id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
2,709 | https://bio-protocol.org/exchange/protocoldetail?id=2709&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Neisseria meningitidis Adherence to Human Epithelial Cells by Colony Counting
SS Sara Sigurlásdóttir*
SS Sunil D Saroj*
OE Olaspers Sara Eriksson
JE Jens Eriksson
AJ Ann-Beth Jonsson
*Contributed equally to this work
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2709 Views: 7639
Reviewed by: Chao JiangAndrea Puhar
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
To cause an infection, the human specific pathogen Neisseria meningitides must first colonize the nasopharynx. Upon tight interaction with the mucosal epithelium, N. meningitidis may cross the epithelial cellular barrier, reach the bloodstream and cause sepsis and/or meningitis. Since N. meningitidis niche is restricted to humans the availability of relevant animal models to study host-pathogen interactions are limiting. Therefore, most findings that involve N. meningitidis colonization derive from studies using cultured human cell lines. Human epithelial cells have been successfully used to examine and identify molecular effectors involved in initial adherence of the pathogen. Here, we describe a standard protocol to quantify the adherence of N. meningitidis to epithelial pharyngeal FaDu cells. Colony counts of cell lysates collected after infection are used to quantify adherence to the epithelial cells.
Keywords: Neisseria Colonization Adherence Adhesion assay Type IV pili
Background
Upon entry to a new host, adherence to specific host tissues serves as an important step in bacterial pathogenesis. Molecular interaction between bacterial adhesins and receptors on the host cell surface determines colonization sites (Soto and Hultgren, 1999). The epithelial layer in the nasopharynx forms the first cellular barrier that the human restricted pathogen N. meningitidis encounters and colonizes asymptomatically. Tight adherence and interaction with the host cells can lead to penetration of the epithelium and entry into the bloodstream, resulting in life-threatening sepsis and/or meningitis (Stephens, 2009). Long filaments extending from the bacterial membrane, called type IV pili (Tfp), containing PilC1 tip-located adhesin play a key role in initial adherence of N. meningitidis to the nasopharyngeal epithelium (Marceau et al., 1995; Rudel et al., 1995). Tfp does not only promote interaction with host cells but is also involved in the development of bacterial aggregates, that can contribute to a high level of adherence and resistance against shear stress (Helaine et al., 2005; Mikaty et al., 2009; Engman et al., 2016). Apart from the Tfp, other surface expressed molecules like the opacity proteins, LPS, NadA, NhhA, App and MspA have been shown to affect the level of adhesion to the epithelial surface (Hill et al., 2010).
Animal models to study N. meningitidis colonization are limiting due to human host specificity. Consequently, the majority of the studies over the years have relied on cultured human cell lines (Merz and So, 2000). Here, we provide a step-by-step protocol adapted from Sigurlásdóttir et al. (2017) to quantify adherence of N. meningitidis to human epithelial pharyngeal FaDu cells in culture. In the following protocol, human epithelial cells are infected with both wild-type and an adhesion-deficient ΔpilC1 strain at a multiplicity of infection (MOI) of 10 for an incubation time of 4 h. The procedure described herein for N. meningitidis adherence to cultured epithelial cells could be easily applicable to a range of different bacterial species and cell lines with adaptation of the growth media (de Klerk et al., 2017).
Materials and Reagents
Lab coat and protective gloves
Marker pen
Cell culture flasks T75 (SARSTEDT, catalog number: 83.1813.001 )
Cell culture plates 24-well (SARSTEDT, catalog number: 83.1836 )
Serological pipettes
2 ml pipette (SARSTEDT, catalog number: 86.1252.001 )
5 ml pipette (SARSTEDT, catalog number: 86.1253.001 )
10 ml pipette (SARSTEDT, catalog number: 86.1254.001 )
25 ml pipette (SARSTEDT, catalog number: 86.1685.001 )
Sterile plastic loops
1 µl plastic loops (SARSTEDT, catalog number: 86.1567.050 )
10 µl plastic loops (SARSTEDT, catalog number: 86.1562.050 )
Falcon tubes
15 ml tubes (SARSTEDT, catalog number: 62.554.502 )
50 ml tubes (SARSTEDT, catalog number: 62.547.254 )
Pipette tips
20-200 µl capacity (SARSTEDT, catalog number: 70.760.502 )
50-1,000 µl capacity (SARSTEDT, catalog number: 70.762.100 )
5 µm pore filter (VWR, catalog number: 514-4106 )
Cell culture plates 96-well (SARSTEDT, catalog number: 83.3924 )
Bacteriological Petri plates, 92 x 16 mm (SARSTEDT, catalog number: 82.1473 )
5 ml syringe (VWR, catalog number: 613-3940 )
250 ml vacuum filtration unit, 0.22 μm (SARSTEDT, catalog number: 83.1822.001 )
Bacterial strain: Neisseria meningitidis serogroup C strain FAM20 wild-type and ΔpilC1 (Rahman et al., 1997). The bacterial strain FAM20 is a nalidixic acid-resistant mutant of FAM18 that is available at ATCC (ATCC, catalog number: 700532 )
Note: The bacterial stocks are stored in 25% glycerol:75% GC liquid medium (see Recipes) at -80 °C.
Cell line: pharyngeal epithelial cell line FaDu (ATCC, catalog number: HTB-43 )
Note: The cell line is stored in 90% FBS:10% DMSO at -140 °C.
70% ethanol
Glycerol (Sigma-Aldrich, catalog number: G5516 )
DMEM high glucose, GlutaMAXTM Supplement, pyruvate (Thermo Fisher Scientific, catalog number: 31966047 )
Fetal bovine serum (FBS), heat inactivated (Sigma-Aldrich, catalog number: F9665 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Phosphate-buffered saline (PBS), 10x concentrated (Statens Veterinärmedicinska Anstalt, catalog number: 992442 )
GC agar medium base (NEOGEN, Acumedia, catalog number: 7104A )
D-glucose (Sigma-Aldrich, catalog number: G8270 )
L-glutamine (Sigma-Aldrich, catalog number: G8540 )
Ferric nitrate (Sigma-Aldrich, catalog number: F3002 )
Note: This product has been discontinued.
Cocarboxylase (Sigma-Aldrich, catalog number: C8754 )
Saponin (Sigma-Aldrich, catalog number: S7900 )
Protease peptone (Oxoid, catalog number: LP0085 )
Starch, soluble (Sigma-Aldrich, catalog number: S9765 )
Potassium phosphate dibasic (Sigma-Aldrich, catalog number: 60353 )
Potassium phosphate monobasic (Sigma-Aldrich, catalog number: 60218 )
Sodium chloride (Sigma-Aldrich, catalog number: S3014 )
Trypsin-EDTA (0.5%), no phenol red, 10x (Thermo Fisher Scientific, GibcoTM, catalog number: 15400054 )
GC agar plates (see Recipes)
Kellogg’s supplement (see Recipes)
Cocarboxylase solution (see Recipes)
2x trypsin (see Recipes)
1% saponin (see Recipes)
Phosphate-based GC liquid medium (see Recipes)
Equipment
Class II biosafety cabinet (e.g., Esco Micro, model: Airstream® Max )
Incubator at 37 °C and with a 5% CO2 environment (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: HeracellTM 150i )
Cell culture hood (e.g., ESCO laminar flow cabinet, Esco Micro, model: Airstream® Gen 3 )
Inverted microscope (e.g., Carl Zeiss, model: Axiovert 40 C )
Spectrophotometer (e.g., Bio-Rad Laboratories, model: SmartSpec Plus )
Hemocytometer (e.g., VWR, catalog number: 631-0923 )
Pipette boy (e.g., Fisher Scientific, model: Fisherbrand Electric Pipet Controller )
Pipettes
10-100 µl capacity (e.g., Eppendorf, catalog number: 4924000053 )
100-1,000 µl capacity (e.g., Eppendorf, catalog number: 4924000088 )
Multichannel pipette, 10-100 µl capacity (e.g., Eppendorf, catalog number: 3125000036 )
Water bath set to 37 °C (e.g., Grant Instruments, model: Sub Aqua Pro, catalog number: SAP12 )
Centrifuge
1 L flask
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sigurlásdóttir, S., Saroj, S. D., Eriksson, O. S., Eriksson, J. and Jonsson, A. (2018). Quantification of Neisseria meningitidis Adherence to Human Epithelial Cells by Colony Counting. Bio-protocol 8(3): e2709. DOI: 10.21769/BioProtoc.2709.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Cell Biology > Cell-based analysis > Cell adhesion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
271 | https://bio-protocol.org/exchange/protocoldetail?id=271&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Genomic Overexpression Library
Wei-Yun (Winnie) Wholey
Published: Vol 2, Iss 19, Oct 5, 2012
DOI: 10.21769/BioProtoc.271 Views: 11698
Original Research Article:
The authors used this protocol in Mar 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2012
Abstract
This protocol is used to identify/select for Escherichia coli genes that, when overexpressed in Vibrio cholerae Hsp33 (hslO gene) deletion mutant, protect against oxidative heat stress and, by extension, against HOCl-mediated protein damage. In the referenced publication, I found that V. cholerae mutant lacking Hsp33 (in addition to its established role in HOCl stress) has severe temperature sensitive phenotypes on MacConkey plates (this phenotype is not found in E. coli ΔhslO mutant). I constructed genomic expression libraries from E. coli and transformed the libraries into V. cholerae ΔhslO mutant. I then searched for complementing E. coli proteins that rescue the temperature sensitive phenotype of V. cholerae ΔhslO mutant on MacConkey plate. This protocol might work for searching complementation of other gene deletion mutants that have a good selective phenotype.
Keywords: Genomic Overexpression Library
Materials and Reagents
Bacteria donor (E. coli MG1655 wild-type or the ΔhslO deletion)
Bacteria recipient (Vibrio cholerae O395 ΔhslO deletion)
GenElute Bacterial Genomic DNA kit (Sigma-Aldrich)
Plasmid pBR322 (New England BioLab, linearized with BamH1)
Plasmid pET11a (New England BioLab, linearized with BamH1)
BamH1 (New England Biolabs)
BfuCI (New England Biolabs)
T4 DNA ligase (New England Biolabs)
Gel Extraction Kit (QIAGEN)
Ultracompetent XL10-Gold cells (Stratagene)
Wizard Plus SV Minipreps kit (Promega Corporation)
MacConkey plates (lab-made)
LB medium
TAE buffer
Equipment
Gel electrophoresis apparatus
Incubator for bacteria
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wholey, W. W. (2012). Preparation of Genomic Overexpression Library. Bio-protocol 2(19): e271. DOI: 10.21769/BioProtoc.271.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA cloning
Microbiology > Microbial genetics
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,710 | https://bio-protocol.org/exchange/protocoldetail?id=2710&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Characterising Maturation of GFP and mCherry of Genomically Integrated Fusions in Saccharomyces cerevisiae
SS Sviatlana Shashkova*
Adam JM Wollman*
SH Stefan Hohmann
Mark C Leake
*Contributed equally to this work
Published: Vol 8, Iss 2, Jan 20, 2018
DOI: 10.21769/BioProtoc.2710 Views: 8349
Edited by: Dennis Nürnberg
Reviewed by: Vikash Verma
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
Single-molecule fluorescence microscopy enables unrivaled sub-cellular quantitation of genomically encoded fusions of native proteins with fluorescent protein reporters. Fluorescent proteins must undergo in vivo maturation after expression before they become photoactive. Maturation effects must be quantified during single-molecule analysis. Here we present a method to characterise maturation of GFP and mCherry genetic protein fusions in budding yeast Saccharomyces cerevisiae.
Keywords: Single-molecule Fluorescence Fluorescent protein maturation Protein fusion GFP mCherry Yeast
Background
Single-molecule fluorescence microscopy enables sensitive quantification of molecular stoichiometry, mobility and copy number, not only on a cell-by-cell basis but also precisely to individual sub-cellular compartments (Leake, 2012; Wollman and Leake, 2015; Shashkova et al., 2017). The technique relies on endogenously expressed fluorescent protein fusions of the wild type protein of interest such that there is one-to-one labelling. However, all fluorescent proteins have an in vivo maturation time varying from a few minutes to several tens of minutes before entering a bright fluorescing state (Badrinarayanan et al., 2012). It is therefore of upmost importance to measure any maturation effects and quantify if there is any immature ‘dark fraction’ of labelled protein. These measurements are also particularly relevant to fluorescence recovery after photobleaching (FRAP). FRAP can be used to study molecular turnover in living cells (Beattie et al., 2017). FRAP is based on photobleaching of a cell region where a fluorescently labelled component is localized, followed by quantification of any fluorescence recovery in that region over time. The measured relation between the fluorescence intensity as a function of time following an initial photobleach can be used to determine molecular mobility and kinetics parameters, such as the rate of dissociation of a particular fluorescent component from a molecular complex (Leake et al., 2006). Therefore, any ‘new’ fluorescence coming from fluorescent protein maturation might affect this apparent result. We present here a protocol to characterise the maturation of Mig1-GFP and Nrd1-mCherry fusion proteins in living yeast Saccharomyces cerevisiae cells used in our single-molecule studies (Wollman et al., 2017).
We blocked protein translation in living cells by adding cycloheximide (Hartwell et al., 1970), and then measured any cellular fluorescence recovery after cells were completely photobleached by continuous illumination. Such fluorescence recovery is then used as a metric for newly matured GFP and/or mCherry in the cell. Our results are broadly consistent with in vivo maturation of GFP and mCherry reported previously (Badrinarayanan et al., 2012; Khmelinskii et al., 2012), but since maturation kinetics may be dependent on cell type and the specific extracellular microenvironment, it is important to quantify these maturation effects under the same experimental conditions used for the in vivo microscopy on the actual fusion strains of interest.
Materials and Reagents
Sterile pipette tips, 1 ml, 200 µl, 10 µl (STARLAB, catalog numbers: S1111-6801 , S1111-0806 , S1111-3800 )
14 ml conical tubes (Corning, Falcon®, catalog number: 352059 )
Petri dishes 92 mm diameter (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 172931 )
Microscopy slides (Fisher Scientific, catalog number: FB58622 )
Cover slips (Scientific Laboratory Supplies, catalog number: MIC3124 )
Yeast S. cerevisiae YSH2348 with Mig1-GFP and Nrd1-mCherry genetically integrated protein fusions, MATa MIG1-GFP-HIS3 NRD1-mCherry-hphNT1 MET LYS (Hohmann lab, University of Gothenburg, Sweden)
D(+)-Glucose (VWR, catalog number: 101176K )
Bacto-yeast extract (BD, BactoTM, catalog number: 212750 )
Peptone from meat (Merck, catalog number: 1072241000 )
Agar-agar (Merck, catalog number: 1016141000 )
MilliQ water
Yeast nitrogen base without amino acids, without (NH4)2SO4 (Sigma-Aldrich, catalog number: Y1251 )
Ammonium sulfate, (NH4)2SO4 (Merck, catalog number: 1012171000 )
Complete supplement mixture (ForMedium, catalog number: DCS0019 )
Cycloheximide (Sigma-Aldrich, catalog number: C7698 )
EtOH (VWR, catalog number: VWRC20821.330 )
Glucose 50% w/v (see Recipes)
YPD agar with 4% glucose (see Recipes)
YPD liquid medium with 4% glucose (see Recipes)
YNB (Yeast Nitrogen Base) liquid medium without glucose (see Recipes)
YNB (Yeast Nitrogen Base) liquid medium with 4% glucose (see Recipes)
100 mg/ml cycloheximide solution in EtOH (see Recipes)
Equipment
Pipettes (STARLAB, model: ErgoOne® Single-Channel Pipette, 2-20 µl, 20-200 µl and 100-1,000 µl)
pH-meter (Scientific & Chemical Supplies, catalog number: PHM975050 )
Two timers (Fisher Scientific, catalog number: 15177414 )
Autoclave (Getinge, model: 400/500LS-E Series Steam Sterilizers (533LS-E))
Magnetic stirrer (Chemtech Scientific, model: C-MAG HS7 )
30 °C incubator (Eppendorf, New Brunswick ScientificTM, model: Innova® 4000 )
Spectrophotometer (Biochrom, model: WPA S800 )
Centrifuge (Eppendorf, model: 5810 R )
Mercury-arc excitation fluorescence microscope Zeiss Axiovert 200M (Carl Zeiss, model: Axiovert 200 M ) with an AxioCamMR3 camera with separate filter sets: 38HE for GFP and 43HE for mCherry excitation; Plan-Apochromat 1.40-numerical-aperture oil immersion, 100x objective
Software
AxioVision
ImageJ 1.50g
Excel
MATLAB 2017a
Procedure
Cell preparation
Streak cells from a frozen stock, using a sterile pipette tip on a freshly-prepared YPD agar plate (see Recipes), and incubate at 30 °C for at least 24 h.
Set an overnight culture in a 14 ml tube by inoculating 3 ml of YPD with cells grown on a YPD plate. Single colonies are not needed for genomically integrated strains. Incubate at 30 °C, 180 rpm.
In the morning exchange the YPD medium (see Recipes) to YNB medium (see Recipes) supplemented with 4% glucose:
Pellet the cells by centrifugation at 1,000 x g for 3 min, remove the supernatant.
Resuspend the cells in 3 ml of YNB medium without any carbon source.
Pellet the cells by centrifugation at 1,000 x g for 3 min, remove the supernatant.
Suspend the cells in 3 ml of YNB supplemented with 4% glucose and incubate at 30 °C, 180 rpm, for ~4 h.
Wash the culture by centrifugation (1,000 x g, 3 min) and re-suspend in 2 ml of YNB with 4% glucose. Incubate at 30 °C, 180 rpm, for about 10 min.
Add 2 μl of 100 mg/ml cycloheximide solution (see Recipes) to the final concentration of 100 μg/ml. Incubate for 1 h at room temperature, without shaking, protect from light.
Place 5 μl of the culture on a microscope slide and cover with a 22 x 22 mm coverslip. Avoid any air under the coverslip.
Data acquisition
Place the sample under the microscope, coverslip on the objective and find a region of interest containing 5-10 cells (100x magnification) which appear stationary and firmly anchored to the glass surface.
Optimize exposure times for in vivo imaging of both GFP and mCherry fluorescent proteins to be able to detect a clear signal without saturating the detector. Under our microscope: GFP exposure time–22 sec, mCherry–7 sec.
Find another region with 5-10 cells positioned far away from the previous one to avoid any potential bleaching from previous illumination exposure.
Take a brightfield and a fluorescence image, by pressing the ‘snap’ button, with both channels using chosen exposure times, opening the mercury lamp shutter for only the length of exposure.
Photobleach GFP or mCherry by continuous illumination of the appropriate wavelength until the region appears completely dark. Continue for 1 min longer. With our settings the total exposure time is: 3 min 40 sec for GFP and 4 min for mCherry. Immediately after, begin timing and acquire a picture of the bleached fluorescent protein with an appropriate channel and a brightfield image. This is denoted time point 0 min.
Continue acquiring both fluorescent and brightfield pictures at the following time points after bleaching: 7.5, 15, 25, 30, 40, 60, 90 and 120 min.
As simultaneous photobleaching of GFP and mCherry is not possible under this microscope, the time points were staggered for GFP and mCherry as listed in Table 1.
Table 1. Order of photobleaching and data acquisition using two channels
Data analysis
Images are converted into open standard tiff files from zvi by AxioVision software.
Further analysis is performed using ImageJ.
Open the first unbleached brightfield image.
By choosing an ‘oval’ selection tool, define a region of interest (ROI), an area around a cell as shown in Figure 1. It does not matter how much of non-cell area is included as every cell will be background-correct during the analysis.
Figure 1. Selection of the region of interest for cell measurements. Scale bar = 20 µm.
Open a fluorescence image of the same set, and define the same area of the same cell by simultaneously choosing ‘Shift’ and ‘E’ keys on the keyboard (Selection → Restore).
From the menu bar select: Analyze → set measurements. Pick ‘area’ (represents a number of pixels, N) and ‘integrated density’ (sum intensity for the cell, Scell). Press ‘OK’.
To obtain numeric values press ‘Ctrl’ + ‘M’ (Analyse → Measure). Record the result in Excel.
Repeat throughout the entire data set for both channels keeping the same ROI.
Repeat the entire procedure for all cells.
Background correction: Choose random background areas around cells (Figure 2) and obtain numerical results for sum intensity (Sbg).
Figure 2. Selection of the region of interest for the background measurements. Scale bar = 20 µm.
Find the average (SAbg) and multiply by the number of pixels from cell (N) measurements. This is the intensity of the background represented within the cell area (Ibg).
Subtraction of the average background sum intensity (Ibg) from the total intensity of the cell (Scell) represents Icell, the cellular fluorescence intensity with background correction.
The average of fluorescence intensity of all cells analysed within the data set gives the final value of the fluorescence intensity (Ifinal) with appropriate estimation of SD and/or SE.
Plot the final fluorescence intensity (Ifinal) vs. experimental time (Figures 3A and 3B) for fluorescently labelled cells and wild type autofluorescent cells. Any signal above autofluorescence is due to fluorescent protein maturation. For GFP (Figure 3A), no maturation was detected so it can be assumed that all of the fluorescent protein was mature in the cells and there is no ‘dark’ fraction. For mCherry (Figure 3B), some fluorescence recovery was measured. The following steps outline quantification of the maturation time and dark fraction.
Subtract the autofluorescence from the mean fluorescent protein intensity at each time point (Figure 3C).
Export the intensity and time values after the bleach by copying and pasting into two new variables in MATLAB, called x (for the time values ) and y (intensity values):
Right click on the Workspace → New. Name it x or y. Press ‘Enter’ on the keyboard.
Double click on this new variable opens a table in the Editor where values of time (for x) or intensity (for y) can be pasted.
Open the curve fitting toolbox from the Apps menu.
Select x for ‘X data’ and y for ‘Y data’.
Choose custom equation and type:
where, Ibleach is the remaining intensity after the bleach, Irec is the recovered intensity above Ibleach and tmat is the maturation time.
If ‘Auto fit’ is ticked, fitting will be automatic.
If the fit has not converged correctly, adjust the ‘Start point’ parameters in ‘Fit Options’ to reasonable estimates from the data i.e., y at x = 0 for Ibleach and y at x = end minus Ibleach for Irec.
If the fit has converged record the fit and goodness of fit parameters from the ‘Results’ panel. For Figure 3C, Irec = 4.3 x 104 ± 3 x 104 counts, Ibleach = 5.2 x 104 ± 2.5 x 104 counts, tmat =17 ± 10 min with R2 = 0.7.
To calculate the proportion dark, immature protein; divide Irec by the initial, autofluorescence corrected pre-bleach intensity. Here give ~5%.
Figure 3. Characterisation of GFP and mCherry maturation times in vivo. GFP maturation within genomically integrated protein fusion (A). Maturation of a genomically integrated mCherry fusion (B) and its’ exponential recovery fit (C). Time normalized to bleach time at t = 0.
Data analysis
Data was analyzed as outlined in section C of the Procedure. Statistical methods are outlined in Wollman et al. (2017) but also briefly outlined here. In imaging experiments, each cell can be defined as a biological replicate sampled from the cell population. Sample sizes of ~10 cells were used to generate reasonable estimates of fluorescent protein maturation and are similar to previous studies (Badrinarayanan et al., 2012). Technical replicates are not possible with irreversible photobleaching however noise is characterized by the autofluorescent of wild type control cell measurements.
Notes
Autofluorescence is calculated as indicated in the protocol above but using a wild type yeast strain (i.e., without any fluorescent proteins present).
Recipes
Glucose 50% w/v
Weigh 500 g of glucose
Bring up to 1 L with MilliQ water
Dissolve by using magnetic stirrer with heating
Autoclave for 20 min at 121 °C
YPD agar with 4% glucose
Mix yeast extract 5 g, Bacto-peptone (peptone from meat) 10 g and agar 10 g
Bring up to 460 ml with MilliQ water
Autoclave for 20 min at 121 °C
Add 40 ml of glucose 50% w/v
Cast plates: approximately 25 ml of the medium per plate
Let them solidify, store upside down at 4 °C
YPD liquid medium with 4% glucose
Mix yeast extract 5 g and Bacto-peptone (peptone from meat) 10 g
Bring up to 460 ml with MilliQ water
Autoclave for 20 min at 121 °C
Add 40 ml of glucose 50% w/v
YNB (Yeast Nitrogen Base) liquid medium without glucose
Mix yeast nitrogen base without amino acids, without (NH4)2SO4 1.7 g, complete supplement 0.79 g, (NH4)2SO4 5 g
Dissolve in 900 ml of MilliQ water, adjust pH 5.8-6.0 using NaOH
Bring up to 1,000 ml with MilliQ water
Autoclave for 20 min at 121 °C
YNB (Yeast Nitrogen Base) liquid medium with 4% glucose
Mix yeast nitrogen base without amino acids, without (NH4)2SO4 1.7 g, complete supplement 0.79 g, (NH4)2SO4 5 g
Dissolve in 900 ml of MilliQ water, set pH 5.8-6.0 using NaOH
Bring up to 920 ml with MilliQ water
Autoclave for 20 min at 121 °C
Add 80 ml of glucose 50% w/v
100 mg/ml cycloheximide solution in EtOH
Weigh 0.5 g of cycloheximide and dissolve in 5 ml of absolute EtOH
Aliquot and store at -20 °C
Acknowledgments
This work was supported by the Biological Physical Sciences Institute, Royal Society, MRC (grant MR/K01580X/1), BBSRC (grant BB/N006453/1), the European Commission via Marie Curie-Network for Initial Training ISOLATE (Grant agreement No.: 289995), and the Royal Society Newton International Fellowship (NF160208). This protocol was adapted from Wollman et al. (2017).
Conflict of interest: Authors declare no conflict of interest.
References
Badrinarayanan, A., Reyes-Lamothe, R., Uphoff, S., Leake, M. C. and Sherratt, D. J. (2012). In vivo architecture and action of bacterial structural maintenance of chromosome proteins. Science 338(6106): 528-531.
Beattie, T. R., Kapadia, N., Nicolas, E., Uphoff, S., Wollman, A. J., Leake, M. C. and Reyes-Lamothe, R. (2017). Frequent exchange of the DNA polymerase during bacterial chromosome replication. Elife 6.
Hartwell, L. H., Culotti, J. and Reid, B. (1970). Genetic control of the cell-division cycle in yeast. I. Detection of mutants. Proc Natl Acad Sci U S A 66(2): 352-359.
Khmelinskii, A., Keller, P. J., Bartosik, A., Meurer, M., Barry, J. D., Mardin, B. R., Kaufmann, A., Trautmann, S., Wachsmuth, M., Pereira, G., Huber, W., Schiebel, E. and Knop, M. (2012). Tandem fluorescent protein timers for in vivo analysis of protein dynamics. Nat Biotechnol 30(7): 708-714.
Leake, M. C. (2012). The physics of life: one molecule at a time. Philos Trans R Soc Lond B Biol Sci 368(1611): 20120248.
Leake, M. C., Chandler, J. H., Wadhams, G. H., Bai, F., Berry, R. M. and Armitage, J. P. (2006). Stoichiometry and turnover in single, functioning membrane protein complexes. Nature 443(7109): 355-358.
Shashkova, S., Wollman, A. J. M., Leake, M. C. and Hohmann, S. (2017). The yeast Mig1 transcriptional repressor is dephosphorylated by glucose-dependent and -independent mechanisms. FEMS Microbiol Lett 364(14).
Wollman, A. J. and Leake, M. C. (2015). Millisecond single-molecule localization microscopy combined with convolution analysis and automated image segmentation to determine protein concentrations in complexly structured, functional cells, one cell at a time. Faraday Discuss 184: 401-424.
Wollman, A. J., Shashkova, S., Hedlund, E. G., Friemann, R., Hohmann, S. and Leake, M. C. (2017). Transcription factor clusters regulate genes in eukaryotic cells. Elife 6: e27451.
Copyright: Shashkova et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Shashkova, S., Wollman, A. J., Hohmann, S. and Leake, M. C. (2018). Characterising Maturation of GFP and mCherry of Genomically Integrated Fusions in Saccharomyces cerevisiae. Bio-protocol 8(2): e2710. DOI: 10.21769/BioProtoc.2710.
Wollman, A. J., Shashkova, S., Hedlund, E. G., Friemann, R., Hohmann, S. and Leake, M. C. (2017). Transcription factor clusters regulate genes in eukaryotic cells. Elife 6: e27451.
Download Citation in RIS Format
Category
Molecular Biology > Protein > Protein maturation
Cell Biology > Cell imaging > Live-cell imaging
Cell Biology > Cell-based analysis > Protein maturation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,711 | https://bio-protocol.org/exchange/protocoldetail?id=2711&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ex vivo Analysis of Lipolysis in Human Subcutaneous Adipose Tissue Explants
PD Pauline Decaunes
AB Anne Bouloumié
MR Mikael Ryden
JG Jean Galitzky
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2711 Views: 6961
Reviewed by: Salma Merchant
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
Most studies of human adipose tissue (AT) metabolism and functionality have been performed in vitro on isolated mature adipocyte or in situ using the microdialysis technique (Lafontan, 2012). However, these approaches have several limitations. The use of mature isolated adipocytes is limiting as adipocytes are not in their physiological environment and the collagenase digestion process could affect both adipocyte survival and functionality. While metabolic studies using microdialysis have brought the advantage of studying the lipolytic response of the adipose tissue in situ, it provides only qualitative measures but does not give any information on the contribution of different adipose tissue cell components. Moreover, the number of microdialysis probes that can be used concomitantly in one subject is limited and can be influenced by local blood flow changes and by the molecular size cut-off of the microdialysis probe. Here we present a protocol to assess adipose tissue functionality ex vivo in AT explants allowing the studies of adipose tissue in its whole context, for several hours. In addition, the isolation of the different cell components to evaluate the cell-specific impact of lipolysis can be performed. We recently used the present protocol and demonstrated that fatty acid release during lipolysis impacts directly on a specific cell subset present in the adipose tissue stroma-vascular compartment. This assay can be adapted to address other research questions such as the effects of hormones or drugs treatment on the phenotype of the various cell types present in adipose tissue (Gao et al., 2016).
