitrosothiols (SNOs) in Plant Samples on Diaminofluorescein (DAF) Gels. Bio-protocol 7(18): e2559. DOI: 10.21769/BioProtoc.2559.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Electrophoresis
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
256 | https://bio-protocol.org/exchange/protocoldetail?id=256&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Acetyl-coenzyme A Synthetase (Acs) Assay
SC Sara Castaño-Cerezo
Vicente Bernal
MC Manuel Cánovas
Published: Vol 2, Iss 17, Sep 5, 2012
DOI: 10.21769/BioProtoc.256 Views: 16987
Original Research Article:
The authors used this protocol in Dec 2011
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2011
Abstract
Acetyl-coenzyme A synthethase (Acs, E.C.6.2.1.1) is an acetate activating enzyme widely represented in nature from bacteria to human. Its function is important for cellular catabolism, especially in order to support microbial growth at low concentrations of acetate (<10 mM) (Castano Cerezo et al., 2011; Castano Cerezo et al., 2009；Renilla et al., 2012). In this protocol, a continuous coupled enzymatic assay for Acs activity is described. Product formation is followed spectrophotometrically by the formation of NADH. The protocol is tailored for E. coli’s Acs, but it can be adapted to assay Acs in any other organism.
The acetyl-coenzyme A synthetase (Acs) assay was first described by Brown et al. (1977). Acs activity is measured using an enzymatic method coupled to malate dehydrogenase (Mdh) and citrate synthase (Cs):
(Acs) acetate + CoASH + ATP -> acetyl-CoA + AMP
(Cs) acetyl-CoA + oxaloacetate -> citrate + CoASH
(Mdh) L-malate + NAD+ -> oxaloacetate + NADH
Net reaction: Acetate + ATP + L-malate + NAD+ -> citrate + AMP + NADH
Under the assay conditions, Mdh and Cs activities are in excess and the rate of NADH formation is limited by Acs activity.
Materials and Reagents
Extraction
Potassium phosphate buffer 65 mM (pH 7.5) (Sigma-Aldrich, catalog number: P5379 )
Cultured cells (approx. 1010 cells) (e.g., for Escherichia coli cells grown in M9 glucose minimal medium, 1 ml of OD600 1 corresponds to approx. 6 x 108 cells)
Enzyme activity
100 mM Tris-HCl buffer (pH 7.8) (Sigma-Aldrich, catalog number: T1502 )
20 mM ATP (Sigma-Aldrich, catalog number: A3377 )
2 mM Coenzyme A trilithium salt (CoASH) (Sigma-Aldrich, catalog number: C3019 )
60 mM β-nicotinamide adenine dinucleotide hydrate (NAD+) (Sigma-Aldrich, catalog number: N7004 )
50 mM MgCl2 (Panreac Applichem, catalog number: 131396 )
50 mM L-malate (Sigma-Aldrich, catalog number: 02288 )
1 M sodium acetate trihydrate (Sigma-Aldrich, catalog number: S8625 )
50 U/ml malate dehydrogenase (Mdh) from bovine heart (Sigma-Aldrich, catalog number: M9004 )
25 U/ml citrate synthase from porcine heart (Cs) (Sigma-Aldrich, catalog number: C3260 )
Reagents 2-4 were prepared in milliQ water and components 5-7 in Tris-HCl buffer (100 mM, pH 7.8). All concentrated stocks (1-7) were prepared in advance and stored at -20 °C. Enzymes (8-9) were stored at 4-6 °C (following the instructions of the manufacturer) and diluted in Tris-HCl buffer (100 mM, pH 7.8) immediately before being used.
96 well flat bottom, non-treated, non-sterile transpartent plates
Ice-cold phosphate buffer
Equipment
Refrigerated benchtop centrifuge (Eppendorf, catalog number: 5801 R )
Ultrasonic homogenizer (Sonics & Materials Inc., Vibra Cell VC 375) equipped with a 3 mm diameter probe
Spectrophotometric plate reader (Bio-Tek)
Novaspec Plus spectrophotometer (Amersham Bioscience GE Healthcare Europe GmbH)
Non-sterile transpartent plates
Water-ice bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,560 | https://bio-protocol.org/exchange/protocoldetail?id=2560&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protease Activity Assay in Fly Intestines
MN Marie-Paule Nawrot-Esposito
RL Rihab Loudhaief
AG Armel Gallet
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2560 Views: 8271
Edited by: Jihyun Kim
Reviewed by: Tzvetina Brumbarova
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
The intestine is a central organ required for the digestion of food, the absorption of nutrients and for fighting against aggressors ingested along with the food. Impairment of gut physiology following mucosal damages impacts its digestive capacities that consequently will affect growth, wellbeing or even survival of the individual. Hence, the assessment of intestinal functions encompasses, among others, the monitoring of its integrity, its cellular renewing, its immune defenses, the production of enteroendocrine hormones and its digestive capacities. Here, we describe in detail how to assess the activity of the proteases secreted in the intestinal lumen of adult Drosophila melanogaster flies. This method can also be used for larval intestines. The present protocol is adapted and improved from the Sigma-Aldrich’s protocol proposed in the ‘Protease Fluorescent Detection Kit’ (Product code PF0100).
Keywords: Drosophila melanogaster Intestine Opportunistic bacteria Protease activity Protein metabolism
Background
The intestine is subjected to many stresses such as feasting, fasting, chemicals, pathogens, injuries etc. The gut is able to overcome such stresses by maintaining its physiological equilibrium named homeostasis. To perceive the incoming stress and to yield an adapted answer to maintain gut functions, the intestine has developed robust and conserved mechanisms such as local innate immune defenses and tissue regeneration (Royet and Charroux, 2013; Bonfini et al., 2016). However, the maintenance of gut homeostasis can be compromised in certain cases. For example, during aging, there is an overall decline in tissue homeostasis maintenance with the presence of numerous immature or misdifferentiated cells (Jasper, 2015; Hu and Jasper, 2017). Another case where homeostasis can also be disrupted is upon exposure to xenobiotic or pathogens (such as opportunistic bacteria) that damage or kill cells impairing their functions (Bonfini et al., 2016). Hence, during the above cited examples, the digestive capacities of the gut are reduced. Moreover, during the process of tissue regeneration itself that produces many precursor cells the digestive capacities are also reduced (Loudhaief et al., 2017). Therefore, the assessment of the digestive capacities of the gut are of prime importance to evaluate the potential impact that can have an aggression on the gut physiology. Importantly, gut digestive function disruption may have both local and systemic metabolic consequences that will affect growth, immune defenses, reproduction, wellbeing, longevity…. Dietary proteins are essential for many (if not all) physiological functions (Soultoukis and Partridge, 2016). Imbalanced amino-acid absorption by the intestine can have dramatic consequences on growth for example. Protein digestion being essential to generate absorbable amino-acids by the enterocytes, the measurement of luminal protease activity appears a good readout to evaluate the physiological state of the intestine and its capacity to fulfill its digestive functions.
Materials and Reagents
Drosophila rearing
6oz Drosophila stock bottles (Genesee Scientific, catalog number: 32-130 )
Cotton balls for stock bottles (Genesee Scientific, catalog number: 51-102B )
CantonS flies (Bloomington Drosophila Stock Center, catalog number: 64349 ) (flystocks.bio.indiana.edu)
Agar (VWR, BDH®, catalog number: 20768-361 )
Sugar (Carrefour or any other supermarket)
Cornflour (AB, Celnat - NaturDis)
Yeast (Biospringer, catalog number: BA10/0-PW )
Tegosept (Apex, Fly Food preservative, Genesee Scientific, catalog number: 20-258 )
Standard nutrient medium for Drosophila (see Recipes)
Bacterial culture
Petri dishes
Sterile tip
15 ml tubes (Corning, Falcon®, catalog number: 352096 )
Graduated test tube
Bacillus thuringiensis var. kurstaki (Btk) strain identified under the code 4D22 at the Bacillus Genetic Stock Center (http://www.bgsc.org/) and described by (Gonzalez et al., 1982)
Erwinia carotovora carotovora (Ecc) was kindly provided by Bruno Lemaitre’s laboratory (École Polytechnique Fédérale, Lausanne, Switzerland)
Escherichia coli (Ec) (One ShotTM TOP10 Chemically Competent E. coli) (Thermo Fisher Scientific, InvitrogenTM, catalog number: C404003 )
Luria broth powder (Conda, catalog number: 1551 )
Agar bacteriological (Euromedex, catalog number: 1330 )
LB medium (see Recipes)
LB-agar medium (see Recipes)
Intoxication
Cotton balls for narrow vials 25 mm (Genesee Scientific, catalog number: 51-101 )
Spectrophotometry cuvettes (Ratiolab, catalog number: 2712120 )
2 ml microtubes (Paul Bottger, catalog number: 02-043 )
20 mm filter disks (Chromatography paper 3MM Chr) (GE Healthcare, catalog number: 3030-917 )
50 ml tube
Drosophila narrow vials 25 mm (Genesee Scientific, catalog number: 32-109RL )
Sucrose (Euromedex, catalog number: 200-301-B )
10% sucrose (see Recipes)
Dissection
1.5 ml microtubes (Paul Bottger, catalog number: 02-063 )
Graduated test tube
Watch glass (Steriplan Petri dishes, DWK Life Sciences, catalog number: 237554008 )
Ice
Ethanol 70% (VWR, catalog number: 83801.360 )
10x PBS (Euromedex, catalog number: ET330 )
1x phosphate-buffered saline (PBS) (see Recipes)
Sample preparation
Microtube pestle 1.5 ml (Argos Technologies, catalog number: P7339-901 )
0.5 ml microtubes (Paul Bottger, catalog number: 02-053 )
1x phosphate-buffered saline (PBS) (see Recipes)
Assay
1.5 ml microtubes (Paul Bottger, catalog number: 02-063 )
96-well black microplates (Greiner Bio One International, catalog number: 655076 )
2 ml microtube
15 ml tube
Aluminum foil
Trypsin from bovine pancreas (Sigma-Aldrich, catalog number: T1005 )
1 mM HCl
Casein Fluorescein IsoThioCyanate from bovine milk (Sigma-Aldrich, catalog number: C0528 )
Distilled water
cOmplete tablets EDTA-free (Roche Diagnostics, catalog number: 04693132001 )
Trichloroacetic acid (TCA) (Sigma-Aldrich, catalog number: T6399 )
Tris base
Trypsin solution (see Recipes)
Casein-FITC (see Recipes)
25x cOmplete (see Recipes)
10% TCA (see Recipes)
0.5 M Tris/HCl pH 8.5 (see Recipes)
Equipment
Drosophila rearing
Refrigerated oven at constant temperature of 25 °C and with a 12 h/12 h light/dark cycle (Fisher Scientific, catalog number: 11857552). Humidity has to be maintained between 40% and 70%
Manufacturer: LMS, model: Model 240 .
Bacterial culture
100 ml flasks (Fisher Scientific, catalog number: 15409103 )
30 °C/37 °C shaking incubator (Infors, model: AK 82 )
Intoxication
Spectrophotometer (Aqualabo, Secomam, model: Prim Light & Aduanced)
Droso-sleeper (Inject-Matic)
Dissection
Stereomicroscope (Leica Microsystems, model: Leica M60 )
Dumont forceps #5 (Fine Science Tools, catalog numbers: 11251-20 and 11252-20 )
Sample preparation
Pestle motor (Heidolph Instruments, model: RZR 2100 )
Refrigerated microfuge (Eppendorf, model: 5430 R )
Assay
Vortex (Scientific Industries, model: Vortex-Genie 2 )
Automated pipette (Eppendorf, model: Multipette® plus)
37 °C solid-door incubator (Jouan)
Fluorimeter (Agilent Technologies, model: Cary Eclipse )
Software
Kyplot
Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nawrot-Esposito, M., Loudhaief, R. and Gallet, A. (2017). Protease Activity Assay in Fly Intestines. Bio-protocol 7(18): e2560. DOI: 10.21769/BioProtoc.2560.
Download Citation in RIS Format
Category
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,561 | https://bio-protocol.org/exchange/protocoldetail?id=2561&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Detection of the Chlorophyll Catabolite Hydroxylating Activity from Capsicum annuum Chromoplasts
MH Mareike Hauenstein
SH Stefan Hörtensteiner
Published: Vol 7, Iss 18, Sep 20, 2017
DOI: 10.21769/BioProtoc.2561 Views: 7532
Edited by: Marisa Rosa
Reviewed by: Mohan TCWenrong He
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
Hydroxylation of chlorophyll catabolites at the so-called C32 position (Hauenstein et al., 2016) is commonly found in all plant species analyzed to date. Here we describe an in vitro hydroxylation assay using Capsicum annuum chromoplast membranes as a source of the hydroxylating activity, which converts the substrate epi-pFCC (epi-primary Fluorescent Chlorophyll Catabolite) (Mühlecker et al., 2000) to epi-pFCC-OH.
Keywords: TIC55 (Translocon at the inner chloroplast membrane 55 kDa) Chlorophyll breakdown PAO/phyllobilin pathway Senescence Chlorophyll catabolites Phyllobilins
Background
During leaf senescence and fruit ripening, light-absorbing chlorophylls are degraded to non-fluorescent catabolites to prevent oxidative damage. The chlorophyll breakdown pathway (PAO/phyllobilin pathway) consists of consecutive steps catalyzed by several enzymes and the final degradation products, called phyllobilins, are ultimately stored in the vacuole (Kräutler, 2016). epi-primary Fluorescent Chlorophyll Catabolite (epi-pFCC) is the first non-phototoxic intermediate. After its formation in the chloroplast, side-chain modifications of epi-pFCC can occur, most of which take place outside the chloroplast. One of these modifications, however, is the hydroxylation of the C32 position (Figure 1) catalyzed by the inner chloroplast envelope enzyme TIC55, a member of the family of ferredoxin (Fd)-dependent non-heme oxygenases. TIC55 contains a Rieske and a mononuclear iron-binding domain and was shown to require a Fd reducing system as well as molecular oxygen for its hydroxylating activity. Here we describe an in vitro enzyme assay for TIC55, which was used to characterize the epi-pFCC hydroxylating enzyme activity from red pepper chromoplasts.
Figure 1. Outline of the pathway of chlorophyll breakdown, highlighting the TIC55-catalyzed reaction from epi-pFCC to epi-pFCC-OH. The circle shows the C32 position, the site of hydroxylation.
Materials and Reagents
Pipette tips (SARSTEDT)
2 ml SafeSeal micro tubes, PP (SARSTEDT, catalog number: 72.695.500 )
Miracloth (pore size 22-25 µm) (Merck)
10 ml syringe with 0.6 mm needle
Watercolor paint brush, number 10 (for example: FILA, Giotto brush art series 400)
Fully ripe red-colored Capsicum annuum fruits, from local supermarket
Sucrose (AppliChem, catalog number: A2211,500 0)
Tris(hydroxymethyl)aminomethane (Tris) (Carl Roth, catalog number: AE15.3 )
2-(N-morpholino)ethanesulfonic acid (MES) (AppliChem, catalog number: A1074.1000 )
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) (AppliChem, catalog number: A2937.1000 )
Polyethylene glycol 4000 (PEG 4000) (Sigma-Aldrich, catalog number: 81240 )
1,4-Dithiothreitol (DTT) (Carl Roth, catalog number: 6908.3 )
(+)-Sodium L-ascorbate (Vitamin C) (Sigma-Aldrich, catalog number: A4034 )
Ferredoxin-NADP+ reductase (FNR) (Sigma-Aldrich, catalog number: F0628 )
Ferredoxin (Fd) (Sigma-Aldrich, catalog number: F3013 )
β-Nicotinamide adenine dinucleotide 2’-phosphate reduced tetrasodium salt hydrate (NADPH) (AppliChem, catalog number: A1395 )
Glucose-6-phosphate dehydrogenase (GDH) (Sigma-Aldrich, catalog number: G8404 )
Glucose-6-phosphate (Glc6P) (Sigma-Aldrich, catalog number: G7879 )
Epi-primary fluorescent chlorophyll catabolite (epi-pFCC) (according to Mühlecker et al., 2000)
Methanol, HPLC grade (Sigma-Aldrich, catalog number: 34860 )
Chromoplast isolation buffer (for composition, see Recipes)
Tris MES pH 8 buffer (for composition, see Recipes)
Equipment
Pipettes (Gilson)
Fruit juicer (Vitality 4 Life, model: Oscar Vitalmax 900 ) or Sorvall mixer
Microcentrifuge: Biofuge fresco (Heraeus, model: Biofuge fresco )
Centrifuge: Avanti J-20 XPi (Beckman Coulter, model: Avanti® J-XN 26 ); Rotors: JLA-10.500 (Beckman Coulter, model: JLA-10.500 with 500 ml polypropylene bottles) and JA-25.50 (Beckman Coulter, model: JA-25.50 with 50 ml polypropylene tubes)
Ultracentrifuge: Optima LE-80K (Beckman Coulter, model: OptimaTM LE-80K ); Rotor: SW-41Ti (Beckman Coulter, model: SW 41 Ti with 13.2 ml polyallomer tubes)
-80 °C freezer (Thermo Fisher Scientific, Thermo ScientificTM, model: HERAfreezeTM HFU 586 Top )
LC-MS/MS: Ultimate3000-Compact (Thermo Fisher Scientific, Thermo ScientificTM, model: UltiMate 3000 ; Bruker Daltonics, model: Compact )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hauenstein, M. and Hörtensteiner, S. (2017). Isolation and Detection of the Chlorophyll Catabolite Hydroxylating Activity from Capsicum annuum Chromoplasts. Bio-protocol 7(18): e2561. DOI: 10.21769/BioProtoc.2561.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,562 | https://bio-protocol.org/exchange/protocoldetail?id=2562&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Flow-assay for Farnesol Removal from Adherent Candida albicans Cultures
MP Melanie Polke
Ilse D. Jacobsen
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2562 Views: 7852
Edited by: Valentine V Trotter
Reviewed by: Emmanuel ZavalzaJose Thekkiniath
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Here, we describe a protocol for a continuous flow system for C. albicans cultures growing adherent to a plastic surface. The protocol was adapted from a previous method established to simulate blood flow on endothelial cells (Wilson and Hube, 2010). The adapted protocol was used by us for the removal of molecules in C. albicans supernatants, especially farnesol, which accumulate over the time course of incubation and cannot be specifically depleted. The system used, however, allows various applications including the simulation of physiological flow conditions. Several example applications are given on the manufacturer’s website (https://ibidi.com/perfusion-system/112-ibidi-pump-system.html).
Keywords: Continuous flow C. albicans Quorum sensing Farnesol Filamentation ibidi® pumps system
Background
Farnesol is a potent inhibitor of the yeast-to hypha transition (Hornby et al., 2001) in the human pathogenic fungus Candida albicans and also promotes the reversal to yeast growth from preformed filaments (Lindsay et al., 2012). The quorum sensing molecule (QSM) rapidly accumulates in the supernatant of a Candida albicans EED1 deletion strain and promotes the reverse morphogenesis and a hyphal maintenance defect of the mutant (Polke et al., 2017). As we were unable to block farnesol synthesis (Polke et al., 2017), we utilized the ibidi® pump system to remove the accumulating QSMs in the supernatant by uni-directional flow. Flow application, together with a constant medium exchange during the time course of incubation, significantly prolonged filamentation in the C. albicans eed1∆ mutant. This indicated the successful removal of QSM accumulates, and provided a direct link between hyphal maintenance and farnesol signaling in C. albicans. The system used for this protocol (ibidi® pump system) allows various applications under simulation of physiological flow conditions, and thus might be easily modified for other applications. Several example applications are given on the manufacturer’s website (https://ibidi.com/perfusion-system/112-ibidi-pump-system.html).
Materials and Reagents
Protective gloves and lab coat
Pipette tips (TipOne) (STARLAB INTERNATIONAL, catalog numbers: S1111-6000 , S1113-1006 , S1110-3000 )
µ-Slide VI0.4 ibiTreat: #1.5 polymer coverslip, tissue culture treated, sterilized (ibidi, catalog number: 80606 )
Flask with absorber beads: dry beads (KC Trockenperlen® [Sorbead®] orange, BASF)
Micro-tubes, 1.5 ml (SARSTEDT, catalog number: 72.690.001 )
0.2 μm sterile filters (Minisart 0.2) (SARSTEDT, catalog number: 83.1862.001 )
Syringe Injekt® 10 ml/Luer Lock Solo, sterile (B. Braun Medical, catalog number: 4606728V-02 )
50 ml Falcon tubes (SARSTEDT, catalog number: 62.547.254 )
10 ml pipette, graduated, sterile (Greiner Bio One International, catalog number: 607180 )
Petri dishes (Greiner Bio One International, catalog number: 633180 )
Disposal bags (Carl Roth, catalog number: E706.1 )
Steam Indicator Tape 3M (ComplyTM, 3M, catalog number: 1322-18MM )
Perfusion Set Blue (ibidi, catalog number: 10961 )
Filter/Reservoir set (10 ml, sterile) (ibidi, catalog number: 10971 )
Candida albicans strains of interest (the system was established using SC5314 and the respective EED1 deletion mutant, see Polke et al., 2017)
RPMI1640 medium [(+)L-glutamine, (+)phenol red, unbuffered] (Thermo Fisher Scientific, GibcoTM, catalog number: 21875034 )
Fermacidal D2® (2%) (LABOTECT, catalog number: 15101 )
Roti®-Histofix 4% (Carl Roth, catalog number: P087.5 )
Glycerol, ROTIPURAN®, water-free (Carl Roth, catalog number: 3783.2 )
D(+)-Glucose, water-free (Carl Roth, catalog number: HN06.4 )
BactoTM peptone (BD, BactoTM, catalog number: 211677 )
Yeast extract, micro-granulated (Carl Roth, catalog number: 2904.1 )
Agar-agar, Kobe I (Carl Roth, catalog number: 5210.4 )
Sodium chloride (NaCl) (Carl Roth, catalog number: 9265.2 )
Disodium phosphate (Na2HPO4·2H2O) (Carl Roth, catalog number: T877.1 )
Monopotassium phosphate (KH2PO4) (Carl Roth, catalog number: 3904.1 )
Ethanol denatured ≥ 99.8% (Carl Roth, catalog number: K928.4 )
30% glycerin solution (see Recipes)
20% D(+)-glucose solution (see Recipes)
YPD broth (see Recipes)
YPD agar medium (see Recipes)
10x PBS (see Recipes)
1x PBS (see Recipes)
70% ethanol (see Recipes)
Equipment
Milli-Q® integral water purification system for ultrapure water (deionized water) (Merck, model: Milli-Q® Integral )
Infors HT, Multitron Standard shaking incubator, Version 2 (Infors, model: Multitron Standard )
BINDER cooling incubator (series: APT.line®KB, BINDER, model: KB 53 ; 30 °C)
BINDER CO2 incubator (series APT.line®CB, BINDER, model: CB 220 ; 37 °C)
Glass flasks 25 ml and 250 ml (Schott, DURAN, Germany)
Pipette set 0.2 μl-1,000 μl (Gilson, model: PIPETMAN® P, P2 , P10 , P20 , P100 , P200 and P1000 )
Tabletop centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HereausTM PicoTM 21 )
Mid bench centrifuge (Sigma Laborzentrifugen, model: SIGMA 3-18K )
Vortexer (Scientific Industries, model: Vortex-Genie 2 )
Neubauer improved, cell counting chamber 0.0025 mm2 (Marienfeld-Superior, catalog number: 0640030 )
Biosafety cabinet (NuAire, model: NU-480-400E )
Ibidi® pump system including ibidi pump, fluidic unit, perfusion set, notebook, PumpControl software (ibidi, catalog number: 10902 )
ZEISS inverted microscope (ZEISS, model: Axio Vert.A1 )
UV Crosslinker (Vilber, model: Bio-Link 254 )
Autoclave (for example: SHP Steriltechnik, model: Laboklav 135 MSLV )
Software
Computer equipped with ZEISS ZEN software (Blue edition, 2012)
Computer with GraphPad Prism 5 software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Polke, M. and Jacobsen, I. D. (2017). A Flow-assay for Farnesol Removal from Adherent Candida albicans Cultures. Bio-protocol 7(19): e2562. DOI: 10.21769/BioProtoc.2562.
Download Citation in RIS Format
Category
Microbiology > Microbial signaling > Quorum sensing
Cell Biology > Cell signaling > Quorum sensing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,563 | https://bio-protocol.org/exchange/protocoldetail?id=2563&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Expression and Purification of the Hsp90-Cdc37-Cdk4 Kinase Complex from Saccharomyces cerevisiae
KV Kliment A. Verba
DA David A. Agard
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2563 Views: 8274
Edited by: Arsalan Daudi
Reviewed by: Yann Simon Gallot
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Interactions between Hsp90, its co-chaperone Cdc37 and kinases have been biochemically studied for over three decades and have been shown to be functionally important in organisms from yeast to humans. However, formation of a stable complex for structural studies has been elusive. In this protocol we describe expression and purification of Hsp90-Cdc37-Cdk4 kinase protein complex from Saccharomyces cerevisiae utilizing the viral 2A sequences to titrate the three proteins at similar levels.
Keywords: Hsp90 Cdc37 Cdk4 Chaperone Kinase 2A peptides Yeast protein expression
Background
Robustly forming complexes between Hsp90 molecular chaperone and its client kinases has proven to be refractory in vitro. Previous work indicated that overexpression of Hsp90’s co-chaperone Cdc37 together with a client kinase in insect Sf9 cells led to a stable complex between Sf9 Hsp90, exogenous Cdc37 and exogenous kinase (Vaughan et al., 2006). However, insect cell culture requires special equipment, is more difficult to genetically manipulate and is significantly slower to both grow and clone into than other well studied expression systems, like bacteria and yeast. Co-expression of the above proteins in E. coli did not yield soluble kinase/stable complex. We reasoned that Saccharomyces cerevisiae would possess the necessary machinery to help fold and facilitate the complex formation and sought to generate the complex between human Hsp90 beta, human Cdc37 and human Cdk4 kinase by co-expressing these proteins in S. cerevisiae. To attain stoichiometric expression of the three proteins, we utilized viral 2A peptides, which allowed transcription of the three proteins on one mRNA with subsequent cleaving at the translation stage. This system has been utilized in human cell lines and in rabbit reticulolysates (Kim et al., 2011; Minskaia and Ryan, 2013), but to our knowledge this is the first utilization of 2A viral expression peptides in S. cerevisiae.
Materials and Reagents
Generating the co-expression construct
100 x 15 mm Petri dishes (Fisher Scientific, catalog number: FB0875713 )
15 ml culture tubes (Corning, Falcon®, catalog number: 352051 )
1.5 ml microcentrifuge tubes (Fisher Scientific, catalog number: 05-408-129 )
0.2 μm filter
83nu vector (obtained from Arkin lab)
GeneArt Strings DNA (Thermo Fisher Scientific)
NEB Builder Assembly Tool (Online: http://nebuilder.neb.com/)
Gibson Assembly Cloning Kit (New England Biolabs, catalog number: E5510S )
DpnI
PCR Clean up Kit (Promega, catalog number: A9281 )
Miniprep Kit (Omega Bio-tek, catalog number: D6942-02 )
Q5 Site-Directed Mutagenesis Kit (New England Biolabs, catalog number: E0554S )
Bacto-tryptone (BD, BactoTM, catalog number: 211705 )
Carbenicillin (Gold Bio, catalog number: C-103-100 )
Yeast extract (BD, BactoTM, catalog number: 212750 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888-10KG )
Agar (BD, DifcoTM, catalog number: 281210 )
LB (see Recipes)
LB agar (see Recipes)
Expression of the Hsp90/Cdc37/Cdk4
Disposable spectrophotometer cells (Agilent Technologies, catalog number: 6610018700 )
JEL1 strain of Saccharomyces cereviase (MAT-alpha, leu2 trp1 ura3-52 prb1-1122 pep4-3 deltahis3::PGAL10-GAL4). Gift from Luke Rice, UT Southwestern
Frozen-EZ Yeast Transformation II Kit (ZYMO RESEARCH, catalog number: T2001 )
Galactose (Sigma-Aldrich, catalog number: G0625 )
Yeast nitrogen base (YNB) (BD, DifcoTM, catalog number: 291940 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
CSM-His amino acid mixture (MP Biomedicals, catalog number: 4510-312 )
Peptone (BD, BactoTM, catalog number: 211820 )
Yeast extract (BD, BactoTM, catalog number: 212750 )
Sodium DL-lactate solution (Sigma-Aldrich, catalog number: L1375 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
SD-His (see Recipes)
YPGL media (see Recipes)
Purification of the Hsp90/Cdc37/Cdk4 complex
30 ml syringe (BD, catalog number: 309650 ) with 16 G needle (BD, catalog number: 305196 )
50 ml conical tubes (Corning, catalog number: 352070 )
Concentrators, 15 ml, 30 kDa cutoff (EMD Millipore, catalog number: UFC903096 )
Dialysis tubing, 10 kDa cutoff (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 68100 )
12 x 75 mm tubes for fraction collection (Fisher Scientific, catalog number: 14-959-16 )
FLAG peptide (GenScript, catalog number: RP10586 )
Protease inhibitors, EDTA free (Roche Diagnostics, catalog number: 11873580001 )
Ni-NTA Superflow beads (QIAGEN, catalog number: 30450 )
Anti-FLAG M2 Magnetic Beads (Sigma-Aldrich, catalog number: M8823 )
TEV protease, prepped in lab, 10 mg/ml, same as (Sigma-Aldrich, catalog number: T4455 )
Liquid nitrogen
Bolt 4-12% Bis-Tris Plus Gels (Thermo Fisher Scientific, InvitrogenTM, catalog number: NW04120BOX )
NuPAGE LDS sample buffer (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0007 )
NuPAGE MOPS SDS running buffer (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0001 )
Trizma base (Sigma-Aldrich, catalog number: T1503 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888-10KG )
Imidazole (Sigma-Aldrich, catalog number: I2399 )
Magnesium chloride (MgCl2), 1 M stock (Sigma-Aldrich, catalog number: 63069 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium molybdate (NaMoO4) (Sigma-Aldrich, catalog number: 243655 )
Dithiothreitol (DTT) (Gold Bio, catalog number: DTT100 )
Lysis buffer (see Recipes)
Dialysis buffer (see Recipes)
Gel filtration buffer (see Recipes)
Equipment
Generating the co-expression construct
PCR machine (like Biorad DNA Engine BG96TC)
37 °C culture shaker (like New Brunswick Innova 43 series)
4 °C and -20 °C fridge (any brand)
42 °C heat block (like Thomas Scientific 3661044)
Expression of Hsp90/Cdc37/Cdk4
2.5 L flasks (Ultra Yield) (Thomson Instrument, catalog number: 931136-B )
Autoclave
Centrifuge capable of 3,000 x g utilizing 1 L bottles (like Beckman Coulter, model: Avanti® J20 Series )
30 °C culture shaker capable of shaking at 200 rpm 250 ml and 1 L flasks (like Eppendorf, New BrunswickTM, model: Innova® 4200 series)
UV-Visible spectrophotometer (Agilent Technologies, model: Agilent 8453 )
Purification of the Hsp90/Cdc37/Cdk4 complex
EmulsiFlex-C3 (Avestin, model: EmulsiFlex-C3 )
Centrifuge (like Beckman Coulter, model: Avanti® J20 Series )
High-speed centrifuge tubes (capable of 30,000 x g like Beckman Coulter, catalog number: 357002 )
Rocker (like Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88880019 )
MonoQ 10/100GL column (GE Healthcare, catalog number: 17-5167-01 )
HiLoad 16/600 Superdex 200pg column (GE Healthcare, catalog number: 28989335 )
Glass gravity columns (Bio-Rad Laboratories, catalog number: 7372512 )
ÄKTApurifier system (GE Healthcare, model: ÄKTApurifier system)
-80 °C fridge (like Eppendorf, New BrunswickTM, model: U570 ULT )
Assortment of beaker sizes
Magnetic stand (like EMD Millipore, catalog number: LSKMAGS15 )
Mini Gel tank (Thermo Fisher Scientific, catalog number: A25977 )
PowerEase 500 Power Supply (Thermo Fisher Scientific, model: PowerEase® 500 )
Liquid nitrogen flask (like Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2129 )
Spatulas (Cole-Parmer, catalog number: UX-06369-16 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Verba, K. A. and Agard, D. A. (2017). Protein Expression and Purification of the Hsp90-Cdc37-Cdk4 Kinase Complex from Saccharomyces cerevisiae. Bio-protocol 7(19): e2563. DOI: 10.21769/BioProtoc.2563.
Download Citation in RIS Format
Category
Biochemistry > Protein > Expression
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,564 | https://bio-protocol.org/exchange/protocoldetail?id=2564&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ensifer-mediated Arabidopsis thaliana Root Transformation (E-ART): A Protocol to Analyse the Factors that Support Ensifer-mediated Transformation (EMT) of Plant Cells
Dheeraj Singh Rathore
Fiona M. Doohan
EM Ewen Mullins
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2564 Views: 10492
Original Research Article:
The authors used this protocol in Jun 2006
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2006
Abstract
Ensifer adhaerens OV14, a soil borne alpha-proteobacteria of the Rhizobiaceae family, fortifies the novel plant transformation technology platform termed ‘Ensifer-mediated transformation’ (EMT). EMT can stably transform both monocot and dicot species, and the host range of EMT is continuously expanding across a diverse range of crop species. In this protocol, we adapted a previously published account that describes the use of Arabidopsis thaliana roots to investigate the interaction of A. thaliana and Agrobacterium tumefaciens. In our laboratory, we routinely use A. thaliana root explants to examine the factors that enhance the utility of EMT. In addition, the E-ART protocol can be used to study the transcriptional response of E. adhaerens and host plant following exposure to explant tissue, the transformability of different Ensifer adhaerens strains/mutants as well as testing the susceptibility of A. thaliana mutant lines as a means to decipher the mechanisms underpinning EMT.
Keywords: Ensifer adhaerens strain OV14 Plant transformation A. thaliana Root assay Transient GUS expression
Background
The advancement of Ensifer-mediated transformation (EMT) technology to successfully transform dicots viz., Arabidopsis thaliana, Solanum tuberosum, Nicotiana tabacum, Manihot esculenta, Brassica napus, and the monocot; Oryza sativa, has been previously reported (Wendt et al., 2012; Zuniga-Soto et al., 2015; Chavarriaga-Aguirre et al., 2016; Rathore et al., 2016). Additionally, genomic analysis of E. adhaerens OV14 by Rudder et al. (2014) revealed the bacterium possessed a 7.7 Mb genome comprised of two circular chromosomes (3.96 Mb and 2.01 Mb) and two plasmids (1.61 Mb and 125 Kb). A comparative analysis of the genome of E. adhaerens OV14 with Agrobacterium tumefaciens C58 (classic genetic engineer) and Sinorhizobium meliloti 1021 (a rhizobia with a propensity for low rates of genetic transformation; Broothaerts et al., 2005), highlighted that both E. adhaerens OV14 and S. meliloti 1021 contain homologs to several chromosomal-based genes essential for Agrobacterium-mediated transformation (AMT). However, a suite of genes which positively influence the successful transformation of a plant genome were found to be only present in the genome of E. adhaerens OV14 but absent from S. meliloti 1021 (Rudder et al., 2014). Overall, the sequence analysis of the E. adhaerens OV14 genome has significantly expanded the knowledge base describing the genetic systems that regulate the transformation of plant genomes via EMT.
To date several transient transformation systems have been proposed to study gene function in plants in regard to the use of A. tumefaciens (Wroblewski et al., 2005; Gelvin, 2006; Bhaskar et al., 2009; Li et al., 2009; Van Loock et al., 2010; Hwang et al., 2013; Krenek et al., 2015). Whereas, the stable transformations of any plant species are lengthy processes to test the utility of a bacterial transfection system to transform the plants. The advantages of transient transformation methods include rapid production of results, functional genomic studies and recombinant protein production (Van Loock et al., 2010; Krenek et al., 2015). The model plant A. thaliana is a powerful research tool with which to study the molecular, genetic and biochemical processes that support genetic transformation of somatic tissues as well as in planta (Provart et al., 2016). In contrast to the several months typically required for the transformation of primary crop species, these investigations require a rapid, reproducible and easy quantification method to determine the rate of transient transformation. Previously, Gelvin (2006) reported an efficient and reproducible quantitative assay for Agrobacterium-mediated Transformation using A. thaliana roots. This assay has well served the purpose of testing either Agrobacterium strains or A. thaliana ecotypes/mutants in the authors’ laboratory for more than two decades, reflecting the significance and competency of the assay in publications such as Shi et al. (2014). Conversely, a transient transformation method to facilitate comparable studies via EMT is not available. In response, the Ensifer-mediated A. thaliana Root Transformation (E-ART) protocol presented here is designed to address this deficit so that specific genetic and microbiological factors that support/enhance EMT can be identified to support the application of the technology to agronomically important crop species. The protocol is a modified version of an existing AMT based quantitative A. thaliana roots assay (Gelvin, 2006). While developing the E-ART protocol, we learnt that it is possible to improve transient GUS expression in A. thaliana root segments by adjusting several experimental factors (e.g., time of co-cultivation, acetosyringone concentrations, etc.) involved in the early stages of E. adhaerens transfection. E-ART, being the first quantitative method of transient gene expression for EMT will facilitate the rapid evaluation of novel E. adhaerens strains in plant transformation while also providing a platform to assess the genetic response of plants to EMT.
Materials and Reagents
2 ml centrifuge tubes
Square Petri-dishes (Greiner Bio One International, catalog number: 688161 )
Parafilm (Bemis, catalog number: PM992 )
50 ml Falcon tube
Scalpel blades (NO. 10A, Swan Morton, catalog number: 0302 )
Sterile filter papers (GE Healthcare, catalog number: 1004-090 )
Petri dish 92 x 16 mm w/o cams (SARSTEDT, catalog number: 82.1472 )
A. thaliana seed (in this case ecotype Columbia, Col-0)
Note: A. thaliana seed is no more than 6 months old being stored at 4 °C.
E. adhaerens strain OV14 harbouring plasmid of choice (in this case pCambia5105/pCambia5106 plasmids [Jefferson et al., 2006])
70% ethanol
Distilled sterile water (DSW)
Bleach (5% sodium hypochlorite; final concentration used is 50% Bleach, i.e., 1:1 Bleach:water)
Tween-20
Agarose (0.1%, Sigma-Aldrich, catalog number: A9539-500G )
Antibiotics for bacterial selection: kanamycin, streptomycin, spectinomycin (Duchefa Biochemie)
Sodium chloride (0.9% NaCl solution)
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
Cefotaxime sodium (Duchefa Biochemie, catalog number: C0111.0005 )
Tryptone (Oxoid, catalog number: LP0042 )
Yeast extract (Oxoid, catalog number: LP0021 )
Calcium chloride dehydrate (Duchefa Biochemie, catalog number: C0504 )
Agar No. 1 (Oxoid, catalog number: LP0011 )
MS basal salts (Duchefa Biochemie, catalog number: M0221 )
Sucrose (Duchefa Biochemie, catalog number: S0809 )
2,4-Morpholino-ethane sulfonic acid (MES monohydrate) (Duchefa Biochemie, catalog number: M1503 )
Myo-inositol (Duchefa Biochemie, catalog number: I0609 )
Nicotinic acid (Duchefa Biochemie, catalog number: N0611 )
Pyridoxine (Duchefa Biochemie, catalog number: P0612 )
Thiamine-HCl (Duchefa Biochemie, catalog number: T0614 )
D-Glucose monohydrate (Duchefa Biochemie, catalog number: G0802 )
Indole-3-acetic acid (IAA) (Duchefa Biochemie, catalog number: I0901 )
2,4-Dicholorophenocxyacetic acid (2,4-D) (Duchefa Biochemie, catalog number: D0911 )
Kinetin (Duchefa Biochemie, catalog number: K0905 )
X-GlcA cyclohexylammonium salt (Duchefa Biochemie, catalog number: X1405 )
Dimethyl sulfoxide (DMSO) (Duchefa Biochemie, catalog number: D1370 )
Teagasc-Tryptone Yeast-extract (TTY) medium (Rathore et al., 2015) (see Recipes)
MS based media (see Recipes)
Seed germination media (SGM)
Co-cultivation media (CCM)
Callus Induction media (CIM)
Vitamin stock
X-GlcA solution (see Recipes)
Histochemical GUS stain solution (Jefferson et al., 1987) (see Recipes)
Equipment
Pipettes (P1000, P100, P10)
Controlled environment room/chamber to grow healthy A. thaliana plants (24 °C, 16 h light, 8 h dark), abbreviated as CT room
Conical flasks (250 ml, sterile)
Centrifuge
Incubator (28 °C and 37 °C)
Shaker incubator (28 °C, 220 rpm)
Fridge (4 °C) and freezers (-20 °C and -80 °C)
Laminar flow to perform aseptic work
Bead sterilizer/flame to sterilize forceps
Scalpel blades handles (No.7 S/S, Swan Morton, catalog number: 0907 )
Autoclave (15 min at 121 °C and 15 psi)
pH meter
Weighing balance
NanoDrop2000 spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 )
Elga water purifier (Veolia Water Solution & Technologies, model: PURELAB® OPTION-R 7, catalog number: OR007BPM1 )
Stereo-microscope
Software
SAS system (Version 9.3, copyright 2002-2010 by SAS Institute Inc., Cary, NC, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rathore, D. S., Doohan, F. M. and Mullins, E. (2017). Ensifer-mediated Arabidopsis thaliana Root Transformation (E-ART): A Protocol to Analyse the Factors that Support Ensifer-mediated Transformation (EMT) of Plant Cells. Bio-protocol 7(19): e2564. DOI: 10.21769/BioProtoc.2564.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Ensifer-mediated transformation
Microbiology > Microbe-host interactions > Bacterium
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,565 | https://bio-protocol.org/exchange/protocoldetail?id=2565&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Caenorhabditis elegans Transgenic Animals by DNA Microinjection
Matthias Rieckher
Nektarios Tavernarakis
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2565 Views: 13970
Edited by: Jyotiska Chaudhuri
Reviewed by: Manish Chamoli
Original Research Article:
The authors used this protocol in May 2009
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2009
Abstract
Microinjection is the most frequently used tool for genetic transformation of the nematode Caenorhabditis elegans, facilitating the transgenic expression of genes, genome editing by the clustered regularly interspersed short palindromic repeats (CRISPR)-Cas9 system, or transcription of dsRNA for RNA intereference (RNAi). Exogenous DNA is delivered into the developing oocytes in the germline of adult hermaphrodites, which then generate transgenic animals among their offspring. In this protocol, we describe the microinjection procedure and the subsequent selection of transgenic progeny.
Keywords: Caenorhabditis elegans Genetic transformation Microinjection Extrachromosomal arrays Germline GFP Transgenic animals
Background
In C. elegans, DNA transformation by microinjection is commonly used to produce transgenic animals that over-express or ectopically express genes, which can be fused to tags (e.g., green fluorescent protein [GFP]), allowing for the phenotypic rescue of mutants, and/or the analysis of localization and function of proteins (Carter et al., 1990; Chalfie et al., 1994; Mello and Fire, 1995). The advent of the clustered regularly interspersed short palindromic repeats (CRISPR)-Cas9 system requires microinjection to achieve highly specific genome editing by introducing point mutations or insertion/deletion mutations (summarized in Dickinson and Goldstein, 2016). Further, the technique is applied for the inducible and/or tissue-specific in vivo transcription of dsRNA to facilitate heritable RNA interference (RNAi) (Tavernarakis et al., 2000). The genetic material is injected into the distal gonad syncytium of adult hermaphrodite animals where it enters the developing oocytes (Figure 1). The exogenous DNA is arranged into large extrachromosomal arrays consisting of 50 to 300 copies, which are inherited in a non-Mendelian fashion to the following generations. Next-generation progeny (F1) carry the extrachromosomal array with a varying probability (between 5 to 80% [Stinchcomb et al., 1985; Mello et al., 1991]). Transgenic animals are identified amongst the offspring by the use of co-transformation markers, which are injected along with the DNA of interest (Table 1). Most commonly used are the pharyngeal expression of green fluorescent protein (GFP) or red fluorescence (mCherry), or the dominant rol-6(su1006) allele, which induces a distinct rolling phenotype in transgenic F1 progeny (Mello et al., 1991; Tabara et al., 1996; Frokjaer-Jensen et al., 2008).
Table 1. Commonly used co-transformation markers with distinct phenotypes for selection of transgenic animals upon microinjection in C. elegans
Figure 1. Microinjection scheme for C. elegans. A. Scheme of an adult C. elegans displaying the major organs including the pharynx, intestine and the gonad. When microinjecting C. elegans the injection capillary needs to be inserted in the syncytium (cytoplasmic core) of the distal gonad. The inlay indicates the area of interest for injection. B. DIC image of the area indicated in 1A. The nuclei of the germ-cells are clearly visible and surround the syncytium. Size bar corresponds to 50 µm.
Materials and Reagents
Sterile pipette tips
Microloader pipette tips (Eppendorf, catalog number: 5242956003 )
Microinjection capillaries (Eppendorf Femtotips II, 0.5 µm inner and 0.7 µm outer diameter) (Eppendorf, catalog number: 930000043 )
Microscope slides, 76 x 26 mm (Carl Roth, catalog number: 0656.1 )
Microscope cover glasses, 24 x 60 mm (VWR, catalog number: 631-1575 )
Tape (~1 mm thickness)
Greiner Petri dishes (60 x 15 mm) (Sigma-Aldrich, catalog number: P5237 )
Glass Pasteur Pipettes, disposable, 150 mm (BRAND, catalog number: 747715 )
C. elegans animals (e.g., available from Caenorhabditis Genetics Center [CGC], University of Minnesota, MN, USA)
Escherichia coli OP50 strain (obtained from the Caenorhabditis Genetics Center)
DNA of interest for injection (plasmid, fosmid, PCR fragment, or similar) and plasmid containing a co-transformation marker (see Table 1)
Miniprep Kit for DNA purification (e.g., QIAGEN-tip 20) (QIAGEN, catalog number: 10023 )
Halocarbon oil 700 (Sigma-Aldrich, catalog number: H8898-100ML )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Peptone (BD, BactoTM, catalog number: 211677 )
Streptomycin sulfate salt (Sigma-Aldrich, catalog number: S6501 )
Agar (Sigma-Aldrich, catalog number: 05040 )
100% ethanol
Calcium chloride dehydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Cholesterol stock solution (SERVA Electrophoresis, catalog number: 17101.01 )
Nystatin stock solution (Sigma-Aldrich, catalog number: N3503 )
Potassium dihydrogen phosphate (KH2PO4) (Carl Roth, catalog number: P018.1 )
Di-Sodium hydrogen phosphate (Na2HPO4) (Carl Roth, catalog number: T876.1 )
Di-Potassium hydrogen phosphate (K2HPO4) (Carl Roth, catalog number: 5066.1 )
Agarose (Biozym Scientific, catalog number: 840004 )
OP50 seeded NGM agar plates (see Recipes)
2% agarose pads (see Recipes)
Hairpin pick (see Recipes)
M9 buffer (see Recipes)
Equipment
Bunsen burner
Cylindrical glass beaker
Wormpick with platinum wire and pre-flattened tip (Genesee Scientific, catalog numbers: 59-AWP and 59-30P6 )
Microwave
Heat plate (e.g., IKA, model: C-MAG HP 4 , catalog number: 0003581600)
Puller (optional; e.g., Sutter Instrument, model: P-97 )
Autoclave
Stereomicroscope (e.g., Leica Microsystems, model: Leica M80 ), optionally fluorescent stereomicroscope (e.g., Leica Microsystems, model: Leica M165 FC)
Microscope for Microinjection (ZEISS, model: Axio Observer.A1 equipped with differential interference contrast [DIC] prisms, gliding table, objective 10x/0.3 M27, objective 40x/0.75 M27, optionally camera AxioCam ERc 5 sec and monitor for observation and demonstration purposes)
Micromanipulator (e.g., Eppendorf InjectMan 4) (Eppendorf, catalog number: 5192000019 )
Microinjector unit (e.g., Eppendorf FemtoJet 4i) (Eppendorf, catalog number: 5252000013 )
Microcentrifuge (e.g., Eppendorf Centrifuge 5424) (Eppendorf, model: 5424 , catalog number: 5404000014)
Spectrophotometer (e.g., Thermo Fisher Scientific, model: NanoDropTM 8000 , catalog number: ND-8000-GL)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rieckher, M. and Tavernarakis, N. (2017). Generation of Caenorhabditis elegans Transgenic Animals by DNA Microinjection. Bio-protocol 7(19): e2565. DOI: 10.21769/BioProtoc.2565.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,566 | https://bio-protocol.org/exchange/protocoldetail?id=2566&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Densities of Bacterial Endosymbionts of Insects by Real-time PCR
Daisuke Kageyama
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2566 Views: 9553
Reviewed by: Filipa VazModesto Redrejo-Rodriguez
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Increased attention has been paid to the endosymbiotic bacteria of insects. Because most insect endosymbionts are uncultivable, quantitative PCR (qPCR) is a practical and convenient method to quantify endosymbiont titers. Here we report a protocol for real-time qPCR based on SYBR Green I fluorescence as well as some tips to prevent possible pitfalls.
Keywords: Bacteria Endosymbionts Insects qPCR Quantification SYBR Green
Background
Insects often harbor bacterial symbionts of various taxa in their bodies. Such bacterial symbionts (endosymbiotic bacteria) attract great attention because of their profound effects on the host insect. Some bacteria provide essential nutrition to their hosts (Baumann et al., 1995), some confer resistance against parasites (Oliver et al., 2003; Hedges et al., 2008), and some even manipulate reproduction or sex determination of their hosts for their own benefit (Werren et al., 2008; Kageyama et al., 2012). Because most insect endosymbionts are uncultivable, quantitative PCR (qPCR) is a practical and convenient method to quantify endosymbiont titers (Simoncini et al., 2001), possibly complemented by other visualization methods, such as fluorescence in situ hybridization (FISH) (Koga et al., 2009) and/or electron microscopy.
Materials and Reagents
Note: Reagents differ depending on the qPCR equipment. Here I describe a protocol for absolute quantification using LightCycler® 480 (Roche). For each reaction, two or more technical replicates are strongly recommended.
Pipette tips:
10-μl tips (e.g., Fukaekasei and Watson, catalog number: 110-201C )
200-μl tips (Fukaekasei and Watson, catalog number: 1201-705C )
1,000-μl tips (Fukaekasei and Watson, catalog number: 110-706C )
To reduce the risk of contamination, use of the filtered tips, e.g.,
10-μl tips (Fukaekasei and Watson, catalog number: 1251-204CS )
200-μl tips (Fukaekasei and Watson, catalog number: 1252-703CS )
1,000-μl tips (Fukaekasei and Watson, catalog number: 124-1000S )] is preferable
Centrifuge tubes of 1.5 ml (e.g., Fukaekasei and Watson, catalog number: 131-7155C )
Centrifuge tubes of 50 ml [e.g., Falcon 50-ml conical centrifuge tubes (Corning, Falcon®, catalog number: 352070 )]
LightCycler® 480 Multiwell Plate 96, white (Roche Molecular Systems, catalog number: 04729692001 , sealing foils included)
Template DNA to be measured (genomic DNA extracted from insects)
Template DNA for standard (PCR products or inserted plasmid DNA with known concentration)
LightCycler® 480, buffer 1 (2x Master mix) (Roche Molecular Systems, catalog number: 04707516001 )
LightCycler® 480, buffer 2 (H2O) (Roche Molecular Systems, catalog number: 04707516001 )
Forward and reverse primers
Reaction mix (see Recipes)
Equipment
Spectrophotometer (Bio-Rad Laboratories, model: SmartSpecTM 3000 )
LightCycler® 480 System (Roche Molecular Systems, model: LightCycler® 480 ) connected to a computer
Centrifuge for 96-well plate (e.g., Kubota, model: PlateSpin II )
Pipettes [e.g., PIPETMAN® P10 (Gilson, catalog number: F144802 ), P20 (Gilson, catalog number: F123600 ), P100 (Gilson, catalog number: F123615 ), P200 (Gilson, catalog number: F123601 ), or P1000 (Gilson, catalog number: F123602 )]
Laminar flow cabinet
Software
LightCycler® 480 Software, version 1.5.1 (Roche Molecular Systems)
Primer3Plus free online software (http://primer3plus.com/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kageyama, D. (2017). Quantification of Densities of Bacterial Endosymbionts of Insects by Real-time PCR. Bio-protocol 7(19): e2566. DOI: 10.21769/BioProtoc.2566.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Microbiology > in vivo model > Bacterium
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,567 | https://bio-protocol.org/exchange/protocoldetail?id=2567&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Large-scale Maize Seedling Infection with Exserohilum turcicum in the Greenhouse
PY Ping Yang
GH Gerhard Herren
SK Simon G. Krattinger
BK Beat Keller
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2567 Views: 9297
Edited by: Zhibing Lai
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Northern corn leaf blight (NCLB) is a serious foliar disease of maize (Zea mays) worldwide and breeding for resistance is of primary importance for maize crop protection. Phenotyping for NCLB resistance is well established in the field, but such experiments depend on suitable environmental conditions and are seasonal. Here we describe a greenhouse seedling approach that is suitable for testing thousands of seedling plants in a single experiment with a duration of 37 days. Three scoring methods were used to quantify the disease severity: the area under the disease progress curve (AUDPC), the primary diseased leaf area of the inoculated leaves at 16 days post inoculation (PrimDLA at 16 dpi) and the incubation period (IP) that was determined as days from inoculation to symptom appearance. By testing a diverse panel of maize genotypes, a high correlation between the three different methods was observed (81.9% to 94.1%), indicating that each of scoring methods can be applied for disease quantification. Thus, the seedling assay developed served as a relatively simple and high-throughput method for phenotyping NCLB disease resistance under greenhouse condition.
Keywords: Northern corn leaf blight Seedling assay High-throughput Disease quantification
Background
Northern corn leaf blight (NCLB) is a ubiquitous foliar wilt disease that threatens maize production worldwide (Welz and Geiger, 2000). The disease is caused by the hemibiotrophic fungus Exserohilum turcicum (anamorph of Setosphaeria turcica), which favors a high-humidity and cool temperature environment. Under favorable conditions, fungal infection manifests itself as large and irregularly emerging lesions that destroy the entire foliage. Therefore, this disease decreases the active leaf area and the accumulation of photosynthesized products. Up to 50% grain yield loss was reported but the reduction largely depended on environmental parameters (e.g., temperature, humidity), phases of maize development and hybrid susceptibility (Ullstrup, 1970; Pataky et al., 1998).
Precision phenotyping for NCLB disease resistance is critical for the determination of host resistance against E. turcicum. Testing for disease resistance in the field is well established, e.g., by placing or distributing inoculums in the leaf whorl at the 4 to 6 leaf stage (or even older) plants (Dingerdissen et al., 1996; Lipps et al., 1997; Brown et al., 2001; Asea et al., 2009; Chung et al., 2010; Chung et al., 2011). Scoring for resistance can be conducted by determining the levels of susceptibility (1 to 9; 1, complete resistance, no symptoms; 9, 90-100% of leaf area infected), the primary diseased leaf area (PrimDLA) that was defined as the percentage of infected leaf area of the inoculated leaf, the diseased leaf area of the entire plant (DLA), the incubation period (IP) rated as the number of days post inoculation until first observing the wilting/lesion, the lesion number (LN) at 14 to 21 days post inoculation and finally the area under the disease progress curve (AUDPC). However, tests for resistance in the field are environmentally-dependent and time-consuming. Here we describe a simple greenhouse seedling assay by testing only the second leaf, thus being suitable for quantifying thousands of seedlings in a single experiment within 37 days.
Materials and Reagents
Pipette tips
General lab materials, including:
Mesh (0.5 mm)
Round Petri dish (9 cm)
Inoculation needle
Microspore glass
Vessel
Funnel
50 ml Falcon tube, etc.
E. turcicum isolate Passau-1
Potato dextrose agar (PDA) (BD, DifcoTM, catalog number: 213400 )
Tween 20 (Sigma-Aldrich, catalog number: V900548 )
PDA medium (see Recipes)
Tween 20 solution (see Recipes)
Equipment
Pipettes
General greenhouse equipment, including jiffy pots (ø8 cm), tray and sieve tray (L/W: 50 cm/30 cm), etc.
Home-made iron frame cover with non-permeable plastic (L/W/H: 50/30/35 cm)
Sprayer (Semadeni, ø28 mm)
Autoclave
A home-made box (L/W/H: 54/30/25 cm, open at the bottom, 3 cm notches on each side) to shield the Blacklight Blue fluorescent tubes (Philips TL-D BLB, 15 W, peak at λ 356 nm) or any incubators that can fit the fluorescent tubes can be used alternatively
Sterile bench with UV light
Neubauer counting chamber (BRAND, catalog number: 717805 )
Microscope (ZEISS, model: Axio Imager 2 ) or other light microscopes
Centrifuge (Eppendorf, model: 5810 R )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yang, P., Herren, G., Krattinger, S. G. and Keller, B. (2017). Large-scale Maize Seedling Infection with Exserohilum turcicum in the Greenhouse. Bio-protocol 7(19): e2567. DOI: 10.21769/BioProtoc.2567.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Host-microbe interactions
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,568 | https://bio-protocol.org/exchange/protocoldetail?id=2568&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Xanthomonas oryzae pv. oryzae Inoculation and Growth Rate on Rice by Leaf Clipping Method
YK Yinggen Ke
SH Shugang Hui
Meng Yuan
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2568 Views: 16061
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Bacterial blight caused by Xanthomonas oryzae pv. oryzae (Xoo) is one of the most serious bacterial diseases and a major impediment to the increase of rice yield. Appropriate methods for inoculation of Xoo and disease scoring are necessary to investigate the nature of the disease and the mechanism of plant resistance to the pathogen. As the most-widely grown crop in the worldwide, rice yield plays an important role in food security. Uncovering mechanisms of plant-pathogen interaction of rice and Xoo will help develop rice plants that are more resistant to disease caused by Xoo. Here we describe our validated and efficient methods for inoculation of Xoo and disease scoring.
Keywords: Xanthomonas oryzae pv. oryzae Bacterial blight Leaf clipping method Inoculation Growth rate Plant-pathogen interactions
Background
Bacterial blight is a vascular disease starting with Xanthomonas oryzae pv. oryzae (Xoo) invasion of rice leaves through wounds, opening and hydathodes at the leaf tip and margin (Niño-Liu et al., 2006). After multiplying in the intercellular spaces of underlying epitheme, Xoo enters and spreads into the rice plant through the xylem, causing long, grey to white, opaque necrotic lesions. The lesion length and bacterial growth rate can be taken as a measure of the progression of blight disease (Mew, 1984; Niño-Liu et al., 2006). Appropriate artificial inoculation methods and assessment of disease occurrence are necessary to investigate the nature of the disease and plant strategies to defend the pathogen. Mew (1984) has briefly summarized several artificial Xoo inoculation methods that include needle-pricking, spraying, and leaf clipping, or dipping of non-leaf parts of rice with bacterial suspension. Leaf clipping method was originally developed by Kauffman et al. (1973), which enables crosscut veins to be exposed to Xoo suspension by cutting off leaf tips with Xoo suspension infected scissors. Our laboratory has found that leaf clipping method is an effective and simple method, and appropriate to the natural infection of Xoo.
Materials and Reagents
Filter paper (Whatman)
Petri dishes (9 cm diameter) (ASONE)
Cultivated land soil
Compound fertilizer (N: 15%; P: 15%; K: 15%)
Kimwipe (Kimberly-Clark)
1.5 ml Eppendorf tube (Eppendorf)
10 ml and 50 ml tubes (BD Falcon)
Tips (200 μl and 1,000 μl) (Axygen)
Xanthomonas oryzae pv. oryzae (Xoo) stocks (provided by International Rice Research Institute/IRRI)
Note: The Xoo strains are maintained as glycerol stock in -80 °C for long term storage. Every strain should be retrieved on a peptone sucrose agar (PSA) plate.
Rice (Oryza sativa subsp. indica) seeds (rice variety IR24, provided by IRRI’s International Rice Genebank)
Sterilized water (Milli-Q)
Ethanol (Sigma-Aldrich, catalog number: 24102 )
Note: This product has been discontinued.
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Peptone (Sigma-Aldrich, catalog number: P4963 )
L-Glutamic acid (Sigma-Aldrich, catalog number: G5667 )
Sucrose (Sigma-Aldrich, catalog number: V900116 )
Agar (Sigma-Aldrich, catalog number: 17209 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: P5958 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Peptone sucrose agar (PSA) solid media (see Recipes)
1 M MgCl2 stock solution (see Recipes)
Equipment
Ruler, scissors, tweezers, mortar and pestle
Pipette (Eppendorf)
Precision balance (Mettler-Toledo, model: ME303TE )
Growth chamber for rice seed germination (Conviron, model: ACT 26 )
Incubation chamber (28 °C) for Xoo growth (Biolab Scientific, model: BIFG-101 )
Spectrophotometer (Beckman Coulter, model: DU-640 )
Greenhouse capable of temperature and humidity control for growing rice plants
Procedure
Preparation of rice materials
Sow rice seeds (at least 20 seeds per genotype) on a piece of filter paper in each Petri dish with appropriate volume of sterile water and place all the Petri dishes in an incubation chamber (14 h light and 10 h dark photoperiod, at 28-36 °C) for one week.
Transplant the one-week-old seedlings into pots (20 cm in diameter and 30 cm in height) containing 80% volume of cultivated land soil (two seedlings per pot). Water the plants every two days and fertilize the plants every two weeks.
Preparation of Xoo
Grow Xoo by transferring 50 μl of Xoo stock from -80 °C (Figure 1A) to a solid PSA media (see Recipes) (Figure 1B) and incubate at 28 °C for three days until a biofilm is formed (Figure 1C) for Xoo activation. The activated Xoo strain can be stored at 4 °C for up to four weeks.
Two days before inoculating rice plants, subculture of Xoo by transferring activated Xoo from the original solid PSA media to a new solid PSA media and incubating at 28 °C for an additional two days (Figure 1D).
At the day of inoculation, suspend Xoo from the most recent solid PSA media in 10 mM sterilized MgCl2 solution (see Recipes) (pH = 7.0) to OD600 = 0.5 (Figure 1E).
Figure 1. Xoo preparation. Spread 50 μl Xoo stock solution (A) to a solid PSA media (B) and incubate at 28 °C for three days until a biofilm is formed (C). Two days before inoculation, transfer Xoo from (B) to a new solid PSA media and incubate at 28 °C for two days (D). At the day of inoculation, make Xoo suspension by diluting Xoo to an OD600 of 0.5 from (D) with 10 mM MgCl2 (E).
Inoculation of rice with Xoo and disease scoring
Inoculation of rice leaves by leaf clipping method. Dip scissor tips into the Xoo suspension (Figure 2B) and cut the leaf tip (approximately 2-3 cm for seedling plants and 4-5 cm for adult plants) away from the leaf (Figures 2C and 2D). Plants were grown at 28-32 °C (light, 12 h), 28-32 °C (dark, 12 h), 90% relative humidity.
Notes:
Clip one to two leaves with one pair of dipped scissor tips into the Xoo suspension for one time.
For statistical analyses of infectious disease, inoculate more than ten leaves per plant and obtain at least five data points for the lesion length.
Rice plants can be transferred into a growth chamber for inoculation.
Cut the tip of the fully extended 1st and 2nd leaves, or just 2nd leaf of seedling plants (before tillering stage). Cut the tip of the fully extended 1st and 2nd leaves, or just 1st leaf per tiller for adult plants (tillering stage or heading stage).
Figure 2. Xoo inoculation. A. Rice plants grown in green house; B. Dipping scissor tips into the Xoo suspension; C and D. Cutting the leaf tip away from the leaf.
Xoo growth rate (Figure 3)
Sample 6 cm-length leaf fragment every two days until to 14 days (Figure 3A).
Note: At day 0, harvest samples at 30 min after inoculation. For later time points, discard the thoroughly blight part close to the inoculated site (Xoo is a biotrophic bacterium and does not exist in the thoroughly blight part where is dead leaf tissue; the discarded part should not contain any green tissue) and harvest 6 cm-length leaf fragment next to the inoculated site.
The surface of the leaf fragment are sterilized by immersing in 75% ethanol for 1 min (Figure 3C). Dry the leaf fragment with sterilized Kimwipe.
Note: The scissors and tweezers are sterilized by immersing in 75% ethanol before use (Figure 3B).
Cut the leaf fragment into a mortar and grind the sample to homogenize with 1 ml sterilized water.
Take 100 μl homogenate from the mortar to a 1.5 ml tube (tube 1) containing 900 μl sterilized water and mix thoroughly.
Take 100 μl diluted homogenate from the tube 1 to a new 1.5 ml tube (tube 2) containing 900 μl sterilized water and mix thoroughly. Repeat this step for several times until to tube n with appropriate dilution.
Take 100 μl diluted homogenate from each of the diluted tubes and spread on PSA solid media. Incubated at 28 °C for 2-3 days until obvious colonies formed (Figure 3D).
Calculate the number of bacteria on three serial dilution plates which have measurable colonies formation individually. For statistical analysis of bacteria, take tube n as an example. N = (Nn-2 x 10n-1 + Nn-1 x 10n + Nn x 10n+1)/3 (N, colony forming unit on the selected 6 cm-length leaf fragment; Nn-2 to Nn represent bacteria colonies from three serial dilution plates corresponding to tube n-2 to tube n, respectively; 10n-1 to 10n+1 represent dilution times corresponding to tube n-2 to tube n).
Notes:
At least calculate three plates and take an average for the number of bacteria of a selected 6 cm-length leaf fragment from one leaf.
For each time point, at least three leaves from three different plants were collected for biological replicates.
Figure 3. Procedure of Xoo dilution and growth. A and B. Take a 6 cm-length leaf fragment next to the inoculated site with pretreated scissors and tweezers. C. Immerse the leaf fragment into 75% ethanol for 1 min for surface sterilization. D. After being dried, cut the leaf fragment and grind the sample to homogenize with 1 ml sterilized water, and take 100 μl homogenate to a new 1.5 ml tube containing 900 μl sterilized water and mix thoroughly. Repeat this step for several times until to tube n with appropriate dilution. Take 100 μl diluted homogenate from each of the diluted tubes and spread on PSA solid media. Incubated at 28 °C for 2-3 days until obvious colonies formed.
Score the disease by measuring the lesion length at one week (for seedling stage) or two weeks (for adult stage) after inoculation (Figure 4).
Figure 4. Disease scoring. Two weeks after inoculation lesions developed on inoculated leaves. The disease was scored by measuring the lesion length. The lesion length is the length from inoculation site to the edge of thoroughly blight leaf middle veins.
Preparation of Xoo stocks
Pick several colonies from PSA solid media streaked with diluted homogenate to 10 ml tubes containing 3 ml PSA liquid medium (one colony per tube) and incubate at 28 °C for two days.
Transfer 100 μl liquid culture into a new 1.5 ml tube and add the same volume of 50% sterilized glycerol, then mix and store at -80 °C.
Data analysis
Data analysis see Yuan et al. (2016).
Recipes
Peptone sucrose agar (PSA) solid media (1 L)
10 g peptone
1 g L-glutamic acid
10 g sucrose
Dissolve the above gradients in 900 ml sterile distilled H2O and adjust the pH of the medium to 7.0 using 1 N KOH and bring volume up to 1 L. Add 20 g agar and autoclave at 121 °C for 30 min
1 M MgCl2 stock solution
Dissolve 203.3 g MgCl2·6H2O in 800 ml sterile H2O and adjust the volume to 1 L and sterilize by autoclaving for 30 min at 121 °C
Acknowledgments
This work was supported by grants from the National Natural Science Foundation of China (31371926, 31501618). The protocol was adapted from Yuan et al. (2016).
References
Kauffman, H. E., Reddy, A. P. K., Hsieh, S. P. Y and Merca, S. D. (1973). An improved technique for evaluating resistance of rice varieties to Xanthomonas oryzae. Plant Dis Rep 57(6): 537-541.