Keywords: Human adipocyte biology Lipolysis ex vivo Explant
Background
Human white adipose tissue (WAT) plays a major role in body energy homeostasis. Adipocytes, specialized cells expressing specific lipid handling metabolic activities, constitute more than 90% of the volume of WAT (Lafontan, 2012). In addition to adipocytes, other cell types are present within human WAT e.g., vascular cells, immune cells (lymphocytes and macrophages) and progenitor cells involved in WAT remodeling and renewal. The metabolic activity of adipocytes is tightly controlled by the integration of both local and systemic pathways. Neurohumoral signals modulated in anabolic or catabolic conditions impact on the net adipocyte metabolic activity, i.e., energy storage or release. In post-prandial conditions, non-esterified fatty acids (NEFAs) originating from the hydrolysis of VLDL and chylomicron particles are taken up by the adipocytes and esterified to glycerol phosphate to form triglycerides packaged into a single lipid vacuole (Large et al., 2004). This process called lipogenesis, is mainly under the control of insulin. In conditions of energy demand such as exercise or fasting, hydrolysis of triacylglycerol through a process called lipolysis results in the release of glycerol and NEFAs into the circulation thereby providing energy to other tissues and organs. Lipolysis involves the sequential hydrolysis of triacylglycerol through the successive action of lipolytic enzymes, i.e., adipose triglyceride lipase, hormone sensitive lipase and monoacylglycerol lipase. In human adipocytes, lipolysis is mainly stimulated by catecholamines and atrial natriuretic peptide (ANP). Catecholamines mediate their pro-lipolytic effects through β-adrenoceptors (β1-AR and β2-AR), while alpha2-adrenoceptors are anti-lipolytic; ANP acts via NPR-A to activate lipolysis (Lafontan, 2012). It should be noted that in human AT the beta3-adrenergic receptor is almost not expressed and is not functional. The classical approach to evaluate adipocyte lipolytic responses was developed by Robdell (Robdell, 1964) who first described mature adipocyte isolation based on flotation after collagenase digestion. Although this technique is used worldwide, it presents several limitations. Firstly, the buoyancy of isolated mature adipocytes will prevent, with increasing time in vitro, their immersion into media and promote direct toxic effects through air contact, ultimately leading to cell damage and disintegration. Secondly, the isolation process per se alters adipocyte phenotype (Ruan et al., 2003). Thirdly, the isolated mature adipocytes are disconnected from their natural microenvironment including extracellular matrix and from other cell types (vascular cells, immune cells (lymphocytes and macrophages) and progenitor cells). Moreover, cytokines such as TNF-alpha and IL6, present in the AT microenvironment, are well described to impact adipocyte lipolysis. Finally, NEFAs originating from in situ lipolysis may have different fates: 1) release into the circulation, 2) re-esterification within the mature adipocytes, 3) potentially taken up by other cell types in the near vicinity of mature adipocytes including progenitor cells. Thus studies on isolated adipocytes do not take into account these different factors.
The present technique allows the study of the lipolytic responsiveness of mature adipocytes for a longer time in their natural context 1) in a closed culture chamber avoiding direct contact with air but with adequate and modulable gas exchange, 2) without the necessity of a collagenase digestion step and 3) in a maintained viable microenvironment. This approach was recently published by our groups and clearly demonstrate that lipolytic stimulation is associated with increased fatty acid uptake by the progenitor cells leading to enhanced adipogenic capacity (Gao et al., 2016).
Materials and Reagents
Pipettes tips (Dutscher, ClearLine®, catalog numbers: 037660CL (10 µl); 032260CL (200 µl); 027120CL (1,000 µl))
50 ml conical tubes (Corning, Falcon®, catalog number: 352070 )
20 ml syringe (Terumo, catalog number: SS-20ES1 )
Sterile individually packaged 5 ml graduated pipettes (Corning, Falcon®, catalog number: 357543 )
Sterile 150 x 20 mm cell culture polystyrene Petri dish (Thermo Fisher Scientific, Thermo ScienticTM, catalog number: 168381 )
10 ml syringe (Terumo, catalog number: SS-10ES1 )
Sterile individually needle 21 G x 11/2” (Terumo, catalog number: NN-2138R )
15 ml conical tubes (Greiner Bio One International, catalog number: 188271 )
0.22 µm syringe filter (Dutscher, catalog number: 051732 )
96 wells microplate clear flat bottom (Thermo Fisher Scientific, Thermo ScienticTM, catalog number: 269620 )
50 ml syringe (Terumo, catalog number: SS-50L1 )
Filtration unit for sterilization, Stericup 500 ml (Merck, catalog number: SCGPU05RE )
Clinicell® 25 cassette (Mabio International, catalog number: 00109 )
RNA lysis buffer (Quiazol, QIAGEN, catalog number: 79306 )
Free glycerol reagent (Sigma-Aldrich, catalog number: F6428 )
Wako NEFA (SOBIODA, catalog numbers: W1W434-91795 and W1W436-91995 )
Lactate FS (Diasys Diagnostics, catalog number: 1400199109 )
Phosphate-buffered saline (PBS) (Sigma-Aldrich, catalog number: D8537 )
Glucose GOD FS (Diasys Diagnostics, catalog number: 1250099100 )
Gentamycin (Sigma-Aldrich, catalog number: G1272 )
ECBM buffer (PromoCell, catalog number: C-22210 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7030 )
HEPES 1 M (PAA, catalog number: S11-001 )
Sodium bicarbonate (Sigma-Aldrich, catalog number: S5761 )
Krebs Ringer powder (Sigma-Aldrich, catalog number: K4002 )
(-)Isoproterenol hydrochloride (Sigma-Aldrich, catalog number: I6504 )
Human alpha-ANF(1-28) (R&D Systems, catalog number: 1906/1 )
ECBM medium (see Recipes)
BSA free fatty acid 20% (see Recipes)
Adipose tissue explant media (ATEM) (see Recipes)
Krebs-Ringer Bicarbonate HEPES 0.1% BSA (KRBHA) (see Recipes)
Isoproterenol stock solution (see Recipes)
ANP stock solution at 200 µM (see Recipes)
Equipment
P20 pipetman (Gilson, catalog number: F123600 )
P200 pipetman (Gilson, catalog number: F123601 )
P1000 pipetman (Gilson, catalog number: F123602 )
Laminar flow hood (Faster, model: BHA36 )
Sterile steel stainless scissors, 16 cm, straight (Dutscher, catalog number: 005055 )
Sterile stainless steel dressing forceps 11.5 cm, straight (Dutscher, catalog number: 711202 )
Stainless steel round-point needle 14 G x 6” (Dutscher, catalog number: 075515 )
Refrigerated tabletop centrifuge for 15 and 50 ml conical tube (Eppendorf, model: 5810 R )
37 °C, 5% CO2 water jacketed incubator (Thermo Fisher Scientific, Thermo ScienticTM, model: HeraCellTM 150i )
Pipettor PipetGirl (Integra Biosciences, catalog number: 155 021 )
Benchtop dry bath (Thermo Electron LED, catalog number: D-63505 )
Autoclave
-20 °C freezer
100 ml beaker (Corning, PYREX®, catalog: 1000-100 )
1 L beaker (Corning, PYREX®, catalog: 1000-1L )
Microplate spectrophotometer (Labsystem, model: iEMS Reader MF )
pH-meter (Mettler-Toledo, model: EL20 )
Software
Excel 2013
GraphPad Prism6 software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Decaunes, P., Bouloumié, A., Ryden, M. and Galitzky, J. (2018). Ex vivo Analysis of Lipolysis in Human Subcutaneous Adipose Tissue Explants. Bio-protocol 8(3): e2711. DOI: 10.21769/BioProtoc.2711.
Download Citation in RIS Format
Category
Cell Biology > Cell metabolism > Lipid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,712 | https://bio-protocol.org/exchange/protocoldetail?id=2712&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Culture and Nucleofection of Postnatal Day 7 Cortical and Cerebellar Mouse Astroglial Cells
MC Malek Chouchane
MC Marcos Romualdo Costa
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2712 Views: 7018
Reviewed by: Ehsan KheradpezhouhAnna La Torre
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Lineage reprogramming of astroglial cells isolated from different brain regions leads to the generation of different neuronal subtypes. This protocol describes the isolation and culture of neocortical and cerebellar astrocytes from postnatal mice. We also present a comprehensive description of the main steps towards successful gene delivery in these cells using nucleofection. Neocortex and cerebellum astrocyte cultures obtained with these methods are suitable for the study of molecular and cellular mechanisms involved in direct cell lineage reprogramming into induced neurons (iNs).
Keywords: Primary cell culture Murine astrocytes Nucleofection Cell lineage reprogramming
Background
Astrocyte culture has been extensively described in the literature (Saura, 2007; Schildge et al., 2013). Several protocols, mostly differing in the number of steps for cell isolation, yield astrocyte cultures with sufficient purity (up to 98%). However, most protocols described to date focus on the isolation of astrocytes from the neocortex and use chemical dissociation (Schildge et al., 2013). Here, we provide an alternative method to generate highly enriched astrocyte monolayers without the necessity of chemical tissue dissociation, what makes the protocol rather faster as compared to previous methods. Additionally, we also describe the isolation and culture of neocortical and cerebellum astrocytes, highlighting some important differences between these two cell populations. Finally, we describe an alternative, cost-effective approach for gene delivery in astrocytes using nucleofection (Chouchane et al., 2017). This technique consists of the direct delivery of DNA molecules following electroporation of the cells using a specific voltage and reagent. Nucleofection of proneural genes into astrocytes is a cheap, fast and relatively efficient method that leads to similar results as compared to retroviral-mediated transfection (Heins et al., 2002; Berninger et al., 2007; Heinrich et al., 2012; Chouchane et al., 2017). It also presents a great advantage as quiescent astrocytes are easily targeted, hence bypassing the precondition of having dividing cells.
Materials and Reagents
Pipette tips and micropipettes (Gilson, catalog numbers: K31-1001B , K31-201Y , K31-11 )
Petri dish (Sigma-Aldrich, catalog number: P5731 )
Manufacturer: Excel Scientific, catalog number: D-910 .
Micro scalpel
T75 culture flasks
15 ml tubes (Corning, catalog number: 430791 )
24-well tissue plates (Eppendorf, catalog number: 0030722019 )
Mice
Note: Postnatal day 7 (P7) C57BL/6 mice were used from the animal facility of the Brain Institute (UFRN, Natal). All animal procedures were done in accordance with national and international laws and were approved by the local ethical committee (CEUA/UFRN, license # 008/2014).
Hank’s balanced salts solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14025092 )
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9625 )
Tryple dissociation reagent (Thermo Fisher Scientific, GibcoTM, catalog number: 12604013 )
Poly-D-lysine (Sigma-Aldrich, catalog number: P0899 )
Nucleofection device and kit
4D nucleofector (LONZA) X unit
16 wells Nucleocuvettes strips (20 µl)
Solution for primary cells P3 (Lonza, catalog number: V4XP-3032 )
Astromedium (see Recipes)
DMEM-F12 (Thermo Fisher Scientific, GibcoTM, catalog number: 12634010 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10082147 )
Horse serum (HS) (Thermo Fisher Scientific, GibcoTM, catalog number: 16050122 )
Penicillin/streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Glucose (Thermo Fisher Scientific, GibcoTM, catalog number: A2494001 )
B27 (Thermo Fisher Scientific, GibcoTM, catalog number: 17504044 )
Epidermal growth factor (EGF) (Thermo Fisher Scientific, InvitrogenTM, catalog number: P35375 )
Fibroblast growth factor 2 (FGF2) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 68-8785-82 )
Differentiation medium (see Recipes)
DMEM/F12 (Thermo Fisher Scientific, GibcoTM, catalog number: 12634010 )
Glucose (Sigma-Alrich, catalog number: G8270 )
Penicillin/streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15070063 )
B27 (Thermo Fisher Scientific, GibcoTM, catalog number: 17504044 )
Brain-derived neurotrophic factor (BDNF) (Sigma-Aldrich, catalog number: B3795 )
Equipment
Dissection microscope (ZEISS, model: Stemi DV4 )
Incubator (Shell Lab CO2 Incubator)
Refrigerated centrifuge (Hettich Lab Technology, model: Rotina 420 R )
Nucleofection device (Lonza, 4D nucleofector controller and X unit) (Lonza, model: 4D-NucleofectorTM )
1,000 µl micropipette
Software
GraphPad Prism version 5.00
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chouchane, M. and Costa, M. R. (2018). Culture and Nucleofection of Postnatal Day 7 Cortical and Cerebellar Mouse Astroglial Cells. Bio-protocol 8(3): e2712. DOI: 10.21769/BioProtoc.2712.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,713 | https://bio-protocol.org/exchange/protocoldetail?id=2713&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
FRET-based Stoichiometry Measurements of Protein Complexes in vitro
FM Francesca Mattiroli
Yajie Gu
Karolin Luger
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2713 Views: 8272
Edited by: Gal Haimovich
Reviewed by: Manuel D GaheteDaniel Kraus
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
For a complete understanding of biochemical reactions, information on complex stoichiometry is essential. However, measuring stoichiometry is experimentally challenging. Our lab has developed a FRET-based assay to study protein complex stoichiometry in vitro. This assay, also known as Job plot, is set up as a continuous variation of the molar ratio between the two species, kept at constant total concentration. The FRET (Fluorescence Resonance Energy Transfer) between the two fluorescently-labeled proteins is measured and the stoichiometry is inferred from the sample with highest FRET signal. This approach allows us to assess complex stoichiometry in solution.
Keywords: Stoichiometry FRET Histones Fluorescence Complex formation Job plot
Background
Each biochemical reaction requires the interaction between two or more cellular components. The stoichiometry of these interactions is an important factor that regulates biochemical reactions in the cell. Experimental determination of complex stoichiometry is therefore critical to fully understand the biochemical and biophysical processes at work within cells.
Measuring stoichiometry has been experimentally challenging. For the interaction between large particles that lead to dramatic molecular weight changes, stoichiometry can be inferred by low-resolution structural analysis. These approaches include size-exclusion chromatography, multi-angle light scattering, analytical ultracentrifugation, which are techniques capable of providing accurate molecular weights of the particles. However, these methods require a considerable amount of material and are prone to error when small molecular weight changes are to be observed.
We have optimized an assay to measure complex stoichiometry in solution based on FRET (Fluorescence Resonance Energy Transfer). This assay, also known as Job plot (Huang, 1982) can be carried out with considerably less material and it is suitable for studying any complex formation, independent on the size of the two components. In this assay, samples are kept at constant total protein concentration, but with continuous variation of the molar ratio between the two components (Figure 1). The sample with the functional stoichiometry of the complex will display the highest FRET signal.
This is a powerful method that enables measurements of complex stoichiometry in solution and among components of any size. Because FRET measurements require both components of the complex to be fluorescently-labeled, a variety of controls are required to exclude potential artifact of the labeling procedure. Ideally single site labeling is advisable in this assay (D’Arcy et al., 2013; Mattiroli et al., 2017), but this is not always possible, as the protein structure may not be known for the components. We suggest performing functional assays with the labeled protein to confirm that the fluorophores do not alter its properties.
Materials and Reagents
Low retention pipette tips (USA Scientific)
PCR tubes (USA Scientific, catalog number: 1402-4308 )
384-well assay plate (Corning, catalog number: 3575 )
PD-10 column (GE Healthcare, catalog number: 52130800 )
Amicon Ultra centrifugal filter units, Ultra-15, MWCO 10 kDa (Merck, catalog number: UFC901008 )
Unlabeled refolded H3-H4 (procedures explained in Dyer et al., 2004)
Histone-binding protein (defined as Protein1 in this protocol)
Alexa488-labeled refolded H3-H4 (procedures explained in Muthurajan et al., 2016) (Protein2)
Atto647N maleimide (Sigma-Aldrich, catalog number: 05316-1MG-F )
Note: Store at -20 °C in DMSO at 10 mM concentration.
Dithiothreitol (DTT) (Gold Biotechnology, catalog number: DTT50 )
Tris pH 7.5 (Fisher Scientific, catalog number: BP152-5 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-10 )
EDTA (Fisher Scientific, catalog number: BP120-1 )
TCEP (Gold Biotechnology, catalog number: TCEP10 )
Nonidet P-40 (NP-40) (Sigma-Aldrich, catalog number: 74385 )
CHAPS (Sigma-Aldrich, catalog number: C3023 )
1 M dithiothreitol (DTT; see Recipes)
PD-10 buffer (see Recipes)
Binding buffer (see Recipes)
Equipment
Pipettes (Gilson)
Plate reader (BMG LABTECH, model: CLARIOstar )
Centrifuge with plate adapter (Beckman Coulter, model: Allegra® X-22R , rotor: Beckman Coulter, model: S2096 )
Software
Excel Software
Procedure
Fluorescence labeling of the histone-binding protein
In a minimum reaction volume of 400 µl, mix 10 µM of histone-binding protein with 10 µM of Atto647N maleimide dye, in PD-10 buffer. Rotate gently at 4 °C for 1 h. Protect the reaction from light.
Quench the reaction with a final concentration of 10 mM DTT (see Recipes).
Dilute the sample to 2 ml and apply it to a PD-10 column. Elute with 3.5 ml of PD-10 buffer (see Recipes). This step removes unconjugated dye from the solution.
Concentrate the labeled protein to ~20 µM using Amicon Ultra (spinning at 3,500 x g at 4 °C) and store at 4 °C. Use within 2 days and freshly label a new aliquot for subsequent repeats of the assay.
Protein function should always be validated after labeling with fluorescence dyes. This includes confirming that the labeled protein still binds to its partner with the same affinity.
Assay design
Reactions are set up in duplicate
Each well contains a 40 µl reaction.
Always include unlabeled controls as specified in Figure 1.
Figure 1. Experimental setup. See also Supplemental file 1.
Supplementary file 1 contains the worksheet for sample preparation.
The total protein concentration in each well should remain constant, and should be at least 10 times higher than the binding constant (Kd) of the interaction between the two components. The relative molar ratio between the two components varies continuously.
In the example in Supplementary file 1: the Kd is ~1 nM, hence we keep the total protein concentration in each tube at 150 nM.
This means that in column 2, we have 150 nM Protein1 (i.e., Histone-binding protein), and in column 14 we have 150 nM Protein2 (i.e., H3-H4), while in column 8 we have 75 nM Protein1 (i.e., Histone-binding protein) and 75 nM Protein2 (i.e., H3-H4).
Assay preparation
Prepare 1 µM stock of each protein, labeled and unlabeled.
Use the worksheet attached to prepare the stock solutions. These are prepared at twice the protein concentration required in the well reactions.
Final well reactions are prepared by mixing 20 µl of Protein1 solution with 20 µl of Protein2 solution, leading to the desired final protein concentration, as they are diluted two-fold in this step.
Mix well by pipetting, but avoid forming bubbles.
Spin down the plate at 100 x g (RCF: relative centrifugal force) for 1 min.
Data collection
The fluorescence intensity is measured in a CLARIOstar machine (BMG labtech) using the following settings:
Measure acceptor fluorescence:
Excitation wavelength-bandwidth: 625-30 nm;
Emission wavelength-bandwidth: 680-30 nm;
Dichroic: automatic;
Gain settings for this channel are adjusted automatically using the sample in wells B2, with highest acceptor dye concentration and no donor dye present.
Measure FRET:
Excitation wavelength-bandwidth: 488-15 nm;
Emission wavelength-bandwidth: 680-30 nm;
Dichroic: automatic;
Gain settings for this channel are not adjusted at first, when an average value is used to gauge the region of highest FRET. Further measurements are repeated at different gain settings to confirm the sample with highest FRET and then this sample (in our example well C8) is used for the final automatic adjustment and measurement.
Measure donor fluorescence:
Excitation wavelength-bandwidth: 488-15 nm;
Emission wavelength-bandwidth: 535-30 nm;
Dichroic: automatic;
Gain settings for this channel are adjusted automatically using the sample in wells A14, with highest donor dye concentration and no acceptor dye present.
The plate-reader software will output the raw data in Excel format.
Data analysis
Data analysis to calculate the corrected FRET signal is performed as described in Hieb et al. (2012) and Winkler et al. (2012). We attached an example analysis file (Supplemental file 2). In summary:
Perform buffer subtraction, as done in R1-AD29 in the attached analysis file (Supplemental file 2). Subtract the average intensity of the Buffer only samples (column 1) from each control and experimental measurement.
Calculate donor bleed-through intensity, as done in Q-AD35 in the attached analysis file. Calculate the ratio between the FRET intensity in the sample where only the donor dye is present (row A) and the donor fluorescence intensity in the same sample. Average the values obtained in the two replicates.
Calculate acceptor direct excitation intensity, as done in Q-AD37 in the attached analysis file. Calculate the ratio between the FRET intensity in the sample where only the acceptor dye is present (row B) and the acceptor fluorescence intensity in the same sample. Average the values obtained in the two replicates.
Calculate the corrected FRET, as done in Q-AD39 and Q-AD40 in the attached analysis file. This is equal to:
Measured FRET in the samples containing both dyes (row C)–donor bleed-through *donor signal in the same sample–acceptor direct excitation *acceptor signal in the same sample.
The average of the corrected FRET from the two replicates is plotted with the Standard deviation (Figure 2).
The stoichiometry is indicated by the sample with the highest FRET signal.
In this case, the sample with Protein1 molar ratio 0.5, meaning with a 1:1 ratio of Protein1 and Protein2 has the highest measured FRET, suggesting that the complex between these two proteins contains one equivalent of each protein.
Figure 2. Example plot of corrected FRET intensity
Notes
Previous knowledge of the binding affinity (Kd) of the two binding partners is required for the proper setup of the experiment and accurate interpretation of the results.
Other validated FRET pairs can be used with the described experimental setup.
Recipes
1 M dithiothreitol (DTT)
Dissolve 0.15425 g of DTT powder into 1 ml of ddH2O
Resuspend by vortexing and store at -20 °C for maximum 2 weeks
PD-10 buffer
20 mM Tris pH 7.5 (pH measured at room temperature)
300 mM NaCl
1 mM EDTA
1 mM TCEP
Binding buffer
20 mM Tris pH 7.5 (pH measured at room temperature)
300 mM NaCl
0.01% NP-40
0.01% CHAPS
1 mM EDTA
1 mM TCEP
Acknowledgments
This protocol was adapted from D’Arcy et al., 2013. F.M. is funded by EMBO (ALTF 1267-2013) and the Dutch Cancer Society (KWF 2014-6649). Research in the Luger lab is funded by the Howard Hughes Medical Institute and NIH (GM067777). The authors declare no conflicts of interest or competing interests.
References
D’Arcy, S., Martin, K. W., Panchenko, T., Chen, X., Bergeron, S., Stargell, L. A., Black, B. E. and Luger, K. (2013). Chaperone Nap1 shields histone surfaces used in a nucleosome and can put H2A-H2B in an unconventional tetrameric form. Mol Cell 51(5): 662-677.
Dyer, P. N., Edayathumangalam, R. S., White, C. L., Bao, Y., Chakravarthy, S., Muthurajan, U. M. and Luger, K. (2004). Reconstitution of nucleosome core particles from recombinant histones and DNA. Methods Enzymol 375: 23-44.
Hieb, A. R., D’Arcy, S., Kramer, M. A., White, A. E. and Luger, K. (2012). Fluorescence strategies for high-throughput quantification of protein interactions. Nucleic Acids Res 40: e33.
Huang, C. Y. (1982). Determination of binding stoichiometry by the continuous variation method: the Job plot. Methods Enzymol 87: 509-525.
Mattiroli, F., Gu, Y., Yadav, T., Balsbaugh, J. L., Harris, M. R., Findlay, E. S., Liu, Y., Radebaugh, C. A., Stargell, L. A., Ahn, N. G., Whitehouse, I. and Luger, K. (2017). DNA-mediated association of two histone-bound complexes of yeast Chromatin Assembly Factor-1 (CAF-1) drives tetrasome assembly in the wake of DNA replication. Elife 6.
Muthurajan, U., Mattiroli, F., Bergeron, S., Zhou, K., Gu, Y., Chakravarthy, S., Dyer, P., Irving, T. and Luger, K. (2016). In vitro chromatin assembly: Strategies and quality control. Methods Enzymol 573: 3-41.
Winkler, D.D., Luger, K. and Hieb, A. R. (2012). Quantifying chromatin-associated interactions: the HI-FI system. Methods Enzymol 512: 243-274.
Copyright: Mattiroli et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Mattiroli, F., Gu, Y. and Luger, K. (2018). FRET-based Stoichiometry Measurements of Protein Complexes in vitro. Bio-protocol 8(3): e2713. DOI: 10.21769/BioProtoc.2713.
Mattiroli, F., Gu, Y., Yadav, T., Balsbaugh, J. L., Harris, M. R., Findlay, E. S., Liu, Y., Radebaugh, C. A., Stargell, L. A., Ahn, N. G., Whitehouse, I. and Luger, K. (2017). DNA-mediated association of two histone-bound complexes of yeast Chromatin Assembly Factor-1 (CAF-1) drives tetrasome assembly in the wake of DNA replication. Elife 6.
Download Citation in RIS Format
Category
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,714 | https://bio-protocol.org/exchange/protocoldetail?id=2714&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Nucleosome Assembly Activity in vitro with the Nucleosome Assembly and Quantification (NAQ) Assay
FM Francesca Mattiroli
Yajie Gu
Karolin Luger
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2714 Views: 7456
Edited by: Gal Haimovich
Reviewed by: Emilia Krypotou Vinay Panwar
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Nucleosomes organize the eukaryotic genome into chromatin. In cells, nucleosome assembly relies on the activity of histone chaperones, proteins with high binding affinity to histones. At least a subset of histone chaperones promotes histone deposition in vivo. However, it has been challenging to characterize this activity, due to the lack of quantitative assays.
Here we developed a quantitative nucleosome assembly (NAQ) assay to measure the amount of nucleosome formation in vitro. This assay relies on a Micrococcal nuclease (MNase) digestion step that yields DNA fragments protected by the deposited histone proteins. A subsequent run on the Bioanalyzer machine allows the accurate quantification of the fragments (length and amount), relative to a loading control. This allows us to measure nucleosome formation by following the signature DNA length of ~150 bp. This assay finally enables the characterization of the nucleosome assembly activity of different histone chaperones, a step forward in the understanding of the functional roles of these proteins in vivo.
Keywords: Nucleosome assembly Histone chaperones Chromatin Micrococcal nuclease Quantification
Background
The eukaryotic genome is organized into nucleosomes. Nucleosomes are modular and dynamic structures composed of an octameric core of histone proteins, wrapped by 147 bp of DNA (Luger et al., 1997). Nucleosome assembly begins with the deposition of one (H3-H4)2 tetramer onto DNA to form a tetrasome. Subsequent incorporation of H2A-H2B dimers forms a hexasome, and finally the nucleosome. Histones are highly positively charged small proteins that primarily exist as histone dimers at physiological salt concentrations. Because of their charges, histones require chaperones which shuttle them from the cytoplasm to the nucleus, and then aid their deposition onto, or removal from DNA (Gurard-Levin et al., 2014).
Histone chaperones are grouped in families of structurally unrelated proteins, all characterized by high binding affinity for histones (Laskey et al., 1978). In this way, they shield the histone charges and prevent their non-specific interaction with DNA and other cellular factors (Elsässer and D’Arcy, 2013). How histone chaperones participate in these different roles, and the degree of division of labor among histone chaperones remain largely unknown.
This is due to the lack of mechanistic knowledge of histone chaperone function, in particular as histone deposition factors onto DNA. It is therefore critical to develop assays that can measure histone deposition activity, i.e., nucleosome assembly, to be able to fully understand the functions of this class of proteins and the dynamics of histones in cells.
Because histone chaperones are not enzymes per se, it has been challenging to develop reliable assays to measure their histone deposition activity. Most existing assays have used native gel analysis to assay nucleosome assembly (Muthurajan et al., 2016). The readout in these assays is prone to misinterpretation, as histones and DNA can form a variety of complexes and native gel analysis is not sufficient to accurately distinguish between the different histone-DNA complexes.
We have developed a nucleosome assembly and quantitation (NAQ) assay that measures the amount of nucleosome particles formation in vitro. This assay relies on the activity of Micrococcal Nuclease (MNase), an enzyme that digests DNA that is not bound by histone proteins. The subsequent purification of the DNA fragments provides a footprint of the histone-DNA complexes in solution. The characteristic protection of ~150 bp DNA is a signature of intact nucleosome species and can be measured using a Bioanalyzer apparatus (Muthurajan et al., 2016). Data normalization to a loading control DNA allows us to compare and accurately quantify the amount of nucleosomes formed in different samples. The NAQ assay has been successfully used to measure the activity of the chromatin assembly factor 1 (CAF-1) in vitro (Mattiroli et al., 2017a and 2017b), and has the potential to reveal the differential contribution of histone chaperones to nucleosome assembly in cells. This will pave the way for the complete understanding of their functional roles in nucleosome dynamics.
Materials and Reagents
Low retention pipette tips (USA Scientific)
PCR tubes (USA Scientific, catalog number: 1402-4308 )
1.5 ml tubes (Fisher Scientific, catalog number: 05-408-129 )
207 bp DNA (procedure explained in Dyer et al., 2004)
Loading control DNA [of length between 400 and 1,000 bp, we use a 621 bp DNA (procedure explained in Muthurajan et al., 2016)]
Refolded H2A-H2B (procedure explained in Dyer et al., 2004) or H2A-H2B labeled with ATTO 647N (procedure explained in Muthurajan et al., 2016).
Refolded (H3-H4)2 (procedure explained in Dyer et al., 2004)
Recombinant histone chaperone
Salt-assembled nucleosome (procedures explained in Dyer et al., 2004)
50% glycerol (autoclaved and stored at room temperature)
50 bp DNA ladder (Gold Bio, catalog number: D100-500 )
10x MNase buffer (New England Biolabs, provided with M0247S )
100x BSA (New England Biolabs, catalog number: B9001 )
Note: This product has been discontinued.
Micrococcal nuclease (MNase) (New England Biolabs, catalog number: M0247S )
MinElute kit (QIAGEN, catalog number: 28006 )
Proteinase K, 20 mg/ml solution (BioExpress, catalog number: E195-5ML )
Tris (2-Carboxyethyl) phosphine Hydrochloride (TCEP) (Gold Bio, catalog number: TCEP100 )
Sodium hydroxide (NaOH) (Fisher Scientific, catalog number: S318-3 )
Tris base (Fisher Scientific, catalog number: BP152-5 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-10 )
500 mM EDTA solution at pH ~8 (stored at room temperature)
Tween-20 (Fisher Scientific, catalog number: BP337 )
SYBR Gold nucleic acid gel stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: S11494 )
Boric acid (Acros Organics, catalog number: 180570025 )
Ammonium persulfate (AMRESCO, catalog number: 0486 )
30% acrylamide 37.5:1 (Life science Products, catalog number: EC-890 )
Tetramethylethylenediamine (TEMED) (Fisher Scientific, catalog number: BP150-20 )
Bromophenol blue (Fisher Scientific, catalog number: B392-5 )
Xylene cyanol FF (Sigma Aldrich, catalog number: X4126 )
Sodium acetate (Fisher Scientific, catalog number: S210-500 )
Acetic acid (Avantor Performance Materials, catalog number: V193-46 )
1 M TCEP (Tris (2-Carboxyethyl) phosphine Hydrochloride; see Recipes)
NA buffer (see Recipes)
SYBR Gold stain solution (see Recipes)
10x TBE (Tris/Borate/EDTA; see Recipes)
25% APS (Ammonium Persulfate; see Recipes)
6% PAGE gels (see Recipes)
10% PAGE gels (see Recipes)
DNA sample buffer (see Recipes)
3 M Na acetate pH 5.0 solution (see Recipes)
Equipment
Pipettes (Gilson)
PAGE running apparatus (Hoefer, model: SE250 )
Thermoblock (Fisher Scientific, catalog number: 11-718 )
Centrifuge (Eppendorf, model: 5417 C )
Typhoon FLA 9500 (GE Healthcare, model: Typhoon FLA 9500, catalog number: 28996943 )
Bioanalyzer (Agilent)
DNA 1000 chip for Bioanalyzer (Agilent Technologies, catalog number: 5067-1504 )
Software
Agilent Expert 2100 Software
Excel Software
Procedure
The workflow of the NAQ assay is shown in Figure 1:
Figure 1. Workflow of the NAQ assay procedure. In gray are the optional steps.