Mew, T. W. (1984). Scanning electron microscopy of virulent and avirulent strains of Xanthomonas campestris pv. oryzae on rice leaves. Phytopathology 74(6):635-641.
Niño-Liu, D. O., Ronald, P. C. and Bogdanove, A. J. (2006). Xanthomonas oryzae pathovars: model pathogens of a model crop. Mol Plant Pathol 7(5): 303-324.
Yuan, M., Ke, Y., Huang, R., Ma, L., Yang, Z., Chu, Z., Xiao, J., Li, X. and Wang, S. (2016). A host basal transcription factor is a key component for infection of rice by TALE-carrying bacteria. Elife 5: e19605.
Copyright: Ke et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Ke, Y., Hui, S. and Yuan, M. (2017). Xanthomonas oryzae pv. oryzae Inoculation and Growth Rate on Rice by Leaf Clipping Method. Bio-protocol 7(19): e2568. DOI: 10.21769/BioProtoc.2568.
Yuan, M., Ke, Y., Huang, R., Ma, L., Yang, Z., Chu, Z., Xiao, J., Li, X. and Wang, S. (2016). A host basal transcription factor is a key component for infection of rice by TALE-carrying bacteria. Elife 5.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > Bacterium
Cell Biology > Cell isolation and culture > Co-culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,569 | https://bio-protocol.org/exchange/protocoldetail?id=2569&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Xyloglucan Composition in Arabidopsis Leaves
Javier Sampedro
CG Cristina Gianzo
EG Esteban Guitián
GR Gloria Revilla
IZ Ignacio Zarra
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2569 Views: 5598
Edited by: Marisa Rosa
Reviewed by: Lifeng LiuHarrie van Erp
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Xyloglucan is one of the main components of the primary cell wall in most species of plants. This protocol describes a method to analyze the composition of the enzyme-accessible and enzyme-inaccessible fractions of xyloglucan in the model species Arabidopsis thaliana. It is based on digestion with an endoglucanase that attacks unsubstituted glucose residues in the backbone. The identities and relative amounts of released xyloglucan fragments are then determined using MALDI-TOF mass spectrometry.
Keywords: Xyloglucan Arabidopsis Cell wall Hemicellulose Primary wall MALDI-TOF
Background
In many flowering plants xyloglucan is a major component of primary cell walls, where it plays an important role in growth regulation. Sequential extraction protocols offer a way of separating distinct xyloglucan domains (Pauly et al., 1999). Some xyloglucan appears to be trapped inside cellulose microfibrils while another fraction is bound to their surface through hydrogen bonding. The rest of the xyloglucan, possibly the majority of it, occupies the space between microfibrils (Park and Cosgrove, 2015). Part of this later xyloglucan can be extracted through direct endoglucanase digestion of cell wall material. Much of the remaining xyloglucan can then be released through alkaline treatment. Studies of mutants deficient in xyloglucan exoglycosidases have shown that these enzymes, together with Xyloglucan Endotransglycosylases/Hydrolases, act mostly on the enzyme-accessible fraction (Sampedro et al., 2010; Günl and Pauly, 2011; Günl et al., 2011; Sampedro et al., 2012; Sampedro et al., 2017). Digestion of Arabidopsis xyloglucan with endoglucanases that attack unsubstituted glucose residues results in a mixture of three and four-glucose subunits that can be quickly and easily analyzed through MALDI-TOF mass spectrometry (Lerouxel et al., 2002; Günl et al., 2010). The area of the ion peaks can be then used to quantify the abundance of the different fragment, although there is evidence of significant differences in response factors (Tuomivaara et al., 2015). This protocol incorporates some changes from our previous versions, such as the use of SDHB (Super-DHB) matrix, which reduces the noise, and the addition of NaCl during extraction to prevent the formation of potassium adducts.
Materials and Reagents
Pipette tips (2 μl, 200 μl, 1,000 μl)
1.5 ml microcentrifuge tubes
Centrifugal filters, modified PES, 10K (VWR, catalog number: 82031-348 )
200 μl PCR tubes
Mature Arabidopsis leaves (2 or 3 leaves)
Liquid nitrogen
Ethanol (Merck, catalog number: 1.00983 )
Type II purified water
Acetone (Sigma-Aldrich, catalog number: 179973 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Cellulase suspension from Trichoderma longibrachiatum (Megazyme, catalog number: E-CELTR )
Pyridine (VWR, catalog number: 27199.292 )
Thimerosal (Sigma-Aldrich, catalog number: T5125 )
Sodium hydroxide (NaOH) (Merck, catalog number: 106469 )
Acetic acid (AppliChem, catalog number: 141008.1611 )
2,5-Dihydroxybenzoic acid (Sigma-Aldrich, catalog number: 39319 )
2-Hydroxy-5-methoxybenzoic acid (Sigma-Aldrich, catalog number: 146188 )
Acetonitrile (Merck, catalog number: 1.00029 )
Xyloglucan oligosaccharide mixture (Megazyme, catalog number: O-XGHON )
Digestion buffer (see Recipes)
Super-DHB (SDHB) matrix (see Recipes)
Equipment
Variable volume single channel manual pipettes (0.2 to 2 μl, 2 to 20 μl, 10 to 100 μl, 100 to 1,000 μl)
Pellet pestles (Sigma-Aldrich, catalog number: Z359947 )
Bench pillar drill, 250 W
Insulation foam block
Polycarbonate cover
Dry block heater
Vortexer
Microcentrifuge (Eppendorf, model: 5424 )
SpeedVac System (Thermo Fisher Scientific, Thermo ScientificTM, model: SavantTM SC210 P1 )
Ultrasonic bath
Orbital shaker
MALDI target plate (Bruker, model: MTP 384 ground steel TF, catalog number: 8209519 )
Mass spectrometer (Bruker, model: UltraFlex III MALDI-TOF/TOF )
Software
Flex Analysis Version 3.0 (Bruker)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Sampedro, J., Gianzo, C., Guitián, E., Revilla, G. and Zarra, I. (2017). Analysis of Xyloglucan Composition in Arabidopsis Leaves. Bio-protocol 7(19): e2569. DOI: 10.21769/BioProtoc.2569.
Sampedro, J., Valdivia, E. R., Fraga, P., Iglesias, N., Revilla, G. and Zarra, I. (2017). Soluble and membrane-bound β-glucosidases are involved in trimming the xyloglucan backbone. Plant Physiol 173(2): 1017-1030.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Xyloglucan
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
257 | https://bio-protocol.org/exchange/protocoldetail?id=257&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein-RNA ELISA Assay
Vanesa Olivares Illana
RF Robin Farhaeus
Published: Vol 2, Iss 17, Sep 5, 2012
DOI: 10.21769/BioProtoc.257 Views: 14144
Original Research Article:
The authors used this protocol in Jan 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2012
Abstract
Protein-RNA ELISA assay is an effective and quantitative method to study protein-RNA interactions in vitro. In this protocol we used recombinant 6x HIS tagged protein, but it works as well for non tagged proteins.
Keywords: RNA Protein Interaction RNA-ELISA
Materials and Reagents
96-well Microplate Nunc maxisorp White (Thermo Fisher Scientific, Nunc, catalog number: 436110 )
Recombinant 6x HIS tagged protein
Streptavidin (New England Biolabs, catalog number: N7021S )
NaHCO3
Phosphate buffered saline (PBS) (Life Technologies, Gibco®, catalog number: 10010031 )
Tween 20
BSA
Biotinylated RNA
1 M Tris (pH 7.5)
NaCl
Yeast tRNA (Life Technologies, Applied Biosystems®, catalog number: AM7119 )
6x His mAb-HRP Conjugate (Clontech, catalog number: 631210 )
ECL Peroxidase Substrate Solution A and B (Pierce Antibodies, catalog number: 32106 )
Water used for all solution is RNAase free
q-PCR tape (R&D systems, catalog number: DY992 )
RiboLoc RNAase Inhibitor (Thermo Fisher Scientific, catalog number: EO0381 )
RNA 3' End Biotinylation Kit (Pierce Antibodies, catalog number: 20160 )
Binding buffer (see Recipes)
PBS-T (see Recipes)
Equipment
Luminescence Plate reader (BMG LABTECH, FLUOstar OPTIMA)
Thermocycler
Centrifuges
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Immunodetection
Biochemistry > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,570 | https://bio-protocol.org/exchange/protocoldetail?id=2570&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Scanning Electron Microscopy of Motile Male Gametes of Land Plants
KR Karen Sue Renzaglia
Renee A. Lopez
SS Steven J. Schmitt
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2570 Views: 7535
Edited by: Scott A M McAdam
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
The only motile cells produced in land plants are male gametes (spermatozoids), which are reduced to non-flagellated cells in flowering plants and most gymnosperms. Although a coiled architecture is universal, the complexity of land plant flagellated cells varies from biflagellated in bryophytes to thousands of flagella per gametes in the seed plants Ginkgo and cycads. This wide diversity in number of flagella is associated with vast differences in cell size and shape. Scanning electron microscopy (SEM) has played an important role in characterizing the external form, including cell shape and arrangement of flagella, across the varied motile gametes of land plants. Because of the size and scarcity of released swimming sperm, it is difficult to concentrate them and prepare them for observation in the SEM. Here we detail an SEM preparation technique that yields good preservation of sperms cells across plant groups.
Keywords: Flagella Male gamete Scanning electron microscopy Spermatozoid
Background
Motile gametes of land plants are strikingly diverse and develop through transformations that involve repositioning cellular components and the assembly of a complex locomotory apparatus (Renzaglia and Garbary, 2001). Because of constraints imposed by cell walls, elongation of the cell and flagella is around the periphery of a nearly spherical space, resulting in a coiled configuration of the mature gamete. The degree of coiling varies from just over one to as many as 10 revolutions per cell. The number of flagella per gamete is even more variable, ranging from two in bryophytes (mosses, hornworts, and liverworts) to an estimated 1,000-40,000 in Ginkgo and cycads. Following the diversification of Ginkgo and cycads, all vestiges of basal bodies and flagella were lost in the remaining seed plants that utilize pollen tubes to deliver non-motile sperm to egg cells (Southworth and Cresti, 1997). Male gametes provide a wealth of biological information, including biodiversity and cell differentiation and evolution (Garbary et al., 1993; Renzaglia et al., 1995; Renzaglia and Garbary, 2001; Renzaglia et al., 2000; Lopez-Smith and Renzaglia, 2008; Lopez and Renzaglia, 2014). Of the range of microscopic techniques utilized to characterize plant spermatozoids, SEM provides the most direct means of elucidating cell shape, and flagella number, length and arrangement. Together with TEM observations, SEM studies lead to comparative descriptions of gamete architecture, and organellar content and arrangement across plant lineages (Renzaglia et al., 2001 and 2002; Lopez-Smith and Renzaglia, 2008).
Materials and Reagents
Scanning Electron Microscopy (SEM) and the motile sperm cell architecture
Pipette tips 1-200 µl (Carolina Biological Supply, catalog number: 215055 )
Pasteur pipettes (Fisher Scientific, catalog number: 13-678-4)
Manufacturer: Corning, catalog number: C7095B5X .
1.5-ml centrifuge tubes (USA Scientific, catalog number: 1615-5500 )
Glass coverslips 22 x 22 mm (Fisher Scientific, catalog number: 12-542B )
Male plants with mature sperm cells
Pellia epiphylla
Conocephalum conicum
Equisetum arvense
Ceratopteris richardii
Sorensens phosphate buffer, 0.2 M, pH 7.2 (Electron Microscopy Sciences, catalog number: 11600-10 )
Glutaraldehyde (Electron Microscopy Sciences, catalog number: 16120 )
Sodium cacodylate buffer, 0.2 M, pH 7.4 (Electron Microscopy Sciences, catalog number: 11652 )
Osmium tetroxide (Electron Microscopy Sciences, catalog number: 19150 )
Ethanol (Decan Laboritories, catalog number: 2705HC )
Hexamethyl disilizane (HMDS) (Electron Microscopy Sciences, catalog number: 16700 )
0.01 M phosphate buffer (pH 7.2) (see Recipes)
0.05 M phosphate buffer (pH 7.2) (see Recipes)
0.02 M phosphate buffer (pH 7.2) (see Recipes)
2.5% glutaraldehyde (see Recipes)
0.05 M sodium cacodylate buffer (pH 7.2) (see Recipes)
2% aqueous osmium tetroxide (see Recipes)
Equipment
Scanning electron microscope (SEM) (FEI, model: QuantaTM 450 FEG )
Shaker (Thermolyne, model: M-16715 )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: mySPINTM 6 , catalog number: 75004061)
Oven (General Signal, model: Gravity convection )
SEM Specimen Mount Stubs, Aluminum Slotted Head (Electron Microscopy Sciences, catalog number: 75220 )
Samdri 790 Critical Point Dryer (Tousumis)
Sputter coater (Denton Vacuum, model: Desk V )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Renzaglia, K. S., Lopez, R. A. and Schmitt, S. J. (2017). Scanning Electron Microscopy of Motile Male Gametes of Land Plants. Bio-protocol 7(19): e2570. DOI: 10.21769/BioProtoc.2570.
Renzaglia, K. S., Villarreal, J. C., Piatkowski, B. T., Lucas, J. R. and Merced, A. (2017). Hornwort Stomata: Architecture and Fate Shared with 400-Million-Year-Old Fossil Plants without Leaves. Plant Physiol 174(2): 788-797.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Electron microscopy
Plant Science > Plant cell biology > Cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,571 | https://bio-protocol.org/exchange/protocoldetail?id=2571&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DQ-Red BSA Trafficking Assay in Cultured Cells to Assess Cargo Delivery to Lysosomes
Rituraj Marwaha
Mahak Sharma
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2571 Views: 24423
Edited by: Pengpeng Li
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Lysosomes are the terminal end of the endocytic pathway having acidic environment required for active hydrolases that degrade the cargo delivered to these compartments. This process of cargo delivery and degradation by endo-lysosomes is a tightly regulated process and important for maintaining cellular homeostasis. Cargos like EGF (Epidermal Growth Factor), Dil-LDL (3,3’-Dioctadecylindocarbocyanine-Low Density Lipoprotein), Dextran, DQ-BSA (Dye Quenched-Bovine Serum Albumin) etc., are routinely used by researchers to analyze the role of various proteins in endocytic pathway. Trafficking of DQ-BSA in cells depleted of or over-expressing the gene of interest is a useful assay for identifying the role of various proteins in endocytic trafficking pathway. The protocol describes the DQ-Red BSA trafficking assay that can be used to study endocytic trafficking in various cell types.
Keywords: DQ-BSA Lysosome Cargo Endocytosis Cell culture HeLa
Background
Cells are constantly exchanging materials with their extracellular environment and in this process they internalize cargo in vesicles at the plasma membrane. This internalized cargo is delivered to the early endosomes from where it either goes back to the plasma membrane via recycling endosomes or enters the canonical endocytic pathway. Once destined to be degraded, the cargo moves to late endosomes and finally fuses with lysosomes where the active hydrolases digest the cargo (Jovic et al., 2010). These endocytic compartments have characteristic pH of their lumen. The early endosomes have a pH in the range of 5.9-6.8, late-endosomes have pH range of 4.9-6.0, and lysosomes are most acidic with pH ranging from 4.5-5.0 (Maxfield and Yamashiro, 1987). The acidic environment of lysosomes is necessary for the activity of hydrolases present in its lumen and degradation of cargo (Garg et al., 2011; Khatter et al., 2015a and 2015b).
Here we discuss the trafficking assay using DQ-Red BSA as cargo, which is a BSA (bovine serum albumin) derived cargo heavily labeled with BODIPY TR-X dye, resulting in self quenching of the dye. Degradation of DQ-Red BSA in acidic, hydrolase active endo-lysosomes results in smaller protein fragments that have isolated fluorophores, hence de-quenching the dye that can be visualized as a bright fluorescence in cells. The excitation and emission maxima for this dye are ~590 nm and ~620 nm respectively. Trafficking of DQ-Red BSA can be used to study the delivery of cargo to lysosomes (Pols et al., 2013; Marwaha et al., 2017; see Figure 1). Under normal conditions, DQ-Red BSA traffics to lysosomes and is cleaved by lysosomal hydrolases, resulting in bright red fluorescent signal (Figure 2). Disruption of cargo delivery to lysosomes such as by depletion of a certain gene product or treatment with chemical inhibitors (such as Bafilomycin A) impairs proteolysis of DQ-Red BSA and thus weak or no fluorescence is observed (see Figure 3).
Figure 1. Schematic representation of DQ-Red BSA cargo uptake and processing in cells. DQ-Red BSA is endocytosed in cells and traffics through early endosomes to late endosomes which then fuse with acidic hydrolase containing lysosomes. This leads to the formation of endo-lysosomes that degrade DQ-Red BSA, de-quenching the fluorescence of the dye attached to this cargo. DQ-Red BSA is heavily labeled with fluorescent dyes that lead to quenching of their fluorescence (shown by pink fluorophores attached to the cargo). Once DQ-Red BSA has reached the degradative endo-lysosomes, the cargo is broken down into smaller fragments which lead to the de-quenching of the fluorophores (shown as bright red spots in endo-lysosomes).
Figure 2. De-quenching of DQ-Red BSA fluorescence at different time points post endocytosis. Representative single-plane confocal micrographs of HeLa cells showing fluorescence (red signal) of DQ-Red BSA after an uptake of 1 h (A) and 6 h (B) time points. At the end of the uptake time point, cells were fixed and stained with DAPI (blue) to mark the cell nucleus. A bright fluorescence punctae of DQ-Red BSA is visible post 6 h uptake as compared to 1 h, indicating its delivery to acidic compartments of the cell. Scale bars = 10 µm.
Figure 3. DQ-BSA uptake and delivery to lysosomes. Representative single-plane confocal micrographs of HeLa cells incubated with DQ-Red BSA in 1% serum containing media for indicated time point in the absence (A) or presence (B) of 100 nM Bafilomycin A1, a V-ATPase inhibitor that disrupts lysosome fusion. The cell nucleus is stained using DAPI (blue). Scale bars = 10 µm.
Materials and Reagents
Coverglass slips (VWR, catalog number: 89015-725 )
BD Falcon15 ml centrifuge tubes (Corning, Falcon®, catalog number: 352096 )
BD Falcon 35 mm cell culture dish (Corning, Falcon®, catalog number: 353001 )
24-well plate (Corning, Falcon®, catalog number: 353226 )
Glass slide (HiMedia Laboratories, catalog number: CG029 )
HeLa cells (ATCC, catalog number: CCL-2 )
siRNA (Dharmacon)
Xtremegene HD transfection reagent (Roche)
DMEM (Lonza, catalog number: 12-604F )
NEAA (Thermo Fisher Scientific, GibcoTM, catalog number: 11140050 )
GlutaMax (Thermo Fisher Scientific, GibcoTM, catalog number: 35050061 )
HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
DQ-Red BSA (Thermo Fisher Scientific, InvitrogenTM, catalog number: D12051 )
DAPI (Thermo Fisher Scientific, InvitrogenTM, catalog number: D1306 )
HI FBS (Thermo Fisher Scientific, GibcoTM, catalog number: 10082147 )
1x DPBS (Lonza, catalog number: 17-512F )
16% paraformaldehyde (PFA) (Electron Microscopy Sciences, catalog number: 15700 )
Fluoromount G (Southern Biotech, catalog number: 0100-01 )
Stock solution of DQ-Red BSA (see Recipes)
DAPI stock solution (see Recipes)
Equipment
CO2 incubator (Eppendorf, New BrunswickTM, model: Galaxy® 170 R )
Confocal microscope (ZEISS, model: LSM 710 )
Software
ImageJ software (NIH)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Marwaha, R. and Sharma, M. (2017). DQ-Red BSA Trafficking Assay in Cultured Cells to Assess Cargo Delivery to Lysosomes. Bio-protocol 7(19): e2571. DOI: 10.21769/BioProtoc.2571.
Marwaha, R., Arya, S. B., Jagga, D., Kaur, H., Tuli, A. and Sharma, M. (2017). The Rab7 effector PLEKHM1 binds Arl8b to promote cargo traffic to lysosomes. J Cell Biol 216(4): 1051-1070.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Confocal microscopy
Cell Biology > Cell-based analysis > Cytosis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,572 | https://bio-protocol.org/exchange/protocoldetail?id=2572&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Teased Nerve Fibers from Rat Sciatic Nerve
JW Jinkun Wen
LL Lixia Li
DT Dandan Tan
JG Jiasong Guo
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2572 Views: 11103
Reviewed by: Alexandros Kokotos
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Compared to tissue sectioning techniques, the technique of teasing single nerve fibers provides a better way to understand the structures of myelin sheaths and axons of the peripheral myelinated nerves. This protocol describes a method for preparation of teased single nerve fibers from rat sciatic nerve. In this protocol, fixed nerves are teased into single individual fibers and arranged onto adhesion microscope slides for further immuno-staining.
Keywords: Peripheral nerve Single nerve fiber Tease Myelin Axon Immuno-staining
Background
Schwann cells in the peripheral nervous system wrap around axons to form insulated myelin sheaths that allow the rapid conduction of action potentials. The remarkable multi-layered myelin sheath consists of elaborate structures including compact sheath, Schmidt-Lanterman incisures, Cajal bands, inner and outer mesaxons, as well as the structures in the paranodal region. To elucidate the normal and abnormal structures of myelinated fibers of peripheral nerves, teased nerve fibers are required. Methods of teasing fibers have been widely applied in studies on peripheral nerves of human and rodents. In this protocol, we describe a method of teasing peripheral nerves into single fibers for further morphological studies on the axons or myelin of peripheral nerves.
Materials and Reagents
Adhesion microscope slides (CITOTEST LABWARE MANUFACTURING, catalog number: 80312-3161-16 )
Note: These slides with special treatment process that electrostatically adheres tissue to the glass without the need for adhesives or protein coatings.
Cover slips (CITOTEST LABWARE MANUFACTURING, catalog number: 80342-1130 )
Cell culture dish (100 x 10 mm) (Corning, catalog number: 430167 )
Animal: 4-month-old Sprague Dawley (SD) rat
Chloral hydrate (Sinopharm Chemical Reagent, catalog number: 30037517 )
Sodium chloride (NaCl) (Guangdong Guanghua Sci-Tech, catalog number: 1.01307.040 )
Paraformaldehyde (PFA) (Guangdong Guanghua Sci-Tech, catalog number: 1.17767.014 )
Phosphate-buffered saline (PBS) (Beyotime Biotechnology, catalog number: C0221A )
Triton X-100 (Sigma-Aldrich, catalog number: V900502 )
Gelatin (Sigma-Aldrich, catalog number: G7041 )
Anti-S100 Protein antibody, clone 15E2E2, produced in mouse (S100) (Merck, catalog number: MAB079-1 )
Anti-Neurofilament 200 antibody produced in rabbit (NF) (Sigma-Aldrich, catalog number: N4142 )
Alexa Fluor® 488 goat anti-mouse IgG (H+L) (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11001 )
Alexa Fluor® 568 goat anti-rabbit IgG (H+L) (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11011 )
TWEEN® 20 (Sigma-Aldrich, catalog number: P1379 )
4,6-Diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, catalog number: D9542 )
Mounting medium for fluorescence (Vector Laboratories, catalog number: H-1000 )
10% chloral hydrate (see Recipes)
0.9% NaCl (see Recipes)
4% PFA (see Recipes)
0.1% Triton X-100 (see Recipes)
Blocking buffer (see Recipes)
PBST (see Recipes)
1,000x DAPI (see Recipes)
Equipment
Dissecting scissors and forceps (see Figure 1A)
Perfusion pump (Longer, catalog number: BT300-1F )
Spring scissors (66 Vision Tech, catalog number: 54053B ) (see Figure 2A)
Fine forceps (Fine Science Tools, Dumont, model: #5SF, catalog number: 11252-00 , see Figure 2A)
Black wet chamber (Leibusi, catalog number: 340012 )
Note: The wet chamber (Leibusi, catalog number: 340012 ) was made by a local workshop.
Stereomicroscope (Olympus, catalog number: SZ61 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wen, J., Li, L., Tan, D. and Guo, J. (2017). Preparation of Teased Nerve Fibers from Rat Sciatic Nerve. Bio-protocol 7(19): e2572. DOI: 10.21769/BioProtoc.2572.
Download Citation in RIS Format
Category
Neuroscience > Peripheral nervous system > Sciatic nerve
Neuroscience > Cellular mechanisms > Myelin
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,573 | https://bio-protocol.org/exchange/protocoldetail?id=2573&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Accurate, Streamlined Analysis of mRNA Translation by Sucrose Gradient Fractionation
Soufiane Aboulhouda
Rachael Di Santo
GT Gabriel Therizols
DW David Weinberg
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2573 Views: 12813
Edited by: Pengpeng Li
Reviewed by: Liang LiuSonali Chaturvedi
Original Research Article:
The authors used this protocol in Oct 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2016
Abstract
The efficiency with which proteins are produced from mRNA molecules can vary widely across transcripts, cell types, and cellular states. Methods that accurately assay the translational efficiency of mRNAs are critical to gaining a mechanistic understanding of post-transcriptional gene regulation. One way to measure translational efficiency is to determine the number of ribosomes associated with an mRNA molecule, normalized to the length of the coding sequence. The primary method for this analysis of individual mRNAs is sucrose gradient fractionation, which physically separates mRNAs based on the number of bound ribosomes. Here, we describe a streamlined protocol for accurate analysis of mRNA association with ribosomes. Compared to previous protocols, our method incorporates internal controls and improved buffer conditions that together reduce artifacts caused by non-specific mRNA–ribosome interactions. Moreover, our direct-from-fraction qRT-PCR protocol eliminates the need for RNA purification from gradient fractions, which greatly reduces the amount of hands-on time required and facilitates parallel analysis of multiple conditions or gene targets. Additionally, no phenol waste is generated during the procedure. We initially developed the protocol to investigate the translationally repressed state of the HAC1 mRNA in S. cerevisiae, but we also detail adapted procedures for mammalian cell lines and tissues.
Keywords: Translation Gene regulation Ribosome Polysome analysis Sucrose gradient fractionation Reproducibility
Background
The translation of mRNA into protein is a highly regulated process that can occur at different rates depending on the gene, cellular context, or environment. Each step of translation–initiation, elongation, and termination–can be a point of regulation that ultimately affects the number of ribosomes associated with an mRNA (Dever and Green, 2012; Hinnebusch and Lorsch, 2012). Because the time between consecutive initiation events is usually shorter than the time required for elongation, most mRNAs are associated with more than one ribosome at a time to form ‘polysome’ structures (Warner et al., 1963). Thus, the ability to count the number of ribosomes per mRNA molecule provides an assay for the overall translation state of mRNA. Traditionally, this counting has been achieved by sucrose gradient fractionation (also sometimes called polysome analysis), in which mRNAs are separated by ultracentrifugation based on their size/shape and then quantified (Mašek et al., 2011). The detection of mRNAs in gradient fractions can either be done for individual mRNAs by RNA blotting or qRT-PCR, or for the entire transcriptome by microarrays or high-throughput RNA sequencing (Arava et al., 2003; Floor and Doudna, 2016). In this way, the absolute number of ribosomes associated with individual mRNA molecules can be determined. An alternative method for assaying translation is ribosome-footprint profiling, in which short fragments of mRNA that are protected from RNase digestion by ribosomes are captured and subjected to high-throughput sequencing (Ingolia et al., 2009). When combined with total RNA sequencing to determine mRNA abundances, ribosome-profiling data can measure the translational efficiencies of mRNAs in a genome-wide manner. However, ribosome profiling provides only a relative measure of translational efficiency that can be biased by RNA-abundance measurements (Weinberg et al., 2016). In addition, ribosome profiling is not well suited to the study of low-abundance mRNAs or when only a small number of mRNAs are of interest. For these reasons, sucrose gradient fractionation remains an important tool for the analysis of translational efficiency.
We present an adaption of this widely used technique that incorporates key features that improve accuracy and reduce hands-on time. mRNA polysome analysis by sucrose gradient fractionation is completed in three steps: lysate preparation, sucrose gradient fractionation, and RNA-abundance analysis. Our protocol was initially developed to streamline the analysis of multiple RNAs in parallel, but in the process of protocol development we also carefully optimized each step to ensure that the assay provided an accurate and reproducible measure of ribosome association. We developed the protocol for the budding yeast S. cerevisiae (Di Santo et al., 2016) but since then have also applied it to a wide variety of human and mouse cell lines and even whole mouse tissues (Odegaard et al., 2016). A key feature of our protocol is the inclusion of heparin in the lysis buffer, which reduces non-specific interactions between mRNA and ribosomes that can otherwise lead to artefactual co-sedimentation of untranslated mRNAs with polysomes. We also incorporate a reliable control for untranslated RNA: an un-capped exogenous RNA that is spiked into the lysate prior to ultracentrifugation. For the RNA analysis step we adapted a qRT-PCR kit previously used for cell lysates to work directly with gradient fractions, thus eliminating the time-consuming RNA purification steps used in all previous polysome analysis protocols. Measuring RNA abundances directly from crude gradient fractions not only reduces time requirements and hands-on manipulations but also eliminates generation of phenol waste. Finally, to control for variations in RT-PCR efficiencies among fractions (which differ in sucrose concentration and macromolecular composition), we spike in an equal amount of artificial RNA to each fraction just after collection to serve as a normalization reference. In summary, our protocol–presented in detail below–contains a collection of improvements and internal controls that together provide an accurate, streamlined assay for polysome analysis.
Materials and Reagents
STAGE 1: Lysate preparation
Materials
Yeast
Inoculation loop (Fisher Scientific, catalog number: 22-363-604 )
50 ml conical tube (Corning, Falcon®, catalog number: 352098 )
1.5 ml siliconized G-tube (Bio Plas, catalog number: 4165SL )
0.45 micron filters (Pall, catalog number: 60206 )
Cell lifter (Corning, catalog number: 3008 )
Mammalian cells
6-well plate (Corning, catalog number: 3516 ) or 10-cm cell culture dish (Corning, catalog number: 353803 )
Cell lifter (Corning, catalog number: 3008 )
15 ml conical tube (Corning, Falcon®, catalog number: 352096 )
1.5 ml siliconized G-tube (Bio Plas, catalog number: 4165SL )
Tissues
50 ml conical tubes (Corning, Falcon®, catalog number: 352098 )
5 ml centrifuge tubes (Eppendorf, catalog number: 0030119401 )
1.5 ml siliconized G-tubes (Bio Plas, catalog number: 4165SL )
Reagents
Liquid nitrogen (LN2)
Appropriate culturing media (e.g., YPD for S. cerevisiae; DMEM, FBS and additives for mammalian cell lines)
1x phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Luciferase RNA (Promega, catalog number: L4561 )
Note: Store aliquotted 100 ng/μl stock at -80 °C.
HEPES (Sigma-Aldrich, catalog number: H4034 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: 68475 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Heparin (Sigma-Aldrich, catalog number: H3149 )
Note: Store 10 mg/ml stock solution at 4 °C.
Triton X-100 solution (Sigma-Aldrich, catalog number: 93443 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D9779 )
Note: Store filtered and aliquotted 1 M stock solution at -20 °C.
Cycloheximide (AMRESCO, catalog number: 94271 )
Superase-IN (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2696 )
Note: Store filtered and aliquotted 100 mg/ml stock solution at -20 °C.
cOmplete, mini, EDTA-free Protease Inhibitor Cocktail (Roche Diagnostics, catalog number: 11836170001 )
Sucrose (Sigma-Aldrich, catalog number: S5016 )
Note: Store solution at 4 °C, see Recipes section.
Lysis buffer (see Recipes)
10% sucrose solution (see Recipes)
50% sucrose solution (see Recipes)
STAGE 2: Sucrose gradient fractionation
Materials
50 ml SteriFlip (EMD Millipore, catalog number: SCGP00525 )
Open top polyclear centrifuge tubes (Seton Scientific, catalog number: 7030 )
SW41 marker block (included with fractionator)
60 ml syringe (BD, catalog number: 309653 )
Stainless steel syringe needle, noncoring point, ~10 inches, ~12 gauge (Sigma-Aldrich, Cadence Science, catalog number: Z116971 )
Short caps (Biocomp, catalog number: 105-514-6 )
Tube rack (Beckman Coulter, catalog number: 331313 )
2 ml tubes w/screw caps (USA Scientific, catalog number: 1420-8700 )
Cling film or Parafilm
STAGE 3: mRNA analysis
Materials
qPCR plates (RPI, catalog number: 141328 )
qPCR film (Bio-Rad Laboratories, catalog number: MSB1001 )
PCR tubes
Reagents
Cells-to-Ct kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM1728 )
Superase-In (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2696 )
XenoRNA (Thermo Fisher Scientific, InvitrogenTM, catalog number: 4386995 , part of control kit)
Note: Store in small aliquots at -80 °C.
TaqMan Gene Expression Master mix (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4369016 )
Primer/Probe qPCR assays for genes of interest (Thermo Fisher Scientific, Ac00010014_a1 (XenoRNA) and Mr03987587_mr (Luciferase))
Equipment
Pipette (e.g., P1000, P10)
250 ml baffled flask (Corning, PYREX®, catalog number: 4444-250 )
2 L baffled flask (Corning, PYREX®, catalog number: 4444-2L )
Filtration system (Restek, catalog number: KT676001-4035 )
Coors porcelain mortar and pestle (Sigma-Aldrich, catalog numbers: Z247472 and Z247510)
Manufacturer: CoorsTek, catalog numbers: 60316 and 60317 .
Dounce, tissue grinder (DWK Life Sciences, WHEATON, catalog number: 357538 ) [optional]
Tabletop cold centrifuge (Eppendorf, model: 5424 R )
SW41 Ti rotor (Beckman Coulter, model: SW 41 Ti , catalog number: 331362)
Ultracentrifuge (Beckman Coulter, model: L8-80M )
Gradient station (Biocomp, catalog number: 153-001 )
Fraction collector (Gilson, catalog number: FC 203B )
BIORAD EM-1 Econo UV monitor (Bio-Rad Laboratories, model: EM-1 EconoTM )
NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Thermo Scientific, model: NanoDropTM 2000 , catalog number: ND-2000)
CFX96 Touch Real-Time PCR detection system (Bio-Rad Laboratories, model: CFX96 TouchTM, catalog number: 1855195 )
Software
Gradient Profiler V2’ software
Procedure
The protocol is divided into three stages (see Figure 1):
Stage 1 Lysate Preparation
1A. Growth and harvesting of cells (a. yeast, b. cells lines, c. tissues)
1B. Sample preparation
Stage 2 Sucrose Gradient Fractionation
2A. Gradient preparation
2B. Ultracentrifugation
2C. Fractionation
Stage 3 mRNA Analysis
3A. DNase treatment and control RNA spike-in
3B. Reverse transcription
3C. Real-time PCR
The recommended workflow timing is:
Note: Stage 2A requires an incubation of 30-60 min and is carried out prior to Stage 1B to optimize timing.
Figure 1. Workflow schematic of the sucrose polysome gradient protocol from multiple cell types. This illustrates the overall steps of the procedure to analyze RNA distribution across a polysome gradient.
STAGE 1: Lysate Preparation
PART 1A. Growth and harvesting of cells
Yeast
Day 0
Inoculate cells from plate into 50 ml YPD in a 250 ml baffled flask.
Grow overnight to saturation.
Day 1
Dilute overnight culture into 400 ml YPD at an OD600 of 0.05 in a 2 L baffled flask.
Note: If growing multiple cultures, stagger culture growth slightly (30 min difference between first and last cultures is sufficient).
When culture reaches an OD600 of 0.5-0.6, harvest cells by rapid filtration:
1) Pour YPD on filter prior to pouring culture.
2) Pour entire culture down the side of the filtration vessel, taking care to avoid pouring foam that will collect on top of the filter.
3) As the last liquid pours through, quickly remove the clamp and top of the filter unit, scrape cells from the filter quickly but gently using a cell lifter, and submerge into conical containing liquid nitrogen. The total time between the last liquid flowing through the filter and the cells being submerged in liquid nitrogen should not exceed 5 sec.
Note: Cell scraper should be pre-chilled in liquid nitrogen.
Place conical with pellet in a -80 °C freezer and allow liquid nitrogen to boil off.
Note: Leave cap loosely tightened.
Lyse cells by grinding with a mortar and pestle.
1) Pre-chill mortar and pestle with liquid nitrogen (~2-3 min) in an ice bucket.
2) Pour out any residual LN2 from the mortar.
3) Add the cell pellet to the mortar.
4) Gently pour ~1-5 ml of LN2 on the cell pellet.
Note: Adding too much LN2 will significantly increase processing times.
5) Grind with a pestle to break apart cells until all LN2 boils off, then grind the dry powder for an additional ~1-2 min.
Note: After evaporation of all the liquid nitrogen in the mortar, the pellet reaches a powder-like consistency quickly, 1-2 min. No benefits are gained from further grinding. From experience, there are no adverse effects of grinding for too long.
6) Re-suspend the cell powder in liquid nitrogen and carefully pour back into the original conical tube.
Place the conical tube in a -80 °C freezer and allow liquid nitrogen to boil off.
Note: Leave cap loosely tightened.
Pause point.
Proceed to Stage 2A.
Mammalian cells
Day 0
Plate cells as required by experiment.
Note: The procedure has been successfully applied to various mammalian cell lines cultured in 6-well plates, 10-cm dishes, and 15-cm dishes, with a harvested range of 106 to 107 cells. Confluency at time of harvesting should be avoided by controlling plating density it is important to consider the effects of cell manipulation on translation. Over-confluence, depleted nutrients or serum, or media changes can induce quick translational responses. Using a stable cell line is recommended over transiently transfected cells to ensure reproducibility.
Incubate cells under optimal growth conditions.
Day 1
Add cycloheximide (CHX) to media at a final concentration of 100 μg/ml, incubate for 10 min at 37 °C. This step can be omitted .
Note: While CHX pre-treatment in growth media is optional, we recommend adding CHX to the PBS and lysis buffer to prevent ribosome run-off during harvesting.
Pre-chill PBS and lysis buffer on ice and add additives (see Recipes).
Transfer tissue culture dish to an ice bucket.
Aspirate media.
Wash the dish twice with 10 ml ice-cold PBS.
Scrape cells thoroughly and quickly in 5 ml of ice-cold PBS.
Transfer cell suspension to a 15 ml conical tube.
Centrifuge for 5 min at 4 °C at 500 x g, discard supernatant.
Flash freeze cell pellet and store at -80 °C.
Proceed to Stage 2A.
Mammalian tissue
Day 0
Dissect out a whole tissue sample.
Wash tissue with ice-cold PBS prior to freezing in liquid nitrogen.
Day 1
Break apart and lyse tissue by grinding with a mortar and pestle.
1) Pre-chill mortar and pestle with liquid nitrogen (~2-3 min) in an ice bucket.
2) Pour out any residual LN2 from the mortar.
3) Add the frozen tissue to the mortar.
4) Pour ~1-5 ml of LN2 on the frozen tissue.
Note: Adding too much LN2 will significantly increase processing times.
5) Grind with a pestle to break apart cells until all LN2 boils off, then grind the dry powder for an additional ~1-2 min.
Note: After evaporation of all the liquid nitrogen in the mortar, the pellet reaches a powder-like consistency quickly, 1-2 min. No benefits are gained from further grinding. From experience, there are no adverse effects of grinding for too long.
6) Re-suspend the cell powder in liquid nitrogen and pour back into the original conical tube.
Place the conical tube in a -80 °C freezer and allow liquid nitrogen to boil off.
Note: Leave cap loosely tightened.
Pause point
Proceed to Stage 2A
Mammalian cells
Day 0
Plate cells as required by experiment.
Note: The procedure has been successfully applied to various mammalian cell lines cultured in 6-well plates, 10-cm dishes, and 15-cm dishes, with a harvested range of 106 to 107 cells. Confluency at time of harvesting should be avoided by controlling plating density it is important to consider the effects of cell manipulation on translation. Over-confluence, depleted nutrients or serum, or media changes can induce quick translational responses. Using a stable cell line is recommended over transiently transfected cells to ensure reproducibility.
Incubate cells under optimal growth conditions.
Day 1
Add cycloheximide (CHX) to media at a final concentration of 100 μg/ml, incubate for 10 min at 37 °C. This step can be omitted .
Note: While CHX pre-treatment in growth media is optional, we recommend adding CHX to the PBS and lysis buffer to prevent ribosome run-off during harvesting.
Pre-chill PBS and lysis buffer on ice and add additives (see Recipes).
Transfer tissue culture dish to an ice bucket.
Aspirate media.
Wash the dish twice with 10 ml ice-cold PBS.
Scrape cells thoroughly and quickly in 5 ml of ice-cold PBS.
Transfer cell suspension to a 15 ml conical tube.
Centrifuge for 5 min at 4 °C at 500 x g, discard supernatant.
Flash freeze cell pellet and store at -80 °C.
Proceed to Stage 2A.
Mammalian tissue
Day 0
Dissect out a whole tissue sample.
Wash tissue with ice-cold PBS prior to freezing in liquid nitrogen.
Day 1
Break apart and lyse tissue by grinding with a mortar and pestle.
1) Pre-chill mortar and pestle with liquid nitrogen (~2-3 min) in an ice bucket.
2) Pour out any residual LN2 from the mortar.
3) Add the frozen tissue to the mortar.
4) Pour ~1-5 ml of LN2 on the frozen tissue.
Note: Adding too much LN2 will significantly increase processing times.
5) Grind with a pestle to break apart cells until all LN2 boils off, then grind the dry powder for an additional ~1-2 min.
Note: After evaporation of all the liquid nitrogen in the mortar, the pellet reaches a powder-like consistency quickly, 1-2 min. No benefits are gained from further grinding. From experience, there are no adverse effects of grinding for too long.
6) Re-suspend the cell powder in liquid nitrogen and pour back into the original conical tube.
Place the conical tube in a -80 °C freezer and allow liquid nitrogen to boil off.
Note: Leave cap loosely tightened.
Pause point
Proceed to Stage 2A
PART 1B: Sample preparation (Day 2)
Note: ALL following steps are done on an ice block or in a 4 °C cold room.
Yeast procedure
Thaw grinded powder on ice for 5 min.
Prematurely adding lysis buffer can cause it to freeze.
In the meantime, pre-label four siliconized microcentrifuge tubes per sample:
Re-suspended powder
Clarified undiluted lysate
Clarified diluted lysate
Aliquoted lysate (multiple tubes)
Note: You will also need three 0.6 ml tubes per sample containing 90 μl ddH2O.
Add 1 ml lysis buffer to the cell powder in each conical.
Swirl each tube to lightly mix, then fully re-suspend by pipetting up and down using a P1000.
Transfer entire tube contents to pre-labeled ‘re-suspended’ 1.7 ml tubes.
Spin for 10 min at 1,300 x g at 4 °C.
Transfer clarified lysate (~800 μl) into ‘clarified undiluted’ labeled 1.7 ml tubes. Clarified lysate should have a translucent appearance with a white/yellow hue.
Transfer 10 μl into 90 μl water to spec on NanoDrop for RNA concentration, which serves as a proxy for total lysate concentration.
Notes:
Triton X-100 interferes with reading so dilution is needed.
Blank will have 10 μl lysis buffer + 90 μl ddH2O.
Dilute all lysates to 25 OD260 U/ml (1 μg/μl RNA) with lysis buffer.
Spec the diluted lysate to ensure that all samples are within ~5% of each other.
Add exogenous uncapped Luciferase RNA (Promega) to a final concentration of 100 ng/ml.
Aliquot 150 μl into 1.7 ml tubes.
Store lysates not immediately needed for experiment at -80 °C.
Proceed to Stage 2B.
Mammalian cells procedure
Thaw cell pellet on ice.
Resuspend cell pellet in 100 μl lysis buffer per 106 cells.
Transfer lysate to a 1.7 ml tube.
Incubate for 10 min on ice, mix by pipetting up and down.
Note: Optimal lysis time and detergent concentration may vary depending on the cell type. Check cell lysis under a microscope with phase contrast at different times during lysis. Triton can be substituted by other detergents such as NP-40 or mechanical lysis using a dounce homogenizer.
Centrifuge for 10 min at 4 °C at 12,000 x g.
Transfer clarified lysate into a ‘clarified undiluted’ labeled 1.7 ml tube.
Dilute 10 μl of lysate into 90 μl water to spec on NanoDrop for RNA concentration, which serves as a proxy for total lysate concentration (see Note 8).
Dilute all samples to the same concentration by adding an appropriate amount of lysis buffer.
Note: We recommend diluting to ~20-100 μg/ml. Adjust concentrations and measure by spec to ensure all samples are within 5% of each other.
Spike in exogenous uncapped Luciferase RNA to a final concentration of 100 ng/ml.
Aliquot 200-500 μl into 1.7 ml tubes and store the remaining lysate (input) at -80 °C.
Proceed to stage 2B.
Tissue procedure
Weigh 50 mg (one scoop) of frozen powder into LN2 chilled 5 ml Eppendorf tubes.
Act quickly to avoid tube warming up.
Dip tubes into LN2 and shake to separate powder frequently (main 50 ml conical).
Let to ‘thaw’ to 4 °C in ice before adding lysis buffer (LB).
Add 50-100 μl of lysis buffer per mg of powder.
Pipette up and down to mix, vortex vigorously, and let sit on ice.
Allow Triton X-100 to lyse lipids for 5-10 min after adding LB before spinning.
Vortex again.
Spin 750 x g for 10 min at 4 °C.
Separate supernatant into a new tube.
Note: Whole tissue samples: Lipid-rich samples must be carefully prepared to avoid lipid contamination. As such, we recommend taking the middle 75% of the clarified lysate after centrifugation to avoid disturbing the top lipid layer or bottom insoluble material.
Spin 12,000 x g for 10 min at 4 °C.
Separate supernatant into a new tube.
Note: Take 75% liquid from the middle.
Transfer 10 μl of supernatant into 90 μl water to spec on NanoDrop for RNA concentration, which serves as a proxy for total lysate concentration (see Note 8).
Dilute all samples to 100 ng/μl RNA in lysis buffer containing Heparin.
Add exogenous uncapped Luciferase RNA (Promega) to a final concentration of 100 ng/ml, then vortex to mix.
Aliquot 250 μl into 1.7 ml tubes and store the remaining lysate (input) at -80 °C.
Proceed to Stage 2B.
STAGE 2: Sucrose Gradient Fractionation (Day 2)
PART 2A. Gradient preparation
The set up should be done at room temperature and prior to the second step of lysate preparation. While gradients are cooling to 4 °C, prepare and clarify the lysates.
Prepare sucrose solutions
Aliquot 40 ml of pre-filtered sucrose solutions (stored at 4 °C, see Recipes section) into a conical tube, and let warm to room temperature.
Add DTT, cycloheximide, and Superase-IN to sucrose solutions, then mix by gentle rotation.
Prepare lysis buffer and put on ice to cool to 4 °C.
Mark Polyclear centrifuge tubes using the SW41 Ti marker block by drawing a line on each tube at the top marker block line.
Using a stripette, fill centrifuge tubes with 10% sucrose solution (see Recipes) up to ~2 mm above the marked line.
Fill up a 50 ml syringe with the 50% sucrose solution (see Recipes) slowly (to avoid bubbles). Attach the cannula and expel any air by holding the syringe vertically (with the cannula pointing up).
Holding the tube such that the marked line is at eye level, quickly and vertically insert the cannula into the bottom of the tube (avoiding the 50% sucrose solution leaking into the 10% solution).
Slowly expel the 50% sucrose solution while maintaining the bottom of the cannula ~5 mm below the meniscus. When the meniscus of the interphase layer reaches the marked line, stop expelling and quickly pull out the cannula.
Cap each tube (taking care to avoid any air pockets).
Using a P1000, pipette out any residual sucrose that was pushed out through the cap’s hole.
Place tubes into the gradient maker tube holder (that has been pre-leveled using the manufacturer-supplied level).
Using the gradient maker station software, run the ‘14S short 10-50%’ program (see Note 1 for program information).
Transfer the tubes to the cold room (but do not remove caps yet) while you prepare the lysates.
At this point, turn on the ultra-centrifuge to allow it to pre-cool to 4 °C.
PART 2B. Ultracentrifugation
Gently remove caps from 10-50% sucrose gradients.
Slide sucrose-gradient tubes into rotor buckets.
Remove (X + 100) μl from the top of each gradient, where X is the amount of lysate you will load (typically 100 μl but up to 600 μl is acceptable).
Note: The downstream RNA analysis steps of this protocol work best for sucrose gradients performed using < 100 μg of lysate (based on A260 units). For higher loading of lysates some scaling up and optimization of the downstream steps of the protocol may be required.
Slowly layer 100-600 μl of lysate on top of the gradient. The lysate should form a visible and neat layer.
Note: Save at least 10 μl of lysate as the ‘Input’ fraction for downstream qRT-PCR analysis.
Weigh each gradient tube in a balance and carefully adjust the weight of each tube, if needed, by adding lysis buffer. Equilibrate the bucket pairs facing each other on the rotor: 1-4, 2-5 and 3-6.
Cap the buckets.
Attach buckets to the SW41 Ti rotor.
Gently lower the rotor into the centrifuge, and lightly spin the rotor by hand to ensure that all buckets are connected properly.
Enter centrifugation settings:
Vacuum–ON
Temp–4 °C
Speed–36,000 rpm (160,000 x g)
Time–2.5 h
Acceleration–1
De-acceleration–7
Start the centrifuge and ensure that it reaches the desired speed. The centrifuge may pause acceleration at 3,000 rpm until the vacuum is fully engaged.
Note: On an SW41 Ti rotor, 36,000 rpm corresponds to 160,000 x g at rav. If you are using a different rotor, please refer to the manual to use the correct speed.
PART 2C. Fractionation
Read and follow manufacturer’s instructions. We recommend contacting the local Biocomp representative for an advanced tutorial.
During the spin, turn on the Bio-Rad Econo UV monitor to warm up and label and chill screw-cap tubes.
Notes:
Allow the Bio-Rad Econo UV Monitor to warm up for at least 2 h before setting the zero.
During centrifugation: Pre-label 16 screw cap tubes (USA Scientific) per gradient, cover with cling film or Parafilm to prevent dust/RNase contamination and store in at 4 °C.
Turn on the Gilson fraction collector, the Biocomp gradient station, the computer and open ‘Gradient Profiler V2’ software.
Set the zero UV reading with clean water Bio-Rad Econo UV monitor.
Ensure that UV readout is stable, not fluctuating.
Remove rotor from centrifuge, place rotor tubes on rack, and place in cold room.
Note: Do not remove screw cap until needed for fractionation.
Fractionate gradients into 2 ml screw-cap tubes using the following settings:
Note: If at any point the Econo-UV monitor light turns red, pull up the piston, release the air valve, and repeat the zeroing with water.
Speed:
0.30 mm/sec
Total distance:
75 mm
Number of fractions:
15
Distance/fraction:
5.00 mm
Volume/fraction:
0.71 ml
Store fractions in the cold room until the entire set of samples have been fractionated.
Flash freeze all tubes and store at -80 °C.
STAGE 3: mRNA Analysis (Day 3)
PART 3A. DNase treatment and control RNA spike-in
Thaw fraction tubes, input tubes, and Cells-to-Ct stop solution.
Dilute the input samples 30-fold by adding 6 μl to 174 μl RNase-free water, then put on ice.
Prepare a Master mix of lysis solution containing the following (per sample):
9.9 μl
Cells-to-Ct lysis buffer
0.1 μl
Cells-to-Ct lysis buffer
0.1 μl
XenoRNA
Per gradient, prepare 16 PCR tubes (to be used for 15 fractions plus the input) containing 10.1 μl lysis solution master mix.
Add 1 μl of each fraction (or input) directly into the lysis master mix (i.e., not to the tube wall), then pipette up and down 2-3 times.
Invert tubes several times to mix gently, then briefly spin down.
Incubate at room temperature for 5 min, then put on ice (during this incubation you can put the fraction tubes back into -80 °C freezer).
Pipet 1 μl Cells-to-Ct stop solution directly into each PCR tube (i.e., not to the tube wall).
Invert tubes several times to mix gently, then briefly spin down.
Incubate at room temperature for 2 min, then put on ice.
PART 3B. Reverse transcription protocol
Prepare RT Master mix containing the following (per sample):
5 μl
2x Cells-to-Ct RT buffer
0.5 μl
20x Cells-to-Ct RT enzyme mix
Use P10 to distribute 5.5 μl RT master mix to PCR tubes.
Use multichannel P10 to add 4.5 μl of lysate.
Perform RT reaction in a thermocycler with the following program: 37 °C for 1 h, 95 °C for 5 min, 4 °C forever.
Dilute each RT reaction by adding 50 μl water and mixing thoroughly.
Store at -20 °C or proceed directly to PCR.
PART 3C. Quantitative real-time PCR protocol
Every fraction is analyzed with qPCR technical duplicates for each probe.
Program instrument for TaqMan assay:
Probes are labeled with FAM dye and nonfluorescent quencher.
Cycling conditions: 50 °C for 2 min (UDG incubation), 95 °C for 10 min (enzyme activation), 40x [95 °C for 15 sec + 60 °C for 1 min] (PCR).
Mix 2x TaqMan Gene Expression Master mix by swirling the bottle, mix 20x assays by vortexing briefly and centrifuging; keep all solutions on ice.
For each gene-of-interest (including the Xeno and Luciferase controls), prepare a TaqMan PCR Cocktail containing (for each qPCR reaction) 5 μl 2x TaqMan Gene Expression Master MIX + 0.5 μl 20x TaqMan assay (gene specific).
Use a P10 to distribute 5.5 μl of PCR cocktail into a real-time PCR plate at room temperature.
Use a multichannel P10 to add 4.5 μl of RT reaction for each qPCR reaction, mix by pipetting.
Cover the plate carefully and briefly centrifuge (~800 x g for a few seconds).
Place reactions in a real-time PCR instrument and start the run.
Data analysis
Per sample, gather raw Cq information from the qPCR machine for:
Xeno
Luciferase
Actin (or other well-translated gene)
Additional genes of interest
Assemble values by fraction numerical order.
Average Cq values from technical duplicates. Also calculate the difference between replicates and repeat qPCR reactions for any samples a difference greater than 0.5 Cq units (see Note 2).
Calculate mRNA abundance in each fraction relative to the input (Pfaffl, 2001) taking into account differences in qRT-PCR efficiency calculated by normalizing to XenoRNA Cq values:
Convert relative RNA abundances to the percent of total detected RNA:
For each gradient, generate line plots with fraction numbers on the x axis and ‘Percent of total mRNA’ for each target on the y axis.
Note: All of the above analysis should be automated in a spreadsheet. In this way, the researcher only needs to copy and paste Cq values to receive all abundance information, quality control metrics, and polysome plots (see Note 2 for troubleshooting). Figure 2 shows an example of the data analysis with this procedure.
Figure 2. Representative data generated from this polysome gradient analysis protocol. The top panel shows the A260 absorbance trace of a fractionated yeast lysate with the species of ribosome associated with each peak annotated. The bottom panel shows a representative plot of the relative distribution of RNA associated with each fraction of the gradient as analyzed by qRT-PCR. Represented is a translationally repressed mRNA (orange), a well-translated mRNA (blue) and the uncapped luciferase RNA (green), which serves as a control for non-specific interactions. The well-translated mRNA is mainly polysomic and sediment deep in the gradient toward the bottom of the tube. Both the translationally repressed mRNA and the exogenous control RNA are not associated to ribosomes and remain in the top fractions.
Notes
Fractionation program setup:
Gradient Master program for 10-50% sucrose gradient:
05/85/35
01/77/0
04/86/35
03/86.5/35
20/81/14
07/86/20
Sequence of steps: abcbdbabcbdbef
Ideally the averaged Cq values for XenoRNA will be roughly the same in all fractions and input (since equal amounts of XenoRNA were added to samples before qRT-PCR). In practice, we allow a range of up to 1 Cq value; a larger range indicates issues with qRT-PCR efficiency in some fractions, which may reflect an overly concentrated or ‘dirty’ lysate. Consider repeating the experiment if > 5% of the uncapped RNA is found associating with polysomes. If a fraction is significantly different in all probe’s Cq values, there was likely a problem introduced at the RT step. If a fraction is significantly different in one probe’s Cq values, there was likely a problem introduced at the qPCR step.
Recipes
Lysis buffer (made fresh each time)
20 mM HEPES-KOH (pH 7.4)
5 mM MgCl2
100 mM KCl
200 μg/ml Heparin
1% Triton X-100
2 mM DTT
100 μg/ml cycloheximide
20 U/ml Superase-IN
cOmplete mini EDTA-free Protease Inhibitor Cocktail (1 tablet per 10 ml solution)
10% sucrose solution
Base: 20 mM HEPES-KOH (pH 7.4), 5 mM MgCl2, 100 mM KCl, 10% sucrose
Filter sterilize. Store at 4 °C for > 2 weeks
Additives added fresh each time (final concentration): 2 mM DTT, 100 μg/ml cycloheximide, 20 U/ml Superase-IN
50% sucrose solution
Base: 20 mM HEPES-KOH (pH 7.4), 5 mM MgCl2, 100 mM KCl, 50% sucrose
Filter sterilize. Store at 4 °C for > 2 weeks
Additives added fresh each time (final concentration): 2 mM DTT, 100 μg/ml cycloheximide, 20 U/ml Superase-IN
Volumes: 1 gradient = 12 ml total volume (~6 ml 10% sucrose solution, ~6 ml 50% sucrose solution) For 6 gradients (which can be spun simultaneously in SW41 Ti rotor), 40 ml of each sucrose solution is sufficient
Acknowledgments
We acknowledge Jonathan Weissman, Raul Andino, Keith Yamamoto, and Alan Frankel for generously sharing equipment. This work was supported by the UCSF Program for Breakthrough Biomedical Research (funded in part by the Sandler Foundation) and by an NIH Director’s Early Independence Award (DP5OD017895).
References
Arava,Y., Wang, Y., Storey, J. D., Liu, C. L., Brown, P. O. and Herschlag, D. (2003). Genome-wide analysis of mRNA translation profilesin Saccharomyces cerevisiae . ProcNatl Acad Sci U S A 100(7): 3889-3894.
Dever,T. E. and Green, R. (2012). Theelongation, termination, and recycling phases of translation in eukaryotes. ColdSpring Harb Perspect Biol 4(7): a013706.
DiSanto, R., Aboulhouda, S. and Weinberg, D. E. (2016). The fail-safe mechanism ofpost-transcriptional silencing of unspliced HAC1 mRNA. Elife 5.
Floor,S. N. and Doudna, J. A. (2016). Tunable protein synthesis bytranscript isoforms in human cells. Elife 5.
Hinnebusch,A. G. and Lorsch, J. R. (2012). The mechanism of eukaryotictranslation initiation: new insights and challenges. ColdSpring Harb Perspect Biol 4(10).
Ingolia,N. T., Ghaemmaghami, S., Newman, J. R. and Weissman, J. S. (2009). Genome-wideanalysis in vivo of translation withnucleotide resolution using ribosome profiling. Science 324(5924): 218-223.
Mašek,T., Valasek, L. and Pospisek, M. (2011). Polysome analysis and RNApurification from sucrose gradients. MethodsMol Biol 703: 293-309.
Odegaard,J. I., Lee, M. W., Sogawa, Y., Bertholet, A. M., Locksley, R. M., Weinberg, D.E., Kirichok, Y., Deo, R. C. and Chawla, A. (2016). Perinatal licensing ofthermogenesis by IL-33 and ST2. Cell 166(4): 841-854.
Pfaffl,M. W. (2001). A new mathematical model forrelative quantification in real-time RT-PCR. NucleicAcids Res 29(9): e45.
Warner,J. R., Knopf, P. M. and Rich, A. (1963). A multiple ribosomal structurein protein synthesis. Proc Natl Acad Sci U S A 49: 122-129.
Weinberg,D. E., Shah, P., Eichhorn, S. W., Hussmann, J. A., Plotkin, J. B. and Bartel,D. P. (2016). Improved ribosome-footprintand mRNA measurements provide insights into dynamics and regulation of yeasttranslation. Cell Rep 14(7):1787-1799.
Copyright: Aboulhouda et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Aboulhouda, S., Di Santo, R., Therizols, G. and Weinberg, D. E. (2017). Accurate, Streamlined Analysis of mRNA Translation by Sucrose Gradient Fractionation. Bio-protocol 7(19): e2573. DOI: 10.21769/BioProtoc.2573.
Di Santo, R., Aboulhouda, S. and Weinberg, D. E. (2016). The fail-safe mechanism of post-transcriptional silencing of unspliced HAC1 mRNA. Elife 5.
Download Citation in RIS Format
Category
Molecular Biology > RNA > mRNA translation
Biochemistry > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
2 Q&A
RNCseq for virus protein
0 Answer
6 Views
Aug 17, 2023
RNCseq extract mRNA
0 Answer
13 Views
Aug 8, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,574 | https://bio-protocol.org/exchange/protocoldetail?id=2574&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for Construction of a Tunable CRISPR Interference (tCRISPRi) Strain for Escherichia coli
XL Xin-tian Li
CS Cindy Sou
SJ Suckjoon Jun
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2574 Views: 9812
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
We present a protocol for construction of tunable CRISPR interference (tCRISPRi) strains for Escherichia coli. The tCRISPRi system alleviates most of the known problems of plasmid-based expression methods, and can be immediately used to construct libraries of sgRNAs that can complement the Keio collection by targeting both essential and nonessential genes. Most importantly from a practical perspective, construction of tCRISPRi to target a new gene requires only one-step oligo recombineering. Additional advantages of tCRISPRi over other existing CRISPRi methods include: (1) tCRISPRi shows significantly less than 10% leaky repression; (2) tCRISPRi uses a tunable arabinose operon promoter and modifications in transporter genes to allow a wide dynamic range with graded control by arabinose inducer; (3) tCRISPRi is plasmid free and the entire system is integrated into the chromosome; (4) tCRISPRi strains show desirable physiological properties.
Keywords: CRISPR interference Gene expression Gene knockdown Recombineering
Background
Various CRISPR interference systems have been developed for use in organisms from bacteria to eukaryotes. For those who are considering to use CRISPRi for bacteria, we provide the following background information on our tCRISPRi system (Li et al., 2016) and its comparison with other CRISPRi systems.
Morgan-Kiss et al. (2002) developed the plasmid-based, dose-inducible promoter pBAD. Their system allows tunable expression of a protein from the pBAD promoter, dependent upon arabinose levels. The arabinose transporter genes araE and araFGH are inactive in the strain. Their strain also has two copies of lacY; the wild-type lacY on the chromosome and a mutant lactose transporter lacY A177C on a plasmid. The LacY A177C function allows arabinose to diffuse into the cell, and thus, the pBAD induction level is precisely controlled by the concentration of the supplied arabinose in the medium (Morgan-Kiss, 2002).
Our tCRISPRi strain contains only the mutant gene lacY A177C (Morgan-Kiss, 2002), which is expressed from the lac operon constitutively because the lacI repressor gene is deleted. Our strain also has gene deletions of araE and araFGH. LacY A177C is the only arabinose transporter in the cell allowing for better control of the PBAD promoter and tunable repression by tCRISPRi.
A recent study by Peters et al. (2016) showed the power of CRISPR-based knockdown methods for studying essential genes in Bacillus subtilis. Their sgRNA libraries were cloned via inverse PCR, and dCas9 was under a xylose-inducible promoter. In contrast, our tCRISPRi system for E. coli uses one-step recombineering to make a tCRISPRi strain. The PBAD promoter in the present work shows about 7.5% leaky expression, whereas the B. subtilis CRISPRi shows approximately 33% leakiness. Another important pioneering CRISPRi system was designed by the Marraffini group (2013), who used a plasmid-based system. We compare our tCRISPRi with these other two systems in Table 1. To see an example of applications of tCRISPRi to essential cell cycle genes, see Si et al. (2017).
Table 1. Comparison of different CRISPR interference system
Materials and Reagents
1.5 ml microcentrifuge tubes
Pipette tips (10 μl , 200 μl, 1,000 μl) (Genesee Scientific, catalog numbers: 24-121RL )
Pipette tips (10 μl , 200 μl, 1,000 μl) (Genesee Scientific, catalog numbers: 24-150RL )
Pipette tips (10 μl , 200 μl, 1,000 μl) (Genesee Scientific, catalog numbers: 24-165RL )
15 ml culture tubes
Electroporation cuvettes, 1 mm gap (Bio-Rad Laboratories, catalog number: 1652089 )
Petri dishes
SJ_XTL219 strain available from Addgene (Addgene, catalog number: 86400 )
Ultrapure water
Antibiotics:
Hygromycin (50 mg/ml) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10687010 )
Tetracycline (12.5 mg/ml) (Sigma-Aldrich, catalog number: T3383 )
PCR purification kit (QIAGEN, catalog number: 28104 )
Phusion high fidelity polymerase (New England Biolabs, catalog number: M0530L )
L(+)Arabinose (EMD Millipore, Calbiochem, catalog number: 178680 )
Gel extraction kit (QIAGEN, catalog number: 28704 )
Tryptone (EMD Millipore, catalog number: 1.07213.1000 )
Yeast extract (Sigma-Aldrich, catalog number: Y1625-1KG )
Sodium chloride (NaCl) (Fisher Bioreagents, catalog number: BP3581 )
LB agar (Fisher Bioreagents, catalog number: BP1425 )
Luria broth (LB) (see Recipes)
LB agar plate (see Recipes)
Sucrose plates (see Recipes)
Equipment
Pipettes (that can accommodate pipette tips in 2 above)
Milli-Q water purification system (Millipore, catalog number: Z00Q0V0WW )
Autoclave (AMSCO, model: 3041-S )
Incubator and shaker (32 °C and 42 °C) (Eppendorf, New BrunswickTM, model: Innova® 3100 , catalog number: M1231-0000)
Microcentrifuge (Eppendorf, catalog number: 5424 )
Electroporator (Bio-Rad Laboratories, catalog number: 1652100 )
Gel electrophoresis chamber (Bio-Rad Laboratories, catalog number: 1704406 )
Thermal cycler (Bio-Rad Laboratories, model: C1000 TouchTM, catalog number: 1851148 )
Nikon Inverted Microscope Eclipse Ti-E (Nikon, model: Eclipse Ti-E , catalog number: MEA53100) equipped with an Andor Neo sCMOS camera (Nikon, model: Neo 5.5 , catalog number: 77026046)
Software
Nikon NIS-Elements Advanced Research software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Li, X., Sou, C. and Jun, S. (2017). Protocol for Construction of a Tunable CRISPR Interference (tCRISPRi) Strain for Escherichia coli. Bio-protocol 7(19): e2574. DOI: 10.21769/BioProtoc.2574.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA modification
Microbiology > Microbial genetics > Gene mapping and cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,575 | https://bio-protocol.org/exchange/protocoldetail?id=2575&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Scanning Electron Microscope (SEM) Imaging to Determine Inflorescence Initiation and Development in Olive
Amnon Haberman
EZ Einat Zelinger
AS Alon Samach
Published: Vol 7, Iss 19, Oct 5, 2017
DOI: 10.21769/BioProtoc.2575 Views: 8026
Edited by: Scott A M McAdam
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Here we present a protocol that describes how to image the structure of the olive axillary bud meristem with a scanning electron microscope (SEM) in order to characterize its identity and developmental stage. Briefly, the specimen is fixed with glutaraldehyde, saturated with ethanol, dried in a critical point dryer (CPD) system, dissected, coated with a conducting material and imaged with a scanning electron microscopy (SEM).
Keywords: SEM Scanning Electron Microscopy Olive Flowering Inflorescence Meristem Bud
Background
The exact timing of flowering induction and inflorescence initiation in olive (Olea europaea L.) is in controversy (Haberman et al., 2017). In olive, inflorescences emerge from lateral buds at the end of winter and flower in the spring. We have developed a protocol to better characterize the timing of inflorescence initiation in olive by imaging the meristem in the olive bud with a SEM at different times during the year. In these SEM images the meristem structure can be identified unambiguously, and the definition level of the meristem can be much higher than images of bud meristem sections presented in previous studies.
Materials and Reagents
Scalpel blade No. 11 (Sigma-Aldrich, catalog number: S2771 )
Double-sided adhesive tape
Glass scintillation vials with screw caps, volume 20 ml (Sigma-Aldrich, catalog number: Z190535 )
Pipette (BRAND, catalog number: 747760 ) or a similar instrument
Gold annular target for the sputter coater (Agar scientific, catalog number: AGB7370 )
Olive (Olea europaea L.) buds
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S3139 )
25% glutaraldehyde (Sigma-Aldrich, catalog number: G5882 )
Ethanol absolute (Sigma-Aldrich, catalog number: 24102 )
Optional: Technical grade ethanol (Sigma-Aldrich, catalog number: V0T0042 )
0.1 M phosphate buffer pH 7.2 (sodium phosphate buffer; see Recipes)
5% glutaraldehyde solution (in 0.1 M phosphate buffer pH 7.2; see Recipes)
Equipment
Scalpel handle No. 3 (Sigma-Aldrich, catalog number: S2896 )
Tweezers style #5 (Sigma-Aldrich, catalog number: T4537 )
Critical point dryer system (BAL-TEC, model: CPD 030 )
Stereo-microscope (Olympus, model: SZX12 )
Sputter coater (E510 scanning electron microscope coating unit) (Polaron Instruments, model: E510 )
Scanning electron microscope (JEOL, model: JSM-5410 LV )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Haberman, A., Zelinger, E. and Samach, A. (2017). Scanning Electron Microscope (SEM) Imaging to Determine Inflorescence Initiation and Development in Olive. Bio-protocol 7(19): e2575. DOI: 10.21769/BioProtoc.2575.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > Morphogenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,576 | https://bio-protocol.org/exchange/protocoldetail?id=2576&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Method for Radioactive Labelling of Hebeloma cylindrosporum to Study Plant-fungus Interactions
AB Adeline Becquer
MT Margarita Torres-Aquino
CG Christine Le Guernevé
LA Laurie K Amenc
CT Carlos Trives-Segura
SS Siobhan Staunton
Hervé Quiquampoix
Claude Plassard
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2576 Views: 6787
Edited by: Scott A M McAdam
Reviewed by: Manjula Mummadisetti
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
In order to quantify P accumulation and P efflux in the ectomycorrhizal basidiomycete fungus Hebeloma cylindrosporum, we supplied 32P to mycelia previously grown in vitro in liquid medium. The culture had four main steps that are 1) growing the mycelium on complete medium with P, 2) transfer the mycelia into new culture solution with or without P, 3) adding a solution containing 32P and 4) rinsing the mycelia before incubation with or without plant. The main point is to rinse very carefully the mycelia after 32P supply in order to avoid overestimation of 32P efflux into the medium.
Keywords: Culture in vitro Phosphate availability 32P labelling Ectomycorrhizal fungi
Background
It is well known that the association between mycorrhizal fungi and plants improves the P nutrition of the host-plant (reviewed by Smith and Read, 2008; Plassard and Dell, 2010; Cairney, 2011; Smith et al., 2015). This positive effect has been attributed primarily to phosphate (Pi) uptake by the fungal cells exploring the soil far from the roots, allowing the exploration of a large volume of soil beyond the depletion zone formed around actively absorbing roots (Smith and Read, 2008; Cairney, 2011; Smith et al., 2015). However, to benefit to the host plant, absorbed Pi has to be transported from the fungal cells exploring soil towards those in close contact with the host cells. In ectomycorrhizal symbiosis, these exchanges are thought to take place in a territory called the ‘Hartig net’ inside the ectomycorrhizal roots (Smith and Read, 2008; Cairney, 2011). In the Hartig net, the fungal cells colonize the walls of cortical cells but there is no direct communication between the two plasma membranes, meaning that P has to be released from the fungal cells via a yet unknown mechanism. Taken together, this knowledge indicates that the ability of the fungus to take up P in external hyphae and to release P is therefore an important feature of the fungal species for its positive effect on plant P nutrition. Here, we developed a methodology using 32P labelling to follow the net 32P accumulation and release by an ectomycorrhizal fungal species cultivable in vitro, without its host plant (Torres-Aquino et al., 2017). This method could be used with other fungal or plant material.
Materials and Reagents
Sterile plastic Petri dish, 90 mm (Dominique DUTSCHER, Gosselin, catalog number: 688302 )
Sterile plastic Petri dish, 35 mm (Corning, Falcon®, catalog number: 351008 )
Liquid scintillation vial, 6 ml with cap (PerkinElmer, catalog number: 6000592 )
Liquid scintillation vial, 20 ml with cap (PerkinElmer, catalog number: 6008117 )
Waste bags for radionuclides (SCIE-PLAS, catalog number: RRP-BAG17 )
Protective paper for bench (Dominique DUTSCHER, Benchguard, catalog number: 090277 )
Liquid scintillation cocktail Ultimagold (PerkinElmer, catalog number: 6013329 )
Nichrome wire, stainless steel, round, 22 gauge, 0.64 mm diameter (suppliers for electronic cigarettes)
Aluminium screw cap, 40 mm with rubber liner (VWR, SPV, catalog number: 215-2690 )
Multi-Purpose Silicone for kitchen or bathroom, 280 ml (Castorama, Rubson)
60 ml Luer-lock syringes (Dominique DUTSCHER, Omnifix, catalog number: 921016 )
Teflon PTFE microtube, 1.15 mm and 1.75 mm for internal (int) and external (ext) diameter (diam), respectively (Dominique DUTSCHER, PTFE, catalog number: 091932 )
Needles 18 G 0.9 x 40 mm (Dominique DUTSCHER, BD MicrolanceTM 3, catalog number: 301300 )
Tubing, int diam 1.14 mm (Dominique DUTSCHER, Silicone, catalog number: 4906591 )
Tubing, int diam 3.17 mm (Dominique DUTSCHER, Silicone, catalog number: 4906600 )
Microtubes, 1.5 ml (Dominique DUTSCHER, Eppendorf, catalog number: 033511 )
Valve Luer polycarbonate one way (Cole-Parmer, catalog number: EW-30600-01 )
Sterile syringe filters for air, 0.2 µm, 6.4 cm diam (Labomoderne, Midisart, catalog number: RS3320 )
Autoclavable Polypropylene bag, 3 L, non-printed (Dominique DUTSCHER, catalog number: 140230 )
Tips 1,200 µl for pipet (Dominique DUTSCHER, Sartorius, catalog number: 077200B )
Home-made syringe holder
Home-made needle holder for aeration
Folding skirted caps, 14.9 mm diam (Dominique DUTSCHER, catalog number: 110602 )
Paper for sterilization (Dominique DUTSCHER, catalog number: 006950 )
Hebeloma cylindrosporum (ectomycorrhizal basidiomycete) (laboratory’s own collection, available upon request)
Manganese(II) sulfate monohydrate (MnSO4·H2O) (Sigma-Aldrich, catalog number: M7899-500G )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: Z0251-100G )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: B6768-500G )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (Sigma-Aldrich, catalog number: C8027-500G )
Sodium molybdate dihydrate (Na2MoO4·2H2O) (Sigma-Aldrich, catalog number: M1651-100G )
Potassium nitrate (KNO3) (Sigma-Aldrich, catalog number: P8291-1KG )
Sodium phosphate monobasic monohydrate (NaH2PO4·H2O) (Sigma-Aldrich, catalog number: 71504-250G-M )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: 63138-250G )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333-500G )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080-500G )
Ferric ammonium citrate (Sigma-Aldrich, catalog number: RES20400-A702X )
D-glucose (Sigma-Aldrich, catalog number: G8270-1KG )
Agar-agar (Sigma-Aldrich, catalog number: A7002-500G )
KH232PO4 in water (PerkinElmer, catalog number: NEX055002MC )
2-N-morpholino-ethanesulfonic acid, 4-morpholineethanesulfonic acid monohydrate (MES) (Sigma-Aldrich, catalog number: 69892-500G )
Tris(hydroxymethyl)aminomethane (TRIS) (Sigma-Aldrich, catalog number: T1378-500G )
1 N sulfuric acid solution (EMD Millipore, catalog number: 1.09072.1000 )
Trace elements (see Recipes)
Mineral salt base solutions (see Recipes)
Thiamine solution (see Recipes)
N6 complete liquid solution (see Recipes)
Solid N6 complete liquid solution (see Recipes)
Interaction medium (IM) (see Recipes)
Equipment
Sample bottles,120 ml (VWR, SPV, catalog number: SPVAGO2246 )
Glass bottles, 1,000 ml, ISO borosilicate, graduated (Dominique DUTSCHER, catalog number: 046415 )
Glass bottles, 2,000 ml, ISO borosilicate, graduated (Dominique DUTSCHER, catalog number: 046416 )
Two pairs of stainless steel straight tweezers Wironit, Brucelles type, 130 mm (Dominique DUTSCHER, catalog number: 491037 )
A scalpel handle for blade 20 to 25 (Dominique DUTSCHER, catalog number: 3740004 )
Surgical blade sterile N°21 (Dominique DUTSCHER, catalog number: 132521 )
A standalone burner (Dominique DUTSCHER, catalog number: 071109 )
Butane gas cartridge for the burner (Dominique DUTSCHER, catalog number: 060415 )
A nail, a hammer, scissors and cutting pliers
Incubator with controlled temperature set at 25 °C
Autoclave
Laminar flow cabinet
Cork-borer, 7.5 mm diameter (Dominique DUTSCHER, catalog number: 942783 )
Aquarium air-pumps (SuperFish, model: air-box Nr.4 )
Shield, fixed 15° angle, flat base, Beta; 530 x 350 mm shield; 350 x 300 mm base (upright x horizontal) (SCIE-PLAS, catalog number: RPP-S15L )
Midi-box with hinged lid, Beta; external dimensions: 80 x 185 x 105 mm; internal dimensions: 60 x 165 x 85 mm (height x width x depth) (SCIE-PLAS, catalog number: RPP-B6 )
Bin for beta wastes on the bench, 3.3 L capacity (SCIE-PLAS, catalog number: RPP-B17 )
Liquid scintillation Counter TRI-CARB 4910TR (PerkinElmer, catalog number: A491000 )
Software
Microsoft Excel for calculations
Statistica 7.1 (StatSoft Inc., Tulsa, OK, USA) for statistical analysis
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Becquer, A., Torres-Aquino, M., Le Guernevé, C., Amenc, L. K., Trives-Segura, C., Staunton, S., Quiquampoix, H. and Plassard, C. (2017). A Method for Radioactive Labelling of Hebeloma cylindrosporum to Study Plant-fungus Interactions. Bio-protocol 7(20): e2576. DOI: 10.21769/BioProtoc.2576.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Fungus
Cell Biology > Cell isolation and culture > Co-culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,577 | https://bio-protocol.org/exchange/protocoldetail?id=2577&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Establishing a Symbiotic Interface between Cultured Ectomycorrhizal Fungi and Plants to Follow Fungal Phosphate Metabolism
AB Adeline Becquer
MT Margarita Torres-Aquino
CG Christine Le Guernevé
LA Laurie K Amenc
CT Carlos Trives-Segura
SS Siobhan Staunton
Hervé Quiquampoix
Claude Plassard
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2577 Views: 7293
Edited by: Scott A M McAdam
Reviewed by: Zhaohui Liu
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
In ectomycorrhizal plants, the fungal cells colonize the roots of their host plant to create new organs called ectomycorrhizae. In these new organs, the fungal cells colonize the walls of the cortical cells, bathing in the same apoplasm as the plant cells in a space named the ‘Hartig net’, where exchanges between the two partners take place. Finally, the efficiency of ectomycorrhizal fungi to improve the phosphorus nutrition of their host plants will depend on the regulation of phosphate transfer from the fungal cells to plant cells in the Hartig net through as yet unknown mechanisms. In order to investigate these mechanisms, we developed an in vitro experimental device mimicking the common apoplasm of the ectomycorrhizae (the Hartig net) to study the phosphorus metabolism in the ectomycorrhizal fungus Hebeloma cylindrosporum when the fungal cells are associated or not with the plant cells of the host plant Pinus pinaster. This device can be used to monitor 32Phosphate efflux from the fungus previously incubated with 32P-orthophosphate.
Keywords: In vitro symbiotic interface 32Phosphate efflux measurement Hebeloma cylindrosporum Pinus pinaster Ectomycorrhizal symbiosis
Background
The association between mycorrhizal fungi and plants is known to improve plant P nutrition (reviewed by Smith and Read, 2008; Plassard and Dell, 2010; Cairney, 2011; Smith et al., 2015). This positive effect is due to P uptake and P transport through the fungal cells exploring soil far away from the roots. The capacity of the fungus to take up P from the soil solution and to release P to mycorrhizal roots is therefore an important feature for its positive effect on plant P nutrition. In ectomycorrhizal symbiosis, we know (i) that the exchanges between the fungus and the plant occur in the Hartig net, located inside the ectomycorrhizae, and (ii) that there is no direct cellular connection via, for example plasmodesmata, between the plasma membrane of the fungal and the plant cells. Therefore, these exchanges are very difficult to study as they occur in the apoplasmic space of the Hartic net. Here, we describe an in vitro system enabling us to mimick this apoplasmic space for the ectomycorrhizal fungus Hebeloma cylindrosporum incubated with its host plant Pinus pinaster (Torres-Aquino et al., 2017). This method could be used with other fungal or plant species.
Materials and Reagents
Sterile plastic 90 mm Petri dishes (Dominique DUTSCHER, Gosselin, catalog number: 688302 )
Gloves, EcoSHIELD Natural Nitrile PF 250 (Dominique DUTSCHER)
Multi-Purpose Silicone for kitchen or bathroom, 280 ml (Castorama, Rubson)
PTFE (Polytetrafluoroethylene) microtube, 1.15 mm and 1.75 mm for internal and external diameter, respectively (Dominique DUTSCHER, PTFE, catalog number: 091932 )
Filter paper without ash, grade 542, 185 mm diameter (Dominique DUTSCHER, WhatmanTM, catalog number: 1542185 )
Autoclavable bags Polypropylene bag, 3 L, non-printed (Dominique DUTSCHER, catalog number: 140230 )
Autoclave tape (Dominique DUTSCHER, catalog number: 490009 )
Sterile 60 ml syringes 3 pieces (Dominique DUTSCHER, Omnifix, catalog number: 921010 )
Sealing film for manual application, roll of 38 m x 100 mm (VWR, PARAFILM® M, catalog number: 291-1213 )
Needles 18 G 0.9 x 40 mm (Dominique DUTSCHER, MicrolanceTM 3, catalog number: 301300 )
Tubing, int diam 1.14 mm (Dominique DUTSCHER, Silicone, catalog number: 4906591 )
Tubing, int diam 3.17 mm (Dominique DUTSCHER, Silicone, catalog number: 4906600 )
125 ml sterile polypropylene containers, red cap (Dominique DUTSCHER, catalog number: 688270 )
Tips 200 µl for pipet (Dominique DUTSCHER, Sartorius, catalog number: 070468 )
Tips 10 µl for pipet (Dominique DUTSCHER, Sartorius, catalog number: 077179 )
Home-made needle holder for aeration
Sterile syringe filters for air, 0.2 µm, 6.4 cm diam (Labomoderne, Midisart, catalog number: RS3320 )
Nichrome wire, stainless steel, round, 22 gauge, 0.64 mm diameter (suppliers for electronic cigarettes)
Valve luer polycarbonate one way (Cole-Parmer, catalog number: EW-30600-01 )
Folding skirted caps, 14.9 mm diam (Dominique DUTSCHER, catalog number: 110603 )
Paper for sterilisation (Dominique DUTSCHER, catalog number: 006950 )
Pinus pinaster (maritime pine), seeds (Vilmorin, catalog number: PPA301 massif landais)
Hebeloma cylindrosporum (ectomycorrhizal basidiomycete) (laboratory’s own collection, available upon request)
Agar-agar (Sigma-Aldrich, catalog number: A7002-500G )
D-glucose (Sigma-Aldrich, catalog number: G8270-1KG )
Concentrated (30%) hydrogen peroxide (H2O2) solution (Sigma-Aldrich, catalog number: 216763-500ML-M )
Manganese(II) sulfate monohydrate (MnSO4·H2O) (Sigma-Aldrich, catalog number: M7899-500G )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: Z0251-100G )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: B6768-500G )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (Sigma-Aldrich, catalog number: C8027-500G )
Calcium nitrate tetrahydrate (Ca(NO3)2·4H2O) (Sigma-Aldrich, catalog number: C2786-500G )
Potassium nitrate (KNO3) (Sigma-Aldrich, catalog number: P8291-500G )
Potassium dihydrogen phosphate (KH2PO4) (EMD Millipore, catalog number: 105108 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: 63138-250G )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333-500G )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080-500G )
Calcium hydroxide (Ca(OH)2) (EMD Millipore, catalog number: 102047 )
Ammonium iron(III) citrate (NH4FeC6H5O7) (Sigma-Aldrich, catalog number: RES20400-A702X )
Calcium sulfate dihydrate (CaSO4·2H2O) (EMD Millipore, catalog number: 102161 )
2-N-morpholino-ethanesulfonic acid, 4-morpholineethanesulfonic acid monohydrate (MES) (Sigma-Aldrich, catalog number: 69892-500G )
Tris(hydroxymethyl)aminomethane (TRIS) (Sigma-Aldrich, catalog number: T1378-500G )
1 N sulfuric acid solution (EMD Millipore, catalog number: 1.09072.1000 )
Agar plates for germination (see Recipes)
0.1 N Ca(OH)2 solution(see Recipes)
Trace elements (1,000 ml) (see Recipes)
Mineral salt base solutions (100 ml) (see Recipes)
N1 + P solution (1,000 ml) (see Recipes)
CaSO4 solution (0.2 mM) (see Recipes)
Interaction medium (1,000 ml) (see Recipes)
Equipment
A pair of stainless steel straight tweezers Wironit, Brucelles type, 130 mm (Dominique DUTSCHER, catalog number: 491037 )
Glass bottles, 250 ml, ISO borosilicate, graduated (Dominique DUTSCHER, catalog number: 046413B )
Glass bottles, 1000 ml, ISO borosilicate, graduated (Dominique DUTSCHER, catalog number: 046415 )
Glass bottles, 2,000 ml, ISO borosilicate, graduated (Dominique DUTSCHER, catalog number: 046416 )
Borosilicate glass funnel, 60° angle, 8 ml (Dominique DUTSCHER, catalog number: 068957 )
A standalone burner (Dominique DUTSCHER, catalog number: 071109 )
Butane gas cartridge for the burner (Dominique DUTSCHER, catalog number: 060415 )
Automatic Piezo electronic gas lighter (Dominique DUTSCHER, catalog number: 076275 )
Air-pumps for aquarium (SuperFish, model: air-box Nr.4 )
Graduated borosilicate glass beaker 400 ml (Dominique DUTSCHER, catalog number: 068939 )
Graduated borosilicate glass beaker 1,000 ml (Dominique DUTSCHER, catalog number: 068942 )
Polypropylene economical beaker 3,000 ml with moulded graduations (Dominique DUTSCHER, catalog number: 391134 )
Soda-lime glass Petri dish 150 x 25 mm (Dominique DUTSCHER, catalog number: 068522 )
Glass tubing, length 150 mm, ext diameter 8 mm (VWR, AR-Glas®, catalog number: SCOR1193467 )
Test tube, borosilicate glass, height 150 mm, internal diameter 20 mm (VWR, Duran, catalog number: 212-1120 )
Stainless steel racks for 6 x 4 tubes of 16-20 mm diameter (Dominique DUTSCHER, catalog number: 854061 )
A nail and cutting pliers
A glass cutting knife (Sigma-Aldrich, catalog number: Z136441 )
One stainless steel spatula, 235 mm (Dominique DUTSCHER, catalog number: 001809 )
Autoclave
Laminar flow cabinet, horizontal (Dominique DUTSCHER, catalog number: 486084 )
Growth cabinet with controlled light, temperature and humidity (Binder, model: KBF P 720 )
Software
Microsoft Excel for calculations
Statistica 7.1 (StatSoft Inc., Tulsa, OK, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Becquer, A., Torres-Aquino, M., Le Guernevé, C., Amenc, L. K., Trives-Segura, C., Staunton, S., Quiquampoix, H. and Plassard, C. (2017). Establishing a Symbiotic Interface between Cultured Ectomycorrhizal Fungi and Plants to Follow Fungal Phosphate Metabolism. Bio-protocol 7(20): e2577. DOI: 10.21769/BioProtoc.2577.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Nutrition
Cell Biology > Tissue analysis > Physiology
Microbiology > Microbe-host interactions > Fungus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,578 | https://bio-protocol.org/exchange/protocoldetail?id=2578&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Labeling Aversive Memory Trace in Mouse Using a Doxycycline-inducible Expression System
Erin E. Koffman
Jianyang Du
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2578 Views: 9844
Reviewed by: Edgar Soria-Gomez
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
A memory trace, also known as a memory engram, is theorized to be a mechanism for physical memory storage in the brain (Silva et al., 2009; Josselyn, 2010) and memory trace is associated with a specific population of neurons (Liu et al., 2012; Ramirez et al., 2013). Labeling and stimulating those neurons will activate the memory trace (Liu et al., 2012; Ramirez et al., 2013). Memory appears to be spread over different regions of the brain rather than being localized to one area. Therefore, the methods used to trace memory have the ability to improve our understanding of neuronal circuits. In this protocol, we introduce a doxycycline-inducible expression system to label the specific neurons associated with the original memory trace.
Keywords: Aversive memory Memory trace TetTag Fos-tTA mouse AAV9-TRE-mCherry Doxycycline-inducible expression system
Background
Memory trace is a theoretical means by which memory is stored as a physical or biochemical change in the brain (Ryan et al., 2015). After the concept of memory trace was formulated by German zoologist Richard Semon at the turn of the twentieth century, the specific process involved in memory storage has been an unsolved topic of debate in the field of neuroscience (Poo et al., 2016). Although the mechanism of memory has been a topic of debate for decades, there has been agreement that specific neurons are utilized in the storage of memories (Liu et al., 2012; Ramirez et al., 2013). In addition, it is believed that memory is not localized to one area, but is instead a mechanism that takes place over many different regions of the brain. Early researchers used a combination of behavioral and surgical approaches to identify memory traces (Bruce, 2001). Although we have learned much from these behavioral and surgical approaches, these methods have not provided us the ability to visualize or identify the target neurons used within a memory trace. In the brain, the expression of immediate-early genes such as Fos, is rapidly upregulated in the specific neurons that are associated with learning and memory formation. Recent studies addressed this issue using the mouse TetTag-Fos driven-GFP mouse model (Reijmers et al., 2007) combined with an adeno-associated virus (AAV9) encoding a TRE-mCherry (Liu et al., 2012; Ramirez et al., 2013). In the interest of continuing the work of identifying target neurons involved in memory trace, we generated Fos-tTA mice from TetTag mice by breeding them with C57BL/6J mice and choosing those that carry only the Fos-tTA transgene. The Fos-tTA mice have Fos promoter-driven expression of nuclear-localized, 2-h half-life EGFP. The Fos promoter also drives expression of the tetracycline transactivator (tTA), which can bind to the tetracycline-responsive element (TRE) site on an injected AAV9-TRE-mCherry virus, resulting in the expression of mCherry. In the Fos-tTA mouse system, application of doxycycline (Dox) inhibits binding of the Fos promoter-driven tTA to the TRE site, preventing target gene expression. We inject the AAV9-TRE-mCherry into the amygdala of the Fos-tTA mice. In the absence of Dox, aversive conditioning activates Fos driving mCherry expression in the targeted neurons (Figure 1). We recently employed this technique to determine if CO2/ASICs enhances the memory trace during retrieval (Du et al., 2017). Other studies have utilized the approaches to identify the specific memory engrams and re-activated it using optogenetics (Liu et al., 2012; Ramirez et al., 2013). In summary, this is a powerful technique to identify a memory trace and will strongly benefit the future study of neuronal circuits, learning, and memories.
Figure 1. Schematic showing how neurons are labeled in mice transgenic for TetTag Fos-tTA and microinjected with the viral vector AAV9-TRE-mCherry. A. Neuronal activity activates the Fos promoter. The Fos promoter drives expression of the tetracycline transactivator (tTA) and shEGFP. The shEGFP protein is rapidly degraded with a 2-h half-life. The tTA protein binds to its target, the tetracycline-responsive element (TRE) site on the microinjected AAV9-TRE-mCherry construct, resulting in the expression of mCherry in neurons. The presence of Dox inhibits tTA from binding to the TRE and thus prevents the expression of mCherry. B. The vector map showing how the pAAV-TRE-mCherry plasmid was constructed. AAV9 viruses containing the construct was packaged by the University of Iowa Gene Transfer Vector Core. The vector map was generated by SnapGene 4.0.
Materials and Reagents
Pipette tips (USA Scientific, catalog numbers: 1112-1820 ; 1110-1800 ; 1111-3840 )
Iodine wipes (Dynarex, catalog number: 1108 )
Alcohol Prep pads (COVIDIEN, catalog number: 5750 )
Butterfly needles, 23 G (Thermo Fisher Scientific, catalog number: 14-840-35)
Manufacturer: Exel International, catalog number: 26706 .
24-well culture plate (Corning, catalog number: 3527 )
Aluminum foil (Thermo Fisher Scientific, catalog number: NC9847171)
Manufacturer: Reynolds Consumer Products, catalog number: 632 .
Staining basket (PELCO Prep-EzeTM 24-well plate Insert) (Ted Pella, catalog number: 36172 )
Super glue (Loctite® Professional Super Glue, Henkel, catalog number: 1365882 )
Single edge razor blade (Fisher Scientific, catalog number: 12-640 )
Coverslip (Fisher Scientific, catalog number: 12-545M )
C57BL/6J mouse (THE JACKSON LABORATORY, catalog number: 000664 )
Note: Mice are group housed before and during the experiment.
B6.Cg-Tg(Fos-tTA,Fos-EGFP*)1Mmay/J mouse (THE JACKSON LABORATORY, catalog number: 018306 )
AAV9-TRE-mCherry virus is produced by the University of Iowa Gene Transfer Vector Core and is commercially available in their stock list (Virus name: AAV2/9-TRE-mCherry, CsCl 1st; Lot # AAV 2679; Tier: 1.45E+12 µg/ml) (Figure 1B)
Note: Aliquots should be stored at -80 °C.
Customized Doxycycline diet, 40 ppm (Envigo, catalog number: TD.10483 )
Note: Stored at 4 °C.
Tissue adhesive, 3 ml (3M, VetbondTM, catalog number: 70200742529 )
Rabbit polyclonal IgG anti-RFP (Rockland Immunochemicals, catalog number: 600-401-379 )
Note: Aliquots should be stored at -20 °C.
Chicken IgY anti-GFP (Thermo Fisher Scientific, catalog number: A10262 )
Mouse anti-NeuN, clone A60 (EMD Millipore, catalog number: MAB377X )
Alexa Fluor 488 goat anti-chicken IgG (H+L) (Thermo Fisher Scientific, catalog number: A-11039 )
Alexa Fluor 568 goat anti-rabbit IgG (H+L) (Thermo Fisher Scientific, catalog number: A-11036 )
Alexa Fluor 647 goat anti-mouse IgG (H+L) (Thermo Fisher Scientific, catalog number: A-21235 )
VectaShield H-1500 (Vector Laboratories, catalog number: H-1500 )
Heparin, 10 kU/10 ml (Sagent Pharmaceuticals, catalog number: 25021-400-10 )
Phosphate-buffered saline (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
20% paraformaldehyde (Electron Microscopy Sciences, catalog number: 15713-S )
SuperBlock (PBS) blocking buffer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 37515 )
Triton X-100 (Fisher Scientific, catalog number: BP151-100 )
Ketamine hydrochloride injection, 10 ml-200 mg/ml (Wildlife Pharmaceuticals, ZooPharm compounding pharmacy)
Xylazine HCl, 30 ml-300 mg/ml (Wildlife Pharmaceuticals, ZooPharm compounding pharmacy)
Isoflurane (Henry Schein, catalog number: 029404 )
100% oxygen cylinder (Airgas, catalog number: UN 1072 )
Alcohol, 140 proof (Decon Labs, catalog number: 2401TP )
PBS/Heparin solution (see Recipes)
PBS/4% paraformaldehyde (PAF) solution (see Recipes)
Blocking solution (see Recipes)
Primary antibody solution (see Recipes)
Ketamine/xylazine cocktail (see Recipes)
Equipment
Anesthesia vaporizer (DRE Medical, model: Drager 19.1 )
Microsyringe, 10 µl, 700 series (Hamilton, catalog number: 80314 )
Small hub removable needles, 33 G, 0.4 inch (Hamilton, catalog number: 7803-05 )
NIR video fear conditioning system for mouse (Med Associates, catalog number: MED-VFC-SCT-M )
Super professional animal clipper (Braintree Scientific, catalog number: CLP-64 800 )
Blunt-ended scissors (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 78702 )
Blunt-ended forceps (Fisher Scientific, catalog number: 13-812-39 )
Iridectomy scissors (Fisher Scientific, catalog number: 50-109-3945)
Manufacturer: Sklar Surgical Instruments, catalog number: 642035 .
Point-ended scissors (Fisher Scientific, catalog number: 13-808-2 )
Hemostats Rankin forceps (Fisher Scientific, catalog number: 13-812-45 )
High-speed rotary micromotor drill kit (Blackstone Industries, Foredom, catalog number: K.1070 )
Microsyringe pump (World Precision Instruments, model: UMP3 )
Microsyringe pump controller (World Precision Instruments, model: Micro4 )
Metal spatula (Fisher Scientific, catalog number: 14-374 )
Vibrating blade microtome (Leica Biosystems, model: Leica VT1000 S )
Shaker (Cole-Parmer, Stuart, model: SSL3 )
Pipettes, single channel, 0.2 µl-1 ml (Gibson, model: PiPETMAN® Classic )
Confocal microscope (Olympus, model: FV1000 )
4 °C refrigerator (Whirlpool, model: WRR56X18FW )
Stereotaxic instrument (KOPF Instruments, model: Model 940 )
Diamond burr grinding bit, Ø0.60 mm (Stoelting, catalog number: 514552 )
Stereo microscope (Amscope, catalog number: SM-5TZ-FRL )
Mini Heat Mat, 4 x 7” (All Living Things®, PETSMART.com)
Software
Imaris Image Analysis Software (Oxford instruments plc.)
ImageJ software (Downloaded from NIH webpage)
SnapGene 4.0 (GSL Biotech LLC)
Procedure
Note: Animal care and procedures met National Institutes of Health standards. Local animal care ethical standards must be adhered to. The University of Iowa Animal Care and Use Committee (ACURF #4041016) and the University of Toledo Institutional Animal Care and Use Committee (Protocol #108791) approved all procedures.
TetTag Fos-tTA mouse generation
The TetTag Fos-tTA mice are generated from the B6.Cg-Tg (Fos-tTA,Fos-EGFP*)1Mmay/J mice by breeding them with C57BL/6J mice and choosing those that carry only the Fos-tTA transgene (Liu et al., 2012; Ramirez et al., 2013). The University of Iowa Genome Editing Core Facility provides mouse genotyping service. The genotyping protocols can be found at https://www.jax.org/strain/018306.
Figure 1 shows how neurons are labeled in mice transgenic for TetTag Fos-tTA and microinjected with the viral vector AAV9-TRE-mCherry.
Viral construct (Figure 1B) and stereotactic injection (Figure 2)
Figure 2. Schematic showing the procedure of labeling the memory retrieval-induced activation of lateral amygdala neurons in the aversive memory trace. A. Mice are fed Dox for 1 week, and then an AAV9 vector encoding mCherry is microinjected into the amygdala. Dox inhibits mCherry expression. Two weeks later, Dox is discontinued, and mice undergo the aversive conditioning protocol. Under those conditions, the Fos promoter will drive both shEGFP and mCherry expression, but shEGFP will rapidly decay. After aversive conditioning, mice immediately resume Dox treatment. One day later, the mice undergo the retrieval protocol. Thirty minutes after that, brain slices are prepared and the shEGFP- and mCherry-positive neurons in the lateral amygdala are determined. B. The stereotaxic system for the surgery of virus injection.
Twelve-week-old mice are fed Dox diet (40 mg/kg) for one week before surgery.
Sterilize the surgery area, instrument, and materials.
Mice are anesthetized using ketamine/xylazine cocktail (see Recipes, 0.1 ml/20 g mouse weight. Intraperitoneal injection) or inhaling 1.5% isoflurane driven by 100% oxygen through an anesthesia machine vaporizer.
Note: Ketamine/xylazine may cause animal death after surgery. Using an anesthesia machine vaporizer is an ideal option. Before surgery, use 2.5-3.5% isoflurane to anesthetize the animals and then lower down the concentration to 1.5% during the surgery.
Shave the surgical site using an electric clipper and sterilize the site using iodine wipes and alcohol pads alternatively. The skin is opened using a blunt-ended scissors. Then a small hole is made using a high-speed rotary micromotor drill with a sterile diamond burr grinding bit.
In the presence of Dox, 0.5 µl AAV9-TRE-mCherry virus is injected vertically (90° to the skull) into the lateral amygdala bilaterally (relative to the bregma: -1.5 mm anteroposterior; ± 3.5 mm mediolateral; -4.3 mm dorsoventral), using a 10 µl Microliter 700 series syringe through a microsyringe pump (UMP3; WPI) (Figure 2B). A stereotaxic microscope is used for the microinjections to the mouse brain.
The injector is slowly moved to the targeted site and should sit for 5 min before starting virus injection.
A microsyringe pump (UMP3; WPI) with a controller (Micro4; WPI) are used to control the speed of the injection. The speed is set as 0.1 µl per minute.
Note: The needle tip is easily clogged by dirt after injection. Clean with water and alcohol each time after use.
The needle remains at the site for 5 min after the end of injection.
Slowly extract the microsyringe from the site and mouse brain.
Note: The microsyringe and needle are wiped with alcohol pads and rinsed with sterile ddH2O after injection.
Glue the skin with Vetbond.
After surgery, mice are housed in their home cages collectively and monitored for two weeks until behavioral testing. The mice will be given Dox diet during the two weeks prior to the behavioral testing.
Anesthetics, Meloxicam and Buprenorphine, are administered to the mice before surgery. Meloxicam is given again 24 h later, and Buprenorphine is given every 12 h for a total 48 h of treatment.
All sites of virus injection are verified histologically based on the immunostaining results after the behavior testing.
Aversive conditioning and memory retrieval (Figure 2)
All the behavioral experiments are performed at the light cycle.
Mice are handled for 30 min on each of 2 days before aversive conditioning.
Twenty-four hours before the TetTag Fos-tTA mice injected with AAV9-TRE-mCherry undergo aversive conditioning, the Dox-containing diet is replaced by a regular diet.
On day 1, mice are habituated to an infrared aversive conditioning chamber (Med Associates Inc.) for 9 min. Then, the mice are presented with six pure tones (80 dB, 2 KHz, 20 sec each). During the last 2 sec of the tone, they receive a foot shock (0.7 mA, 2 sec). The interval between tones is 100 sec. The mice are then returned to their home cage 180 sec after the experiment.
Immediately after aversive conditioning, the Dox-containing diet is restarted.
One day after the aversive conditioning, mice are put into a new context (Figure 3) and receive a retrieval tone or not.
Figure 3. Contexts for aversive conditioning and memory retrieval experiments. To change the odor in different contexts, the chambers and floors are wiped thoroughly with 1% Bleach or 0.25% peppermint.
Transcardial perfusion and whole brain fixation
Thirty minutes after retrieval, the mice are euthanized with an intraperitoneal injection of overdose ketamine/xylazine cocktail (0.2 ml/20 g mouse weight).
Place the animal on its back on a dissection board, and pin out all four feet.
Use a blunt-end scissors to open the rib cage and expose the whole heart.
Hold the heart gently with blunt forceps. Hold the butterfly needle with hemostats. Insert the needle into the left ventricle (no more than ¼ inch).
Note: Gently insert the needle and make sure the needle stays in the left ventricle.
Turn on ice-cold PBS/Heparin solution perfusion (see Recipes). While supporting the heart with the needle and hemostats, snip the right atrium.
Carefully unpin the front feet and skin flap.
Continue the perfusion of PBS/Heparin until blood is invisible in the liver (more than 5 min).
Note: Make sure blood is completely gone.
Switch the perfusion from PBS/Heparin to ice-cold PBS/4% PAF. Keep running the PBS/4% PAF for at least 5 min.
Notes:
The mouse tail shows tremble when perfused with PAF efficiently.
4% PAF/PBS is not stable at 4 °C. Make a fresh solution from 20% PAF every week.
Open the skull with scissors and forceps. Extract the whole brain using a metal spatula.
Immerse the brain in 10 ml of PBS/4% PAF and store at 4 °C for 24 h.
Brain slices preparation
The fixed brain is glued to the plate of the vibratome and rinse with ice-cold PBS.
The brain is cut coronally into 50 µm sections from -1.54 mm to -2.34 mm anteroposterior. The settings of the Leica VT1000 vibratome: Speed: 4; Frequency: 5. Amygdala slices are identified according to a mouse brain atlas book (The Mouse Brain in Stereotaxic Coordinates, 3rd edition, 2008). Six coronal amygdala slices are microdissected from the brain slices using two 33 G syringe needles.
Immunohistochemistry and cell counting
Transfer the amygdala slices into a 24-well culture plate (one slice per well) by brush and wash for 5 min, three times in 4 °C PBS on a shaker.
Note: The plate is covered with aluminum foil throughout the immunostaining experiment.
Pipette 2 ml of blocking solution (see Recipes) into each well containing the staining basket. Place plate on a shaker at room temperature for one hour.
Transfer each basket into a new well with 1 ml of primary antibody solution (see Recipes). Antibodies: Rabbit polyclonal IgG anti-RFP (Rockland) 1:1,000 dilution; Chicken IgY anti-GFP (Invitrogen) 1:1,000 dilution. Mouse anti-NeuN antibody, clone A60 1:1,000 dilution. Place the plate on a shaker in 4 °C for 12 h.
Transfer each basket into a new well with 2 ml of PBS on a shaker at room temperature. Wash for 10 min, three times.
Transfer each basket into a new well with 1 ml of secondary antibody solution. Antibody: Alexa Fluor 488 Goat anti-chicken IgG (H+L) (Invitrogen); Alexa Fluor 568 Goat anti-rabbit IgG (H+L) (Invitrogen); Alexa Fluor 647 Goat anti-mouse IgG (H+L) (Invitrogen), 1:200 dilution. Place plate on a shaker at room temperature for one hour.
Transfer each basket into a new well with 2 ml of PBS on a shaker at room temperature. Wash for 10 min, three times.
Use a wide mouth pipet to transfer slices to the slide and remove the extra solution. Then apply 3-6 drop mounting solution (VectaShield HardSet Mounting Medium with DAPI) containing DAPI to the edge of the slice, and then cover it with a coverslip.
Check the sample on a confocal microscope and store the slides in 4 °C refrigerator.
Count mCherry-positive and shEGFP-positive neurons from 6 coronal amygdala slices (-1.54 mm to -2.34 mm anterioposterior) for each mouse. Co-localization of shEGFP and mCherry is analyzed by Imaris and ImageJ.
Data analysis
Aversive conditioning labeled amygdala neurons with long-lasting mCherry and with a short-half life (2 h) nuclear-localized EGFP (shEGFP) (Figure 4). Immediately after aversive conditioning, mice began receiving Dox, which prevents expression of mCherry, but not shEGFP. Twenty-four hours later, we delivered a single retrieval tone or not. Thirty minutes after that, we harvested the amygdala and imaged shEGFP- and mCherry-positive cells (Figure 4). Compared to the control, a single retrieval tone increased the percentage of mCherry-positive cells that were also shEGFP-positive (Figure 4). These findings indicate that the retrieval cue reactivated neurons bearing the memory trace.
Figure 4. Representative images of amygdala neurons that are labeled by mCherry after aversive conditioning and by GFP after retrieval as well as NeuN (blue). White dash line circles the area of the amygdala. White arrows indicate examples of colocalization of mCherry and shEGFP. mCherry- and shEGFP-positive cells are also NeuN-positive. Right, data are the percentage of mCherry-positive cells that were also shEGFP-positive. Data are mean ± SEM. n = 5 mice for each group. * indicates P < 0.05 by ANOVA with Tukey’s post hoc multiple comparisons.
Recipes
PBS/Heparin solution (10 U/ml Heparin)
To make 500 ml PBS/Heparin, add 5 ml Heparin stock (10 kU/10 ml per vial) to 495 ml 1x PBS
PBS/4% paraformaldehyde (PAF) solution
To make 100 ml 4% PFA in 1x PBS, mix 10 ml 10x PBS and 20 ml 20% PAF. Add double distilled water to make the final volume up to 100 ml
Note: 4% PAF diluted into PBS can only be stable for one week at 4 °C.
Blocking solution
SuperBlock blocking buffer
Triton X-100 (final con. 0.2%)
Primary antibody solution
Mix equal volume of SuperBlock blocking buffer and PBS, and then add Triton X-100 (final con. 0.2%)
Ketamine/xylazine cocktail
87.5 mg/kg ketamine
2.5 mg/kg xylazine
Acknowledgments
We thank Thomas Moninger, Theresa Mayhew, and Sarah Horgen for assistance. We thank Drs. Susumu Tonegawa, Xu Liu, and Steve Ramirez for providing the TRE-mCherry plasmid and their previous works (Liu et al., 2012; Ramirez et al., 2013). JD is supported by the American Heart Association (15SDG25700054) and the University of Toledo start-up fund and NIH 5R01MH113986.
References
Bruce, D. (2001). Fifty years since Lashley’s In search of the Engram: refutations and conjectures. J Hist Neurosci 10(3): 308-318.
Du, J., Price, M. P., Taugher, R. J., Grigsby, D., Ash, J. J., Stark, A. C., Hossain Saad, M. Z., Singh, K., Mandal, J., Wemmie, J. A. and Welsh, M. J. (2017). Transient acidosis while retrieving a fear-related memory enhances its lability. eLife 6.
Josselyn, S. A. (2010). Continuing the search for the engram: examining the mechanism of fear memories. J Psychiatry Neurosci 35(4): 221-228.
Liu, X., Ramirez, S., Pang, P. T., Puryear, C. B., Govindarajan, A., Deisseroth, K. and Tonegawa, S. (2012). Optogenetic stimulation of a hippocampal engram activates fear memory recall. Nature 484(7394): 381-385.
Poo, M. M., Pignatelli, M., Ryan, T. J., Tonegawa, S., Bonhoeffer, T., Martin, K. C., Rudenko, A., Tsai, L. H., Tsien, R. W., Fishell, G., Mullins, C., Goncalves, J. T., Shtrahman, M., Johnston, S. T., Gage, F. H., Dan, Y., Long, J., Buzsaki, G. and Stevens, C. (2016). What is memory? The present state of the engram. BMC Biol 14: 40.
Ramirez, S., Liu, X., Lin, P. A., Suh, J., Pignatelli, M., Redondo, R. L., Ryan, T. J. and Tonegawa, S. (2013). Creating a false memory in the hippocampus. Science 341(6144): 387-391.
Reijmers, L. G., Perkins, B. L., Matsuo, N. and Mayford, M. (2007). Localization of a stable neural correlate of associative memory. Science 317(5842): 1230-1233.
Ryan, T. J., Roy, D. S., Pignatelli, M., Arons, A. and Tonegawa, S. (2015). Memory. Engram cells retain memory under retrograde amnesia. Science 348(6238): 1007-1013.
Silva, A. J., Zhou, Y., Rogerson, T., Shobe, J. and Balaji, J. (2009). Molecular and cellular approaches to memory allocation in neural circuits. Science 326(5951): 391-395.
Copyright: Koffman and Du. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Koffman, E. E. and Du, J. (2017). Labeling Aversive Memory Trace in Mouse Using a Doxycycline-inducible Expression System. Bio-protocol 7(20): e2578. DOI: 10.21769/BioProtoc.2578.
Du, J., Price, M. P., Taugher, R. J., Grigsby, D., Ash, J. J., Stark, A. C., Hossain Saad, M. Z., Singh, K., Mandal, J., Wemmie, J. A. and Welsh, M. J. (2017). Transient acidosis while retrieving a fear-related memory enhances its lability. eLife 6.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Neuroscience > Neuroanatomy and circuitry
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,579 | https://bio-protocol.org/exchange/protocoldetail?id=2579&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Trimolecular Fluorescence Complementation (TriFC) Assay for Direct Visualization of RNA-Protein Interaction in planta
Jun Sung Seo
NC Nam-Hai Chua
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2579 Views: 11075
Edited by: Tie Liu
Reviewed by: Alexandros AlexandratosHonghong Wu
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
RNA-Protein interactions play important roles in various eukaryotic biological processes. Molecular imaging of subcellular localization of RNA/protein complexes in plants is critical for understanding these interactions. However, methods to image RNA-Protein interactions in living plants have not yet been developed until now. Recently, we have developed a trimolecular fluorescence complementation (TriFC) system for in vivo visualization of RNA-Protein interaction by transient expression in tobacco leaves. In this method, we combined conventional bimolecular fluorescence complementation (BiFC) system with MS2 system (phage MS2 coat protein [MCP] and its binding RNA sequence [MS2 sequence]) (Schonberger et al., 2012). Target RNA is tagged with 6xMS2 and MCP and RNA binding protein are fused with YFP fragments. DNA constructs encoding such fusion RNA and proteins are infiltrated into tobacco leaves with Agrobacterium suspensions. RNA-Protein interaction in vivo is observed by confocal microscope.
Keywords: Long non-coding RNA RNA-Protein interaction TriFC Tobacco transient expression
Background
Recently, a variety of types of long-noncoding RNAs (lncRNAs) has been identified and shown to play important roles in transcriptional regulation and chromatin modification (St Laurent et al., 2015). So far, most of the molecular mechanisms for lncRNA-mediated functions are closely related with RNA-Protein interactions (St Laurent et al., 2015). Therefore, an experiment for RNA-Protein interaction is a key step in functional study of lncRNAs. In plants, molecular functions of lncRNAs are only beginning to be characterized, and the molecular basis of lncRNA-mediated gene regulation is still poorly understood. Though techniques for RNA visualization in plants have been well developed, visual assay for RNA-Protein interaction in plant is still poorly developed (Christensen et al., 2010). To develop the visual assay for RNA-Protein interaction in plants, we modified and combined MS2 system for RNA imaging technique with conventional BiFC system for protein-protein interaction (Schonberger et al., 2012) (Figure 1D). We generated binary Gateway vectors (pBA3130, 3132, 3134, and 3136) for transient BiFC assay (Seo et al., 2017) and got binary Gateway vectors (pBA-GW-6xMS2 and pBA-6xMS2-GW) for RNA tagging from Dr. Ulrich Z. Hammes (Schonberger et al., 2012). We tested and confirmed this TriFC assay was working well in plants with lncRNA, ELENA1, and MED19a protein (Seo et al., 2017). TriFC assay in plants will provide new insights in interaction between lncRNAs and proteins.
Materials and Reagents
Pipette tips (Thermo Fisher Scientific, Fisher ScientificTM BasixTM Universal Tips)
Fisherbrand sterile 100 x 15 mm polystyrene Petri dish (Fisher Scientific, catalog number: FB0875713 )
1 ml syringes (BD, catalog number: 302100 )
50 ml Falcon tubes (Corning, Falcon®, catalog number: 352070 )
Agrobacterium tumefaciens (strain GV3101)
Nicotiana benthamiana (N. benthamiana) plants; 2-4 weeks old (6-10 leaves stage)
Gateway entry clones for RNA, RNA binding protein (RNA-BP), and MCP
TriFC Gateway destination vectors (pBA3130, 3132, 3134, 3136, pBA-GW-MS2, and pBA-MS2-GW)
LR clonase II (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11791100 )
LB medium powder (MP Biomedicals, catalog number: 113002082 )
Spectinomycin (1,000x; 100 mg/ml) (Sigma-Aldrich, catalog number: S4014 )
Gentamycin (1,000x; 50 mg/ml) (Sigma-Aldrich, catalog number: G1264 )
Kanamycin (1,000x; 100 mg/ml) (Sigma-Aldrich, catalog number: K0200000 )
Bacto agar (BD, BactoTM, catalog number: 214010 )
Ethanol or DMSO
MES (Sigma-Aldrich, catalog number: M8250 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
LB media (see Recipes)
LB agar media (see Recipes)
100 mM acetosyringone stock (see Recipes)
LB-MES (pH 5.6) (see Recipes)
Resuspension solution (see Recipes)
Equipment
PIPETMAN ClassicTM Pipettes (Gilson, model: P1000, P100, P20, catalog number: F123602 , F123615 , F123600 )
Centrifuge for 50 ml tubes (Beckman Coulter, model: Avanti® J-20XP )
Spectrometer (Biochrom, model: Ultrospec 2100 pro )
Confocal laser scanning microscope (ZEISS, model: LSM 780 )
Autoclave (TOMY DIGITAL BIOLOGY, model: ES-215 )
Laminar flow cabinet (NuAire, model: NU-440-400E )
Incubator (MMM Medcenter Einrichtungen, model: INCUCELL 55 )
Shaking incubator (Infors, model: Multitron Standard )
Software
ZEN (Image analysis program for ZEISS confocal microscope)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Seo, J. S. and Chua, N. (2017). Trimolecular Fluorescence Complementation (TriFC) Assay for Direct Visualization of RNA-Protein Interaction in planta. Bio-protocol 7(20): e2579. DOI: 10.21769/BioProtoc.2579.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Are there too many false positives for the MS2 phage coat protein in this system?
1 Answer
3 Views
Dec 31, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
258 | https://bio-protocol.org/exchange/protocoldetail?id=258&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification of His-ubiquitin Proteins from Mammalian Cells
Vanesa Olivares Illana
RF Robin Farhaeus
Published: Vol 2, Iss 17, Sep 5, 2012
DOI: 10.21769/BioProtoc.258 Views: 21810
Original Research Article:
The authors used this protocol in Jan 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2012
Abstract
This protocol is used to purify His-tag ubiquitin conjugated protein. In this particular case, cells were transfected with His-tag ubiquitin and p53 which allowed us to purify using His-tag and reveal the WB using antibodies against p53 to see just the p53-ubiquitinate. The present protocol can be used in general for His-tag proteins expressed in mammalian cells.
Materials and Reagents
EDTA free protease inhibitors (F. Hoffmann-La Roche, catalog number: 05892988001 )
Proteasome inhibitor MG-132 (Calbiochem®, catalog number: 474790-5MG )
Phosphate buffered saline (PBS)
Tris
Ni-NTA-Agarose beads (QIAGEN, catalog number: 30210 )
Urea
Guanidinium-HCl ( Sigma-Aldrich, catalog number: G4505-25G )
Imidazole (Sigma-Aldrich, catalog number: 12399 )
Triton X-100
Glycerol
β-mercaptoethanol
SDS
Bromophenol blue
Lysis buffer (see Recipes)
Wash buffer (see Recipes)
Elution buffer (see Recipes)
4x laemmeli buffer (see Recipes)
Equipment
Centrifuges
Sonicator
Western blotting equipment
Tissue culture plates
1.5 ml eppendorf tube
15 ml falcon tube
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Illana, V. O. and Farhaeus, R. (2012). Purification of His-ubiquitin Proteins from Mammalian Cells. Bio-protocol 2(17): e258. DOI: 10.21769/BioProtoc.258.
Download Citation in RIS Format
Category
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,580 | https://bio-protocol.org/exchange/protocoldetail?id=2580&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Monitoring Xylem Hydraulic Pressure in Woody Plants
Guillaume Charrier
RB Régis Burlett
GG Gregory Gambetta
SD Sylvain Delzon
JD Jean-Christophe Domec
FB François Beaujard
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2580 Views: 8751
Edited by: Marisa Rosa
Reviewed by: Valérie CornuaultCarsten Patrick Ade
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
Xylem sap circulates under either positive or negative hydraulic pressure in plants. Negative hydraulic pressure (i.e., tension) is the most common situation when transpiration is high, and several devices have been developed to quantify it accurately (e.g., Scholander pressure chamber, psychrometers). However, a proper measurement of positive xylem sap pressures may be critical when pressure is generated by the root system, allowing vessels to be refilled. Here, we describe two different methods to monitor positive xylem bulk pressure: the pressure gauge which can only be set onto a rootstock or a side branch and the point pressure sensor, which can allow measurements from a functioning plant without detopping or cutting.
Keywords: Pressure Tension Water status Xylem water potential
Background
Although plants can recover from critical levels of xylem embolism, < 50% loss of hydraulic conductivity in conifers (Brodribb and Cochard, 2009) and < 88% in angiosperms (Urli et al., 2013), the exact mechanism is still under debate. The ascent of sap is driven by the evaporative demand from the atmosphere, which generates a negative pressure (i.e., tension) in the water column and hydrogen bonds between molecules (i.e., cohesion) pull the sap through the plant via the well accepted cohesion-tension theory (Dixon, 1896; Angeles et al., 2004). However, positive xylem sap pressure can be recorded under particular conditions, for example water-saturated soil combined with very low transpiration. This mechanism has been shown to refill embolized vessels in springtime (Sperry et al., 1994) and in species that experienced freeze-thaw induced embolism (Charrier et al., 2013 and 2014). Refilling of embolized vessels has been hypothesized to occur under both positive and negative xylem sap pressures in Laurus sp or Vitis sp, for example (Salleo et al., 1996). However, the ‘refilling under tension’ mechanism is inconsistent with the cohesion-tension theory (Zwieniecki and Holbrook, 2000). Moreover, recent works suggest that refilling occurs only under positive pressure in Vitis (Charrier et al., 2016). The dynamic changes in xylem sap pressure therefore need to be explored at both the seasonal and diurnal scale while maintaining as much as possible the integrity of the hydraulic architecture of the plant.
Although the use of stem psychrometers has been extensively described since the 80’s (e.g., Dixon and Tyree, 1984; Tyree and Dixon, 1986), the measurement of positive xylem sap pressure is relatively rare. The protocol described here allows the quantification of the spatio-temporal pattern of bulk xylem sap water potential under positive pressures, and even moderate tensions (maximum of 0.05 MPa) along the water column using non-invasive sensors (i.e., point pressure sensors).
Materials and Reagents
Parafilm M (Bemis, catalog number: PM996 )
Stainless-steel hypodermic needle 21 G 1 ½” (Terumo Medical, catalog number: 8AN2138R1 )
Union–1/16” PEEK (Interchim, catalog number: 869290 )
Lock ring (Ark-Plas Products, catalog number: LEX66-PP0 )
Threaded male Luer connector 10-32 UNF (Ark-Plas Products, catalog number: LGX74-PP0 )
Reinforced PVC flexible tubes (RS Components, catalog number: 440-874 )
Zip ties e.g., RS Pro Black Nylon Non-Releasable Cable Tie, 300 x 4.8 mm (RS Components, catalog number: 233-487 )
4-way Luer Lock Stopcock, Male-Male-Female (Cole-Parmer, catalog number: EW-30600-04 )
Stainless steel high quality single edge blades (e.g., Mure & Peyrot, catalog number: 144.3 )
Nylon Hose clips (RS Components, catalog number: 291-587 )
Cutting disk (RS Components, catalog number: 448-7439 )
HSS Drill bit, 0.8 mm diameter (e.g., RS Components, catalog number: 457-651 )
Note: Most parts are available from the laboratory equipment suppliers.
Equipment
High resolution datalogger (e.g., Campbell Scientific, model: CR1000 )
Pressure transducer 30Psi (Honeywell International, catalog number: 26PCDFA6D )
Stabilized power supply 12V DC (e.g., Traco Power, catalog number: TML 20212C )
Hand-held driller
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Charrier, G., Burlett, R., Gambetta, G. A., Delzon, S., Domec, J. C. and Beaujard, F. (2017). Monitoring Xylem Hydraulic Pressure in Woody Plants. Bio-protocol 7(20): e2580. DOI: 10.21769/BioProtoc.2580.
Charrier, G., Torres-Ruiz, J. M., Badel, E., Burlett, R., Choat, B., Cochard, H., Delmas, C. E., Domec, J. C., Jansen, S., King, A., Lenoir, N., Martin-StPaul, N., Gambetta, G. A. and Delzon, S. (2016). Evidence for hydraulic vulnerability segmentation and lack of xylem refilling under tension. Plant Physiol 172(3): 1657-1668.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,581 | https://bio-protocol.org/exchange/protocoldetail?id=2581&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Uptake Assays in Xenopus laevis Oocytes Using Liquid Chromatography-mass Spectrometry to Detect Transport Activity
MJ Morten Egevang Jørgensen
CC Christoph Crocoll
BH Barbara Ann Halkier
HN Hussam Hassan Nour-Eldin
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2581 Views: 9200
Edited by: Tie Liu
Reviewed by: Bin Tian
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Xenopus laevis oocytes are a widely used model system for characterization of heterologously expressed secondary active transporters. Historically, researchers have relied on detecting transport activity by measuring accumulation of radiolabeled substrates by scintillation counting or of fluorescently labelled substrates by spectrofluorometric quantification. These techniques are, however, limited to substrates that are available as radiolabeled isotopes or to when the substrate is fluorescent. This prompted us to develop a transport assay where we could in principle detect transport activity for any organic metabolite regardless of its availability as radiolabeled isotope or fluorescence properties.
In this protocol we describe the use of X. laevis oocytes as a heterologous host for expression of secondary active transporters and how to perform uptake assays followed by detection and quantification of transported metabolites by liquid chromatography-mass spectrometry (LC-MS). We have successfully used this method for identification and characterization of transporters of the plant defense metabolites called glucosinolates and cyanogenic glucosides (Jørgensen et al., 2017), however the method is usable for the characterization of any transporter whose substrate can be detected by LC-MS.
Keywords: Xenopus laevis oocytes Uptake assays Transporter characterization Liquid chromatography-mass spectrometry
Background
Oocytes from the African clawed frog (Xenopus laevis) is a well-established expression system for heterologous expression and characterization of membrane proteins (i.e., transporters and channels). The X. laevis oocyte express few endogenous membrane proteins and has a low background transport activity. Furthermore, secondary active transporters from plants (Boorer et al., 1992; Theodoulou and Miller, 1995; Nour-Eldin et al., 2006), animals (Sumikawa et al., 1981; Sigel, 1990) and microbes (Calamita et al., 1995; Wahl et al., 2010) have been successfully expressed in X. laevis oocytes, showing that this system is widely applicable to characterize transporters from any organism.
A transport assay requires the expression of the transport protein in a system capable of folding the protein correctly and localizing it to a membrane across which movement of substrate can be detected. Due to the minute amounts moved, researchers have typically used radiolabeled substrates for transport assays. By washing oocytes after incubation and scintillation counting of the oocytes interior accumulation of substrate inside the oocyte could be detected. We have previously utilized this method to identify and characterize sucrose and glucose transporters from Arabidopsis thaliana using the Xenopus oocytes system (Nour-Eldin et al., 2006; Norholm et al., 2006). However, for identification and characterization of plant specialized metabolite transporters, it can be very challenging to generate radiolabeled isotopes of a target substrate. To overcome this challenge we developed a protocol for detecting and quantifying transport of specialized metabolites into X. laevis oocytes by use of LC-MS. Use of this method has allowed us to expand the inventory of assayable substrates to anything that can be detected and quantified by the LC-MS system applied.
Materials and Reagents
Pipette filter tips (e.g., Biotix, catalog numbers: M-0012-9FC , M0020-9FC , M-0300-9FC , M-1250-9FC96 )
Petri dishes for oocyte washing (e.g., 90 mm diameter, Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 263991 )
24-well NuncTM cell-culture dish (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 142475 )
Pasteur pipette for oocyte handling
1.5 ml tubes (e.g., 1.5 ml microfuge tubes, ‘Easy Fit’, Almeco, catalog number: 02.023.01001 )
0.22 μm PVDF-based filter plate (EMD Millipore, catalog number: MSGVN2250 )
LC-MS vials
Oocytes expressing transporter(s) of interest and water-injected control oocytes (see Jørgensen et al., 2016 for protocols on making and injecting cRNA and handling oocytes)
Notes:
A high-affinity glucosinolate transporter from Arabidopsis thaliana, ARABIDOPSIS THALIANA GLUCOSINOLATE TRANSPORTER-1 (AtGTR1) (UniProt, catalog number: Q944G5), is used as an example here.
Oocytes can be purchased from Ecocyte-biosciences (http://ecocyte-us.com/).
Substrate
Note: We use 4-methylthiobutyl glucosinolate (4MTB) and 3-indolylmethylglucosinolate (I3M) obtained from C2 Bioengineering (http://www.glucosinolates.com/) and CFM Oskar Tropitzsch GmbH, Marktredwitz (http://www.cfmot.de/), respectively. Cyanogenic glucoside linamarin can be purchased from Santa Cruz Biotechnology.
Methanol for HPLC ≥99.9% (Sigma-Aldrich, catalog number: 34860 )
Formic acid, reagent grade (Sigma-Aldrich, catalog number: F0507 )
Acetonitrile for HPLC (Sigma-Aldrich, catalog number: 34851 )
Sodium chloride (NaCl) (Duchefa Biochemie, catalog number: S0520.5000 )
Potassium chloride (KCl) (Merck, catalog number: 1.04936.1000 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670 )
Calcium chloride dihydrate (CaCl2·2H2O) (EMD Millipore, catalog number: 1.02382 )
HEPES (Sigma-Aldrich, catalog number: H4034 )
Tris-HCl solutions (Trisma hydrochloride) (Sigma-Aldrich, catalog number: T3253 )
MES (Sigma-Aldrich, catalog number: M8250 )
Kulori media (pH 7.4) (see Recipes)
Kulori media (pH 5.6) (see Recipes)
Equipment
17 °C incubator for oocyte storage (BINDER, model: Model KB 23 )
Pipettes (10 µl, 50 µl, 200 µl and 1,000 µl)
Table top centrifuge for 1.5 ml microfuge tubes (e.g., Ole Dich Instrumentmakers, model: Ole Dich 157 , max speed 20,000 x g, refrigerated)
Kinetex 1.7u XB-C18 column (100 x 2.1 mm, 1.7 μm, 100 Å) (Phenomenex, catalog number: 00D-4499-AN )
LC-MS Triple Quadrupole system for sample analysis/data acquisition (Advance UHPLC coupled to an EVOQ Elite Triple Quadrupole mass spectrometer) (Bruker, model: EVOQ EliteTM Triple Quadrupole )
Software
Microsoft Excel for data analysis and presentation
Bruker MS Workstation software (Version 8.2, Bruker, Bremen, Germany)
Procedure
In the following, we will provide an example of a typical assay where we test the uptake activity of a given transport protein towards glucosinolates. We test seven oocytes that have been injected with cRNA for our transporter of interest and seven oocytes which have been injected with water to be used as negative control. A set of negative control oocytes should be included for every compound to be tested.
Assay preparation
Prepare seven oocytes expressing the transporter of interest (injected with Complimentary RNA (cRNA) [25-50 ng] and incubated at 17 °C for 72 h prior) and seven oocytes that have been injected with water to be used as control oocytes (and incubated at 17 °C for 72 h prior). Injection volume is typically 50 nl.
Note: See Jørgensen et al., 2016 for a detailed protocol for cRNA generation and injection and for oocyte handling from injection to assay.
24-well NuncTM cell-culture dish plates are prepared as shown in Figure 1. The pre-incubation well (Figure 1B) is filled with 2 ml Kulori media (pH 5.6, see Recipes). The assay well (Figure 1C) is filled with 1 ml Kulori media (pH 5.6) with substrate (for AtGTRs typically between 100 µM and 1 mM glucosinolate to measure uptake in the high-affinity range).
Note: A mastermix of Kulori pH 5.6 media and substrate is prepared so exactly that the same concentration of substrate is found in each well.
Figure 1. 24-well assay plates suitable for 12 assays at a time
Three Petri dishes are filled with cold (4 °C) Kulori media (pH 7.4, see Recipes) and stored in fridge.
Number two sets of 12 microfuge tubes from 1-12. Tubes numbered 1-6 will be used for samples from oocytes expressing the transporter. Tubes numbered 7-12 will be used for the samples from the control oocytes.
Note: Use different colours for the two sets of tubes (e.g., the first set of 12 tubes are labelled with a black marker and the second set is marked with a red marker).
To keep track of the assay during the experiment and for laboratory book reporting, we recommend using an assay schematic as shown in Table 1.
Table 1. Assay schematic
Assay
To start the first transport assay, preincubate 6-7 oocytes expressing AtGTR1 in the preincubation well containing Kulori media (pH 5.6) for 5 min (Figure 1B). Subsequently, use a Pasteur pipette to transfer oocytes to the assay well containing Kulori media (pH 5.6) with substrate (Figure 1C) and incubate for 2-180 min at room temperature. Make sure to transfer oocytes in only one drop from the pipette (see Figure 2). Wait three minutes and start the next transport assay. Continue this until all the assays you want to run are running. The duration of the assay is determined by the transport activity and should be determined empirically.
Notes:
We start the assay with 1-2 oocytes more than we want to analyze on the LC-MS as sometimes 1-2 oocytes are lost during the washing steps.
Transfer the oocytes in only one drop of the Pasteur pipette.
Note: The length of the assay depends on the activity of the transporter and how well the substrate is ionized and thereby detected by the LC-MS system. Consequently it needs to be determined empirically and minimized as much as possible (i.e., you need to start by running a long assay and then gradually reduce the incubation time). This is especially important if transport kinetics are to be performed (and electrophysiology is not an option) as kinetic measurements need to be performed in the linear range of transport.
Figure 2. Process of transferring oocytes from one well to another using a Pasteur pipette. Please note how the oocytes are allowed to settle in the tip and are expelled in a single drop.
With a < 2 µl pipette, take out 1 µl of each assay media (Figure 1C) and add it to the Eppendorf tube for the media sample (in this example tube 1).
Stop the assay by adding 1 ml cold (4 °C) Kulori media (pH 7.4) to the assay well and immediately transfer the oocytes to the first Petri dish using a Pasteur pipette. Make sure to transfer oocytes in only one drop from the pipette and empty the rest of the solution in the pipette into the waste. Subsequently, and in the same way move the oocytes to Petri dish two and then Petri dish three to wash away any external substrate. This washing procedure effectively dilutes the substrate in the external uptake media to below detection levels.
Note: Each time make sure to only transfer the oocytes with one drop of Kulori media.
Transfer one oocyte to each of the 1.5 ml Eppendorf tubes numbered 2-6 and carefully remove excess wash media with a 100 µl pipette from each tube.
Note: Removal of excess wash media is a key step. Complete removal ensures low variability between replicates.
Add 50 μl of 50% MeOH (with an appropriate internal standard. For glucosinolate transport assays, we use 1,250 nM of the glucosinolate sinigrin as it is commercially available) to the five oocyte samples and the media sample. Immediately homogenate the oocytes using a 100 µl pipette.
Note: Adding MeOH and waiting will result in oocytes that cannot be homogenated due to the dehydration by MeOH. It is therefore important that the homogenization is carried out immediately.
Leave the homogenate for two hours at -20 °C and then centrifuge the samples at 20,000 x g for 15 min at 4 °C to precipitate proteins. Transfer 40 µl of the supernatant to the corresponding tube in the second set of numbered tubes and dilute with 60 μl H2O.
Filter the diluted samples through a 0.22 μm PVDF based filter plate (EMD Millipore) and subsequently analyze by analytical LC-MS.