Nucleosome assembly reaction
Prepare a 40 µl reaction in NA buffer (see Recipes) containing:
200 nM histone chaperone
200 nM (H3-H4)2 (tetramer concentration)
400 nM H2A-H2B (dimer concentration)
Notes:
It is important to pipette the histone chaperone first, as the histones are destabilized at low salt concentration.
Histones are added subsequently in any order. Octamer preparations (Dyer et al., 2004) (200 nM) can also be used instead of separate (H3-H4)2 and H2A-H2B addition.
Keep the stock solutions at 4 °C, but the reaction at room temperature (20 °C).
We normally set up reactions for multiple histone chaperone concentrations, usually between 100 and 800 nM (or 0.5-4 times the concentration of histones and DNA components).
Always include a ‘no chaperone’ reaction (where only histones are present), a chaperone only reaction (where no histones are present) and a salt-reconstituted nucleosome reaction (pre-assembled on 207 bp DNA [Dyer et al., 2004]). These are set up in parallel and treated exactly like the assembly reactions.
Incubate for 15 min at room temperature.
Add 200 nM of 207 bp DNA, and mix by pipetting.
Incubate for 30 min at room temperature.
Proceed with the following steps and do not store the assembly reactions.
Native PAGE analysis of assembled nucleosomes
10 µl of the assembly reaction can be used for native PAGE analysis for validation purposes:
Add 2 µl of 50% glycerol stock.
Load 4 µl of the final mix onto a 6% native PAGE (see Recipes) and run in 0.2x TBE buffer (pre-run gel at 150 V at 4 °C for 1 h, see Recipes).
Include a lane with a DNA ladder (50 bp DNA ladder).
Run samples at 150 V for 70 min at 4 °C.
Stain with SYBR GOLD stain solution (see Recipes) for 20 min at room temperature.
Image with Typhoon: Cy2/488 and A647 (if using ATTO 647N labeled H2A-H2B), with PMT (photomultiplier tube) at 500 V and resolution at 100 µm.
An example of native PAGE analysis of assembled nucleosomes is shown in Figure 2.
Figure 2. Example of 6% PAGE analysis of the purified DNA. Nuc stands for salt-assembled nucleosomes. tCAF-1 is an active construct of the histone chaperone CAF-1 (Mattiroli et al., 2017b).
Micrococcal Nuclease digestion and DNA purification
Take 25 µl of the nucleosome assembly reaction and mix with 10 µl of 10x MNase buffer, 1 µl 100x BSA, 1 µl of MNase (stock at 25 U/µl) and 63 µl of water.
Incubate for 10 min in a thermoblock at 37 °C
Quench the reaction by adding 10 µl of 500 mM EDTA (final EDTA concentration ~50 mM).
Optional: Treat the sample with 25 µg of Proteinase K (1.25 µl of a 20 mg/ml solution) for 20 min at 50 °C.
Add 550 µl of PB buffer from MinElute kit (QIAGEN) and 10 µl of 3 M Na acetate pH 5.0 solution.
Incubate for 10 min at room temperature.
Add 50 ng of loading control DNA (stock at 25 ng/µl).
Apply sample to the spin column.
Centrifuge for 1 min at 16,000 x g at room temperature.
Discard flow-through.
Wash membrane with 100 µl of PB buffer.
Centrifuge for 1 min at 16,000 x g at room temperature.
Discard flow-through.
Wash membrane with 700 µl of PE buffer.
Centrifuge for 1 min at 16,000 x g at room temperature.
Discard flow-through.
Centrifuge for 1 min at 16,000 x g at room temperature.
Discard flow-through.
Apply 10 µl of ddH2O to the spin column (make sure the tip of the pipette is in the center of the membrane).
Incubate for 10 min at room temperature.
Place spin column into a clean Eppendorf tube.
Centrifuge for 1 min at 16,000 x g at room temperature.
Purified DNA analysis on native PAGE
2.5 µl of the purified DNA can be used for native PAGE analysis for validation purposes:
Add 2.5 µl of 2x DNA sample buffer.
Load 5 µl of the final mix onto a 10% native PAGE (see Recipes) and run in 0.5x TBE buffer.
Include a lane with 50 bp DNA ladder.
Run samples at 200 V for 50 min at room temperature.
Stain with SYBR GOLD stain solution for 10 min at room temperature.
Image with Typhoon: Cy2/488 with PMT (photomultiplier tube) at 500 V and resolution at 100 µm.
An example of native PAGE analysis of the purified DNA is shown in Figure 3.
Figure 3. Example of 10% PAGE analysis of the purified DNA. Nuc stands for salt-assembled nucleosomes. tCAF-1 is an active construct of the histone chaperone CAF-1 (Mattiroli et al., 2017b).
Bioanalyzer run
Inject 1 µl of the purified DNA (at least 15-20 ng of DNA) into a DNA1000 chip in a Bioanalyzer machine.
Data analysis
The output of the Bioanalyzer run (Figure 4) is checked in the Expert 2100 Software to keep the signal threshold to 20 RFU (relative fluorescence units).
Figure 4. Example of Bioanalyzer output data. Nuc stands for salt-assembled nucleosomes. tCAF-1 is an active construct of the histone chaperone CAF-1 (Mattiroli et al., 2017b).
The data is then analyzed in Excel. We use an example to explain the analysis procedure (Figures 5 and 6).
Figure 5. Example of output Bioanalyzer data of two samples. Sample 1 (columns A-C). Sample 2 (columns E-G). Column I explains the interpreted nature of the bands identified.
Sum the molarity of the fragments with size between 126-165 bp (orange) to obtain 126-165 bp fragments [nM] (column L in Figure 6)
Sample 1: 16.6 + 13.8 + 29.1 + 19.5 + 28.6 = 107.5 nM
Sample 2: 13.6 + 11.6 + 22.3 + 13.2 + 21.3 = 82 nM
Perform loading control DNA correction to obtain loading control [nM] (column M in Figure 6)
Molarity of the loading control (C18 or G18) x Size [bp] of the loading control (A18 or E18)/621 bp (exact length of the loading control DNA)
Sample 1: 5.9 x 743/621= 7.06 nM
Sample 2: 6.8 x 752/621= 8.23 nM
Normalize the amount of 126-165 bp fragments [nM] (column L in Figure 6) to the loading control [nM] (column M in Figure 6) to obtain the Normalized values used for sample comparison (column N in Figure 6).
Sample 1: 107.5/7.06 = 15.24
Sample 2: 82/8.23 = 9.96
Figure 6. Analysis table example
These values are then plotted in Excel or other software (GraphPad Prism) to show the amount of nucleosome formation in each sample and to allow comparisons.
These values can be expressed as percentage of nucleosomal DNA fragments, calculated by running a known amount of untreated pure 207 bp DNA into the Bioanalyzer to deduce the conversion factor for the theoretical maximum DNA amount.
For example:
If the analysis of untreated 207 bp DNA yields a Normalized nM value of 35.
Sample 1 above will contain the following percentage (%) of nucleosome protected DNA:
% nucleosomal DNA fragmentsSample 1 = 100 x normalized valueSample 1/normalized valueuntreated DNA
% nucleosomal DNA fragmentsSample 1 = 100 x 15.24/35 = 42.8%
Notes
Fluorescently-labeled H2A-H2B histones can be used in this assay to facilitate the identification of the nucleosome band in the assembly gel analysis.
H2A-H2B associate with a tetrasome in absence of histone chaperones (Mattiroli et al., 2017b).
The Bioanalyzer machine estimates the fragments size based on the elution time of the peaks and using the upper and lower marker bands as references. This leads to errors in the absolute measure of the fragment bp length. Use a salt-assembled nucleosome control to check for this variation in each experiment.
Recipes
1 M TCEP
0.2866 g of TCEP (Tris (2-Carboxyethyl) phosphine Hydrochloride)
360 µl of 10 M NaOH
ddH2O to 1.5 ml
Use fresh or store at -20 °C for use within one week (limit freeze/thaw cycles)
NA buffer
25 mM Tris pH 7.5 (pH measured at room temperature)
150 mM NaCl
1 mM EDTA
0.02% Tween 20
Store at 4 °C and add a final concentration of 0.5 mM TCEP just before use
SYBR Gold stain solution
Dissolve 3 µl of SYBR Gold gel stain into 50 ml of ddH2O or 0.2x TBE buffer
10x TBE buffer (Tris/Borate/EDTA)
890 mM Tris
890 mM boric acid
20 mM EDTA pH 8.0
25% APS
Dissolve 0.25 g of ammonium persulfate in 1 ml of ddH2O
Store at 4 °C for not longer than 1 week
6% PAGE (final concentrations)
6% acrylamide
0.2x TBE
0.05% APS
0.08% TEMED
10% PAGE (final concentrations)
10% acrylamide
1x TBE
0.1% APS
0.1% TEMED
DNA sample buffer
30% (v/v) glycerol
0.25% (w/v) bromophenol blue
0.25% (w/v) xylene cyanol FF
Store at 4 °C
3 M Na acetate pH 5.0 solution
3 M sodium acetate
Adjust pH with acetic acid to pH 5.0.
Store at room temperature
Acknowledgments
We thank Serge Bergeron for optimization of the assembly part of the protocol. F.M. is funded by EMBO (ALTF 1267-2013) and the Dutch Cancer Society (KWF 2014-6649). Research in the Luger lab is funded by the Howard Hughes Medical Institute and NIH (GM067777). The authors declare no conflicts of interest or competing interests.
References
Dyer, P. N., Edayathumangalam, R. S., White, C. L., Bao, Y., Chakravarthy, S., Muthurajan, U. M. and Luger, K. (2004). Reconstitution of nucleosome core particles from recombinant histones and DNA. Methods Enzymol 375: 23-44.
Elsässer, S. J. and D’Arcy, S. (2013). Towards a mechanism for histone chaperones. Biochim Biophys Acta 1819(3-4): 211-221.
Gurard-Levin, Z. A., Quivy, J. P. and Almouzni, G. (2014). Histone chaperones: assisting histone traffic and nucleosome dynamics. Annu Rev Biochem 83: 487-517.
Laskey, R. A., Honda, B. M., Mills, A. D. and Finch, J. T. (1978). Nucleosomes are assembled by an acidic protein which binds histones and transfers them to DNA. Nature 275(5679): 416-420.
Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F. and Richmond, T. J. (1997). Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389(6648): 251-260.
Mattiroli, F., Gu, Y., Balsbaugh, J. L., Ahn, N. G. and Luger, K. (2017a). The Cac2 subunit is essential for productive histone binding and nucleosome assembly in CAF-1. Sci Rep 7: 46274.
Mattiroli, F., Gu, Y., Yadav, T., Balsbaugh, J. L., Harris, M. R., Findlay, E. S., Liu, Y., Radebaugh, C. A., Stargell, L. A., Ahn, N. G., Whitehouse, I. and Luger, K. (2017b). DNA-mediated association of two histone-bound complexes of yeast Chromatin Assembly Factor-1 (CAF-1) drives tetrasome assembly in the wake of DNA replication. Elife 6.
Muthurajan, U., Mattiroli, F., Bergeron, S., Zhou, K., Gu, Y., Chakravarthy, S., Dyer, P., Irving, T. and Luger, K. (2016). In vitro chromatin assembly: Strategies and quality control. Methods Enzymol 573: 3-41.
Copyright: Mattiroli et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Mattiroli, F., Gu, Y. and Luger, K. (2018). Measuring Nucleosome Assembly Activity in vitro with the Nucleosome Assembly and Quantification (NAQ) Assay. Bio-protocol 8(3): e2714. DOI: 10.21769/BioProtoc.2714.
Mattiroli, F., Gu, Y., Yadav, T., Balsbaugh, J. L., Harris, M. R., Findlay, E. S., Liu, Y., Radebaugh, C. A., Stargell, L. A., Ahn, N. G., Whitehouse, I. and Luger, K. (2017). DNA-mediated association of two histone-bound complexes of yeast Chromatin Assembly Factor-1 (CAF-1) drives tetrasome assembly in the wake of DNA replication. Elife 6.
Download Citation in RIS Format
Category
Molecular Biology > Protein > Protein-DNA binding
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,715 | https://bio-protocol.org/exchange/protocoldetail?id=2715&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Analysis of Pan-metabolome Polar Metabolites by Ultra Performance Liquid Chromatography–Tandem Mass Spectrometry (UPLC-MS/MS)
DM Dania M. Malik
SR Seth Rhoades
AW Aalim Weljie
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2715 Views: 8350
Edited by: Neelanjan Bose
Reviewed by: Anca Flavia Savulescu
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Modern triple quadrupole mass spectrometers provide the ability to detect and quantify a large number of metabolites using tandem mass spectrometry (MS/MS). Liquid chromatography (LC) is advantageous, as it does not require derivatization procedures and a large diversity in physiochemical characteristics of analytes can be accommodated through a variety of column chemistries. Recently, the comprehensive optimization of LC-MS metabolomics using design of experiments (COLMeD) approach has been described and used by our group to develop robust LC-MS workflows (Rhoades and Weljie, 2016). The optimized LC-MS/MS method described here has been utilized extensively for metabolomics analysis of polar metabolites. Typically, tissue or biofluid samples are extracted using a modified Bligh-Dyer protocol (Bligh and Dyer, 1959; Tambellini et al., 2013). The protocol described herein describes this workflow using targeted polar metabolite multiple reaction monitoring (MRM) from tissues and biofluids via ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS). This workflow has been utilized extensively for chronometabolic analysis (Krishnaiah et al., 2017), with applications generalized to other types of analyses as well (Sengupta et al., 2017; Sivanand et al., 2017).
Keywords: UPLC-MS Tandem mass spectrometry Metabolomics Triple quadrupole Liquid-liquid extraction MRM Liquid chromatography
Background
Metabolomics is a field of study aiming to comprehensively analyze metabolites through the use of various analytical detection methods, namely mass spectrometry (MS) and nuclear magnetic resonance (NMR) (Liu and Locasale, 2017). Although both NMR and MS are essential tools in metabolomics, mass spectrometry can analyze samples with greater sensitivity (Liu and Locasale, 2017). Within mass spectrometry, various approaches are available, however a rapid approach to profile the global metabolome is needed (Lv et al., 2011; Rhoades and Weljie, 2016). Advancements in triple quadrupole mass spectrometers have made them well suited for ion-switching methods (scanning in both positive and negative ion modes within a single analysis) in addition to enabling reproducible and sensitive targeted profiling of numerous metabolites (Lv et al., 2011; Gika et al., 2012; Yuan et al., 2012; Rhoades and Weljie, 2016). Additionally, LC typically does not require extensive sample preparation, nor derivatization, which allows for the detection of a broader range of metabolites (Gika et al., 2012; Liu and Locasale, 2017). Nonetheless, development of LC-MS methods to comprehensively analyze small polar metabolites is nontrivial, and requires advanced modeling to optimize both LC and MS factors simultaneously. Thus, the COLMeD approach aimed to address this challenge and enabled a more comprehensive metabolite analysis across platforms including on a triple quadrupole mass spectrometer (Rhoades and Weljie, 2016). The LC-MS workflow on a triple quadrupole is described here and has been used to successfully study metabolomics in a circadian context in which 179 metabolites were successfully profiled and analyzed (Krishnaiah et al., 2017).
Materials and Reagents
Pipette tips 1,000 μl, 200 μl, 10 μl (Gilson, catalog numbers: F1735001 , F1733001 , F1732001 )
1.7 ml PosiClick tubes (Denville Scientific, catalog number: C2170 )
2.0 ml Safe-Lock tubes (Eppendorf, catalog number: 022363352 )
Mass spectrometry vials and caps–Verex Vial Kit, 9 mm, PP, 300 μl + PTFE/Silicone, pre slit (Phenomenex, catalog number: AR0-9992-13 )
Stainless steel beads 5 mm (QIAGEN, catalog number: 69989 )
Gloves (Denville Scientific, catalog number: G4161 )
Sample trays
VanGuard cartridge holder (WATERS, catalog number: 186007949 )
XBridge BEH Amide 2.5 μm XP Vanguard Cartridge, 2.1 x 5 mm (WATERS, catalog number: 186007763 )
XBridge BEH Amide 2.5 μm, 2.1 x 100 mm column XP (WATERS, catalog number: 186006091 )
Acquity UPLC column In-Line Filter Kit (WATERS, catalog number: 205000343 )
MilliQ water–18 mΩ, 0.22 μm filter (Merck, catalog number: MPGP04001 )
Acetonitrile–Optima LC/MS (Fisher Scientific, catalog number: A955-4 )
Ammonium acetate (Sigma-Aldrich, catalog number: 73594-25G-F )
Ammonium hydroxide TraceMetal grade (Fisher Scientific, catalog number: A512-P500 )
Argon compressed gas (Airgas)
Chloroform (Fisher Scientific, catalog number: C298-1 )
Methanol optima LCMS (Fisher Scientific, catalog number: A456-4 )
Nitrogen gas (Airgas, catalog number: NI230LT230RB )
Solvent A (see Recipes)
Solvent B (see Recipes)
Seal wash (see Recipes)
Equipment
Pipettes (P1000, P200, P20, P10)
Centrifuge (Eppendorf, model: 5430 R , catalog number: 022620511)
Vortex
ACQUITY H-Class UPLC (WATERS, model: ACQUITY UPLC H-Class )
Bath Sonicator (VWR, catalog number: 97043-976 )
Speed Vacuum–Vacufuge Plus (Eppendorf, model: Vacufuge plus , catalog number: 022822993)
TissueLyser II (QIAGEN, catalog number: 85300 )
Xevo TQ-S Micro (WATERS, model: Xevo TQ-S Micro )
Software
MassLynx Version 4.1
TargetLynx XS
R (version 3.3)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Malik, D. M., Rhoades, S. D. and Weljie, A. M. (2018). Extraction and Analysis of Pan-metabolome Polar Metabolites by Ultra Performance Liquid Chromatography–Tandem Mass Spectrometry (UPLC-MS/MS). Bio-protocol 8(3): e2715. DOI: 10.21769/BioProtoc.2715.
Download Citation in RIS Format
Category
Systems Biology > Metabolomics > Biofluid
Systems Biology > Metabolomics > Tissue
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,716 | https://bio-protocol.org/exchange/protocoldetail?id=2716&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Medaka-microinjection with an Upright Microscope
Yu Murakami
MK Masato Kinoshita
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2716 Views: 7211
Edited by: David Cisneros
Reviewed by: Alberto RissoneMichelle Goody
Original Research Article:
The authors used this protocol in 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
2017
Abstract
We described a simple method for microinjecting DNA/RNA/Protein solutions into medaka eggs under an upright microscope. Medaka is an excellent vertebrate model for reverse genetics, because of its daily spawning, short generation time, and egg transparency. These features enable us to efficiently perform functional genomic analyses of transgenic or genome edited fish. This protocol contains the initial steps necessary to create various types of genetically modified fish.
Keywords: Fish Medaka Microinjection Upright microscope Genome editing Transgenesis
Background
Medaka is a small freshwater teleost species and has desirable features for use as a vertebrate model, including daily spawning, complete genome sequence, and availability of a number of useful strains. Moreover, the transparency of its eggs enables precise introduction of DNA/RNA/Protein solutions into the cytoplasm of the eggs by microinjection. Microinjection is important for the functional genomic analysis; for example, DNA microinjection is an indispensable technique for generating transgenic fish, and helps us to understand the functions of introduced genes in vivo (Ozato et al., 1986). Furthermore, microinjection of CRISPR/Cas system is able to achieve targeted genome editings such as knockout and knock-in approaches (Ansai and Kinoshita, 2014; Murakami et al., 2017a).
Both of a stereoscopic microscope and an upright microscope can be used for microinjection into fish embryos. Although microinjection with an upright microscope requires attachment of some specific instruments including a micromanipulator and an injection needle holder to the microscope, this method may achieve more precise introduction of solutions into the cytoplasm than that with a stereoscopic microscope due to its high resolution property. In this paper, we described the outline of a microinjection method with an upright microscope. This method can be used together with other protocols, such as those for the generation of gene knockout or gene knock-in lines (Ansai and Kinoshita, 2014; Murakami et al., 2017b).
Materials and Reagents
Spatula (SANSYO, catalog number: 93-4159 or equivalents)
Cutter (SANSYO, catalog number: 97-0417 or equivalents)
Glass capillary (NARISHIGE, catalog number: GD-1 )
Egg holder plate (Figure 1)
Silicone sealant; repair materials made of silicone (Konishi, catalog number: 04890 or equivalents)
Micro-loading tip (Eppendorf, catalog number: 5242956003 )
Disposable syringe (TERUMO, catalog number: 4987350396457 or equivalents)
Disposable glass pipette (SANSYO, catalog number: 73-0102 or equivalents)
Needle (Hamilton, catalog number: KF731 )
Plastic dish (35 mm in diameter) (Corning, Falcon®, catalog number: 351008 )
Male fish
Female fish
Mineral oil (NACALAI TESQUE, catalog number: 23306-84 )
Methylene blue (NACALAI TESQUE, catalog number: 37125-95 )
Phenol red (NACALAI TESQUE, catalog number: 26807-21 )
Sodium chloride (NaCl)
Potassium chloride (KCl)
Calcium chloride dihydrate (CaCl2·2H2O)
Magnesium sulfate heptahydrate (MgSO4·7H2O)
17 mM methylene blue (see Recipes)
100x embryo culture medium (see Recipes)
Embryo culture medium (see Recipes)
Equipment
Forceps (DUMONT, model: 91-3869 or equivalents)
Micropipette puller (NARISHIGE, model: PC-100 )
Microinjection system (NARISHIGE, models: M-152 and IM-6 )
Stereoscopic microscope (Leica Microsystems, model: WILD MZ8 )
Upright microscope modified to attach micro-manipulator system (Nikon, model: XF-PH-21 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Murakami, Y. and Kinoshita, M. (2018). Medaka-microinjection with an Upright Microscope. Bio-protocol 8(3): e2716. DOI: 10.21769/BioProtoc.2716.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Mutagenesis
Cell Biology > Cell engineering > Microinjection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,717 | https://bio-protocol.org/exchange/protocoldetail?id=2717&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunoprecipitation of Tri-methylated Capped RNA
KH Karen E. Hayes
JB Jamie A. Barr
MX Mingyi Xie
JS Joan A. Steitz
Ivan Martinez
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2717 Views: 8385
Edited by: Gal Haimovich
Reviewed by: Savita NairAnca Flavia Savulescu
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
Cellular quiescence (also known as G0 arrest) is characterized by reduced DNA replication, increased autophagy, and increased expression of cyclin-dependent kinase p27Kip1. Quiescence is essential for wound healing, organ regeneration, and preventing neoplasia. Previous findings indicate that microRNAs (miRNAs) play an important role in regulating cellular quiescence. Our recent publication demonstrated the existence of an alternative miRNA biogenesis pathway in primary human foreskin fibroblast (HFF) cells during quiescence. Indeed, we have identified a group of pri-miRNAs (whose mature miRNAs were found induced during quiescence) modified with a 2,2,7-trimethylguanosine (TMG)-cap by the trimethylguanosine synthase 1 (TGS1) protein and transported to the cytoplasm by the Exportin-1 (XPO1) protein. We used an antibody against (TMG)-caps (which does not cross-react with the (m7G)-caps that most pri-miRNAs or mRNAs contain [Luhrmann et al., 1982]) to perform RNA immunoprecipitations from total RNA extracts of proliferating or quiescent HFFs. The novelty of this assay is the specific isolation of pri-miRNAs as well as other non-coding RNAs containing a TMG-cap modification.
Keywords: m2,2,7G-cap RNA TMG-cap RNA Tri-methylated RNA RNA immunoprecipitation Pri-miRNA
Background
Cellular quiescence, a type of reversible growth arrest, is an important cellular state involved in wound healing, organ regeneration, and preventing neoplasia (Coller, 2011; Valcourt et al., 2012). Small non-coding RNAs such as miRNAs have been found involved in the regulation of cellular quiescence. miRNAs are small non-coding RNAs ~22-nucleotides long that regulate the expression of protein-coding genes by base-pairing with the 3’ untranslated region (3’UTR) of messenger RNAs (mRNAs) (Esteller, 2011). The canonical miRNA biogenesis pathway is based on a stepwise processing machinery (Ha and Kim, 2014; Kim et al., 2016). miRNAs are transcribed to produce a primary miRNA (pri-miRNA) with an imperfect loop structure that is recognized by the enzyme Drosha and its binding partner DGCR8 in the nucleus. Cleavage of the pri-miRNA generates a precursor miRNA (pre-miRNA) that is recognized and transported to the cytoplasm by the Exportin-5 (XPO5) protein. The pre-miRNA is cleaved by the enzyme Dicer (mature miRNA) and loaded into the RNA-induced silencing complex (RISC). On the other hand, precursors of small nuclear RNAs (snRNAs) involved in mRNA processing such as U1, U2, U4, and U5 have a (m7G)-cap, which is recognized by cap-binding complex (CBC) and the phosphorylated adaptor for RNA export (PHAX) in the nucleus to enable their export to the cytoplasm by XPO1 (Ohno et al., 2000). These snRNAs are then recognized by Sec1/Munc18 (Sm) proteins (by binding to Sm binding site sequences) in the cytoplasm and TGS1 is recruited to hypermethylate the (m7G)-cap into a (m2,2,7G, TMG)-cap. This modification is recognized by Snuportin-1 in association with Importin-β and other factors to import the snRNAs back into the nucleus (Palacios et al., 1997; Kiss, 2004). Interestingly, XPO1 also has high affinity for the (TMG)-capped small nucleolar RNA (snoRNA) U3 in the nucleus and transports it from Cajal bodies to the nucleoli (Boulon et al., 2004). A previous study showed that TGS1 enhances Rev-dependent HIV-1 RNA expression by (TMG)-capping viral mRNAs in the nucleus, thereby increasing recognition by XPO1 for transport to the cytoplasm (Yedavalli and Jeang, 2010). These findings suggest that TMG-capping of RNAs gives plasticity to different types of RNA molecules in order to regulate their processing and cellular localization. Our recent findings demonstrated the existence of a group of pri-miRNAs modified with a 2,2,7-trimethylguanosine (TMG)-cap by TGS1 protein and transported to the cytoplasm by XPO1 during quiescence. Previous publications have shown the ability to pull-down (TMG)-cap RNAs, such as snRNAs and snoRNAs, with specific antibodies against (TMG)-cap RNAs (Luhrmann et al., 1982). Our previous publications demonstrated for the first time the pull-down of (TMG)-cap pri-miRNAs in human cells (Martinez et al., 2017). Understanding which RNAs could be modified with a TMG-cap will provide new important insights into RNA biogenesis in normal or disease-related conditions.
Materials and Reagents
1.5 ml microcentrifuge tubes (Fisher Scientific, catalog number: 05-408-129 )
15 ml conical centrifuge tubes (DNase-/RNase-free) (Corning, catalog number: 430052 )
GilsonTM EXPERTTM University Fit pipette filter tips (Gilson, catalog numbers: F1731031 , F1733031 , F1735031 , F1737031 )
Gel-loading pipet tips (Fisher Scientific, catalog number: 02-707-139 )
Large-orifice pipet tips (Fisher Scientific, catalog number: 02-707-134 )
Sterile polystyrene disposable serological pipettes (Greiner Bio One International, catalog number: 710180 )
Serological pipettes
2 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11C )
5 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11D )
10 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11E )
25 ml serological pipettes (Fisher Scientific, catalog number: 13-678-11 )
150 cm2 vented tissue culture treated flasks (Corning, Falcon®, catalog number: 355001 )
100 mm TC-treated cell culture dish (Corning, Falcon®, catalog number: 353033 )
Cell scrapers (Fisher Scientific, catalog number: 08-100-242 )
HFF cells (obtained from the Yale Skin Disease Research Center) (Alternative source of HFF cells from ATCC: Hs27 (ATCC, catalog number: CRL-1634 )
DMEM (Sigma-Aldrich, catalog number: D7777 )
Minimum essential medium (MEM) non-essential amino acids, 100x (Thermo Fisher Scientific, catalog number: 11140076 )
0.05% trypsin-EDTA with phenol red (Thermo Fisher Scientific, catalog number: 25300054 )
10x PBS (Sigma-Aldrich, catalog number: P5493 )
Nuclease-free water (not DEPC-Treated) (Thermo Fisher Scientific, catalog number: AM9937 )
TRIzolTM Reagent (Thermo Fisher Scientific, catalog number: 15596026 )
RNase AWAYTM Surface Decontaminant (Thermo Fisher Scientific, catalog number: 7002 )
Chloroform (Sigma-Aldrich, catalog number: C2432 )
Ethanol, molecular biology grade (Fisher Scientific, catalog number: BP2818-500 )
Isopropanol, molecular biology grade (Fisher Scientific, catalog number: BP26184 )
GlycoBlueTM Coprecipitant (15 mg/ml) (Thermo Fisher Scientific, catalog number: AM9516 )
TURBO DNA-freeTM Kit (Thermo Fisher Scientific, catalog number: AM1907 )
Anti-m3G-cap, rabbit polyclonal, antiserum (Synaptic Systems)*
Note: *Synaptic Systems discontinued the production of the Anti-m3G-cap, rabbit polyclonal, antiserum. Creative Diagnostics has a rabbit anti-TMG antibody (Anti-m3G-cap polyclonal antibody, Creative Diagnostics, catalog number: DPAB29202 ) that would be similar to the one we previously used but the experimental conditions have to be re-evaluated.