LC-MS analysis of glucosinolates and cyanogenic glucosides
Analysis can be performed by any type of UHPLC coupled to a Triple Quadrupole mass spectrometer. Separation of analytes is routinely done by reverse phase liquid chromatography using a C18-type column using MilliQ-grade water with 0.05% formic acid and acetonitrile with 0.05% formic acid as gradient solvents. Electrospray ionization (ESI) is then followed by detection by the MS using Multi Reaction Monitoring (MRM) which allows for detection of analytes to very low concentrations depending on ionization efficiency and other instrument parameters. Typically, analytes such as glucosinolates have a lower limit of detection (LLOD) around 5-10 nM (approx. 5-10 fmol on column) (Crocoll et al., 2016) while cyanogenic glucosides have a LLOD of around 200-250 nM (approx. 200-250 fmol on column). The lower limit of quantification (LLOQ) is around 20-50 nM and 400-500 nM for glucosinolates and cyanogenic glycosides, respectively.
Here, chromatography was performed on an Advance UHPLC system (Bruker, Bremen, Germany). Separation was achieved on a Kinetex 1.7u XB-C18 column (100 x 2.1 mm, 1.7 μm, 100 Å, Phenomenex, Torrance, CA, USA). Formic acid (0.05%) in water and acetonitrile (supplied with 0.05% formic acid) were employed as mobile phases A and B, respectively. The elution profile was: 0-0.2 min, 2% B; 0.2-1.8 min, 2-30% B; 1.8-2.5 min 30-100% B, 2.5-2.8 min 100% B; 2.8-2.9 min 100-2% B and 2.9-4.0 min 2% B. The mobile phase flow rate was 400 μl/min. The column temperature was maintained at 40 °C. The liquid chromatography was coupled to an EVOQ Elite Triple Quadrupole mass spectrometer (Bruker, Bremen, Germany) equipped with an electrospray ion source (ESI) operated in combined positive and negative ionization mode. The instrument parameters were optimized by infusion experiments with pure standards. The ion spray voltage was maintained at 5,000 V or -4,000 V for cyanogenic glucoside and glucosinolate analysis, respectively. Cone temperature was set to 300 °C and cone gas to 20 psi. Heated probe temperature was set to 180 °C and probe gas flow to 50 psi. Nebulizing gas was set to 60 psi and collision gas to 1.6 mTorr. Nitrogen was used as probe and nebulizing gas and argon as collision gas. Active exhaust was constantly on. Multiple Reaction Monitoring (MRM) was used to monitor analyte parent ion → product ion transitions: MRM transitions were chosen based on direct infusion experiments. Detailed values for mass transitions can be found in supplemental Table S3 of Jørgensen et al. (2017). Both Q1 and Q3 quadrupoles were maintained at unit resolution. Bruker MS Workstation software (Version 8.2, Bruker, Bremen, Germany) was used for data acquisition and processing. Linearity in ionization efficiencies was verified by analyzing dilution series of standard mixtures. Quantification of all compounds was achieved by use of sinigrin as an internal standard.
LC-MS analysis–preparation of standards
The LC-MS analysis parameters are highly dependent on the type of equipment available, the setup of the LC-MS system and the compound to be analyzed. It is therefore important to consult the person running the LC-MS equipment prior to starting assays.
We utilize an internal standard (e.g., sinigrin) and an external standard curve to (semi)quantitatively measure the amount of glucosinolates that is taken up into oocytes during the assay. Based on the external standard curve we can calculate a response factor that we can then use to calculate a sample’s substrate concentration. Using an internal standard for analysis has several advantages over only using an external standard curve, e.g., correction for handling during extraction, correction for technical variation during LC-MS acquisition and it does not require running an external standard curve every single time which reduces sample number and running costs (especially when considering triple injection of a standard curve with 10-12 concentrations covering the linear range of detection). The linear range of modern mass spectrometers often covers 4-5 orders of magnitude (e.g., from as low as 1 nM to up 100 µM). The linearity should always be checked as some analytes might show a non-linear behavior or the linear range is reduced.
Prepare your standard dilution series in 20% MeOH (same as samples to be analyzed). The range of your standard dilution series should be determined empirically based on your substrates ionization efficiency and the transporter’s activity. In our case, we prepare a dilution series from 1 nM to 20,000 nM sinigrin in 20% MeOH.
Note: How to empirically determine the correct dilution series range? Perform an uptake experiment and as default use a dilution series from 1 nM to 20,000 nM internal standard. If your sample concentrations are not within the standards linear range, you should increase the range of your dilution series or dilute your sample appropriately.
Prepare 11 LC-MS vials (one per standard curve concentration) and add 100 µl of the appropriate standard curve solution in each.
Standard curve samples are measured by LC-MS in triplicate and an average is calculated (see Table 2).
Table 2. Standard curve measurements
We plot the analyte concentration (sinigrin and 4MTB in this example) as a function of the signal intensity from the LC-MS and calculate the linear equation to describe the relationship between these two values (see Figure 3) (Crocoll et al., 2016).
Figure 3. Plot of the standard concentrations relative to the peak area measured by the mass spectrometer
We calculate the response factor (RF) between our internal standard with known concentration and our substrate (4MTB in this example) by dividing the slope of the internal standard with the slope of the substrate.
Note: RF values can NOT be transferred between instruments as the response of each analyte depends on instrument settings for source temperature, ionization energy, collision gas, collision energy and other settings that also can be specific to instruments from different vendors (Crocoll et al., 2016).
The RF value is used to quantify the amount of substrate taken up during our transport assays.
Data analysis
Upon completion of the LC-MS analysis, we calculate the amount of transported substrate into the oocytes. To calculate the number of mol substrate transported per oocyte we multiply the area of the substrate with the amount of internal standard added in the sample and multiplied this with the response factor we calculated in step D4. This value is divided by the area of the internal standard (Equation 2, see Table 3 and Figure 4 for example data).
The 50% MeOH solution in which we bust oocytes contains 1,250 nM sinigrin as an internal standard. Consequently, we have 50 picomole internal standard in the analyte.
Table 3. Example of data analysis
Note: These values can be plotted in a bar graph to visually compare uptake by AtGTR1-expressing oocytes and non-expressing control oocytes.
Figure 4. Transport assay with glucosinolate transporter AtGTR1 and non-injected control oocytes
Recipes
Kulori media (pH 7.4)
90 mM NaCl
1 mM KCl
1 mM MgCl2
1 mM CaCl2
10 mM HEPES
Adjust to pH 7.4 with Tris
Kulori media (pH 5.6)
90 mM NaCl
1 mM KCl
1 mM MgCl2
1 mM CaCl2
10 mM MES
Adjust to pH 5.6 with Tris
Acknowledgments
We thank Meike Burow and Bo Larsen for their help with the initial LCMS method development for glucosinolate detection from oocyte uptake assays. Morten Egevang Jørgensen is supported by a grant from the Danish Council for Independent Research: DFF–6108-00122. BAH and CC were funded by DNRF99 grant from the Danish National Research Foundation. HHN was funded by DNRF99 grant from the Danish National Research Foundation and by Innovation Fund Denmark J.nr.: 76-2014-3.
References
Boorer, K. J., Forde, B. G., Leigh, R. A. and Miller, A. J. (1992). Functional expression of a plant plasma membrane transporter in Xenopus oocytes. FEBS Lett 302(2): 166-168.
Calamita, G., Bishai, W. R., Preston, G. M., Guggino, W. B. and Agre, P. (1995). Molecular cloning and characterization of AqpZ, a water channel from Escherichia coli. J Biol Chem 270(49): 29063-29066.
Crocoll, C., Halkier, B. A. and Burow, M. (2016). Analysis and quantification of glucosinolates. Curr Protoc Plant Biol 1: 385-409.
Jørgensen, M. E., Nour-Eldin, H. H. and Halkier, B. A. (2016). A Western blot protocol for detection of proteins heterologously expressed in Xenopus laevis oocytes. Methods Mol Biol 1405: 99-107.
Jørgensen, M. E. Xu, D., Crocoll, C., Ramírez, D., Motawia, M. S., Olsen, C. E., Nour-Eldin, H. H. and Halkier, B. A. (2017). Origin and evolution of transporter substrate specificity within the NPF family. eLife 6: e19466.
Norholm, M. H., Nour-Eldin, H. H., Brodersen, P., Mundy, J. and Halkier, B. A. (2006). Expression of the Arabidopsis high-affinity hexose transporter STP13 correlates with programmed cell death. FEBS Lett 580(9): 2381-2387.
Nour-Eldin, H. H., Norholm, M. H. and Halkier, B. A. (2006). Screening for plant transporter function by expressing a normalized Arabidopsis full-length cDNA library in Xenopus oocytes. Plant Methods 2: 17.
Sigel, E. (1990). Use of Xenopus oocytes for the functional expression of plasma membrane proteins. J Membr Biol 117(3): 201-221.
Sumikawa, K., Houghton, M., Emtage, J. S., Richards, B. M. and Barnard, E. A. (1981). Active multi-subunit ACh receptor assembled by translation of heterologous mRNA in Xenopus oocytes. Nature 292(5826): 862-864.
Theodoulou, F. L. and Miller, A. J. (1995). Xenopus oocytes as a heterologous expression system for plant proteins. Mol Biotechnol 3(2): 101-115.
Wahl, R., Wippel, K., Goos, S., Kamper, J. and Sauer, N. (2010). A novel high-affinity sucrose transporter is required for virulence of the plant pathogen Ustilago maydis. PLoS Biol 8(2): e1000303.
Copyright: Jørgensen et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Jørgensen, M. E., Crocoll, C., Halkier, B. A. and Nour-Eldin, H. H. (2017). Uptake Assays in Xenopus laevis Oocytes Using Liquid Chromatography-mass Spectrometry to Detect Transport Activity. Bio-protocol 7(20): e2581. DOI: 10.21769/BioProtoc.2581.
Jørgensen, M. E. Xu, D., Crocoll, C., Ramírez, D., Motawia, M. S., Olsen, C. E., Nour-Eldin, H. H. and Halkier, B. A. (2017). Origin and evolution of transporter substrate specificity within the NPF family. eLife 6: e19466.
Download Citation in RIS Format
Category
Molecular Biology > Protein > Expression
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,582 | https://bio-protocol.org/exchange/protocoldetail?id=2582&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for Notch-ligand Binding Assays Using Dynabeads
SS Shogo Sawaguchi
MO Mitsutaka Ogawa
TO Tetsuya Okajima
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2582 Views: 8053
Edited by: Gal Haimovich
Reviewed by: Liang Liu
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
This protocol describes how to measure interaction between Notch receptors and their ligands by cell-based assay using Dynabeads. We have used the protocol to determine binding capacity between Notch1-transfected HEK293T cells and ligand-coated Dynabeads. Expression of Eogt in Notch1-expressing cells promoted binding toward DLL4-coated beads, but not JAG1-coated beads. The Notch-ligand assay using Dynabeads suggested that Eogt facilitates DLL4-Notch1 interaction (Sawaguchi et al., 2017).
Keywords: Notch Ligand binding assay Dynabeads Dll4-Fc
Background
The Notch signal pathway regulates many types of cellular events such as proliferation, cell fate determination, and cellular differentiation in all metazoans (Mumm and Kopan, 2000). To initiate Notch signaling, extracellular domains of Notch receptors engage their ligands, Delta like (DLL) ligands or Jagged (JAG) ligands, presented on opposing cells.
Epidermal growth factor (EGF)-like domains of Notch receptors are critical for the ligand binding and modified by specific glycans including O-fucose, O-glucose, and O-GlcNAc glycans (Stanley and Okajima, 2010). Some of these glycans serve as regulators of Notch signaling pathway by modulating physical interaction between Notch receptors and ligands (Moloney et al., 2000). To investigate whether O-GlcNAc regulates Notch-ligand interaction, we developed a novel Dynabeads-based Notch-ligand binding assay. In this assay, Notch receptors expressed on HEK293T cells are incubated with Dynabeads Protein A coated with DLL4-Fc or JAG1-Fc. Unlike soluble ligands used for other binding assay, direction of Notch ligands is fixed on the beads so that they behave like ligand-expressing cells. Thus, the detected binding represents trans-binding rather than cis-binding, which occurs when Notch receptors and their ligands are expressed in the same cells. This assay demonstrated that O-GlcNAc modification of Notch1 by Eogt potentiates Notch1 binding to DLL4 without affecting JAG1 binding (Sawaguchi et al., 2017).
Materials and Reagents
Microtube (INA•OPTIKA, Bio-Bik, catalog number: ST-0150F )
Multiwell culture plates 6 wells (Greiner Bio One International, catalog number: 657160 )
15 ml conical centrifuge tubes (Greiner Bio One International, catalog number: 188271 )
Syringe filter with a 0.22 µm pore size membrane (Pall, catalog number: 4192 )
HEK293T cell
Notch1 expressing vector (pTracer-CMV/Notch1) (Sawaguchi et al., 2017)
Note: NOT commercially available.
Eogt expressing vector (pSecTag2/Hygro/Eogt) (Sawaguchi et al., 2017)
Note: NOT commercially available.
GFP expressing vector (pMAX-GFP) (Addgene, catalog number: VDF-1012 )
Dynabeads Protein A (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10002D )
Opti-MEM (Thermo Fisher Scientific, GibcoTM, catalog number: 31985070 )
4% paraformaldehyde (Wako Pure Chemical Industries, catalog number: 163-20145 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: 172012-500ML )
Sodium phosphate dibasic (Na2HPO4) (Wako Pure Chemical Industries, catalog number: 196-02835 )
Potassium phosphate monobasic (KH2PO4) (Wako Pure Chemical Industries, catalog number: 164-04295 )
Sodium chloride (NaCl) (Wako Pure Chemical Industries, catalog number: 197-01667 )
Potassium chloride (KCl) (Wako Pure Chemical Industries, catalog number: 163-03545 )
DLL4-Fc (Thermo Fisher Scientific, catalog number: 10171H02H )
JAG1-Fc (Thermo Fisher Scientific, catalog number: 11648H02H )
Dulbecco’s modified Eagle medium (NISSUI PHARMACEUTICAL, catalog number: 05915 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Polyethylenimine, linear, MW 25,000 (PEI 25000) (Polysciences, catalog number: 23966 )
Fetal bovine serum (FBS) (see Recipes)
Phosphate-buffered saline (PBS) (see Recipes)
100 ng/µl DLL4-Fc/PBS and 100 ng/µl JAG1-Fc/PBS (see Recipes)
Complete culture media (see Recipes)
PEI solution (see Recipes)
Equipment
Pipettes (various sizes) (GILSON)
6-Tube magnetic separation rack (New England Biolabs, catalog number: S1506S )
Tube rotator (Taiyo, model: RT-50 ) (Figure 1A)
CO2 incubator (SANYO, catalog number: MCO-175 )
Orbital rotator (Oriental Instruments, catalog number: KS-6300 ) (Figure 1B)
Self-made aspirator (Figures 1C and 1D)
Box-type fluorescence imaging device (Olympus, catalog number: FSX100 )
Figure 1. Equipment. A. Tube rotator RT50; B. Orbital rotator; C and D. Self-made aspirators.
Procedure
Preparation of ligand-coated Dynabeads
20 µl of Dynabeads Protein A is washed with 1 ml of PBS (see Recipes) in a microtube.
Note: The standard procedure can be scaled up for multiple samples.
Beads are collected using Magnetic Separation Rack.
The solution is removed from the beads.
The beads are resuspended in 100 µl of PBS.
2 µl of 100 ng/µl DLL4-Fc/PBS (see Recipes) or JAG1-Fc/PBS (see Recipes) is added to the tube
The beads are incubated for 20 min at room temperature or overnight at 4 °C using a tube rotator (Video 1).
Video 1. Dynabeads Protein A was incubated at room temperature using a tube rotator. Note that Dynabeads have brown color in the video.
Beads are collected using a Magnetic Separation Rack.
The solution is removed from the beads.
Beads are washed 3 times with 1 ml of PBS.
The solution is removed from the beads.
100 µl of PBS is added to the tube.
Just before use, 900 µl of ice-cold complete culture media is added to the tube.
Preparation of Notch-expressing cells
HEK293T cells are seeded in a 6-well plate at 6 x 105 cells per well in complete culture media (see Recipes).
Next day, the culture media are replaced with 800 µl of Opti-MEM.
Cells are incubated for 30 min at 37 °C in a CO2 incubator.
Plasmid DNA (2 µg) is diluted into 200 µl of Opti-MEM in a microtube.
Note: To identify transfected cells, GFP expression vector (e.g., pMAX-GFP) is included at 1/8 amount of total plasmids.
The tube is vortexed gently.
6 µl of 1 mg/ml PEI solution (see Recipes) is added to the DNA solution.
The mixture is incubated for 30 min at room temperature.
The DNA/PEI mixtures are gently dropped onto each well of the plate.
Cells are incubated for 4 h at 37 °C in a CO2 incubator.
The culture media are replaced with 2 ml of complete culture media.
Cells are incubated for 48 h at 37 °C in a CO2 incubator.
Binding assay (Figure 2)
Figure 2. Binding assay. A. Complete culture media in a 15 ml tube; B. Dynabeads resuspended in complete culture media; C. HEK293T cells in a 6-well plate were incubated with ligand-coupled beads in a cold room. D. The culture plate during fixation with paraformaldehyde; E. The culture plate before removing PBS; F. PBS was removed from the culture plate using self-made aspirator. G. The culture plate after removing PBS; H. The culture plate after washing three times with PBS; I. The culture plate after washing five times with PBS.
The culture media are replaced with 1 ml of ice-cold complete culture media containing DLL4-Fc or JAG1-Fc beads (Figure 2C).
The cells are incubated in cold room for 30 min.
The culture media are removed from the culture dish using aspirator.
Cells are fixed with 4% paraformaldehyde for 20 min at room temperature (Figure 2D).
The fixed cells are gently washed with 5 ml of PBS for 5 min using an orbital rotator (Video 2).
Video 2. The fixed cells were washed with PBS for using an orbital rotator
PBS is removed from the culture plate using aspirator (Video 3).
Note: The beads accumulated in the center of each well can be removed using aspirator.
Video 3. PBS was removed from the culture plate using aspirator
Cells are washed 5 times in total by repeating steps C5 and C6.
1 ml of PBS is added to each well of the dish (Figure 2I).
Phase contrast and fluorescence images are captured using FSX100 (Figure 3).
The number of bound beads on GFP-positive cell is counted (Figure 4).
Note: 50 GFP-positive cells were counted for quantification. Floating beads were excluded for counting.
Figure 3. Counting of Dynabeads-bound cells. A-C. HEK293T cells transfected to express GFP were cultured with control Dynabeads. D-F. HEK293T cells transfected to express GFP, Notch1 were incubated with DLL4-Fc-bound beads. G-I. HEK293T cells transfected to express GFP, Eogt, and Notch1 were incubated with DLL4-Fc-bound beads. A, D and G. Phase contrast images; B, E and H. Fluorescent Images; C, F and I. Merged images. Scale bars = 60 µm. C’, F’ and I’. Higher magnification of boxed area in images (C, F, I). Scale bars = 60 µm. C”, F” and I”. Same as C’, F’, and I’. Red dots represent bound beads on GFP-positive cells. The dotted line shows outline of the cells. Scale bars = 60 µm.
Figure 4. Analysis of counting of Dynabeads-bound cells. HEK293T cells or cells transiently transfected with Notch1 with or without Eogt, were incubated with DLL4 or JAG1 beads. The number of Dynabeads bound per transfected cell marked by GFP expression was determined (n = 50). Data are mean ± SD from three independent experiments. *P < 0.05; **P < 0.01; bar by Welch’s t-test.
Data analysis
In the previously published experiments (Sawaguchi et al., 2017), data were shown as mean ± SD from three independent experiments. In each experiment, 50 GFP-positive cells are analyzed. Welch’s t-test was used.
Notes
This protocol provides high reproducibility. Counting 50 GFP-positive cells gives low variability in most experiments.
Recipes
Fetal bovine serum (FBS)
The bottle containing FBS is incubated at 56 °C for 30 min before use
Phosphate-buffered saline (PBS)
10 mM Na2HPO4
1.8 mM KH2PO4
137 mM NaCl
2.7 mM KCl
100 ng/µl DLL4-Fc/PBS and 100 ng/µl JAG1-Fc/PBS
DLL4-Fc or JAG1-Fc (5 µg) is dissolved in 50 µl of PBS
Note: 100 ng/µl DLL4-Fc/PBS and 100 ng/µl JAG1-Fc/PBS can be stored at 4 °C for 3 months.
Complete culture media
DMEM containing 10% FBS and penicillin-streptomycin
PEI solution
100 mg of PEI is dissolved in 100 ml of Milli-Q water
The solution is sterilized by passing through a 0.22 µm membrane
Aliquots are stored at -30 °C
Acknowledgments
This protocol was modified from the previously published article (Sawaguchi et al., 2017). This work was supported by Japan Society for the Promotion of Science grants # JP15K15064 to TO and MO, #JP26110709 to TO, #JP26291020 to TO, #JP15K18502 to MO, #JP16J00004 to MO; Takeda Science Foundation to TO; Japan Foundation for Applied Enzymology to TO; YOKOYAMA Foundation for Clinical Pharmacology #YRY-1612 to MO.
References
Moloney, D. J., Panin, V. M., Johnston, S. H., Chen, J., Shao, L., Wilson, R., Wang, Y., Stanley, P., Irvine, K. D., Haltiwanger, R. S. and Vogt, T. F. (2000). Fringe is a glycosyltransferase that modifies Notch. Nature 406(6794): 369-375.
Mumm, J. S. and Kopan, R. (2000). Notch signaling: from the outside in. Dev Biol 228(2): 151-165.
Sawaguchi, S., Varshney, S., Ogawa, M., Sakaidani, Y., Yagi, H., Takeshita, K., Murohara, T., Kato, K., Sundaram, S., Stanley, P. and Okajima, T. (2017). O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals. Elife 6: e24419.
Stanley, P. and Okajima, T. (2010). Roles of glycosylation in Notch signaling. Curr Top Dev Biol 92: 131-164.
Copyright: Sawaguchi et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Sawaguchi, S., Ogawa, M. and Okajima, T. (2017). Protocol for Notch-ligand Binding Assays Using Dynabeads. Bio-protocol 7(20): e2582. DOI: 10.21769/BioProtoc.2582.
Sawaguchi, S., Varshney, S., Ogawa, M., Sakaidani, Y., Yagi, H., Takeshita, K., Murohara, T., Kato, K., Sundaram, S., Stanley, P. and Okajima, T. (2017). O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals. Elife 6.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling > Ligand
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,583 | https://bio-protocol.org/exchange/protocoldetail?id=2583&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Touchscreen-based Visual Discrimination and Reversal Tasks for Mice to Test Cognitive Flexibility
KT Karly M. Turner
CS Christopher G. Simpson
TB Thomas H. J. Burne
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2583 Views: 9512
Edited by: Soyun Kim
Reviewed by: Alexandra Gros
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Reversal learning can be used to examine deficits in cognitive flexibility, which have been linked to a number of neuropsychiatric disorders including schizophrenia and addiction. However, methods of examining reversal learning have varied substantially between species. Touchscreen technology has allowed researchers to explore cognitive deficits with a platform that is translatable across rodents, non-human primates and human subjects. Here we describe a method for measuring visual discrimination and reversal learning in mice using automated touchscreen-based operant chambers.
Keywords: Visual discrimination Reversal Touchscreen Cognition Mice
Background
Cognitive flexibility is the ability to flexibly adjust responses to a previously learned stimulus-reward association, and impairments occur in a range of neuropsychiatric conditions, including schizophrenia, autism, obsessive-compulsive disorder and addiction. To further study the neural mechanisms implicated in cognitive flexibility, performance of choice and reversal tasks have been used in animal models. There are a variety of methods used to measure cognitive flexibility in rodent models, however many techniques have been difficult to compare between rodent and human studies (Brigman et al., 2010). However, using touchscreens, a similar paradigm can be used to study reversal learning across species (Bussey et al., 2012; Horner et al., 2013). Trained rodents are able to discriminate visual stimuli and then successfully reverse their choice when the contingency changes. However, cognitive performance in both rats and mice has been shown to be highly strain dependent (Graybeal et al., 2014). C57BL/6J mice are a popular strain for behavioural and genetic studies, and have been used as a standard strain against which others are compared (Izquierdo et al., 2006). Meanwhile, BALB/c mice often display poor learning and cognitive performance compared to other strains (Graybeal et al., 2014). Recently, the BALB/c strain was shown to be ‘severely impaired’ in basic training, visual discrimination and reversal learning using touchscreen chambers (Graybeal et al., 2014). Therefore, we have adapted the training protocol to promote responding in an anxious mouse strain (BALB/c), where behavioural (rather than cognitive) traits may impair performance. Our results indicated that this protocol provides comparable levels of performance in the standard C57BL/6 mouse to those previously published and significantly enhanced performance of the anxious and emotionally reactive BALB/c mouse (Turner et al., 2017).
Materials and Reagents
Small containers, such as 50 ml Falcon tube lids (BD Biosciences)
Paper towels for cleaning chambers
Our experiment used male BALB/c or C57BL/6J mice (Animal Resource Centre, Australia) at 12 weeks of age one week after arrival to allow the mice to habituate to the facility
Notes:
Mice are housed in groups of four in individually ventilated cages (OptiMICE, Animal Care Systems, USA) with water available ad libitum. Mice are housed with bedding with tissues. The temperature (21 ± 1 °C) and humidity (50 ± 10%) are controlled and lights are kept on a 12-h cycle (lights on at 07:00 AM).
Mice are tail marked for identification and weighed for 3 days to get an average free-feeding body weight. Food restriction should be conducted for at least 3 days prior to testing to gradually reduce weight and allow mice to adapt to a set feeding schedule. Food restriction is used as mice will readily perform for strawberry milk rewards when hungry.
They are then food restricted to around 90% of their free-feeding body weight using small pieces of food to minimise fighting.
Ensure that growth relevant to the strain and age is considered in determining ongoing food restriction limits.
Treatment group size should be based on a power analysis where possible, however groups of 10-15 mice are commonly considered sufficient.
Undiluted strawberry milk (Breaka, Parmalat, Australia)
Ethanol (70%) for cleaning chambers
Equipment
Bussey-Saksida Mouse Touchscreen Chambers (Campden Instruments, model: Model 80614 ) equipped with:
Touchscreen
House light
Liquid reward dispenser
Magazine
Two-window black masks
Overhead camera
Sound-attenuating chamber
Multi-Media Single Station Licence for each chamber (Campden Instruments, model: Model 80698-1 )
Software
PC with ABET II Software for Touchscreens (Model 89505, Campden Instruments Ltd., UK) with Whisker Multi-Media Single Station Licence for each chamber (Model 80698-1, Campden Instruments Ltd., UK)
SPSS (ver.20, SPSS Inc., Chicago, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Turner, K. M., Simpson, C. and Burne, T. H. J. (2017). Touchscreen-based Visual Discrimination and Reversal Tasks for Mice to Test Cognitive Flexibility. Bio-protocol 7(20): e2583. DOI: 10.21769/BioProtoc.2583.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,584 | https://bio-protocol.org/exchange/protocoldetail?id=2584&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
NP-40 Fractionation and Nucleic Acid Extraction in Mammalian Cells
AG Alvaro E. Galvis
HF Hugh E. Fisher
DC David Camerini
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2584 Views: 13771
Edited by: Gal Haimovich
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
This technique allows for efficient, highly purified cytoplasmic and nuclear-associated compartment fractionation utilizing NP-40 detergent in mammalian cells. The nuclear membrane is not disturbed during the fractionation thus leaving all nuclear and perinuclear associated components in the nuclear fraction. This protocol has been modified from Sambrook and Russell (2001) in order to downscale the amount of cells needed. To determine the efficiency of fractionation, we recommend using qPCR to compare the subcellular compartments that have been purified with equivalent amount of control whole cell extracts.
Keywords: Cell fractionation Cytoplasmic and nuclear extractions Nucleic acid purification Quantitative PCR
Background
To fully obtain an understanding of cellular processes, fractionation of nuclear and cytoplasmic compartments are needed. There are many protocols and even some commercial kits available to help separate the two compartments. However, most require high centrifugation speeds and there is a high discrepancy in the yield and even the methods to verify the amount of contamination in the final products. Our protocol utilizes a small benchtop centrifuge at low speeds to obtain highly pure extractions for the cytoplasmic and a combined nuclear/perinuclear associated compartments as well as the data analysis to verify the percentage of contamination. To date, the cells lines that have been tested are 293 T, HeLa and GHOST cell lines. (Galvis, 2014; Galvis et al., 2014).
Materials and Reagents
BD 21 G needles (Fisher Scientific, catalog number: 14-823-55)
Manufacturer: BD, catalog number: 305274 .
BD tuberculin syringes (Fisher Scientific, catalog number: 14-823-2F)
Manufacturer: BD, catalog number: 309602 . This product has been discontinued.
TipOne 10 µl pipet tips (USA Scientific, catalog number: 1111-3200 )
TipOne 1-200 µl natural pipet tips (USA Scientific, catalog number: 1111-1800 )
TipOne 1,000 µl natural pipet tips (USA Scientific, catalog number: 1111-2020 )
Costar 6-well cell culture plates (Fisher Scientific, catalog number: 07-200-80)
Manufacturer: Corning, catalog number: 3506 .
1.5 ml microcentrifuge tubes (Fisher Scientific, catalog number: 14-666-318 )
Iscove’s modification of DMEM (Mediatech, catalog number: 10-016-CV )
Tween 40 (CHEM-IMPEX INTERNATIONAL, catalog number: 01513 )
1x phosphate buffered saline (PBS) (MP Biomedicals, catalog number: 091860454 )
1x trypsin-EDTA (Mediatech, catalog number: 25-051-Cl )
0.5 M ethylenediaminetetraacetic acid (EDTA) pH 8.0 (Fisher Scientific, catalog number: BP2482-500 )
10% sodium dodecyl sulfate (SDS) (Mediatech, catalog number: 46-040-Cl )
Proteinase K (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EO0491 )
Ribonuclease A, DNase free (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EN0531 )
Potassium acetate (Fisher Scientific, catalog number: P171-500 )
Isopropanol (Fisher Scientific, catalog number: A416-500 )
Ethanol 70% (Fisher Scientific, catalog number: BP82011 )
Sodium hydroxide (NaOH) (Fisher Scientific, catalog: S318-500 )
SYBR Green PCR Master mix (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4309155 )
Magnesium chloride (MgCl2) (Fisher Scientific, catalog number: BP214-500 )
Sucrose (Fisher Scientific, catalog number: S3-500 )
Tris-HCl buffer pH 7.4 (Lonza, catalog number: 51237 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: P330-500 )
NP-40 10% solution (Thermo Fisher Scientific, catalog number: 28324 )
1 M MgCl2 (see Recipes)
2.5 M sucrose (see Recipes)
TMK (see Recipes)
TMK + 1% NP-40 (see Recipes)
S1 buffer (see Recipes)
S2 buffer (see Recipes)
Cell lysis buffer (see Recipes)
Equipment
Ventilated microcentrifuge (Fisher Scientific, model: accuSpinTM Micro 17R, catalog number: 13-100-676 )
Gilson PIPETMAN Classic pipets (Gilson, model: P1000, catalog number: F123602 )
Gilson PIPETMAN Classic pipets (Gilson, model: P20, catalog number: F123600 )
Gilson PIPETMAN Classic pipets (Gilson, model: P200, catalog number: F123601 )
Gilson PIPETMAN Classic pipets (Gilson, model: P2, catalog number: F144801 )
Water bath (Fisher Scientific, model: FS-14 )
Vortexer (Fisher Scientific, catalog number: 02-216-108 )
ABI Prism 7900HT sequence detection system (PE-Applied Biosystems) (Thermo Fisher Scientific, Applied BiosystemsTM, model: ABI PRISMTM 7900HT )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Galvis, A. E., Fisher, H. E. and Camerini, D. (2017). NP-40 Fractionation and Nucleic Acid Extraction in Mammalian Cells. Bio-protocol 7(20): e2584. DOI: 10.21769/BioProtoc.2584.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA extraction
Cell Biology > Organelle isolation > Nuclei
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,585 | https://bio-protocol.org/exchange/protocoldetail?id=2585&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Crude Preparation of Lipopolysaccharide from Helicobacter pylori for Silver Staining and Western Blot
Hong Li
MB Mohammed Benghezal
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2585 Views: 9506
Edited by: Andrea Puhar
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
This protocol provides an easy and rapid method to prepare lipopolysaccharide from the gastric pathogen Helicobacter pylori for visualization on acrylamide gels by silver staining and for detecting the presence of Lewis antigens by Western blot. The silver staining is a four-step procedure, involving a 20 min-oxidation step, a 10 min-silver staining step, a 2-10 min color development step and finally a 1-min color termination step. Lipopolysaccharide from H. pylori wild-type and corresponding mutants analyzed by this method are described in a recent publication (Li et al., 2017). This crude preparation of LPS for silver staining is also applicable in other Gram-negative bacteria.
Keywords: Lipopolysaccharide Crude preparation Silver staining Western blot Helicobacter pylori
Background
Lipopolysaccharide (LPS) is a large and variable complex glycolipid that makes up the outer leaflet of the outer membranes of most Gram-negative bacteria. It is typically composed of three domains: a hydrophobic domain termed lipid A (or endotoxin), which is embedded in the outer membrane; a relatively conserved non-repeating core-oligosaccharide; and a variable O-antigen, which extends from the cell to the external environment. A unique feature of H. pylori lipopolysaccharide O-antigen is the presence of fucosylated oligosaccharide structures that mimic human Lewis antigens. Large-scale extraction of highly pure LPS from Gram-negative bacteria is labor-intensive and time-consuming. Here, in this protocol, we describe in detail the use of an easy and rapid crude preparation of LPS from the gastric pathogen Helicobacter pylori for visualization by silver staining and Lewis antigen expression by Western blot.
Materials and Reagents
Pipette tips
Inoculating loops (10 μl) (Copan Diagnostics, catalog number: 8177CS20H )
Aluminum foil
PVDF membrane (0.2 μm) (Merck, catalog number: ISEQ00010 )
H. pylori cells
Columbia blood agar (CBA) plates (Autobio Diagnostics, catalog number: M0109-2 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 746398-500G )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: 746436-500G )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: 795410-500G )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: 795496-500G )
NaOH (Sigma-Aldrich, catalog number: S5881-500G )
Proteinase K (Sigma-Aldrich, catalog number: P8044-1G )
Ethanol (Sigma-Aldrich, catalog number: 24102-5L-R )
SDS (Sigma-Aldrich, catalog number: L3771-1KG )
Glycerol (Sigma-Aldrich, catalog number: G9012-1L )
Tris base (Sigma-Aldrich, Roche Diagnostics, catalog number: 11814273001 )
Glycine (Sigma-Aldrich, catalog number: G8898-1KG )
Bromphenol blue (AMRESCO, catalog number: 0449-50G )
β-Mercaptoethanol (AMRESCO, catalog number: 0482-100ML )
Periodic acid (Sigma-Aldrich, catalog number: P7875 )
Acetic acid (BDH, catalog number: 100015N )
Ammonium persulfate (Sigma-Aldrich, catalog number: A3678 )
Ammonium hydroxide (Sigma-Aldrich, catalog number: 320145 )
Silver nitrate (Sigma-Aldrich, catalog number: 209139 )
Citric acid (Sigma-Aldrich, catalog number: C7129 )
Formalin (37% formaldehyde) (Sigma-Aldrich, catalog number: 252549 )
Freshly-made 15% SDS-PAGE gels
30% Acrylamide/Bis (Bio-Rad Laboratories, catalog number: 1610157 )
TEMED (Bio-Rad Laboratories, catalog number: 1610801 )
Methanol (Sigma-Aldrich, catalog number: 34860-4X4L-R )
Bovine serum albumin (BSA) (AMRESCO, catalog number: 0332-100G )
Tween-20 (Solarbio, catalog number: T8220-500 ml )
Mouse anti-Lex (Santa Cruz Biotechnology, catalog number: sc-59471 )
Mouse anti-Ley (Santa Cruz Biotechnology, catalog number: sc-59472 )
Mouse anti-Lea (Santa Cruz Biotechnology, catalog number: sc-51512 )
Mouse anti-Leb (Santa Cruz Biotechnology, catalog number: sc-51513 )
Secondary rabbit anti-mouse peroxidase-conjugated IgM antibody (Jackson ImmunoResearch Laboratories, catalog number: 315-035-049 )
Chemiluminescent peroxidase substrate-1 (Sigma-Aldrich, catalog number: CPS1120 )
PBS (pH 7.2) (10x) (see Recipes)
SDS-PAGE running buffer (10x, see Recipes)
0.1 N NaOH solution (see Recipes)
LPS lysis buffer (see Recipes)
Oxidation solution (see Recipes)
Silver staining solution (see Recipes)
Color developer solution (see Recipes)
Termination solution (see Recipes)
SDS-PAGE transfer buffer (10x, see Recipes)
TBS (10x, see Recipes)
Equipment
Pipettes (Eppendorf, catalog numbers: 4920000024 , 4920000059 , 4920000067 , 4920000083 )
Centrifuges (Eppendorf, catalog number: 5418 R )
Glass wares
Water bath
Rotary shaker
Cell electrophoresis tank (Bio-Rad Laboratories, catalog number: 1658001 )
Electrophoresis power supply (Bio-Rad Laboratories, catalog number: 1645070 )
Semi-dry electrophoretic transfer system (Bio-Rad Laboratories, catalog number: 1703940 )
pH meter
Spectrophotometer (Shimadzu, model: UV-1601 UV-Visible)
Digital camera
Luminescent Image Analyzer (Fujifilm, model: LAS-3000 )
Software
Image reader LAS 3000 V2.2
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Li, H. and Benghezal, M. (2017). Crude Preparation of Lipopolysaccharide from Helicobacter pylori for Silver Staining and Western Blot. Bio-protocol 7(20): e2585. DOI: 10.21769/BioProtoc.2585.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Lipid
Biochemistry > Lipid > Lipid isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,586 | https://bio-protocol.org/exchange/protocoldetail?id=2586&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cytosolic and Nuclear Delivery of CRISPR/Cas9-ribonucleoprotein for Gene Editing Using Arginine Functionalized Gold Nanoparticles
Rubul Mout
VR Vincent M. Rotello
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2586 Views: 12084
Edited by: David Cisneros
Reviewed by: Andrea Puhar
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
In this protocol, engineered Cas9-ribonucleoprotein (Cas9 protein and sgRNA, together called Cas9-RNP) and gold nanoparticles are used to make nanoassemblies that are employed to deliver Cas9-RNP into cell cytoplasm and nucleus. Cas9 protein is engineered with an N-terminus glutamic acid tag (E-tag or En, where n = the number of glutamic acid in an E-tag and usually n = 15 or 20), C-terminus nuclear localizing signal (NLS), and a C-terminus 6xHis-tag. [Cas9En hereafter]
To use this protocol, the first step is to generate the required materials (gold nanoparticles, recombinant Cas9En, and sgRNA). Laboratory-synthesis of gold nanoparticles can take up to a few weeks, but can be synthesized in large batches that can be used for many years without compromising the quality. Cas9En can be cloned from a regular SpCas9 gene (Addgene plasmid id = 47327), and expressed and purified using standard laboratory procedures which are not a part of this protocol. Similarly, sgRNA can be laboratory-synthesized using in vitro transcription from a template gene (Addgene plasmid id = 51765) or can be purchased from various sources.
Once these materials are ready, it takes about ~30 min to make the Cas9En-RNP complex and 10 min to make the Cas9En-RNP/nanoparticles nanoassemblies, which are immediately used for delivery (Figure 1). Complete delivery (90-95% cytoplasmic and nuclear delivery) is achieved in less than 3 h. Follow-up editing experiments require additional time based on users’ need.
Synthesis of arginine functionalized gold nanoparticles (ArgNPs) (Yang et al., 2011), expression of recombinant Cas9En, and in vitro synthesis of sgRNA is reported elsewhere (Mout et al., 2017). We report here only the generation of the delivery vehicle i.e., the fabrication of Cas9En-RNP/ArgNPs nanoassembly.
Keywords: Cas9-ribonucleoprotein delivery Protocol for CRISPR/Cas9 delivery Cytosolic delivery Nanoparticles Gene editing
Background
Delivery of Cas9-ribonucleoprotein provides an alternative strategy for CRISPR gene delivery, offering a transient way of editing genes. Although a few strategies for Cas9-RNP delivery have been reported, these strategies suffer from endosomal entrapment of both Cas9 protein and sgRNA (Liu et al., 2015). Mechanical methods including membrane deformation (Han et al., 2015), electroporation (Schumann et al., 2015), and the use of hypertonic agents (D’Astolfo et al., 2015) provide direct delivery, however, they require specialized instrumentations and are generally not practical for in vivo therapeutic applications. Our protocol provides an approach for direct cytoplasmic and nuclear delivery of Cas9-RNP that can find applications in both gene editing and genome imaging.
Materials and Reagents
Round bottom 35 mm confocal dish (MATTEK, catalog number: P35G-0-14-C )
24-well plates (Corning, Costar®, catalog number: 3524 )
Sterile 1.5 ml tubes (Fisher Scientific, catalog number: 05-408-129 )
Sterile pipette tips
Cell lines (i.e., HeLa)
Stock solution of ArgNP gold nanoparticles (~50 μM in water), freshly purified Cas9En protein (~10-20 μM), and sgRNA (~150 μM)
1x phosphate-buffered saline (PBS) (GE Healthcare, HyCloneTM, catalog number: SH30028.02 )
Plain DMEM media (No serum and antibiotics, appropriate media for cell culture, i.e., HeLa cells) (Thermo Fisher Scientific, GibcoTM, catalog number: 10567014 )
Alexa Fluor 488 NHS Ester (Thermo Fisher Scientific, InvitrogenTM, catalog number: A20000 )
AmpliScribe T7-Flash- Transcription Kit (Epicentre, catalog numbers: ASF3257 and ASF3507 )
Equipment
Pipettes
Cell culture incubator at 5% CO2 and 37 °C
Fluorescence microscope (any confocal microscope)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mout, R. and Rotello, V. M. (2017). Cytosolic and Nuclear Delivery of CRISPR/Cas9-ribonucleoprotein for Gene Editing Using Arginine Functionalized Gold Nanoparticles. Bio-protocol 7(20): e2586. DOI: 10.21769/BioProtoc.2586.
Download Citation in RIS Format
Category
Cell Biology > Cell engineering > CRISPR-cas9
Molecular Biology > DNA > DNA modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,587 | https://bio-protocol.org/exchange/protocoldetail?id=2587&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Co-culture of Mesenchymal Stem Cells and Endothelial Colony Forming Cells
Abbas Shafiee
KK Kiarash Khosrotehrani
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2587 Views: 14045
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
The discovery of endothelial colony forming cells (ECFCs) with robust self-renewal and de novo vessel formation potentials suggests that ECFCs can be an excellent cell source for cardiovascular diseases treatment through improving neovascularization in the ischemic tissues. However, their engraftment after transplantation resulted to be low. Previous studies showed mesenchymal stem/stromal cells (MSCs) could improve the survival and capillary formation capacity of ECFCs in co-culture systems. In this article, we describe a protocol for in vitro co-culture of MSCs and ECFCs to prime ECFCs for better engraftment.
Keywords: Endothelial colony forming cells Endothelial progenitor cells Mesenchymal stem/stromal cells Vascularization Placenta Co-culture in vitro
Background
Endothelial progenitor cells (EPC) are defined as a cell population capable of forming new blood vessels through a vasculogenesis process. In 2004, Ingram et al. identified a specific highly proliferative population of EPC in ex vivo culture termed ‘endothelial colony-forming cells (ECFC)’ from human umbilical cord blood (Ingram et al., 2004) and these cells have recently been declared to represent EPCs (Medina et al., 2017). A similar population can also be isolated from the human term placenta tissue with equivalent vascularization potential and at clinically relevant quantities (Patel et al., 2013; Shafiee et al., 2015). Therefore, ECFC transplantation has been proposed as a therapeutical approach for ischemic diseases such as myocardial infarction or critical leg ischemia. However, ECFCs engraftment and vasculogenic potential after transplantation are well documented to be low (Shafiee et al., 2017; Medina et al., 2017). Previous experiments have shown enhanced ECFC engraftment and function by co-transplantation of mesenchymal stem/stromal cells (MSC) with ECFC (Shafiee et al., 2017). In vitro and in the presence of MSC, ECFC showed enhanced survival in serum deprivation conditions. In normal/growth culture conditions, MSC co-culture resulted in reduced ECFC proliferation and altered appearance towards an elongated mesenchymal-like morphology. Further investigations suggested that direct contact with MSC was required for changes in ECFC morphology and proliferation rate (Shafiee et al., 2017). In addition, after being co-cultured with MSCs for 4 days, ‘primed ECFCs’ showed reduced colony forming potential but improved capacity to form tube-like structures on MatrigelTM in vitro (Shafiee et al., 2017). In this article, we describe a protocol for in vitro co-culturing of ECFCs and bone marrow-derived MSCs (BM-MSCs).
Materials and Reagents
Materials
15 ml centrifuge tube (Corning, Falcon®, catalog number: 352196 )
50 ml centrifuge tube (Corning, Falcon®, catalog number: 352070 )
T75 flasks
2 ml micro tubes
Transwell chambers with a 0.4 µm pore size membrane (Corning, catalog number: 3397 )
0.22 μm filter (EMD Millipore, catalog number: SLGP033RS )
Amicon Ultra-15 Centrifugal Filter Unit with Ultracel-3 membrane (molecular weight cut off, 3 kDa) (EMD Millipore, catalog number: UFC900308 )
NuncTM 6-well plate (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 140675 )
NuncTM 96-well flat bottom (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 167008 )
24-well plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 140644 )
Culture slides (Corning, Falcon®, catalog number: 354118 )
Cell strainer (size: 40 μm) (Corning, Falcon®, catalog number: 352340 )
20 µl, 100 µl, and 1 ml pipette tips
5 ml, 10 ml, and 50 ml serological pipettes
Cryogenic vials, 1.2 ml (Corning, catalog number: 430487 )
50 ml syringe (BD, catalog number: 1018841 )
Fluorescence activated cell sorting (FACS) tubes (5 ml Round-Bottom Polypropylene) (Corning, Falcon®, catalog number: 352063 )
FACS tubes (5 ml Round-Bottom Polystyrene, with Cell Strainer Snap Cap) (Corning, Falcon®, catalog number: 352235 )
Cells
Human MSCs: Adult BM-MSCs were purchased from Lonza (Lonza, USA)
Human ECFCs: Human fetal placental ECFCs were isolated as reported previously (Patel et al., 2013). To distinguish between MSCs and ECFCs after co-culture, we suggest using GFP tagged ECFCs as used in the current protocol but non-GFP tagged cells can also be used
Reagents
Double-distilled water (ddH2O)
100% ethanol
Dulbecco modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11995073 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437028 )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
PBS tablet (Sigma-Aldrich, catalog number: P4417 )
TrypLE-express dissociation reagent (Thermo Fisher Scientific, GibcoTM, catalog number: 12605093 )
Collagen, Type I solution from rat tail (concentrated stock, 100x) (Sigma-Aldrich, catalog number: C3867 )
Acetic acid (Sigma-Aldrich, catalog number: ARK2183 )
Endothelial basal medium-2 (EBM-2) (Lonza, catalog number: 190860 )
Endothelial growth medium-2 (EGM-2) BulletKitTM (Lonza, catalog number: CC-3162 )
Note: The components of this kit includes the following items: Hydrocortisone, GA-1000 (Gentamicin, Amphotericin-B), hEGF, VEGF, hFGF-B, R3-IGF-1, Ascorbic acid, Heparin.
Growth factor reduced MatrigelTM Matrix (Corning, catalog number: 356230 )
Dimethyl sulfoxide (DMSO) (Fisher Scientific, catalog number: BP231-100 )
Secondary antibody goat anti-rabbit Alexa Fluor® 488 conjugate (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11034 )
Secondary antibody goat anti-mouse Alexa Fluor® 568 conjugate (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11004 )
PE/Cy5 conjugated anti-human CD90 antibody (Thermo Fisher Scientific, eBioscienceTM, catalog number: 15-0909-42 )
V450 mouse anti-human CD31 (BD, BD Biosciences, catalog number: 561653 )
7-Aminoactinomycin D (7-AAD) (Thermo Fisher Scientific, InvitrogenTM, catalog number: A1310 )
Prolong Gold reagent with 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Thermo Fisher Scientific, catalog number: P36935 )
Dulbecco’s phosphate buffered saline (D-PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190250 )
EDTA (Merck, USA, CAS: 6381-92-6)
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Paraformaldehyde powder (PFA) (Sigma-Aldrich, catalog number: P6148 )
100% Triton X-100 (Fisher Scientific, catalog number: BP151-500 )
Tween 20 (Sigma-Aldrich, catalog number: P9416 )
Penicillin/streptomycin 10,000 U/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Normal goat serum
Trypan blue powder
70% ethanol (see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
Coating solution (see Recipes)
Complete EGM2 medium (see Recipes)
Freezing medium (see Recipes)
FACS buffer (see Recipes)
4% paraformaldehyde (PFA) (see Recipes)
0.1% Triton X-100 (see Recipes)
Washing solution (see Recipes)
Antibodies diluting solution (see Recipes)
Blocking solution (see Recipes)
0.4% Trypan blue solution (see Recipes)
Equipment
Water bath
Refrigerator
Portable Pipet-aid
Centrifuge (Eppendorf, catalog number: 5810 R )
Laminar flow work bench
Centrifuge
Shaker
Tissue culture incubator set at 37 °C, 5% CO2 (Memmert GmbH & Co., Nurnberg, Germany)
Hemocytometer (Hausser Scientific, catalog number: 3110 )
IncuCyte Zoom (Essen BioScience)
Zeiss Axio microscope (Carl Zeiss)
Fluorescence-activated flow cytometry (FACS) Aria 11u system (BD Biosciences, FACSAriaTM)
Gallios flow cytometer (Beckman Coulter, Fullerton, CA, USA)
Software
Kaluza Flow Cytometry Analysis Software
GraphPad Prism 7 software
ZEN 2.3 (Blue edition, Carl Zeiss Microscopy GmbH)
ImageJ (Fiji)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Shafiee, A. and Khosrotehrani, K. (2017). In vitro Co-culture of Mesenchymal Stem Cells and Endothelial Colony Forming Cells. Bio-protocol 7(20): e2587. DOI: 10.21769/BioProtoc.2587.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Endothelial stem/progenitor cell
Developmental Biology > Cell growth and fate > Angiogenesis
Cell Biology > Cell isolation and culture > Co-culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,588 | https://bio-protocol.org/exchange/protocoldetail?id=2588&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Purification of Schwann Cells from Spinal Nerves of Neonatal Rat
JW Jinkun Wen
DT Dandan Tan
LL Lixia Li
JG Jiasong Guo
Published: Vol 7, Iss 20, Oct 20, 2017
DOI: 10.21769/BioProtoc.2588 Views: 11743
Reviewed by: Sébastien Gillotin
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Primary cultured Schwann cells (SCs) are widely used in the investigation of the biology of SC and are important seed cells for neural tissue engineering. Here, we describe a novel protocol for harvesting primary cultured SCs from neonatal Sprague-Dawley (SD) rats. In the present protocol, dissociated SCs are isolated from the spinal nerves of neonatal rats and purified by the treatment of cytosine arabinoside (AraC).
Keywords: Schwann cell Spinal nerve Isolation Purification Rat
Background
SCs are the glial cells of the peripheral nervous system (PNS). Isolation and purification of primary SCs are crucial steps for studying the biology of SC. In addition, purified primary cultured SCs are important seed cells for neural tissue engineering. To date, various methods of culturing SCs have been reported based on the method of Brockes (Brockes et al., 1979). By reported methods, sciatic nerves are mostly used for SC isolation because they are large in size and can be easily obtained. However, SCs from sciatic nerves are easily contaminated with fibroblasts because the connective tissue is difficult to be cleared off. Especially the epineurium and perineurium are the main source of fibroblasts. Without special treatment, contaminating fibroblasts proliferate much faster than SCs and will soon be the predominant cells in the cultures. In the past decades, numerous purification methods have been developed for isolating SCs from the contaminating fibroblasts. The details of these purification methods included single or combination of antimitotic treatment (Wood, 1976), antibody-mediated cytolysis (Brockes et al., 1979), immunoselection (Assouline et al., 1983; Vroemen and Weidner, 2003), repeated explantation (Oda et al., 1989), cold jet technique (Haastert et al., 2007), differential adhesion (Pannunzio et al., 2005) and differential detachment (Jin et al., 2008). These purification methods involve either complicated techniques with high cost or long harvested period with low cell yield. Therefore, obtaining a large number of purified SCs is still a challenging work for basic research and further clinical use. Here, we describe a method that uses spinal nerves from neonatal SD rats as a cell source to efficiently obtain highly purified SCs in a short period.
Materials and Reagents
Pipette tips (Corning, Axygen®, catalog numbers: T-1000-B-R-S , T-200-Y-R-S )
Cell culture dish (35 x 10 mm) (3.5-cm dish) (Corning, catalog number: 430165 )
1.5 ml centrifuge tubes (Corning, Axygen®, catalog number: MCT-150-C )
50 ml centrifuge tubes (Corning, catalog number: 430290 )
100 µm cell strainer (Corning, catalog number: 431752 )
Neonatal Sprague-Dawley (SD) Rat (Postnatal 2-4 days, P2-4)
Distilled water
75% ethanol
Hank’s balanced salts solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: C14175500BT )
Poly-L-lysine hydrobromide (PLL) (Sigma-Aldrich, catalog number: P1274 )
0.25% trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200072 )
Fetal bovine serum (FBS) (Mediatech, catalog number: 35-076-CV )
Dulbecco’s modification of Eagle’s medium/Ham’s F-12 50/50 Mix (DMEM/F12) (Mediatech, catalog number: 10-092-CV )
Cytosine Arabinoside (AraC) (Sigma-Aldrich, catalog number: C1768 )
Forskolin (Sigma-Aldrich, catalog number: F6886 )
Recombinant Human Heregulin β-1 (Heregulin) (PeproTech, catalog number: 100-03 )
Dimethyl sulfoxide (DMSO) (MP Biomedicals, catalog number: 196055 )
Penicillin/streptomycin (Pen/Strep) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Phosphate-buffered saline (PBS) (Beyotime Biotechnology, catalog number: C0221A )
Paraformaldehyde (PFA) (Guangdong Guanghua Sci-Tech, catalog number: 1.17767.014 )
Gelatin (Sigma-Aldrich, catalog number: G7041 )
Triton X-100 (Sigma-Aldrich, catalog number: V900502 )
4,6-Diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, catalog number: D9542 )
Anti-glial fibrillary acidic protein antibody produced in rabbit (GFAP) (Sigma-Aldrich, catalog number: G9269 )
Anti-S-100 protein antibody, clone 15E2E2, produced in mouse (S100) (Merck, catalog number: MAB079-1 )
Anti-nerve growth factor receptor antibody, p75, produced in rabbit (P75) (Merck, catalog number: AB1554 )
Alexa Fluor® 488 goat anti-mouse IgG (H+L) (Thermo Fisher Scientific, Invitrogen, catalog number: A-11001 )
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) (Thermo Fisher Scientific, Invitrogen, catalog number: A-11008 )
100x PLL (see Recipes)
10% FBS (see Recipes)
1,000x AraC (see Recipes)
500x heregulin (see Recipes)
10,000x forskolin (see Recipes)
SC culture medium (see Recipes)
4% paraformaldehyde (PFA) (see Recipes)
0.1% Triton X-100 (see Recipes)
Blocking buffer (see Recipes)
1,000x DAPI (see Recipes)
Equipment
Pipettes (Eppendorf, model: Research Plus® , 200 μl, 1000 μl)
CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: Model 3100 Series , catalog number: 3111)
Tissue culture hood (AIRTECH, catalog number: SW-CJ-1F )
Surgical scissors and forceps (RWD Life Science, catalog numbers: S14001-15 , F13024-13 , S12003-09 , F13029-10 , see Figure 1A)
Note: S14001-15 and F13024013 are scissors and forceps used for decapitation, S12003-09 and F13029-10 are scissors and forceps used for skin dissection.
Spring scissors (66 Vision, catalog number: 54053B , see Figure 1B)
Fine forceps (Fine Science Tools, Dumont, model: #5, catalog number: 11252-23 , with tips of 0.1 x 0.06 mm, see Figure 1B)
Superfine forceps (Fine Science Tools, Dumont, model: #5, catalog number: 11252-20 , with tips of 0.05 x 0.02 mm, see Figure 1B)
Dissecting board, needles and ice packs
Water bath (Ningbo Scientz Biotechnology, model: GH-15 )
Stereomicroscope (Olympus, model: SZ61 )
Centrifuge (Eppendorf, model: 5430 )
Figure 1. Dissection tools. A. Surgical scissors and forceps used to decapitate the rat and to dissect skin. B. Spring scissors and fine forceps used to separate muscle, open vertebral laminae and collect spinal nerves.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wen, J., Tan, D., Li, L. and Guo, J. (2017). Isolation and Purification of Schwann Cells from Spinal Nerves of Neonatal Rat. Bio-protocol 7(20): e2588. DOI: 10.21769/BioProtoc.2588.
Download Citation in RIS Format
Category
Neuroscience > Peripheral nervous system > Schwann cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,589 | https://bio-protocol.org/exchange/protocoldetail?id=2589&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Bioreactor Method to Generate High-titer, Genetically Stable, Clinical-isolate Human Cytomegalovirus
VS Victoria R. Saykally
LR Luke I. Rast
JS Jeff Sasaki
SJ Seung-Yong Jung
CB Cynthia Bolovan-Fritts
LW Leor S. Weinberger
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2589 Views: 8499
Edited by: Modesto Redrejo-Rodriguez
Reviewed by: Marielle Cavrois
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Human cytomegalovirus (HCMV) infection is a major cause of morbidity and mortality in transplant patients and a leading cause of congenital birth defects (Saint Louis, 2016). Vaccination and therapeutic studies often require scalable cell culture production of wild type virus, represented by clinical isolates. Obtaining sufficient stocks of wild-type clinical HCMV is often labor intensive and inefficient due to low yield and genetic loss, presenting a barrier to studies of clinical isolates. Here we report a bioreactor method based on continuous infection, where retinal pigment epithelial (ARPE-19) cells adhered to microcarrier beads are infected in a bioreactor and used to produce high-titers of clinical isolate HCMV that maintain genetic integrity of key viral tropism factors and the viral genome. In this bioreactor, an end-stage infection can be maintained by regular addition of uninfected ARPE-19 cells, providing convenient preparation of 107-108 pfu/ml of concentrated TB40/E IE2-EYFP stocks without daily cell passaging or trypsinization. Overall, this represents a 100-fold increase in gain of virus production of 100-times compared to conventional static-culture plates, while requiring 90% less handling time. Moreover, this continuous infection environment has the potential to monitor infection dynamics with applications for real-time tracking of viral evolution.
Keywords: Human cytomegalovirus Bioreactor Microbeads (Microcarrier beads) Viral tropism Continuous infection culture Clinical isolate
Background
Congenital CMV infection is a leading cause of birth defects with an annual direct cost of one billion dollars in the US alone, and represents a global unmet medical need (Bristow et al., 2011; Griffiths et al., 2013; Manicklal et al., 2013; Saint Louis, 2016). This would be preventable with an effective vaccine or therapeutic targeting women in their reproductive years. Human cytomegalovirus (HCMV) can infect a wide range of cell types, but a major barrier in the field is that extended passage of clinically derived HCMV strains in fibroblast cells leads to a loss of viral tropism for other cell types (Waldman et al., 1991; Sinzger et al., 1999). In the late 1960s, several laboratory-adapted strains of CMV were serially passaged in fibroblasts–including the HCMV AD169, Towne, and Davis strains, as well as the Smith strain of murine CMV–and became some of the first tools used to study the molecular biology of CMV (Plotkin et al., 1975). These laboratory-adapted strains–often created during unsuccessful attempts to generate a live attenuated vaccine–were found to have a number of mutations affecting (i) their ability to infect different cell types, (ii) rate of viral replication, and (iii) altering latency phenotypes (Albrecht and Weller, 1980; Yamane et al., 1983; Waldman et al., 1989; Kahl et al., 2000). Specifically, the HCMV open reading frames (ORFs) UL128, UL130, UL131, which comprise a viral glycoprotein entry complex, were found to accumulate mutations during passage in fibroblasts, leading to the loss of viral tropism for infection of epithelial cells, endothelial cells, macrophages, and dendritic cells (Sinzger et al., 1999, Hahn et al., 2004; Wang and Shenk, 2005; Adler et al., 2006). These lab-adapted HCMV strains were also shown to have lost several genes in the UL/b’ region of the viral genome, a region that confers immune evasion functions and replication dissemination in vivo (Cha et al., 1996). It is now known that sustained viral growth on fibroblast cultures removes the selection pressure to retain these sequences, resulting in genetic loss or rearrangement of sequences essential for replication and dissemination in other host cells and tissues. However, passage of HCMV clinical isolates (e.g., TB40/E and VR1814) in epithelial and endothelial cell settings maintains selection pressure to prevent loss of tropism for non-fibroblast cell types (Waldman et al., 1991; Hahn et al., 2002; Sinzger et al., 2008).
Differences between established laboratory-adapted strains of HCMV and clinical isolates of HCMV are important considerations when planning experiments, as the choice of virus strain used may influence results. Clinical isolates are much more similar to the viruses that replicate within patients, making them preferable for understanding clinical symptoms, as well as natural and drug-selected genetic variability of human CMV. These clinical isolates also maintain productive infection and latency phenotypes that best represent the wild-type virus population (Lee et al., 2015). Because clinical isolates spread through a cell-associated manner, yields from clinical isolates are significantly lower than those collected from laboratory-adapted virus strains, due in part to clinical strains being more limited to cell-associated spread. This contributes to time consuming and labor-intensive aspects of clinical virus stock preparation.
Here, we report a new, more efficient method for generating stocks of clinically derived HCMV isolates, represented by TB40/E IE2-EYEFP. This virus is genetically tagged with an EYEFP fusion to enable convenient monitoring of continuous infection in the bioreactor environment. Using a two-stage bioreactor system (Figure 1) with microcarrier beads and the advantage of the prolonged period of virus production characteristic of HCMV, we are able to maintain an end-stage infection and generate high titer virus stocks on primary adherent cell cultures that preserve genetic integrity of key viral tropism factors and the viral genome. We have used the TB40/E-IE2 EYFP tagged virus in development and characterization of the bioreactor infection. The fluorescent tag enables convenient monitoring of the virus in the bioreactor culture, by surveying aliquots of the infected samples with fluorescent microscopy.
Materials and Reagents
15 cm tissue culture dish (Corning, Falcon®, catalog number: 353025 )
Vented screw caps (Corning, Falcon®, catalog number: 354639 ; Corning, catalog number: 3968 )
1.5 ml polypropylene microcentrifuge tubes (Corning, Axygen®, catalog number: MCT-150-C )
Conical sterile polypropylene centrifuge tubes, 50 ml (Fisher Scientific, catalog number: 05-539-12 )
96-well flat-bottom cell culture plates (Corning, catalog number: 3596 )
12-well reagent reservoirs (Corning, Costar®, catalog number: 4877 )
40 μm cell strainers (Corning, catalog number: 431750 )
Conical sterile polypropylene centrifuge tubes, 15 ml (Fisher Scientific, catalog number: 06-443-18 )
0.45 μm sterile syringe filters (EMD Millipore, catalog number: SLHV033RS )
Disposable sterile syringes with Luer-Lock tips (BD, catalog number: 309646 )
Serological pipettes (50 ml, 25 ml, 10 ml, 5 ml, 2 ml)
0.2 or 0.1 μm filter system
ARPE-19 cells (ATCC, catalog number: CRL-2302 )
MRC-5 cells (ATCC, catalog number: CCL-171 )
TB40/E IE2-EYFP bacmid cloned virus
TB40/E IE2-EYFP is derived from the bacmid clone of TB40/E, a clinically derived HCMV isolate (Sinzger et al., 2008). The viral double stranded DNA genome has been cloned as a bacmid and can produce infectious virus encoding the tropism factors required for replication in multiple host cell types. This virus contains an EYFP fluorescent tag fused to the carboxyl terminus of a key viral transactivator, the IE2 gene, as previously reported (Teng et al., 2012). This bacmid clone was generated using the galK selection and counterselection recombination protocol described previously for bacmid cloning with HCMV (Murphy et al., 2008, Warming et al., 2005). Expression of this fluorescent tag occurs throughout the virus lytic infection cycle and enables convenient real time monitoring of continuous infection in the bioreactor environment.
DPBS without calcium and magnesium, DPBS-CMF (Mediatech, catalog number: 21-031-CV )
Trypsin-EDTA, 0.25% (Mediatech, catalog number: 25-053-CI )
Trypsin-EDTA, 0.05% (Mediatech, catalog number: 25-052-CI )
Dry ice pellets
Isopropanol (Fisher Scientific, catalog number: A451-4 )
DMEM with L-glutamine and sodium pyruvate (Mediatech, catalog number: 10-013-CV )
DMEM/F-12 with L-glutamine and 15 mM HEPES (Mediatech, catalog number: 10-092-CV )
Fetal bovine serum (FBS) (Mediatech, catalog number: 35-011-CV )
Penicillin-streptomycin solution (Pen/Strep) (Mediatech, catalog number: 30-002-CI )
Sigmacote (Sigma-Aldrich, catalog number: SL2-25ML )
1 M Tris, pH 7.5
Magnesium chloride (MgCl2)
Hydrochloric acid (HCl)
Cytodex 1 microcarrier beads, 60-87 μm (Sigma-Aldrich, catalog number: C0646-5G )
Culture media for titration assays (TCID50) (see Recipes)
Culture media for bioreactor (see Recipes)
Siliconizing glassware with SigmaCote (see Recipes)
20% sorbitol (see Recipes)
Microcarrier beads ratio and preparation (see Recipes)
Adherent cell ratio (see Recipes)
Equipment
Personal protective equipment, PPE, required for working at BSL-2: Laboratory coats or gowns, eye and face protection, gloves
Wheaton Celstir spinner flasks, 150 ml, 250 ml, and 500 ml (WHEATON, catalog numbers: 356879 and 356882 )
Tissue culture incubator: 37 °C, 5% CO2
4 position slow-speed stir plate (Corning, catalog number: 440814 )
Class II biosafety cabinets (The Baker)
Vortex mixer
Micropipette (1-1,000 μl capacity), multiple channel pipettes (1-200 μl capacity) (P1000 pipette and P200 pipette [Pipetteman])
Hemocytometer (Hausser Scientific, catalog number: 1475 )
Cell culture inverted epi-fluorescent microscope
Tabletop centrifuge
Water bath, 37 °C
100 ml autoclavable glass bottle (WHEATON, catalog number: W818012406 )
Approved BSL-2 laboratory facilities
Autoclave
Pipette controller (Pipette-aid, Drummond Scientific, model: Pipet-Aid® XP2, catalog number: 4-000-501 )
Freezers: -80 °C, -20 °C, 4 °C
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Saykally, V. R., Rast, L. I., Sasaki, J., Jung, S., Bolovan-Fritts, C. and Weinberger, L. S. (2017). A Bioreactor Method to Generate High-titer, Genetically Stable, Clinical-isolate Human Cytomegalovirus. Bio-protocol 7(21): e2589. DOI: 10.21769/BioProtoc.2589.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > Cell growth
Microbiology > Microbial cell biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
259 | https://bio-protocol.org/exchange/protocoldetail?id=259&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Rice Embryo Single Cell Type using Laser Capture Microdissection (LCM)
Tie Liu
Published: Vol 2, Iss 18, Sep 20, 2012
DOI: 10.21769/BioProtoc.259 Views: 12202
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
A lot of transcriptional profiling in plant and animals has used RNAs samples from many different cell types. The laser-capture microdissection (LCM) can identify and harvest pure cellular populations directly from heterogenous tissues based on histological identification. The molecules or protein isolated from LCM-captured cells can be suitable for single cell type analysis by using chip expression profiling or sequencing.