Protein G Sepharose® 4 Fast Flow Beads (GE Healthcare, catalog number: 17061801 )
Normal rabbit serum (control, EMD Millipore, catalog number: NS01L-1ML )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-3 )
NP-40 (Thermo Fisher Scientific, catalog number: 28324 )
Tris base (Fisher Scientific, catalog number: BP152-5 )
Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-1 )
RNasinTM Plus RNase inhibitor (Promega, catalog number: N2611 )
NaOAc (AMRESCO, catalog number: 0602 )
Ethylenediaminetetraacetate acid (EDTA), pH 8 (Thermo Fisher Scientific, catalog number: AM9260G )
Ethylenediaminetetraacetate acid (EDTA) (AMRESCO, catalog number: 0105 )
Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: AM9822 )
Phenol/Chloroform/Isoamyl Alcohol; 125:24:1 mixture, pH 4.5 (Thermo Fisher Scientific, catalog number: AM9720 )
Agarose LE (Denville Scientific, catalog number: CA3510-8 )
iScriptTM cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708891 )
Sso AdvancedTM Universal SYBR® Green Supermix (Bio-Rad Laboratories, catalog number: 1725274 )
PARISTM Kit (Thermo Fisher Scientific, catalog number: AM1921 )
Boric acid (Fisher Scientific, catalog number: A73-1 )
NET-2 Buffer (see Recipes)
G-50 Buffer (see Recipes)
1x TBE (see Recipes)
Equipment
Micropipettes (Gilson, model: Pipetman® L, catalog number: F167370 )
FormaTM Steri-CycleTM CO2 Incubator (Thermo Scientific, model: FormaTM Steri-CycleTM CO2 Incubators, catalog number: 370)
-80 °C freeze
SorvallTM LegendTM Micro 21R Microcentrifuge (Thermo Fisher Scientific, model: SorvallTM LegendTM Micro 21R , catalog number: 75002490)
EppendorfTM ThermomixerTM R (Eppendorf, model: Thermomixer R , catalog number: 05-412-401)
LabquakeTM Tube Shaker/Rotator (Thermo Fisher Scientific, catalog number: C4152110Q )
SorvallTM ST 40R Centrifuge (Thermo Fisher Scientific, model: SorvallTM ST 40R , catalog number: 75004525)
NanoDropTM 2000 Spectrophotometer (Thermo Fisher Scientific, model: NanoDropTM 2000 , catalog number: ND-2000)
T100TM Thermal Cycler (Bio-Rad Laboratories, catalog number: 1861096 )
CFX ConnectTM Real-Time PCR Detection System (Bio-Rad Laboratories, catalog number: 1855200 )
UV transilluminator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hayes, K. E., Barr, J. A., Xie, M., Steitz, J. A. and Martinez, I. (2018). Immunoprecipitation of Tri-methylated Capped RNA. Bio-protocol 8(3): e2717. DOI: 10.21769/BioProtoc.2717.
Download Citation in RIS Format
Category
Molecular Biology > RNA > RNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,718 | https://bio-protocol.org/exchange/protocoldetail?id=2718&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Identification of Insertion Site by RESDA-PCR in Chlamydomonas Mutants Generated by AphVIII Random Insertional Mutagenesis
Fantao Kong
YL Yonghua Li-Beisson
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2718 Views: 7342
Reviewed by: Trinadh Venkata Satish Tammana
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Chlamydomonas reinhardtii is frequently used as a model organism to study fundamental processes in photosynthesis, metabolism, and flagellar biology. Versatile tool boxes have been developed for this alga (Fuhrmann et al., 1999; Schroda et al., 2000; Schroda, 2006). Among them, forward genetic approach has been intensively used, mostly because of the high efficiency in the generation of hundreds of thousands of mutants by random insertional mutagenesis and the haploid nature therefore phenotypic analysis can be done in the first generation (Cagnon et al., 2013; Tunçay et al., 2013). A major bottleneck in the application of high throughput methods in a forward genetic approach is the identification of the genetic lesion(s) responsible for the observed phenotype. In this protocol, we describe in detail an improved version of the restriction enzyme site-directed amplification PCR (RESDA-PCR) originally reported in (González-Ballester et al., 2005). The improvement includes optimization of primer combination, the choice of DNA polymerase, optimization of PCR cycle parameters, and application of direct sequencing of the PCR products. These modifications make it easier to get specific PCR products as well as speeding up subcloning steps to obtain sequencing data faster.
Keywords: Chlamydomonas reinhardtii Insertional mutagenesis RESDA PCR Forward genetic Chlamydomonas mutant
Background
In addition to the restriction enzyme site-directed amplification PCR (RESDA-PCR) (González-Ballester et al., 2005), several other molecular techniques have been developed to identify insertion sites within the nuclear genome, including Genome Walker (Stirnberg and Happe, 2004), thermal asymmetric interlaced PCR (TAIL-PCR) (Dent et al., 2005), 3’-rapid amplification of cDNA ends (3’RACE) (Meslet-Cladiere and Vallon, 2012), Mme1-based insertion site sequencing strategy (ChlaMmeSeq) (Zhang et al., 2014), or whole-genome resequencing (Goold et al., 2016). RESDA-PCR is based on the use of specific primers of the marker gene combined with the use of degenerate primers that anneal with sequences of restriction sites highly and randomly distributed in the nuclear genome. RESDA-PCR is one of the most commonly used, is not too expensive and has been found to give the highest possibility in identifying the flanking sequence in our hands.
Materials and Reagents
Falcon conical centrifuge tubes, 15 ml (Corning, catalog number: 430055 )
Eppendorf tube, 1.5 ml and 2.0 ml, Eppendorf QualityTM (Eppendorf, catalog numbers: 0030120086 and 0030120094 )
Petri dishes, 90 mm in diameter (Thermo Fisher Scientific, SterilinTM, catalog number: 101R20 )
Sterilized toothpick (Fujian Fuhua, FUHUA FANGYUANTM, catalog number: 855 )
Chlamydomonas reinhardtii mutants generated by random insertional mutagenesis (Cagnon et al., 2013)
One ShotTM TOP10 Chemically Competent cell (Thermo Fisher Scientific, catalog number: C404010 )
Zero BluntTM TOPOTM PCR Cloning Kit (Thermo Fisher Scientific, catalog number: 450245 )
Taq DNA polymerase (5,000 U ml-1), 10x Standard Taq Reaction Buffer, dNTPs (New England Biolabs, catalog number: M0273S )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: 472301 )
PCR-grade H2O (Sigma-Aldrich, catalog number: W1754 )
Ethanol (Sigma-Aldrich, catalog number: 34852 )
KOD Xtreme Hot Start DNA polymerase, dNTPs (2 mM each), 2x Xtreme buffer (Merck, Novagen®, catalog number: 71842 )
Agarose (Sigma-Aldrich, catalog number: A9539 )
ExactLadder® DNA PreMix 2 log (OZYME, catalog number: OZYC002-500 )
SYBRTM Safe DNA gel stain (Thermo Fisher Scientific, catalog number: S33102 )
UltraPureTM 10x TAE buffer (Thermo Fisher Scientific, catalog number: 15558026 )
Luria broth (Sigma-Aldrich, catalog number: L1900 )
Kanamycin sulfate (Thermo Fisher Scientific, catalog number: 11815024 )
NucleoSpin® Gel and PCR Clean-up Kit (MACHEREY-NAGEL, catalog number: 740609.10 )
NucleoSpin® Plasmid Miniprep Kit (MACHEREY-NAGEL, catalog number: 740588.10 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E9884 )
Tris base (Sigma-Aldrich, catalog number: T6066 )
Hexadecyltrimethyl ammonium bromide (CTAB) (Sigma-Aldrich, catalog number: H9151 )
Isopropanol (Sigma-Aldrich, catalog number: W292907 )
Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma-Aldrich, catalog number: P3803 )
Proteinase K (20.0 mg ml-1) (Sigma-Aldrich, catalog number: P6556 )
Lysis buffer (see Recipes)
0.7 M NaCl
10% SDS
0.5 M Tris-HCl, pH 8.0
10 mM EDTA
5 M KCl (see Recipes)
10% CTAB (see Recipes)
10% DMSO (see Recipes)
1.0% agarose gel (see Recipes)
1x TAE (see Recipes)
70% ethanol (see Recipes)
Equipment
Shaker (Eppendorf, New BrunswickTM, model: Innova® 44 , catalog number: M1282-0002)
AccumetTM pH meter (Fisher Scientific, model: 3-in-1 Set, catalog number: 13-636-AE153 )
PCR Thermal Cyclers (Thermo Fisher Scientific, Applied BiosystemsTM, model: 2720 , catalog number: ED000651)
Agarose electrophoresis tank (Bio-Rad Laboratories, model: Mini-Sub® Cell GT, catalog number: 1704401 )
Gel Doc XR System (Bio-Rad Laboratories, model: Gel DocTM XR+ , catalog number: 5838)
FisherbrandTM Common bench-top vortexer (Fisher Scientific, catalog number: 02-216-125 )
Bench-top centrifuge (Beckman Coulter, model: Allegra® 64R , catalog number: 367586)
Bench-top incubator (Eppendorf, New BrunswickTM, model: S41i , catalog number: S41I230011)
NanoDrop 2000 (Thermo Fisher Scientific, model: NanoDropTM 2000 , catalog number: ND-2000)
Multisizer 3 Coulter counter (Beckman Coulter, model: MultisizerTM 3 , catalog number: 6605697)
Software
SPSS program (version 19.0)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kong, F. and Li-Beisson, Y. (2018). Identification of Insertion Site by RESDA-PCR in Chlamydomonas Mutants Generated by AphVIII Random Insertional Mutagenesis. Bio-protocol 8(3): e2718. DOI: 10.21769/BioProtoc.2718.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Microbiology > Microbial genetics > Gene mapping and cloning
Molecular Biology > DNA > Genotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,719 | https://bio-protocol.org/exchange/protocoldetail?id=2719&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Radioactive Tracer Feeding Experiments and Product Analysis to Determine the Biosynthetic Capability of Comfrey (Symphytum officinale) Leaves for Pyrrolizidine Alkaloids
TS Thomas Stegemann
LK Lars H. Kruse
DO Dietrich Ober
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2719 Views: 6081
Reviewed by: Venkatasalam Shanmugabalaji
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
This protocol delivers a method to determine the biosynthetic capability of comfrey leaves for pyrrolizidine alkaloids independently from other organs like roots or flowers.
The protocol applies and combines radioactive tracer experiments with standard and modern techniques like thin layer chromatography (TLC), solid-phase extraction (SPE), high-performance liquid chromatography (HPLC) and gas chromatography-mass spectrometry (GC-MS).
Keywords: Tracer Radio-HPLC Radio-TLC SPE GC-MS Alkaloid Plant-organ specificity
Background
Comfrey roots are known to be able to synthesize pyrrolizidine alkaloids (Frölich et al., 2007) and the key enzyme for biosynthesis, homospermidine synthase (HSS), was localized in the endodermis cells. In addition to this site of synthesis, there have been hints that also leaves of a certain developmental stage might be able to produce pyrrolizidine alkaloids (Niemüller et al., 2012). Therefore, a protocol was developed to determine the biosynthetic capability of comfrey leaves to synthesize pyrrolizidine alkaloids independently from other plant organs.
Materials and Reagents
epT.I.P.S® pipette tips (Eppendorf, catalog number: 0030000730 )
Strata SCX 500 mg/6 ml tubes (Phenomenex, catalog number: 8B-S010-HCH )
Scintillation vial 4 ml (Carl Roth, catalog number: HEE8.1 )
1.5 ml microcentrifuge tube (SARSTEDT, catalog number: 72.706.700 )
2 ml microcentrifuge tube (SARSTEDT, catalog number: 72.695.500 )
Scalpel (Carl Roth, catalog number: AH88.1 )
Microcapillary pipette, volume 1-5 µl (Sigma-Aldrich, catalog number: Z611239 )
Silica gel G-25 TLC plates 20 x 20 cm (Merck, catalog number: 1003900001 )
Verex Vial Kit 9 mm, µVial i3 (Phenomenex, catalog number: AR0-9974-12 )
Hamilton syringe 25 µl (Hamilton, catalog number: 80400 )
Fresh comfrey leaves from a flowering plant (size about 3.5 cm in length)
Liquid nitrogen
[1,4-14C]Putrescine (3.95 GBq/mmol, Amersham Int., catalog number: CFA.301, since the end of Amersham Int., [1,4-14C]Putrescine is still available at PerkinElmer, catalog number: NEC150000MC )
[12C]Putrescine (Carl Roth, catalog number: 4141.2 )
Scintillation cocktail, Rotiszint eco plus (Carl Roth, catalog number: 0016.3 )
Acetonitrile (Carl Roth, catalog number: 7330.1 )
Methanol (Carl Roth, catalog number: P717.1 )
Ammonia solution 30% (Carl Roth, catalog number: CP17.1 )
Sulphuric acid solution volumetric, 0.05 M (VWR, catalog number: 319589-500ML )
Zinc dust (Carl Roth, catalog number: 9524.2 )
Sodium hydroxide (NaOH) (Carl Roth, catalog number: 6771.1 )
Potassium phosphate dibasic (K2HPO4) (Carl Roth, catalog number: T875.1 )
Potassium phosphate monobasic (KH2PO4) (Carl Roth, catalog number: P018.1 )
[14C]Retronecine
Note: It was prepared according to Lindigkeit et al., 1997 and Hartmann et al., 2001.
Ethyl acetate (Carl Roth, catalog number: 6784.1 )
2-Propanol (Carl Roth, catalog number: 9866.2 )
5% ammonia in methanol (see Recipes)
100 mM phosphate buffer, pH 7.5 (see Recipes)
Mobile phase TLC (see Recipes)
Equipment
Pipettes (Eppendorf, model: Research® plus, catalog number: 3123000063 )
Microscale
Fume hood (Thermo Fisher Scientific, catalog number: 1363 )
Vacuum manifold for SPE (Agilent Technologies, catalog number: 5982-9110 )
Lamp (Carl Roth, catalog number: 2986.1 )
Mortar and pestle (Carl Roth, catalog number: NT80.1 )
Vortex shaker (IKA, model: Vortex 2 )
Micro stir bars (Carl Roth, catalog number: 0955.1 )
Magnetic stirrer (IKA, model: lab disc [white] )
Optima 1 MS GC column (MACHEREY-NAGEL, catalog number: 726205.15 )
Minispin Microcentrifuge (Eppendorf, catalog number: 5452000018 )
Radioactivity thin-layer-chromatography detector (RITA, Raytest, Straubenhardt)
Tri-Carb 2910 TR LSC Low Activity Liquid Scintillation Analyzer (PerkinElmer)
LiChrograph HPLC (Merck-Hitachi) connected to a fraction collector Pharmacia Frac-100 (GE Healthcare Life Science)
EC 250/4 NUCLEOSIL® 120-5 C18 HPLC column (MACHEREY-NAGEL, catalog number: 720041.40 )
Developing chambers for TLC (Carl Roth, catalog number: 3133.1 )
Shimadzu GC-2010 gas chromatograph with SSL injector (Shimadzu, model: GC-2010 )
Shimadzu AOC-20i Auto-injector (Shimadzu, model: AOC-20i )
Fisons MD 800 quadrupole mass spectrometer
Software
XCalibur 1.1 (Thermo Fisher Scientific, Dreieich, Germany)
GinaStar TLC (Raytest, Straubenhardt)
QuantaSmartTM 4.0 (PerkinElmer)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Stegemann, T., Kruse, L. H. and Ober, D. (2018). Radioactive Tracer Feeding Experiments and Product Analysis to Determine the Biosynthetic Capability of Comfrey (Symphytum officinale) Leaves for Pyrrolizidine Alkaloids. Bio-protocol 8(3): e2719. DOI: 10.21769/BioProtoc.2719.
Kruse, L. H., Stegemann, T., Sievert, C. and Ober, D. (2017). Identification of a second site of pyrrolizidine alkaloid biosynthesis in comfrey to boost plant defense in floral stage. Plant Physiol 174(1): 47-55.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Other compound
Biochemistry > Other compound > Alkaloid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
272 | https://bio-protocol.org/exchange/protocoldetail?id=272&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Differential in vivo Thiol Trapping with N-ethylmaleimide (NEM) and 4-acetamido-4'-maleimidylstilbene-2,2'-disulfonic acid (AMS)
Wei-Yun (Winnie) Wholey
Published: Vol 2, Iss 20, Oct 20, 2012
DOI: 10.21769/BioProtoc.272 Views: 14161
Original Research Article:
The authors used this protocol in Mar 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2012
Abstract
This protocol is used to compare the in vivo redox status of Escherichia coli and Vibrio cholerae protein before and after HOCl treatment. For example, I examined whether the EF-Tu protein is reduced or oxidized in the referenced publication. This protocol should work for other proteins and other oxidative stress treatments. You will need the antibody for your protein to visualize your protein on western blot.
Keywords: Thiol trap Oxidation Redox status
Materials and Reagents
Bacteria (this protocol works for E. coli MG1655 and Vibrio cholerae O395 strains, I didn’t try other bacteria)
HOCl (Sigma-Aldrich)
Trichloroacetic acid (TCA)
Urea
Tris-HCl
EDTA
SDS
N-ethylmaleimide (NEM)
DTT
4-acetamido-4'-maleimidylstilbene-2,2'-disulfonic acid (AMS)
Polyclonal antibodies against your protein and appropriate secondary antibodies
LB media (see Recipes)
DAB buffer (see Recipes)
Equipment
Centrifuges
Western blotting equipment
Spectrometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wholey, W. W. (2012). Differential in vivo Thiol Trapping with N-ethylmaleimide (NEM) and 4-acetamido-4'-maleimidylstilbene-2,2'-disulfonic acid (AMS). Bio-protocol 2(20): e272. DOI: 10.21769/BioProtoc.272.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,720 | https://bio-protocol.org/exchange/protocoldetail?id=2720&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunofluorescence Analysis of Human Endocervical Tissue Explants Infected with Neisseria gonorrhoeae
LW Liang-Chun Wang
QY Qian Yu
DS Daniel C. Stein
WS Wenxia Song
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2720 Views: 6527
Reviewed by: Lokesh KalekarBenoit Chassaing
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Colonization and penetration of the epithelium is the infection-initiating route of mucosal pathogens. The epithelium counteracts infection by eliciting host cell responses while maintaining the mucosal barrier function. The obligate human sexually transmitted bacterium Neisseria gonorrhoeae, or gonococcus (GC) infects the female reproductive tract primarily from the endocervical epithelium. Due to lack of an infection model that mimics all aspects of human infections in the female reproductive tract, GC pathogenesis is poorly understood. This protocol takes advantage of the viability and functional integrity of human cervical tissues propagated in culture to generate an ex vivo infection model. This tissue model maintains the nature of the infection target and environment without any manipulation such as immortalization of epithelial cells by viruses. Using immunofluorescence microscopy, the interaction of GC with the endocervical epithelium was analyzed.
Keywords: Neisseria gonorrhoeae Gonorrhea Infection ex vivo Endocervix Immunofluorescence staining
Background
Neisseria gonorrhoeae (GC) infects human genital epithelium causing gonorrhea, a common sexually transmitted infection. Infections in women can lead to severe complications, such as pelvic inflammatory disease, causing fallopian tube scarring and blockage and predisposition to ectopic pregnancy or infertility. Gonorrhea has reemerged as a critical public health issue due to increased prevalence of antibiotic-resistant strains. Because humans are the only host for GC, a lack of an infection model that mimics all aspects of human infections has been a major obstacle to advance our understanding of GC pathogenesis. We have established a human endocervical tissue explant model and immunofluorescence microscopic analysis to examine the mechanism by which GC infect the human endocervix, the primary site for GC infection in women. This ex vivo model maintains the normal cytoarchitecture and tissue integrity of the endocervical epithelium. Using this model and immunofluorescence analysis, we demonstrate that GC colonizes and penetrates into the endocervical tissue, where they potentially cause symptomatic and disseminated gonococcal infection. GC penetration is enabled by the junction disruption and exfoliation of endocervical epithelial cells in response to GC infection. Taken together, our data show that GC infection in endocervical tissue explants resembles GC infection in vivo observed using patients’ biopsies. In combination with immunofluorescent microscopy, this infection model removes an important roadblock to fully understanding the pathogenesis of GC.
Materials and Reagents
Cotton swab (Fisher Scientific, catalog number: 23-400-122 )
Manufacturer: Thermo Fisher Scientific, catalog number: 16F0024 .
Carbon steel surgical blades #20 (Aspen Surgical, Bard-Parker, catalog number: 371120 )
Petri dishes (VWR, catalog number: 25384-302 )
6-well tissue culture plates (Corning, Falcon®, catalog number: 353046 )
Sterile Microcentrifuge tubes (1.7 ml) (Sorenson BioScience, catalog number: 16070 )
Sterile 15 ml conical tubes (VWR, catalog number: 21008-216 )
Sterile polyester-tipped applicators (Fisher Scientific, catalog number: 23-400-122 )
Pipette tips (1,000 μl: VWR, catalog number: 83007-382 ; 200 μl: VWR, catalog number: 53509-007 ; 0.1-10 μl: Fisher Scientific, catalog number: 02-717-133 )
PAP pen for immunostaining (Sigma-Aldrich, catalog number: Z377821-1EA )
Manufacturer: TED PELLA, catalog number: 22309 .
VWR Micro Slides Superfrost Plus (VWR, catalog number: 48311-703 )
Zeiss NO.1.5 cover glasses (ZEISS, catalog number: 474030-9000-000 )
Polysciences flat embedding mold 1.2 x 0.5 x 0.4 cm (Length x Width x Depth) (Polysciences, catalog number: 02615 )
MS11 Neisseria gonorrhoeae strain(s) (kindly provided by Dr. Herman Schneider, Walter Reed Army Institute for Research)
Hank’s balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14025092 )
Liquid nitrogen (Roberts Oxygen Company)
Hoechst 33342, trihydrochloride, trihydrate, 10 mg/ml (Thermo Fisher Scientific, InvitrogenTM, catalog number: H3570 )
Alexa Fluor 488 goat anti-mouse IgG1 (Thermo Fisher Scientific, Invitrogen, catalog number: A-21121 )
Mouse anti-human ZO1 (BD, Transduction LaboratoriesTM, catalog number: 610966 )
Goat anti-GC antibody (Lab generated)
DyLight 633 Antibody Labeling Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 53046 )
Aqua Poly/Mount (Polysciences, catalog number: 18606 )
Nail polish (Electron Microscopy Science, catalog number: 72180 )
O.C.T. Compound (SAKURA, Tissue-Tek, catalog number: 4583 )
Penicillin G sodium salt (Sigma-Aldrich, catalog number: P3032-25MU )
Streptomycin sulfate (Sigma-Aldrich, catalog number: S9137 )
Leibovitz’s (1x) L-15 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 21083027 )
CMRL medium 1066 (1x) (Thermo Fisher Scientific, GibcoTM, catalog number: 11530037 )
Hydrocortisone 21-hemisuccinate sodium (Sigma-Aldrich, catalog number: H2270-100MG )
Bovine insulin (Akron Biotech, catalog number: AK8213-0100 )
L-glutamine 200 mM (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10082147 )
DifcoTM GC medium base (BD, DifcoTM, catalog number: 228950 )
Agar (United States Biological, catalog number: A0930 )
L-glutamine, White Crystals or Crystalline Powder (Fisher Scientific, catalog number: BP379-100 )
Ferric nitrate, nonahydrate (Sigma-Aldrich, catalog number: 254223-10G )
Thiamine pyrophosphate (Sigma-Aldrich, catalog number: C8754-5G )
Glucose, as Dextrose anhydrous (Fisher Scientific, catalog number: BP350-1 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-10 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333-500G )
Sodium phosphate dibasic (Na2HPO4) (Fisher Scientific, catalog number: S374-1 )
Potassium phosphate monobasic (KH2PO4) (Fisher Scientific, catalog number: BP329-1 )
Hydrochloric acid (HCl) (Fisher Scientific, catalog number: A144-212 )
Manufacturer: Thermo Fisher Scientific, catalog number: FLA144212 .
Paraformaldehyde 16% solution (Electron Microscopy Science, catalog number: 15710 )
Sucrose (Merck, catalog number: SX1075-1 )
Gelatin from porcine skin (Sigma-Aldrich, catalog number: G1890-500G )
Gelatin from cold water fish skin (FSG) (Sigma-Aldrich, catalog number: G7765-250ML )
Triton X-100 (Sigma-Aldrich, catalog number: X100-100ML )
100x penicillin/streptomycin stock (see Recipes)
Cervical tissue culture medium (see Recipes)
GCK agar plate (see Recipes)
100x Kellogg’s supplement (see Recipes)
1x phosphate buffer solution (PBS) (see Recipes)
4% paraformaldehyde (PFA) (see Recipes)
5% and 15% sucrose solution (see Recipes)
7.5% and 20% gelatin solution (see Recipes)
Staining solution (see Recipes)
Equipment
Biosafety cabinet (NU-425-600 Class II, A2 Laminar Flow Biohazard Hood) (Nuaire, model: NU-425-600 Class II, A2 , catalog number: 32776)
Spectrophotometer Ultrospec 2000 UV (Pharmacia Biotech, model number: 80-2106-00 )
Heating block (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SP18425Q )
Stainless steel forceps (VWR, Dissecting forceps)
Multi-Purpose rotator (Multi-Purpose Rotator) (Barnstead International Lab-line, Thermo Fisher Scientific, Thermo ScientificTM, model: Model 2309 )
CO2 incubator (Fisher Scientific, model: Isotemp Incubator Model 3530 )
Confocal microscope (Carl Zeiss, model: LSM 710 )
Cryostat (Thermo Fisher Scientific, model: Microm HM 550-388114 )
Slide holder (Newcomer Supply, catalog number: 6841 )
Software
NIH ImageJ and ZEN software
GraphPad Software (La Jolla, CA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, L., Yu, Q., Stein, D. C. and Song, W. (2018). Immunofluorescence Analysis of Human Endocervical Tissue Explants Infected with Neisseria gonorrhoeae. Bio-protocol 8(3): e2720. DOI: 10.21769/BioProtoc.2720.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Ex vivo model
Immunology > Mucosal immunology > Epithelium
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,721 | https://bio-protocol.org/exchange/protocoldetail?id=2721&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Precision Tagging: A Novel Seamless Protein Tagging by Combinational Use of Type II and Type IIS Restriction Endonucleases
Zhen Xu*
YR Yan-Ning Rui*
JH John P. Hagan
DK Dong H. Kim
*Contributed equally to this work
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2721 Views: 7909
Edited by: Gal Haimovich
Reviewed by: Omar AkilKanika Gera
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Protein tagging is a powerful tool for performing comprehensive analyses of the biological functions of a protein of interest owing to the existence of a wide variety of tags. It becomes indispensable in some cases, such as in tracking protein dynamics in a live cell or adding a peptide epitope due to the lack of optimal antibodies. However, efficiently integrating an array of tags into the gene of interest remains a challenge. Traditional DNA recombinant technology based on type II restriction endonucleases renders protein tagging tedious and inefficient as well as the introduction of an unwanted junction sequence. In our attempt to tag Thrombospondin type 1 domain-containing 1 (THSD1) that we identified as the first intracranial aneurysm gene (Santiago-Sim et al., 2016), we developed a novel precision tagging technique by combinational use of type II and IIS restriction endonucleases (Xu et al., 2017), which generates a seamless clone with high efficiency. Here, we describe a protocol that not only provides a generalized strategy for any gene of interest but also takes its application of 11 different tags in THSD1 as a step-by-step example.
Keywords: DNA cloning Protein tagging Type IIS restriction enzyme Non-palindromic THSD1
Background
Versatile tags with different features serve as a set of tools to dissect protein function molecularly. Various tags such as Green Fluorescence Protein (GFP) tag and its derivatives, tandem affinity purification tags, such as FLAG-HA or ProtA-CBP, have revolutionized the biological research over the years. Some newly developed chemical tags, such as SNAP or CLIP, allow conditional labeling of the protein of interest in a time-controlled fashion (Bodor et al., 2012). However, a method to incorporate as many different tags as possible into a gene of interest efficiently has been poorly developed.
Traditional DNA recombination utilizes type II restriction endonucleases that recognize palindromic sequences. For example, EcoRI recognizes 5’-GAATTC and cleaves inside to make a 3’-AATT sticky end. When a protein needs different tags, it is a tedious and inefficient process that may also lead to the introduction of unwanted junction sequences due to the existence of a restriction recognition sequence. To improve the cloning efficiency, gateway technology takes advantage of another enzyme called integrase, which allows for site-specific recombination (Esposito et al., 2009). However, as patented technology, it requires that many essential reagents be purchased from designated resources. Also, the recognition sequence for integrase imposes a longer unwanted junction sequence between the tag and the protein of interest.
In our recent study to add 11 different tags to the N-terminus of THSD1, a single-span transmembrane protein responsible for cerebral aneurysm pathogenesis (Santiago-Sim et al., 2016), we developed a new cloning strategy by combinational use of type II and type IIS restriction endonucleases (Xu et al., 2017). Unlike type II, type IIS restriction endonucleases recognize non-palindromic sequences and cleave the DNA outside of their recognition site. For example, BsaI recognizes 5’-GGTCTC and cleaves the DNA a nucleotide downstream, resulting in a 5’ overhang 4 nucleotides long, thus making a custom sticky end that matches the gene of interest. Therefore, we can generate a seamless clone by completely eliminating the unwanted junction sequences (Xu et al., 2017). Even more importantly, using type II and type IIS restriction endonucleases in combination makes our method highly compatible with the traditional cloning system that is still widely used by many research labs. In addition, unlike gateway technology, precision tagging does not require designated destination vectors. Since each lab may favor a different set of destination vectors and tags for its gene of interest, our protocol affords researchers great flexibility in making their personalized tagging choices.
Materials and Reagents
PCR tubes (Corning, Axygen®, catalog number: PCR-02-C )
Pipette tips
Razor blade (Fisher Scientific, catalog number: 12-640 )
Microcentrifuge tubes, 1.5 ml (Fisher Scientific, catalog number: 05-408-129 )
Petri dish, 100 mm (Fisher Scientific, catalog number: FB0875713 )
DH5α competent cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18265017 )
Plasmids containing different tags:
pBabe-GFP (Addgene, catalog number: 10668 )
mCherry-Talin-H-18 (Addgene, catalog number: 62749 )
Dendra2-Vinculin-N-21 (Addgene, catalog number: 57749 )
pSNAPf-C1 (Addgene, catalog number: 58186 )
miniSOG-Zyxin-6 (Addgene, catalog number: 57781 )
Type II restriction endonucleases such as:
EcoRI-HF (New England Biolabs, catalog number: R3101S )
BamHI-HF (New England Biolabs, catalog number: R3136S )
SalI-HF (New England Biolabs, catalog number: R3138S )
Bsu36I (New England Biolabs, catalog number: R0524S )
Type IIS restriction endonucleases such as:
BsaI-HF (New England Biolabs, catalog number: R3535S )
BbsI-HF (New England Biolabs, catalog number: R3539S )
BsmBI (New England Biolabs, catalog number: R0580S )
LB broth (Fisher Scientific, catalog number: BP1427-500 )
LB agar (Fisher Scientific, catalog number: BP1425-500 )
Ampicillin sodium salt (Fisher Scientific, catalog number: BP1760-5 )
Calf intestinal alkaline phosphatase (CIP) (New England Biolabs, catalog number: M0290S )
T4 polynucleotide kinase (New England Biolabs, catalog number: M0201S )
pBS-KSII-4B was modified from pBS-KSII (accession number: X52327) by synonymously destroying BsaI site (Xu et al., 2017)
Note: It is available upon request and will be deposited to Addgene soon.
pCMV5 (accession number: AF239249, from lab stock and available upon request) and pBabe-puro (Addgene, catalog number: 1764 )
Ultrapure water (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977015 )
Phusion high-fidelity DNA polymerase (New England Biolabs, catalog number: M0530S )
Custom DNA Oligonucleotides (Integrated DNA Technology)
1x Low-EDTA TE buffer pH 8.0 (Quality Biological, catalog number: 351-324-721 )
6x Gel loading dye, purple (New England Biolabs, catalog number: B7024S )
Agarose (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 17850 )
GeneRuler 1 kb DNA ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SM0313 )
50x TAE (Bio-Rad Laboratories, catalog number: 1610773 )
UltraPure Ethidium Bromide (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15585011 )
QIAquick gel extraction (QIAGEN, catalog number: 28704 )
QIAquick PCR purification kit (QIAGEN, catalog number: 28104 )
QIAprep spin miniprep kit (QIAGEN, catalog number: 27106 )
Overlapping PCR (Recipe 1)
In vitro digestion by restriction endonucleases (Recipe 2)
Linearization of a vector by restriction endonucleases and dephosphorylation by calf intestinal alkaline phosphatase (CIP) (Recipe 3)
In vitro DNA ligation (Recipe 4)
DNA transformation (Recipe 5)
In vitro DNA oligonucleotide annealing (Recipe 6)
In vitro T4 polynucleotide kinase phosphorylation (Recipe 7)
Equipment
Pipettes
Thermo Cycler (Applied Biosystems) (or any other convention PCR device)
DNA electrophoresis system (Takara Bio, model: Mupid-exU )
3UV lamp (Fisher Scientific)
Water bath (VWR International), set at 37 °C for enzymatic digestion and 42 °C for DNA transformation into DH5α competent cells
Heat block (VWR International), set at 55 °C for agarose gel dissolution
Air incubator (VWR International), set at 37 °C for bacteria growth on LB plates
Microcentrifuge (Eppendorf, model: 5424 )
Orbital shaker (Forma Scientific), set at 37 °C for bacteria growth in LB medium
ChemiDoc MP imaging system (Bio-Rad Laboratories, model: ChemiDocTM MP )
Software
DNA sequence analysis software: Word, Vector NTI, DNAstar, or other
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Xu, Z., Rui, Y., Hagan, J. P. and Kim, D. H. (2018). Precision Tagging: A Novel Seamless Protein Tagging by Combinational Use of Type II and Type IIS Restriction Endonucleases. Bio-protocol 8(3): e2721. DOI: 10.21769/BioProtoc.2721.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,722 | https://bio-protocol.org/exchange/protocoldetail?id=2722&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
How to Catch a Smurf? – Ageing and Beyond…
In vivo Assessment of Intestinal Permeability in Multiple Model Organisms
RM Raquel R. Martins
AM Andrew W. McCracken
MS Mirre J. P. Simons
Catarina M. Henriques
MR Michael Rera
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2722 Views: 12012
Reviewed by: Michael EnosAnand Ramesh Patwardhan
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
The Smurf Assay (SA) was initially developed in the model organism Drosophila melanogaster where a dramatic increase of intestinal permeability has been shown to occur during aging (Rera et al., 2011). We have since validated the protocol in multiple other model organisms (Dambroise et al., 2016) and have utilized the assay to further our understanding of aging (Tricoire and Rera, 2015; Rera et al., 2018). The SA has now also been used by other labs to assess intestinal barrier permeability (Clark et al., 2015; Katzenberger et al., 2015; Barekat et al., 2016; Chakrabarti et al., 2016; Gelino et al., 2016). The SA in itself is simple; however, numerous small details can have a considerable impact on its experimental validity and subsequent interpretation. Here, we provide a detailed update on the SA technique and explain how to catch a Smurf while avoiding the most common experimental fallacies.
Keywords: Smurf Assay Digestive tract permeability Blue dye #1 Ageing
Background
The Smurf Assay (SA) is based on the Drosophila feeding assay described in (Wong et al., 2009). The assay assesses food intake by the co-ingestion of a blue dye, which is not absorbed by the digestive tract, thereby allowing direct quantification. For the SA it is essential that this specific blue dye does not pass an intact intestinal barrier since its readout is a whole body coloration (here blue). This property allows direct in vivo assessment of gut permeability, which has been shown to increase with age (Rera et al., 2011 and 2012).
As recently discussed in Rera et al. (2018), the Smurf Assay is not only a simple way to assess intestinal permeability in vivo, but also an elegant way to assess the physiological age of individuals in a broad range of organisms. As such, it allows novel approaches to study the various events occurring in aging individuals (Tricoire and Rera, 2015; Rera et al., 2018).
In recent years, we have received numerous comments and questions about the initial protocol, leading us to develop the present extended protocol.
Specifics of the dye used: The dye typically used is FD&C blue dye #1, but we have also validated the use of red #40 and fluorescein (Rera et al., 2011 and 2012). We adapted the use of the very same blue #1 to zebrafish (Dambroise et al., 2016) and killifish (Rera et al., 2018) but found it is easier to use fluorescein with nematodes although the same blue #1 can also be used as demonstrated in (Gelino et al., 2016). The dye is non-toxic and does not decrease the lifespan of individuals when exposed during their whole life (Figure 1A). Moreover, no reduction in longevity is detected even when the gut becomes permeable and the dye diffuses into the body, contrary to what was recently suggested in Clark et al. (2015). We confirmed this by placing newly identified Smurfs on normal non-dyed media, and this did not lead to a longer lifespan (Figure 1B).
Figure 1. The blue dye #1 is not toxic neither for non-Smurfs or Smurfs. A. The longevity curve of 1,146 individual female flies maintained on blue medium overlaps the longevity curves of 295 female flies maintained on standard medium by groups of 28-32 individuals (longevity data from Tricoire and Rera, 2015). B. The longevity curve of 173 individual female flies maintained on blue dye for their whole lives overlaps the longevity curve of 172 individual female flies transferred back to standard medium when they became Smurf. This confirms that Smurfs do not die prematurely because the dye gains toxic properties when it diffuses through the gut.
Catching Smurfs
Although we initially described Smurfness as a well-marked, almost binary phenotype (Rera et al., 2011 and 2012; Tricoire and Rera, 2015), Smurfness is, as most phenotypes are, continuous (Figures 2A-2D, Clark et al., 2015). Thus, it is important to understand that the lighter the Smurf is, the greater the chance of misidentifying Smurf individuals. Indeed, the major part of uncertainly identified Smurfs appears in the few days preceding clear mortality acceleration in the population (Figure 3). The continuous nature of the Smurf phenotype can have two main causes. First, the dye might take some time to diffuse through limited gut permeability, thus generating a determined relationship between Smurfness and the level of gut permeability. Second, there can be biological (environmental and/or genetic factors) that can cause variation in the phenotype observed.
Moreover, there can be observer bias, attributable to the experimenter who is sorting and classifying individuals. We noticed that the earlier in the lifespan, and the fewer Smurfs are present in the group, the more likely an observer is to classify individuals as Smurfs, despite subsequently being scored as non-Smurf. The latter is probably inherent in the way we distinguish individuals based on their surrounding individuals, and hence the more Smurf individuals are present, the more stringent we are on their identification. To circumvent this, single individuals could be photographed for independent verification. In practice, however, it is difficult to both sort large numbers of flies and photograph every individual for subsequent blue hue quantification. This problem is less relevant to larger organisms.
Figure 2. The Smurf phenotype is not binary but rather continuous. A. The continuous aspect of the Smurf phenotype was previously described in Clark et al. (2015), but we noticed much more subtle shades of blue in our experimental conditions. B. Nevertheless, only the two categories of Smurfs and non-Smurfs showed significant blue hue difference on all body parts (n = 31 female from the drsGFP genotype, nns = 16, n? = 4, nls = 4 and ns = 7)–a subsequent experiment with larger n was conducted and showed significant differences only between Smurfs and non-Smurfs (not shown). C. The continuous Smurfness distribution is not just due to the Smurf (blue dye based) assay but is also observable in the drsGFP individuals by D. measuring GFP intensity in Smurfs (n = 33) and non-Smurfs (n = 130). The drosomycin promoter-driven GFP expression has been shown to be a surrogate of Smurfness in Rera et al. (2012). Mated 35-40 days old female Drosophila.
Figure 3. All individuals eventually become Smurf prior to death. Estimating Smurf survival time requires taking into account individuals from different moments of the survival experiment to prevent misestimation. A. All 1,146 individual female flies became Smurf prior to death and survived for various duration in that state. B. The uncertainty on the Smurf status has the strongest effect on the youngest identified Smurfs. Restricting Smurf studies to that period is thus at high risk of misestimating their remaining lifespan. We recommend to study them close to the T50 of the population. Original data from (Tricoire and Rera, 2015). C. Proportion of the three different types of living Smurfs at various percent survival in the population. The largest population of uncertain Smurf individuals is restricted to the first few days of Smurf apparition in the population.
Other experimental considerations
The duration of exposure to the dye does not affect survival nor the Smurf Increase Rate (SIR). For ease we now use overnight feeding on the blue dye. The fly population density is of critical importance: we observed that at a too high density, individuals tend to get covered with blue faeces. Although easy to rinse with water (the addition of some ethanol can help immersion) to discern ‘false’ Smurfs from legitimate ones, we do not recommend more than 30 individuals per vial for overnight exposure. For continued exposure to the dye, lower numbers should be considered. Moreover, when learning how to distinguish smurfs we recommend washing flies to confirm the phenotype. These considerations could be especially important as behaviour and the quantity of feaces produced can differ between genetic backgrounds and experimental conditions.
We received a significant number of questions regarding ‘the number of Smurfs with time’. As previously stated in (Rera et al., 2011 and 2012; Tricoire and Rera, 2015; Dambroise et al., 2016), it is the Smurf proportion calculated as at a specific age that increases as a function of age, rather than the absolute number of Smurf individuals. The interpretation of this number is similar to that of mortality risk, as it is related to the age-specific risk of an individual in the population to become a Smurf. Note that Smurfs remain in the population for a short time until they die and thus remain in the numerator of the formula above. The Smurf proportion is thus not equal to the risk of becoming a Smurf, but could be calculated as such (Promislow et al., 1999).
Most of the Smurf-related studies we conduct are based on female flies because, as we described in (Rera et al., 2012), they are easier for Smurf identification, principally since their abdomen is larger. In addition, the age-dependent SIR is weaker in males (see Figure S1A in Rera et al., 2012). This might be due to a much shorter remaining lifespan of males when they are in the Smurf state, as we recently observed (unpublished) and/or their smaller body. It is interesting to notice that in zebrafish the sex-specific SIR intensity was inverted (see Figure S1B in Dambroise et al., 2016). Regardless, male Drosophila do undergo the Smurf transition prior to death (Figure 4), contrary to what was recently suggested in Regan et al., 2016.
Figure 4. The Smurf phenotype occurs in male Drosophila melanogaster. Two examples are pictured: A. A smurf male; B. A non-smurf male. 35 days old males.
Materials and Reagents
Parafilm
0.22 µm sterile vacuum filter (Corning® bottle-top vacuum filter, Corning, catalog number: 430015 )
0.45 µm filter (VWR, catalog number: 514-4127 )
Note: The 0.45 µm filter is for fish.
30 G syringe (BD, catalog number: 324826 )
Narrow plastic vials
22-G Micro-Renathane Implantation tubing (Braintree Scientific, catalog number: MRE025 )
Disposable syringe 0.3 ml BD needle 30 G (Insuline) (BD, catalog numbers: 324826 , 320837 )
Soft sponge of approximately 20 mm in height (such as Jaece Industries, catalog number: L800-D )
Drosophila and fish (any source)
FD&C blue dye #1 (Sigma-Aldrich, catalog number: 861146 , SPS Alfachem Ref: 101-2912 and A & Z Food Additives Brilliant Blue FCF(CAS No. 3844-45-9), FD&C Blue 1, E133)
Fluorescein sodium salt (Sigma-Aldrich, catalog number: F6377-500g )
FD&C Red #40, Allura Red (SPS Alfachem)
Bi-distilled deionized water (ddH2O)
Hanks’ balanced salt solution (HBSS, Thermo Fisher Scientific, GibcoTM, catalog number: 14175053 )
Buffered tricaine methanesulfonate (Sigma-Aldrich, catalog number: A5040 ) 164 mg/L in fish tank water
Moldex (VWR, catalog number: 25605.293 )
Blue #1 stock solution (12.8x) (see Recipes)
Dyed media (see Recipes)
Equipment
Magnetic stirrer
5 L glass beaker
2 L glass bottle
LED cool white lighting
White background
Epi-fluorescence microscope Nikon Eclipse 80i for nematode Smurfs (Nikon, model: Eclipse 80i )
Software
ImageJ 1.46j and above
GraphPad Prism 6.01
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Martins, R. R., McCracken, A. A., Simons, M. J. P., Henriques, C. M. and Rera, M. (2018). How to Catch a Smurf? – Ageing and Beyond…
In vivo Assessment of Intestinal Permeability in Multiple Model Organisms. Bio-protocol 8(3): e2722. DOI: 10.21769/BioProtoc.2722.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Ageing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,723 | https://bio-protocol.org/exchange/protocoldetail?id=2723&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Investigating Localization of Chimeric Transporter Proteins within Chloroplasts of Arabidopsis thaliana
SU Susumu Uehara
YI Yasuko Ito-Inaba
TI Takehito Inaba
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2723 Views: 8790
Edited by: Dennis Nürnberg
Reviewed by: Sam-Geun Kong
Original Research Article:
The authors used this protocol in 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
2016
Abstract
In this protocol, we describe a method to design chimeric proteins for specific targeting to the inner envelope membrane (IEM) of Arabidopsis chloroplasts and the confirmation of their localization by biochemical analysis. Specific targeting to the chloroplast IEM can be achieved by fusing the protein of interest with a transit peptide and an IEM targeting signal. This protocol makes it possible to investigate the localization of chimeric proteins in chloroplasts using a small number of transgenic plants by using a modified method of chloroplast isolation and fractionation. IEM localization of chimeric proteins can be further assessed by trypsin digestion and alkaline extraction. Here, the localization of the chimeric bicarbonate transporter, designated as SbtAII, is detected by Western blotting using antibodies against Staphylococcal protein A. This protocol is adapted from Uehara et al., 2016.
Keywords: Alkaline Arabidopsis Chimeric bicarbonate transporter Chloroplast isolation Chloroplast fractionation Trypsin
Background
It has been proposed that the integration of cyanobacterial CO2 concentration mechanisms into chloroplasts is a promising approach to improve photosynthesis in C3 plants. According to theoretical estimations, integration of BicA and SbtA into the chloroplast IEM improves photosynthetic CO2 fixation rates. We examined the integration of nuclear-encoded cyanobacterial bicarbonate transporters, BicA and SbtA, to the IEM of chloroplasts in Arabidopsis. Therefore, we developed a protocol to design chimeric constructs for specific targeting of the IEM and investigate the localization of chimeric proteins in chloroplasts.
Materials and Reagents
Construction of vectors and Arabidopsis transformation
Pipette tips (20 μl, 200 μl, 1,000 μl and 5 ml tips)
1.5 ml microtubes
Arabidopsis chloroplast isolation
Pipette tips (20 μl, 200 μl, 1,000 μl and 5 ml tips)
1.5 ml microtubes
Single-edge razor blades
Plastic Petri plates, diameter 150 x 15 mm and diameter 90 x 15 mm
200 μm nylon mesh cone (Kyoshin Rikoh)
Note: 100 to 120 mm mesh squares were folded into a cone and stapled to hold its shape (Figure 1).
Figure 1. Procedure to make the 200 μm mesh cone
Protoplast-rupturing device (Figure 2)
10 ml disposable syringe (Terumo)
20 μm nylon mesh (Kyoshin Rikoh)
10 μm nylon mesh (Kyoshin Rikoh)
Electrical tape, 15-20 mm wide
Note: Cut off the end of the syringe barrel so that it resembles a hollow tube (Figure 2A). Put the 10 μm mesh on top of the 20 μm mesh and place both over the cut end of the syringe, such that the 10 μm mesh faces the outside and the 20 μm mesh is against the syringe barrel (Figures 2B and 2C). Fix the mesh in place using electrical tape to hold the two layers of mesh to the sides of the syringe, leaving the mesh exposed at the end of the barrel (Figure 2D).
Figure 2. Procedure to make the protoplast-rupturing device. A. Cut off the end of syringe barrel. B. Syringe barrel, 20 μm mesh (Left), and 10 μm mesh. C. Schematic drawings of making the protoplast-rupturing device. D. Finished product of the protoplast-rupturing device.
Pasteur pipet
Arabidopsis (accession Columbia)
Murashige and Skoog Plant salt mixture (Wako Pure Chemical Industries, catalog number: 392-00591 )
Sucrose (Wako Pure Chemical Industries, catalog number: 196-00015 )
2-Morpholinoethanesulfonic acid, monohydrate (MES) (DOJINDO, catalog number: 343-01621 )
Agar (Wako Pure Chemical Industries, catalog number: 016-11875 )
Potassium hydroxide (KOH) (Wako Pure Chemical Industries, catalog number: 168-21815 )
Sorbitol (Sigma-Aldrich, catalog number: S1876-1KG )
Calcium chloride dihydrate (CaCl2·2H2O) (Wako Pure Chemical Industries, catalog number: 031-00435 )
Cellulase (Yakult)
Macerozyme (Yakult)
Percoll (GE Healthcare Life Sciences, catalog number: 17089101 )
1 M 2-[4-(2-Hydroxyethyl)-1-piperazinyl] ethanesulfonic acid (HEPES)-KOH, pH 7.5 and pH 8.0 (HEPES was purchased from DOJINDO, catalog number: 342-01375 )
Note: The pH of HEPES buffer was adjusted with KOH.
Magnesium chloride hexahydrate (MgCl2·6H2O) (Wako Pure Chemical Industries, catalog number: 135-00165 )
Note: 1 M magnesium chloride was used in Procedure B.
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (Wako Pure Chemical Industries, catalog number: 133-00725 )
Note: 1 M manganese(II) chloride was used in Procedure B.
Ethylenediaminetetraacetic acid (EDTA) (DOJINDO, catalog number: 345-01865 )
Note: 0.5 M EDTA was used in Procedure B.
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3912-100G )
Tricine (DOJINDO, catalog number: 347-02844 )
Note: Tricine was directly used in Procedure B.
O,O’-bis(2-aminoethyl)ethyleneglycol-N,N,N’,N’-tetraacetic acid (EGTA) (DOJINDO, catalog number: 346-01312 )
Sodium hydrogen carbonate (NaHCO3) (Wako Pure Chemical Industries, catalog number: 191-01305 )
0.5x Murashige and Skoog medium (MS medium) (see Recipes)
Digestion buffer (see Recipes)
Digestion enzyme buffer (see Recipes)
40% (v/v) AT Percoll (see Recipes)
85% (v/v) AT Percoll (see Recipes)
Gradient buffer (see Recipes)
Protoplast resuspension buffer (see Recipes)
Protoplast breakage buffer (see Recipes)
HEPES-sorbitol buffer, pH 8.0 (see Recipes)
Fractionation of chloroplasts
Pipette tips (20 μl, 200 μl, 1,000 μl and 5 ml tips)
1.5 ml microtubes
Acetone (Wako Pure Chemical Industries, catalog number: 016-00346 )
Note: 80% (v/v) acetone was used in Procedure C.
100% (w/v) trichloroacetic acid (TCA) (Wako Pure Chemical Industries, catalog number: 208-08081 )
Sucrose (Wako Pure Chemical Industries, catalog number: 196-00015 )
Potassium hydroxide (KOH) (Wako Pure Chemical Industries, catalog number: 168-21815 )
Sorbitol (Sigma-Aldrich, catalog number: S1876-1KG )
Ethylenediaminetetraacetic acid (EDTA) (DOJINDO, catalog number: 345-01865 )
Note: 0.5 M EDTA was used in Procedure C.
Tricine (DOJINDO, catalog number: 347-02844 )
Note: 1 M Tricine-KOH, pH 7.5, was made for TE/DTT buffer in Procedure C.
Dithiothreitol (DTT) (Wako Pure Chemical Industries, catalog number: 041-08976 )
Note: 1 M DTT was used in Procedure C.
Ribonucleic acid, transfer (tRNA) (MP Biomedicals, catalog number: 0215653480 )
2-Amino-2-hydroxymethyl-1,3-propanediol (Tris) base (Wako Pure Chemical Industries, catalog number: 207-06275 )
Note: 1 M Tris was used in Procedure C.
Sodium dodecyl sulfate (SDS) (Wako Pure Chemical Industries, catalog number: 196-08675 )
Note: 20% (w/v) SDS was used in Procedure C.
Glycerol (Wako Pure Chemical Industries, catalog number: 075-00616 )
Note: 50% (v/v) glycerol was used in Procedure C.
Saturated bromophenol blue (Wako Pure Chemical Industries, catalog number: 029-02912 )
TE/DTT buffer (see Recipes) containing 1, 0.6, 0.46, 0.2, and 0 M sucrose
SDS-sample buffer (see Recipes)
Trypsin treatment of intact chloroplasts
Pipette tips (20 μl, 200 μl, 1,000 μl and 5 ml tips)
Sorbitol (Sigma-Aldrich, catalog number: S1876-1KG )
Calcium chloride dihydrate (CaCl2·2H2O) (Wako Pure Chemical Industries, catalog number: 031-00435 )
Note: 1 M calcium chloride was used in Procedure D.
Percoll (GE Healthcare, catalog number: 17089101 )
1 M 2-[4-(2-Hydroxyethyl)-1-piperazinyl] ethanesulfonic acid (HEPES)-KOH, pH 7.5 and pH 8.0 (HEPES was purchased from DOJINDO, catalog number: 342-01375 )
Note: The pH of 1 M HEPES buffer was adjusted with KOH.
Magnesium chloride hexahydrate (MgCl2·6H2O) (Wako Pure Chemical Industries, catalog number: 135-00165 )
Note: 1 M magnesium chloride was used in Procedure D.
Ethylenediaminetetraacetic acid (EDTA) (DOJINDO, catalog number: 345-01865 )
Note: 0.5 M EDTA was used in Procedure D.
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3912-100G )
Dithiothreitol (DTT) (Wako Pure Chemical Industries, catalog number: 041-08976 )
Note: 1 M DTT was used in Procedure D.
2-Amino-2-hydroxymethyl-1,3-propanediol (Tris) base (Wako Pure Chemical Industries, catalog number: 207-06275 )
Note: 1 M Tris was used in Procedure D.
Sodium dodecyl sulfate (SDS) (Wako Pure Chemical Industries, catalog number: 196-08675 )
Note: 20 % (w/v) SDS was used in Procedure D.
Glycerol (Wako Pure Chemical Industries, catalog number: 075-00616 )
Note: 50% (v/v) glycerol was used in Procedure D.
Saturated bromophenol blue (Wako Pure Chemical Industries, catalog number: 029-02912 )
Trypsin (Sigma-Aldrich, catalog number: T1005 )
Note: 20 mg/ml trypsin was used in Procedure D.
Nα-Tosyl-L-lysine chloromethyl ketone (TLCK) (Sigma-Aldrich, catalog number: T7254-100MG )
Note: 50 mg/ml TLCK was used in Procedure D.
Aprotinin (Sigma-Aldrich, catalog number: A3886-1VL )
Note: 2 mg/ml aprotinin was used in Procedure D.
Phenylmethanesulfonyl fluoride (PMSF) (Wako Pure Chemical Industries, catalog number: 164-12181 )
Note: 200 mM PMSF was used in Procedure D.
Trypsin inhibitor (Sigma-Aldrich, catalog number: T6522-25MG )
Note: 10 mg/ml trypsin inhibitor was used in Procedure D.
cOmpleteTM, EDTA-FREE (Roche Diagnostics, catalog number: 11 873 580 001 )
40% (v/v) AT Percoll (see Recipes)
SDS-sample buffer (see Recipes)
2x trypsin buffer (see Recipes)
2x stop buffer (see Recipes)
1x 40% (v/v) Percoll (see Recipes)
1x HEPES-sorbitol buffer (see Recipes)
SDS-cOmpleteTM buffer (see Recipes)
Alkaline extraction of chloroplasts
Pipette tips (20 μl, 200 μl, 1,000 μl and 5 ml tips)
Acetone (Wako Pure Chemical Industries, catalog number: 016-00346 )
Note: 80 % (v/v) acetone was used in Procedure E.
100% (w/v) trichloroacetic acid (TCA) (Wako Pure Chemical Industries, catalog number: 208-08081 )
Dithiothreitol (DTT) (Wako Pure Chemical Industries, catalog number: 041-08976 )
Note: 1 M DTT was used in Procedure E.
Ribonucleic acid, transfer (tRNA) (MP Biomedicals, catalog number: 0215653480 )
Sodium dodecyl sulfate (SDS) (Wako Pure Chemical Industries, catalog number: 196-08675 )
Note: 20 % (w/v) SDS was used in Procedure E.
Glycerol (Wako Pure Chemical Industries, catalog number: 075-00616 )
Note: 50% (v/v) glycerol was used in Procedure E.
Saturated bromophenol blue (Wako Pure Chemical Industries, catalog number: 029-02912 )
Sodium carbonate (Na2CO3), pH 12 (Wako Pure Chemical Industries, catalog number: 199-01585 )
Note: 0.2 M sodium carbonate was used in Procedure E.
SDS-sample buffer (see Recipes)
Dot blot assay for estimation of protein concentration
Pipette tips (20 μl, 200 μl, 1,000 μl and 5 ml tips)
WhatmanTM 3MM Chromatography paper (GE Healthcare, catalog number: 3030-917 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3912-100G )
Dithiothreitol (DTT) (Wako Pure Chemical Industries, catalog number: 041-08976 )
Note: 1 M DTT was used in Procedure F.
2-Amino-2-hydroxymethyl-1,3-propanediol (Tris) base (Wako Pure Chemical Industries, catalog number: 207-06275 )
Note: 1 M Tris was used in Procedure F.
20% (w/v) sodium dodecyl sulfate (SDS) (Wako Pure Chemical Industries, catalog number: 196-08675 )
Glycerol (Wako Pure Chemical Industries, catalog number: 075-00616 )
Note: 50% (v/v) glycerol was used in Procedure F.
Saturated bromophenol blue (Wako Pure Chemical Industries, catalog number: 029-02912 )
Coomassie Blue R-250 (Wako Pure Chemical Industries, catalog number: 031-17922 )
Methanol (Wako Pure Chemical Industries, catalog number: 139-01827 )
Acetic acid (Wako Pure Chemical Industries, catalog number: 017-00256 )
Paper towel
SDS-sample buffer (see Recipes)
Coomassie Blue stain (see Recipes)
Coomassie destain solution (see Recipes)
Data analysis
Antibody against the protein A (Sigma-Aldrich, catalog number: P3775 ) (this antibody was used for the detection of chimeric transporter protein tagged with protein A)
Antibody against the large subunit (LSU) of Rubisco (a marker protein of the stroma)
Antibody against Tic (Translocon at the inner envelope membrane of chloroplasts) 110 (a marker protein of the inner envelope membrane)
Antibody against the light-harvesting complex protein (LHCP) (a marker protein of the thylakoid membrane)
Antibody against Toc (Translocon at the outer envelope membrane of chloroplasts) 75 (a marker protein of the outer envelope membrane)
Note: These four antibodies (40 to 43) are either homemade or provided by other scientists. You may use commercially available antibodies raised against marker proteins for each subcompartment of the chloroplasts.
Equipment
Construction of vectors and Arabidopsis transformation
Pipettes (Gilson, models: P20, P200, P1000, and P5000, catalog numbers: F123600 , F123601 , F123602 , and F123603 )
Arabidopsis chloroplast isolation
Pipettes (Gilson, models: P20, P200, P1000, and P5000, catalog numbers: F123600 , F123601 , F123602 , and F123603 )
Refrigerator and Freezer
Growth chamber (16 h light/8 h dark, 70-120 μE m-2 sec-1, 22 °C)
50 ml centrifuge tubes (IWAKI)
Large-capacity centrifuge (TOMY SEIKO, model: Suprema 23 )
Swinging-bucket rotor (TOMY SEIKO, models: TS-33N and B433 )
Swinging-bucket (TOMY SEIKO, model: 3350-G01P )
Fractionation of chloroplasts
Pipettes (Gilson, models: P20, P200, P1000, and P5000, catalog numbers: F123600 , F123601 , F123602 , and F123603 )
Refrigerator and Freezer
Homogenizer (IUCHI)
OptimaTM TL Ultracentrifuge (Beckman Coulter)
Angle rotor (Beckman Coulter, model: TLA-100.3 , catalog number: 349490)
3.5 ml polycarbonate ultracentrifuge tubes (Beckman Coulter, catalog number: 349622 )
Swinging-bucket rotor (Beckman Coulter, model: TLS-55 , catalog number: 346134)
2.2 ml Ultra-ClearTM centrifuge tubes (Beckman Coulter, catalog number: 347356 )
Trypsin treatment of intact chloroplasts
Pipettes (Gilson, models: P20, P200, P1000, and P5000, catalog numbers: F123600 , F123601 , F123602 , and F123603 )
Alkaline extraction of chloroplasts
Pipettes (Gilson, models: P20, P200, P1000, and P5000, catalog numbers: F123600 , F123601 , F123602 , and F123603 )
Angle rotor (Beckman Coulter, model: TLA-100.3 , catalog number: 349490)
OptimaTM TL Ultracentrifuge (Beckman Coulter)
1.5 ml Polyallomer tubes (Beckman Coulter, catalog numbers: 357448 , 355919 )
Dot blot assay for estimation of protein concentrations
Pipettes (Gilson, models: P20, P200, P1000, and P5000, catalog numbers: F123600 , F123601 , F123602 , and F123603 )
Labo Shaker (BIO CRAFT, model: BC-740 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Uehara, S., Ito-Inaba, Y. and Inaba, T. (2018). Investigating Localization of Chimeric Transporter Proteins within Chloroplasts of Arabidopsis thaliana. Bio-protocol 8(3): e2723. DOI: 10.21769/BioProtoc.2723.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Organelle isolation
Plant Science > Plant biochemistry > Protein
Cell Biology > Organelle isolation > Chloroplast
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,724 | https://bio-protocol.org/exchange/protocoldetail?id=2724&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Lysosomal Size and Lysosomal Marker Intensities in Adult Caenorhabditis elegans
JH Julie M. Huynh
HD Hope Dang
HF Hanna Fares
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2724 Views: 6307
Reviewed by: Manish Chamoli
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Assays have been developed to study trafficking in various tissues of Caenorhabditis elegans. Adult C. elegans intestinal cells are large and have extensive endocytic networks, thus making them a good system for deciphering the endocytic pathway using live imaging techniques. However, the presence of auto-fluorescent gut granules in adult intestine can interfere with the signals of endocytic compartment reporters, like GFP. Here we demonstrate a protocol adapted from the original method developed by the Grant laboratory to identify signals from reporters in adult intestinal cells. The goal of this protocol is to identify endocytic compartments tagged with fluorescent markers without any confounding effects of background autofluorescent gut granules in adult intestinal cells of Caenorhabditis elegans.