Materials and Reagents
Ethanol
Acetic acid
Histoclear (also named CitriSolv) (Thermo Fisher Scientific, catalog number: 5989-27-5 )
DEPC H2O
75% (v/v) ethanol and 25% (v/v) acetic acid (see Recipes)
Gradient series of ethanol solutions in H2O or histoclear (see Recipes)
Equipment
Microscope
Microtome (Waldorf, model: HM310 )
Pix-Cell IIe LCM system (Arcturus)
RNase-free glass slides
15 μm laser beam
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, T. (2012). Isolation of Rice Embryo Single Cell Type using Laser Capture Microdissection (LCM) . Bio-protocol 2(18): e259. DOI: 10.21769/BioProtoc.259.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell isolation
Plant Science > Plant cell biology > Tissue analysis
Cell Biology > Single cell analysis > Laser capture microdissection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,590 | https://bio-protocol.org/exchange/protocoldetail?id=2590&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Quick and Easy Method for Making Competent Escherichia coli Cells for Transformation Using Rubidium Chloride
Nidhi Sharma
M. Ximena Anleu Gil
DW Diego Wengier
Published: Nov 5, 2017
DOI: 10.21769/BioProtoc.2590 Views: 19552
Edited by: Dennis Nürnberg
Reviewed by: Christian SailerMichael Tscherner
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
This protocol describes a quick and efficient method to make competent E. coli cells for transformation using rubidium chloride. Commercial competent cells are expensive and this protocol provides a cheaper alternative to them.
Keywords: Competent cells E. coli Transformation efficiency TOP10 DH5α
Background
The success of gene cloning is highly dependent on the transformation efficiency of bacterial cells. The efficiency can be artificially improved by treating the cells with chemicals or electric pulses. Several protocols are available to prepare competent E. coli cells, however, they are usually long, laborious, and show inconsistency in competence. The protocol by Green and Rogers (2013) overcomes these downsides and allows the preparation of highly competent cells (~106-108 CFU/µg DNA). While other protocols require cells to be grown at low temperature (19-22 °C), this protocol involves growing cells at 37 °C. Thus, the cells grow faster and reach log phase within 4 h as compared to 18-24 h. This protocol is highly reproducible.
Materials and Reagents
25 mm, 0.2 µm syringe filter PES (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 725-2520 )
5 ml syringe (Fisher Scientific, catalog number: 14-829-45)
Manufacturer: BD, catalog number: 309646 .
1.5 ml Eppendorf tubes (Corning, Costar®, catalog number: 3207 )
100 mm Petri dish (Corning, Falcon®, catalog number: 351029 )
Pipettes tips
10 ml culture tubes (VWR, catalog number: 60818-725 )
Spreaders (Fisher Scientific, catalog number: 14-665-230 )
250 ml centrifuge bottles (Sigma-Aldrich, catalog number: Z353736)
Manufacturer: Thermo Fisher Scientific, catalog number: 3141-0250 .
E. coli strain (TOP10 or DH5α)
Control plasmid (e.g., pUC19)
LB broth (Fisher Scientific, catalog number: BP9723-500 )
LB agar (BD, catalog number: 244510 )
Ice
Liquid nitrogen
Rubidium chloride (RbCl) (Sigma-Aldrich, catalog number: R2252 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (Sigma-Aldrich, catalog number: 203734 )
Potassium acetate (Sigma-Aldrich, catalog number: P1190 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C8106 )
Glycerol (Fisher Scientific, catalog number: BP229-4 )
MOPS (Fisher Scientific, catalog number: BP308-100 )
Acetic acid (Fisher Scientific, catalog number: A38-212 )
Sodium hydroxide (Fisher Scientific, catalog number: S318-1 )
Vector specific Antibiotics
Buffer I (see Recipes)
Buffer II (see Recipes)
Equipment
Pipettes (P1000 and P200)
1 L flasks (Fisher Scientific, catalog number: 10-040K)
Manufacturer: Corning, catalog number: C49801L .
Spectrophotometer (Beckman Coulter, model: DU-640 , catalog number: 8043-30-1090)
Water bath (Marshall Scientific, model: Precision 181 )
37 °C incubator and shaker (Thermo Fisher Scientific, model: MaxQTM 4000 , catalog number: SHKE4000-1CE)
Centrifuge (Thermo Fisher Scientific, SorvallTM, model: RC-5B , catalog number: 8327-30-1004)
pH meter (Fisher Scientific, catalog number: 13-644-928)
Manufacturer: Thermo Fisher Scientific, catalog number: 1112106 .
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sharma, N., Anleu Gil, M. X. and Wengier, D. (2017). A Quick and Easy Method for Making Competent Escherichia coli Cells for Transformation Using Rubidium Chloride. Bio-101: e2590. DOI: 10.21769/BioProtoc.2590.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Cell Biology > Cell isolation and culture > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,591 | https://bio-protocol.org/exchange/protocoldetail?id=2591&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Primary Human Skeletal Muscle Cells
Janelle M. Spinazzola
Emanuela Gussoni
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2591 Views: 9268
Edited by: Antoine de Morree
Reviewed by: Hui ZhuYann Simon Gallot
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
Primary myoblast culture is a valuable tool in research of muscle disease, pathophysiology, and pharmacology. This protocol describes techniques for dissociation of cells from human skeletal muscle biopsies and enrichment for a highly myogenic population by fluorescence-activated cell sorting (FACS). We also describe methods for assessing myogenicity and population expansion for subsequent in vitro study.
Keywords: Skeletal muscle Myoblast isolation Tissue dissociation Fluorescence-activated cell sorting (FACS)
Background
Primary human myoblasts from muscle biopsies are a valuable resource for modeling human muscle disease in vitro. Alterations in myoblast proliferation, differentiation, and fusion are features shared by many neuromuscular disorders, and can be used to assay cell-based and pharmacological therapies. Human skeletal muscle biopsies, especially those affected by disease, often contain extensive populations of non-myogenic cells such as adipocytes and fibroblasts. Thus, it is important to purify a myogenic population for in vitro study of skeletal muscle development and disease. Early studies of muscle disease involved use of tissue explants or unpurified dissociated cells (Geiger and Garvin, 1957; Herrmann et al., 1960; Goyle et al., 1967; Bishop et al., 1971), and later, Blau and Webster introduced a pre-plating technique to remove fibroblasts (Blau and Webster, 1981). Here, we describe an effective technique for dissociation of mononuclear cells from human muscle biopsies, and purification of a highly myogenic population utilizing FACS with the cell surface markers CD56 and CD82 (see Note 1). We recently demonstrated that CD82 is an excellent myogenic marker in both human fetal and adult skeletal muscle that is also retained on activated and differentiating myogenic progenitors (Alexander et al., 2016). This protocol also describes methods to culture these myoblasts and confirm a myogenic population by in vitro fusion assay. Isolation and expansion of these cells from normal individuals and from individuals with muscle disorders will help accelerate the development of therapies for human disorders such as muscular dystrophies.
Materials and Reagents
Dissociation of primary human skeletal muscle tissue (see Note 2)
Protected sterile disposable scalpels with stainless steel blade size #10 (Aspen Surgical, Bard-ParkerTM, catalog number: 372610 )
Sterile 10 cm tissue culture-treated plastic dishes (Corning, Falcon®, catalog number: 353003 )
Assorted sterile 5, 10, and 25 ml pipettes (Olympus Plastics, catalog numbers: 12-102 , 12-104 , 12-106 )
Sterile 0.22 µm PES (low protein binding) filters (250 and 500 ml volumes) (such as Olympus Plastics, catalog number: 25-227 )
Sterile 15 and 50 ml conical centrifuge tubes (Olympus Plastics, catalog numbers: 21-101 and 21-106 )
BD Falcon sterile nylon cell strainers (100 µm and 40 µm pore sizes) ( Corning, catalog numbers: 352360 and 352340 )
Sterile 1.8 ml CryoTubeTM vials (Thermo Fisher Scientific, Thermo Scientific TM, catalog number: 377267 )
10x Hank’s balanced saline solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14185052 ) or 10x Dulbecco’s phosphate buffer saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14200075 ), free of calcium chloride, magnesium chloride and magnesium sulfate, diluted to 1x with double distilled water and filter sterilized with a 0.22 µm PES filter
Note: This solution can be stored at 4 °C or room temperature (RT).
Sterile red blood cell lysis solution (QIAGEN, catalog number: 158904 ) (stored at RT)
Sterile HEPES buffered saline solution, without phenol red (Lonza, catalog number: 12-747F )
Dulbecco’s modified Eagle’s medium (DMEM 4.5 g glucose) (Thermo Fisher Scientific, GibcoTM, catalog number: 10564011 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437 )
100x penicillin-streptomycin-glutamine (PSG) (Thermo Fisher Scientific, GibcoTM, catalog number: 10378016 )
Calcium chloride dihydrate (Sigma-Aldrich, catalog number: C7902-500G )
Dispase II (Roche Diagnostics, catalog number: 04942078001 )
Collagenase D (Roche Diagnostics, catalog number: 11088882001 2.5g )
Complete growth medium (500 ml) (see Recipes)
1 M calcium chloride solution (CaCl2·2H2O, FW 147) (see Recipes)
Dispase stock solution (see Recipes)
Collagenase D stock solution (see Recipes)
Sterile freezing medium (see Recipes)
Purification of myoblasts from dissociated human skeletal muscle mononuclear cells
Thawing of cryopreserved sample prior to FACS
Sterile 0.22 µm PES filter (500 ml volume) (Thermo Fisher Scientific, catalog number: 569-0020 )
Sterile 50 ml conical centrifuge tubes (Olympus Plastics, catalog number: 21-106 )
Sterile tissue culture-treated plastic dishes (10 or 15 cm size) (Corning, Falcon®, catalog numbers: 353003 and 353025 )
CryoTubeTM vial containing dissociated unpurified primary cells (Simport, catalog number: T309-2A )
Dulbecco’s modified Eagle’s medium (DMEM) (DMEM 4.5 g glucose) (Thermo Fisher Scientific, GibcoTM, catalog number: 10564011 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437 )
100x penicillin-streptomycin-glutamine (PSG) (Thermo Fisher Scientific, GibcoTM, catalog number: 10378016 )
Complete growth medium (see Recipes)
Preparation of sample for FACS
Sterile 0.22 µm PES filter (50 ml volume) Cole Palmer Steriflip-GP Filter, 0.22 µm PES Item # UX-29969-20 (EMD Millipore, catalog number: SCGP00525 )
Sterile 15 and 50 ml conical centrifuge tubes (Olympus Plastics, catalog numbers: 21-101 and 21-106 )
Sterile 5 ml round bottom test tubes with cell strainer caps (Corning, Falcon®, catalog number: 352054 )
Dissociated unpurified primary cells, thawed one day prior to FACS
Sterile 1x HBSS (diluted from 10x stock) (Thermo Fisher Scientific, GibcoTM, catalog number: 14185052 )
Sterile 1x DPBS (diluted from 10x stock) (Thermo Fisher Scientific, GibcoTM, catalog number: 14200075 )
TrypLE ExpressTM dissociation enzyme with phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 12605010 )
Antibodies
APC anti-CD56 antibody, Clone HCD56 (BioLegend, catalog number: 318310 )
PE anti-CD82 antibody, Clone ASL-24 (BioLegend, catalog number: 342103 )
Calcein blue (1 mg vial) (Thermo Fisher Scientific, catalog number: C1430 )
Note: Resuspend in 200 µl dimethyl sulfoxide (DMSO, AmericanBio, catalog number: AB03091-00050 ) aliquot in 25 µl aliquots and store at -20 °C (stock). Use 0.5 µl stock calcein/106 cells.
Sterile 5% FBS solution (50 ml) (see Recipes)
Fluorescence-activated cell sorting (FACS)
FACS or 5 ml round-bottom tubes with cell strainer caps (Corning, Falcon®, catalog number: 352235 )
In vitro culture and analysis of human skeletal myoblasts
Sterile 50 ml conical centrifuge tubes (Olympus Plastics, catalog number: 21-106 )
Sterile 10 cm tissue culture-treated plastic dishes (Corning, Falcon®, catalog number: 353003 )
Sterile 0.22 µm PES filter (50 ml volume) Cole Palmer Steriflip-GP Filter, 0.22 µm PES Item # UX-29969-20 (EMD Millipore, catalog number: SCGP00525 )
Sterile 1x HBSS (diluted from 10x stock) (Thermo Fisher Scientific, GibcoTM, catalog number: 14185052 )
TrypLETM Express Dissociation Enzyme with Phenol Red (Thermo Fisher Scientific, GibcoTM, catalog number: 12605010 )
Dulbecco’s modified Eagle’s medium (DMEM) 4.5 g glucose for proliferation medium (Thermo Fisher Scientific, GibcoTM, catalog number: 10564011 ) and DMEM 1 g glucose for differentiation medium (Thermo Fisher Scientific, GibcoTM, catalog number: 10567014 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437 )
100x penicillin-streptomycin-glutamine (PSG) (Thermo Fisher Scientific, GibcoTM, catalog number: 10378016 )
Gelatin Type A from porcine skin (Sigma-Aldrich, catalog number: G1890 )
Horse serum (Thermo Fisher Scientific, GibcoTM, catalog number: 16050122 )
Complete growth medium (see Recipes)
Differentiation medium (50 ml) (see Recipes)
0.1% gelatin (see Recipes)
Immunofluorescence for in vitro fusion assay
Aluminum foil
4-well chamber slides, Nunc Lab-Tek II Permanox (Thermo Fisher Scientific, catalog number: 177437 )
10x Dulbecco’s phosphate buffered saline (PBS) (diluted from 10x stock) (Thermo Fisher Scientific, GibcoTM, catalog number: 14200075 )
Note: Diluted to 1x with double distilled water. Store at RT.
Antibodies (stored at 4 °C)
Anti-Myosin Heavy Chain (Developmental Studies Hybridoma Bank, MF-20) or anti human desmin (clone D33) (Abcam, catalog number: ab8470 )
AffiniPure F(Ab’)2 Alexa Fluor 594 Donkey anti-Mouse IgG (H+L) (Jackson ImmunoResearch, catalog number: 715-586-150 ) (Protect from light)
Vectashield HardSet mounting medium with DAPI (Vector Laboratories, catalog number: H-1500 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787-250ml )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437 )
16% paraformaldehyde (PFA) (Electron Microscopy Sciences, catalog number: 15710-S ), diluted to 4%
4% paraformaldehyde (PFA) (see Recipes)
Permeabilization solution (see Recipes)
Blocking solution (see Recipes)
Equipment
Dissociation of primary human skeletal muscle tissue
Bench top centrifuge (Beckman Coulter, model: Allegra® 6R , catalog number: 366816)
Bright-LineTM hemocytometer (0.1 mm) (Hausser Scientific, catalog number: 1492 )
Sterile laminar flow biosafety cabinet (SterilGard® Class II Type A/B3) (The Baker Company, model: SG400 )
-150 °C freezer, with liquid nitrogen storage backup tank (VIP® PLUS) (Panasonic, model: MDF-C2156VANC )
Humidified 5% CO2 incubator set to 37 °C (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Series II 3110 , catalog number: 3110)
FACS: Becton Dickinson Aria II equipped with 4 lasers and a biosafety cabinet
Purification of myoblasts from dissociated human skeletal muscle mononuclear cells
Sterile laminar flow biosafety cabinet (SterilGard® Class II Type A/B3) (The Baker Company, model: SG400 )
Water bath set to 37 °C (Sheldon Manufacturing, SHEL LAB®, model: SWB15 )
Bench top centrifuge (Beckman Coulter, model: Allegra® 6R , catalog number: 366816)
Inverted microscope (Nikon, model: TMS-F , catalog number: 210775)
Bright-LineTM hemocytometer (0.1 mm) (Hausser Scientific, catalog number: 1492 )
Cell sorter, such as Becton Dickinson Aria II equipped with 4 lasers and a biosafety cabinet
In vitro culture and analysis of human skeletal myoblasts
1,000 µl pipette
Rotating shaker
Sterile laminar flow biosafety cabinet (SterilGard® Class II Type A/B3) (The Baker Company, model: SG400 )
Water bath set to 37 °C (Sheldon Manufacturing, SHEL LAB®, model: SWB15 )
Humidified 5% CO2 incubator set to 37 °C (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Series II 3110 , catalog number: 3110)
Bench top centrifuge (Beckman Coulter, model: Allegra® 6R , catalog number: 366816)
Inverted microscope (Nikon, model: TMS-F , catalog number: 210775)
Bright-LineTM hemocytometer (0.1 mm) (Hausser Scientific, catalog number: 1492 )
Inverted microscope with epi-fluorescence capabilities including ultraviolet/DAPI and FITC/GFP filter sets (such as Nikon, model: Eclipse E1000 )
Software
Cell sorter analysis software (FlowJo: https://www.flowjo.com/solutions/flowjo)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Spinazzola, J. M. and Gussoni, E. (2017). Isolation of Primary Human Skeletal Muscle Cells. Bio-protocol 7(21): e2591. DOI: 10.21769/BioProtoc.2591.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Muscle stem cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,592 | https://bio-protocol.org/exchange/protocoldetail?id=2592&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Histochemical Staining of Collagen and Identification of Its Subtypes by Picrosirius Red Dye in Mouse Reproductive Tissues
Smita Bhutda
Manalee V Surve
Anjali Anil
KK Kshama Kamath
Neha Singh
Deepak Modi
Anirban Banerjee
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2592 Views: 25809
Edited by: Andrea Puhar
Reviewed by: Rakesh Bam
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
Collagen is one of the foremost components of tissue extracellular matrix (ECM). It provides strength, elasticity and architecture to the tissue enabling it to bear the wear and tear from external factors like physical stress as well as internal stress factors like inflammation or other pathological conditions. During normal pregnancy or pregnancy related pathological conditions like preterm premature rupture of membranes (PPROM), collagen of the fetal membrane undergoes dynamic remodeling defining biochemical properties of the fetal membrane. The protocol in this article describes the histochemical method to stain total collagen by Picrosirius red stain which is a simple, quick and reliable method. This protocol can be used on paraformaldehyde (PFA) and formaldehyde fixed paraffin embedded tissue sections. We further describe the staining and distribution of collagen in different mouse reproductive tissues and also demonstrate how this technique in combination with polarization microscopy is useful to detect the distribution of different subtypes of collagen.
Keywords: Collagen Histochemical staining Picrosirius red Reproductive tissues Birefringence Polarization
Background
Collagen is the principal load-bearing polymer in all connective tissues ranging from skin to bone. Collagen networks strongly stiffen when a mechanical force is applied, thus preventing excessive deformation of the tissue. There are 16 types of collagen, of which the type I, II, and III nearly comprise the 80% of the collagen in the body that are packed together to form long thin fibrils. Collagen type IV forms a two-dimensional reticulum; while several other collagen types are associated with fibril-type collagen, linking them to each other or to other matrix components. These collagens along with the other components of the extracellular matrix (ECM) undergo constant remodeling to provide required biochemical properties like tensile strength and elasticity. This unique attribute of collagen is one of the influencing factors of the stability of reproductive tissues and its dysregulation can lead to adverse events such as abnormal placentation, rupture of membranes (Hampson et al., 1997; Marpaung, 2016) and pathological conditions of the reproductive tract, such as endometriosis (Shimizu and Hokano, 1990) etc.
In tissues, the basement membrane is rich in collagen, in addition it is found in the stroma and lining the connective tissues. Physical, mechanical or chemical damage of a tissue or organ would lead to disruption of collagen deposition, and organization. Hence, assessing the patterns of collagen distribution would provide us an idea about the tensile strength of the tissue/organs. Any alterations from normal patterns of collagen distribution would imply tissue damage. In this study, chorio-decidual tissue has been used as a model basement membrane. Changes in the biochemical properties of this feto-maternal membrane during pregnancy and various pathological conditions lead to its preterm rupture (Sebire, 2001; Fujimoto et al., 2002; Wang et al., 2004; Vega Sánchez et al., 2004; Surve et al., 2016).
Sirius red is a histology stain used to mark total collagen as well as differentiate between varying collagen types for evaluation of collagen distribution in tissues. The sulphonic acid group of Sirius red reacts with basic amino groups of lysine and hydroxylysine and guanidine group of arginine (present in the collagen molecule (Junqueira et al., 1979)). Thereby, being an anionic dye, it attaches to all the varying types of collagen isoforms. In bright field, collagen appears as bundles of pink to red fibers which get disturbed in pathological conditions. The same larger collagen fibers under polarized light appear bright yellow to orange and the thinner ones, including reticular fibers, look green. This birefringence or double refraction, whereby incident light is split by polarization into two different paths, is highly specific for collagen. The amount of polarized light absorbed by the Sirius red dye stringently depends on the orientation of the collagen bundles enabling to differentiate different collagen types (Junqueira et al., 1979; Lattouf et al., 2014). This method is very simple, quick, economic and reliable in comparison with other commonly used staining methods for collagen.
Materials and Reagents
Glass coverslips (HiMedia Laboratories, catalog number: CG108 )
Glass slides (size, 76 x 26 mm) (HiMedia Laboratories, catalog number: CG029 )
Paraffin mold and embedding cassette (Simport, catalog number: M490-2 )
Mice strain: C57BL/6 Black (Experimental Animal Facility, ICMR-National Institute of Research in Reproductive Health)
Distilled water (D/W)
Formaldehyde (Sigma-Aldrich, catalog number: F8775 )
Xylene (Merck, catalog number: 1086342500 )
Methanol (Merck, catalog number: 1070182521 )
Ethanol (Merck, catalog number: 1085430250 )
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
Sodium phosphate monobasic (NaH2PO4)
Sodium phosphate dibasic (Na2HPO4)
Sodium chloride (NaCl)
Potassium chloride (KCl)
Potassium phosphate monobasic (KH2PO4)
Paraffin wax (Merck, catalog number: 1073371000 )
Poly-lysine (Sigma-Aldrich, catalog number: P8920 )
Picric acid (Fisher Scientific, catalog number: 13205 )
Direct Red 80 (Sigma-Aldrich, catalog number: 365548 )
Glacial acetic acid (CH3COOH) (Merck, catalog number: 1.93002 )
Haematoxylin (C.I. 75290) (EMD Millipore, catalog number: 104302 )
Iron(III) chloride (ferric chloride) (Merck, catalog number: 803945 )
Sodium bicarbonate (Merck, catalog number: 106329 )
Hydrochloric acid (37%) (Merck, catalog number: 1.93001 )
D.P.X. mountant liquid (HiMedia Laboratories, catalog number: GRM655 )
Weigert’s haematoxylin solution (see Recipes)
4% paraformaldehyde (PFA) (see Recipes)
10% formaldehyde (see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
Poly-lysine coated glass slides (see Recipes)
Picrosirius red solution (see Recipes)
Acidified water (see Recipes)
Equipment
Coplin jar (Thermo Scientific, catalog number: 107 )
Bright field microscope (Leica, model: Leica DMi8 )
Polarization microscope (Leica, model: Leica DMi8 )
Note: Items 2 and 3 are the same microscope. For polarization applications, a polarizer (Leica Microsystems, Germany) is placed in the light path of the bright field microscope.
Hot plate (LED Digital, Lab Depot, model: MS7-H550-S )
Microtome (Leica, model: Leica RM2255 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bhutda, S., Surve, M. V., Anil, A., Kamath, K. G., Singh, N., Modi, D. and Banerjee, A. (2017). Histochemical Staining of Collagen and Identification of Its Subtypes by Picrosirius Red Dye in Mouse Reproductive Tissues. Bio-protocol 7(21): e2592. DOI: 10.21769/BioProtoc.2592.
Download Citation in RIS Format
Category
Cell Biology > Tissue analysis > Tissue staining
Immunology > Host defense > Murine
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,593 | https://bio-protocol.org/exchange/protocoldetail?id=2593&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro NLK Kinase Assay
SM Sungho Moon*
JK Jiyoung Kim*
Eek‐hoon Jho
*Contributed equally to this work
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2593 Views: 10079
Edited by: Ralph Bottcher
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
This protocol provides step by step instructions to perform an in vitro kinase assay for nemo-like kinase. In addition, this protocol also describes an efficient method using mild lysis buffer for expression and purification of Glutathione S-transferase (GST) fusion proteins.
Keywords: NLK in vitro kinase assay GST-fusion protein YAP Hippo pathway
Background
Drosophila nemo has been identified as a pivotal regulator of photoreceptor clusters in the developing Drosophila eyes (Choi and Benzer, 1994). It has been reported that nemo is conserved across various species. The mammalian homolog is nemo-like kinase (NLK) (Brott et al., 1998; Rocheleau et al., 1999). NLK is a member of the CMGC group (CDK, MAPK, GSK3 and CLK) and also belongs to the atypical MAPK family. NLK regulates multiple cellular mechanisms through transcription factors including TCF/LEF1, NICD, and FOXO, which are key players in diverse signaling pathways (Ishitani et al., 1999; Ishitani et al., 2010; Kim et al., 2010). Moreover, recently we have identified NLK as a novel kinase for Yes-associated protein (YAP), a co-transcriptional activator in the Hippo pathway (Moon et al., 2017). This protocol describes an in vitro method to measure the nemo-like kinase activity.
Materials and Reagents
Pipette tips–1,000 μl tips (OHAUS, catalog number: PCB-1000 ), 200 μl tips (Neptune Scientific, catalog number: 2100 )
14 ml round bottom tubes (SPL, catalog number: 40014 )
15 ml conical centrifuge tubes (Ihanil Scientific, catalog number: LP-00015CP-00 )
60 mm cell culture dish (SPL, catalog number: 20060 )
Microcentrifuge tube (SARSTEDT, catalog number: 72.690 )
X-ray film cassette (Advansta, catalog number: L-07019-001 )
X-ray film (XSANATEC, AGFA, catalog number: EA75Q )
Cell scraper (SARSTEDT, catalog number: 83.1832 )
Centrifuge bottles (Sigma-Aldrich, catalog number: B1033 )
pGEX-4T-3 vector (GE Healthcare, catalog number: 28-9545-52 )
pFLAG-CMV4 vector (Sigma-Aldrich, catalog number: E7158 )
Flag-NLK vectors (Ishitani et al., 1999)
Competent cells-BL21 (DE3) (EMD Millipore, Novagen, catalog number: 70235 )
Homo sapiens (Human) HEK293 cells (ATCC, catalog number: CRL-1573 )
Zinc chloride (ZnCl2) (Sigma-Aldrich, catalog number: 229997 )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Bio Basic, catalog number: IB0168 )
Glutathione Sepharose 4B (GE Healthcare, catalog number: 17075601 )
Ethanol (Merk, catalog number: 1.00983.1011 )
Bovine serum albumin (BSA) (Bio Basic, catalog number: AD0023 )
Dulbecco’s modified Eagle medium (DMEM) (Lonza, catalog number: 12-604F )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 16000044 )
Antibiotic-Antimycotic (Thermo Fisher Scientific, GibcoTM, catalog number: 15240062 )
TurboFect transfection reagents (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0531 )
Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, catalog number: 5000006 )
Anti-FLAG M2 antibody (Sigma-Aldrich, catalog number: F3165 )
Protein A/G plus agarose (Santa Cruz Biotechnology, catalog number: sc-2003 )
Adenosine 5’-triphosphate (ATP) [γ-32P] (PerkinElmer, catalog number: NEG502A )
LB broth high salt (Duchefa Biochemie, catalog number: L1704 )
Micro agar (Duchefa Biochemie, catalog number: M1002 )
Ampicillin (Duchefa Biochemie, catalog number: A0104 )
Tryptone (Duchefa Biochemie, catalog number: T1332 )
Yeast extract (Duchefa Biochemie, catalog number: Y1333 )
Sodium chloride (NaCl) (Duchefa Biochemie, catalog number: S0520 )
Potassium chloride (KCl) (Duchefa Biochemie, catalog number: P0515 )
Di-sodium hydrogen phosphate dihydrate (Na2HPO4·2H2O) (Duchefa Biochemie, catalog number: S0537 )
Potassium phosphate dibasic (K2HPO4) (Merck, catalog number: 105108 )
Tris (Duchefa Biochemie, catalog number: T1501 )
NP-40 (IGEPAL CA-630) (Sigma-Aldrich, catalog number: I8896 )
Ethylenediaminetetraacetic acid (EDTA) (Duchefa Biochemie, catalog number: E0511 )
Ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’,-tetraacetic acid (EGTA) (MP Biomedicals, catalog number: 194823 )
β-Glycerophosphate (MP Biomedicals, catalog number: 195206 )
Sodium fluoride (NaF) (Sigma-Aldrich, catalog number: S1504 )
Dithiothreitol (DTT) (Bio Basic, catalog number: DB0058 )
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Leupeptin (Sigma-Aldrich, catalog number: L2884 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
L-Glutathione reduced (Sigma-Aldrich, catalog number: G4251 )
Methanol (Merck, catalog number: 106099 )
Acetic acid (Merck, catalog number: 100056 )
Coomassie Blue (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 20279 )
HEPES (pH 7.5) (Duchefa Biochemie, catalog number: H1504.0100 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670 )
Sodium dodecyl sulfate (SDS) (Duchefa Biochemie, catalog number: S1377 )
Glycerol (Duchefa Biochemie, catalog number: G1345.1000 )
β-Mercaptoethanol (AMRESCO, catalog number: 0482 )
Bromophenol Blue (BPB) (AMRESCO, catalog number: 0449 )
Sodium orthovanadate (Sigma-Aldrich, catalog number: S6508 )
Lysozyme (Agilent Technologies, catalog number: EC 3.2.1.17 )
LB medium (see Recipes)
LB agar plate (see Recipes)
2x YTA medium (see Recipes)
1x phosphate-buffered saline (PBS) (see Recipes)
Cell lysis buffer A (see Recipes)
Cell lysis buffer B (see Recipes)
Elution buffer (see Recipes)
Coomassie Blue staining buffer (see Recipes)
10x kinase buffer (see Recipes)
4x SDS loading dye (see Recipes)
Destaining buffer (see Recipes)
Equipment
Shaking incubator (VISION SCIENTIFIC, model: VS-8480SF )
Erlenmeyer flask (Corning, PYREX®, catalog number: 4980-500 )
UV spectrophotomter (Mecasys, Optizen, model: 2120UV )
Centrifuge for 50/250 ml tubes
50 ml centrifuge tubes (Thermo Fisher Scientific, Thermo ScientificTM, model: 3119 )
250 ml centrifuge bottles (Thermo Fisher Scientific, Thermo ScientificTM, model: 3120 )
Sonicator (Sonics & Materials, model: VCX 500 )
High speed refrigerated micro centrifuge (TOMY DIGITAL BIOLOGY, model: MX-300 )
Water-Jacketed CO2 incubator (Thermo Fisher Scientific, model: Forma Series II 3111 )
Pipettes (Gilson, model: PIPETMAN®, catalog number: F167300 )
Micro centrifuge rotor rack (TOMY DIGITAL BIOLOGY, model: AR015-24 )
Micro centrifuge rotor rack (TOMY DIGITAL BIOLOGY, model: AR015-24 )
Electrophoresis apparatus (Bio-Rad Laboratories, model: 1658033FC )
Flat scanner (Epson, model: Epson Perfection V37 )
Gel drying equipment (Vision Scientific, model: ME-2B-S )
-80 °C freezer (NuAire, model: NU-6625D36 )
Water bath (VISION SCIENTIFIC, model: VS-1205SW1 )
Thermo shaker (BIOAND, model: MSC100 )
Solid tapered microtip (Sonics & Materials, catalog number: 630-0418 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Moon, S., Kim, J. and Jho, E. (2017). In vitro NLK Kinase Assay. Bio-protocol 7(21): e2593. DOI: 10.21769/BioProtoc.2593.
Download Citation in RIS Format
Category
Cancer Biology > Proliferative signaling > Biochemical assays
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,594 | https://bio-protocol.org/exchange/protocoldetail?id=2594&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Xenograft Mouse Model of Human Uveal Melanoma
YC Yao Chen
XL Xiao Liu
LG Ling Gao
YL Yongqing Liu
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2594 Views: 7746
Original Research Article:
The authors used this protocol in 10-Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
10-Jan 2017
Abstract
Uveal melanoma (UM) is a malignant intraocular tumor in adults. Metastasis develops in almost half of the patients and over 90% of the metastases are in the liver. With the advances in molecular targeting therapy for melanoma, a proper metastasis animal model is of increasing importance for testing the accuracy and effectiveness of systemic therapies. Here, we describe a xenograft model for mimicking human UM liver metastasis by injecting human UM cells into the vitreous cavity in nude mice. The athymic nude mice are immunocompromised and suitable for xenograft tumor growth and metastasis, and intravitreal injection of cells is a quicker and easier operation under a binocular scope, thereby it is simple and effective to test human UM growth and metastasis.
Keywords: Human uveal melanoma Xenograft mouse model Intravitreal injection Ocular tumor growth Liver metastasis
Background
UM is the most common primary intraocular tumor in adults, with an incidence rate varying from 5 to 10 cases per million in the world (Singh et al., 2011). Almost half of the patients develop metastasis within 15 years from initial diagnosis even after treatment or/and removal of primary tumor (Kujala et al., 2003; Weis et al., 2016). In over 4% of the patients, micrometastasis already exists at the time of diagnosis (Finger et al., 2005). The number might be underestimated because of limitations in detection of early UM. Current medical treatments such as enucleation, plaque brachytherapy, proton beam irradiation have been successful in removing or repressing early focal ocular UMs (Dogrusoz et al., 2017). But in general, UM is resistant to the standard chemotherapies and to date no effective systemic treatment is available for metastatic lesions (Goh and Layton, 2016; Carvajal et al., 2017). Although various advances have been made in UM treatment over decades, one-year survival rate after metastasis remains unchanged at 10-15% (Woodman, 2012).
UM arises from uveal melanocytes. Enriched with blood supply and lack of ocular lymph ducts, UM cells mainly spread to distant organs hematogenously. As a result, 95% of UM metastases have a predilection for the liver (Woodman, 2012). The mechanism underlying metastatic transformation of UM is still not clear. Since the liver metastasis is the leading cause of UM-related death (Collaborative Ocular Melanoma Study, 2011), current studies have been focused on the mechanism and molecular targeted prevention of tumor metastasis. Based on the metastatic proclivity, UMs are divided into two categories: class 1 and 2. Class 2 UMs are more inclined to metastasis with primitive stem cell-like gene expression pattern (Harbour and Chao, 2014). The activation of RB/P53, PI3K/AKT and MAPK signaling pathways leads to tumor overgrowth and anti-apoptosis (Coupland et al., 2013; Reichstein, 2017). 85% of primary and metastatic UMs are presented with gain-function mutations in either of two G-protein genes, GNAQ and GNA11 (Shoushtari and Carvajal, 2014). Loss of chromosome 3 or loss-function mutation in BAP1 gene indicates a poor prognosis and metastatic UM (Damato et al., 2011; van Essen et al., 2014). Transcription factors such as ID2, ZEB1 and TWIST1 are involved in UM growth and invasiveness (Chen et al., 2017), expression of PD-1 in UM cells avoids immune destruction by suppressing T cell, facilitating tumor dissemination, and resistance to chemotherapies (Komatsubara and Carvajal, 2017).
Appropriate animal models for UM are critical in understanding molecular mechanisms and evaluating therapeutic effectiveness. Mice are most commonly utilized for tumor models. No spontaneous UM was found in wild-type mice (Stei et al., 2016). Mutation in GNAQ gene could generate choroidal melanoma in mice, but the tumor exclusively metastasizes to the lung (Huang et al., 2015). To date, no genetic animal model mimicking the aforementioned biological and molecular features of human UM has been generated (Stei et al., 2016). By contrast, mouse intraocular xenograft tumor is a widely accepted UM animal model with an effective formation of primary ocular tumors and potential to metastasize to the liver. This article details a protocol to xenograft human UM cells in the vitreous cavity of nude mice, which develops primary tumors in the eye and metastases in the liver in a relatively short period of time.
Materials and Reagents
100-mm culture plate (Corning, catalog number: 430293 )
15-ml tube (Corning, catalog number: 430052 )
30 G blunt needle (BD, catalog number: 305106 )
Cotton swabs (VWR, catalog number: 89031-270 )
Glass coverslips (Fisher Scientific, catalog number: 12-550-15 )
Diapers (VWR, catalog number: 82020-845 )
Surgeon masks (VWR, catalog number: 10843-149)
Manufacturer: KCWW, Kimberly-Clark, catalog number: 47500 .
Gloves (VWR, catalog number: 82026-426 )
Head cover (3M, catalog number: S-133S-5 )
1-ml syringe (BD, catalog number: 309628 )
27 G needle (BD, catalog number: 305109 )
200-μl tips (USA Scientific, catalog number: 1111-1700 )
Athymic nude mice (THE JACKSON LABORATORY, catalog number: 002019 )
Human UM cell line OCM1 (provided by Dr. Klara Valyi-Nagy in the University of Illinois at Chicago)
0.25% trypsin (Mediatech, catalog number: 20-053-Cl )
Phosphate-buffered saline (PBS) (Mediatech, catalog number: 21-040-CV )
Mydriatic eye drops are the mixture of Phenylephrine Hydrochloride Ophthalmic Solution (Paragon, NDC 42702-102-15) and Tropicamide Ophthalmic Solution (Bausch & Lomb, NDC 24208-585-64) at the ratio of 1:1
Hypromellose ophthalmic demulcent solution (Akorn, NDC 17478-064-12)
GONAK Lubricant (2.5% Hypromellose ophthalmic demulcent solution) (Akorn, NDC 17478-064-12)
Povidone-Iodine solution (Dynarex, NDC 67777-100-03)
Ketamine hydrochloride (Hospira, NDC 0409-2053-10)
Xylazine sterile solution (Akorn, AnaSed®, NDC 59399-110-20)
Neomycin and polymyxin B sulfates and dexamethasone ophthalmic ointment (Fera, NDC 48102-003-35)
Meloxicam (Henry Schein, NDC 11695-6925-2)
10% neutral buffered formalin (Sigma-Aldrich, catalog number: F5554-4L )
Ethanol (Sigma-Aldrich, catalog number: 459836-1L )
Dulbecco’s modified Eagle’s medium (DMEM) (Mediatech, catalog number: 10-013-CV )
Fetal bovine serum (FBS) (GE Healthcare, HycloneTM, catalog number: SH30070.03HI )
Penicillin-streptomycin solution (Mediatech, catalog number: 30-002-Cl )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D5879-500ML )
Cell culture medium (see Recipes)
Cell cryopreservation medium (see Recipes)
Equipment
Cell culture incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: Series 8000 Water-Jacketed , catalog number: 3423)
Bench top centrifuge (Fisher Scientific, model: accuSpin 24CTM )
-80 °C freezer (Thermo Fisher Scientific, Thermo ScientificTM, model: TSUTM Series , catalog number: TSU400A-EA)
5-μl syringe (Hamilton, catalog number: 87900 )
50-ml beaker (VWR, catalog number: 10754-946 )
Forceps (VWR, catalog number: 82027-404 )
Scissors (VWR, catalog number: 89259-982 )
200-µl pipet (Eppendorf, catalog number: 3123000055 )
Liquid nitrogen tank (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: CY50945 )
Surgical microscope (Olympus, model: SZ61/51 )
Warm pad (Pristech Products, catalog number: 20414 )
Autoclave (SOMA Technology, model: Steris Amsco Century V116 )
-20 °C freezer (Kelvinator Commercial, model: KCBM180FQY )
Sterile hood (Labconco, model: Class II, Type B2 (Total Exhaust) )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, Y., Liu, X., Gao, L. and Liu, Y. (2017). Xenograft Mouse Model of Human Uveal Melanoma. Bio-protocol 7(21): e2594. DOI: 10.21769/BioProtoc.2594.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Animal models
Cell Biology > Cell Transplantation > Xenograft
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,595 | https://bio-protocol.org/exchange/protocoldetail?id=2595&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessment of Aversion of Acute Pain Stimulus through Conditioned Place Aversion
LU Louise Urien
QZ Qiaosheng Zhang
EM Erik Martinez
HZ Haocheng Zhou
ND Nicole Desrosier
JD Jahrane Dale
JW Jing Wang
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2595 Views: 6946
Edited by: Geoff Lau
Reviewed by: Juan Facundo Rodriguez AyalaQing Yan
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
Pain is a complex experience. The aversive component of pain has been assessed through conditioned place aversion in rodents. However, this behavioral test does not allow the evaluation of the aversion of an acute pain stimulus. In Zhang et al. (2017), we provide an updated version of a Conditioned Place Aversion paradigm to address this challenge. In this protocol, a detailed version of this method is described.
Keywords: Conditioned Place Aversion Acute pain Laser stimulus Optogenetic stimulation
Background
Pain is a multidimensional experience that includes sensory and affective components. As such, behavioral tests that assess both the sensory and the emotional aspects of pain are critical to understanding the whole pain experience. However, the majority of available behavioral tests depends on the measurement of nociceptive stimuli and relies on withdrawal thresholds, which are reflexive responses. Nociceptive withdrawal reflex behaviors are under supraspinal control and can occur in the absence of supraspinal inputs. On the other hand, higher order pain behaviors such as conditioned place aversion (CPA) assess some of the emotional component of pain. These experiments involve having the animal choosing to avoid or escape a pain-inducing behavior and/or treatments by moving to the other chamber of the box (LaBuda and Fuchs 2000; Ding et al., 2005; van der Kam et al., 2008; McNabb et al., 2012; He et al., 2012). Lesions of the anterior cingulate cortex (ACC) block the development of escape-avoidance pain behaviors (Johansen et al., 2001; LaGraize et al., 2004; Qu et al., 2011). However, those previous behavioral assays always implied an avoidance learning paradigm, and the conditioning lasts for consecutive days. These assays also require that pain stimulation be applied for prolonged periods of time during the multi-day conditioning phases, and thus most of these assays employed a persistent or chronic pain model. As a result, these assays do not assess the aversive response to an acute pain stimulus. Therefore, testing the aversion of acute pain stimulus is urgently needed to allow for the accurate and comprehensive assessment of acute pain and the screening of analgesics.
With this in mind, we modified the previously described conditioned place aversion test. We applied an acute nociceptive stimulus to the hind paw of the animals. This stimulus was short-lived, as a paw withdrawal removed it. To make sure of a behavioral response, we repeated this stimulus. However, to ensure that we are testing an acute pain response, we shortened the experiment to 3 consecutive sessions of 10 min, with 10 min total for the pain conditioning phase.
Through this assay, we can observe an avoidance behavior which is short lasting and easily regulated by optogenetic modulation of ACC neurons.
Materials and Reagents
Male Sprague-Dawley rats, 250-300 g (Taconic Biosciences, catalog number: SD-M )
70% ethanol solution (Decon Labs, catalog number: 2716 )
Nivea Lip Care A Kiss of Cherry Fruity Lip Care 0.17 oz. (Walgreen, Nivea, catalog number: 331781 )
Nivea Lip Care A Kiss of Mint & Minerals Refreshing Lip Care 0.17 oz. (Walgreen, Nivea, catalog number: 443307 )
Isoflurane (Piramal Critical care, NDC 66794-017-25)
AAV1.CAMKII.ChR2-eYFP.WPRE.hGH (Penn vector Core, University of Pennsylvania)
AAV1.CAMKII.NpHR-eYFP.WPRE.hGH (Penn vector Core, University of Pennsylvania)
Equipment
Hamilton syringe, 75 ASN, 26 G, 5 µl (Hamilton, catalog number: 87989 )
Two High Power blue DPSS Lasers HPL1 and HPL2, 1,000 mW, 473 nm (Shanghai Dreams Laser Technology, catalog number: SDL-473-1000T )
Low Power blue DPSS Laser LPL, 200 mW, 473 nm (Shanghai Dream Lasers Technology, catalog number: SDL-473-10T )
Low Power yellow DPSS Laser LPL, 50 mW, 589 nm (Ultralasers, model: MGL-III-589-50 )
Digital Optical Power and Energy Meter (Thorlabs, model: PM100D )
Standard Photodiode Power Sensor (Thorlabs, model: S121C )
Mesh table (IITC Life Science, catalog number: 410 )
USB 3.0 monochrome industrial camera (The Imaging Source, catalog number: DMK 23U618 )
Varifocal manual iris lens (Computar, catalog number: T3Z3510CS )
1x2 fiber-optic rotary joint (Doric Lenses, model: FRJ_1x2i_FC-2FC )
TTL pulse generator (Doric Lenses, model: OTPG_4 )
Dohm sound machine (Marpac, catalog number: Marpac Dohm DS )
Standard desktop computer or laptop
Metal stand (Humboldt, catalog number: H-21330 )
2 chambered apparatus (designed in the laboratory, 16 x 7 x 13 cm) made from black (color number 2025) opaque acrylic, 1/4” (5.6 mm) thick (Canal Plastics Center, NY, USA)
Mini Glue Gun, 15 Watt, 1/4 In (Stanley Black & Decker, model: GR10 , catalog number: 3NZW9Mfr)
Clear Hot Melt Glue Stick, 1/4” Diameter, 4” Length, 24 PK (Stanley Black & Decker, model: GS10DT , catalog number: 2FDB9 Mfr.)
Ceramic LC MM Ferrule 1.25 mm (Thorlabs, catalog number: CFLC230-10 )
Ceramic split mating sleeve (Thorlabs, catalog number: ADAL1 )
Fiber cable (Thorlabs, catalog number: M83L01 )
Dental Cement Unifast Trad powder (Pearson Dental Supply, catalog number: G 05-12-24 ) and liquid (Pearson Dental Supply, catalog number: G 05-12-26 )
Software
ANY-maze tracking software (Stoelting Co., Illinois, USA, www.stoeltingco.com)
GraphPad Prism version 7 (GraphPad Software Inc, California, USA, www.graphpad.com)
OTPG4 software (Doric Lenses Inc, Quebec, Canada, http://doriclenses.com)
Procedure
For the outline of this protocol, see Figure 1.
Figure 1. Flowchart of the basic steps of the protocol
Hardware setup (detailed Figure 2)
For these experiments, we used thermal stimuli applied via High Power Lasers (HPL), and modulate the neuronal activity using optogenetic stimulation. The set up described above, can be customized to fit another type of stimulus.
Figure 2. Schematic of the complete set up used for performing a Conditioned Place Aversion experiment. CPA apparatus is placed on the mesh table. Animals are recorded via a camera connected to ANY-maze software. A High Power Laser (HPL) delivers a thermal stimulus applied by the experimenter, and a Low Power Laser (LPL) delivers optogenetic light stimulation. The LPL connects 2 fiber cables to the 2 optical fibers implanted in the head of the animal for bilateral optogenetic stimulation of the ACC. All lasers are controlled via a TTL pulse generator in the OPTG4 software to deliver the light stimuli synchronically.
We used a modified escape-avoidance paradigm as previously published (LaBuda and Fuchs, 2000). The apparatus was made of Plexiglas with dimensions 16 x 7 x 13 cm and placed on top of a mesh table (Figure 3). The box was divided into two chambers. To allow the animal to discriminate between the 2 chambers, each one is paired with different cues (any kind of smell, visual, or tactile cues). In our experiment, we applied different smell cues inside each lateral side of the 2 chambers (right chamber = cherry fruity smell/left chamber = mint smell).
Figure 3. Rat in the CPA apparatus. The rat is allowed to freely move between the two chambers during the 3 phases of the experiment. Its movements are recorded by the camera linked to the ANY-maze software, which calculates the time spent in each chamber.
Install the camera on the Metal stand above the 2 chambered apparatus.
Connect the lasers to the TTL pulse generator.
Connect the TTL pulse generator to the computer.
Turn on the Dohm sound machine.
Turn On HPLs and LPL. Let them warm up for 15 min.
Set HPLs to the desired power using the power meter
HPL1 Non noxious Stimulus NS-50 mW, and HPL2 to High noxious Stimulus HS-250 mW;
HPL1 Low noxious Stimulus LS-150 mW and HPL2 to High noxious Stimulus HS-250 mW;
HPL1 Non noxious Stimulus NS-50 mW and HPL2 to Non noxious Stimulus NS-50 mW;
HPL1 Low noxious Stimulus LS-150 mW and HPL2 to Low noxious Stimulus LS-150 mW;
HPL1 High noxious Stimulus HS-250 mW and HPL2 to High noxious Stimulus HS-250 mW.
Set LPL to the desired power using the power meter for optogenetic stimulation (power = 10 mW).
Software set up
Ensure that the number of the channel corresponds to the correct port on the TTL pulse generator. HPL1 connected to port entry #1 will be controlled in Channel 1, HPL2 connected to port entry #2 will be controlled in Channel 2, and LPL connected to port entry #3 will be controlled in Channel 3 (Figure 4).
Set the parameters in OTPG4 software to control the HPL.
For optogenetic modulation of neuronal activity:
Set the parameters in OTPG4 software to control the LPL (example: frequency = 20 Hz; Time ON duration = 10 msec, Number of Pulses = 100, Channel 3 in Figure 4).
Figure 4. OTPG4 software interface
Turn On the ANY-maze software on the computer
Start by opening a New Experiment and name it.
Create a New Protocol (Figure 5).
Figure 5. ANY-maze software. How to create a new protocol.
Select the video source corresponding to your camera and set up your image. Name a new apparatus (example CPA).
Create two zones on the screen (Figure 6), name them and select the settings you want to record during the experiment (time in the zone).
Figure 6. ANY-maze software. How to delimitate 2 zones.
On the stages tab, select the duration of your experiment (600 sec = 10 min in our case) Select the type of data you want to collect in Results, Report and Data.
Set up the parameters of your Experiment (number of animals, different phases. Figure 7).
Figure 7. ANY-maze software. Set up for a new experiment.
To start recording, go to the Test section → click on video recording → ‘Play’ button (double click until the chronometer starts).
Note: For any additional parameters, please refer to ANY-maze software Guideline.
Experiments
For optogenetic manipulation of neuronal activity, prior to conducting the behavioral experiments, perform transcranial injections of optogenetic constructs. Anesthetize animals with isoflurane (1.5 to 2%). In all experiments, the virus is delivered to the anterior cingulate cortex (ACC) only. Rats are bilaterally injected with 0.5 μl of viral vectors at a rate of 0.1 μl/10 sec with a 26-G 5 μl Hamilton syringe at anteroposterior (AP) +2.6 mm, mediolateral (ML) ±1.6 mm, and dorsoventral (DV) -2.25 mm, with tips angled 28° toward the midline. The microinjection needles are left in place for 10 min, raised 1 mm and left for another minute to allow for diffusion of virus particles away from injection site, while minimizing spread of viral particles along the injection tract.
Rats are then implanted with 200 μm optic fibers held in 2.5 mm ferrules in the ACC: AP +2.6 mm, ML ±1.6 mm, DV -1.25 mm. Fibers with ferrules are held in place by dental acrylic. Allow the virus to be properly expressed in the neurons (2 to 4 weeks depending of the viral vector serotype).
For 1 week prior to beginning experiments, rats are habituated to the experimenter and the environment. Rats must be comfortable with the experimenter to give the best possible results. Rats are handled by the experimenter. If they seemed stressed or anxious, they are put back in their cages and resumed habituation the following day. During all the behavioral phases, animals are allowed to move unrestricted to either side of the box. The movements of rats in each chamber are automatically recorded by a camera and analyzed with the ANY-maze software (Stoelting).
During the preconditioning phase (Video 1), place rats randomly on either the left or the right side of the box to start. An equal number of animals in each group starts on either the left or the right side of the box. All animals are allowed to explore the two chamber apparatus without restraint for 10 min. The movement of each rat is recorded and analyzed to verify the absence of any preconditioning chamber preference (Figure 9). Animals spending more than 500 sec or less than 100 sec of the total time in any chamber should be eliminated from further testing or analysis (< 20% of total animals).
Video 1. Preconditioning phase. All animals are allowed to explore the two chamber apparatus for 10 min. The two chambers are delimited by an orange rectangle and the position of the animal is monitored by a red dot tracking the center of the animal’s body. Time spent in each chamber is recorded by the camera linked to the ANY-maze software.
Following the preconditioning phase, the rats undergo conditioning for 10 min (Video 2): each chamber is paired with a stimulus (noxious or not, different noxious intensity). As an example, chamber A is paired with a thermal painful stimulus (laser-High Stimulus HS) and the other chamber (B) is paired with a thermal non-painful stimulus (laser-Non Noxious Stimulus NS). Stimuli are given to the hind-paw every 10 sec when the animal is immobile. For each stimulus applied to the rat’s hind paw, bring the laser tip closely to the animal (0.3-0.5 mm without touching the rodent’s skin), between the holes in the grid of the mesh table. Even if the animal is freely moving, it has some immobile periods during which it’s possible for the experimenter to apply the stimulus on a precise location, its hind paw. Paw withdrawal removes the stimulus as the experimenter would stop applying the stimulus to the rodent’s hind paw.
Video 2. Conditioning phase. Each chamber is paired with a stimulus. The left chamber is paired with a thermal painful stimulus (laser-High Stimulus HS) and the right chamber is paired with a thermal non-painful stimulus (laser-Non Noxious Stimulus NS). Stimuli are given to the hind-paw every 10 sec. Peripheral stimuli are applied to the hind paws through the mesh table.
As you can observe on this picture (Figure 8), the tip of the laser (red arrow) is positioned between the holes of the mesh table, allowing to come as close as 0.3-0.5 mm to the rat’s hindpaw, standing above.
Note: In some experiments, the thermal stimulus delivered by the HPL is paired with an optogenetic activation or inhibition of ACC neurons controlled by the LPL. If channel 1 controls HPL1 and channel 3 controls the LPL for the optogenetic stimulation you just have to click on ‘Start All’ on the OTPG4 software interface (Figure 4) and you will activate both lasers simultaneously.
Figure 8. How to apply the stimulus
Finally, the animals undergo a test phase (Video 3), where they are allowed to explore the two chamber apparatus for 10 min (Figure 9).
Video 3. Test phase. All animals are allowed to explore the two chamber apparatus for 10 min. This phase is comparable to the preconditioning phase and aims to see the effect of the conditioning through a change of time spent in each chamber.
Figure 9. Representative results of CPA behavior (original Figure 1.C [Zhang et al., 2017]: Rats recognize and seek to avoid the aversive value associated with HS). During conditioning, rats receive HS in one chamber and NS in the other chamber. After conditioning, rats spend less time in the chamber paired with HS during the post conditioning phase (blue bars) than during the preconditioning phase (white bars), and more time in the chamber paired with NS. n = 14; P < 0.0001; paired Student’s t-test.
At the end of the test, place the animal back in his cage; clean the apparatus, and mesh table with a 70% ethanol solution.
Data analysis
The data analysis was conducted using GraphPad Prism version 7. The ANY-maze software provides us a value of time spent in each chamber and we analyze the videos offline to be sure that the tracking was efficient, and not erroneous because of tracking artifacts introduced by, for example, manual movement of the laser fiber.
A paired Student’s t-test was used to compare the time spent in each treatment chamber before and after conditioning (i.e., baseline vs. test phase for each chamber). Decreased time spent in a chamber during the test phase when compared with the baseline, indicates avoidance (aversion) for that chamber.
Notes
All procedures in this study were approved by the New York University School of Medicine Institutional Animal Care and Use Committee (IACUC) as consistent with the National Institute of Health Guide for the care and use of laboratory Animals to ensure minimal animal use and discomfort. Male Sprague-Dawley rats were purchased from Taconic Farms, Albany, NY and kept at Mispro Biotech Services Facility in the Alexandria Center for Life Science, with controlled humidity, temperature, and 12 h (6:30 AM to 6:30 PM) light-dark cycle. Food and water were available ad libitum. Animals arrived to the animal facility at 250 to 300 g and were given on average 10 days to adjust to the new environment prior to the onset of experiments.
The apparatus was made of 6 black acrylic plexiglas panels (2 panels 16 x 13 and 2 panels 7 x 13 to build the rectangular base, 2 panels 1 x 13 to do the separation between the 2 chambers). The panels were glued together to make a two chamber apparatus, dimensions 16 x 7 x 13 cm (see Equipment).
The box was divided into two chambers. To allow the animal to discriminate between the 2 chambers, each one is paired with different cues (any kind of smell, visual, or tactile cues). In our experiment, we applied different smell cues inside each lateral side of the 2 chambers (right chamber = cherry fruity smell/left chamber = mint smell).
The habituation of the rats to the experimenter 1 week prior to the test is done to ensure that the rats are comfortable with the experimenter and the testing environment. This will reduce/mitigate the effect that the presence of the experimenter and novel environment will have on the rat’s movement during the experiments. The animals were handled by the experimenter daily for 5 min, until the animals showed signs of stress (start to urinate, defecate or vocalize), or escaped from the experimenter’s arms. No force or restraint was used and the time the animals are handled increases daily. The habituation was performed in the same room as the experiments will be conducted. In addition to the experimenter’s handling, the animals were also placed 5 min in the two-chamber apparatus for habituation to the environment. The experimenter is expected to stand in a neutral position when performing the test; a location where each chamber is equidistant from the experimenter. All the phases of the experiment (preconditioning, conditioning, and testing) should occur, one right after the other.
Acknowledgments
This work was supported by the National Institute of General Medical Sciences (GM115384), National Institute of Neurological Disorders and Stroke (NS100065), (Bethesda, MD, USA) and the Anesthesia Research Fund of New York University Department of Anesthesiology (New York, NY, USA). The authors declare no competing financial interests. This protocol was adapted from LaBuda and Fuchs, 2000.
References
Ding, H. K., Shum, F. W., Ko, S. W. and Zhuo, M. (2005). A new assay of thermal-based avoidance test in freely moving mice. J Pain 6(7): 411-416.
He, Y., Tian, X., Hu, X., Porreca, F. and Wang, Z. J. (2012). Negative reinforcement reveals non-evoked ongoing pain in mice with tissue or nerve injury. J Pain 13(6): 598-607.
Johansen, J. P., Fields, H. L. and Manning, B. H. (2001). The affective component of pain in rodents: direct evidence for a contribution of the anterior cingulate cortex. Proc Natl Acad Sci U S A 98(14): 8077-8082.
LaBuda, C. J. and Fuchs, P. N. (2000). A behavioral test paradigm to measure the aversive quality of inflammatory and neuropathic pain in rats. Exp Neurol 163(2): 490-494.
LaGraize, S. C., Labuda, C. J., Rutledge, M. A., Jackson, R. L. and Fuchs, P. N. (2004). Differential effect of anterior cingulate cortex lesion on mechanical hypersensitivity and escape/avoidance behavior in an animal model of neuropathic pain. Exp Neurol 188(1): 139-148.
McNabb, C. T., Uhelski, M. L. and Fuchs, P. N. (2012). A direct comparison of affective pain processing underlying two traditional pain modalities in rodents. Neurosci Lett 507(1): 57-61.
Qu, C., King, T., Okun, A., Lai, J., Fields, H. L. and Porreca, F. (2011). Lesion of the rostral anterior cingulate cortex eliminates the aversiveness of spontaneous neuropathic pain following partial or complete axotomy. Pain 152(7): 1641-1648.
van der Kam, E. L., De Vry, J., Schiene, K. and Tzschentke, T. M. (2008). Differential effects of morphine on the affective and the sensory component of carrageenan-induced nociception in the rat. Pain 136: 373-79.
Zhang, Q., Manders, T., Tong, A. P., Yang, R., Garg, A., Martinez, E., Zhou, H., Dale, J., Goyal, A., Urien, L., Yang, G., Chen, Z. and Wang, J. (2017). Chronic pain induces generalized enhancement of aversion. Elife 6: e25302.
Copyright: Urien et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Urien, L., Zhang, Q., Martinez, E., Zhou, H., Desrosier, N., Dale, J. and Wang, J. (2017). Assessment of Aversion of Acute Pain Stimulus through Conditioned Place Aversion. Bio-protocol 7(21): e2595. DOI: 10.21769/BioProtoc.2595.
Zhang, Q., Manders, T., Tong, A. P., Yang, R., Garg, A., Martinez, E., Zhou, H., Dale, J., Goyal, A., Urien, L., Yang, G., Chen, Z. and Wang, J. (2017). Chronic pain induces generalized enhancement of aversion. Elife 6.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Neuroscience > Sensory and motor systems > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,596 | https://bio-protocol.org/exchange/protocoldetail?id=2596&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Nematode Epicuticle Visualisation by PeakForce Tapping Atomic Force Microscopy
FA Farida Akhatova
GF Gölnur Fakhrullina
EG Elvira Gayazova
Rawil Fakhrullin
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2596 Views: 7589
Edited by: Neelanjan Bose
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
The free-living soil nematode Caenorhabditis elegans has become an iconic experimental model animal in biology. This transparent animal can be easily imaged using optical microscopy to visualise its organs, tissues, single cells and subcellular events. The epicuticle of C. elegans nematodes has been studied at nanoscale using transmission and scanning (SEM) electron microscopies. As a result, imaging artefacts can appear due to embedding the worms into resins or coating the worms with a conductive gold layer. In addition, fixation and contrasting may also damage the cuticle. Conventional tapping mode atomic force microscopy (AFM) can be applied to image the cuticle of the dried nematodes in air, however this approach also suffers from imaging defects. Ideally, the nematodes should be imaged under conditions resembling their natural environment. Recently, we reported the use of PeakForce Tapping AFM mode for the successful visualisation and numerical characterisation of C. elegans nematode cuticle both in air and in liquid (Fakhrullina et al., 2017). We imaged the principal nematode surface structures and characterised mechanical properties of the cuticle. This protocol provides the detailed description of AFM imaging of liquid-immersed C. elegans nematodes using PeakForce Tapping atomic force microscopy.
Keywords: Atomic force microscopy Nematodes Caenorhabditis elegans Cuticle PeakForce Tapping Layer-by-Layer assembly
Background
Nematodes, both free-living and parasitic, have been extensively studied due to their remarkable biology and effects on agriculture and human well-being. Apparently, the most studied and famous species among nematodes is a free-living soil nematode Caenorhabditis elegans (Sterken et al., 2015). This round worm has been successfully employed as a versatile model organism in a number of investigations (Fire et al., 1998; Kenyon, 2010; Swierczek et al., 2011; O’Reilly et al., 2014; Stroustrup et al., 2016), securing eventually a Nobel prize for Sidney Brenner, John Sulston and Robert Horvitz in 2002. C. elegans nematode is a tiny (~1 mm long) transparent animal which can be easily visualised using an optical microscope. Its cuticle, though thin and transparent, serves as a principal protective barrier between the worm and its habitat. Cuticle is an important marker of disease, when pathogenic bacteria colonize it, leading to the death of the infected animal. In addition, the structure of the cuticle may indicate the ageing in the nematodes. From the human health care and industrial point of view, monitoring of the cuticle of nematodes might be helpful in elucidation of novel antinematode chemicals affecting the cuticle. As a result, nanoscale imaging of the nematode epicuticle in its natural liquid environments may open new avenues in biomedical research.
Previously, the cuticle of nematodes (mostly employing C. elegans as a model organism) has been studied using electron microscopy, both transmission and scanning. Unfortunately, electron microscopy does not allow imaging the worms in liquid, which is their native environment. Sample preparation for electron microscopy requires fixation, dehydration, contrast staining or surface sputtering, and also resin embedding for ultrathin slicing. As a result, nematode cuticle may exhibit secondary artifacts preventing from evaluation of native surface structure and mechanical characterisation. Atomic force microscopy has been established as a potent tool in imaging biological samples in situ, including imaging live cells in liquid media (Beaussart et al., 2015). Recently, the application of tapping mode AFM to visualise C. elegans nematodes in air has been reported (Allen et al., 2015). Imaging in air suffered from the same drawback as scanning electron microscopy, for example the images demonstrated the typical shrunk and collapsed cuticle surfaces apparently caused by dehydration and air imaging. We envisaged a different technique, based on PeakForce Tapping AFM mode (Alsteens et al., 2012) for successful visualisation of C. elegans nematode cuticle in water (Fakhrullina et al., 2017). Here we report a detailed protocol for this technique.
Materials and Reagents
Note: All chemicals were purchased from Sigma-Aldrich unless noted otherwise.
Pipette tips
Petri dishes
Dust-free Nexterion glass slides (Schott)
Wild type C. elegans (N2 Bristol) nematodes
Escherichia coli OP50 bacteria
Poly(allylamine hydrochloride) (PAH, molecular weight ~17,5 kDa) (Sigma-Aldrich, catalog number: 283215 )
Poly(sodium 4-styrenesulfonate) (PSS, molecular weight ~70 kDa) (Sigma-Aldrich, catalog number: 243051 )
Nematode growth media (NGM) (bioWORLD, catalog number: 30620040-1 )
Nematode lysis solution (aqueous 2% NaOCl/0.45 M NaOH)
Sodium hypochlorite (NaClO) (Sigma-Aldrich, catalog number: 425044 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S8045 )
Levamisole hydrochloride (Sigma-Aldrich, catalog number: L9756 )
Glutaraldehyde (25% aqueous) (Sigma-Aldrich, catalog number: G5882 )
Ultrapure (type 1) water purified by Simplicity (Millipore) water purification system
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: NIST200B )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: 71649 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: 793612 )
Aqueous M9 buffer (see Recipes)
Equipment
Pipettes (mechanical Eppendorf or Gilson pipettes)
Eppendorf Scientific Excella E24 temperature-controlled benchtop shaker (Eppendorf, New BrunswickTM, model: Excella® E24 )
Biosan V-1 plus vortex (Biosan, model: V-1 plus )
Nikon SMZ 745 T stereomicroscope (Nikon, model: SMZ745T )
Dimension FastScan Bio atomic force microscope (Bruker, model: Dimension FastScan ) equipped with a liquid submergible scanner
Note: Do not use air scanners for scanning in liquid, this may damage the instrument.
Biosan Microspin 12 centrifuge (Biosan, model: Microspin 12 )
ScanAsyst-Fluid probes (nominal length 70 µm, tip radius 20 nm, spring constant of 0.7 N m-1) (Bruker, model: SCANASYST-FLUID )
Note: Other AFM probes from Bruker or other producers approved for using in PeakForce Tapping mode having characteristics similar to ScanAsyst-Fluid probes can also be used.
Software
NanoScope AFM operating software (Bruker Corporation)
NanoScope Analysis v.1.7. software (Bruker Corporation)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Akhatova, F., Fakhrullina, G., Gayazova, E. and Fakhrullin, R. (2017). Nematode Epicuticle Visualisation by PeakForce Tapping Atomic Force Microscopy. Bio-protocol 7(21): e2596. DOI: 10.21769/BioProtoc.2596.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Atomic force microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,597 | https://bio-protocol.org/exchange/protocoldetail?id=2597&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Rice Stripe Virus Preparation from Viruliferous Small Brown Planthoppers and Mechanic Inoculation on Rice
WZ Wan Zhao
LK Le Kang
FC Feng Cui
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2597 Views: 5910
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Tenuiviruses can infect the plants of the family Poaceae, and cause serious loss of crops, particularly rice and maize, in South-Eastern Asian countries. Tenuiviruses usually depend on insect vectors for their transmission and cannot be transmitted between plants through wounds or abrasions. Rice stripe virus (RSV), a typical member of tenuiviruses, is efficiently transmitted by the small brown planthopper Laodelphax striatellus in a persistent-propagative manner to cause rice stripe disease. Here we presented a convenient method, the midrib micro-injection, to mechanically inoculate insect-derived RSV into rice leaves for conducting pathogenicity assay on rice plants.
Keywords: Rice stripe virus Mechanical inoculation Micro-injection Small brown planthopper
Background
Tenuiviruses cannot be mechanically inoculated into plants, unless through vascular puncture inoculation with quite different transmission rates ranging from 1% to 90% according to different experimental details (Louie, 1995; Hogenhout et al., 2008). As to RSV, mechanical transmission usually fails or yields a low infectious rate (Ling, 1972). In particular, the transmission rate was only 6% after the injection of the RSV crude extraction from diseased plants (Okuyama and Asuyama, 1959). The midrib micro-injection method mentioned in this work promotes the RSV transmission rate to 17%. Though the incidence of RSV by mechanical transmission is still much lower than that by insect vector transmission (53%), our method provides a convenient way for mechanical inoculation of persistent-propagative plant viruses. Moreover, based on this method, replication and gene expression of a persistent-propagative plant virus can be determined more accurately in infected plant hosts without the interference of insects, i.e., the inoculation doses and the insect proteins.