Keywords: C. elegans Intestine Endocytosis Gut granule Confocal microscopy Lysosome
Background
Caenorhabditis elegans is a multicellular organism that has been used to study endocytic trafficking. Originally, assays were developed to study endocytosis in C. elegans oocytes, embryos, and coelomocytes (scavenger cells). Briefly, the assays in oocytes and embryos were performed by measuring the intensities and sizes of compartments containing a yolk protein-green fluorescent protein reporter (VIT-2::GFP) in intestinal compartments at the comma to ‘1.5 fold’ stages of development (Grant and Hirsh, 1999; Schaheen et al., 2006a). In adults, the intensities and sizes of compartments containing GFP (secreted from body wall muscle cells into the psuedocoelom and endocytosed by coelomocytes) were measured in the coelomocytes of transgenic adult C. elegans expressing Pmyo-3::ssGFP (signal sequence-GFP fusion protein) (Treusch et al., 2004). These assays have been used to identify and to elucidate functions of mediators of the endocytic pathway (Fares and Greenwald, 2001a and 2001b; Schaheen et al., 2006b; Huynh et al., 2016).
Here, we present an assay that can be used to study endocytosis in another C. elegans tissue. Adult intestinal cells of C. elegans are large and are thus also a great system for deciphering the endocytic pathway using live imaging techniques. The functions of intestinal cells include food assimilation and synthesis, storage of macromolecules, stress response, and host-pathogen interactions (McGhee, 2007). However, one of the main challenges of studying endocytic transport by live imaging in adult intestinal cells is the prevalence of auto-fluorescent gut granules that interfere with the unambiguous determination of bona fide endocytic compartment reporter (like GFP) signals and therefore bias qualitative and quantitative studies (Clokey and Jacobson, 1986). We therefore adapted a method developed by the Grant laboratory to conclusively identify signals from reporters in adult intestinal cells (Gleason et al., 2016; Huynh et al., 2016).
Materials and Reagents
Microscope slides (VWR, catalog number: 48382-171 )
Coverslips for microscope slides (Fisher Scientific, Fisherbrand, catalog number: 12-541A )
60 mm plates (Fisher Scientific, Fisherbrand, catalog number: FB0875713A )
100 mm plates (Fisher Scientific, Fisherbrand, catalog number: FB0875713 )
Labeling tape (Fisher Scientific, Fisherbrand, catalog number: 15-901-5K )
Glass pipette
Aluminum foil
Autoclave tape
Inoculating loops
Pipette tips
C. elegans experimental strain:
RT258: unc-119(ed3); pwIs50[lmp-1::GFP, unc-119]
Note: LMP-1 is the orthologue of mammalian Lamp1 that localizes to lysosomes in Caenorhabditis elegans (Kostich et al., 2000)
C. elegans control strain: N2
Calcium chloride dihydrate (CaCl2·2H2O) (Fisher Scientific, catalog number: C79-500 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Fisher Scientific, catalog number: M63-500 )
Potassium phosphate monobasic (KH2PO4) (Fisher Scientific, catalog number P285-500 )
Cholesterol (Sigma-Aldrich, catalog number: C8667 )
EtOH (Merck, catalog number: EX0276-4 )
LE agarose for making 2.2% agarose (BioExpress, GeneMate, catalog number: E-3120 )
Levamisole (Sigma-Aldrich, catalog number: 31742 )
C. elegans culture
Platinum wire-pick to transfer C. elegans
Making NGM plates (Brenner, 1974; He, 2011) (see Recipes)
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-3 )
Bacto peptone (BD, BactoTM, catalog number: 211677 )
Bacto agar (BD, BactoTM, catalog number: 214030 )
Double distilled water
Cholesterol 5 mg/ml in 95% EtOH (see Recipes)
1 M CaCl2 sterile (see Recipes)
1 M MgSO4 sterile (see Recipes)
1 M KH2PO4 pH 6.0 sterile (see Recipes)
Making 2x YT + OP50 for spotting NGM plates
OP50 frozen stock
2x YT agar plate
2x YT agar plate (see Recipes)
Bacto tryptone (BD, BactoTM, catalog number: 211705 )
Yeast extract (Fisher Scientific, catalog number: BP1422-500 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-3 )
Bacto agar (BD, catalog number: 214030 )
Double distilled water
2x YT medium (see Recipes)
2x YT medium + OP50 (see Recipes)
2.2% agarose pad (see Recipes)
9 mM levamisole/1x PBS (see Recipes)
Equipment
20 °C Incubator for C. elegans storage (VWR, manufactured by Sheldon Manufacturing, model: Model 2020 )
4 L flask
Stir bar
Stir plate
Autoclave
2 L beaker
1 L bottle
37 °C Incubator (VWR, manufactured by Sheldon Manufacturing, model: 5025 T )
Microwave
Heating block
5-100 ml bottle
Microscope (Carl Zeiss, model: STEMI SV 6 )
Zeiss LSM 510 Meta confocal microscope (Zeiss, model: LSM 510 ):
63x lens
Argon 488-nm laser
Helium neon 543-nm laser
Software
MetaMorph® Microscopy Automation & Image Analysis Software (Sunnyvale, CA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Huynh, J. M., Dang, H. and Fares, H. (2018). Measurement of Lysosomal Size and Lysosomal Marker Intensities in Adult Caenorhabditis elegans. Bio-protocol 8(3): e2724. DOI: 10.21769/BioProtoc.2724.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,725 | https://bio-protocol.org/exchange/protocoldetail?id=2725&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Precisely Oriented Cryosections of Undistorted Drosophila Wing Imaginal Discs for High Resolution Confocal Imaging
SP Samuel Petshow
Marcel Wehrli
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2725 Views: 8556
Edited by: Jihyun Kim
Reviewed by: Imre Gáspár
Original Research Article:
The authors used this protocol in Jul 2019
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2019
Abstract
The combination of immunofluorescence and laser scanning confocal microscopy (LSM) is essential to high-resolution detection of molecular distribution in biological specimens. A frequent limitation is the need to image deep inside a tissue or in a specific plane, which may be inaccessible due to tissue size or shape. Recreating high-resolution 3D images is not possible because the point-spread function of light reduces the resolution in the Z-axis about 3-fold, compared to XY, and light scattering obscures signal deep in the tissue. However, the XY plane of interest can be chosen if embedded samples are precisely oriented and sectioned prior to imaging (Figure 1). Here we describe the preparation of frozen tissue sections of the Drosophila wing imaginal disc, which allows us to obtain high-resolution images throughout the depth of this folded epithelium.
Figure 1. The epithelial structure and undistorted folding pattern are revealed in its entire depth in this frozen section of developing Drosophila wing. A-D. Transverse dorsoventral sections through the wing pouch. A. Cryosection reveals nuclei (A, green) and subcellular distribution of α-catenin (A’, A”, magenta) with signal throughout the depth of the epithelium. The basal surface is clearly detectable (arrows). A” is digitally enhanced image of A’. B. A Z-stack of images collected in a top-down view displayed as XZ orthogonal view reveals nuclei (B) but little discernable detail for α-catenin (B’, B”) and even the digitally enhanced image (B”) fails to reveal the basal epithelial surface (arrow). C. Transverse dorsoventral section displaying the Distal-less (Dll, green) gradient in the wing pouch and subcellular localization of DE-Cadherin (magenta) throughout the epithelium. D. View of the wing pouch. Dorsal is to the left; apical is up. Scale bars are 1 µm in A, B, 11 µm in C, 5 µm in D.
Keywords: Cryosection Frozen sections Confocal microscopy Wing imaginal disc Drosophila
Background
Third instar imaginal discs are flat pocket-like involutions of the epidermis (Cohen, 1993; McClure and Schubiger, 2005). One layer of this pocket, the ‘disc proper’, is a pseudostratified columnar epithelium that is heavily folded at the onset of metamorphosis. It is continuous with the ‘overlaying’ squamous epithelium, the peripodial membrane. The focus of our work is to understand how the Wnt morphogen patterns the dome-shaped wing pouch region of the wing disc. As imaginal discs are flat overall, conventional imaging has them mounted for top-down or upside-down observation, whereby cover-slips compress and distort the folded structure. The use of spacers prevents distortions, but imaging of the entire wing pouch using Z-stacks has proved unsatisfactory or impossible; as outlined above, the reduced resolution in the Z-axis typically prevents high-resolution reconstruction of the epithelium in the apical/basal direction. Therefore, only the apical half of the epithelium of the wing pouch is detected at high resolution. This problem is exacerbated if weak signals are to be detected. Thus, uniform imaging requires a ‘side-view’ that can be obtained in sections. We modified a cryosection protocol (Culbertson et al., 2011; Sui et al., 2012) to obtain transverse sections of wing discs at defined angles. This methodology was critical to our analysis of signaling gradients in the wing pouch.
Materials and Reagents
Pipette tips (USA Scientific, catalog numbers: 1111-1800 , 200 µl; 1111-2821 , 1,000 µl)
Glass 9-well plate (PYREXTM Spot Plate, Fisher Scientific, catalog number: 13-748B )
Razor blades (Single Edge Razor Blades, Stanley Black & Decker, catalog number: 28-510 )
Conical tipped plastic embedding capsules (Electron Microscopy Sciences, BEEM®, catalog number: 69913-01 )
Glass microscope slides (FisherfinestTM Premium Frosted, Fisher Scientific, catalog number: 12-544-2 )
Microscope cover glass (coverslips), 22 x 50-1 (Fisher Scientific, Fisherbrand, catalog number: 12-545E )
Plastic cling wrap
Late third instar Drosophila melanogaster larvae
Tissue Freezing Medium (TFMTM), clear (General Data, catalog number: TFM-C )
Fluoromount-G® (SouthernBiotech, catalog number: 0100-01 )
Clear Nail polish (i.e., Sally Hansen Hard As Nails)
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: P330 )
Sodium bicarbonate (NaHCO3) (Fisher Scientific, catalog number: S233 )
Calcium chloride dihydrate (CaCl2·2H2O) (Fisher Scientific, catalog number: C79 )
Sodium phosphate dibasic anhydrous (Na2HPO4) (Fisher Scientific, catalog number: S374 )
Potassium phosphate monobasic (KH2PO4) (Fisher Scientific, catalog number: P285 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Normal goat serum (Jackson ImmunoResearch, catalog number: 005-000-121 )
Gelatin from porcine skin (gel strength 300 Type A, Sigma-Aldrich, catalog number: G2500 )
D-Sucrose (Fisher Scientific, catalog number: BP220 )
Sodium azide (Fisher Scientific, catalog number: S2271 )
16% paraformaldehyde (Ted Pella, catalog number: 18505 )
Ice
Dry ice
Ringer’s solution (see Recipes)
4% formaldehyde fix (Solution A; see Recipes)
10x phosphate-buffered saline (PBS) (see Recipes)
PBT (see Recipes)
5% normal goat serum (Solution B; see Recipes)
30% sucrose (Solution C; see Recipes)
10% gelatin (Solution D; see Recipes)
Equipment
Dissection microscope (Leica Biosystems, model: Leica MZ6 )
Fine forceps (Dumont Tweezers #5, World Precision Instruments, catalog number: 500085 )
Pipettes 20 µl, 200 µl, 1,000 µl (Gilson, model: Pipetman P20, catalog number: F123600 ; Gilson, model: Pipetman P200, catalog number: F123601 ; Gilson, model: Pipetman P1000, catalog number: F123602 )
Water bath, 50 °C (Fisher Scientific, model: IsotempTM 205 )
Cryostat (Leica Biosystems, model: Leica CM1850 , with anti-roll plate assembly, Leica Biosystems, catalog number: 14041933981 )
Note: The product “Leica CM1850” has been discontinued.
Sample holders for cryostat (Specimen disc, 25 mm, Leica, catalog number: 14041619275 )
Ultralow Temperature Freezer, -80 °C (Thermo Fisher Scientific, model: UXF60086A , catalog number: 315673H01)
Fluorescence/confocal microscope (laser scanning microscope, ZEISS, model: LSM 780 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Petshow, S. and Wehrli, M. (2018). Preparation of Precisely Oriented Cryosections of Undistorted Drosophila Wing Imaginal Discs for High Resolution Confocal Imaging. Bio-protocol 8(3): e2725. DOI: 10.21769/BioProtoc.2725.
Download Citation in RIS Format
Category
Developmental Biology > Morphogenesis > Cell structure
Cell Biology > Cell imaging > Cryosection
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,726 | https://bio-protocol.org/exchange/protocoldetail?id=2726&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Chromosome Condensation/Decondensation During Mitosis by EdU Incorporation in Nigella damascena L. Seedling Roots
Eugene V. Sheval
Published: Vol 8, Iss 3, Feb 5, 2018
DOI: 10.21769/BioProtoc.2726 Views: 5747
Edited by: Amey Redkar
Reviewed by: Smita NairIsabelle Colas
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
To investigate the chromosome dynamics during mitosis, it is convenient to mark the discrete chromosome foci and then analyze their spatial rearrangements during prophase condensation and telophase decondensation. To label the chromosome regions in plant chromosomes, we incorporated the synthetic nucleotide, 5-ethynyl-2’-deoxyuridine (EdU), which can be detected by click-chemistry, into chromatin during replication. Here, we described a protocol of a method based on the application of semi-thin sections of Nigella damascena L. roots embedded in LR White acrylic resin. The thickness of semi-thin (100-250 nm) sections is significantly lower than that of optical sections even if a confocal microscope was used. This approach may also be suitable for work with any tissue fragments or large cells (oocytes, cells with polytene chromosomes, etc.).
Keywords: Plant Chromosome Replication EdU Click-chemistry
Background
Most data concerning chromosome organization have been acquired from studies of a small number of model organisms, the majority of which are mammals. In plants with large genomes, the chromosomes are significantly larger than the animal chromosomes that have been studied to date. To investigate the chromosome dynamics during mitosis, it is necessary to mark the discrete chromosome foci and then analyze their spatial rearrangements during prophase condensation and telophase decondensation. To label the chromosome regions, we incorporated the synthetic nucleotide, 5-ethynyl-2’-deoxyuridine (EdU) (Kuznetsova et al., 2017). Detection of EdU is based on a click-reaction, which is a copper catalyzed reaction between an azide and an alkyne. The EdU contains the alkyne which can react with the azide-containing detection reagent.
The most suitable distribution of labeled regions (i.e., separated labeled dots) was seen in cells which incorporated EdU during late S-phase. The brief pulse labeled all S-phase cells, and the initial appearance of EdU-labeled mitotic figures thus denoted the time needed for cells labeled in late S-phase to traverse into mitosis.
Root apical meristem does not allow for the acquisition of high-resolution images because of the out-of-focus fluorescence. Here, we described a protocol of a method based on the application of semi-thin (100-250 nm) sections of roots embedded in LR White acrylic resin. LR White is a polyhydroxy-aromatic acrylic resin with low toxicity and ultra-low viscosity. The polymerized resin is hydrophilic (sections freely permeable to aqueous solutions). The thickness of semi-thin sections is significantly lower than that of optical sections even if a confocal microscope was used. This approach may also be suitable for work with any tissue fragments or large cells (e.g., cells with polytene chromosomes).
Materials and Reagents
30 mm and 90 mm Petri dishes (Greiner Bio One International)
Filter paper
Single edge blades (Ted Pella, catalog number: 121-3 )
1.5 microtubes (SSIbio, catalog number: 1260-00 )
Snap-fit Gelatin Capsules, Size 2 (Ted Pella, catalog number: 130-19 )
Cover slips, No. 1 (Fisher Scientific, catalog number: 12-548A )
Microscope slides (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: AA00000112E00MNT10 )
Parafilm
Cotton wool
Foil
Safety gloves
Nigella damascena L. seeds
Click-iT EdU Alexa 555 Imaging Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: C10338 )
Thymidine (Sigma-Aldrich, catalog number: T9250 )
Phosphate buffered saline (PBS), pH 7.2 (10x) (Thermo Fisher Scientific, GibcoTM, catalog number: 70013016 )
Ethanol
4’,6-Diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 62248 )
Tris base
Concentrated HCl
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
LR White embedding kit (Sigma-Aldrich, catalog number: 62662 )
Note: This product has been discontinued.
Formvar 1595E (Serva, catalog number: 21740 )
1,2-Dichloroethane anhydrous (Sigma-Aldrich, catalog number: 284505 )
Mowiol 4-88 (Sigma-Aldrich, catalog number: 81381 )
Glycerol (MP Biomedicals, catalog number: 04800687 )
1,4-Diazabicyclo-[2.2.2]-octane (Sigma-Aldrich, catalog number: D2522 )
Note: This product has been discontinued.
Deionized H2O
1 M Tris-HCl (pH 8.5) (see Recipe 1)
Paraformaldehyde (see Recipe 2)
LR White acrylic resin (see Recipe 3)
Formvar coated cover slips (see Recipe 4)
Mowion mounting medium (see Recipe 5)
Equipment
Perfect Loop (Ted Pella, catalog number: 13064 )
Orbital Shaker OS-20 (Biosan, model: OS-20 , catalog number: BS-010108-AAG)
Laboratory incubator TC1/20 (SKTB, model: TC-1/20 , catalog number: 1003)
Chemical fume hood
Ultratome LKB III
Fluorescent microscope Axiovision 200M (Carl Zeiss, model: Axiovision 200M ) equipped with the ORCAII-ERG2 camera (Hamamatsu).
Note: For deconvolution, AxioVision 3.1 software (Carl Zeiss) was used.
pH meter
Magnetic stirrer with hot plate MSH-300 (Biosan, model: MSH-300, catalog number: BS-010302-OAA )
Glass or diamond knife
Micro-centrifuge MiniSpin (Eppendorf, model: MiniSpin® plus , catalog number: 5452000018)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sheval, E. V. (2018). Analysis of Chromosome Condensation/Decondensation During Mitosis by EdU Incorporation in Nigella damascena L. Seedling Roots. Bio-protocol 8(3): e2726. DOI: 10.21769/BioProtoc.2726.
Download Citation in RIS Format
Category
Cell Biology > Cell staining > Nucleic acid
Plant Science > Plant cell biology > Cell structure
Plant Science > Plant cell biology > Cell staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,727 | https://bio-protocol.org/exchange/protocoldetail?id=2727&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Small RNA Isolation and Sequencing Protocol and Its Application to Assay CRISPR RNA Biogenesis in Bacteria
Sukrit Silas
NJ Nimit Jain
MS Michael Stadler
BF Becky Xu Hua Fu
AS Antonio Sánchez-Amat
AF Andrew Z. Fire
JA Joshua Arribere
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2727 Views: 9227
Edited by: David Cisneros
Reviewed by: Kabin XieRamon Cervantes-Rivera
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
Next generation high-throughput sequencing has enabled sensitive and unambiguous analysis of RNA populations in cells. Here, we describe a method for isolation and strand-specific sequencing of small RNA pools from bacteria that can be multiplexed to accommodate multiple biological samples in a single experiment. Small RNAs are isolated by polyacrylamide gel electrophoresis and treated with T4 polynucleotide kinase. This allows for 3’ adapter ligation to CRISPR RNAs, which don’t have pre-existing 3’-OH ends. Pre-adenylated adapters are then ligated using T4 RNA ligase 1 in the absence of ATP and with a high concentration of polyethylene glycol (PEG). The 3’ capture step enables precise determination of the 3’ ends of diverse RNA molecules. Additionally, a random hexamer in the ligated adapter helps control for potential downstream amplification bias. Following reverse-transcription, the cDNA product is circularized and libraries are prepared by PCR. We show that the amplified library need not be visible by gel electrophoresis for efficient sequencing of the desired product. Using this method, we routinely prepare RNA sequencing libraries from minute amounts of purified small RNA. This protocol is tailored to assay for CRISPR RNA biogenesis in bacteria through sequencing of mature CRISPR RNAs, but can be used to sequence diverse classes of small RNAs. We also provide a fully worked example of our data processing pipeline, with instructions for running the provided scripts.
Keywords: CRISPR Small RNA High throughput sequencing Guide RNA CRISPR RNA crRNA processing crRNA biogenesis crRNA maturation
Background
Genetic modules associated with Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) confer adaptive immunity in diverse prokaryotic hosts (Barrangou et al., 2007). Memories of invasive elements (such as viruses, plasmids, and other mobile elements) are stored interspersed between directed repeats of the CRISPR arrays in the host genome in the form of ‘spacers’ comprising the nucleic acid sequence of the molecular parasite (Brouns et al., 2008; Jackson et al., 2017). In order to identify subsequent infections by the same invader, the information contained in CRISPR spacers must be communicated to CRISPR-associated (Cas) endonucleases (Plagens et al., 2015). For the vast majority of CRISPR-Cas systems (phylogenetically grouped as ‘type I’ and ‘type III’ [Makarova et al., 2011 and 2015]), this occurs through the activity of a family of CRISPR-associated endoribonucleases known as Cas6 (Charpentier et al., 2015; Hochstrasser and Doudna, 2015). The entire CRISPR array is transcribed as a precursor CRISPR RNA (pre-crRNA) molecule from the genome, and the Cas6 protein domain helps to process this transcript into a collection of mature CRISPR RNAs (crRNA) consisting of one CRISPR spacer each, flanked by portions of the CRISPR repeat sequence (Carte et al., 2008 and 2010; Haurwitz et al., 2010). This mechanism is known as crRNA biogenesis. Cas6 endoribonucleases promote crRNA biogenesis through site-specific cleavage of the CRISPR repeat sequence, which generates 5’-OH and 2’3’-cyclic phosphate termini (Charpentier et al., 2015; Hochstrasser and Doudna, 2015). Site-specific cleavage at every CRISPR repeat results in the pre-crRNA molecule being chopped at regular intervals into almost equal-length crRNAs, each with a different spacer sequence (Charpentier et al., 2015; Hochstrasser and Doudna, 2015). Mature crRNAs are then loaded onto Cas effector complexes and serve as molecular guides that direct Cas enzymes to target DNA or RNA parasites based on sequence complementarity (Deveau et al., 2008; Marraffini and Sontheimer, 2008). The presence or absence of mature crRNAs isolated from bacterial cell populations can be used as a proxy for Cas6 activity. While biochemical methods have been developed to detect crRNAs (Carte et al., 2008 and 2010; Haurwitz et al., 2010), high-throughput RNA sequencing can be used to assay for Cas6 activity unambiguously (Heidrich et al., 2015). Whole transcriptome sequencing is expensive and can be biased against specific classes of RNAs depending on the specific method of library preparation. Therefore, various small RNA sequencing protocols have been developed to preferentially detect mature crRNAs (Juranek et al., 2012; Richter et al., 2012; Heidrich et al., 2015).
Here, we present a multiplexed small RNA sequencing method to enable facile and reproducible comparisons of crRNA maturation between many different biological conditions at once, such as mutations in the Cas6 protein to assess the mechanism of Cas6 activity. This protocol builds on previous work on small RNA sequencing and ribosome profiling (Lau et al., 2001; Ingolia et al., 2009; Guo et al., 2010; Kwon, 2011; Kivioja et al., 2011). The assay features high sensitivity and dynamic range without expending a lot of sequencing bandwidth on other cellular RNAs, with the caveat that the full-length precursor transcript is not observed by small RNA sequencing.
Materials and Reagents
Gel-Loading Pipette tips 0.5-200 μl (Thermo Fisher Scientific, InvitrogenTM, catalog number: LC1001 )
0.6 ml microcentrifuge tubes (Sigma-Aldrich, catalog number: T5149 )
Razor blade
Siliconized 1.5 ml microcentrifuge tubes (VWR, catalog number: 22179-004)
Manufacturer: BIO PLAS, catalog number: 4165SL .
Plastic dish
Clear plastic film (Saran wrap, or equivalent)
Corning Costar Spin-X sterile 0.45 μm cellulose acetate centrifuge tube filters (Corning, catalog number: 8162 )
0.2 ml PCR tubes, MicroAmp (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: N8010540 ) or equivalent
Gel-Excision Pipette tips (Corning, Axygen®, catalog number: TGL-1165-R )
Heavy Phase Lock Gel in 2 ml tubes (Quantabio, catalog number: 2302830 )
Corning tube top vacuum filtration system (Corning, catalog number: 430320 )
Trizol reagent (Thermo Fisher Scietific, InvitrogenTM, catalog number: 15596026 )
Pre-Cast Novex 6% TBE-Urea polyacrylamide gels (Thermo Fisher Scientific, InvitrogenTM, catalog number: EC6865BOX )
10x TBE running buffer (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9863 )–dilute to 1x before use
GeneRuler Ultra Low Range DNA Ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SM1211 )
2x formamide gel loading dye (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM8546G )
SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: S11494 )
UltraPure glycogen (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10814010 )
200 Proof molecular biology grade ethanol (Sigma-Aldrich, catalog number: E7023 )
UltraPure DNase/RNase-free distilled water (Thermo Fisher Scientific, catalog number: 10977035 )
Polynucleotide Kinase (PNK) enzyme and buffer (New England Biolabs, catalog number: M0201S )
Ammonium acetate solution 7.5 M molecular biology grade (Sigma-Aldrich, catalog number: A2706 )
50% PEG 8000 (supplied with NEB T4 RNA ligase I)
Pre-adenylated 3’ adapter oligo: /5rApp/NNNNNNAGATCGGAAGAGCACACGTCT/3ddC/
T4 RNA ligase I (New England Biolabs, catalog number: M0204S )
NEB buffer 2 (New England Biolabs, catalog number: B7002S )
5’ Deadenylase (New England Biolabs, catalog number: M0331S )
RecJf (New England Biolabs, catalog number: M0264S )
Acidified phenol:chloroform 1:1 mixture (Thermo Fisher Scientific, catalog number: AM9720 )
Chloroform (Sigma-Aldrich, catalog number: 496189 )
5x First Strand Buffer (supplied with SuperScript II Reverse Transcriptase)
0.1 M dithiothreitol (supplied with SuperScript II Reverse Transcriptase)
10 mM dNTP mix (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0191 )
SuperScript II Reverse Transcriptase (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18064014 )
Reverse transcription primer:
/5Phos/AGATCGGAAGAGCGTCGTGT/iSp18/CACTCA/iSp18/GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
Pre-Cast Novex 10% TBE-Urea polyacrylamide gels (Thermo Fisher Scientific, InvitrogenTM, catalog number: EC6875BOX )
1 N sodium hydroxide solution (Merck, catalog number: SX0607H )
CircLigase ssDNA ligase and 10x reaction buffer (Lucigen, catalog number: CL4111K )
1 mM ATP solution (supplied with circLigase)
UltraPure Agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500500 )
10x TAE (Thermo Fisher Scientific, catalog number: AM9869 )–dilute to 1x before use
Ethidium bromide solution 10 mg/ml (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 17898 )
Phusion High-Fidelity PCR master mix (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: F531S )
Indexing primers:
CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCG where the X6 barcodes correspond to Illumina TruSeq LT indexes AD001 to AD008 [ATCACG, CGATGT, TTAGGC, TGACCA, ACAGTG, GCCAAT, CAGATC, ACTTGA]
Note: More indexing primers may be added as needed.
Universal PCR primer:
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
DNA gel loading dye 6x (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0611 )
25 bp DNA ladder
MinElute Gel extraction kit (QIAGEN, catalog number: 28604 )
5 M sodium chloride solution BioUltra for molecular biology (Sigma-Aldrich, catalog number: 71386 )
0.1 M EDTA solution, pH 7.5 (Merck, catalog number: EX0546A )
1 M HEPES solution BioPerformance certified and 0.2 μm filtered (Sigma-Aldrich, catalog number: H3537 )
8 N potassium hydroxide solution (Sigma-Aldrich, catalog number: P4494 )
50 mM manganese chloride solution (supplied with circLigase)
Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32854 )
1 M Dithiothreitol solution BioUltra for molecular biology (Sigma-Aldrich, catalog number: 43816 )
Glycerol for molecular biology (Sigma-Aldrich, catalog number: G5516 )
1 M magnesium chloride solution for molecular biology (Sigma-Aldrich, catalog number: M1028 )
20 mg/ml Acetylated bovine serum albumin (Thermo Fisher Scientific, catalog number: AM2614 )
Polyacrylamide gel elution buffer (see Recipes)
1 M HEPES/KOH buffer pH 8.3 (see Recipes)
60% glycerol solution (see Recipes)
5x adenylation buffer (see Recipes)
Equipment
Scissors
XCell SureLock Mini-Cell (Thermo Fisher Scientific, InvitrogenTM, model: XCell SureLockTM Mini-Cell, catalog number: EI0001 )
Heated-lid thermocycler, Veriti 96-well (Thermo Fisher Scientific, Applied BiosystemsTM, model: VeritiTM 96-well, catalog number: 4375786 ) or equivalent
Transilluminator with 365 nm wavelength UV bulb (VWR, catalog number: 89131-464 or equivalent)
Tabletop microcentrifuge (Eppendorf, model: 5424 or equivalent, for use at room temperature and 4 °C)
Freezer capable of reaching -80 °C
Programmable water bath/heat block
Rotisserie tube rotator (VWR, catalog number: 10136-084 or equivalent)
10 μl pipette
Gel electrophoresis power supply (Thermo Fisher Scientific, model: OwlTM EC1000XL or equivalent)
Owl EasyCast Mini Gel electrophoresis system (Thermo Fisher Scientific, Thermo ScientificTM, model: OwlTM EasyCastTM B2 ) or equivalent
100-1,000 μl pipette
Qubit 3.0 Fluorometer (Thermo Fisher Scientific, InvitrogenTM, model: QubitTM 3 , catalog number: Q33216)
Procedure
Duration: The protocol can be performed comfortably in 4 days (including RNA isolation from bacteria) as follows: Steps A1-A16 on day 1, A17-C5 on day 2, D1-E12 on day 3, and E13 onwards on day 4. The flowchart below summarizes the major steps in the protocol (Figure 1).