Materials and Reagents
15 ml centrifuge tube, RNase-/DNase-free (Corning, catalog number: 430791 )
1.5 ml clear Microtubes (Corning, Axygen®, catalog number: MCT-150-C )
Plastic tissue grinder pestles (Tiangen Biotech, catalog number: OSE-Y001 )
Pipettes with tips of 10 μl, 100 μl, and 1,000 μl (Eppendorf, catalog numbers: 3120000020 , 3120000046 and 31200000623 )
PVDF Western blotting membranes (Sigma-Aldrich, catalog number: 03010040001 )
Note: Currently, it is ‘Merck, catalog number: 03010040001 ’.
Extra thick blot paper filter paper (Bio-Rad Laboratories, catalog number: 1703965 )
96-well ELISA Microplates (Greiner Bio One International, catalog number: 650001 )
Adhesive plastic
25 G ⅝ to 30 G ½ gauge needle
Drummond replacement glass capillaries, 100/vial (Drummond Scientific, catalog number: 3-000-203-G/X )
Parafilm® M (Sigma-Aldrich, catalog number: P7793 )
Note: Currently, it is ‘Merck, catalog number: P7793 ’.
Insect vectors (Laodelphax striatellusi, Fallen) (collected from a field population in Hai’an, Jiangsu Province, China)
RSV cp gene was amplified with the primers: 5’-ATGGGTACCAACAAGCCAGC-3’, and 5’-CTAGTCATCTGCACCTTCTG-3’. PCR was run on the ProFlexTM PCR System under cycling conditions of 95 °C for 5 min, followed by 30 cycles of 95 °C for 20 sec, 50 °C for 30 sec and 72 °C for 30 sec. The purified 969 bp of PCR products were cloned into pET-28a (Merck, Novagen, catalog number: 69865-3 ) for Cp protein expression. The recombinant cp plasmid was sent to Beijing Genomics Institute for monoclonal anti-Cp antibody production
Host plants (Oryza sativa L. spp. japonica var. Nippobare)
Note: Healthy 2-week-old rice leaves with the length of approximately 15 cm were used for microinjection.
Protein loading buffer (5x) (Adipogen International, catalog number: AG-10T-0020-L001 )
ExpressPlusTM PAGE gel, 4-20% (GenScript, catalog number: M42010 )
PageRulerTM prestained protein ladder, 10 to 180 kDa (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 26616 ), used for SDS-PAGE
HEPES (Fisher Scientific, catalog number: BP310-100 ), used for SDS-PAGE
EMPLURA® methanol (Merck, catalog number: 822283 )
ELISA coating buffer, 1x (Solarbio, catalog number: C1050 )
SuperSignalTM West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 34095 )
Goat anti-mouse IgG (H+L) secondary antibody, HRP (Thermo Fisher Scientific, InvitrogenTM, catalog number: 32430 )
Anti-Cp antibody (Beijing Genomics Institute)
3,3’,5,5’-Tetramethylbenzidine (TMB) Liquid Substrate System for ELISA (Sigma-Aldrich, catalog number: T0440 )
Note: Currently, it is ‘Merck, catalog number: T0440 ’.
Sulfuric acid (H2SO4) (5 N) (Merck, catalog number: 480364 ), used for ELISA
Sodium dodecyl sulfate (SDS) (AMRESCO, catalog number: 0227 ), used for ELISA
Mineral oil (Sigma-Aldrich, catalog number: M8410 )
Note: Currently, it is ‘Merck, catalog number: M8410 ’ .
Tween® 20 (Sigma-Aldrich, catalog number: P1379 )
Phosphate buffer saline (PBS), pH 7.4, basic (1x) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010031 )
OxoidTM Skim milk power (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: LP0031B )
Phosphate buffer saline with Tween 20 (1x) (PBST) (see Recipes)
Transfer buffer (see Recipes)
Blocking buffer (see Recipes)
Diluted monoclonal anti-Cp antibody (see Recipes)
Diluted Goat anti-mouse IgG, HRP-conjugated antibody (see Recipes)
Equipment
TGrinder High Speed Tissue grinder (Tiangen Biotech, catalog number: OSE-Y30 )
Centrifuge 5424R (Eppendorf, model: 5424 R )
Decolorizing Orbital Shaker (T-Bota Scietech Instruments & Equipment, model: TS-200 ), used for antibody incubation in ELISA and Western blots
Chemiluminescent Imaging System (Tanon, model: Tanon 5200 )
SpectraMax® Paradigm® Multi-Mode Detection Platform (Molecular Devices, model: SpectraMax Paradigm Multi-Mode )
Micropipette Puller (Sutter Instrument, model: P-97 )
ProFlexTM PCR System (Thermo Fisher Scientific, Applied BiosystemsTM, model: ProFlexTM 3 x 32-Well PCR System, catalog number: 4484073 )
Glass incubators (Φ55 x 150 mm, Φ110 x 150 mm), used for planthopper incubation
Note: Each glass incubator must be sealed with a nylon mesh in order to protect the cultured plants or insects from other interference sources. The culture condition is 25 °C, with 16 h of light daily (Figure 1).
Figure 1. Plant culture and insect rearing. The small brown planthoppers and rice seedlings are cultured in glass incubators sealed with nylon meshes. The viruliferous or nonviruliferous planthoppers are geographically isolated, which are cultured in different insectaries.
MixMate® , the 3-in-1 mixer (Eppendorf, catalog number: 5353000014 )
H2O3 dry bath (Coyote Bioscience, model: H2O3-100C )
PowerPacTM universal power supply (Bio-Rad Laboratories, catalog number: 1645070 )
Trans-Blot® TurboTM transfer system (Bio-Rad Laboratories, catalog number: 1704150 )
Nanoject II Programmable Nanoliter injector (World Precision Instruments, model: Nanoliter 2000 )
Backfilling Needle for Nanoject II Auto-Nanoliter Injector, 2” Length (Drummond Scientific, model: 3-000-027 )
SZ61 Stereo microscope (Olympus, model: SZ61 ), used for microinjection
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhao, W., Kang, L. and Cui, F. (2017). Isolation of Rice Stripe Virus Preparation from Viruliferous Small Brown Planthoppers and Mechanic Inoculation on Rice. Bio-protocol 7(21): e2597. DOI: 10.21769/BioProtoc.2597.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Plant Science > Plant physiology > Phenotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,598 | https://bio-protocol.org/exchange/protocoldetail?id=2598&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Monitoring the Targeting of Cathepsin D to the Lysosome by Metabolic Labeling and Pulse-chase Analysis
LT Lucas A. Tavares
Ld Luis L. P. daSilva
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2598 Views: 7013
Edited by: Ralph Bottcher
Reviewed by: Kate HannanYong Teng
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Mannose 6-phosphate receptors function can be studied in living cells by investigating alterations in processing and secretion of their ligand Cathepsin D. The assay described here is well established in the literature and comprises the metabolic labeling of newly synthesized proteins with [35S] methionine-cysteine in HeLa cells to monitor Cathepsin D processing through secretory pathway and secretion using immunoprecipitation, SDS-PAGE and fluorography.
Keywords: Acid hydrolases Cathepsin D Mannose 6-phosphate receptors MPR Secretory pathway Lysosomes Metabolic labeling Pulse-chase
Background
Cathepsin D (catD) is a lysosomal aspartic protease sorted by Mannose 6-phosphate receptors (M6PRs) that transport it from the trans-Golgi network to endosomes/lysosomes in mammalian cells (Ghosh et al., 2003). CatD is synthesized as a precursor protein (~52 kDa), which is cleaved in lysosomes to generate an intermediate (~48 kDa) or the mature lysosomal form (~34 kDa). Trace amounts of the precursor protein are also secreted from the biosynthetic pathway (Benes et al., 2008). The abundance of catD can be determined using several approaches, such as immunofluorescence-based staining (Poole et al., 1972), Western blotting, fluorometric activity assay (Bewley et al., 2011) or metabolic labeling with pulse-chase analysis (Hirst et al., 2009; Kametaka et al., 2007; Tavares et al., 2017). The later is considered a highly sensitive and quantitative approach to monitor catD dynamics (post-translational processing, secretion and degradation) through the secretory pathway. Specifically it involves metabolically labeling newly synthesized proteins in cells followed by a chase, and then to immunoprecipitate catD from the cell lysate and media (secreted form). Therefore, this method provides a way to follow catD molecules from synthesis to lysosomal targeting or secretion with minimal disturbance of normal cell physiology in its natural environment. Herein we described metabolic labeling with [35S] methionine-cysteine in HeLa cells to monitor catD processing, secretion and degradation by using immunoprecipitation, SDS-PAGE and fluorography.
Materials and Reagents
Filter pipette tips
6-well plate (Corning, catalog number: 3516 )
Ice bucket
Aluminum foil
1.5 ml micro-centrifuge tubes (Corning, Axygen®, catalog number: MCT-150-C )
WhatmanTM 3030-347 Grade 3 MM Chr cellulose chromatography paper sheet (GE Healthcare, catalog number: 3030-347 )
Minisart filters pore size 0.22 μm (Sartorius, catalog number: 16534-K )
HeLa (ATCC, catalog number: CCL-2 )
10x PBS (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9624 )
Penicillin-streptomycin solution (Thermo Fisher Scientific, GibcoTM, catalog number: 15070063 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, catalog number: 12657029 )
Dulbecco’s modified Eagle’s medium-high glucose-without L-methionine, L-cysteine and L-glutamine (Sigma-Aldrich, catalog number: D0422 )
L-Methionine (Sigma-Aldrich, catalog number: M9625 )
L-Cysteine (Sigma-Aldrich, catalog number: 168149 )
L-Glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
EasyTagTM EXPRESS 35S protein labeling mix of both 35S-L-methionine and 35S-L-cysteine (Express Protein Label) (PerkinElmer, catalog number: NEG772007MC )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Ethylenediamine tetraacetic acid (EDTA) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575020 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 )
Protein A plus Ultralink resin (Thermo Fisher Scientific, catalog number: 53142 )
10% (v/v) bovine serum albumin (BSA) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15561020 )
Cathepsin D antibody (EMD Millipore, Calbiochem, catalog number: 219361 )
L-Glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030149 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Glycerol (C3H8O3) (Sigma-Aldrich, catalog number: G5516 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Methanol (CH3OH) (Sigma-Aldrich, catalog number: 322415 )
Acetic acid (CH3COOH) (Sigma-Aldrich, catalog number: 320099 )
Amplify fluorographic reagent (GE Healthcare, catalog number: NAMP100 )
β-Mercaptoethanol (Sigma-Aldrich, catalog number: M3701 )
Dulbecco’s modified eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 12800017 ) (see Recipes)
100x L-methionine/L-cysteine solution (see Recipes)
Pulse medium (see Recipes)
Chase medium (see Recipes)
Lysis buffer (see Recipes)
Wash buffer (see Recipes)
2x sample buffer (see Recipes)
Fixation solution (see Recipes)
Running buffer (see Recipes)
Equipment
Pipettes
Incubator
Titer plate shaker (Thermo Fisher Scientific, catalog number: 4625Q )
Centrifuge for 1.5 ml micro-centrifuge tubes (Thermo Fisher Scientific, model: SorvallTM ST 16 , catalog number: 75004380) with rotor for micro-centrifuge tubes (Thermo Fisher Scientific, catalog number: 75003652 )
Tube rotator capable of end-over-end inversion of the tubes (Phoenix Luferco, catalog number: AP22 or equivalent)
A chamber to run mini-gels (Bio-Rad Laboratories, model: Mini-PROTEAN Tetra Cell )
Gel-dryer (Hoefer, model: GD2000 , Slab Gel Dryer) coupled with a vacuum pump
Exposure cassette for unmounted screen, 20 x 25 cm (GE Healthcare, catalog number: 63-0035-44 )
Pharos FX plus molecular imager (Bio-Rad Laboratories, catalog number: 1709450 )
BAS storage phosphor screen (GE Healthcare, catalog number: 28-9564-82 )
Appropriate receptacle to dispose of solid and liquid contaminated with 35S (according to the local radiation safety guidelines)
Software
Quantity One 1-D Analysis Software (Bio-Rad Laboratories)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tavares, L. A. and daSilva, L. L. (2017). Monitoring the Targeting of Cathepsin D to the Lysosome by Metabolic Labeling and Pulse-chase Analysis. Bio-protocol 7(21): e2598. DOI: 10.21769/BioProtoc.2598.
Download Citation in RIS Format
Category
Biochemistry > Protein > Labeling
Biochemistry > Protein > Immunodetection
Molecular Biology > Protein > Detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,599 | https://bio-protocol.org/exchange/protocoldetail?id=2599&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunogold Localization of Molecular Constituents Associated with Basal Bodies, Flagella, and Extracellular Matrices in Male Gametes of Land Plants
Renee A. Lopez
KM Katayoun Mansouri
JH Jason S. Henry
NF Nicholas D. Flowers
KR Karen Sue Renzaglia
*Contributed equally to this work
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2599 Views: 6465
Edited by: Scott A M McAdam
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
Male gametes (spermatozoids) are the only motile cells produced during the life cycle of land plants. While absent from flowering and most cone-bearing plants, motile cells are found in less derived taxa, including bryophytes (mosses, liverworts and hornworts), pteridophytes (lycophytes and ferns) and some seed plants (Ginkgo and cycads). During development, these cells undergo profound changes that involve the production of a locomotory apparatus, unique microtubule (MT) arrays, and a series of special cell walls that are produced in sequence and are synchronized with cellular differentiation. Immunogold labeling in the transmission electron microscope (TEM) provides information on the exact location and potential function of macromolecules involved with this developmental process. Specifically, it is possible to localize epitopes to proteins that are associated with the cellular inclusions involved in MT production and function. Spermatogenesis in these plants is also ideal for examining the differential expression of carbohydrates and glycoproteins that comprise the extracellular matrixes associated with the dramatic architectural changes in gamete shape and locomotory apparatus development. Here we provide methodologies using monoclonal antibodies (MAbs) and immunogold labeling in the TEM to localize macromolecules that are integral to spermatozoid development.
Keywords: Arabinogalactan proteins Carbohydrates Centrin Extracellular matrix Flagella Gamma tubulin Immunogold labeling Microtubule organizing centers Transmission electron microscopy
Background
Motile gametes of land plants are strikingly diverse with numbers of flagella ranging from two to greater than 40,000 (Renzaglia and Garbary, 2001). Following a series of synchronized mitotic divisions within antheridia, nascent sperm cells (spermatids) undergo a sequence of developmental changes within the confines of a dynamic and growing cell wall. A complex locomotory apparatus is produced and flagella elongate around the cell as the organelles are repositioned and shaped. Synchronized development yields hundreds of cells in a single stage of maturation and in different planes of section within a single antheridium.
This profound cellular differentiation involves the development of unique MT arrays, the spline and flagella, that emanate from discrete microtubule organizing centers (MTOCs), the only centriole-containing centrosomes in land plants. Because of the exclusive occurrence of basal bodies, flagella and associated complexes in developing male gametes, studies of spermatogenesis have revealed important information on the structure, composition, and developmental changes in MT arrays as they relate to the cell cycle, MTOCs and cellular differentiation in plants (Joshi et al., 1992; Lui et al., 1993; Vaughn and Renzaglia, 1993; Hoffman et al., 1994; Hoffman and Vaughn, 1995; Vaughn and Harper, 1998; Klink and Wolniak, 2003; Vaughn and Renzaglia, 2006; Vaughn and Bowling, 2008; Vaughn, 2013). A dynamic and flexible extracellular matrix is necessary for spermatogenesis to take place (Garbary and Renzaglia, 2001; Lopez and Renzaglia, 2014); thus spermatogenesis in plants provides an opportunity to examine cell wall changes during development.
The purpose of this review is to describe the methodologies used in localizing proteins, carbohydrates and glycoproteins during the development of motile gametes in land plants. One of the most powerful tools in these studies involves antibodies that recognize epitopes to macromolecules using immunogold labeling techniques at the TEM level (Vaughn, 2013). Here we provide images and a brief discussion of results using immunogold labeling to examine the molecular constituents involved in sperm cell development in plants. Two procedures for these investigations are provided that use the same Materials and Reagents, and Equipment: Procedure A describes the protocol for microtubule-related proteins and procedure B for localizing cell wall constituents.
Procedure A: Immunogold labeling has led to important advances in understanding the role of the proteins centrin and tubulin in plants (Figures 1A-1E). Centrin is a ~20 kDa Ca-binding protein first discovered in motile green algae (Satisbury, 1995), where it is localized to the stellate pattern in the transition zone of the flagella and a dense band of fibers (distal fibers) that connect the nucleus to the basal bodies. In spermatogenous cells, centrin localizes to specific, seemingly diverse structures (Figures 1A-1D). The plates of the multilayered structure (MLS) of the locomotory apparatus, but not the microtubules (MTs), are strongly labeled with antibodies that recognize centrin (Vaughn and Renzaglia, 1993; Vaughn and Harper, 1998) (Figures 1A and 1B). The transition zone that occurs in the flagella of most plants with motile cells also strongly labels with antibodies to centrin, indicating homology with a similar zone in the basal body apparatus in green algae (Vaughn and Renzaglia, 1993; Hoffman et al., 1994; Vaughn and Harper, 1998; Klink and Wolniak, 2003; Vaughn and Renzaglia, 2006) (Figures 1C and 1D). In tracheophytes, an electron opaque pericentriolar type material, called the amorphous zone (AZ), runs along the top of the spline (MT band), connects the basal bodies of adjacent flagella and labels with centrin antibodies (Figure 1B) (Hoffman et al., 1994; Hoffman and Vaughn, 1995). The AZ thus serves as that same sort of basal body connector as found in the green algae.
These localizations are indicative of two possible functions for centrin, as an MTOC protein, and as a contractile protein. In the MLS, centrin appears to be involved in MT nucleation and organization of the spline MT array. In the AZ and transition zone, it is more likely that the centrin is involved in contractile functions. The AZ might also be involved in nucleation/organization of MTs as it lies at the base of the basal body and is close to the spline MT array.
Gamma tubulin was the last of the tubulin proteins to be discovered (Oakley et al., 1990) and occurs in a much lower quantity than alpha and beta tubulin. In mammalian cells, gamma tubulin is restricted to the ends of MTs, where it forms a template for the MTs to form (Joshi et al., 1992). In contrast, gamma tubulin in plants occurs along MTs and not just at their termini (Liu et al., 1993; Liu et al., 1994; Hoffman et al., 1994; Vaughn and Harper, 1998). These sites are in fact new nucleating sites as plant MTs form more of a ‘fir tree’ or highly branched pattern than that is noted in mammalian cells (Murata et al., 2005; Murata and Hasebe, 2007).
The blepharoplast occurs in the last two spermatogenous cell divisions in pteridophytes and serves as the spindle pole body in these divisions as well as the template for basal body production (Hepler, 1976; Hoffman and Vaughn, 1995). In an attempt to determine its ability to nucleate MTs, Vaughn and Bowling (2008) treated Ceratopteris antheridia with the potent microtubule-disrupter oryzalin (ChemService Inc., West Chester, PA) leading to the loss of all microtubules except those in stabilized MT arrays such as in flagella. In these oryzalin-treated cells, the blepharoplast was clearly recognizable but free of MTs and covered with pits that were the size and structure of the MT templates (tubulin ring complexes) recognized in mammalian cells.
Figure 1. Immunogold labeling of basal bodies and flagella of land plants. A. Centrin localization in the lamella strip (ls) that subtends the band of microtubules (mt) and basal bodies (b) of Phaeoceros carolinianus, a hornwort. B. In the seed plant, Ginkgo biloba, centrin epitopes are localized in the lamellar strip (ls), amorphous zone (az) where the basal bodies insert and stellate pattern (sp) of the transition zone. C. Longitudinal section of the long stellate pattern in Ceratopteris basal bodies that label with anti-centrin. A faint outline of the stellate pattern is visible at the arrow. D. Cross section at the basal body of Ceratopteris showing centrin localizations in the stellate pattern and amorphous zone around the basal body. E. In Ceratopteris spermatogenous cells, gamma tubulin (arrows) localizes around the periphery of the blepharoplast following oryzalin treatment. Bars = 0.1 µm.
Gamma tubulin antibodies label the periphery of the blepharoplast in oryzalin treated cells (Figure 1E). When the oryzalin is washed from the antheridia, MTs are quickly reformed along this pitted surface, further indicating the ability of the blepharoplast to serve as an MTOC.
In mammalian cells, the centrioles are surrounded by an electron opaque material where spindle MTs emanate. To identify the components of this pericentriolar material, monoclonal antibodies (MAbs) were raised to mitotic cells and MAbs that recognize the centriolar material could be used not only for mammalian cells but also for other materials, including spermatogenous cells. For example, MPM-2 recognizes a phosphorylated-protein epitope (Davis et al., 1983; Vandre et al., 1984) in spermatogenous cells. In cells without blepharoplasts, this MAb recognizes the surface of the nuclear envelope immediately before mitosis (Hoffman et al., 1994; Klink and Wolniak, 2003). These are the sites where MTs appear to be produced prior to mitosis in all plant cells. In cells with a blepharoplast, these antibodies strongly label the interior of this structure, not the edges (Hoffman et al., 1994; Vaughn and Bowling, 2008). Interestingly, as the blepharoplast begins to reorganize, the reactivity of the antibody is lost and centrin labeling increases in the pericentriolar material. Thus, as different MT arrays are formed, changes occur in proteins of the MTOC.
Procedure B: Immunogold localizations of the sequential matrices that are made during spermatogenesis has revealed differential labeling of carbohydrate-specific MAbs during development and across phylogeny. Callose is a prominent wall constituent in spermatogenesis of ferns, especially in the thickened wall of rounded spermatids in the early stages of ontogeny. In this stage, the locomotory apparatus originates and consists of a multilayered structure (MLS) and basal bodies (Figure 2A). Pectin is absent in this thickened wall in ferns (Lopez and Renzaglia, 2017). In contrast, mosses have a comparable wall that is deposited as spermatids become round, but it is devoid of callose and contains scattered aggregates of esterified pectin as localized with the JIM7 MAb (Figure 2B). By far the most abundant polysaccharide in this thickened wall layer in mosses is hemicellulose that localizes with both LM15 and LM25 MAbs (Figures 2C and 2D) (Lopez-Swalls, 2016).
In addition to carbohydrates, the walls involved in plant spermatogenesis contain abundant but diverse arabinogalactan proteins (AGPs) (Figures 2E-2G). AGPs recognized by the LM2 MAb replace the hemicelluloses around moss spermatids (Figure 2E). As the spermatid matures and begins to develop flagella and assume a coiled configuration, a flexible extraprotoplasmic matrix forms between the plasmalemma and thick callosic wall in ferns and between the plasmalemma and hemicellulosic-pectinaceous wall of mosses (Figures 2F and 2G). The matrix does not label with monoclonal antibodies raised against standard cell wall polysaccharide epitopes such as pectins, cellulose, and hemicelluloses. Rather, MAbs that recognize sugar residues of AGPs abundantly label the matrix as well as the plasmalemma of elongating flagella in fern and moss spermatids (Figures 1F and 1G) (Lopez and Renzaglia, 2014). These results coupled with light and fluorescence microscopy and inhibitor experiments with Yariv (a reagent that binds and precipitates AGPs) suggest that AGPs are involved in growth and positioning of flagella. The implication of AGPs as calcium modulators through binding and release of Ca2+ (Lamport and Várnai, 2013) is a potential mechanism for the regulation of cellular development in plants, and spermatogenesis is an ideal system in which to further pursue this hypothesis.
Figure 2. Immunogold labeling of spermatogenous cell walls in land plants. A. Callose localization in the unevenly-thickened wall layer that surrounds spermatids of Ceratopteris richardii during the formation of the locomotory apparatus which includes an anterior mitochondrion (am), a multilayered structure (mls) and basal bodies (b). B. A thickened wall layer comparable to that in Ceratopteris spermatids, is deposited by young spermatids in the moss, Physcomitrella patens. This wall labels intensely with the JIM7 MAb that binds to esterified pectin epitopes. C-D. Immunogold labeling of hemicelluloses in the thickened wall layer of young spermatids in the moss Aulacomnium palustre. C. This wall layer contains abundant xyloglucan epitopes recognized by the LM15 MAb. D. Similarly, galactoxyloglucan epitopes (LM25 MAb) are a rich component of these thickened walls. (Note: Spermatids in C. were post-fixed in osmium tetroxide (OsO4) that reveals the loose fibrillar consistency of the wall compared to the spermatids in D. that were not post-fixed in OsO4.) E-G. Immunogold labeling of arabinogalactan proteins (AGPs) in spermatid walls. E. AGP epitopes recognized by the LM2 MAb replace the hemicelluloses in the wall around spermatids in P. patens. F. JIM13, a monoclonal antibody to the epitope structure (β)-D-GlcpA1-(1,3)-α-D-GalpA-(1,2)-L-Rha of AGPs, is expressed in the extracellular matrix (*) around flagella during development in C. richardii. The microtubule band (mt), basal body (b) and a hub extension (h) are visible inside the developing spermatid. G. Cross sections of Ceratopteris flagella labelled with JIM8, a monoclonal antibody that identifies an unknown AGP epitope, showing specific localization on the plasmalemma. Bars = 0.5 µm for A-E; 0.1 µm for F-G.
Materials and Reagents
Immunogold labeling of microtubules and microtubule organizing center proteins
Scintillation vials with aluminum covered caps (Fisher Scientific, catalog number: 03-340-4B)
Manufacturer: DWK Life Sciences, Kimble, catalog number: 7450320 .
Pasteur pipette (Fisher Scientific, catalog number: 13-678-20C )
Gelatin capsules (Electron Microscopy Sciences, catalog number: 70100 )
200 mesh nickel grids (Electron Microscopy Sciences, catalog number: EMS200-Ni )
300 mesh gold grids (Electron Microscopy Sciences, catalog number: EMS300-Au )
Glass Petri dishes (Corning, catalog number: 3160-101 )
90 mm filter paper (GE Healthcare, catalog number: 1004-090 )
Sterile filters (0.2 µm) (Corning, catalog number: 431212 )
Parafilm (Sigma-Aldrich, Parafilm, catalog number: P7793 )
Dental wax plate (Electron Microscopy Sciences, catalog number: 72670 )
Glass slides (Fisher Scientific, catalog number: 12-544-1 )
Microcentrifuge tubes, 1.5 ml natural (USA Scientific, catalog number: 1615-5500 )
Ethylene dichloride (Electron Microscopy Sciences, catalog number: 13250 )
LR white resin (Electron Microscopy Sciences, catalog number: 14383 )
Primary antibodies: (see Table 1), centrin (Sigma-Aldrich, catalog number: ABE480 ); MPM-2 (EMD Millipore, catalog number: 05-368 )
Table 1. Primary antibodies used to immunogold label microtubules, microtubule organizing center proteins, and carbohydrates and arabinogalactan proteins in extracellular matrices during spermatogenesis
aPhaeoceros carolinianus (hornwort); bPhyscomitrella patens (moss); cAulacomnium palustre (moss); dCeratopteris richardii (fern), and eGinkgo biloba (seed plant).
Secondary antibody: goat anti-mouse conjugated with gold (Millipore Sigma, catalog number: G7652 )
Sorenson’s phosphate buffer, 0.2 M, pH 7.2 (Electron Microscopy Sciences , catalog number: 11600-10 )
Glutaraldehyde (Electron Microscopy Sciences, catalog number: 16120 )
Osmium tetroxide (Electron Microscopy Sciences, catalog number: 19150 )
PIPES buffer, 0.2 M, pH 7.2 (Sigma-Aldrich, catalog number: P6757 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: B4287 )
Uranyl acetate (Polyscience, catalog number: 21447 )
Lead nitrate (Electron Microscopy Sciences, catalog number: 17900 )
Sodium citrate (Electron Microscopy Sciences, catalog number: 21140 )
1 N NaOH (Electron Microscopy Sciences, catalog number: 21170-01 )
0.01 M phosphate buffer (pH 7.2) (see Recipes)
0.05 M phosphate buffer (pH 7.2) (see Recipes)
2.5% glutaraldehyde (see Recipes)
2% aqueous osmium tetroxide (see Recipes)
0.02 M phosphate buffer (pH 7.2) (see Recipes)
Antibodies (see Recipes)
2% PBS/BSA (see Recipes)
0.05 M PIPES buffer (pH 7.2) (see Recipes)
2% uranyl acetate (see Recipes)
1 N NaOH (see Recipes)
Reynold’s lead citrate (see Recipes)
Immunogold labeling of spermatozoid matrix and cell wall constituents
Scintillation vials with aluminum covered caps (Fisher Scientific, catalog number: 03-340-4B)
Manufacturer: DWK Life Sciences, Kimble, catalog number: 7450320 .
Pasteur pipette (Fisher Scientific, catalog number: 13-678-20C )
200 mesh nickel grids (Electron Microscopy Sciences, catalog number: EMS200-Ni )
300 mesh gold grids (Electron Microscopy Sciences, catalog number: EMS300-Au )
90 mm filter paper (GE Healthcare, catalog number: 1004-090 )
Dental wax plate (Electron Microscopy Sciences, catalog number: 72670 )
Glass Petri dish (Corning, catalog number: 3160-101 )
Glass Slides (Fisher Scientific, catalog number: 12-544-1 )
Gelatin capsules (Electron Microscopy Sciences, catalog number: 70100 )
Microcentrifuge tubes, 1.5 ml natural (USA Scientific, catalog number: 1615-5500 )
Parafilm (Sigma-Aldrich, Parafilm, catalog number: P7793 )
Sterile filters (0.2 µm) (Corning, catalog number: 431212 )
Ethylene dichloride (Electron Microscopy Sciences, catalog number: 13250 )
LR white resin (Electron Microscopy Sciences, catalog number: 14383 )
Primary antibodies (PlantProbes) (see Table 1)
Secondary antibody: Goat-Anti-Rat IgG-gold (Sigma-Aldrich, catalog number: G7035 )
Secondary antibody: goat anti-mouse conjugated with gold (Sigma-Aldrich, catalog number: G7652 )
Sorensen’s phosphate buffer, 0.2 M, pH 7.2 (Electron Microscopy Sciences , catalog number: 11600-10 )
Glutaraldehyde (Electron Microscopy Sciences, catalog number: 16120 )
Osmium tetroxide (Electron Microscopy Sciences, catalog number: 19150 )
PIPES buffer, 0.2 M, pH 7.2 (Sigma-Aldrich, catalog number: P6757 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: B4287 )
Uranyl acetate (Polyscience, Inc., catalog number: 21447 )
Lead nitrate (Electron Microscopy Sciences, catalog number: 17900 )
Sodium citrate (Electron Microscopy Sciences, catalog number: 21140 )
1 N NaOH (Electron Microscopy Sciences, catalog number: 21170-01 )
0.01 M phosphate buffer (pH 7.2) (see Recipes)
0.05 M phosphate buffer (pH 7.2) (see Recipes)
2.5% glutaraldehyde (see Recipes)
2% aqueous osmium tetroxide (see Recipes)
0.02 M phosphate buffer (pH 7.2) (see Recipes)
Antibodies (see Recipes)
2% PBS/BSA (see Recipes)
0.05 M PIPES buffer (pH 7.2) (see Recipes) (see Recipes)
2% uranyl acetate (see Recipes)
1 N NaOH (see Recipes)
Reynold’s lead citrate (see Recipes)
Equipment
Immunogold labeling of microtubules and microtubule organizing center proteins
Bunsen burner (Fisher Scientific, catalog number: S12809 )
-20 °C freezer
M2100 Benchmark Tube Rocker (Benchmark Scientific Inc.)
Oven (General Signal, model: Gravity convection )
Water bath (Sheldon Manufacturing, model: SWB23 )
Micropipette (Bioexpress, GeneMate, catalog number: P-4963-20 )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 75004061 )
Diamond knife (Diatome, specs: Ultra, 45°, 4 mm, Wet)
Transmission electron microscope (Hitachi, model: HF7100 )
Immunogold labeling of spermatozoid matrix and cell wall constituents
Bunsen burner (Fisher Scientific, catalog number: S12809 )
M2100 Benchmark Tube Rocker (Benchmark Scientific Inc.)
Oven (General Signal, model: Gravity convection )
Micropipette (Bioexpress, catalog number: P-4963-20 )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 75004061 )
Diamond knife (Diatome, specs: Ultra, 45°, 4 mm, Wet)
Humid chamber (see Notes)
Transmission electron microscope (Hitachi, model: HF7100 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lopez, R. A., Mansouri, K., Henry, J. S., Flowers, N. D., Vaughn, K. C. and Renzaglia, K. S. (2017). Immunogold Localization of Molecular Constituents Associated with Basal Bodies, Flagella, and Extracellular Matrices in Male Gametes of Land Plants. Bio-protocol 7(21): e2599. DOI: 10.21769/BioProtoc.2599.
Renzaglia, K. S., Villarreal, J. C., Piatkowski, B. T., Lucas, J. R. and Merced, A. (2017). Hornwort Stomata: Architecture and Fate Shared with 400-Million-Year-Old Fossil Plants without Leaves. Plant Physiol 174(2): 788-797.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Electron microscopy
Cell Biology > Cell imaging > Fixed-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
26 | https://bio-protocol.org/exchange/protocoldetail?id=26&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Silver Staining
NA Nabila Aboulaich
Published: Feb 5, 2011
DOI: 10.21769/BioProtoc.26 Views: 34260
Download PDF
Ask a question
How to cite
Favorite
Cited by
Materials and Reagents
99.5 % ethanol (Sigma-Aldrich )
Silver nitrate (AgNO3) (Sigma-Aldrich )
Formaldehyde solution (37 %) (Sigma-Aldrich)
Sodium carbonate (Sigma-Aldrich)
Sodium thiosulphate (Sigma-Aldrich)
EDTA (Sigma-Aldrich)
Sodium dithionite (Sigma-Aldrich)
30% ethanol
Acetic acid
Stop solution (see Recipes)
Fixation solution (see Recipes)
Sensitizer solution (see Recipes)
Staining solution (see Recipes)
Developer solution (see Recipes)
Equipment
Shaker
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Aboulaich, N. (2011). Silver Staining. Bio-101: e26. DOI: 10.21769/BioProtoc.26.
Download Citation in RIS Format
Category
Biochemistry > Protein > Electrophoresis
Molecular Biology > Protein > Detection
Biochemistry > Protein > Quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
260 | https://bio-protocol.org/exchange/protocoldetail?id=260&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay
JK Josephine MY Ko
Maria Li Lung
Published: Vol 2, Iss 18, Sep 20, 2012
DOI: 10.21769/BioProtoc.260 Views: 67497
Original Research Article:
The authors used this protocol in Feb 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2012
Abstract
Angiogenesis is involved not only in pathological conditions including cancer biology and non-neoplastic diseases, but also many biological processes including reproduction, development and repair. During angiogenesis, endothelial cells (ECs) undergo activation after binding of angiogenic factors to their receptors, release of proteases to dissolve the basement membrane, migration towards an angiogenic signal, proliferation, and an increase in cell number for new blood vessel formation. Finally, reorganization of ECs forms the three-dimensional vasculature. HUVEC tube-formation assay is one of the simple, but well-established in vitro angiogenesis assays based on the ability of ECs to form three-dimensional capillary-like tubular structures, when cultured on a gel of growth factor-reduced basement membrane extracts. During the assay, ECs differentiate, directionally migrate to align, branch, and form the tubular polygonal networks of blood vessels.
Keywords: HUVEC Angiogenesis assay Tube formation assay
Materials and Reagents
Target cell lines can be those with and without drug treatment or expressing the gene of interest.
Note: Our example includes four cell lines that are engineered to have inducible expression of tumor suppressor gene and the corresponding vector alone controls.
Growth factor-reduced BD Matrigel (BD Biosciences, catalog number: 354230 )
Dulbecco’s Modified Eagle Medium (DMEM) (High Glucose L-Glutamine, 500 ml) (Life Technologies, Invitrogen™, catalog number: 11965-092 )
Fetal bovine serum (Life Technologies, Invitrogen™, catalog number: 26140-079 )
Primary Human Umbilical Vein Endothelial Cell (HUVEC) (Life Technologies, Invitrogen™, catalog number: C-003-5C )
Medium 200PRF (Life Technologies, Invitrogen™, catalog number: M-200PRF-500 )
Low serum growth supplement (LSGS) (Life Technologies, Invitrogen™, catalog number: S-003-10 )
Conditioned medium (CM)
Equipment
Tissue culture setup
Inverted microscope with digital camera (Nikon TMS)
Scion Image software downloaded from the NIH website
96-well plates
Centrifuge
Cell counter
T75 tissue culture flask
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Angiogenesis > Cell biology assays
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell isolation and culture > 3D cell culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,600 | https://bio-protocol.org/exchange/protocoldetail?id=2600&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of the Partially Methylated Alditol Acetates Derived from CS Tetrasaccharides Containing Galactose for the Gas Chromatography/Mass Spectrometry Analysis
KH Kyohei Higashi
TT Toshihiko Toida
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2600 Views: 9157
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
Chondroitin sulfate (CS), a member of the glycosaminoglycan (GAG) family of carbohydrates, is composed of linear, sulfated repeating disaccharide sequences of N-acetyl-D-galactosamine (GalNAc) and glucuronic acid (GlcA). Recently, a keratan sulfate (KS) disaccharide [GlcNAc6S(β1-3)Galactose(β1-]-branched CS-E was identified from the clam species M. chinensis. This protocol details a methodology to analyze the glycosidic linkages of galactose in KS disaccharide-branched CS by GC-MS analysis. A complementary method for the identification and characterization of KS-branched CS in M. chinensis can be found in Higashi et al. (2016).
Keywords: Mactra chinensis Chondroitin sulfate Keratan sulfate Partially methylated alditol acetates GC-MS analysis
Background
Gas chromatography/mass spectrometry (GC-MS) analysis of the reaction products of partially methylated alditol acetates (PMAA) derived from the polysaccharides has been shown to represent a powerful tool to investigate the glycosidic linkages. The PMAAs preparation from M. chinensis in this protocol was performed according to the method of Anumula and Tayler (1992) with minor modifications.
Materials and Reagents
Screw-cap tube (AGC techno glass, borosilicate Pyrex glass, 13 mm i.d. x 120 mm)
Glass measuring pipette (0.1, 0.5, 1 and 2 ml)
Pasteur pipette IK-PAS-5P (IWAKI, catalog number: 73-0001 )
Keratan sulfate from Bovine Cornea (SEIKAGAKU, catalog number: 400760 )
Dry tetrasaccharide (100 μg) is composed of ∆UA, N-acetyl-D-galactosamine (4S, 6S), galactose, N-acetyl-D-glucosamine (6S). Briefly, KS branched CS from M. chinensis was treated with chondroitinase ACII, and resulting tetrasaccharide was collected through the fractionation using HPLC with Docosil column. Please see details in Higashi et al. (2016)
Dimethyl sulfoxide, dehydrated (dry DMSO) (Wako Pure Chemical Industries, catalog number: 040-18032 )
Iodomethane (CH3I) (Wako Pure Chemical Industries, catalog number: 139-02662 )
Chloroform
Nitrogen gas (> 99.995%) (Nippon Megacare)
Trifluoroacetic acid (TFA) (Wako Pure Chemical Industries, catalog number: 204-02743 )
Acetic acid (NACALAI TESQUE, catalog number: 00212-43 )
4-N,N-dimethylaminopyridine (Wako Pure Chemical Industries, catalog number: 042-19212 )
Pyridine (NACALAI TESQUE, catalog number: 29509-25 )
Acetic anhydride (Wako Pure Chemical Industries, catalog number: 011-00276 )
Hexane (NACALAI TESQUE, catalog number: 17935-05 )
Sodium hydroxide (NaOH) (NACALAI TESQUE, catalog number: 31511-05 )
Methanol (NACALAI TESQUE, catalog number: 21915-93 )
Dimethyl sulfoxide (DMSO) (Wako Pure Chemical Industries, catalog number: 043-07216 )
0.5 mol/L hydrochloric acid methanolic solution (Wako Pure Chemical Industries, catalog number: 080-07725 )
Sodium tetrahydroborate (NaBH4) (Wako Pure Chemical Industries, catalog number: 192-01472 )
NaOH-DMSO suspension (see Recipes)
5% (v/v) pyridine in 50% acetonitrile/water (see Recipes)
NaBH4 (5 mg/ml) solution (see Recipes)
Equipment
Test tube mixer (SEIKAGAKU, model: TM-251 )
Centrifuge (KUBOTA, model: Model 5922 )
Sample concentrator (Hangzhou Allsheng Instruments, model: MD200-2 )
Time-of-flight mass spectrometer JMS-T100GCV (JEOL, model: JMS-T100GCV )
ZB-5ms column (0.25 µm film thickness, 0.25 µm i.d. x 30 m) (Phenomenex)
Agilent Technologies 7890A GC system (Agilent Technologies, model: Agilent 7890A GC )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Higashi, K. and Toida, T. (2017). Preparation of the Partially Methylated Alditol Acetates Derived from CS Tetrasaccharides Containing Galactose for the Gas Chromatography/Mass Spectrometry Analysis. Bio-protocol 7(21): e2600. DOI: 10.21769/BioProtoc.2600.
Download Citation in RIS Format
Category
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,601 | https://bio-protocol.org/exchange/protocoldetail?id=2601&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sensitive Estimation of Flavor Preferences in STFP Using Cumulative Time Profiles
Aditya Singh
J. Balaji
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2601 Views: 5899
Edited by: Soyun Kim
Reviewed by: Alexandra Gros
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Social transmission of food preference (STFP) is observed among rodents between a demonstrator and a naïve hungry observer. During social interaction, hungry observer receives information about safety of the food consumed by the demonstrator. This task has been implemented to develop a single trial non-aversive learning task in order to test hippocampus dependent non-spatial memory in rodents. In this protocol, we describe some novel modifications to the conventional STFP protocol and analysis for more sensitive estimation of change in preferences. Using this method, preference trends can be observed for weeks after training, allowing one to probe the role of systems consolidation (SC) in declarative memory that is relatively independent of spatial navigation.
Keywords: Remote memory Social transmission of food preference (STFP) Mouse behavior Sensitivity Performance Flavor Innate preference
Background
Bennet G Galef Jr. developed STFP based behavior paradigm with rats during 1970’s in order to test memory mechanisms and since then, it has been implemented in various studies with both rats and mice (Galef Jr, 1977; Clark et al., 2002; Wrenn et al., 2003; Ross and Eichenbaum 2006; Smith et al., 2007; Choleris et al., 2011; Lesburguères et al., 2011; Clark, 2012). In case of rodents, the basic premise of this paradigm comes from their natural feeding behavior. Demonstrator mice [DemoMice] find the food that is safe for consumption through trial and error, and soon after consumption, the information for palatable food is shared with other observer mice [ObMice] through social interaction. Such interactions happen at a location situated away from the feeding site where ObMice learn about the safety of consumed food, or more specifically consumed flavor, when it is detected along with certain breath components of the DemoMice (Galef et al., 1988; Choleris et al., 2009). After establishing such flavor-safety association in STFP paradigm, ObMice have been observed to preferably consume the demonstrated flavor (demoFlavor), when given a choice between a novel and a familiar flavor.
Traditionally, the experimental design would involve arriving at the flavor pairs where both flavors are equally palatable during a consumption session with close to 50% preference for each flavor (Galef and Whiskin, 1998). Since the relative palatability of flavors is determined with different set of animals, one does not get any direct information reflecting innate preferences (IP) of experimental animals. After determining relative palatability of the flavor pair, one of these flavors is demonstrated through social interaction and increase in its preference beyond the 50% level is estimated after STFP. However, such a design does not consider the fact that even though average preference of a group of mice could be 50%, there could be individuals with varying native preference and this in turn could bias the interpretations of the result. Our novel design measures the STFP mediated change in preference while considering the native preference of individual animals.
Further, conventional preference estimation involves comparing the weight of food containers recorded before and after the sessions to calculate ‘weight of consumed food’ (WC.F). During a typical STFP testing session with mice, each individual consumes ~1 g and spills the food weighing up to ~5 g from containers weighing close to 100 g (typical weight of the container had to be ~100 g to prevent toppling). Correcting for errors associated with spillage limits the accuracy of WC.F. Consequently, it makes it difficult to detect minor changes in the strength and nature of the flavor-safety associations. Alternatively, we propose and utilize the ‘number of food consumption episodes’ obtained through video analysis as a measure of performance. Using this method, we establish an STFP procedure that is easy to implement and more sensitive. Inherently, such analyses are easy to use and less error prone as compared to weight measure. They utilize more data points and hence they convey more information in comparison to single point measurements such as total weight of consumed food or total time spent during consumption. Since mice consume small amounts over extended time windows, food intake data cannot be used directly for observing variations in rates of food consumption.
Materials and Reagents
Identical plastic containers (Figures 1A and 1B): Dimensions 6.5 x 4.5 cm, assembled weight ~100 g (Julia Pet Jar 130 ml) (Princeware, catalog number: 9462 )
Bedding material made from non-uniform corn cobb granules of 3-4 mm average diameter (Spar Cobb, Sagar Industries, Bangalore, India)
Food vessel: A lid for smaller plastic container was used as food vessel (Figure 1) (Julia Pet Jar 60 ml) (Princeware, catalog number: 9461 )
Note: It is filled with ground flavored food and placed above the bedding material inside the plastic container. The lid of plastic container is closed such that the centers for food vessel and hole in the lid are aligned vertically.
C57/B6 mice (males, 8-12 weeks of age) housed in pairs after weaning until the beginning of habituation sessions. In order to clearly identify observer mice from demonstrators during interaction sessions in our experiments, demonstrator mice are marked with one hole in each ear pinna under general anesthesia after one week of weaning. Animals are separated for individual housing just before first habituation session.12-16 mice per group provide acceptable power during statistical analyses. The mice are reared in 12 h light/dark cycle and all the experiments are conducted during the light-on phase (06:30 AM-18:30 PM). All the procedures involving animals were performed with approval from institute animal ethics committee, IISc Bangalore
Note: One important consideration is co-housing of observer mouse with demonstrator mouse after weaning. In our method, we do not use a wire mesh/screen during social interaction to separate ObMice and demoMice, in order for the mice interaction to resemble their natural setting. To avoid excessive fighting during social interaction, we randomly select two just-weaned mice and co-house them in the same cage for one month. At the age of ~2 months, these mice are separated to be housed individually for further steps of the protocol and one of them is assigned to become a demonstrator for its cage-mate. Social interaction between two familiar male mice may also help in making it more effective for STFP in comparison to interaction with a stranger male. So, it is crucial to collect a large number of mice in comparable age group at the same time. Either observer or demonstrator mouse can be marked by making a hole in their ear pinna in order to identify them correctly after social interaction session.
Mouse food pellets (Nutrilab Rodent Feed, Provimi)
Powdered condiments as flavoring agents (Cocoa, Cinnamon, Thyme, Basil; SNAPIN herbs and spices, Lotus household product, India)
Note: Source of all the condiments must be consistent from the beginning to the end of the experiment.
70% ethanol to clean all the components of food apparatus
Note: Ethanol cleaning is carried out a day before the experiment session. All clean components are dried in warm air flow overnight to remove any odor trace from ethanol.
Sodium hypochlorite solution (4% NaOCl solution) (Fisher Scientific, catalog number: SS290-1 )
Note: It is further diluted to make cleaning solution (see Recipes) for removing prevailing odor from the components of food apparatus and animal cages. After each experiment session, all the components of food apparatus are submerged in a cleaning solution for 15-20 min followed by thorough rinsing in tap water. Cleaned components are then air dried and stored in hygienic conditions.
X% ‘Condiment’ flavored food (see Recipes)
Cleaning solution (see Recipes)
Equipment
Plier for making metal trays
Paint for metal trays: white paint if black coat mice are used and vice versa
Transparent Perspex sheets with holes drilled along short central axis (Figures 1E)
Aluminum/Tin metal sheet (sized to fit in the test cage): 1-2 mm thickness for making spill-proof trays to hold food containers. The vertical walls of these trays are 2 cm high. Length and breadth of these trays can be adjusted for achieving best fit within the test cage. For our setup, the dimensions were 16 x 13 cm
Weighing balance: with sensitivity up to 10 mg
Electronic grinder (Morphy Richards, model: Icon Essentials ) for making powdered food
Full HD webcam (Logitech, model: C920 ) for multiplexed video monitoring
Polarizer filter (RG610, RG series color glass filters, Optica, Optics India; it is optional) to avoid reflections from transparent Perspex sheets covering the test-cages
Webcam mounting assembly: We used a long wooden stick (300 x 10 x 5 cm3) with a hole at the center along its length and an M6 screw to fix the webcam above test-cage assembly
Individually ventilated cages (IVCs)/polycarbonate cages for individual housing of mice (IVC; 36 long x 14 wide x 12.5 cm high) (Citizen Industries, catalog number: 11 )
Portable electronic drill (Robert Bosch, model: Bosch GSB 10 RE Professional ) with drill bits to make holes of 1 cm diameter in the lids of food container
Software
Free, open source media player such as VLC. Any software for position tracking may also be implemented for estimating time spent near food containers
Origin software
Microsoft Excel
ImageJ plugins (such as Analyze particle)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Singh, A. and Balaji, J. (2017). Sensitive Estimation of Flavor Preferences in STFP Using Cumulative Time Profiles. Bio-protocol 7(21): e2601. DOI: 10.21769/BioProtoc.2601.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,602 | https://bio-protocol.org/exchange/protocoldetail?id=2602&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Proximal Ligation Assay (PLA) on Lung Tissue and Cultured Macrophages to Demonstrate Protein-protein Interaction
RM Roberto Mendez
SB Santanu Banerjee
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2602 Views: 10185
Edited by: Ivan Zanoni
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
In this protocol, we describe proximal ligation assay (PLA), an antibody-based detection method for protein-protein interaction. This method relies on specific binding of individual primary antibodies to the two putative interacting proteins. The primary antibodies need to have different hosts. The secondary antibodies against the two hosts have complementary oligonucleotide moieties attached to them. If the two antigens are in close proximity (presumably interacting with each other), the complementary oligonucleotides can anneal and fluorescent nucleotides can be incorporated in a single DNA polymerization step. Under a microscope, these reactions appear as punctate fluorescent spots, indicating successful PLA reaction and suggesting protein-protein interaction between the two antigens.
Keywords: Proximal ligation assay Protein-protein interaction Toll-like receptors Fluorescence microscopy Bronchial epithelium Macrophages J774 Duolink
Background
Proximal ligation assay (PLA) is an antibody-based technique to determine whether two proteins are with 40 nm of each other. Proteins detected in this manner are identifiable by fluorescence (Ho et al., 2012; Banerjee et al., 2015). This makes PLA an excellent tool for locating protein-protein interactions. Activation of toll-like receptor (TLR) pathways is an important part of the innate immune response to pathogenic threats. TLRs recognize pathogen-associated molecules and induce a signaling cascade to effect a rapid response to infection. TLR2 and TLR4 are two well-studied members of the TLR family that respond to different stimuli. While both receptors activate in response to bacterial infection, only TLR4 responds to lipopolysaccharide exposure. They activate some shared signaling cascades, however, including the MyD88/Traf6 pathway. The induction of this pathway includes the formation a signaling complex known as the myddosome (Gay et al., 2011; Xiong et al., 2011; Cleaver et al., 2014), a protein complex that includes the MyD88, IRAK1, IRAK4 and Traf6 among others. Myddosome assembly results in NF-κb-mediated inflammatory response and pathogen clearance.
Visualizing the engagement of TLR signaling pathways is an important step in identifying and locating immune response. Here, we use PLA to detect TLR pathway activation in fixed lung tissue and a cultured peritoneal macrophage cell-line under treatment with LPS or exposure to opportunistic infection. This method fluorescently labels proteins that interact and remain within close proximity. Using fluorescence microscopy to visualize the resulting labels in vivo allows us to identify the protein complex in respect to tissue location. Here, we demonstrate the ability of this assay to detect TLR2 activation during opportunistic lung infection in vivo and myddosome formation after LPS treatment of peritoneal macrophage cells in vitro. We have also shown the specificity of the technique, as it does not indicate TLR2 activation after LPS treatment in vivo.
Materials and Reagents
NuncTM Lab-TekTM II Chamber SlideTM System (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 154534 )
0.22 µm PVDF syringe filter (EMD Millipore, catalog number: SLGV004SL )
Coverslip (22 x 40 mm) (VWR, catalog number: 470019-008 )
Lung tissue harvested from morphine-treated and/or Streptococcus pneumoniae-infected mice
J774 cells, a murine peritoneal macrophage cell line (ATCC, catalog number: TIB-67 )
Primary antibodies
Note: Each pair used in PLA reaction needs to be validated for specificity with Western blot (both native and SDS-PAGE) and must come from a different host, compatible with Duolink secondary antibodies with PLA probes.
Affinity isolated anti-TRAF6 antibody raised in rabbit (Sigma-Aldrich, catalog number: SAB2102531 )
Note: This product has been discontinued.
Affinity isolated anti-TLR2 antibody raised in rabbit (Sigma-Aldrich, catalog number: SAB1300199 )
Monoclonal anti-MYD88 (Clone OTI2B2) (OriGene Technologies, catalog number: TA502117 )
Secondary antibodies linked to PLA probes
Duolink® in situ PLA® probe anti-mouse MINUS, Affinity purified Donkey anti-Mouse IgG (H+L) (Sigma-Aldrich, catalog number: DUO92004 )
Duolink® in situ PLA® probe anti-rabbit PLUS, Affinity purified Donkey anti-Rabbit IgG (H+L) (Sigma-Aldrich, catalog number: DUO92002 )
Formalin solution, neutral buffered, 10% (10% NBF) (Sigma-Aldrich, catalog number: HT501128-4L )
Paraffin (Fisher Scientific, catalog number: P31-500 )
Xylene (Histological grade) (Fisher Scientific, catalog number: X3S-4 )
Ethanol 200 proof (Merck, catalog number: AX0441 )
Fixation-permeabilization buffer set (Thermo Fisher Scientific, eBiosciencesTM, catalog number: 88-8824-00 )
Phosphate-buffered saline (PBS) pH 7.4 (1x) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Tween® 20 (Fisher Scientific, catalog number: BP337-100 )
Duolink® in situ mounting medium with DAPI (Sigma-Aldrich, catalog number: DUO82049 )
Nail polish (as cover slip sealant)
DMEM/High glucose (4,500 mg/L L-glucose) (GE Healthcare, HyCloneTM, catalog number: SH30243.01 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Fetal bovine serum (FBS), qualified, USDA-approved regions (Thermo Fisher Scientific, GibcoTM, catalog number: 10437010 )
Ultrapure 0.5 M EDTA, pH 6.0 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575020 )
Lipopolysaccharides from Escherichia coli O127:B8 (Sigma-Aldrich, catalog number: L3880 )
Duolink® in situ wash buffers, fluorescence (Sigma-Aldrich, catalog number: DUO82049 )
Duolink® in situ detection reagents orange (Sigma-Aldrich, catalog number: DUO92007 )
Duolink in situ wash buffers A and B (Sigma-Aldrich, catalog number: DUO82047 )
Duolink in situ wash buffer A working solution (see Recipes)
Duolink in situ wash buffer B working solution (see Recipes)
Equipment
Coplin Jar (Generic)
Oil marker (Aqua-hold pap pen) (Electron Microscopy Sciences, catalog number: 71311 )
Vegetable steamer (Generic)
Slide humidity chamber (Simport, model: M920 )
Laboratory shaker or rocker
Flourescence filters (Leica)
Filter set 49, Excitation G365, Emission 445/50
Filter set 43 HE, Excitation BP550/25, Emission 605/70
Flourescence microscope
Software
ImageJ software (https://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mendez, R. and Banerjee, S. (2017). Proximal Ligation Assay (PLA) on Lung Tissue and Cultured Macrophages to Demonstrate Protein-protein Interaction. Bio-protocol 7(21): e2602. DOI: 10.21769/BioProtoc.2602.
Download Citation in RIS Format
Category
Immunology > Immune cell imaging > Confocal microscopy
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,603 | https://bio-protocol.org/exchange/protocoldetail?id=2603&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation, Culture and Differentiation of Adult Hippocampal Precursor Cells
SB Stefanie N. Bernas*
OL Odette Leiter*
TW Tara L. Walker
GK Gerd Kempermann
*Contributed equally to this work
Published: Vol 7, Iss 21, Nov 5, 2017
DOI: 10.21769/BioProtoc.2603 Views: 18603
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
There are two neurogenic niches in the adult mammalian brain: the subventricular zone of the lateral ventricle and the subgranular zone of the hippocampal dentate gyrus. Cells from these areas can be isolated and maintained in vitro, using two different culture systems to assess their potential regarding proliferation and differentiation in a reductionist model. While the neurosphere assay is primarily performed to directly study the proliferative and differentiation potential of cells in individual brains, the monolayer culture allows single cell analysis in a rather homogeneous cell population. Here, we describe the isolation, culturing methods and differentiation of neural precursor cells in both systems.
Keywords: Neuroscience Precursor cell Neurosphere Adherent monolayer Differentiation Subventricular zone Dentate gyrus Adult mouse
Background
In the mammalian brain, adult neural stem cells reside in two main neurogenic niches, the subgranular zone (SGZ) of the hippocampal dentate gyrus (DG) and the lateral ventricle of the subventricular zone (SVZ), that allow the generation of new neurons in the adult brain. Neural precursor cells from the neurogenic niches can be isolated and cultured in vitro to model cellular processes, especially proliferation and differentiation. Two standard culture systems, the adherent monolayer culture (Palmer et al., 1995; Ray et al., 1995) and the neurosphere assay (Reynolds and Weiss, 1992 and 1996), both introduced in the 1990s, represent valuable tools to study neural progenitor cell biology in vitro.
Depending on the research question, each system has advantages and disadvantages that should be considered carefully before choosing one or the other culture method. In adherent monolayer cultures cells grow rather isolated and form more homogeneous cultures. Monolayers allow the direct investigation and monitoring of neural precursor cells at the single cell level. Characteristics like morphology, proliferation and differentiation under controlled conditions, can easily be analysed and visualised. However, compared to neurosphere cultures, cells cultured as monolayer represent a more reductionist model as the cells grow with fewer cell-to-cell contacts that are usually present in the niche.
Neurosphere cultures are free-floating aggregate cultures that are easy to obtain from adult tissue. Primary neurospheres are more heterogeneous and presumably represent a more niche-like environment. Neurospheres can be used to model the interaction of different cell types and allow relative comparisons of precursor cell number and potential, but does not allow absolute conclusions about stem cell numbers in vivo. Also, the sphere-forming capacity is not identical to ‘stemness’.
This protocol describes the detailed workflow of the generation and analysis of adult neural precursor cultures as neurospheres and monolayers from both neurogenic regions, the SVZ and the DG. The protocol represents an optimized version of our previously published protocols that have been successfully applied to many research projects within our group and by other groups (Babu et al., 2011; Walker and Kempermann, 2014; Ehret et al., 2016; Hörster et al., 2017).
Materials and Reagents
Animals
Mice: C57BL/6J (8 weeks old)
Note: We recommend three to four mice for establishing a monolayer cell culture. For neurosphere assay experiments we recommend one mouse per 96-well plate.
General materials and reagents
Centrifugation tubes 15 ml and 50 ml
Reaction tubes 1.5 ml
Parafilm
70% ethanol
Double distilled water (ddH2O)
1x phosphate-buffered saline (PBS)
DMEM/F-12 without glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 21331020 )
4% paraformaldehyde (PFA) in 0.1 M phosphate buffer pH 7.4
PFA (Merck, catalog number: 1040051000 )
Sodium dihydrogen phosphate (Merck, catalog number: 1063421000 )
Disodium phosphate dihydrate (Acros Organics, catalog number: 343810025 )
Sodium hydroxide (NaOH) (Carl Roth, catalog number: 6771 )
Growth media (see Recipes)
Neurobasal® medium (Thermo Fisher Scientific, GibcoTM, catalog number: 21103049 )
B-27® supplement (50x) (Thermo Fisher Scientific, GibcoTM, catalog number: 17504044 )
Pen/Strep 100,000 U/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
GlutaMAXTM supplement (100x stock) (Thermo Fisher Scientific, GibcoTM, catalog number: 35050061 )
Fire polished pipettes
Glass Pasteur pipette (1 mm diameter)
Coating
Poly-D-Lysine hydrobromide (PDL) (Sigma-Aldrich, catalog number: P7280 )
Laminin (Roche Diagnostics, catalog number: 11243217001 )
Brain dissection
Petri dishes (10 cm diameter)
SVZ tissue dissociation
Petri dishes (6 cm diameter)
Scalpel (#10) (Fisher Scientific, catalog number: 11995756)
Manufacturer: B. Braun Melsungen, catalog number: 5518059 .
Falcon® 40 µm cell strainer (Corning, Falcon®, catalog number: 352340 )
0.05% trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25300054 )
Trypsin inhibitor containing DNAse I (see Recipes)
Trypsin inhibitor (Sigma-Aldrich, catalog number: T6522 )
DNase I (Roche Diagnostics, catalog number: 10104159001 )
DG tissue dissociation
Petri dishes (6 cm diameter)
Falcon® 40 µm cell strainer (Corning, Falcon®, catalog number: 352340 )
Neural tissue dissociation kit (P) (Miltenyi Biotech, catalog number: 130-092-628 )
Beta-mercaptoethanol (Sigma-Aldrich, catalog number: M7522 )
Note: This product has been discontinued.
Hank’s buffered salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14175 )
Monolayer culture
Tissue culture flasks (T25 and T75)
24-well tissue culture plates (growth-enhance treated, gamma-sterilized, free of pyrogens, free of RNA/DNA, DNase, RNase)
Coverglass slips 12 mm (Fisher Scientific, catalog number: 12-545-82 )
Note: This product has been discontinued.
Heparin (MP Biomedicals, catalog number: 0210193125 )
Human EGF (PeproTech, catalog number: AF-100-15 )
Human FGF2 (PeproTech, catalog number: 100-18B )
Accutase solution (Sigma-Aldrich, catalog number: A6964 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Normal donkey serum (Jackson ImmunoResearch Laboratories, catalog number: 017-000-121 )
Trypan blue solution, 0.4% (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
BrdU (Sigma-Aldrich, catalog number: B5002 )
Freezing mix (see Recipes)
Antibody solution (see Recipes)
Neurosphere assay
Petri dishes (10 cm diameter)
96-well tissue culture plates (growth-enhance treated, gamma-sterilized, free of pyrogens, free of RNA/DNA, DNase, RNase)
24-well tissue culture plates (growth-enhance treated, gamma-sterilized, free of pyrogens, free of RNA/DNA, DNase, RNase)
Coverglass slips 12 mm (Fisher Scientific, catalog number: 12-545-82 )
Heparin (MP Biomedicals, catalog number: 0210193125 )
Human EGF (Peprotech, catalog number: AF-100-15 )
Human FGF2 (PeproTech, catalog number: 100-18B )
Blocking solution (see Recipes)
Staining reagents
Microscope slides SuperFrost® (VWR, Thermo Scientific, catalog number: 631-0706 )
Triton® X-100 (Carl Roth, catalog number: 3051 )
1 N HCl (from 37% stock solution) (Sigma-Aldrich, catalog number: 435570 )
Note: This product has been discontinued.
0.9% NaCl
Normal donkey serum (Jackson ImmunoResearch Laboratories, catalog number: 017-000-121 )
Hoechst 33342 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 62249 )
Primary antibodies (see Table 1)
Aqua-Poly/Mount (Polysciences, catalog number: 18606 )
Borate buffer (see Recipes)
Boric acid (Carl Roth, catalog number: 6943.1 )
Sodium hydroxide (NaOH) (Carl Roth, catalog number: 6771 )
Table 1. Primary antibodies for immunocytochemistry
Antibody
Host Clone Isotype
Company
Catalog number
β-III-tubulin (β-tubulin)
Mouse
5G8
IgG1
Promega
G7121
5’-bromo-2’-deoxyuridine (BrdU)
Rat
BU1/75 (ICR1)
IgG2a
Bio-Rad Laboratories
OBT0030
Glial fibrillary acidic protein (GFAP)
Rabbit
polyclonal
-
Agilent Technologies
Z0334
Map2ab
Mouse
AP-20
IgG1
Sigma-Aldrich
M1406
Nestin
Mouse
25/NESTIN
IgG1, κ
BD
611658
Oligodendrocyte marker 4 (O4)
Mouse
O4
IgM
R&D Systems
MAB1326
Sox2
Rabbit
polyclonal
-
Merck
AB5603
Equipment
Bunsen burner
Autoclave
Dissection tools
Scissors
Small spatula (Fine Science Tools, catalog number: 10093-13 )
Curved forceps (Fine Science Tools, model: Dumont #7, catalog number: 11271-30 )
Angled forceps (Fine Science Tools, model: Dumont #5-45, catalog number: 11253-25 )
27 G ¾ needle (B. Braun Melsungen, catalog number: 4657705-02 )
Vacuum pump
Stereo microscope (Olympus, model: SZ61 )
Inverted microscope (Olympus, model: CKX42 )
Centrifuge with swing bucket rotor for 15 ml and 50 ml centrifuge tubes (Eppendorf, model: 5430 R )
Incubator at 37 °C with 5% CO2
Sterile laminar flow hood
Hemocytometer (Neugebauer improved)
Fluorescence microscope (ZEISS, model: Axio Imager.M2 )
Freezing containers, Mr. FrostyTM (Thermo Fisher Scientific, Thermo ScientificTM, model: Mr. FrostyTM, catalog number: 5100-0001 )
37 °C water bath
-80 °C freezer
Pipettes
Multistepper pipette (and tips)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bernas, S. N., Leiter, O., Walker, T. L. and Kempermann, G. (2017). Isolation, Culture and Differentiation of Adult Hippocampal Precursor Cells. Bio-protocol 7(21): e2603. DOI: 10.21769/BioProtoc.2603.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Stem Cell > Adult stem cell > Neural stem cell
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,604 | https://bio-protocol.org/exchange/protocoldetail?id=2604&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Markerless Gene Editing in the Hyperthermophilic Archaeon Thermococcus kodakarensis
AG Alexandra M. Gehring*
TS Travis J. Sanders*
TS Thomas J. Santangelo
*Contributed equally to this work
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2604 Views: 7424
Edited by: Modesto Redrejo-Rodriguez
Reviewed by: Timo LehtiAlba Blesa
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
The advent of single cell genomics and the continued use of metagenomic profiling in diverse environments has exponentially increased the known diversity of life. The recovered and assembled genomes predict physiology, consortium interactions and gene function, but experimental validation of metabolisms and molecular pathways requires more directed approaches. Gene function–and the correlation between phenotype and genotype is most obviously studied with genetics, and it is therefore critical to develop techniques permitting rapid and facile strain construction. Many new and candidate archaeal lineages have recently been discovered, but experimental, genetic access to archaeal genomes is currently limited to a few model organisms. The results obtained from manipulating the genomes of these genetically-accessible organisms have already had profound effects on our understanding of archaeal physiology and information processing systems, and these continued studies also help resolve phylogenetic reconstruction of the tree of life. The hyperthermophilic, planktonic, marine heterotrophic archaeon Thermococcus kodakarensis, has emerged as an ideal genetic system with a suite of techniques available to add or delete encoded activities, or modify expression of genes in vivo. We outline here techniques to rapidly and markerlessly delete a single, or repetitively delete several, continuous sequences from the T. kodakarensis genome. Our procedure includes details on the construction of the plasmid DNA necessary for transformation that directs, via homologous recombination, integration into the genome, identification of strains that have incorporated plasmid sequences (termed intermediate strains), and confirmation of plasmid excision, leading to deletion of the target gene in final strains. Near identical procedures can be employed to modify, rather than delete, a genomic locus.