Figure 1. The flowchart of the major steps in the protocol
RNA isolation from bacteria: RNA extraction methods will depend on the bacteria under study. The extraction method must avoid any column-based or size-dependent purification steps that could lead to preferential loss of small RNAs. We follow the manufacturer’s instructions provided with Trizol reagent for our model system Marinomonas mediterranea, a gamma-proteobacterium (like E. coli). We use no more than 200-500 μl of saturated M. mediterranea culture in Marine Broth 2216 for RNA isolation.
Sequencing library preparation:
Small RNA isolation by denaturing polyacrylamide gel electrophoresis (PAGE)
Assemble a pre-cast Novex 6% TBE-Urea denaturing polyacrylamide gel in the XCell SureLock Mini-Cell Electrophoresis System.
Note: Remember to remove the gel comb and the green tape at the bottom of the gel cassette before assembling the electrophoresis cell.
Fill the inside and outside chambers with 1x TBE running buffer, and pre-run the gel at 180 V for at least 30 min.
Prepare samples of at least 5-10 μg total intact RNA and 0.1 μg Ultra Low Range DNA ladder in 2x formamide gel loading dye at a final concentration of 1x. We suggest keeping the total volume of each sample < 15 μl.
Denature the samples and ladder by heating in a thermocycler with a pre-heated lid at 94 °C for 5 min, then immediately place in an ice-water slurry.
While the samples are denaturing, thoroughly flush urea out of each gel well using a 100 μl pipette with the running buffer from the inner chamber several times.
Load samples carefully with gel-loading pipette tips.
Note: Leave 1-2 lanes between different RNA samples to reduce the amount of cross-contamination between experiments. We recommend including no more than 4-5 RNA samples (and one lane for the approximate sizing ladder) in a 10-lane gel.
Run at 180 V until the bromophenol blue dye front (bottom band ~25 nt) reaches close to the end of the gel (about 35 min).
While the gel is running, prepare gel elution tubes by making a small cross-shaped incision at the bottom of a 0.6 ml tube with a clean razor blade (see diagram for details) and placing it inside a 1.5 ml siliconized centrifuge tube. Do not remove the caps of either the 0.6 ml or 1.5 ml tubes (Figure 2).
Figure 2. Longitudinal and transverse view of 0.6 ml tube for pulverizing polyacrylamide gel fragments. A cross-shaped incision is made at the bottom of 0.6 ml centrifuge tube using a clean razor blade. The polyacrylamide gel fragment is pulverized as it is forced through the incision and into a 1.5 ml siliconized centrifuge tube by centrifugation.
Note: Use of siliconized tubes is critical to avoid the loss of RNA due to non-specific binding to tube walls.
Carefully disassemble the cassette and remove the gel. Stain with SYBR Gold diluted 1:5,000 in 1x TBE running buffer.
Note: We typically use 3 μl of SYBR Gold in 15 ml running buffer and stain on a slowly rocking nutator in a small plastic dish for about 5 min at room temperature. Wear appropriate protective equipment to prevent exposure to SYBR Gold, and also to prevent contamination of samples with extraneous biological material.
Transfer the gel onto a clear plastic film and place on a UV transilluminator (set at 365 nm wavelength).
Carefully excise out gel fragments for each sample from the 25-nt marker upto the 75-nt marker, which should be just below a bright band corresponding to cellular tRNAs (Figure 3).
Note: For a non-degraded RNA sample, there will most likely be no visible RNA in the excised gel fragment. We often include a small portion of the lowest visible tRNA band to serve as a carrier in subsequent steps. Intact tRNAs typically do not reverse transcribe efficiently and should not result in overwhelming contamination in the final dataset.
Figure 3. Small RNA size selection. A. Four intact total RNA samples (6% denaturing TBE-Urea PAGE). Two biological replicates for each experiment were run side-by-side, with approximate DNA sizing ladders. Images cropped and brightness/contrast adjusted in Microsoft Word. B. Size selection of 25- to 75-nt RNAs, including lowest tRNA band. The Invitrogen 10 bp DNA ladder was used in this gel but has since been discontinued by the manufacturer.
Place each gel fragment in a separate elution tube.
Centrifuge each elution tube at 20,000 x g at room temperature in a tabletop microcentrifuge for 1-3 min to force the gel fragment through the incision in the 0.6 ml tube and into the 1.5 ml siliconized tube. Carefully remove any leftover gel pieces in the 0.6 ml tube with a clean pipette tip, and place in the corresponding 1.5 ml siliconized tube. Discard the 0.6 ml tube.
Add 300 μl of polyacrylamide gel elution buffer (see Recipes) into each 1.5 ml siliconized tube containing pulverized gel fragments, and vortex vigorously to make a uniform slurry.
Place the tubes at -80 °C to freeze, then in a 37 °C water bath for 2 min to thaw. Vortex vigorously, and then repeat this step 2-3 times.
Place the samples on ice for 1 min to cool, then incubate at 4 °C with shaking in a rotisserie tube rotator overnight to elute RNA from gel fragments.
Centrifuge briefly to collect gel slurry at the bottom of the tube.
Prepare filtration tubes by placing 0.45 μm sterile cellulose acetate filters in new 1.5 ml siliconized tubes.
Widen the bore of 1,000 μl pipette tips using clean scissors, and transfer gel slurry to the filtration tubes.
Collect RNA eluate by centrifugation at 16,000 x g for 2 min at room temperature, discard the filters, and add (in order) 1 μl (20 mg/ml) glycogen and 1 ml 100% ethanol to each sample.
Precipitate nucleic acids by placing the tubes at -80 °C for 30 min.
Centrifuge at 20,000 x g at 4 °C for 30 min, and discard the ethanol while taking care not to dislodge the pellet.
Wash with 1 ml freshly prepared 70% ethanol, taking care to flush out the cap by inverting several times.
Note: It is not necessary to vortex aggressively at this step. Vortexing can be helpful in dislodging the pellet, but excessive agitation, as well as use of more concentrated ethanol for washing will lead to pellet fragmentation and reduction in yield.
Centrifuge at 20,000 x g for 2 min at room temperature to collect the pellet, pour off the ethanol and repeat the wash.
Centrifuge briefly at room temperature to collect residual ethanol after the second wash step is complete. Remove remaining ethanol using a 10 μl pipette, taking care not to touch the pellet. Air dry for 3 min.
Note: After removing residual ethanol with a pipette, 3 min is sufficient to dry the pellet. We typically dry under a flame to prevent dust from accidentally settling in the tubes.
Resuspend pellet in 17 μl RNase-free water at room temperature.
Note: The added glycogen from Step A20 should result in a clearly visible pellet that may become translucent upon drying. The pellet will be easy to resuspend provided it has not been over-dried.
Polynucleotide kinase (PNK) treatment
Denature RNA at 90 °C for 1 min in a heated-lid thermocycler, then plunge in ice for 1 min.
Note: We use the entire RNA sample from the previous step, and do not attempt to measure its concentration since the amount of RNA is often below the detection limit of commercial assay kits.
To 17 μl of the RNA sample, add (in order) 2 μl 10x PNK buffer and 1 μl PNK enzyme, and mix well by pipetting.
Incubate at 37 °C for 1 h.
Add (in order) 80 μl RNase-free water, 50 μl (7.5 M) ammonium acetate, and 500 μl 100% ethanol.
Precipitate RNA as in Steps A21-A25.
Resuspend pellet in 4.5 μl RNase-free water at room temperature.
Note: The added glycogen from Step A20 should result in a clearly visible pellet that may become translucent upon drying. The pellet will be easy to resuspend provided it has not been over-dried.
3’ adapter ligation (without ATP)
Pre-mix equal volumes of 5x adenylation buffer (see Recipes) and 50% PEG 8000 to make 4 μl mixture per sample (+ 20% extra to account for pipetting error).
Transfer RNA samples to 0.2 ml PCR tubes, and add 4 μl of the mixture to each RNA sample. Mix well by pipetting.
Note: PEG 8000 is viscous and pre-mixing with 5x adenylation buffer helps to reduce viscosity and make dispensing to sample tubes easier. Mix by pipetting for as long as necessary until the solution appears uniform.
Heat sample to 98 °C for 1 min, plunge in ice for 1 min, then place at room temperature for the next step.
Add (in order) 0.5 μl (100 μM) pre-adenylated 3’ adapter oligo, and 1 μl T4 RNA ligase I. Mix well by pipetting.
Note: We keep the pre-adenylated 3’ adapter oligo at -80 °C and thaw on ice before use.
Incubate in a thermocycler at 22 °C for 6 h. The reaction can be stored at 4 °C if performing this step overnight.
Excess adapter digestion
Pre-mix 78 μl RNase-free water and 10 μl NEB buffer 2 for each sample.
Incubate RNA samples at 95 °C for 1 min, allow to cool and then add 88 μl of buffer mixture.
Add 1 μl 5’ deadenylase, mix, and incubate at 30 °C in a thermocycler for 30 min.
Add 1 μl RecJf, mix, and incubate at 37 °C in a thermocycler for 30 min.
Note: The 5’ deadenylase removes the /5rApp/ group from the free 5’ ends of un-ligated pre-adenylated adapters, thereby exposing the excess adapter molecules to digestion by the single-stranded-DNA-specific 5’ → 3’ exonuclease RecJf.
During the digestion step, pre-spin a heavy phaselock gel tube for each sample at 16,000 x g for 2 min at room temperature.
Add 100 μl RNase-free water to each RNA sample, mix well, and transfer to a pre-spun phaselock tube.
Add 200 μl acid-phenol:chloroform to each sample and mix by shaking vigorously by hand.
Centrifuge at 16,000 x g at room temperature for 5 min.
Add 200 μl chloroform to each sample in the same tube and mix gently by inversion.
Centrifuge at 16,000 x g at room temperature for 5 min.
Transfer the aqueous phase to a new 1.5 ml siliconized tube, and add (in order) 0.5 μl (20 mg/ml) glycogen, 100 μl (7.5 M) ammonium acetate and 1 ml 100% ethanol to each sample.
Precipitate RNA as in Steps A21-A25.
Resuspend pellet in 5.75 μl RNase-free water at room temperature.
Note: The added glycogen from Step D11 should result in a clearly visible pellet that may become translucent upon drying. The pellet will be easy to resuspend provided it has not been over-dried.
Reverse-transcription
Prepare a reverse-transcription master mix, with 2 μl 5x First-strand buffer, 1 μl (0.1 M) dithiothreitol, and 0.5 μl (10 mM) dNTPs for each RNA sample (+ 20% extra to account for pipetting error).
Transfer RNA samples to 0.2 ml PCR tubes, and add 0.25 μl (100 μM) reverse-transcription primer to each tube.
Heat samples to 90 °C for 1 min, then plunge on ice for 1 min.
Add 3.5 μl of reverse-transcription master mix to each sample.
Note: Also maintain a ‘no-template’ control, which will allow for visualization of the reverse-transcription primer during the subsequent gel purification step.
Add 0.5 μl SuperScript II reverse transcriptase to each reaction and mix well by pipetting.
Incubate at 42 °C for 30 min in a heated-lid thermocycler to synthesize complementary DNA (cDNA).
During this incubation step, set up and pre-run a Novex 10% TBE-Urea denaturing polyacrylamide gel in the XCell SureLock Mini-Cell Electrophoresis System at 180 V for at least 30 min as described in Steps A1-A2.
Add 2 μl (1 N) sodium hydroxide to each reaction.
Incubate at 70 °C for 15 min in a heated-lid thermocycler to hydrolyze RNA.
Add 12 μl 2x formamide gel loading dye (i.e., at a final concentration of 1x) to each sample.
Prepare 0.1 μg of Ultra Low Range DNA ladder in 2x formamide gel loading dye at a final concentration of 1x.
Denature and run cDNA on pre-run gels as in Steps A4-A25, with the following modifications:
In Step A7, run the gel until the Xylene Cyanol dye front (top band ~55 nt) reaches close to the bottom of the gel (about 45-60 min).
In Step A11, excise gel fragments in the 100- to 160-nt range (processed CRISPR RNAs are generally in the ~50-100-nt range and the reverse transcription primer adds ~65-nt to the size of the desired small RNAs). Use the no-template control as a visual guide during gel excision, and avoid the bright bands formed in this lane (typically no higher than 90-nt) (Figure 4).
In step A16, cDNA elution should be carried out at room temperature.
Resuspend the cDNA pellet in 17 μl water. Reserve half the sample and store at -20 °C as a backup.
Figure 4. Purification of cDNA following reverse transcription. A. Four cDNA sample (10% denaturing TBE-Urea PAGE). The first lane is the no-template control, followed by an approximate DNA sizing ladder. Brightness/contrast adjusted in Microsoft Word. B. Size selection of 100- to 160-nt cDNAs, avoiding bright high-molecular-weight bands. The Invitrogen 10 bp DNA ladder was used in this gel but has since been discontinued by the manufacturer.
cDNA circularization
Add 1 μl 10x circLigase reaction buffer, 0.5 μl (1 mM) ATP, and 0.5 μl (50 mM) manganese chloride solution to 8 μl cDNA in 0.2 ml PCR tubes.
Add 0.5 μl circLigase enzyme. Mix well by pipetting.
Incubate at 60 °C for 75 min in a heated-lid thermocycler.
While the circularization reaction is proceeding, prepare enough 3-3.5% agarose gels (in 1x TAE with 0.5 μg/ml ethidium bromide) to accommodate 5 PCR lanes plus 1 DNA sizing ladder per cDNA sample.
Note: We use the 1.5 mm thick 12-well combs supplied with Owl EasyCast B2 gel electrophoresis systems to make enough lanes for two cDNA samples.
Stop the reaction by heating to 80 °C for 15 min. Use this circularized cDNA (ccDNA) sample directly as a template for PCR.
PCR amplification and purification of sequencing libraries
Prepare a PCR mix with 100 μl 2x Phusion Master Mix, 1 μl (100 μM) Universal PCR primer, and 100 μl water for each cDNA sample.
Add 200 μl PCR mix to 5 μl ccDNA from Step F5. Add 1 μl of a different indexing primer for each sample.
Split each reaction mixture into 5 separate 0.2 ml PCR tubes (40 μl each).
Perform a PCR titration for each ccDNA sample by running each sub-reaction for a different number of cycles according to the following program:
98 °C for 30 sec
N cycles of
98 °C for 10 sec
60 °C for 10 sec
72 °C for 10 sec
hold at 10 °C
Note: We typically perform titrations with N = 12, 15, 18, 21, and 24 cycles for each ccDNA sample.
Add 8 μl of 6x DNA gel loading dye to each reaction.
Load all 5 titrations for each sample side-by-side on the agarose gel. We suggest using the Ultra Low Range DNA ladder (~0.5 μg/lane) to demarcate sets of titrations of different ccDNA samples.
Run the gel in agarose gel running buffer (1x TAE with 0.5 μg/ml ethidium bromide) at 3.6-3.7 V/cm for 1-2 h.
Place the gels on a UV transilluminator (set at 365 nm wavelength). Choose the appropriate number of PCR cycles for each ccDNA sample by visually assessing the PCR titration (see Note below) and excise a gel slice containing the PCR amplicon corresponding to the size of the desired product using a 100-1,000 μl pipette fitted with gel excision tips. Expel each gel slice into a separate 1.5 ml centrifuge tube.
Note: A bright band corresponding to the ‘empty’ circularized ccDNA product (i.e., without a small RNA insert) should be visible in each lane. This may appear as a doublet as the number of PCR cycles (N) is increased. For most small RNA sequencing applications, the desired product will be ~50 bp above this bright band/doublet. For CRISPR RNA sequencing, we rarely ever see a visible smear at this size range, and cut ‘blindly’ using the DNA ladder and the location of the bright band/doublet (~125 bp) as a visual guide. We typically aim for the highest number of PCR cycles for each ccDNA sample while still safely avoiding the upward-smear from the bright ~125 bp band/doublet (Figure 5).
Figure 5. Library preparation by ‘blind’ gel excision. A. PCR titrations of amplified sequencing libraries for two ccDNA samples (3-3.5% native agarose gel electrophoresis). 5 titrations for each ccDNA sample were run side-by-side along with a DNA sizing ladder. Brightness/contrast adjusted in Microsoft Word. B. Size selection of DNA at the 175 bp marker, above the bright band/doublet formed by amplification from empty ccDNA (i.e., without a small RNA insert). The Invitrogen 25 bp DNA ladder was used in this gel but has since been discontinued by the manufacturer.
Extract DNA from the gel slices according to manufacturer’s instructions using the QIAGEN MinElute Gel Extraction kit.
Quantify each purified DNA sample according to manufacturer’s instructions using the high-sensitivity double stranded DNA quantification kit accompanying the Qubit fluorometer.
Calculate the approximate concentration of each sample according to the following formula:
Pool the samples in equimolar amounts. The pooled library can be sequenced according to the specifications of your Illumina high-throughput sequencing services provider. We typically use the single-read configuration for 80 cycles for small RNA sequencing applications. For assessing pre-crRNA processing in Marinomonas mediterranea, we sequence no more than 1 million reads per sample, but this will depend on the level of expression of pre-crRNA in the species of interest.
Data analysis
We include a worked example with sample data, which requires the following programs to be installed:
cutadapt (tested on v1.14; likely compatible with most other versions)
Python 2.7 (with numpy, matplotlib for plotting)
The usage formats of the provided python scripts are in bold italics, followed by the specific commands in bold for the worked example with sample data. Start by downloading the worked example, and navigating to the worked_example/ directory in a unix terminal.
Demultiplex reads: Obtain the high-throughput sequencing data in ‘fastq’ format.
Sample and index reads will be in files Undetermined_S0_L001_R1_001.fastq and Undetermined_S0_L001_I1_001.fastq respectively, with the first read corresponding to the first index, the second read corresponding to the second index, and so on. A sample dataset is provided in the sample_data directory.
To segregate reads corresponding to each index, prepare a demultiplexing ‘key’–a tab separated text file with the first column containing the desired sample name, and the second containing the reverse complement of the corresponding TruSeq LT index (AD001-8). A sample file deMultiplexKey_sample.dat is provided.
Now run the deMultiplexer.py file as follows:
python deMultiplexer.py <path_to_directory> <key>
e.g., python deMultiplexer.py sample_data/ deMultiplexKey_sample.dat
This generates a FASTQ file for each index provided in the key. Note how the files for samples 1-4 in the provided example are empty. The example dataset only contains reads corresponding to the index reads provided for samples 5-8.
Move demultiplexed data (samples 5-8) to a separate directory
mkdir sample_demultiplexed
cd sample_data/
mv sample[5-8]*.fastq ../sample_demultiplexed/
cd ../
Trim adapters: The high-throughput sequencing data will contain Illumina adapter sequences. These are parts of the molecule that were necessary for sequencing on the Illumina flowcell.
Collapse reads to eliminate amplification bias: The assay design includes a random hexamer (NNNNNN) in the 3’ adapter sequence, which is ligated to every RNA molecule before reverse-transcription. This helps eliminate amplification bias in downstream steps and helps ensure that every read corresponds to a distinct RNA molecule in the biological sample.
Both Steps 2 and 3 (trimming and collapsing) are performed in the provided example with the dirRNAseqAnalyse.py script (using the readCollapser2.py function, which must be in the same directory as the script) as follows:
python dirRNAseqAnalyse.py <path_to_directory> <maximum_read_length>
e.g., python dirRNAseqAnalyse.py sample_demultiplexed/ 80
The program produces a log file dirRNAseqAnalyseLog.txt which contains details of the adapter trimming step.
Convert to fasta: The fastq2fasta.sh script has been prepared anticipating the files that will be generated in Step 3 for sample data. Each line in this script processes one input fastq file to one output fasta file. Modify this file with your input files (with .trimmed.collapsed.fastq extensions) and output files (with .fasta extensions) as desired. Convert using the following commands:
Run the provided fastqtofasta.sh script:
sh fastq2fasta.sh
Move the trimming intermediates to a new directory:
mkdir sample_trimmed_collapsed
mv *.trimmed* sample_trimmed_collapsed/
Move the .fasta files to a new directory:
mkdir sample_fasta
mv *.fasta sample_fasta/
Filtering:
Identify CRISPR derived reads: First, identify sequencing reads containing the 5’ end of the CRISPR direct repeat sequence. We require at least 5 contiguous bases in the sequencing read to match the first five bases of the CRISPR repeat. The CRISPR repeat of interest is supplied in the 1st line of the parameters file crRNAfigureMaker_params.txt. Any sequence upstream of the start of the CRISPR repeat is removed.
Remove short matches: If the resulting processed repeat is shorter than 12 bases, also check to see if the 5 bases preceding the CRISPR repeat in the original read match one of the possible spacer endings from the CRISPR arrays in the bacterial genome. In this way, we require at least 12 bases from the CRISPR repeat, or 10 bases across the spacer-repeat junction for any read to qualify for downstream analysis. A dictionary of all possible native spacer endings from the type III-B CRISPR locus in the Marinomonas mediterranea MMB-1 genome is provided in spacerEnds.dict.
Note: The spacerEnds.dict file can be modified in any text editor, but its formatting must be preserved to prevent parsing errors in python.
Assess match fidelity: If the read passes initial filtering, the processed repeat is then matched to the expected CRISPR repeat sequence. We require the repeat to be a left-anchored substring of the CRISPR repeat (i.e., the processed repeat may be shorter than the CRISPR repeat, but it must match at the 5’ end and cannot contain mismatches).
Measure levels of a reference gene: Next, count reads containing 25-nt substrings of a reference gene that is highly expressed and does not vary with the biological conditions under study. We use the isoleucine-tRNA sequence as a reference in M. mediterranea datasets, but this may need to be empirically determined based on your RNAseq data for your model. This sequence must be provided in the 2nd line of the crRNAfigureMaker_params.txt file.
Plot a histogram of lengths of trimmed reads: Finally, plot a histogram of the lengths of the processed CRISPR repeats normalized to the reference gene. The 3rd line of the crRNAfigureMaker_params.txt file is an arbitrary scaling parameter that controls the height of the Y axis in the plot. It can be changed to accommodate the levels of processed crRNAs relative to the reference gene in your dataset.
Steps 5, 6, and 7 are performed by the crRNAfigureMaker.py script as follows:
python crRNAfigureMaker.py <path_to_fasta_files> <keyword>
e.g., python crRNAfigureMaker.py sample_fasta/ 8
The keyword option specifies which files should be included in the analysis. The keyword can be any part of the file name. For instance, using the keyword ‘8’ will only process sample8.fasta in the worked example, while using the keyword ‘mpl’ will include all 4 sample files for processing, and using the keyword ‘sem’ will result in no files being included.
The crRNAfigureMaker_param.txt file must be in the same directory as the code. Running the above command (i.e., only processing sample8.fasta) should generate Figure 6 below.
Figure 6. Expected output of code provided in the worked example. Processed crRNA levels assayed by high throughput small RNA sequencing. This dataset has been artificially supplemented with sequences matching expected CRISPR-derived RNAs. The CRISPR repeat sequence from the 1st line of the parameters file crRNAfigureMaker_params.txt is on the X-axis. The height of the bar at each base along the X-axis represents the relative proportion of crRNAs with 3’ ends at that base, normalized to the levels of the reference RNA (isoleucine tRNA; consistently the most abundant species encountered in our M. mediterranea datasets). The presence of a distinct 3’ end sequence in the population of CRISPR repeat containing RNAs indicates site-specific cleavage and processing of pre-crRNA.
The data files in the worked example are small subsets of our experimental data and have been artificially supplemented with sequences matching expected CRISPR-derived RNAs. Please refer to our public datasets at the NCBI Short Read Archive (SRP103952) to recreate the published graphs (Silas et al., 2017a). The following table specifies the accession numbers for the experiments that correspond to each of the relevant figure panels in (Silas et al., 2017a).
Recipes
Polyacrylamide gel elution buffer
300 mM NaCl
1 mM EDTA
To make 50 ml:
3 ml
5 M sodium chloride solution
500 μl
0.1 M EDTA solution
46.5 ml
RNase free water
1 M HEPES/KOH buffer pH 8.3
Adjust the pH of 1 M HEPES solution with 8 N potassium hydroxide to 8.3
Sterile filter using a 0.2 μm vacuum filtration unit
60% glycerol solution
To make 10 ml, mix 6 ml glycerol with 4 ml RNase-free water
Sterilize by autoclaving
5x adenylation buffer
Note: Store in 1 ml aliquots at -20 °C up to 1 year.
41% glycerol
250 mM HEPES/KOH pH 8.3
50 mM MgCl2
16.5 mM DTT
50 μg/ml Ac-BSA
To make 5 ml, mix:
3.4 ml
60% glycerol solution
1.25 ml
1 M HEPES/KOH buffer pH 8.3
250 μl
1 M magnesium chloride solution
82.5 μl
1 M dithiothreitol solution
12.5 μl
20 mg/ml acetylated BSA
Acknowledgments
S.S. was supported by a Stanford Graduate Fellowship and an HHMI International Student Research Fellowship. This protocol was developed with support from the NIH (grant R01-GM37706 to A.Z.F.). We adapted earlier RNA sequencing methods (Lau et al., 2001; Ingolia et al., 2009; Guo et al., 2010; Kwon, 2011) for RNA sequencing from C. elegans (Lamm et al., 2011), incorporated others’ work on unique molecular identifiers to remove PCR duplicates (Kivioja et al., 2011), and introduced enzymatic cleanup steps (5’ deadenylase/RecJ) to circumvent a gel purification step. We have found this protocol useful for a variety of RNA sequencing applications, such as crRNA detection (Silas et al., 2017a), prokaryotic transcriptome profiling (Silas et al., 2016), sequencing RNA from metagenomic environmental samples (Silas et al., 2017b), and ribosome footprinting (Arribere et al., 2016). We declare that we have no competing interests or conflicts of interest.
References
Arribere, J. A., Cenik, E. S., Jain, N., Hess, G. T., Lee, C. H., Bassik, M. C. and Fire, A. Z. (2016). Translation readthrough mitigation. Nature 534(7609): 719-723.
Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P., Moineau, S., Romero, D. A. and Horvath, P. (2007). CRISPR provides acquired resistance against viruses in prokaryotes. Science 315(5819): 1709-1712.
Brouns, S. J., Jore, M. M., Lundgren, M., Westra, E. R., Slijkhuis, R. J., Snijders, A. P., Dickman, M. J., Makarova, K. S., Koonin, E. V. and van der Oost, J. (2008). Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321(5891): 960-964.
Carte, J., Pfister, N. T., Compton, M. M., Terns, R. M. and Terns, M. P. (2010). Binding and cleavage of CRISPR RNA by Cas6. RNA 16(11): 2181-2188.
Carte, J., Wang, R., Li, H., Terns, R. M. and Terns, M. P. (2008). Cas6 is an endoribonuclease that generates guide RNAs for invader defense in prokaryotes. Genes Dev 22(24): 3489-96.
Charpentier, E., Richter, H., van der Oost, J. and White, M. F. (2015). Biogenesis pathways of RNA guides in archaeal and bacterial CRISPR-Cas adaptive immunity. FEMS Microbiol Rev 39(3): 428-441.
Deveau, H., Barrangou, R., Garneau, J. E., Labonte, J., Fremaux, C., Boyaval, P., Romero, D. A., Horvath, P. and Moineau, S. (2008). Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. J Bacteriol 190(4): 1390-1400.
Guo, H., Ingolia, N. T., Weissman, J. S. and Bartel, D. P. (2010). Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466(7308): 835-840.
Haurwitz, R. E., Jinek, M., Wiedenheft, B., Zhou, K. and Doudna, J. A. (2010). Sequence- and structure-specific RNA processing by a CRISPR endonuclease. Science 329(5997): 1355-1358.
Heidrich, N., Dugar, G., Vogel, J. and Sharma, C. M. (2015). Investigating CRISPR RNA biogenesis and function using RNA-seq. Methods Mol Biol 1311: 1-21.
Hochstrasser, M. L. and Doudna, J. A. (2015). Cutting it close: CRISPR-associated endoribonuclease structure and function. Trends Biochem Sci 40(1): 58-66.
Ingolia, N. T., Ghaemmaghami, S., Newman, J. R. and Weissman, J. S. (2009). Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science 324(5924): 218-223.
Jackson, S. A., McKenzie, R. E., Fagerlund, R. D., Kieper, S. N., Fineran, P. C. and Brouns, S. J. (2017). CRISPR-Cas: Adapting to change. Science 356(6333).
Juranek, S., Eban, T., Altuvia, Y., Brown, M., Morozov, P., Tuschl, T. and Margalit, H. (2012). A genome-wide view of the expression and processing patterns of Thermus thermophilus HB8 CRISPR RNAs. RNA 18(4): 783-794.
Kivioja, T., Vaharautio, A., Karlsson, K., Bonke, M., Enge, M., Linnarsson, S. and Taipale, J. (2011). Counting absolute numbers of molecules using unique molecular identifiers. Nat Methods 9(1): 72-74.
Kwon, Y. S. (2011). Small RNA library preparation for next-generation sequencing by single ligation, extension and circularization technology. Biotechnol Lett 33(8): 1633-1641.
Lamm, A. T., Stadler, M. R., Zhang, H., Gent, J. I. and Fire, A. Z. (2011). Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome. Genome Res 21(2): 265-275.
Lau, N. C., Lim, L. P., Weinstein, E. G. and Bartel, D. P. (2001). An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294(5543): 858-862.
Makarova, K. S., Haft, D. H., Barrangou, R., Brouns, S. J., Charpentier, E., Horvath, P., Moineau, S., Mojica, F. J., Wolf, Y. I., Yakunin, A. F., van der Oost, J. and Koonin, E. V. (2011). Evolution and classification of the CRISPR-Cas systems. Nat Rev Microbiol 9(6): 467-477.
Makarova, K. S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou, R., Brouns, S. J., Charpentier, E., Haft, D. H., Horvath, P., Moineau, S., Mojica, F. J., Terns, R. M., Terns, M. P., White, M. F., Yakunin, A. F., Garrett, R. A., van der Oost, J., Backofen, R. and Koonin, E. V. (2015). An updated evolutionary classification of CRISPR-Cas systems. Nat Rev Microbiol 13(11): 722-736.
Marraffini, L. A. and Sontheimer, E. J. (2008). CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science 322(5909): 1843-1845.
Plagens, A., Richter, H., Charpentier, E. and Randau, L. (2015). DNA and RNA interference mechanisms by CRISPR-Cas surveillance complexes. FEMS Microbiol Rev 39(3): 442-463.