Keywords: Genome editing Gene deletion Thermococcus kodakarensis
Background
Archaea often thrive in seemingly inhospitable and rapidly changing environments. Analyses of archaeal genomes reveal a plethora of metabolic strategies, predict sophisticated and highly interdependent regulatory networks underlying gene expression and reveal many genes whose protein–and increasingly often stable RNA–products lack a defined function. The ability to challenge existing, and define new pathways through genetic manipulation has assisted in deconvoluting archaeal physiology and information processing systems, and has more recently opened archaeal species to synthetic- and systems-level approaches to define intra- and intercellular networks.
Thermococcus kodakarensis is a hyperthermophilic, anaerobic, marine archaeon for which a genetic system has been developed over the last decade (Sato et al., 2003 and 2005; Fukui et al., 2005; Santangelo et al., 2008; Santangelo and Reeve, 2011; Hileman and Santangelo, 2012). The ability to genetically modify T. kodakarensis has allowed for the study of individual gene function in metabolism, replication, transcription and translation. Using a recombination based system and both selective and counter-selective markers, individual genes are deleted from the T. kodakarensis genome in a markerless manner (Figure 1). This markerless deletion strategy allows the consecutive deletion of multiple genes in a single strain using the same strategy for each gene.
T. kodakarensis strain TS559 (ΔTK2276; ΔTK0254::TK2276; ΔTK0149; ΔTK0664) requires the presence of agmatine and tryptophan for cellular growth (Santangelo et al., 2010). The deletion strategy presented here utilizes the selectable and counter-selectable markers TK0149 and TK0664, respectively. TK0149 encodes a pyruvoyl-dependent arginine decarboxylase, an enzyme necessary in the conversion of arginine to agmatine which is then converted to putrescine. Cells lacking TK0149 are dependent on the addition of agmatine to the media for viability. TK0664 encodes a hypoxanthine guanine phosphoribosyltransferase, an enzyme involved in a ribonucleotide scavenging pathway. Cells encoding TK0664 can metabolize 6-methylpurine (6-MP), a cytotoxic purine derivative, and thus perish in environments containing 6-MP. To assist others in implementing this technology, here we outline a procedure to delete a gene [as one example, we delete TK0566 (Walker et al., 2017)] from the T. kodakarensis TS559 genome.
Figure 1. Overview of the markerless deletion scheme used in T. kodakarensis. At the top of the figure is the B-plasmid used to delete the target gene from the genome. The plasmid recombines into the genome providing agmatine prototrophy to recipient cells and yields an intermediate genome. Two intermediate genomes are possible; however only one is depicted here. A second spontaneous recombination event excises plasmid sequences and permits survival in the presence of cytotoxic 6-MP. This second recombination event will result in the desired deletion genome (left) or the restoration of the TS559 genome (right).
Materials and Reagents
1 ml TB syringe (BD, catalog number: 309624 )
1.7 ml microcentrifuge tubes (VWR, catalog number: 490004-444 )
0.2 ml PCR tubes (VWR, catalog number: 20170-012 )
Polystyrene Petri plates (Fisher Scientific, catalog number: S33580A )
Split rubber stopper (DWK Life Sciences, Wheaton, catalog number: W224100-282 )
20 mm aluminum seals (DWK Life Sciences, Wheaton, catalog number: 224178-01 )
20 mm E-Z Crimper, Standard Seal (DWK Life Sciences, Wheaton, catalog number: W225303 )
20 mm E-Z Decapper (DWK Life Sciences, Wheaton, catalog number: W225353 )
Polycarbonate centrifuge tubes (Beckman Coulter, catalog number: 361690 )
Cell spreader (Fisher Scientific, catalog number: 08-100-10 )
10 ml serum bottles (DWK Life Sciences, Wheaton, catalog number: 223739 )
Face shields, lab coats, and autoclave gloves
Paper towels
T. kodakarensis strain TS559 (Santangelo et al., 2010)
DH5α E. coli competent cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18258012 )
XL1-Blue E. coli competent cells (Agilent Technologies, catalog number: 200228 )
pTS700 (Hileman and Santangelo, 2012)
Note: Please contact corresponding author to obtain plasmid.
Agmatine (Sigma-Aldrich, catalog number: A7127 )
Elemental sulfur (Aqua Solutions, catalog number: S8800-12KG )
10 mM Tris-HCl pH 8.0 (VWR, catalog number: 97061-258 )
Isopropanol (Sigma-Aldrich, catalog number: 190764 )
LE Quick dissolve agarose (VWR, catalog number: 490000-004 )
Ethidium bromide (Sigma-Aldrich, catalog number: E1510 )
AMPure XP (Fisher Scientific, catalog number: NC9959336)
Manufacturer: Beckman Coulter, catalog number: A63880 .
Nucleospin Gel and PCR Clean-up Kit (MACHERY-NAGEL, catalog number: 740609 )
ZR Plasmid Miniprep kit (Zymo Research, catalog number: D4015 )
T4 DNA polymerase (New England Biolabs, catalog number: M0203 )
dGTP (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10297018 )
SwaI restriction enzyme (New England Biolabs, catalog number: R0604 )
dCTP (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10297018 )
NEBuffer 2.1 (New England Biolabs, catalog number: B7202S )
Taq DNA polymerase (New England Biolabs, catalog number: M0267 )
dNTPs (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10297018 )
700Forward primer (5’ CGCCGCAATAGCGGTCGTCGTCATGTTCCC 3’)
700Reverse primer (5’ AACAATTTCACACAGGAAACAGCTATGACC 3’)
Plasmid Miniprep kit
Quikchange II (Agilent Technologies, catalog number: 200523 )
DpnI
Gelzan (Sigma-Aldrich, catalog number: G1910 )
Phusion DNA polymerase (New England Biolabs, catalog number: M0530 )
6-Methylpurine (Sigma-Aldrich, catalog number: M1256 )
Note: This product has been discontinued.
Polysulfides
Phenol (AMRESCO, catalog number: 0945 )
Chloroform (Sigma-Aldrich, catalog number: C2432 )
Isoamyl alcohol (EMD Millipore, catalog number: 1009791000 )
Tryptone (EMD Millipore, catalog number: 1072131000 )
Note: T. kodakarensis requires casein peptone that is enzymatically digested using pancreatic enzymes. Other sources of tryptone are suitable for E. coli media.
Yeast extract (AMRESCO, catalog number: J850 )
Note: For E. coli media, any yeast extract is suitable, however T. kodakarensis requires this source of yeast extract.
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 793566 )
Agar
Ampicillin (Sigma-Aldrich, catalog number: A0166 )
Niacin (Sigma-Aldrich, catalog number: PHR1276 )
Biotin (AMRESCO, catalog number: 0340 )
Pantothenate (Sigma-Aldrich, catalog number: 259721 )
Note: This product has been discontinued.
Lipoic acid (Fisher Scientific, catalog number: BP26821 )
Note: This product has been discontinued.
Folic acid (Sigma-Aldrich, catalog number: F7876 )
P-aminobenzoic acid (Acros Organics, catalog number: 146210010 )
Thiamine (Fisher Scientific, catalog number: BP892-100 )
Riboflavin (Sigma-Aldrich, catalog number: R1706 )
Note: This product has been discontinued.
Pyridoxine (Sigma-Aldrich, catalog number: P9755 )
Cobalamin (Sigma-Aldrich, catalog number: V6629 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M9272 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (EMD Millipore, catalog number: MX0070 )
Ammonium sulfate ((NH4)2SO4) (VWR, catalog number: BDH9216 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S6014 )
Calcium chloride dihydrate (CaCl2·2H2O) (EMD Millipore, catalog number: CX0130 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P3911 )
Potassium phosphate monobasic (K2HPO4) (Sigma-Aldrich, catalog number: P0662 )
Sodium bromide (NaBr) (Fisher Scientific, catalog number: S255 )
Strontium chloride hexahydrate (SrCl2·6H2O) (Sigma-Aldrich, catalog number: 13909 )
Note: This product has been discontinued.
Ammonium iron(II) sulfate hexahydrate (Fe(NH4)2(SO4)2·6H2O) (Sigma-Aldrich, catalog number: F3754 )
Manganese(II) sulfate monohydrate (MnSO4·H2O) (Fisher Scientific, catalog number: M114 )
Cobalt(II) chloride hexahydrate (CoCl2·6H2O) (Sigma-Aldrich, catalog number: 202185 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (RICCA Chemical, catalog number: RDCZ0200 )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (Sigma-Aldrich, catalog number: C8027 )
Aluminum potassium sulfate dodecahydrate (AlK(SO4)2·12H2O) (Fisher Scientific, catalog number: A605 )
Boric acid (H3BO3) (Fisher Scientific, catalog number: A73 )
Sodium molybdate dehydrate (Na2MoO4·2H2O) (Sigma-Aldrich, catalog number: S6646 )
Note: This product has been discontinued.
Sodium sulfide nonahydrate (Na2S·9H2O) (Sigma-Aldrich, catalog number: 431648 )
Cysteine (Fisher Scientific, catalog number: BP377 )
Glutamic acid (AMRESCO, catalog number: 0421 )
Glycine (Sigma-Aldrich, catalog number: W328707 )
Arginine (Sigma-Aldrich, catalog number: A5131 )
Proline (Sigma-Aldrich, catalog number: W331902 )
Asparagine (AMRESCO, catalog number: 94341 )
Histidine (Sigma-Aldrich, catalog number: H8000 )
Isoleucine (Sigma-Aldrich, catalog number: W527602 )
Leucine (Sigma-Aldrich, catalog number: L8000 )
Lysine (Sigma-Aldrich, catalog number: L5626 )
Threonine (Sigma-Aldrich, catalog number: T8625 )
Tyrosine (Sigma-Aldrich, catalog number: T3754 )
Alanine (Sigma-Aldrich, catalog number: W381829 )
Methionine (Sigma-Aldrich, catalog number: M9625 )
Phenylalanine (Sigma-Aldrich, catalog number: P2126 )
Serine (Sigma-Aldrich, catalog number: S8407 )
Note: This product has been discontinued
Tryptophan (AMRESCO, catalog number: E800 )
Aspartic acid (AMRESCO, catalog number: 0192 )
Glutamine (Sigma-Aldrich, catalog number: G3126 )
Valine (Sigma-Aldrich, catalog number: V0500 )
Phenol:Chloroform:Isoamyl Alcohol (25:24:1) (see Recipes)
LB plates (see Recipes)
LB-Amp plates (see Recipes)
KOD Vitamins (see Recipes)
ASW-YT media (see Recipes)
2x ASW solution (see Recipes)
Trace minerals solution (see Recipes)
Polysulfides (see Recipes)
0.8x ASW solution (see Recipes)
20 amino acid solution (see Recipes)
Equipment
Eppendorf Microcentrifuge 5424 (Eppendorf, model: 5424 )
125 ml serum bottles (DWK Life Sciences, Wheaton, catalog number: 223748 )
Noodle pot
Autoclave
Anaerobic chamber (Coy Labs)
Glass Petri plates (VWR, catalog number: 89000-304 )
Note: Glass Petri plates are used here, as many plastic Petri plates melt at T. kodakarensis incubation temperature (85 °C).
Beckman Avanti J Series centrifuge system
JLA10.500 rotor (Beckman Coulter, model: JLA10.500 , catalog number: 369681)
Eppendorf Mastercycler Nexus Thermal cycler (Eppendorf, catalog number: 6333000022 )
GasPak EZ Anaerobe Container System (BD, model: GasPakTM EZ, catalog number: 260678)
Pipettes (Gilson, catalog numbers: F123600 , F123615 , F123602 )
Enzyme Cooler, Isotherm System (Eppendorf, model: IsoTherm-System® start set, catalog number: 3880000011 )
VWR forced air incubator (37 °C and 85 °C)
Thermo MaxQ 4000 benchtop orbital shaker (Thermo Fisher Scientific, Thermo ScientificTM, model: MaxQTM 4000 )
Dry block heater (VWR, catalog number: 12621-090 )
Software
Primer3 (Untergasser et al., 2007)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gehring, A. M., Sanders, T. J. and Santangelo, T. J. J. (2017). Markerless Gene Editing in the Hyperthermophilic Archaeon Thermococcus kodakarensis. Bio-protocol 7(22): e2604. DOI: 10.21769/BioProtoc.2604.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Microbiology > Microbial genetics > Gene mapping and cloning
Molecular Biology > DNA > Chromosome engineering
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,605 | https://bio-protocol.org/exchange/protocoldetail?id=2605&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Organotypic Brain Cultures: A Framework for Studying CNS Infection by Neurotropic Viruses and Screening Antiviral Drugs
Jeremy Charles Welsch
CL Claire Lionnet
BH Branka Horvat
DG Denis Gerlier
CM Cyrille Mathieu
*Contributed equally to this work
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2605 Views: 12215
Reviewed by: Kae-Jiun Chang
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
According to the World Health Organization (WHO), at least 50% of emerging viruses endowed with pathogenicity in humans can infect the Central Nervous System (CNS) with induction of encephalitis and other neurologic diseases (Taylor et al., 2001; Olival and Daszak, 2005). While neurological diseases are progressively documented, the underlying cellular and molecular mechanisms involved in virus infection and dissemination within the CNS are still poorly understood (Swanson and McGavern, 2015; Ludlow et al., 2016). For example, measles virus (MeV) can infect neural cells, and cause a persistent brain infections leading to lethal encephalitis from several months to years after primary infection with no available treatment (Reuter and Schneider-Schaulies, 2010; Laksono et al., 2016). The Organotypic Brain Culture (OBC) is a suitable model for the virology field to better understand the CNS infections. Indeed, it allows not only studying the infection and the dissemination of neurotropic viruses within the CNS but it could also serve as screening model of innovative antiviral strategies or molecules, such as our recently published studies about fusion inhibitory peptides and the HSP90 chaperone activity inhibitor, 17-DMAG (Welsch et al., 2013; Bloyet et al., 2016). Based on our previous work, we propose here an optimized method to prepare OBC of hippocampi and cerebellums which are suitable for small rodent models based virus studies, including mice, rats as well as hamsters at a post-natal stage, between P6 to P10. We notably took into account the stress of the slice procedure on the tissue and the subsequent cellular reactions, which is essential to fully characterize the model prior to any use in infectious conditions. With this knowledge, we propose a protocol highlighting the requirements, including potential trouble shootings of the slicing parameters, to consider the variations we observed according to the structure and animal studied. This framework should facilitate the use of OBC for better conclusive studies of neurotropic viruses.
Keywords: Organotypic brain culture Neurotropic viruses CNS infection Brain viral dissemination Antiviral molecule screening
Background
Since 1958 neurobiologists have continuously developed organotypic brain cultures (OBC) with a tremendous increase in their usage over the last two decades in the fields of neurodevelopment, neurodegenerative diseases or neuropharmacology (Bornstein and Murray, 1958; Kim et al., 2013; Humpel, 2015). In contrast, despite the advantages of this model, very few studies of virus infection, tropism or dissemination have been published (Mayer et al., 2005; Braun et al., 2006; Stubblefield Park et al., 2011). Indeed, experiments using OBC are inherently more complex to set up than classical cellular primary cultures (i.e., purified neurons or dissociated brain cultures). However, the elegance of this approach resides in the possibility to maintain major cell types in a preserved three-dimensional tissue architecture that allows studying in real time viral invasion throughout brain structures and cell subsets, in more physiological environment and without the impact of the peripheral immune system. Furthermore, since the cellular composition of the tissue is maintained, including neurons, oligodendrocytes, microglial cells and astrocytes, it becomes possible to assess and decipher the involvement and the response of each cell population during the viral infection (Lossi et al., 2009). This model also presents the advantage to reduce the animal payload compared to in vivo experiment which fits perfectly with the recommendations and regulation of animal usage in life science by the Institutional Animal Care and Use Committee (IACUC). Indeed, it is possible to generate at least 10 to 15 slices per structure and thus it allows expanding the number of tested conditions per animal. Furthermore, most of the equipment required for its implementation is easy to acquire or already available in laboratories using tissue culture approaches with interest in neuro-virology. This protocol details the preparation of cultured rodent brain slices obtained from either hippocampus or cerebellum, assessment of its viability, analysis of brain cell types, morphological rearrangements and kinetic during one-week culture. Finally, this protocol offers an example of utilization of OBC to study viral brain infection with measles virus (MeV) in rodent explants.
Materials and Reagents
Sterile pipette tips, 1,000 μl (Corning, catalog number: 9032 )
Sterile filtered pipette tips, 10 μl (Corning, catalog number: 4807 )
Sterile Falcon 6-well flat bottom plate (Corning, Falcon®, catalog number: 353046 )
Feather 81-S razor blades (Dominique Dutscher, catalog number: 711164B)
Manufacturer: Feather Safety Razor, model: 81-S .
Scalpel blades N°10 (Dominique Dutcher, catalog number: 132510 )
Sterile 50 ml sterile Falcon tubes (Corning, catalog number: 430290 )
Sterile Petri dishes, 35 mm (Corning, Falcon®, catalog number: 351008 )
Sterile pipettes for cell culture 5 ml Falcon (Corning, Falcon®, catalog number: 356543 )
Sterile Whatman paper (for the hippocampal slicing process) (GE Healthcare, catalog number: 10347510 )
Sterile PTFE plate 60 x 60 x 5 mm for cerebellum slicing (ePlastics, 0.250” PTFE Sheet 12” x 12”)
Sterile syringe filter with a pore size of 0.22 µm (EMD Millipore, catalog number: SLGV033RS )
Sterile Millicell Cell Culture insert, 30 mm, hydrophilic PTFE, 0.4 µm (EMD Millipore, catalog number: PICM0RG50 )
96-well, white plate flat clear bottom with lid (Corning, catalog number: 3610 )
Falcon 12-well flat bottom plate (Dominique Dutscher, catalog number: 064023 )
Slide and coverslip
Filtration unit Stericup GP Millipore, pores 0.2 µm (EMD Millipore, catalog number: SCGPU05RE )
Needle (Hamilton Bell, catalog number: 6980 )
Neonate rodent (mouse, rat, hamster) between postnatal day P6 to P10 (males and/or females)
Note: Based on our experience, the sex of the animals did not affect our results, but this parameter should be considered carefully when working with other viruses than MeV.
Example of virus: recombinant measles virus (IC323 strain) coding for enhanced green fluorescent protein (MeV-EGFP–1.107 pfu/ml)
70% ethanol
Ketamine hydrochloride (MWI Animal Health, NDC 13985-584-10)
Propidium iodide solution (Sigma-Aldrich, catalog number: P4864 )
Dulbecco’s phosphate buffer saline (DPBS) 1x, w/o calcium/magnesium (Thermo Fisher Scientific, catalog number: 14190094 )
AlarmarBlue® Cell Viability Reagent–Stock solution 10x (Thermo Fisher Scientific, InvitrogenTM, catalog number: DAL1025 )
Anti-Glial Fibrillary Acidic Protein (GFAP) rabbit polyclonal (Agilent Technologies, Dako, catalog number: Z0334 ) used at 1/700 in BPS
Anti-NeuN rabbit polyclonal (EMD Millipore, catalog number: ABN78 ) used at 1/500 in BPS
Anti-calbindin D-28 K rabbit polyclonal (Swant, catalog number: CB38 ) used at 1/700 in BPS
Anti-Iba1 (Wako Pure Chemical Industries, catalog number: 019-19741 ) used at 1/250 in BPS
Anti-olig2 (Oligodendrocyte Lineage Transcription Factor 2) (R&D Systems, catalog number: AF2418 ) used at 1/200 in BPS
Anti-rabbit IgG Fab2 Alexa Fluor® 488 (Cell Signaling Technology, catalog number: 4412S ) used at 1/750 in BPS
Anti-goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Thermo Fisher Scientific, catalog number: A-11055 ) used at 1/750 in BPS
Anti-rabbit IgG Fab2 Alexa Fluor® 555 (Cell Signaling Technology, catalog number: 4413S ) used at 1/750 in BPS
Fluoprep (BioMérieux, catalog number: 75521 )
Opti-MEM reduced serum medium (Thermo Fisher Scientific, GibcoTM, catalog number: 31985062 )
RNA extraction kit NucleoSpin® RNA (MACHEREY-NAGEL, catalog number: 740955.250 )
RNase Away®, 475 ml (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 7002 )
iScriptTM cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 170-8891 )
Platinum® SYBR® Green qPCR SuperMix-UDG w/ROX (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11744500 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266-1KG )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S8045-1KG )
Hydrochloric acid solution (HCl), 1.0 N, BioReagent, suitable for cell culture (Sigma-Aldrich, catalog number: H9892-100ML )
Recombinant human insulin (Sigma-Aldrich, catalog number: 91077C-100MG )
Minimum Essential Media (MEM), HEPES, GlutaMAXTM Supplement, 500 ml (Thermo Fisher Scientific, GibcoTM, catalog number: 42360081 )
Heat-inactivated horse serum, 100 ml (Thermo Fisher Scientific, GibcoTM, catalog number: 26050070 )
D-glucose cell culture grade 5 g/L (Sigma-Aldrich, catalog number: G7528 )
Kynurenic acid (Sigma-Aldrich, catalog number: K3375-5G )
HEPES 1 M, 100 ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
Hibernate®-A medium (Thermo Fisher Scientific, GibcoTM, catalog number: A1247501 )
Crystalline PFA (Sigma-Aldrich, catalog number: P6148 )
Fetal bovine serum (FBS), 500 ml (Eurobio, catalog number: CVFSVF0001 )
TritonTM X-100 (Sigma-Aldrich, catalog number: T8787 )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
1 M MgCl2 solution (see Recipes)
0.1 N NaOH solution (see Recipes)
Human insulin 50 mg/ml (see Recipes)
Organotypic brain culture medium (see Recipes)
10x kynurenic acid solution (see Recipes)
Dissection medium (see Recipes)
8% paraformaldehyde (PFA) (see Recipes)
4% paraformaldehyde (PFA) (see Recipes)
Blocking and permeabilization solution (BPS) (see Recipes)
Equipment
Straight tweezers, type N°5 length 11 cm for removing the skin and the skull (Dominique Dutscher, catalog number: 005092 )
Ice container
5% CO2 incubator maintained at 37 °C with humidified atmosphere (Thermo Fisher Scientific, Thermo ScientificTM, model: Series 8000 Water-Jacketed , catalog number: 3423)
Biosafety cabinets
Note: Work in a horizontal flow hood is recommended for the slices preparation and BSL2 vertical flow hood is recommended for the viral infection step with BSL2 pathogens and infection follow-up. However, if the protection glass on the BSL2 cabinet can be maintained up, the slices can be prepared the same way. Based on our experience and even if the sterility is not well preserved under these conditions, the contamination rate remains very low. In any case, the biosafety level has to be adapted depending on the virus considered (BSL2, BSL3 or BSL4) for the viral infection and follow up steps.
Stainless steel dissecting scissors length 11 cm (Dominique Dutscher, catalog number: 005064 )
Beaker, 250 ml
McIlwain tissue chopper (Campden Instruments, model: TC752 )
Pipette bulb (Fisher Scientific, catalog number: 03-448-29 )
Stainless steel dissecting scissors ultra-fine length 12 cm for cutting and removing the skull (Dominique Dutscher, catalog number: 005068 )
Dumont tweezers #5 for the dissection of the brain and the meninges removal, 0.1 x 0.06, Dumoxel (World Precision Instruments, catalog number: 14098 )
Stainless steel forceps rounded ends length 130 mm for holding the brain during the dissection procedure and the slices separation (Dominique Dutscher, catalog number: 442256 )
Lanceolate tip spatula for the midbrain removal (imLab, catalog number: NE010 )
Curved tweezers type N°7 length 11 cm for the midbrain removal and harvesting the slices from the culture insert (Dominique Dutcher, catalog number: 005093 )
P1000 Pipetman (Gilson, catalog number: F123602 )
P20 Pipetman (Gilson, catalog number: F123600 )
KOLLE needle holder for the slices separation (Hamilton Bell, catalog number: 6780 )
Water bath
Widefield fluorescence microscope (ZEISS, model: Axioplan 2 ) with a cooled monochrome camera (Photometrics, model: CoolSNAP HQ2 ) and a fluorescence filter set for propidium iodide (for example: excitation 550-580 nm, emission 600-660 nm)
Tecan Infinite® 200 PRO series plate reader (Tecan, model: M Plex )
Confocal spectral microscope (Leica, model: Leica TCS SP5 )
TPersonal 48 Thermal Cycler (Analytik Jena, Biometra, model: T-Personal 48 , catalog number: 846-050-551)
StepOnePlusTM Real-Time PCR System (Thermo Fisher Scientific, Applied BiosystemsTM, model: StepOnePlusTM, catalog number: 4376600 )
Stereomicroscope for dissection (Leica, model: Leica LED2000 )
Fume hood
-20 °C freezer
-80 °C freezer
Software
ImageJ (https://imagej.nih.gov/ij/ [Schneider et al., 2012]) with the plugin ‘Auto Local Threshold’ from Gabriel Landini (http://fiji.sc/Auto_Local_Threshold#Installation)
Note: Fiji (http://fiji.sc/ [Schindelin et al., 2012]) could be used instead of ImageJ because it bundles the required plugin. Download the Macro file ‘OBC_IP_mortality.ijm’ for the analysis of the propidium iodide staining. Save the file in the ImageJ/plugins folder. ‘OBC IP mortality’ should appear in the Plugins menu.
GraphPad Prism (GraphPad software–https://www.graphpad.com/scientific-software/prism/) and/or R software (https://www.r-project.org/)
StepOnePlus software (https://www.thermofisher.com/us/en/home/technical-resources/software-downloads/StepOne-and-StepOnePlus-Real-Time-PCR-System.html)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Welsch, J. C., Lionnet, C., Terzian, C., Horvat, B., Gerlier, D. and Mathieu, C. (2017). Organotypic Brain Cultures: A Framework for Studying CNS Infection by Neurotropic Viruses and Screening Antiviral Drugs. Bio-protocol 7(22): e2605. DOI: 10.21769/BioProtoc.2605.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture > 3D cell culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Where can this macro be found OBC_IP_mortality.ijm?
1 Answer
4 Views
Sep 24, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,606 | https://bio-protocol.org/exchange/protocoldetail?id=2606&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Rapid IFM Dissection for Visualizing Fluorescently Tagged Sarcomeric Proteins
YX Yu Shu Xiao
FS Frieder Schöck
NG Nicanor González-Morales
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2606 Views: 9775
Edited by: Jyotiska Chaudhuri
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
Sarcomeres, the smallest contractile unit of muscles, are arguably the most impressive actomyosin structure. Yet a complete understanding of sarcomere formation and maintenance is missing. The Drosophila indirect flight muscle (IFM) has proven to be a very valuable model to study sarcomeres. Here, we present a protocol for the rapid dissection of IFM and analysis of sarcomeres using fluorescently tagged proteins.
Keywords: Dissection Drosophila GFP Indirect flight muscle Sarcomere Z-disc
Background
The cytoskeletal structures that enable contractility of striated muscle fibers are hundreds of cables called myofibrils. Myofibrils in turn are an array of serially arranged sarcomeres, all contracting simultaneously. The sarcomere is a perfectly symmetrical structure that contains all the elements required for contraction. At the center of the sarcomere lies the M-line, where myosin thick filaments are anchored. Flanking the sarcomere are the Z-discs, where actin thin filaments are anchored.
Muscular dystrophies are inherited disorders that cause progressive skeletal muscle weakness (Schröder and Schoser, 2009). There is no cure for muscular dystrophy, likely due to an incomplete understanding of the molecular mechanisms that underlie muscular dystrophies (Olive et al., 2013). Drosophila melanogaster is an effective genetic model organism to study muscle biology owing to its short life span, economical maintenance, and abundant available resources (Hales et al., 2015; Wangler et al., 2015).
Flight in Drosophila is powered by the synchronized action of the indirect flight muscles (IFM), the biggest muscles in flies, which are further subdivided into dorsal longitudinal muscles (DLM) and dorsal ventral muscles (DVM). The IFM share many fundamental similarities with human skeletal muscle: contraction mechanism, developmental steps, overall ultrastructure, and protein components (Vigoreaux, 2001). For example, the myopathy-related proteins ZASP and Filamin-C have fly homologs that when mutated develop muscle phenotypes (Liao et al., 2016; Gonzalez-Morales et al., 2017). Despite the advantages of using the IFM for muscle research, IFM dissection can be challenging and time-consuming. Here we present a protocol that combines fast and easy IFM dissection with high-quality imaging of the IFM using fluorescent proteins. We also provide a strategy for analyzing mutant phenotypes and quantifying sarcomeres by semi-automatic detection of sarcomere components.
Materials and Reagents
Surgical blade (FEATHER Safety Razor, catalog number: No. 23 )
1.5 ml microcentrifuge tube
Pipette tips
Conventional needles PrecisionGlide 23 G 1 in. (Fisher Scientific, catalog number: 14-826-6B)
Manufacturer: BD, catalog number: 305193 .
BD disposable syringes (BD, catalog number: 309628 )
Cover Glass No. 1 ½ 22 x 30 mm (e.g., Corning, catalog number: 2850-22 )
Microscope slides (e.g., Fisher Scientific, catalog number: 12-552-3 )
Flies expressing sarcomere fluorescent markers (e.g., Zasp52-GFP, Table 1)
Custom-made 3.5% agar-filled 60 x 15 mm Petri dish plate (BioShop, catalog number: AGR003 )
Phalloidin-Tetramethylrhodamine B isothiocyanate (TRITC) (Sigma-Aldrich, catalog number: P1951 )
Phalloidin-Fluorescein Isothiocyanate (FITC) (Sigma-Aldrich, catalog number: P5282 )
Mounting media ProLong Gold Antifade Mountant (Thermo Fisher Scientific, InvitrogenTM, catalog number: P36934 )
Magnesium chloride (MgCl2)
Ethylene glycol-bis-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E3889 )
Adenosine triphosphate (ATP) (BioShop, catalog number: ATP007 )
1,4-Dithiothreitol (DTT) (BioShop, catalog number: DTT001 )
cOmpleteTM, EDTA-free Protease Inhibitor Cocktail (Roche Diagnostics, catalog number: 11873580001 )
Glycerol (BioShop, catalog number: GLY001 )
Triton X-100 (BioShop, catalog number: TRX777 )
8% paraformaldehyde aqueous solution glass vial (Electron Microscopy Sciences, catalog number: 157-8 )
Sodium chloride (NaCl)
Potassium chloride (KCl)
Sodium phosphate dibasic (Na2HPO4)
Potassium phosphate dibasic (K2HPO4)
Relaxing solution (see Recipes)
Relaxing-Glycerol solution (see Recipes)
8% paraformaldehyde (see Recipes)
10x phosphate buffered saline (PBS) (see Recipes)
1x PBS, 0.1% Triton X-100 (PBST) (see Recipes)
Equipment
CO2 Flypad, standard size (8.1 x 11.6 cm) (Genesee Scientific, Flystuff, catalog number: 59-114 )
Blade handle for surgical blade (FEATHER Safety Razor, catalog number: No. 4 )
Glass Petri dish; 60 x 15 mm (VWR, catalog number: 89000-770)
Manufacturer: DWK Life Sciences, KIMBLE®, catalog number: 2306-10010 .
Stereo microscope (Leica Microsystems, model: Leica MS5 )
Dumont #5 forceps (Fine Science Tools, catalog number: 11251-30 )
Incubator set to 25 °C
P2, P20, P100, and P1000 Micro Pipettes (e.g., Gilson, catalog numbers: F144801 , F123600 , F123615 and F123602 )
Platform mixers (e.g., Speci-Mix Test Tube Rocker) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: M71015Q )
Medium-sized pointed brush
Standard fly husbandry equipment
Software
Fiji (https://fiji.sc/)
R Statistics package (https://www.r-project.org/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Xiao, Y. S., Schöck, F. and González-Morales, N. (2017). Rapid IFM Dissection for Visualizing Fluorescently Tagged Sarcomeric Proteins. Bio-protocol 7(22): e2606. DOI: 10.21769/BioProtoc.2606.
Download Citation in RIS Format
Category
Developmental Biology > Morphogenesis > Cell structure
Cell Biology > Tissue analysis > Tissue imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,607 | https://bio-protocol.org/exchange/protocoldetail?id=2607&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Estimation of Silica Cell Silicification Level in Grass Leaves Using in situ Charring Method
SK Santosh Kumar
RE Rivka Elbaum
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2607 Views: 6737
Edited by: Scott A M McAdam
Reviewed by: Daniel F. Caddell
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Silica cells are specialized leaf epidermal cells in grasses with almost the whole cell volume filled with solid silica. In sorghum, silica deposition in silica cells takes place in young, elongating leaves around the mid-length of the leaf. We developed a protocol for estimating the level of silica cell silicification in Sorghum bicolor leaves using in situ charring method (Kumar et al., 2017a). Here, we provide greater details on our protocol and method of image analysis. Although we based our protocol on sorghum, this protocol can be extended for estimating silica cell silicification level in any grass species.
Keywords: Silicification Silica cells Grasses Sorghum bicolor Spodogram Light microscope
Background
Silica deposition is central to grasses. Grasses deposit up to 10% of their dry weight as silica. The major sites of silica deposition in plants are root endodermal cells, abaxial epidermal cells of inflorescence bracts and silica cells in leaves (Kumar et al., 2017b). Almost the entire volume of silica cells is filled with solid, amorphous silica. Silica deposition in silica cells is physiologically controlled and takes place around the middle length of young leaves (Kumar et al., 2017a), which we named leaf-2 (Figure 1). Silica cell silicification is also a fast process completed within hours (Kumar and Elbaum, 2017), hence in the same leaf there are areas of high and low silicification intensity depending upon which area of leaf we are examining. To study the deposition process, we need a way to quantify the silica cell silicification level in different parts of the same leaf. In situ charring or spodogram preparation of plant material is an easy and cheap way to study silica deposition in plants. The plant material is burnt at temperatures typically above 500 °C for 3 h to overnight that oxidises all of the organic material. The ash remaining after the charring process contains silica and other minerals. The non-silicate minerals from the ash are dissolved by 1 N HCl and the remaining insoluble substance is silica. The in situ charring method can also be used to quantify the silica cell silicification level (Kumar et al., 2017a). The leaf piece is kept in between two glass slides to keep the leaf specimen flat (Figure 2), and then the specimen is burnt, ash washed with HCl (Figure 3) and subsequently with double distilled water to remove the mineral salts. The slide is then taken to a light microscope to count the number of silica cells silicified per unit length. Figure 4 shows a spodogram prepared from the middle of a young leaf. This part was analyzed to quantify silica deposition levels. Our method can be extended to quantify the silica cell silicification level in any leaf piece, but best results are obtained with young and still silicifying leaves.
Materials and Reagents
Glass slides
Paper towel
Aluminium foil
Plastic disposable droppers
Scalpel
Ceramic tile
Young Sorghum bicolor plants
Double distilled water
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 258148 )
1 N Hydrochloric acid (HCl) (see Recipes)
Equipment
Scalpel
Forceps
Muffle furnace (Alfi Laboratory supplies)
Binocular microscope (Motic, model: SMZ168 Series )
Light microscope (Nikon Instruments, model: Eclipse 80i )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kumar, S. and Elbaum, R. (2017). Estimation of Silica Cell Silicification Level in Grass Leaves Using in situ Charring Method. Bio-protocol 7(22): e2607. DOI: 10.21769/BioProtoc.2607.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Biomineralization
Plant Science > Plant biochemistry > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,608 | https://bio-protocol.org/exchange/protocoldetail?id=2608&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Combination of Fluorescent in situ Hybridization (FISH) and Immunofluorescence Imaging for Detection of Cytokine Expression in Microglia/Macrophage Cells
Maria Fe Lanfranco
DL David J. Loane
IM Italo Mocchetti
MB Mark P. Burns
Sonia Villapol
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2608 Views: 13978
Edited by: Xi Feng
Reviewed by: Karthik Krishnamurthy
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Microglia and macrophage cells are the primary producers of cytokines in response to neuroinflammatory processes. But these cytokines are also produced by other glial cells, endothelial cells, and neurons. It is essential to identify the cells that produce these cytokines to target their different levels of activation. We used dual RNAscope® fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) techniques to visualize the mRNA expression pattern of pro- and anti-inflammatory cytokines in microglia/macrophages cells. Using these methods, we can associate one mRNA to specific cell types when combining with different cellular markers by immunofluorescence. Results from RNAscope® probes IL-1β, TNFα, TGFβ, IL-10 or Arg1, showed colocalization with antibodies for microglia/macrophage cells. These target probes showed adequate sensitivity and specificity to detect mRNA expression. New FISH detection techniques combined with immunohistochemical techniques will help to jointly determine the protein and mRNA localization, as well as provide reliable quantification of the mRNA expression levels.
Keywords: in situ hybridization RNAscope Traumatic brain injury (TBI) Macrophages Immunofluorescence Microglia cells Neuroinflammation Cytokines
Background
The mRNA in situ hybridization technique is a useful tool that allows the specific and selective labeling of RNA sequences in brain slices in a cell-dependent manner (Grabinski et al., 2015). Furthermore, the use of antibodies against these specific cytokines can produce variable results due to the detection limits of the technique. Namely, because these cytokines are expressed in low abundance, the detection limit becomes the limiting factor for the use of antibodies. Lastly, fluorescence in situ hybridization (FISH) combined with immunohistochemistry (ISH) allows the examination of cytokine mRNA profiles in distinct cells with high selectivity and specificity, thus allowing us to identify the precise cellular source of cytokine production following TBI. This protocol describes how the combination of FISH and immunofluorescence imaging can bridge the gap between mRNA and protein analysis. We can identify the target mRNA being produced by microglia/macrophage cells. Analysis of both RNA and protein expression in the same tissue allows differentiating between cell specific production of microglia/macrophage cells and other cell types. There are limited studies on the effects of sex on inflammation profile following traumatic brain injury (TBI). In our recent publication (Villapol et al., 2017), we used RNAscope® technology combined with immunofluorescence to determine pro-inflammatory (e.g., IL1β and TNFα) and anti-inflammatory (e.g., TGFβ and Arg1) cytokine mRNA expression profiles in microglia/macrophages in the injured brains of male and female mice. Our data demonstrate that a mixed pattern of both pro-inflammatory and anti-inflammatory cytokine expression occurred in microglia/macrophages in the first week after TBI. Also, we have previously shown that IL-10 levels are significantly increased in microglia/macrophages in the injured cortex of NOX2-/- mice (Barrett et al., 2017).
In summary, the use of FISH improves specificity and sensitivity when examining cytokine mRNAs in distinct cells, confirmed by antibody co-immunostaining for microglia/macrophages. This method allows us to identify the cellular source of cytokine production following brain injury with much-improved confidence.
Materials and Reagents
Thick Whatman paper (Fischerbrand® Chromatography Paper) (Fisher Scientific, catalog number: 05-714-4 )
Gelatin-coated glass slides (Superfrost Plus) (Fisher Scientific, catalog number: 12-550-15 )
Microscope cover glass (24 x 50 mm) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3422ERI )
ImmEdge hydrophobic barrier pen (Advanced Cell Diagnostics, catalog number: 310018 )
Kimwipes (KCWW, Kimberly-Clark, catalog number: 34133 )
Foil paper
Mice (C57BL/6 from THE JACKSON LABORATORY, catalog number: 000664 )
RNAscope® positive control probe-Mm-Ppib (peptidylprolyl isomerase B) (Advanced Cell Diagnostics, catalog number: 313911 )
RNAscope® negative control probe-DapB (Advanced Cell Diagnostics, catalog number: 310043 )
RNAscope® probe-Mm-Tgfβ1 (Transforming growth factor beta 1) (Advanced Cell Diagnostics, catalog number: 407751 )
RNAscope® probe-Mm-IL1β (interleukin 1 beta) (Advanced Cell Diagnostics, catalog number: 316891 )
RNAscope® probe-Mm-TNFα (tumor necrosis factor alpha) (Advanced Cell Diagnostics, catalog number: 311081 )
RNAscope® probe-Mm-Arg1 (Arginase 1) (Advanced Cell Diagnostics, catalog number: 403431 )
Phosphate-buffered saline (PBS), 10x solution (Fisher Scientific, catalog number: BP39920 )
Paraformaldehyde (PFA) stock to prepare 4% (w/v) PFA, PRILLS (Electron Microscopy Sciences, catalog number: 19200 )
Sucrose Crystalline stock (Fisher Scientific, catalog number: S5 ) to prepare 30% (w/v) solution diluted in ultra-pure water
Ultra-pure water (e.g., Milli-Q)
Freshly prepared 50% (v/v) ethanol in ultra-pure water (e.g., Milli-Q water) solution
Freshly prepared 70% (v/v) ethanol in ultra-pure water (e.g., Milli-Q water) solution
Absolute ethanol (200-proof ethanol) (Fisher Scientific, catalog number: BP28184 )
RNAscope® H2O2 & protease plus reagents (Advanced Cell Diagnostics, catalog number: 322330 )
RNAscope® 2.5 HD detection reagents-RED (Advanced Cell Diagnostics, catalog number: 322360 ) (read Note 1)
RNAscope® target retrieval reagents (Advanced Cell Diagnostics, catalog number: 322000 )–previously known as pretreatment 2 solution
Normal goat serum (NGS) blocking solution (Vector Laboratories, catalog number: S-1000 )
Triton X-100
Polyclonal anti-rabbit Iba-1 (ionized calcium binding adaptor molecule-1) antibody (Wako Pure Chemical Industries, catalog number: 019-19741 )
Polyclonal anti-rabbit P2Y12 antibody (AnaSpec, catalog number: AS-55042A )
Polyclonal anti-rat F4/80 antibody (R&D systems, catalog number: MAB5580 )
Goat anti-rabbit Alexa Fluor® 488 secondary antibody (Thermo Fisher Scientific, catalog number: A-11034 )
Goat anti-rat Alexa Fluor® 488 secondary antibody (Thermo Fisher Scientific, catalog number: A-11006 )
Fluoro-gel (with Tris buffer) mounting medium, 20 ml (Electron Microscopy Science, catalog number: 17985-10 )
Glycerol
Ethylene glycol
RNAscope® Wash Buffer Reagents (4 x 60 ml) (Advanced Cell Diagnostics, catalog number: 310091 )
4’,6-Diamidino-2-phenylindole (DAPI) solution (Sigma-Aldrich, catalog number: D9542 )
Antifreeze solution (see Recipes)
1x wash buffer (see Recipes)
1x antigen retrieval solution (see Recipes)
DAPI solution (see Recipes)
Equipment
GilsonTM PIPETMAN ClassicTM Pipets (Gilson, models: P20, P200, P1000, catalog numbers: F123600 , F123601 , F123602 )
2 L beaker
Extra-long forceps (Thermo Fisher Scientific, FisherbrandTM, catalog number: 10-316A )
Timer, TraceableTM NanoTM (Fisher Scientific, FisherbrandTM, catalog number: 14-649-83 )
Slide Holder Handle, 24 slides (Electron Microscopy Sciences, catalog number: 62543-06 )
Sliding microtome, MicromHM 430 (Thermo Fisher Scientific, Thermo ScientificTM, model: HM 430 , catalog number: 910010)
HybEzTM hybridization system (Advanced Cell Diagnostics, catalog number: 310010 )
ACD HybEZTM humidity control tray with lid (Advanced Cell Diagnostics, catalog number: 310012 )
Tissue Tek Slide Stain Set with EasyDipTM slide staining (Electron Microscopy Sciences, catalog number: 62540-01 )
ACD EZ-slide holder/rack (Advanced Cell Diagnostics, catalog number: 310017 )
Thermix® Hot plate with magnetic stirrer, Model 210T (Fisher Scientific, model: Model 210T , catalog number: 11-493-210T)
Fluorescent images were acquired on an Axioplan 2 microscope (Carl Zeiss, model: Axioplan 2 , catalog number: 451485) with a Photometrics camera (CoolSNAP, fx, Axioskop, Roper Scientific, serial number: A02M86017)
Leica SP8 confocal microscope (Leica Microsystems, model: Leica TCS SP8 )
Software
GraphPad Prism software V. 5.0 (GraphPad Software, Inc., La Jolla, CA)
Adobe Photoshop CS5 V. 12.0 (Adobe Photoshop, CC)
AxionVision 4V, 4.8.2.0., licensed to: 3018897 (Carl Zeiss MicroImaging, GmbH)
ImageJ64 software (National Institute of Health)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lanfranco, M. F., Loane, D. J., Mocchetti, I., Burns, M. P. and Villapol, S. (2017). Combination of Fluorescent in situ Hybridization (FISH) and Immunofluorescence Imaging for Detection of Cytokine Expression in Microglia/Macrophage Cells. Bio-protocol 7(22): e2608. DOI: 10.21769/BioProtoc.2608.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Neuroscience > Cellular mechanisms > Intracellular signalling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,609 | https://bio-protocol.org/exchange/protocoldetail?id=2609&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Obtaining Multi-electrode Array Recordings from Human Induced Pluripotent Stem Cell–Derived Neurons
XX Xiaohong Xu
CR Carola I. Radulescu
KU Kagistia Hana Utami
M Mahmoud A. Pouladi
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2609 Views: 11548
Edited by: Jihyun Kim
Reviewed by: Khyati Hitesh Shah
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Neuronal electrical properties are often aberrant in neurological disorders. Human induced pluripotent stem cells (hiPSCs)-derived neurons represent a useful platform for neurological disease modeling, drug discovery and toxicity screening in vitro. Multi-electrode array (MEA) systems offer a non-invasive and label-free platform to record neuronal evoked-responses concurrently from multiple electrodes. To better detect the neural network changes, we used the Axion Maestro MEA platform to assess neuronal activity and bursting behaviors in hiPSC-derived neuronal cultures. Here we describe the detailed protocol for neuronal culture preparation, MEA recording, and data analysis, which we hope will benefit other researchers in the field.
Keywords: Multi-electrode array Human induced pluripotent stem cells Neurological diseases Disease modeling
Background
Human induced pluripotent stem cell (hiPSC) technology is currently being used to model neurological and psychiatric diseases in vitro. Recent studies have demonstrated that certain cellular phenotypes associated with particular disorders can be recapitulated in the dish. Neural electrical activity is at the essence of nervous system function, representing a key form of communication whose normal functioning is essential for emotion, memory, sensory modalities, and behavior in vivo. In disease conditions, the electrical properties can be affected, so it is important to understand neuronal circuit connectivity, physiology, and pathology in hiPSC-based models of neurological disease.
Patch-clamp and multi-electrode array (MEA) technology are the prevailing techniques used to assess electrophysiological activity, and thus neuronal function. While patch-clamp is a powerful intracellular method to investigate the activity and function of a single cell (Neher et al., 1978), an MEA plate has the ability to record extracellular action potentials (or spikes) and local field potentials simultaneously from thousands of different cells in the same plate over time, thus offering a better understanding of neuronal activity at a network level (Hutzler et al., 2006; Obien et al., 2014). MEAs are grids of tightly spaced electrodes that are capable of directly sensing changes in extracellular membrane potential in excitable cells and produce real-time trace of neuronal activity. The transparent CytoView 12-well MEA plate contains 64 recording electrodes per well, whereas the 48-well MEA plate contains 12 electrodes per well. The MEA system then parses these voltage traces for action potential waveforms, time-stamps the waveforms, and calculates action potential firing rates on-line for each electrode. This on-line firing rate is represented by color-coded heat-maps that depict real-time and simultaneous indications of network activity, and experimental effects (Figure 1).
Figure 1. Example plate activity heat map, and spike detector. Top: Heat map of MEA reading visualized using Axion BioSystems Integrated Studio (AxIS). Each box represents one well. Active channels represented by bright light blue dots on the map. Bottom: Offline spiking activity illustrated on AxIS data display.
Materials and Reagents
6-well cell culture plate (Corning, Costar®, catalog number: 3516 )
Plastic pipette tips (Corning, Axygen®, catalog number: T-1000-B )
Sterile 1.5 ml centrifuge tubes (Corning, Axygen®, catalog number: MCT-175-C )
15 ml and 50 ml centrifuge tubes (Corning, Falcon®, catalog numbers: 352096 and 352070 )
Petri dish (Corning, Falcon®, catalog number: 351029 )
Cell lifter (Corning, catalog number: 3008 )
12-well MEA plate (Axion BioSystem, catalog number: M768-GL1-30Pt200 )
0.22 µm filter (Corning, catalog number: 431097 )
Kimwipes (KCWW, Kimberly-Clark, catalog number: 34155 )
Sterile water (Thermo Fisher Scientific, GibcoTM, catalog number: 15230162 )
Dispase (STEMCELL Technologies, catalog number: 07923 )
Y-27632 (STEMCELL Technologies, catalog number: 72302 )
Laminin (Thermo Fisher Scientific, GibcoTM, catalog number: 23017015 )
LDN-193819 (Stemgent, catalog number: 04-0074 )
SB431542 (Sigma-Aldrich, catalog number: S4317 )
XAV939 (Stemgent, catalog number: 04-0046 )
Recombinant Human Sonic Hedgehog (SHH) (R&D Systems, catalog number: 464-SH-025 )
Brain-derived neurotrophic factor (BDNF) (R&D Systems, catalog number: 248-BD-025 )
Glial-derived neurotrophic factor (GDNF) (R&D Systems, catalog number: 212-GD-050 )
L-Ascorbic acid (Sigma-Aldrich, catalog number: A4403 )
N6,2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (dbcAMP) (Sigma-Aldrich, catalog number: D0260 )
50% poly(ethyleneimine) (PEI) solution (Sigma-Aldrich, catalog number: P3143 )
Accutase (STEMCELL Technologies, catalog number: 07920 )
Tetrodotoxin (TTX) (Alomone Labs, catalog number: T-500 )
N2 (Thermo Fisher Scientific, GibcoTM, catalog number: 17502048 )
B27 (Thermo Fisher Scientific, GibcoTM, catalog number: 17504044 )
Modified Eagle’s Medium-Non Essential Amino Acid (MEM-NEAA) (Thermo Fisher Scientific, GibcoTM, catalog number: 11140050 )
L-Glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Penicillin-streptomycin (Pen-Strep) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Dulbecco’s modified Eagle’s medium: Nutrient Mixture F-12 (DMEM/F12) (Thermo Fisher Scientific, GibcoTM, catalog number: 11320082 )
Neurobasal medium (Thermo Fisher Scientific, GibcoTM, catalog number: 21103049 )
N2 Supplement-A (STEMCELL Technologies, catalog number: 07152 )
NeuroCultTM SM1 (STEMCELL Technologies, catalog number: 05711 )
BrainPhysTM neuronal medium (STEMCELL Technologies, catalog number: 05790 )
Boric acid (Sigma-Aldrich, catalog number: B6768 )
Sodium tetraborate (Sigma-Aldrich, catalog number: 221732 )
Hydrochloric acid fuming 37% (Merck, catalog number: 100317 )
N2B27 medium (see Recipe 1)
BrainPhys medium (see Recipe 2)
Borate buffer (see Recipe 3)
Equipment
Pipettes
P10 (Gilson, catalog number: F144802 )
P200 (Gilson, catalog number: F123601 )
P1000 (Gilson, catalog number: F123602 )
Tissue culture hood (Gelman, model: BH Class II Type A2 series )
37 °C water bath (Thermo Fisher Scientific, Thermo ScientificTM, model: Labline 183 , catalog number: 2835)
Cell culture incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: HeracellTM I50i CO2 , catalog number: 50116047)
Centrifuge (Eppendorf, model: 5810 , catalog number: 5810000424)
Cell counter Countess II (Thermo Fisher Scientific, model: CountessTM II, catalog number: AMQAX1000 )
Phase contrast microscope (Leica DMIL LED Inverted Fluorescence microscope) (Leica Microsystems, model: Leica DM IL LED )
Maestro MEA system (Axion Biosystem)
Software
Axion Biosystems Integrated Studio (AxIS, Axion Biosystem)
Neural Metric tool (Axion Biosystem)
Neuroexplorer (NEX, Plexon)
MATLAB (R2016a)
Excel (Microsoft Office)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Xu, X., Radulescu, C. I., Utami, K. H. and Pouladi, M. A. (2017). Obtaining Multi-electrode Array Recordings from Human Induced Pluripotent Stem Cell–Derived Neurons. Bio-protocol 7(22): e2609. DOI: 10.21769/BioProtoc.2609.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Cellular mechanisms
Stem Cell > Pluripotent stem cell > Cell-based analysis
Neuroscience > Cellular mechanisms > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
261 | https://bio-protocol.org/exchange/protocoldetail?id=261&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo Matrigel Plug Angiogenesis Assay
Hong Lok Lung
Maria Li Lung
Published: Vol 2, Iss 18, Sep 20, 2012
DOI: 10.21769/BioProtoc.261 Views: 51154
Edited by: Ivan Zanoni
Reviewed by: Alexandros Alexandratos
Original Research Article:
The authors used this protocol in Feb 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2012
Abstract
The matrigel plug angiogenesis assay is a simple in vivo technique to detect the newly formed blood vessels in the transplanted gel plugs in nude mice. The matrigel matrix is derived from the engelbroth-holm-swarm (EHS) mouse sarcoma, and its composition is comparable to the basement membrane proteins. The matrigel can induce differentiation of a variety of cell types such as hepatocytes, mammary epithelial cells, and endothelial cells. In our case, tumor cells are mixed with the matrigel gel and are injected into the mice. The later immunohistochemistry (IHC) staining with the endothelial marker indicates the presence of the newly formed capillaries in the sectioned gel plugs.
Keywords: In vivo Matrigel plug Angiogenesis Nude mice Endothelial cell
Materials and Reagents
BALB/cAnN-nu (Nude) female mouse, 6 to 8 week-old
Tumor cells
Matrigel matrix (BD Biosciences, Falcon®, catalog number: 354234 )
10% formalin solution-neutral buffered (Sigma-Aldrich, catalog number: HT501128-4L )
Anti-rat CD34 (Santa Cruz, catalog number: sc-18917 )
Biotin goat Anti-Rat IgG (BD Biosciences, catalog number: 559286 )
Streptavidin-peroxidase conjugate (Dako, catalog number: P0397 )
Diaminobenzidine (DAB) (Dako, catalog number: K3467 )
Paraffin
Potassium chloride
Potassium phosphate monobasic
Dodium chloride (NaCl)
Sodium phosphate dibasic anhydrous
Hematoxylin and eosin (H&E)
Trypsin
Complete medium
Plain medium
Phosphate buffered saline (PBS) (see Recipes)
Software
Aperio ScanScope System
ImageScope v10 software (Aperio, Vista)
Equipment
Aperio Scanscope CS-S microscopic slide scanning system
Tumor cell culture set up
Hemocytometer
Centrifuges
24G syringe
T175 flask
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Angiogenesis > Animal models
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
The anesthesia requirement
0 Answer
2 Views
May 8, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,610 | https://bio-protocol.org/exchange/protocoldetail?id=2610&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Streamlined Method for the Preparation of Gelatin Embedded Brains and Simplified Organization of Sections for Serial Reconstructions
Andrew W. Liu
SA Sho Aoki
JW Jeffery R. Wickens
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2610 Views: 12972
Edited by: Shai Berlin
Reviewed by: Junjie LuoYunbing Ma
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Gelatin embedding of whole brains for sectioning is a critical procedure used in neuroscience to ensure all morphological and spatial details are preserved intact. Here, we describe an inexpensive, reproducible and efficient means to embed post-fixed brains ready for sectioning in gelatin within a week’s time. The sections obtained are distortion-free and their fragile internal structures preserved which can be used for serial reconstructions for lesion studies and mapping of viral expression after stereotaxic injections. In addition, the separation of adjacent slices into a series of 3-4 vials facilitates subsequent organization and assembly of serial sections at the mounting step.
Keywords: Gelatin embedding Serial reconstruction Slide mounting Lesion Viral expression Neuronal tracing
Background
Recent advances in behavioral neurosciences have allowed the introduction of opsins and antibody targeted-toxins to specific subsets of neurons and regions of the brain. These studies often require visualization of whole brain sections for histological and morphological analysis to localize cell-type specific antibody targeted-toxin induced lesions by stereotaxic injection for behavioral validation (Aoki et al., 2015) or the introduction of virus delivered transgenes (Aquili et al., 2014). Detailed mapping of neuronal circuitry by rabies virus (Suzuki et al., 2012) and localization surveys of serial sections have been achieved using gelatin as an embedding agent, which acts a structural substrate within and around the tissue. Gelatin impregnated brain tissue provides strengthened support for delicate internal structures such as the hippocampus and ventricle spaces which are easily damaged when processed for immunohistochemistry (IHC) and subsequent mounting onto slides. Embedded brain sections are also often free of distortions when mounted and adjacent sections can be used for serial reconstructions.
Qualities of the gel embedding and post-IHC handling are dependent on several procedural details, which can be tedious and time consuming. In previous published protocols, proper penetration and infiltration of the gelatin into the brain and ventricular spaces required a vacuum oven (Griffioen et al., 1992). Further, embedding the brains in a small mold is challenging as the brain has a tendency to float. Additionally, identifying and orienting adjacent slices after IHC processing for serial reconstructions can be arduous.
In this improved protocol, we address several issues important for timely and trouble-free gelatin embedding of whole brains. Begin with rapid impregnation of gelatin into the brain using a magnetic stir bar to weigh the brain down into the liquefied gelatin. Further, the use of an icebox allows the gelatin to set from bottom to top thus eliminating the problem of floating brains. Finally, the arrangement and determination of adjacent serial sections for 3D reconstruction series are simplified by placing the adjacent sections sequentially into 3 to 4 vials, looping back to the first vial after the last. After IHC processing, the sections from each vial are placed in a column next to one another in a large Petri-dish and adjacent slices can be rapidly mounted moving along row by row.
Materials and Reagents
50 ml conical tubes in styrofoam frack (Corning, Falcon®, catalog number: 352098 )
Weigh boats, small and medium (Dyn-A-Med Plus, catalog numbers: 80051 , 80056 )
150 mm Petri dishes (Corning, Falcon®, catalog number: 351058 )
PS-10 vials (AS ONE, catalog number: 9-892-12 )
Frosted slides (Matsunami Glass, catalog number: S024410 )
Single edge razors (FEATHER Safety Razor, catalog number: 99129 )
Paintbrush (Arteje Brush Camlon Pro, model 630 #3/0 Round)
Kimwipe
Paraformaldehyde (Merck, catalog number: 104005 )
Sodium phosphate dibasic (Na2HPO4) (Wako Pure Chemical Industries, catalog number: 197-09705 )
Sodium phosphate monobasic (NaH2PO4) (Wako Pure Chemical Industries, catalog number: 197-02865 )
Sucrose (Wako Pure Chemical Industries, catalog number: 190-00013 )
Gelatin (Wako Pure Chemical Industries, catalog number: 077-03155 )
H2O2 (Wako Pure Chemical Industries, catalog number: 081-04215 )
Triton X-100 (Bio-Rad Laboratories, catalog number: 1610407 )
Tween-20 (Bio-Rad Laboratories, catalog number: 1706531 )
Anti-tyrosine hydroxylase (Enzo Life Sciences, catalog number: BML-SA497-0100 )
Thionin (Alfa Aesar, catalog number: A18912 )
Standard ABC Peroxidase Kit (Vector Laboratories, catalog number: PK-4000 )
Metal Enhanced DAB Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 34065 )
Entellan new mounting medium (Merck, catalog number: 107961 )
Rabbit Anti-ChAT conjugated saporin (Advanced Targeting Systems, catalog number: IT-42 )
Mouse Anti-NeuN (Abcam, catalog number: ab104224 )
Goat Anti-ChAT (EMD Millipore, catalog number: AB144P )
Biotin conjugated Goat anti-rabbit IgG (Thermo Fisher Scientific, catalog number: B-2770 )
Biotin conjugated Goat anti-mouse IgG (Thermo Fisher Scientific, catalog number: B-2763 )
Biotin conjugated Rabbit anti-goat IgG (Thermo Fisher Scientific, catalog number: A10518 )
4% PFA/0.1 M PB (4% paraformaldehyde/0.1 M phosphate buffer, pH 7.4) (see Recipes)
0.1 M PB (0.1 M phosphate buffer, pH 7.4) (see Recipes)
30% sucrose 0.1 M phosphate buffer, pH 7.4 (see Recipes)
4% paraformaldehyde/10% sucrose in 0.1 M phosphate buffer, pH 7.4 (see Recipes)
0.05 M PB (0.05 M phosphate buffer, pH 7.4) (see Recipes)
30% sucrose 0.05 M phosphate buffer, pH 7.4 (see Recipes)
Blocking solution (see Recipes)
Antibody solution (see Recipes)
0.5% w/v gelatin in H2O (see Recipes)
Equipment
Rack for 50 ml conical tubes
Thermometer
Spoon spatula
Spin-plus 19 mm magnetic stir-bars (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F37144-0034 ) and magnetic spin-bar removal tool
2 x 500 ml beakers (DWK Life Sciences, Duran®, catalog number: 21 106 48 )
5 L liquid waste buckets for PFA/gel (AS ONE, catalog number: 4-5308-03 )
Bent forceps (Ideal-Tek, model: 650.S.6 )
Oven (SANYO, model number: MIR-162 )
Hot plate with magnetic stirring capability (IKA, model: C-MAG HS 7 )
Refrigerator (SANYO, model: MPR-414FR )
Fume hood
Vibratome (Leica Biosystems, model: Leica VT1000 S )
Upright light microscope (Olympus, model: CX22LED )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Liu, A. W., Aoki, S. and Wickens, J. R. (2017). A Streamlined Method for the Preparation of Gelatin Embedded Brains and Simplified Organization of Sections for Serial Reconstructions. Bio-protocol 7(22): e2610. DOI: 10.21769/BioProtoc.2610.
Aoki, S., Liu, A. W., Zucca, A., Zucca, S. and Wickens, J. R. (2015). Role of striatal cholinergic interneurons in set-shifting in the rat. J Neurosci 35(25): 9424-9431.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Synaptic physiology
Neuroscience > Neuroanatomy and circuitry > Animal model
Cell Biology > Cell imaging > Fixed-tissue imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,611 | https://bio-protocol.org/exchange/protocoldetail?id=2611&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation and Selection of Transgenic Olive Plants
EP Elena Palomo-Ríos
SC Sergio Cerezo
JM Jose Ángel Mercado
FP Fernando Pliego-Alfaro
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2611 Views: 8211
Edited by: Scott A M McAdam
Reviewed by: Moritz Bomer
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Olive (Olea europaea L.) is one of the most important oil crops in the Mediterranean basin. Biotechnological improvement of this species is hampered by the recalcitrant nature of olive tissue to regenerate in vitro. In previous investigations, our group has developed a reliable Agrobacterium-mediated transformation protocol using olive somatic embryos as explants (Torreblanca et al., 2010). Embryogenic cultures derived from radicles of matured zygotic embryos are infected with Agrobacterium tumefaciens, AGL1 strain, containing a binary plasmid with the gene of interest and the nptII selection gene. After a meticulous selection procedure, carried out using solid and liquid media supplemented with paromomycin, the putative transformed lines are established. A preliminary confirmation of their transgenic nature is carried out through PCR amplification. Afterwards, plants can be obtained through an efficient regeneration protocol, whose main characteristics are the use of a low-ionic-strength mineral formulation, a phase in liquid medium for synchronization of cultures and the use of semi-permeable cellulose acetate membranes for embryo maturation (Cerezo et al., 2011). Final confirmation of transgene insertion is carried out through Southern or Northern analysis using leaf samples of regenerated plants.
Keywords: Olea europaea Genetic transformation Agrobacterium tumefaciens Somatic embryogenesis
Background
The protocol developed by Torreblanca et al. (2010) differs from the previous olive transformation protocol, developed by Rugini et al. (2000), in several aspects; mainly, kind of explant, Agrobacterium strain and the selection method used. Rugini et al. (2000) used embryogenic masses as explants, which were incubated in a bacterial suspension of LBA4404 Agrobacterium strain for 48 h. After the infection, the explants were rinsed in water and cultured in embryogenic medium supplemented with 250 mg/L cefotaxime; however, the selection of transgenic embryos was not started until 30 days after the infection, with the addition of 100 mg/L kanamycin. To speed up the process, the explants were transferred to liquid medium in light, and the embryos which turned green were selected and cultured in isolation on solid multiplication medium with 150 mg/L kanamycin. Later on, the plant regeneration process was carried out without kanamycin. In contrast, Torreblanca et al. (2010) used globular somatic embryos as explants and the AGL1 Agrobacterium strain, with an incubation period of only 2 h and 2 days co-culture. Afterwards, the explants were transferred to selection medium with 200 mg/L paromomycin, and re-cultured onto fresh selection medium weekly during the first month and bi-weekly thereafter. In addition, a 3 weeks selection period in liquid medium supplemented with 50 mg/L paromomycin was included. The selection process and the use of somatic embryos as explants solved the problems of chimaeric transgenic embryos appearance, and higher transformation efficiencies were obtained. The protocol for olive plant regeneration published by Cerezo et al. (2011) improved whole plant recovery (shoots and roots) from 1.5% up to 50%. Both protocols together, have allowed the development of a reliable regeneration and transformation procedure in olive, recently used in flower induction studies (Haberman et al., 2017). Indeed, these protocols have been employed to analyze the effect of overexpression of MtFT1 gene in olive.
Materials and Reagents
Biological material
Embryogenic olive cultures, formed by callus and globular embryo structures of yellow-creamed colour
Agrobacterium tumefaciens AGL1 strain harbouring a binary vector, containing the gene of interest and the nptII selection gene
Chemicals and materials
Sterile filter paper cut 10 x 10 cm (Filtros Anois, FILTER-LAB®, catalog number: RM13054252 )
Petri plates (90 cm) (J. D. CATALAN, S. L.)
Mesh, 3 x 3 (ALBUS Suministros de Laboratorio)
Active charcoal (Sigma-Aldrich, catalog number: C9157 )
Assay tubes (25 x 150 mm) (Kimble Chase Life Science and Research Products, catalog number: 73500-20150 )
Dialysis tubing cellulose membrane (Sigma-Aldrich, catalog number: D9777-100FT )
Jiffystrips 5-50 peat pots square, 4.5 x 4.5 cm (Jiffy, catalog number: 110007 )
Plant pots (12.5 and 20 cm)
1:1 peat moss:perlite substrate (Projar professional)
Agrobacterium liquid growth medium (LB medium) (AppliChem, catalog number: 414753 )
10 mM magnesium sulphate (MgSO4) (AppliChem, catalog number: 131404 )
Antibiotics:
Paromomycin (Duchefa Biochemie, catalog number: P0141 )
Cefotaxime (PhytoTechnology Laboratories, catalog number: C380 )
Timentin (Duchefa Biochemie, catalog number: 011258 )
¼ OM (Cañas and Benbadis, 1988) macroelements
¼ MS (Murashige and Skoog, 1962) microelements
½ OM Vitamins
Myo-inositol (Sigma-Aldrich, catalog number: I5125 )
Sucrose (D(+)-Saccharose) (VWR, catalog number: 27478.467 )
L-Glutamine (Biowest, catalog number: P1012 )
Casein hydrolysate (N-Z-Amine® A) (Sigma-Aldrich, catalog number: C0626 )
Mannitol (Sigma-Aldrich, catalog number: M9647 )
Plant hormones:
N6-2-Isopentenyladenine (2iP) (Duchefa Biochemie, catalog number: D0934 )
N6-benzyladenine (BA) (Duchefa Biochemie, catalog number: B0904 )
Indole-3-butyric acid (IBA) (Sigma-Aldrich, catalog number: I5386 )
Zeatin riboside (ZR) (Duchefa Biochemie, catalog number: Z0917 )
Olive cyclic embryogenesis medium (ECO) (see Recipes)
Germination medium (see Recipes)
Shoot proliferation medium (see Recipes)
Plant rooting medium (see Recipes)
Equipment
Culture flasks (125 ml) (Nalgene)
Autoclave (JP SELECTA, model: Autester MOD 437-G )
Constant temperature/orbital shaker incubator (Optic Ivymen System)
Laminar flow hood (Telstar, model: BH-100 )
Laboratory centrifuge (Sigma Laborzentrifugen, model: 3K30 )
Spectrophotometer (JP SELECTA, model: UV-2005 )
Walk in plant growth cabinet with controlled light and temperature conditions
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Palomo-Ríos, E., Cerezo, S., Mercado, J. A. and Pliego-Alfaro, F. (2017). Generation and Selection of Transgenic Olive Plants. Bio-protocol 7(22): e2611. DOI: 10.21769/BioProtoc.2611.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Agrobacterium
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,612 | https://bio-protocol.org/exchange/protocoldetail?id=2612&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Engineered DNA-binding Molecule-mediated Chromatin Immunoprecipitation (in vitro enChIP) Using CRISPR Ribonucleoproteins in Combination with Next-generation Sequencing (in vitro enChIP-Seq) for the Identification of Chromosomal Interactions
Toshitsugu Fujita
Hodaka Fujii
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2612 Views: 8879
Edited by: Jihyun Kim
Reviewed by: Xiao LiKate Hannan
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
We have developed locus-specific chromatin immunoprecipitation (locus-specific ChIP) technologies consisting of insertional ChIP (iChIP) and engineered DNA-binding molecule-mediated ChIP (enChIP). Locus-specific ChIP is a method to isolate a genomic region of interest from cells while it also identifies what binds to this region using mass spectrometry (for protein) or next generation sequencing (for RNA or DNA) as described in Fujita et al. (2016a). Recently, we identified genomic regions that physically interact with a locus using an updated form of enChIP, in vitro enChIP, in combination with NGS (in vitro enChIP-Seq) (Fujita et al., 2017a). Here, we describe a protocol on in vitro enChIP to isolate a target locus for identification of genomic regions that physically interact with the locus.
Keywords: Chromatin immunoprecipitation ChIP locus-specific ChIP enChIP in vitro enChIP NGS in vitro enChIP-Seq
Background
Elucidation of molecular mechanisms underlining genome functions requires the identification of molecules that interact with the genomic region of interest in vivo. To this end, we have developed locus-specific chromatin immunoprecipitation (locus-specific ChIP) technologies consisting of insertional ChIP (iChIP) and engineered DNA-binding molecule-mediated ChIP (enChIP) (Fujita et al., 2016a). Locus-specific ChIP is a method to biochemically isolate a genomic region of interest from cells. Molecules interacting with that isolated genomic region are identified by biochemical analyses, such as mass spectrometry (MS) and next generation sequencing (NGS). In iChIP, an exogenous DNA-binding protein and its recognition DNA sequence are used for ‘in cell’ locus-tagging. In enChIP, engineered DNA-binding molecules, such as transcription activator-like (TAL) proteins and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), are used for ‘in cell’ locus-tagging. The tagged loci are isolated by affinity-purification. We recently developed in vitro enChIP, in which the locus-tagging was performed in vitro (in a test tube) using recombinant and/or synthetic engineered DNA-binding molecules (Figure 1) (Fujita and Fujii, 2014a and 2016b). Here, we describe a protocol of in vitro enChIP using CRISPR ribonucleoproteins (RNPs) followed by NGS (in vitro enChIP-Seq) for the identification of genomic regions that physically interact with the locus of interest (Fujita et al., 2017a).
Figure 1. Scheme of in vitro enChIP using CRISPR RNPs. Figure 1 reproduced under the Creative Commons Attribution License from: Fujita et al. Efficient sequence-specific isolation of DNA fragments and chromatin by in vitro enChIP technology using recombinant CRISPR ribonucleoproteins. Genes Cells. 2016; 21: 370-377.
Scheme of in vitro enChIP using CRISPR RNPs (Figure 1)
1. A nuclease-dead form of Cas9 (dCas9) fused to an epitope-tag(s) (e.g., 3xFLAG-dCas9) is prepared as a recombinant protein. Guide RNA (gRNA) that recognizes the DNA sequence of the genomic region of interest is generated chemically. As to gRNA, single gRNA (sgRNA) or a complex of CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) can be used.
2. Cells to be analyzed are crosslinked, if necessary, and lysed, and DNA is fragmented.
3. The 3xFLAG-dCas9/gRNA complex is incubated with the fragmented chromatin DNA in a test tube. The genomic DNA bound to the 3xFLAG-dCas9/gRNA complex is affinity-purified using antibody against the epitope-tag(s) or dCas9 itself. Alternatively, the complex can be purified using tags fused to gRNA (e.g., biotin). The isolated complexes retain molecules that interact with the target locus.
4. Reverse crosslinking, if necessary, and subsequent purification of DNA, RNA, or proteins allows identification and characterization of these molecules. For example, NGS or MS can be combined to identify genomic regions or proteins that physically bind to the target locus.
We previously described a detailed protocol of ‘in cell’ enChIP for the identification of proteins that interact with a locus of interest in Bio-protocol (Fujita and Fujii, 2014b). Procedures for the preparation of sonicated chromatin in in vitro enChIP are the same as those for ‘in cell’ enChIP. In addition, other procedures (e.g., preparation of Dynabeads) are similar between them. Therefore, we recommend to refer to the ‘in cell’ enChIP protocol (Fujita and Fujii, 2014b) in parallel.
Materials and Reagents
1.5 ml centrifuge tube (SARSTEDT, catalog number: 72.690.001 )
Pipettes tips (DNase/RNase-free)
DT40 cell (RIKEN BioResource Center) (an example)
10 µM crRNA (FASMAC, diluted in DNase/RNase-free water) (see step B1)
10 µM tracrRNA (FASMAC, diluted in DNase/RNase-free water) (see step B1)
3xFLAG-dCas9-D (Sysmex, ProCube)
37% formaldehyde (NACALAI TESQUE, catalog number: 16223-55 )
Anti-FLAG M2 antibody (Sigma-Aldrich, catalog number: F1804 )
Normal mouse IgG (Santa Cruz Biotechnology, catalog number: sc-2025 )
Dynabeads-Protein G (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10004D )
RNasin plus RNase inhibitor (Promega, catalog number: N261A )
10 mg/ml RNase A (Sigma-Aldrich, catalog number: R6513 )
10% SDS solution (NACALAI TESQUE, catalog number: 30562-04 )
20 mg/ml Proteinase K (Roche Diagnostics, catalog number: 3115828001 )
ChIP DNA Clean and Concentrator (ZYMO RESEARCH, catalog number: D5205 )
TruSeq ChIP Sample Prep Kit (Illumina, catalog number: IP-202-1012 )
Potassium chloride (KCl) (NACALAI TESQUE, catalog number: 28538-62 )
Dithiothreitol (DTT) (NACALAI TESQUE, catalog number: 14128-91 )
1 M HEPES (pH 7.1-7.5) (NACALAI TESQUE, catalog number: 17557-94 )
0.5 M ethylenediaminetetraacetate acid (EDTA) (pH 8.0) (NACALAI TESQUE, catalog number: 06894-85 )
1 M magnesium chloride hexahydrate (MgCl2·6H2O) (NACALAI TESQUE, catalog number: 20942-34 )
cOmplete, Mini, EDTA-free Protease Inhibitor (Roche Diagnostics, catalog number: 4693159001 )
UltraPure DNase/RNase-Free Distilled Water (DDW) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977015 )
10x phosphate buffered saline (PBS) (pH 7.4) (NACALAI TESQUE, catalog number: 27575-31 )
1x PBS (10x dilution of 10x PBS with distilled water)
Tween-20 (Sigma-Aldrich, catalog number: P5927 )
Note: This product has been discontinued.
BSA fraction V (7.5%) (Thermo Fisher Scientific, catalog number: 15260037 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9625 )
1 M Tris (pH 8.0) (AppliChem, catalog number: A4577 )
1 M Tris (pH 7.5) (AppliChem, catalog number: A4263 )
Polyethylene Glycol Mono-p-isooctylphenyl Ether (Triton X-100) (NACALAI TESQUE, catalog number: 12967-45 )
IGEPAL CA-630 (Sigma-Aldrich, catalog number: I8896 )
3xFLAG peptide (Sigma-Aldrich, catalog number: F4799 )
1 M KCl (see Recipes)
0.1 M DTT (see Recipes)
In vitro CRISPR buffer (+ 0.5 mM DTT) (see Recipes)
PBS-T (see Recipes)
PBS-T-BSA (see Recipes)
5 M NaCl (see Recipes)
Modified low salt buffer (+ 0.04% SDS) (see Recipes)
TBS (see Recipes)
TBS-IGEPAL CA-630 (see Recipes)
Elution buffer (see Recipes)
Equipment
Pipettes
Ultrasonic Disruptor (TOMY SEIKO, model: UD-201 )
Block heater (Eppendorf, catalog number: 5355 000.046 )
Magnetic stand (Magical Trapper) (TOYOBO, catalog number: MGS-101 )
Centrifuge (Eppendorf, catalog number: 5427 R )
Vortex mixer (Fisher Scientific, catalog number: 128101 )
Rotator (AS ONE, catalog number: TR-118 )
HiSeq 2500 system (Illumina, model: HiSeq 2500 System )
Software
Integrative Genomics Viewer, http://software.broadinstitute.org/software/igv/IGV
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fujita, T. and Fujii, H. (2017). In vitro Engineered DNA-binding Molecule-mediated Chromatin Immunoprecipitation (in vitro enChIP) Using CRISPR Ribonucleoproteins in Combination with Next-generation Sequencing (in vitro enChIP-Seq) for the Identification of Chromosomal Interactions. Bio-protocol 7(22): e2612. DOI: 10.21769/BioProtoc.2612.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,613 | https://bio-protocol.org/exchange/protocoldetail?id=2613&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Trypanosoma cruzi in Tissue and Trypanosoma cruzi Killing Assay
HK Hisako Kayama
SK Shoko Kitada
KT Kiyoshi Takeda
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2613 Views: 7267
Reviewed by: Alexandros Alexandratos
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
Infection with Trypanosoma cruzi causes Chagas disease. The methods provided here allow for the quantification of T. cruzi in the liver, heart, and blood of intraperitoneally-infected mice and analysis of the killing activity of the cells infected with T. cruzi in vitro.
Keywords: Trypanosoma cruzi Quantitative PCR Killing assay Mouse Heart Liver Blood Bone marrow-derived macrophage
Background
Chagas disease, characterized by chronic cardiomyopathy, is caused by infection with the intracellular protozoan parasite Trypanosoma cruzi (Bonney et al., 2015). Approximately 20 million people in Latin America suffer from Chagas disease (Ribeiro et al., 2012; Flavia Nardy et al., 2015), and it has become a global health issue owing to the migration of infected individuals (Andrade et al., 2014; Garcia et al., 2015; Requena-Mendez et al., 2015). Several drugs, such as nifurtimox and benznidazole, have been developed for treating Chagas disease. However, these drugs need to be taken for several months and severe side effects have been reported (Viotti et al., 2009). A major aim of treatment is to inhibit T. cruzi transmission via blood as well as prevent the development of heart failure. Thus, the protocol for quantification of T. cruzi and the T. cruzi killing assay presented here might aid the development of novel diagnostic methods and therapeutic strategies for Chagas disease.
Part I: Quantification of T. cruzi in tissue
The following protocol (Kitada et al., 2017) was partially modified from the previously described methods (Cencig et al., 2011; Caldas et al., 2012).
Materials and Reagents
Pipette tips (Labcon, catalog numbers: 1093-260-000 , 1045-260-000 , 1036-260-000 )
15 cm culture dishes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 150468 )
Blood collection tubes CAPIJECT (Terumo, catalog number: CJ-NA )
10 cm Petri dishes (Sansyo, catalog number: 36-3406 )
1.5 ml microtubes (FUKAEKASEI and WATSON, catalog number: 131-415C )
Disposal hemocytometer (All-Biz, catalog number: 4109:37650 )
8-week-old male and female C57BL/6 mice (Japan SLC)
LLC-MK2 cells (Rhesus monkey kidney epithelial cells) gifted by Professor S. Hamano (Institute of Tropical Medicine, Nagasaki University), which are also available at ATCC. Information regarding the LLC-MK2 cells is available at https://www.atcc.org/en/Products/Cells_and_Microorganisms/By_Tissue/Kidney/CCL-7.aspx#documentation
Trypanosoma cruzi Tulahuen strain (gifted by professor S. Hamano (Institute of Tropical medicine, Nagasaki University))
10 mg/ml Proteinase K (Merck, catalog number: 124568 )
Phenol:chloroform:isoamyl alcohol (25:24:1) (NACALAI TESQUE, catalog number: 25970-56 )
Chloroform (JUNSEI CHEMICAL, catalog number: 28560-0330 )
2-Propanol (JUNSEI CHEMICAL, catalog number: 64605-0330 )
70% ethanol (JUNSEI CHEMICAL, catalog number: 17065-0382 )
TE buffer solution (pH 8.0) (NACALAI TESQUE, catalog number: 32739-31 )
Go Taq qPCR Master Mix (Promega, catalog number: A6002 )
RPMI 1640 (NACALAI TESQUE, catalog number: 30264-56 )
Primers (Invitrogen custom DNA primers)
T. cruzi specific primers (Tc1), 5’-cgagctgttgcccacacgggtgct-3’ and 5’-cctccaagcagcggatagttcagg-3’ (Cencig et al., 2011); and TNF-α DNA primers, 5’-tccctctcatcagttctatggccca-3’ and 5’-cagcaagcatctatgcacttagacccc-3’ (Caldas et al., 2012)
Lysis buffer (see Recipes)
Tris-HCl (NACALAI TESQUE, catalog number: 35434-21 )
Ethylenediaminetetraacetate acid (EDTA) (NACALAI TESQUE, catalog number: 06894-14 )
Sodium dodecyl sulfate (SDS) (Wako Pure Chemical Industries, catalog number: 311-90271 )
Potassium chloride (NaCl) (JUNSEI CHEMICAL, catalog number: 19015-0350 )
RPMI 1640 culture medium (see Recipes)
Fetal bovine serum (CCB, catalog number: 171012 )
Penicillin/streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
2-Mercaptoethanol (Thermo Fisher Scientific, GibcoTM, catalog number: 21985023)
Equipment
Pipettes (Nichiryo, catalog numbers: 00-NPX2-1000 , 00-NPX2-200 , 00-NPX2-20 , 00-NPX2-2 )
Forceps (Hammacher, catalog number: HSC_553-11 )
Microbalance (Chyo Balance, model: JPN-200W )
Scissor (Fine Science Tools, catalog number: 91460-11 )
Shaking incubator (TAITEC, model: BR-43FM MR )
Centrifuge (TOMY SEIKO, model: MX-200 )
Vortex
Real-Time PCR thermal cycler: Step One PlusTM system Real-Time PCR System (Thermo Fisher Scientific, Applied BiosystemsTM, model: StepOnePlusTM, catalog number: 4376600 )
Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kayama, H., Kitada, S. and Takeda, K. (2017). Quantification of Trypanosoma cruzi in Tissue and Trypanosoma cruzi Killing Assay. Bio-protocol 7(22): e2613. DOI: 10.21769/BioProtoc.2613.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Killing assay
Immunology > Animal model > Mouse
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,614 | https://bio-protocol.org/exchange/protocoldetail?id=2614&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Affinity-directed Protein Missile (AdPROM) System for Targeted Destruction of Endogenous Proteins
Thomas J Macartney
GS Gopal P Sapkota
Luke J Fulcher
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2614 Views: 8665
Edited by: Jihyun Kim
Reviewed by: Amriti Rajender Lulla
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
We recently reported an Affinity-directed PROtein Missile (AdPROM) system for the targeted proteolysis of endogenous proteins of interest (POI) (Fulcher et al., 2016 and 2017). AdPROM consists of the Von Hippel Lindau (VHL) protein, a Cullin 2 E3 ligase substrate receptor (Bosu and Kipreos, 2008), conjugated to a high affinity polypeptide binder (such as a camelid nanobody) that recognises the target protein in cells. When introduced in cells, the target protein is recruited to the CUL2 E3 ubiquitin ligase complex for ubiquitin-mediated proteasomal degradation. For target protein recruitment, we have utilised both camelid-derived VHH domain nanobodies as well as synthetic polypeptide monobodies based on the human type III fibronectin domain (Sha et al., 2013; Fridy et al., 2014; Schmidt et al., 2016). In this protocol, we describe detailed methodology involved in generating AdPROM constructs and their application in human cell lines for target protein destruction. AdPROM allows functional characterisation of the POI and its efficiency of target protein destruction overcomes many limitations of RNA-interference approaches, which necessitate long treatments and are associated with off-target effects, and CRISPR/Cas9 gene editing, which is not always feasible.
Keywords: AdPROM Proteolysis VHL Cullin2 Ubiquitination Nanobody Monobody CRISPR/Cas9
Background
This protocol enables one to design, build and express AdPROM VHL-nano/monobody constructs in mammalian cell lines to achieve the proteolytic destruction of the endogenous POI. In the original entries, we demonstrated the near-complete destruction of specific target proteins, by using nanobodies that recognise either green fluorescent protein (GFP) (Fridy et al., 2014) or the inflammasomal protein ASC (Schmidt et al., 2016) and two distinct monobodies that recognize the protein tyrosine phosphatase SHP2 (Sha et al., 2013) as target probes, in a number of human cancer cell lines (Fulcher et al., 2016 and 2017). This protocol provides details for the generation of AdPROM constructs, their expression in cells, and monitoring of target protein degradation and can be adapted for use with any nanobody and monobody, both for constitutive and inducible degradation of the POI. The focus of this protocol is not on the generation of nano/monobodies against POIs or CRISPR/Cas9 genome editing (to knockin GFP tags on POIs) but rather the latter steps to facilitate target protein destruction with the AdPROM system.
Materials and Reagents
Pipette tips (10 µl, 200 µl, 1,000 µl, alpha gel loading tips) (Greiner Bio One International, catalog numbers: 771290; STARLAB INTERNATIONAL, catalog number: S1111-1006 ; Greiner Bio One International, catalog number: 740295 and Alpha Laboratories, catalog number: LW1100 respectively)
15 ml Falcons tube (Greiner Bio One International, catalog number: 188271 )
50 ml Falcon tube (Greiner Bio One International, catalog number: 227261 )
10-cm tissue culture dishes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 172931 )
Micro tubes (1.5 ml) (SARSTEDT, catalog number: 72.706.400 )
0.45 µm sterile syringe filters (Sartorius, catalog number: 16555-K )
0.22 µm sterile syringe filters (Sartorius, catalog number: 16532-K )
96-well plates for tissue culture (Greiner Bio One International, catalog number: 655101 )
Immobilon-®P PVDF membranes (Merck, catalog number: IPFL00005 )
10 ml plastic syringes (BD, BD Biosciences, catalog number: 302188 )
Sterile disposable scalpels (Swann Morton, catalog number: 0503 )
X-ray films (Konica Minolta, APLUS)
HEK-293 FT cells for retrovirus production (Thermo Fisher Scientific, InvitrogenTM, catalog number: R70007 )
Cell line of interest that expresses the target protein
Note: We used U2OS osteosarcoma, Human Embryonic kidney HEK-293, adenocarcinoma A549, and breast cancer MDA-MB-231 and MDA-MB-468 cells in the original entries (Fulcher et al., 2016 and 2017).
Cloning grade chemically competent DH5α cells (prepared in-house using a modified version of the Hanahan method (Sambrook and Russell, 2006))
pBABED (Dundee modified pBABE vector) Puro FLAG vectors containing controls and AdPROM reagents for retrovirus production
Note: These may be obtained from the MRCPPU http://mrcppureagents.dundee.ac.uk/reagent-catalogues (refer to AdPROM cloning procedure below for details).
pCMV-GAG/Pol (Cell Biolabs, catalog number: RV-111 )
pCMV-VSVG (Cell Biolabs, catalog number: RV-110 )
pRetroX-Tet-On Advanced system plasmids for Tet-inducible AdPROM expression (Takara Bio, Clontech, catalog number: 632104 )
Nano/monobody cDNA with flanking EcoRI/NotI sites (the sequences for the nano/monobodies constructs used in the original entries were obtained from the literature (Fulcher et al., 2016 and 2017))
Restriction enzymes (FastDigest)–BamHI, EcoRI, DpnI and NotI (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: FD0054 , FD0274 , FD1703 and FD0594 respectively)
Ultrapure agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500500 )
Sequencing oligos (0.025 nM, Desalted) (Sigma-Aldrich)
QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704 )
Rapid DNA Ligation Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: K1422 )
Ampicillin (ForMedium, catalog number: AMP25 )
QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27104 )
PureLinkTM HiPure Plasmid Filter Maxiprep Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: K210017 )
KOD Hot Start DNA polymerase (Merck, catalog number: 71086-3 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11960085 )
Foetal bovine serum (FBS) (Labtech, catalog number: FCS-SA/500 )
L-Glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030024 )
Penicillin/streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Opti-MEM (Thermo Fisher Scientific, GibcoTM, catalog number: 31985062 )
Cell culture grade trypsin (Thermo Fisher Scientific, GibcoTM, catalog number: 25300054 )
Polyethylenimine (PEI) (Polysciences, catalog number: 24765 )
HEPES (Sigma-Aldrich, catalog number: H4034 )
Polybrene (Sigma-Aldrich, catalog number: 107689 )
Puromycin (Sigma-Aldrich, catalog number: P9620 )
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190169 )
Non-fat dried milk powder (we use Marvel milk powder)
4-12% Bis/Tris gradient gels (Novex)
Primary antibody that recognises the POI
Note: We used in-house generated antibodies recognizing VPS34 and FAM83G in the first of the original entries (Fulcher et al., 2016). Both antibodies can be made available upon request or purchased from the MRC-PPU Reagents Website (http://mrcppureagents.dundee.ac.uk/reagent-catalogues). For the second original entry (Fulcher et al., 2017), we used anti-SHP2 (C-terminus (Cell Signaling Technology, catalog number: 3397 ); and N-terminus (Cell Signaling Technology, catalog number: 3752 )) and anti-ASC (Martin Oeggerli, Adipogen, catalog number: AL177 ) antibodies.
Primary antibodies that recognise GFP (an anti-GFP antibody from ChromoTek, catalog number: 3H9), and in-house generated anti-GFP antibody, which can be purchased from the MRC-PPU Reagents Website (http://mrcppureagents.dundee.ac.uk/reagent-catalogues)
Primary antibody that recognises VHL (Cell Signalling Technology, catalog number: 68547 )
Primary antibody that recognises a house keeping gene (loading control) (We use anti-GAPDH (Cell Signaling Technology, catalog number: 2118 ))
Bovine serum albumin (BSA) powder (Sigma-Aldrich, catalog number: A7906 )
Enhanced Chemiluminescence (ECL) reagent (GE Healthcare, catalog number: RPN2106 )
Secondary antibodies for primary antibody identification
Note: We use anti-sheep IgG-HRP (Santa Cruz Biotechnology, catalog number: sc-2770 ); and anti-rabbit IgG, HRP-linked (Cell Signaling Technology, catalog number: 7074 )
G418/Geneticin (Thermo Fisher Scientific, GibcoTM, catalog number: 10131035 )
Doxycycline (hydrochloride) (Sigma-Aldrich, catalog number: D3447 )
Orange G (Sigma-Aldrich, catalog number: O3756 )
Glycerol (VWR, catalog number: 24388.320 )
Ethylenediaminetetraacetic acid (EDTA) (ForMedium, catalog number: EDTA250 )
Tris (VWR, catalog number: 103157P )
Sucrose (VWR, catalog number: 27480.360 )
Sodium chloride (NaCl) (VWR, catalog number: 27810.364 )
Ethylene glycol-bis(β-aminoethyl ether)-N,N,N’,N’-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E3889 )
Sodium orthovanadate (Sigma-Aldrich, catalog number: 450243 )
β-Glycerophosphate (Sigma-Aldrich, catalog number: G9422 )
Sodium fluoride (Sigma-Aldrich, catalog number: S7920 )
Sodium pyrophosphate (Sigma-Aldrich, catalog number: P8010 )
Nonidet P-40 substitute (Sigma-Aldrich, catalog number: 74385 )
β-Mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Protease inhibitor cocktail tablet (Roche Diagnostics, catalog number: 11836170001 )
Glycine (VWR, catalog number: 10119CU )
Methanol (VWR, catalog number: 20847.307 )
Sodium dodecyl sulphate (SDS) (VWR, catalog number: 444464T )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Hydrochloric acid (HCl) for pH adjustment (VWR, catalog number: 20252.335 )
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
Gelatin (from porcine skin) (Sigma-Aldrich, catalog number: G2500 )
DNA loading buffer (see Recipes)
Lysis buffer (see Recipes)
Running buffer (10x) (see Recipes)
Transfer buffer (10x) (see Recipes)
Sample buffer (5x) (see Recipes)
TBS (10x) (see Recipes)
TBS-T (1x) (see Recipes)
TE buffer (pH 8.0) (see Recipes)
Equipment
Water baths 37 °C and 42 °C
Incubator/shaker 37 °C (Infors)
Desktop centrifuge (4 °C)
Desktop centrifuge (RT [room temperature])
500 ml Erlenmeyer flask
Thermocycler (Thermo Fisher Scientific, Applied Biosystems, model: ProFLEX PCR System )
Vortex (Scientific Industries, model: Vortex-Genie 2 )
Humidified incubator for cell culture
Sterile hood for tissue culture, suitable for category 2 work
Pipettes (P2, P20, P200, P1000)
Table-top heat block
Gel electrophoresis apparatus (Peqlab)
X-ray film developer
Autoclave
Nanodrop 1000 Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 1000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Macartney, T. J., Sapkota, G. P. and Fulcher, L. J. (2017). An Affinity-directed Protein Missile (AdPROM) System for Targeted Destruction of Endogenous Proteins. Bio-protocol 7(22): e2614. DOI: 10.21769/BioProtoc.2614.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Molecular biology technique
Molecular Biology > Protein > Targeted degradation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,615 | https://bio-protocol.org/exchange/protocoldetail?id=2615&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Design and Direct Assembly of Synthesized Uracil-containing Non-clonal DNA Fragments into Vectors by USERTM Cloning
MJ Morten Egevang Jørgensen
NW Nikolai Wulff
MN Majse Nafisi
DX Deyang Xu
CW Cuiwei Wang
SL Sophie Konstanze Lambertz
ZB Zeinu Mussa Belew
HN Hussam Hassan Nour-Eldin
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2615 Views: 9414
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
This protocol describes how to order and directly assemble uracil-containing non-clonal DNA fragments by uracil excision based cloning (USER cloning). The protocol was generated with the goal of making synthesized non-clonal DNA fragments directly compatible with USERTM cloning. The protocol is highly efficient and would be compatible with uracil-containing non-clonal DNA fragments obtained from any synthesizing company. The protocol drastically reduces time and handling between receiving the synthesized DNA fragments and transforming with vector and DNA fragment(s).
Keywords: USERTM cloning Cloning of synthesized non-clonal DNA fragments Fusion of DNA fragments Uracil excision based cloning uNCDFs Geneart
Background
For synthesized DNA, non-clonal linear DNA fragments (NCDF) have emerged as a cheaper and faster alternative to clonal fragments that are delivered sequenced and in a circular vector. NCDFs can be regarded as an IKEA solution to DNA synthesis where it is the customers that assemble their DNA fragments into a vector of choice and subsequently must verify the sequence of the final construct. In this protocol, we obtained uracil-containing NCDFs from Thermo Fisher Scientific Geneart, whose NCDFs are termed DNA strings. The uracil-containing NCDFs will here be named uNCDFs. In uNCDFs, uracils are inserted at designated positions during synthesis. We were able to clone uNCDFs directly into USER cloning compatible vectors by simply re-suspending the fragments in water, incubating them with linearized USER vector and USER enzyme (as described below) followed by transformation of E. coli. The procedure requires minimal handling, lasts less than 1 h from receipt to transformation and requires very small amounts of DNA. We have tested uNCDFs for almost a year in our laboratory and found them to perform consistently well. We recently cloned 13 transporter genes into a USER compatible Xenopus oocyte expression vector. Each gene fragment was obtained as a uNCDF (~2 kb in size). We tested a single colony for each cloning and found that 12 of the genes were inserted correctly into the pNB1u destination vector. For the last clone we found a single mutation which was correct in the second colony that we tested for that fragment (Jorgensen et al., 2017). The pNB1u vector is approximately 2.5 kb in size. In another project, we cloned a larger batch of uNCDFs composed of 64 fragments 1-2.4 kb in size into a variety of USER compatible vectors including the large (~10 kb) USER compatible pCambia based vectors (Nour-Eldin et al., 2006). Of these, 55 were correct after testing a single colony, 62 were correct after sequencing a second colony, while the remaining two were found in a correct form in the third colony (unpublished). We also used the protocol to seamlessly fuse three fragments together and insert them into a destination vector by USER fusion (Geu-Flores et al., 2007). Thus, we experienced high efficiency when cloning uNCDFs which was comparable to the efficiency of cloning uracil-containing DNA fragments generated via PCR. Moreover the uNCDFs were shown to work well for both small and large USER compatible vectors.
The innovation in this protocol is the ability to design and order synthesized DNA fragment containing uracils at appropriate locations. To appreciate the value of this advance and ensure an understanding of this cloning technique for researchers who have not used USER cloning previously, a brief introduction to USER cloning is given below.
The principle behind the efficiency of USER cloning lies in the ability to generate long, complementary overhangs. These overhangs can anneal to form stable hybridization products that can be used to transform E. coli without prior ligation. Most importantly, their generation is not dependent on the introduction of restriction sites. Hitherto, the generation of long single stranded overhangs has proceeded in two steps. First, a PCR reaction was performed on a DNA fragment of interest using primers containing a short 8-16 nt upstream extension that is preceded by a single deoxyuridine residue. The resulting PCR products are treated briefly with a commercial mix of uracil DNA glycosylase and DNA glycosylaselyase Endo VIII. These enzymes, are included in the USERTM enzyme mix, and remove the two single deoxyuridine residues and enable the dissociation of the short, single-stranded fragments lying upstream from the cleavage sites. For the generation of overhangs in a USER compatible destination vector, a short cassette is inserted into it so that digestion with a restriction- and a nicking enzyme creates the desired long overhangs. The fact that long, custom-made overhangs can be generated on PCR products can be exploited to generate a series of PCR products with complementary overhangs. This enables the generation of a hybridization product consisting of a vector and multiple PCR products, which can be fused into a compatible vector as easily as a single PCR product. For more detailed information on the cloning method, readers are referred to the following references on how to perform USER cloning and USER fusion (Nour-Eldin et al., 2006 and 2010; Geu-Flores et al., 2007). Additionally, bioinformatic tools have been developed to aid design of primers and strategy of USER cloning and fusion including the (Automated DNA Modifications with USER cloning) AMUSER web server tool for automated primer design (Genee et al., 2015) and an interactive lab simulation that teaches the principles of USER cloning (https://www.labster.com/simulations/user/). Finally, overlap design for USER fusion has recently been optimized (Cavaleiro et al., 2015).
Introducing uracils into DNA fragments was hitherto performed via PCR using uracil-containing primers. The PCR was performed after receiving the NCDF and required designing and ordering of appropriate uracil-containing primers. Incorporating uracils in DNA fragments during synthesis omits the need to design and order uracil-containing primers and also omits the need to perform a PCR reaction, this drastically reduces time and handling between receiving the synthesized DNA fragments and transforming with vector and DNA fragment(s).
Materials and Reagents
For ordering uracil-containing NCDFs
Sequence of DNA to be synthesized (optimized for desired organism)
Note: Depending on the fidelity of synthesis, any size of fragment is in principle suitable for synthesis. Until now the maximum size of NCDFs we have been able to order is 3 kb (varies depending on the company) and the fidelity in terms of how many colonies we had to sequence to find a correct clone has generally been 1-2.
Sequence of USER tails to be added for insertion into USER vector (for single gene insertion)
Sequence of USER overlaps for seamless USER fusion
Note: For insertion into USER compatible vectors, the USER tails are given by the USER cassette that has been inserted. Please consult the relevant publications. For USER fusion we typically use USER overlaps between 7-16 bp in length.
For linerarizing USER compatible vector
1.5 ml centrifuge tubes (Eppendorf tubes)
USER compatible vector (Nour-Eldin et al., 2006 and 2010; Geu-Flores et al., 2007)
PacI restriction enzyme (New England Biolabs, catalog number: R0547S )
Nt.BbvCI nicking enzyme (New England Biolabs, catalog number: R0632S )
Cutsmart buffer (included when ordering enzymes above)
H2O
PCR purification kit of choice (e.g., QIAquick PCR purification kit) (QIAGEN, catalog number: 28104 )
Note: For part B, follow protocol published previously (Nour-Eldin et al., 2010).
For cloning uNCDFs into linearized USER compatible vector
1.5 ml centrifuge tubes (Eppendorf tubes)
CaCl2 competent E. coli cells (DH5α or NEB10β or other common cloning strains)
Note: Do not perform transformation by electroshocking as the shock will cause the vector and uNCDF to dissociate.
uNCDFs from synthesis company (in this case from Thermo Fisher Scientific Geneart)
Note: Despite their success, uNCDFs are not yet offered officially by Geneart. Please contact e.g., Anja Martinez at Thermofisher Geneart ([email protected]) or us for ordering questions.
H2O
Linearized USER compatible vector
Note: A long list of vectors has been made USER cloning compatible for almost all organisms. Search within these three papers (Nour-Eldin et al., 2006 and 2010; Geu-Flores et al., 2007) and the many papers citing them. Please note, we are currently in the process of gathering USER vectors from groups from all over the world in order to deposit them at Addgene for easy accessibility.
USER enzyme (New England Biolabs, catalog number: M5505S )
5x or 10x PCR buffer (any kind)
Equipment
37 °C heat block
42 °C heat block/water bath
Procedure
Design and order uracil-containing NCDFs for single fragment USER cloning
For cloning single uNCDFs into USER compatible vectors that have been generated by our lab, our generic 5’ and 3’ user tails are added to termini of the fragment to be inserted (5’ USER tail: 5’-GGCTTAAU, 3’ USER tail: 5’-GGTTTAAU) (for inserting into other USER compatible vectors please use the corresponding USER tails). When ordering synthesized DNA we typically codon optimize the sequence for the organism wherein the gene will be expressed. In an example below, we show how we ordered the gene AT1G15210 as a uNCDF from Thermo Fisher Scientific Geneart. As instructed by Geneart, we provided them with a word file containing sequences to be synthesized in FASTA format. At the beginning of the word document, we included general instructions to the synthesis company, which are given in italics below
Dear synthesis company:
Green marks a T in the top strand that must be replaced by a U. Turquoise marks an A, which is complementary to a T on the opposite strand that must be replaced by a U (i.e., it is the T on the opposite strand that must be replaced by a uracil). Yellow marks sequence that may not be altered. Non-marked sequence represents coding sequence, which may be changed to overcome synthesis challenges. The gene will be expressed in Xenopus laevis oocytes. Please use the appropriate codon preference table for codon optimization and alternations.
Note: Punctuation marks approx. 2 kb of sequence that was included in the order but which has been omitted here for brevity. In this example, yellow sequence represents our standard 5’ and 3’ USER tails.
Cloning single uNCDFs into linearized USER compatible vector
Figure 1. Overview of the USER cloning technique. A USER cassette in a USER-compatible vector (upper left corner) with a restriction site (PacI, light blue) in the middle, one variable nt surrounding it (different for each side, yellow and green), and oppositely oriented nicking sites (Nt.BbvCI, tan). The USER vector is digested with PacI and Nt.BbvCI to generate 8 nt overhangs. A DNA fragment (upper right corner) with uracils at appropriate positions can be generated by PCR as described previously or via synthesis as a uNCDF as described here. Fragment and vector are mixed with USERTM enzyme mix (excising deoxyuridines, pink) and the digested USER-compatible vector. Following brief incubation, the hybridized product can be used to transform E. coli without prior ligation. This figure has been reproduced with permission from (Nour-Eldin et al., 2006).
Each fragment is to be surrounded by USER tails that enable insertion into a USER compatible vector. In this example, we use our X. laevis expression vector pNB1u (Nour-Eldin et al., 2006). uNCDFs are mixed directly with the digested pNB1u vector without prior PCR amplification (Figure1).
Dilute each uNCDF to 100 ng/μl in H2O (or TE buffer pH 8).
The USER-compatible pNB1u X. laevis oocyte expression vector is digested with PacI/Nt.BbvCI overnight, PCR purified and diluted to a concentration of ~50 ng/μl (as previously described [Nour-Eldin et al., 2006 and 2010]).
Note: If a USER compatible vector is not available, it is possible to generate them via PCR. In that case, the vector backbone is treated as a DNA fragment to be assembled with DNA fragment of interest via USER fusion (please see below).
For the USER reaction, mix 100 ng uNCDF with 50 ng digested pNB1u, 1 U USER enzyme (NEB), 2 µl 5x PCR reaction buffer and 5 µl H2O.
Incubate the reaction at 37 °C for 25 min, and then for 25 min at room temperature.
Transform 50 µl chemically competent E. coli cells with the reaction mixture by heat shock (5 min on ice, 30-45 sec at 42 °C and 5 min on ice).
Plate the transformation mixture on LB-plates containing appropriate antibiotic selection (for pNB1u we use carbenicillin or ampicilin–containing LB plates).
Select three colonies from the plates and grow overnight. Extract plasmids and analyze the extracted plasmids by gel-electrophoresis. Sequence the plasmids with an insert.
Design and order uracil-containing NCDFs for USER fusion of multiple fragments
For fusion of multiple uNCDFs into USER compatible vectors overlap regions have to be selected and included in adjacent fragments. Overlap regions are selected as previously described by finding a T on the bottom strand and a T on the top strand 7-15 bases downstream of the first T. The pair of selected Ts should be within 20-30 bases distance to the junction site (Figure 2) (Geu-Flores et al., 2007; Nour-Eldin et al., 2010). These Ts will be the ones replaced by a U during synthesis. For insertion into the USER compatible vector, our generic 5’ and 3’ user tails are added to the terminal fragments. When ordering synthesized DNA we typically codon optimize the sequence for the organism wherein the gene will be expressed. In an example below, we show how we designed and ordered three fragments to be fused and inserted into a USER compatible vector by USER cloning. The full-length sequence (~7,200 bp) was split into three fragments (FAS1_A, FAS1_B and FAS1_C). The sequence of their termini is given below. In each fragment, the punctuation in the middle denotes approximately 2 kb of sequence, which was included in the order but has been omitted here for brevity. Each fragment was designed to include overlap regions to the adjacent fragment close to the junction sites. Please see below and see (Geu-Flores et al., 2007; Nour-Eldin et al., 2010) for more detailed information on how to design USER fusion overlap regions. Alternatively, the Amuser web server tool can deisgn overlap regions for any USER fusion approach (Genee et al., 2015). As instructed by Geneart we provided them with a Word file containing sequences to be synthesized in FASTA format. At the beginning of the Word document, we included general instructions to the synthesis company, which are given in italics below.
Dear synthesis company:
Green marks a T in the top strand that must be replaced by a U. Turquoise marks an A, which is complementary to a T on the opposite strand that must be replaced by a U (i.e., it is the T on the opposite strand that must be replaced by a uracil). No alterations are allowed in any color shaded sequence. Non-marked sequence represents coding sequence, which may be changed to overcome synthesis challenges. The genes will be expressed in Xenopus laevis oocytes. Please use the appropriate codon preference table for codon optimization and alternations.
Note: Only the sense strand is included in the ordering process but the result is a uracil-containing double stranded fragment. No alterations are allowed in any colored region during the codon optimization process. Yellow marks our standard 5’ USER tail. Green marks the T, which must be synthesized as U. Turquoise marks the A, whose complimentary T must be synthesized as U. Grey marks the overlap which will be exposed as a single stranded fragment upon USER treatment and which will hybridize to the complimentary single stranded overhang on the adjacent fragment (in this case FAS1_B). Once synthesized, the double stranded FAS1_A uNCDF will look as follows:
Upon treatment with USER enzyme the double stranded FAS1_A uNCDF will loose sequences lying upstream of the uracils and look as follows:
As for FAS1_A only the sense strand is included in the ordering process. Green marks the T, which must be synthesized as U. Turquoise marks the A, whose complimentary T must be synthesized as U. Grey marks the overlaps which will be exposed as single stranded overhangs upon USER treatment and which will hybridize to the complimentary single stranded overhangs on the adjacent fragments (in this case the left ‘grey’ will hybridize to the overhang generated on FAS1_A, whereas the right ‘grey’ will hybridize to the overhang generated on FAS1_C). Once synthesized, the double stranded FAS1_B uNCDF will look as follows:
Upon treatment with USER enzyme the double stranded FAS1_B uNCDF will loose sequences lying upstream of the uracils and look as follows:
As for FAS1_A only the sense strand is included in the ordering process. Green marks the T, which must be synthesized as U. Turquoise marks the A, whose complimentary T must be synthesized as U. Grey marks the overlap, which will be exposed as single stranded overhang upon USER treatment and which will hybridize to the complimentary single stranded overhangs on the adjacent fragment (in this case the rightmost ‘grey’ overlap region on FAS1_B). Once synthesized, the double stranded FAS1_B uNCDF will look as follows:
Upon treatment with USER enzyme the double stranded FAS1_C uNCDF will loose sequences lying upstream of the uracils and look as follows:
Fusion and clone of multiple uNCDFs into linearized USER compatible vector
Figure 2. Overview of the USER fusion technique. Fragments X1, X2, and X3 are to be fused together. Overlap regions are marked in grey. Uracils can be inserted via PCR or as described here during synthesis. The DNA fragments are mixed with a pre-digested USER-compatible vector and treated with the deoxyuridine-excising USERTM enzyme mix. This generated 3’ overhangs that complement each other (indicated by arrows), while the outermost ones complemented the overhangs of the pre-digested vector. This design enables the formation of a stable circular hybridization product that can be transformed directly into E. coli without prior ligation. This figure has been reproduced with permission from (Geu-Flores et al., 2007).
For fusing and cloning multiple uNCDFs into USER compatible vectors that have been generated by our lab, our generic 8 bp long 5’ and 3’ user tails are added to termini of the terminal fragments. At junction sites uracil-containing overlaps were included to allow seamless fusion upon mixing. When possible we strive to choose fusion overlaps of different lengths and composition to minimize mis-hybridization between fragments. In this example, we fuse and clone three fragments into our X. laevis expression vector pNB1u (Nour-Eldin et al., 2006). Each fragment contained a uracil at the appropriate location in each USER tail. The uracil was incorporated during synthesis. Thus, uNCDFs are mixed in equimolar ratios directly with the digested pNB1u vector without prior PCR amplification with uracil-containing primers.
Dilute each uNCDFs to 50 ng/µl in H2O.
The USER-compatible pNB1u X. laevis oocyte expression vector is digested with PacI/Nt.BbvCI overnight, PCR purified and diluted to a concentration of ~50 ng/µl (as previously described (Nour-Eldin et al., 2006 and 2010)).
For the USER reaction, mix 100 ng of each uNCDFs with 50 ng digested pNB1u, 1 U USER enzyme (NEB), 2 µl 5x PCR reaction buffer and H2O to bring the total volume to 10 µl.
Incubate the reaction at 37 °C for 25 min, and then for 25 min at room temperature.
Transform 50 µl chemically competent E. coli cells (for example NEB10β by heat shock) with the reaction mixture (5 min on ice, 30-45 sec at 42 °C and 5 min on ice).
Note: Typically the volume of added USER reaction mixture should not exceed 10% of the competent E. coli volume (i.e., max 5 µl reaction mixture to 50 µl E. coli volume, 10 µl reaction mixture to 100 µl E. coli volume etc. Exceeding this ration can reduce transformation efficiency.
Plate the transformation mixture on LB-plates containing appropriate antibiotic selection (for pNB1u we used carbenicillin–containing LB plates).
Select eight colonies from the plates and grow overnight. Extract plasmids and analyze the extracted plasmids by gel-electrophoresis. Sequence the plasmids with an insert.
Notes
If insertion does not succeed in the first trial, we encourage users–in addition to the USER cloning–to clone the uNCDFs into a blunt-ended cloning vector (such as pJET) for safekeeping and future work.
Acknowledgments
MEJ is supported by a grant from the Danish Council for Independent Research: DFF–6108-00122. DX, AP, CW, DV, SKL and HHN were funded by DNRF99 grant from the Danish National Research Foundation. ZNB was funded by Innovationfund Denmark J.nr.: 76-2014-3 and NW was funded by Human Frontier Science Program RGY0075/2015. The authors declare no conflicts of or competing interest.
References
Cavaleiro, A. M., Kim, S. H., Seppala, S., Nielsen, M. T. and Norholm, M. H. (2015). Accurate DNA assembly and genome engineering with optimized uracil excision cloning. ACS Synth Biol 4(9): 1042-1046.
Genee, H. J., Bonde, M. T., Bagger, F. O., Jespersen, J. B., Sommer, M. O., Wernersson, R. and Olsen, L. R. (2015). Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly. ACS Synth Biol 4(3): 342-349.
Geu-Flores, F., Nour-Eldin, H. H., Nielsen, M. T. and Halkier, B. A. (2007). USER fusion: a rapid and efficient method for simultaneous fusion and cloning of multiple PCR products. Nucleic Acids Res 35(7): e55.
Jorgensen, M. E., Xu, D., Crocoll, C., Ramirez, D., Motawia, M. S., Olsen, C. E., Nour-Eldin, H. H. and Halkier, B. A. (2017). Origin and evolution of transporter substrate specificity within the NPF family. Elife 6: e19466.
Nour-Eldin, H. H., Geu-Flores, F. and Halkier, B. A. (2010). USER cloning and USER fusion: the ideal cloning techniques for small and big laboratories. Methods Mol Biol 643: 185-200.
Nour-Eldin, H. H., Hansen, B. G., Norholm, M. H., Jensen, J. K. and Halkier, B. A. (2006). Advancing uracil-excision based cloning towards an ideal technique for cloning PCR fragments. Nucleic Acids Res 34(18): e122.
Copyright: Jørgensen et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Jørgensen, M. E., Wulff, N., Nafisi, M., Xu, D., Wang, C., Lambertz, S. K., Belew, Z. M. and Nour-Eldin, H. H. (2017). Design and Direct Assembly of Synthesized Uracil-containing Non-clonal DNA Fragments into Vectors by USERTM Cloning. Bio-protocol 7(22): e2615. DOI: 10.21769/BioProtoc.2615.
Jorgensen, M. E., Xu, D., Crocoll, C., Ramirez, D., Motawia, M. S., Olsen, C. E., Nour-Eldin, H. H. and Halkier, B. A. (2017). Origin and evolution of transporter substrate specificity within the NPF family. Elife 6.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,616 | https://bio-protocol.org/exchange/protocoldetail?id=2616&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell-free Fluorescent Intra-Golgi Retrograde Vesicle Trafficking Assay
NC Nathanael P. Cottam
DU Daniel Ungar
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2616 Views: 7308
Edited by: Jia Li
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Intra-Golgi retrograde vesicle transport is used to traffic and sort resident Golgi enzymes to their appropriate cisternal locations. An assay was established to investigate the molecular details of vesicle targeting in a cell-free system. Stable cell lines were generated in which the trans-Golgi enzyme galactosyltransferase (GalT) was tagged with either CFP or YFP. Given that GalT is recycled to the cisterna where it is located at steady state, GalT-containing vesicles target GalT-containing cisternal membranes. Golgi membranes were therefore isolated from GalT-CFP expressing cells, while vesicles were prepared from GalT-YFP expressing ones. Incubating CFP-labelled Golgi with YFP-labelled vesicles in the presence of cytosol and an energy regeneration mixture at 37 °C produced a significant increase in CFP-YFP co-localization upon fluorescent imaging of the mixture compared to incubation on ice. The assay was validated to require energy, proteins and physiologically important trafficking components such as Rab GTPases and the conserved oligomeric Golgi tethering complex. This assay is useful for the investigation of both physiological and pathological changes that affect the Golgi trafficking machinery, in particular, vesicle tethering.
Keywords: Golgi apparatus Fluorescent imaging Galactosyltransferase Vesicle trafficking Vesicle tethering Conserved oligomeric Golgi complex
Background
The molecular mechanisms of intracellular vesicle targeting are important to decipher to understand processes as diverse as glycosylation homeostasis, neurotransmitter release, regulation of signaling receptors and nutrient uptake (Ungar and Hughson, 2003; Fisher and Ungar, 2016). The Golgi apparatus is an excellent test case, as it maintains a network of target compartments, called cisternae, that require the specific delivery of different vesicles (Cottam and Ungar, 2012). The Golgi can also be isolated in a functional form retaining its ability for vesicle transport (Balch et al., 1984). Fluorescent labelling of vesicles and target cisternae offers a direct readout of vesicle targeting by measuring the co-localization of the two membrane fractions following a cell-free incubation. This type of measurement has some caveats. The size of vesicles is below the resolution limit of conventional microscopy, and there are only single fluorophores in the majority of the vesicles (C. Baumann and D. Ungar, University of York, unpublished data). This means that very high quality optics and sensitive detection has to be combined with automated exposure control during microscopy to avoid photobleaching, and sophisticated image processing to obtain images that are free of noise.
The assay was set up to investigate the molecular requirements of vesicle tethering at the trans-Golgi (Cottam et al., 2014). Accordingly, it was found to be dependent on functional Rab GTPases (Rabs), as the protein Rab-GDI, which extracts Rabs from membranes (Soldati et al., 1993), was found to inhibit the signal (Cottam et al., 2014). Moreover, the assay was sensitive to various defects of the conserved oligomeric Golgi (COG) tethering complex. Cytosol is an essential component of the assay mixture for obtaining activity, and when used from cells harboring patient-derived COG mutations (Wu et al., 2004; Luebbehusen et al., 2010), it inhibited the assay signal (Cottam et al., 2014). Moreover, the assay was able to differentiate the contributions to retrograde trafficking of two different COG mutants (Cog1- and Cog2-null mutations, Cottam et al., 2014), which have essentially identical cellular phenotypes in CHO cells (Kingsley et al., 1986).
Materials and Reagents
Microscope slides and coverslips (purchased from Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: MNJ-400-030Y and MNJ-100-030J )
Note: The quality of the slides and coverslips is critical, the mentioned product does work, if others are to be used it is advised to test these.
Silica beads (5 micron silica beads) (Bangs Laboratories, catalog number: SS06N )
0.5 ml and 1.5 ml microfuge tubes, 0.2 ml PCR tubes
T175 flasks (each 175 cm2) (Corning BV Life Sciences, Amsterdam, the Netherlands)
10 ml serological pipette
PD-10 desalting column (GE Healthcare, Buckinghamshire, UK)
Wild type HEK293 cells
HEK293 cells stably expressing CFP/YFP-GalT
Water
Note: Molecular biology grade water was used for all procedures, including the washing of microscope slides and coverslips.
Detergent decon90 (Decon Laboratories Limited, Sussex, UK)
Potassium chloride (KCl)
Geneticin (GibcoTM)
Dulbecco’s Modified Eagle Medium (DMEM, high glucose, pyruvate, no glutamine) (Thermo Fisher Scientific, GibcoTM, catalog number: 21969 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 12657029 )
GlutaMAX-I (an L-alanyl-L-glutamine dipeptide substitute for L-glutamine) (Thermo Fisher Scientific, GibcoTM, catalog number: A12860-01 )
Penicillin-streptomycin (10,000 U/ml; 100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Ham’s F-12 Nutrient Mix (Sigma-Aldrich, catalog number: N4888 )
Liquid nitrogen
Tris
Optiprep density gradient media (Axis-Shield PoC) (Cosmo Bio, catalog number: AXS-1114542 )
α-HA antibody (monoclonal anti-HA.11) (BioLegend, catalog number: 901513 )
Dithiothreitol (DTT)
Golgi membranes, vesicles, cytosol (see preparation of working aliquots under Recipes)
Sucrose (Fisher Scientific, catalog number: S/8600/60 )
HEPES
Creatine phosphokinase
GTP
ATP
Creatine phosphate
Potassium hydroxide (KOH)
Magnesium acetate (Mg(OAc)2)
Magnesium chloride (MgCl2)
Trypsin, 2.5% (10x) (Thermo Fisher Scientific, GibcoTM, catalog number: 15090046 )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Buffers (see Recipes)
Assay sucrose
ATP/GTP mixture (10x)
Cytosol buffer
HM buffer
KHM buffer
Reaction buffer (10x)
Trypsin-PBS buffer
Note: All reagents and buffers should be stored in convenient sized aliquots at -80 °C. When running low on critical aliquots (membranes, cytosol, ATP/GTP mixture), prepare a new set and test it against the old ones to ensure reproducibility.
Equipment
Microwave oven
Water bath
Sonicating water bath (Grant Instruments, model number: XUBA3 )
Incubator
1 ml Dounce homogenizer (DWK Life Sciences, Wheaton, catalog number: 357538 )
Centrifuge
Ultracentrifuge
SW41 rotor (Beckman Coulter, model: SW 41 Ti ) and 13.2 ml thinwall ultra-clearTM tubes (Beckman Coulter, catalog number: 344059 )
Sugar refractometer (range 0-50%) (Bellingham and Stanley Ltd, UK)
TLA 100.3 rotor (Beckman Coulter, model: TLA-100.3 ) and 3.5 ml thickwall polycarbonate tubes (Beckman Coulter, catalog number: 349622 )
TLS-55 rotor (Beckman Coulter, model: TLS-55 ) and 2.2 ml thinwall ultra-clearTM tubes (Beckman Coulter, catalog number: 347356 )
Standard mammalian cell culture apparatus
Evolve 512 EMCCD (electron multiplying charged coupled device) Camera (Photometrics, model: Evolve® 512 )
Zeiss Axiovert 200M fully motorized inverted microscope (Carl Zeiss, model: Axiovert 200M )
X-Cite 120Q excitation light source (Excelitas Technologies, model: X-Cite 120Q )
CFP filter (Chroma Technology, catalog number: 49001 )
YFP filter (Chroma Technology, catalog number: 49003 )
Objective lens (Zeiss Plan-Apochromat 63x/1.40 Oil DIC, Carl Zeiss Ltd, Cambridge, UK)
Black card to exclude room light from samples during imaging
Software
ZEN 2009 software (www.zeiss.com)
PM Capture Pro software (http://www.photometrics.com)
AutoHotkey (www.autohotkey.com) (AutoHotkey Foundation LLC)
ImageJ (https://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cottam, N. P. and Ungar, D. (2017). Cell-free Fluorescent Intra-Golgi Retrograde Vesicle Trafficking Assay. Bio-protocol 7(22): e2616. DOI: 10.21769/BioProtoc.2616.
Download Citation in RIS Format
Category
Biochemistry > Protein > Activity
Cell Biology > Organelle isolation > Golgi
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,617 | https://bio-protocol.org/exchange/protocoldetail?id=2617&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection
AM Adam Martin
ER Emily A. Rex
TI Takao Ishidate
RL Rueyling Lin
DG Don B. Gammon
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2617 Views: 7753
Edited by: Peichuan Zhang
Reviewed by: Suprabhat Mukherjee
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Over the past 15 years, the free-living nematode, Caenorhabditis elegans has become an important model system for exploring eukaryotic innate immunity to bacterial and fungal pathogens. More recently, infection models using either natural or non-natural nematode viruses have also been established in C. elegans. These models offer new opportunities to use the nematode to understand eukaryotic antiviral defense mechanisms. Here we report protocols for the infection of C. elegans with a non-natural viral pathogen, vesicular stomatitis virus (VSV) through microinjection. We also describe how recombinant VSV strains encoding fluorescent or luciferase reporter genes can be used in conjunction with simple fluorescence-, survival-, and luminescence-based assays to identify host genetic backgrounds with differential susceptibilities to virus infection.
Keywords: Vesicular stomatitis virus Virus-host interactions C. elegans Microinjection
Background
Given its genetic tractability, small size, inexpensive culture, and transparent body, the free-living nematode Caenorhabditis elegans offers many advantages as a model organism. Furthermore, the susceptibility of C. elegans to a wide range of human bacterial and fungal pathogens has made the worm an attractive system for studying microbial pathogenesis (Zhang and Hou, 2013; Cohen and Troemel, 2015). More recently, the discovery of the positive-sense ssRNA Orsay virus (OV) as the first natural viral pathogen of C. elegans has prompted the use of the OV-C. elegans model to define nematode antiviral defense mechanisms (Felix et al., 2011; Gammon, 2017). These studies have demonstrated a clear role for nematode antiviral RNA interference pathway components, such as Dicer-related helicase 1 (DRH-1), in the restriction of virus replication (Ashe et al., 2013).
To complement the OV model system, we recently reported the generation of a new virus-C. elegans model that uses the negative-sense, ssRNA vesicular stomatitis virus (VSV) (Gammon et al., 2017). Infection of wild-type (N2) worms with VSV is lethal although mutants defective in antiviral responses (e.g., drh-1 mutants) succumb to infection more rapidly (Gammon et al., 2017). Therefore, one can use lifespan assays as a convenient phenotypic readout when comparing different worm backgrounds for virus susceptibilities. Furthermore, the use of recombinant VSV strains encoding fluorescent reporters facilitates the scoring and tracking of infection in C. elegans tissues in real-time (Gammon et al., 2017). In addition, infection of worms with firefly luciferase-encoding VSV recombinants allows one to score virus replication using simple and quantitative luminescence assays (Gammon et al., 2017). Finally, the current study of VSV in a broad range of other model organisms (e.g., Drosophila, mice, etc.) provides the opportunity to examine VSV interactions with multiple invertebrate and vertebrate hosts. Here we describe how to establish VSV infection in C. elegans and use simple fluorescence and luminescence-based assays to track infection with the goal of uncovering nematode genetic backgrounds with differential susceptibilities to infection.
Materials and Reagents
Personal protective equipment (gloves, lab coat, eye protection)
Tissue culture dish, 150 x 25 mm (Corning, catalog number: 430599 )
50 ml conical tubes (Corning, catalog number: 431472 )
Tissue culture dish, 6-well (Corning, catalog number: 3516 )
9” disposable borosilicate glass Pasteur pipets (Fisher Scientific, catalog number: 13-678-20C )
FisherfinestTM Premium cover glasses (50 x 35 mm) (Fisher Scientific, catalog number: 12-548-5R )
Glass needle, single capillary, 1.2 mm x 4 in. (102 mm) (World Precision Instruments, catalog number: 1B120F4 )
Kimwipes (KCWW, Kimberly-Clark, catalog number: 34155 )
Beckman Ultra-Clear ultracentrifuge tubes (Beckman Coulter, catalog number: 344058 )
Eppendorf MicroloaderTM 20 µl pipette tips (Eppendorf, catalog number: 930001007 )
1.5 ml tube (VWR, catalog number: 20170-333 )
96-well plates (Corning, catalog number: 3915 )
Modeling clay (Nasco, catalog number: 0300257M )
C. elegans N2 strain (Caenorhabditis Genetics Center)
Recombinant vesicular stomatitis virus encoding fluorescent marker gene [e.g., VSV-dsRED (Duntsch et al., 2004)] and/or firefly luciferase [e.g., VSV-LUC (Cureton et al., 2009)]
Bacterial Escherichia coli strain OP50 (Caenorhabditis Genetics Center)
Baby Hamster Kidney (BHK-21) cell line (ATCC, catalog number: CCL-10 )
Vero cell line (ATCC, catalog number: CCL-81 ) or BSC-40 cell line (ATCC, catalog number: CRL-2761 )
Methyl cellulose (Sigma-Aldrich, catalog number: 19-2930 )
Crystal violet staining solution (Yamada and Takaoka, 2017)
Crystal violet (Sigma-Aldrich, catalog number: C6158 )
Agarose (Fisher Scientific, catalog number: BP160-500 )
Microinjection oil (Series 700 Halocarbon oil) (Sigma-Aldrich, catalog number: H8898 )
Reporter lysis buffer 5x (Promega, catalog number: E3971 )
Luciferase Assay Reagent (Promega, catalog number: E1483 )
6.0% sodium hypochlorite solution (Fisher Scientific, catalog number: SS290 )
Potassium hydroxide pellets (KOH) (Fisher Scientific, catalog number: P250 )
Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich, catalog number: D6429 )
Fetal bovine serum (FBS) (Atlanta Biologicals, catalog number: S12450 )
Antibiotic-antimycotic solution, 100x (Sigma-Aldrich, catalog number: A5955 )
L-Glutamine, 100x (Mediatech, catalog number: 25-005-CI )
MEM nonessential amino acids (Mediatech, catalog number: 25-025-CI )
NGM plates (He, 2011a)
5-Fluorodeoxyuridine (FUdR) (Sigma-Aldrich, catalog number: F0503 )
50% (w/v) polyethylene-glycol (PEG) 3000 (Rigaku Reagents, catalog number: 1008056 )
M9 buffer (He, 2011a)
Acetic acid (Fisher Scientific, catalog number: A38 )
Methanol (PHARMCO-AAPER, catalog number: 339000000 )
Formaldehyde (Fisher Scientific, catalog number: BP531-500 )
Fixation solution (Yamada and Takaoka, 2017)
Bleach solution (see Recipes)
Complete DMEM (see Recipes)
NGM + [50 µg/ml] FUdR Plates (see Recipes)
M-PEG (see Recipes)
Equipment
37 °C cell culture incubator with 5% CO2 (Eppendorf, model: Galaxy® 170 S )
Type 2 Biosafety cabinet (NuAire, model: NU-425-400 )
Refrigerated benchtop centrifuge (e.g., Eppendorf, model: 5810 R ) with swinging bucket rotor capable of holding 50 ml conical tubes (e.g., Eppendorf, model: A-4-62 )
Ultracentrifuge (e.g., Beckman Coulter, model: OptimaTM LE-80K ) with Beckman SW28 rotor (Beckman Coulter, model: SW 28 Ti )
Refrigerated microcentrifuge (e.g., Southwest Science, model: SC1024-R )
50 °C water bath (e.g., VWR, model: 89501-468 )
80 °C oven (Gruenberg, model: CG45V240SS )
Needle Puller (NARISHIGE, catalog number: PN-30 ) with Platinum board 3 mm filament (NARISHIGE, catalog number: PN-3H )
Dissecting stereomicroscope (e.g., Nikon Instruments, model: SMZ745 )
Refrigerated incubator capable of maintaining 15 °C (Sheldon Manufacturing, Shel Lab, model: SRI20 )
Incubator capable of maintaining 25 °C (Sheldon Manufacturing, model: Model 2005 )
Fluorescence stereo zoom microscope with dsRED and GFP filters (e.g., ZEISS, model: Axio Zoom.V16 )
-80 °C freezer (VWR, model: VWR40086A )
Bioruptor® II Type 12 (Cosmo Bio, model: Bioruptor2 Type 12 , catalog number: TOS-BR2012A)
Envision 2102 Multilabel Reader (PerkinElmer, catalog number: 2105-0010 )
Platinum Wire for worm pick, 30 gauge 0.254 mm diameter (Genesee Scientific, catalog number: 59-30P6 )
Worm pick handle (Genesee Scientific, catalog number: 59-AWP )
Autoclave (e.g., Getinge, model: 633LS )
Air Table (e.g., Kinetic Systems, model: VIBRAPLANE )
Compressed Nitrogen Tank (for connection to air table and microinjector unit) (e.g., Airgas, model: CGA-580 , catalog number: NI-NF300)
Microinjector Unit (e.g., Eppendorf, model: FemtoJet® 5247 )
Inverted microscope (e.g., Carl Zeiss, model: Axiovert 200 )
Micromanipulator (e.g., Eppendorf, model: PatchMan 5173 )
Micromanipulator controller (e.g., Eppendorf, model: 5171 )
Software
Wallac EnVision Manager software for Envision 2102 Multilabel Reader (version 1.12)
GraphPad Prism (v.6.0c, GraphPad Software Inc.)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Martin, A., Rex, E. A., Ishidate, T., Lin, R. and Gammon, D. B. (2017). Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-protocol 7(22): e2617. DOI: 10.21769/BioProtoc.2617.
Download Citation in RIS Format
Category
Microbiology > in vivo model > Viruses
Immunology > Animal model > Other
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,618 | https://bio-protocol.org/exchange/protocoldetail?id=2618&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Instillation of Particulate Suspensions to the Lungs
EK Etsushi Kuroda
YM Yasuo Morimoto
KI Ken J Ishii
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2618 Views: 7637
Edited by: Ivan Zanoni
Reviewed by: Achille Broggi
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
Inhaled fine particulates are thought to cause chronic pulmonary inflammation through the deposition of particulates into the lungs. To investigate the effect of fine particulates on the lungs, instillation of suspension of particulates into the lungs is required. This protocol describes direct injection of suspensions of fine particulates into the airway. We also show examples of typical lung immune responses after particulate administration.
Keywords: Particulates Lung inflammation Pulmonary aspiration Intranasal administration
Background
Recently, many studies have demonstrated that particulate pollutants such as diesel exhaust particles, sand dusts and particulate matter 2.5 (PM 2.5), are involved in chronic pulmonary inflammation leading to lung cancer or allergic asthma. Epidemiological analysis revealed that increased particulate air pollution is related to increased asthma hospitalization. In general, upon inhalation, fine particles, such as PM 2.5, are known to reach deep into the lungs. Instillation of suspensions of particulates into the lungs has been widely used for understanding pulmonary inflammation induced by deposited particulates (Morimoto et al., 2016).
Materials and Reagents
Pipet tip for gel loading (Vertex-GL 200 μl gel-loading tip) (SSIbio, catalog number: 4837-S0S )
Parafilm
1 ml sterile syringe (without needle) (TERUMO, catalog number: SS-01T )
Mice (C57BL/6, BALB/c etc.)
Note: For training, bigger mice (aged male mice) are better.
Alhydrogel (InvivoGen, catalog number: vac-alu-250 ) as particulate for instillation
Note: Alhydrogel (alum) is suspended in dH2O. For instillation of alum into the lungs, buffer exchange is required. Centrifuge a suspension of alum in a microtube at 2,000 x g for 2 min. Discard supernatant (H2O) and add an equal volume of saline or PBS. Mix well and centrifuge again. Repeat this procedure five times to exchange H2O to saline or PBS. Finally, adjust the concentration of alum to 2 mg/ml in saline and use for instillation.
Anesthetic (ketamine/xylazine mixture)
Note: 10 ml of Ketalar (Ketamine, 50 mg/ml, Daiichi Sankyo Co. Ltd., Tokyo, Japan) is mixed with 2.2 ml of Selactar (Xylazine, 20 mg/ml, Bayer HealthCare Ltd., Tokyo, Japan). Anesthetize mice with 50 to 75 μl of ketamine/xylazine mixture by s.c. injection into the back.
Equipment
Ear pick earwax remover with light (Japan Smile Kids)
Note: Before use, silicone rubber at the tip of ear pick will be removed (Figure 1).
Stainless steel micro spatula (Figure 1) (ASONE, catalog number: 9-891-02 )
Note: This is used as a tongue depressor, so small size is better.
Figure 1. Ear puck with light and spatula
Platform for instillation into the lungs. As shown in Figure 2, stretch a string across the wooden (cork) board (approximate size: 20 x 30 cm)
Figure 2. Platform for instillation into the lungs
Injector for instillation (Figure 3)
FACS analyzer
Figure 3. Injector for instillation. A. Fix a thin pipet tip to the ear pick by Parafilm. B. Attach a syringe to the pipet tip. C. If needed, cut the top of pipet tip to adjust for syringe insertion. D. Cut the edge of the pipet tip (arrow) for injection.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kuroda, E., Morimoto, Y. and Ishii, K. J. (2017). Instillation of Particulate Suspensions to the Lungs. Bio-protocol 7(22): e2618. DOI: 10.21769/BioProtoc.2618.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Cell Biology > Tissue analysis > Physiology
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.