Richter, H., Zoephel, J., Schermuly, J., Maticzka, D., Backofen, R. and Randau, L. (2012). Characterization of CRISPR RNA processing in Clostridium thermocellum and Methanococcus maripaludis. Nucleic Acids Res 40(19): 9887-9896.
Silas, S., Lucas-Elio, P., Jackson, S. A., Aroca-Crevillen, A., Hansen, L. L., Fineran, P. C., Fire, A. Z. and Sanchez-Amat, A. (2017a). Type III CRISPR-Cas systems can provide redundancy to counteract viral escape from type I systems. Elife 6.
Silas, S., Makarova, K. S., Shmakov, S., Paez-Espino, D., Mohr, G., Liu, Y., Davison, M., Roux, S., Krishnamurthy, S. R., Fu, B. X. H., Hansen, L. L., Wang, D., Sullivan, M. B., Millard, A., Clokie, M. R., Bhaya, D., Lambowitz, A. M., Kyrpides, N. C., Koonin, E. V. and Fire, A. Z. (2017b). On the origin of reverse transcriptase-using CRISPR-Cas systems and their hyperdiverse, enigmatic spacer repertoires. MBio 8(4).
Silas, S., Mohr, G., Sidote, D. J., Markham, L. M., Sanchez-Amat, A., Bhaya, D., Lambowitz, A. M. and Fire, A. Z. (2016). Direct CRISPR spacer acquisition from RNA by a natural reverse transcriptase-Cas1 fusion protein. Science 351(6276): aad4234.
Copyright: Silas et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Silas, S., Jain, N., Stadler, M., Fu, B. X. H., Sanchez-Amat, A., Fire, A. Z. and Arribere, J. (2018). A Small RNA Isolation and Sequencing Protocol and Its Application to Assay CRISPR RNA Biogenesis in Bacteria. Bio-protocol 8(4): e2727. DOI: 10.21769/BioProtoc.2727.
Silas, S., Lucas-Elio, P., Jackson, S. A., Aroca-Crevillen, A., Hansen, L. L., Fineran, P. C., Fire, A. Z. and Sanchez-Amat, A. (2017a). Type III CRISPR-Cas systems can provide redundancy to counteract viral escape from type I systems. Elife 6.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > RNA sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,728 | https://bio-protocol.org/exchange/protocoldetail?id=2728&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Conditional Knockdown of Proteins Using Auxin-inducible Degron (AID) Fusions in Toxoplasma gondii
KB Kevin M. Brown
SL Shaojun Long
LS L. David Sibley
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2728 Views: 16067
Edited by: David Cisneros
Reviewed by: Noelia Lander
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
Toxoplasma gondii is a member of the deadly phylum of protozoan parasites called Apicomplexa. As a model apicomplexan, there is a great wealth of information regarding T. gondii’s 8,000+ protein coding genes including sequence variation, expression, and relative contribution to parasite fitness. However, new tools are needed to functionally investigate hundreds of putative essential protein coding genes. Accordingly, we recently implemented the auxin-inducible degron (AID) system for studying essential proteins in T. gondii. Here we provide a step-by-step protocol for examining protein function in T. gondii using the AID system in a tissue culture setting.
Keywords: Auxin Degron AID Conditional knockdown Protein regulation Parasite Toxoplasma gondii CRISPR
Background
Auxins are a class of phytohormones that signal by targeting certain proteins for proteasomal degradation in plants (Teale et al., 2006). Kohei Nishimura et al. had the clever idea of transferring components of this plant-specific signaling system to other eukaryotes for conditional regulation of proteins of interest (POIs), creating the auxin-inducible degron (AID) system (Nishimura et al., 2009). This system has since been adapted successfully in several eukaryotes, including the apicomplexan parasite Plasmodium (Kreidenweiss et al., 2013; Philip and Waters, 2015). Just two transgenic components are needed to implement this system, a plant auxin receptor called transport inhibitor response 1 (TIR1) and a POI tagged with an AID. Treatment with an auxin (e.g., 3-indolacetic acid/IAA) activates the SCFTIR1 ubiquitin ligase complex which exclusively targets AID-tagged proteins for ubiquitin-dependent proteasomal degradation (Figure 1). We recently engineered an RHΔhxgprtΔku80 line of T. gondii to stably express TIR1 from Oryza sativa (RH TIR1-3FLAG) (Brown et al., 2017; Long et al., 2017a). In this background, we were able to use CRISPR/Cas9 genome editing (Shen et al., 2014; Sidik et al., 2014; Shen et al., 2017) to tag essential T. gondii genes of interest with AID-3HA or mini-AID(mAID)-3HA, regulate their expression with auxin, and identify phenotypes associated with their loss (Brown et al., 2017; Long et al., 2017a and 2017b).
There are several advantages for using this system for conditional knockdowns in T. gondii. First, POI-AID fusions are expressed from their endogenous promoters, maintaining normal expression timing and levels. Second, auxin is non-toxic to parasite and host cell cultures at 1 mM but can function as low as ~50 µM. Third, auxin is added only when knockdown is desired and is commercially available for less than $5 USD per gram. Last and most importantly, POI-AID fusions are fully degraded in as little as 15 min following auxin treatment. For these reasons, we were compelled to elaborate on our published methods in this detailed protocol to facilitate the establishment of this system in other apicomplexan laboratories.
Figure 1. Model of the auxin inducible-degron system. A. In the absence of auxin, the plant auxin receptor TIR1 is in its inactive ‘Apo’ state, allowing the protein of interest (POI)-AID-3HA fusion to express and function normally. B. Auxin-bound TIR1 assembles into an active Skp-Cullen-F Box (SCFTIR1) ubiquitin ligase complex where it recognizes and polyubiquitinates AID. C. The polyubiquitin modification targets POI-AID-3HA for proteasomal degradation.
Materials and Reagents
Microcentrifuge tubes (1.7 ml)
PCR tubes (0.2 ml)
T-25 and T-175 culture flasks (Corning, catalog numbers: 430639 , 431080 )
96-well tissue culture plates (TPP, catalog number: 92696 )
24-well plates (TPP, catalog number: 92024 )
22 G blunt needles (CML Supply, catalog number: 901-22-100M )
3.0 µm pore size 47 mm filter membrane (GE Healthcare, Whatman, catalog number: 111112 )
10 ml syringes (BD, catalog number: 309695 )
50 ml polystyrene conical vials (Fisher Scientific, catalog number: 05-539-10 )
1 L Stericup Filter Units (Merck, catalog number: SCVPU11RE )
13 mm cell scrapers (TPP, catalog number: 99002 )
47 mm polycarbonate syringe filter holder (GE Healthcare, Whatman, catalog number: 420400 )
Filter paper for Western blot wet transfer (GE Healthcare, Whatman, catalog number: 3030-917 )
Nitrocellulose membrane (GE Healthcare, Amersham, catalog number: 10600003 )
Petri dishes (Sigma-Aldrich, catalog number: P5606 )
Pipette tips for Gilson pipettes (Gilson, catalog numbers: F171101 , F171301 , F171501 )
Sterile serological pipettes (5 ml, 10 ml, 25 ml)
Electroporation cuvettes 4 mm gap (BTX, catalog number: 45-0126 )
pSAG1::Cas9-U6::sgUPRT plasmid (Addgene, catalog number: 54467 ) (Shen et al., 2014)
pYFP-AID-3HA, Floxed HXGPRT plasmid (Addgene, catalog number: 87260 ) (Long et al., 2017a)
pYFP-mAID-3HA, Floxed HXGPRT plasmid (Addgene, catalog number: 87259 ) (Brown et al., 2017)
T. gondii line RH TIR1-3FLAG (genotype: RHΔhxgprtΔku80; TUB1:TIR1-3FLAG, SAG1:CAT) (Brown et al., 2017; Long et al., 2017a)
NEB5α chemically-competent E. coli with SOC medium (New England Biolabs, catalog number: C2987I )
Human foreskin fibroblasts (HFF) (ATCC, catalog number: SCRC-1041 )
Q5 Site-Directed Mutagenesis Kit with chemically competent E. coli (New England Biolabs, catalog number: E0554S )
Mutagenesis primers for reprogramming pSAG1::Cas9-U6::sgUPRT (IDT, 25 nmole, standard desalting)
2x SDS-PAGE sample buffer (Sigma-Aldrich, catalog number: S3401 )
1 kb DNA ladder (New England Biolabs, catalog number: N3232 )
Agarose (Fisher Scientific, catalog number: BP160 )
SDS-PAGE 4-15% gradient Tris-glycine polyacrylamide gels (Bio-Rad Laboratories, catalog number: 4561086 )
6x Gel Loading Dye (New England Biolabs, catalog number: B7025 )
LB broth (BD, catalog number: 244610 )
Ampicillin (Sigma-Aldrich, catalog number: A9518 )
Plasmid miniprep kit (Macherey-Nagel, catalog number: 740588 )
M13 Reverse universal primer (5’-ACAGGAAACAGCTATGAC) (Genewiz)
Q5 DNA Polymerase (New England Biolabs, catalog number: M0491 )
dNTPs 10 mM each (New England Biolabs, catalog number: N0447 )
Gene of interest tagging primers for amplifying (m)AID-3HA, Floxed HXGPRT tagging cassette with short homology flanks (IDT, 25 nmole, standard desalting)
Gene of interest diagnostic tagging primers (IDT, 25 nmole)
Agarose Gel and PCR Cleanup Kit (Macherey-Nagel, catalog number: 740609 )
Trypsin-EDTA (Sigma-Aldrich, catalog number: T3924 )
ATP (Sigma-Aldrich, catalog number: A6419 )
Glutathione (Sigma-Aldrich, catalog number: G6013 )
Mycophenolic acid (Sigma-Aldrich, catalog number: M3536 )
Xanthine (Sigma-Aldrich, catalog number: X4002 )
Proteinase K (Sigma-Aldrich, catalog number: P2308 )
Taq polymerase (New England Biolabs, catalog number: M0273 )
Ethanol (EtOH) (Pharmco-AAPER, catalog number: 11100020 )
GelRed nucleic acid stain (Biotium, catalog number: 41001 )
Licor anti-mouse 800CW secondary antibody (LI-COR, catalog number: 925-32210 )
Licor anti-rabbit 680RD secondary antibody (LI-COR, catalog number: 925-68071 )
Mouse anti-HA monoclonal antibody (BioLegend, catalog number: 901501 )
Non-fat powdered milk (Nestle Carnation)
Rabbit anti-Aldolase (T. gondii) (Starnes et al., 2009) or other T. gondii loading control antibody
Tris base (Sigma-Aldrich, catalog number: T6066 )
Glacial acetic acid (Fisher Scientific, catalog number: A38-500 )
0.5 M EDTA pH 8.0 (Merck, catalog number: 324504 )
Boric acid (Sigma-Aldrich, catalog number: B6768 )
Glycine (Sigma-Aldrich, catalog number: G7128 )
Note: This product has been discontinued.
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L5750 )
Methanol (Fisher Scientific, catalog number: A412P )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P5405 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P8281 )
Tween-20 (Sigma-Aldrich, catalog number: P2287 )
Dulbecco’s Modified Eagle’s Medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 12100046 )
Sodium bicarbonate (Sigma-Aldrich, catalog number: S5761 )
200 mM L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030149 )
10 mg/ml gentamicin (Thermo Fisher Scientific, GibcoTM, catalog number: 15710072 )
Characterized fetal bovine serum (FBS) (GE Healthcare, catalog number: SH30071.01HI )
Hanks’ balanced salt solution (Sigma-Aldrich, catalog number: H9269 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
EGTA (Merck, catalog number: 324626 )
EDTA (Merck, catalog number: 324504 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M4880 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
3-indoleacetic acid (IAA/auxin) (Sigma-Aldrich, catalog number: I2886 )
Agar (Fisher Scientific, catalog number: BP1423 )
10x Tris-Acetate-EDTA (TAE) buffer (see Recipes)
10x Tris-Borate-EDTA (TBE) buffer (see Recipes)
10x SDS-PAGE running buffer (see Recipes)
10x protein transfer buffer (see Recipes)
1x protein transfer buffer (see Recipes)
10x phosphate buffered saline (PBS) (see Recipes)
Phosphate buffered saline + Tween-20 (PBST) (see Recipes)
PCR lysis buffer (see Recipes)
D10 medium (see Recipes)
Hank’s balanced salt solution with HEPES and EGTA (HHE) (see Recipes)
0.1 M KPO4 buffer pH 7.6 (for Cytomix buffer) (see Recipes)
Cytomix electroporation buffer pH 7.6 (Soldati and Boothroyd, 1993) (see Recipes)
500 mM 3-indoleacetic acid (IAA/auxin) (1,000x Stock) (see Recipes)
Equipment
Autoclave (Steris, model: SG-120 )
Benchtop centrifuge with 15 ml and 50 ml conical vial holders (Eppendorf, model: 5810 R )
Biological safety cabinet (Baker, model: SterilGuard® II )
CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM 310 )
Detergent free pyrex glassware and stir bars for media preparation
Electroporator (BTX, model: ECM 830 )
Gel documentation system (Bio-Rad Laboratories, model: Gel DocTM XR+ )
Incubating orbital shaker (VWR, model: Model 3500I )
Inverted phase contrast microscope (Nikon Instruments, model: Eclipse TS100 )
Hemacytometer (Sigma-Aldrich, model: Bright-LineTM )
Licor Odyssey imaging system (LI-COR, model: Odyssey® CLx )
Microcentrifuge (Eppendorf, model: 5417 R )
Microvolume spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM One )
Microwave (VWR, catalog number: 75856-526)
Manufacturer: Argos Technologies, catalog number: 111092 .
Pipet aid (Thermo Fisher Scientific, Thermo ScientificTM, model: S1 )
Pipettes (Pipetman, Gilson, models: P2 , P20 , P200 , P1000 )
Protein wet transfer blotting apparatus (Bio-Rad Laboratories, model: Mini Trans-Blot® )
Refrigerator Freezer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 10ECEETSA )
SDS-PAGE electrophoresis apparatus (Bio-Rad Laboratories, model: Mini-Protean Tetra Cell )
Standard orbital shaker (VWR, model: Model 1000 )
Thermal cycler (Thermo Fisher Scientific, Applied BiosystemsTM, model: VeritiTM 96-well )
Software
Google Chrome (Google) or other web browsing software
Snapgene (Snapgene) or other plasmid viewing software
Image studio lite (LI-COR) or other gel analysis software
Axiovision (Carl Zeiss Microscopy) or other cellular imaging software
ImageJ (Developed by Wayne Rasband) or other image quantification software
GraphPad Prism (GraphPad Software Inc.) or other graphing and statistical analysis software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Brown, K. M., Long, S. and Sibley, L. D. (2018). Conditional Knockdown of Proteins Using Auxin-inducible Degron (AID) Fusions in Toxoplasma gondii. Bio-protocol 8(4): e2728. DOI: 10.21769/BioProtoc.2728.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > Protein > Targeted degradation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,729 | https://bio-protocol.org/exchange/protocoldetail?id=2729&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Adapting the Smart-seq2 Protocol for Robust Single Worm RNA-seq
LS Lorrayne Serra
DC Dennis Z. Chang
MM Marissa Macchietto
KW Katherine Williams
RM Rabi Murad
DL Dihong Lu
Adler R. Dillman
AM Ali Mortazavi
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2729 Views: 19136
Edited by: Pengpeng Li
Reviewed by: Hillel SchwarzLokesh Kalekar
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Most nematodes are small worms that lack enough RNA for regular RNA-seq protocols without pooling hundred to thousand of individuals. We have adapted the Smart-seq2 protocol in order to sequence the transcriptome of an individual worm. While developed for individual Steinernema carpocapsae and Caenorhabditis elegans larvae as well as embryos, the protocol should be adaptable for other nematode species and small invertebrates. In addition, we describe how to analyze the RNA-seq results using the Galaxy online environment. We expect that this method will be useful for the studying gene expression variances of individual nematodes in wild type and mutant backgrounds.
Keywords: RNA-seq Transcriptome C. elegans S. carpocapsae
Background
Low input RNA-seq protocols and amplification kits, such as Smart-seq (Takara Bio, USA, Inc) and SuperAmp (Miltenyl Biotec, Inc), have been increasingly developed and commercialized as a response to the growing prevalence of low input RNA-seq studies based on small tissues, single microorganisms, and single cells. These studies often explore and address heterogeneous gene expression among individuals of a certain population, such as a population of cells, a complex tissue, or a population of microscopic organisms. Improvements and adaptations of low input RNA-seq protocols for microscopic organisms, such as nematodes, will greatly benefit the field of nematology by allowing for the analysis of gene expression heterogeneity at the single nematode level. Here we have adapted the single cell RNA-seq protocol, Smart-seq2 (Picelli et al., 2013 and 2014; Trombetta et al., 2014), for single nematode RNA-sequencing. We successfully utilized adapted versions of this protocol in the transcriptomic analysis of the insect-parasitic nematode, Steinernema carpocapsae (Lu et al., 2017) as well as in the analysis of individual embryos and L1 larvae from two Steinernema and two Caenorhabditis species including C. elegans (Macchietto et al., 2017), but this protocol can be adapted for any species of nematode. While this protocol will work on nematodes without already sequenced genomes or transcriptomes, we limit our computational analysis to organisms with published genome annotations, such as S. carpocapsae (Dillman et al., 2015). Our need for single nematode RNA-sequencing arose as a method to circumvent the limitations of working with samples with low-inputs of RNA. For example, many of our in vivo experiments limited the number of nematodes we could utilize. Single nematode RNA-seq has allowed us to efficiently obtain high resolution gene expression data from these nematodes. The protocol has also enabled us to collect individual embryos to map out time courses of nematode embryonic development for comparative transcriptomics across multiple species. The development and advancement of low input RNA-seq protocols will aid investigators in circumventing issues related to using individual organisms and specialized/limited samples.
Materials and Reagents
Gloves
8-strip, nuclease-free, 0.2-ml, thin-walled PCR tubes with caps (SARSTEDT, catalog numbers: 72.985.002 and 65.989.002 )
Needle 25 G 1.5 inch regular (BD, PrecisionGlide, catalog number: 305127 )
QubitTM assay tubes (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32856 )
Pipette tips
1.5 ml Eppendorf tube
Spatulas
70% ethanol or RNase away
Proteinase K (QIAGEN, catalog number: 19131 )
RNasin ribonuclease inhibitor (RNase inhibitor) (Promega, catalog number: N2611 )
UltraPure DNase/RNase free distilled water (Thermo Fisher Scientific, GibcoTM, catalog number: 10977015 )
Oligo-dT30VN primer (ordered from IDT (https://www.idtdna.com/site)): 5’-AAGCAGTGGTATCAACGCAGAGTACT30VN-3’
Note: This oligonucleotide anneals to all the RNAs containing a poly(A) tail. The 3’ end of this oligonucleotide contains ‘VN’, where ‘N’ is any base and ‘V’ is either A, C or G. The two terminal nucleotides are necessary for anchoring the oligonucleotide to the beginning of the poly(A) tail and for avoiding unnecessary amplification of long stretches of adenosines. Dissolve the oligonucleotide in TE buffer to a final concentration of 100 μM. Store this oligo at -20 °C for 6 months.
dNTP mix (10 mM each) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0192 )
Superscript II reverse transcriptase kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18064014 )
LNA-modified TSO (ordered from Exiqon (http://www.exiqon.com/))
5’-AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3’
Note: At the 5’ end, this TSO carries a common primer sequence, whereas, at the 3’ end, there are two riboguanosines (rG) and one LNA-modified guanosine (+G) to facilitate template switching. TSO dissolved in TE buffer can be stored in 100 μM aliquots at -80 °C for 6 months. Avoid repeated freeze-thaw cycles.
Betaine (BioUltra ≥ 99.0%) (Sigma-Aldrich, catalog number: 61962 )
Magnesium chloride (MgCl2; anhydrous) (Sigma-Aldrich, catalog number: M8266 )
Kapa HiFi HotStart ReadyMix (Kapa Biosystems, catalog number: KK2602 )
IS PCR oligo (ordered from IDT (https://www.idtdna.com/site))
5’-AAGCAGTGGTATCAACGCAGAGT-3’
Note: This oligonucleotide acts as PCR primer in the amplification step after RT. Dissolve the oligonucleotide in TE buffer to a final concentration of 100 μM. This oligo can be stored at -20 °C for 6 months.
Agencourt Ampure XP beads (Beckman Coulter, catalog number: A63881 )
Ethanol 99.5% (vol/vol) (Kemethyl, catalog number: SN366915-06 )
QubitTM dsDNA HS assay kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32854 )
Agilent high sensitivity DNA kit (Agilent Technologies, catalog number: 5067-4626 )
Buffer PM (QIAGEN, catalog number: 19083 )
Nextera DNA library prep kit (24 samples) (Illumina, catalog number: FC-121-1030 )
QIAquick PCR purification kit (50) (QIAGEN, catalog number: 28104 )
Phusion high fidelity PCR master mix with HF buffer, 500 reactions (New England Biolabs, catalog number: M0531L )
Tris-HCl pH 8.0 (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9850G )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
EDTA pH 8.0 (Mediatech, catalog number: 46-034-Cl )
Polysorbate 20, Acros OrganicsTM (Tween 20) (Acros Organics, catalog number: 233362500 )
RNaseZap (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9780 )
List of sequencing indexes (Buenrostro et al., 2015) (see Supplemental file)
Equipment
Pipettes
Mini-centrifuge with head for 8-strip PCR tubes
Vortexer
Thermocycler
Stereo microscope
Qubit® Fluorometer
Agilent 2100 Bioanalyzer (Agilent Technologies, model: Agilent 2100 , catalog number: G2938C)
Magnetic stand 96 (Thermo Fisher Scientific, catalog number: AM10027 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Serra, L., Chang, D., Macchietto, M., Williams, K., Murad, R., Lu, D., Dillman, A. R. and Mortazavi, A. (2018). Adapting the Smart-seq2 Protocol for Robust Single Worm RNA-seq. Bio-protocol 8(4): e2729. DOI: 10.21769/BioProtoc.2729.
Download Citation in RIS Format
Category
Systems Biology > Transcriptomics > RNA-seq
Molecular Biology > RNA > Transcription
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
273 | https://bio-protocol.org/exchange/protocoldetail?id=273&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Inner Membrane Vesicles from Escherichia coli by Using an Affinity Tag
Gang Li
Kevin D. Young
Published: Vol 2, Iss 20, Oct 20, 2012
DOI: 10.21769/BioProtoc.273 Views: 11152
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
This protocol was developed in a project aimed to identify the inner membrane proteins localizing to cell poles in Escherichia coli (E. coli). By using a known polar protein Tar as a tag, we isolated pole-derived inner membrane vesicles by affinity capture. The specificity of the polar vesicle isolation was confirmed by mass spectrometry that identified more than one hundred proteins, most of which are known inner membrane proteins, including other known polar proteins. This protocol, or if adapted properly by choosing other affinity targets, is well suited to isolate other membrane domains of interest for identification of proteins or lipid composition.
Materials and Reagents
Isopropyl β-D-1-thiogalactopyranoside (IPTG)
Medium copy plasmid pLP8 for recombinant protein expression (Plac lacIq KanR, Li and Young, 2012)
Bacto Tryptone (BD Biosciences, catalog number: 211705 )
Halt protease inhibitor (Thermo Fisher Scientific, catalog number: 78425 )
RNase A (Sigma-Aldrich, catalog number: R5503 )
DNase I (Thermo Fisher Scientific, catalog number: NC9709009 )
anti-FLAG M2 affinity gel (Sigma-Aldrich, catalog number: A2220 )
Poly-Prep chromatography column (Bio-Rad Laboratories, catalog number: 731-1550 )
Micro BCA protein assay kit (Thermo Fisher Scientific, catalog number: 23235 )
Triton X-100
Tween 20
Tryptone medium
Phosphate buffered saline (PBS) (see Recipes)
Phosphate buffered saline with Tween 20 (PBST) (see Recipes)
Equipment
Centrifuges for 1.5 ml, 10 ml and 100 ml volumes
High shear fluid processor (Microfluidics, model: LV1 ) or French press
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Li, G. and Young, K. D. (2012). Isolation of Inner Membrane Vesicles from Escherichia coli by Using an Affinity Tag. Bio-protocol 2(20): e273. DOI: 10.21769/BioProtoc.273.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial cell biology > Organelle isolation
Cell Biology > Organelle isolation > Membrane
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,730 | https://bio-protocol.org/exchange/protocoldetail?id=2730&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sebinger Culture: A System Optimized for Morphological Maturation and Imaging of Cultured Mouse Metanephric Primordia
ME Mona Elhendawi
Jamie A. Davies
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2730 Views: 6014
Edited by: Alessandro Didonna
Reviewed by: Xia Wang
Original Research Article:
The authors used this protocol in May 2010
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2010
Abstract
Here, we present a detailed protocol on setting up embryonic renal organ cultures using a culture method that we have optimised for anatomical maturation and imaging. Our culture method places kidney rudiments on glass in a thin film of medium, which results in very flat cultures with all tubules in the same image plane. For reasons not yet understood, this technique results in improved renal maturation compared to traditional techniques. Typically, this protocol will result in an organ formed with distinct cortical and medullary regions as well as elongated, correctly positioned loops of Henle. This article describes our method and provides detailed advice. We have published qualitative and quantitative evaluations on the performance of the technique in Sebinger et al. (2010) and Chang and Davies (2012).
Keywords: Organ culture Kidney Metanephros Sebinger culture Organoid Imaging
Background
The metanephric (permanent) kidneys of mammals develop from simple rudiments located at the caudal end of the intermediate mesoderm. In mice, at about embryonic day (‘E’) 10 these rudiments form and consist of two morphologically distinguishable components; an epithelial ureteric bud that arises as a diverticulum of the Wolffian (nephric) duct, and a metanephrogenic mesenchyme that forms next to the duct. As development progresses, the ureteric bud enters the metanephrogenic mesenchyme and undergoes many successive rounds of growth and branching to make a ‘tree’; this later remodels to produce a mature collecting duct system in which tubules radiate from a central cavity, the renal pelvis (Lindstrom et al., 2015). The renal pelvis drains to the ureter, which forms from the original stalk of the ureteric bud. As the ureteric bud develops, it induces cells from the metanephrogenic mesenchyme to condense around each of its tips to form a ‘cap mesenchyme’ (Schreiner, 1902; Reinhoff, 1922). The cap mesenchymes are stem cell populations that divide as the tips divide, so that each tip formed by bifurcation of an existing branch inherits its own cap (reviewed by Hendry et al., 2011). Cells at the more distal ends of the caps differentiate to form excretory nephrons, which connect to the ureteric bud branch from whose cap they formed (Georgas et al., 2009). Blood vessels invade from the base of the metanephros and follow the ureteric bud, making a network around (but never entering) the cap mesenchymes (Munro et al., 2017): later, these vessels will serve glomeruli and other parts of the kidney.
In vitro culture of metanephric kidney rudiments has a long history. Indeed, these were among the first embryonic organs to show continued development outside the body (Carrel and Burrows, 1910). The continued development of kidney rudiments outside of the body was a scientific, as well as a technical, advance: the autonomous development of isolated organs demonstrated that the information required to build them was ‘local’ and did not depend on the rest of the embryo. This observation added considerable support to the idea that architecture of the body is hierarchical, with modules (organs) that largely look after themselves and interact with the rest of the body only at specific functional interfaces. The earliest culture methods used rather complex media and culture supports, such as Grobstein’s use of clotted avian plasma and chick embryo extract (Grobstein, 1953). These systems were necessary because simply placing a kidney rudiment in a glass dish or flask resulted in its breakdown because cells adhered to the substrate and spread out to form a monolayer. Immersion in medium in non-adhesive dishes prevents cell dispersal but does not result in proper development (see ‘Data analysis’ section). Both imaging and reproducibility were greatly improved by Saxén’s adoption of a culture method developed by Trowell for culture of rat lymph nodes (Trowell, 1954). Saxén placed embryonic kidney rudiments, isolated from mice at E11, on filters that were supported by a stainless steel grid at the interface between gas and medium (Saxén et al., 1962).
The Trowell method has been a mainstay of research in kidney development for many decades. It allows for significant ureteric bud growth and branching, formation of nephrons, differentiation of their separate proximal and distal domains and connection of nephrons to ureteric bud branches. Rudiments grow flat enough to facilitate confocal microscopy of fixed specimens without the need for ‘clearing’ techniques, and even conventional epifluorescence microscopy is adequate for many purposes (e.g., Davies et al., 2014). Another advantage is that diffusion paths have proved to be short enough and open enough to enable mechanisms of development to be investigated in this method with drugs (e.g., Fisher et al., 2001), growth factors (e.g., Piscione et al., 1997), function-blocking antibodies (e.g., Falk et al., 1996) and, to a limited extent, siRNAs (e.g., Davies et al., 2004). The Trowell system, together with variants that place rudiments at the air-medium interface using use Transwell filters instead of stainless steel supports, remains very common in studies of kidney development.
Useful as it is, the Trowell culture system has a few problems. One is that the filter itself interferes with bright-field/phase contrast imaging because the filter pores appear, out of focus, in the image (though some Transwell systems do achieve good optical clarity). Another is that the tissue is too thick for reliable high-resolution, unattended time-lapse photography, because tubules leave the focal plane. A third problem is that some aspects of renal development, such as the formation of distinct cortex and medulla, and extension of nephrons’ loops of Henle from the cortex to the medulla, occur poorly if at all. In an attempt to address these issues, we developed an alternative culture system that uses the surface tension of very shallow medium to hold a kidney rudiment on to a clear glass substrate. To our surprise, the system not only solved the imaging problem, but it also allowed the organ rudiments to develop clear cortico-medullary zonation and nephron maturation proceeded as far as the production of clear and elongated loops of Henle (Sebinger et al., 2010) (Figure 1). The enhanced development is seen in cultures made from natural kidneys isolated from mouse embryos, and also in organoids engineered from suspensions of stem cells (Chang and Davies, 2012).
Figure 1. Kidneys cultured in the Sebinger system. A. Bright field images for E11.5 kidney grown in culture for 0, 3 and 7 days. Scale bars = 0.5 mm. B-D. E11.5 kidneys cultured for 7 days in the Sebinger system and stained for different renal markers to show maturation. B. Stained for the ureteric bud marker CALB (shown in green) and the basement membrane marker Laminin (shown in red). The red channel shows the presence of loops of Henle dipping into the medulla; C. Stained for CALB (green) and the proximal tubular marker LTL (red); D. Stained for ECAD (ureteric bud and distal tubular marker; shown in green) and WT1 (podocyte and cap mesenchyme marker; shown in red). Scale bars = 100 μm.
Materials and Reagents
1 ml disposable syringes (Plastipak 1 ml, BD, catalog number: 303172 ) with fine needles (0.5 x 16 mm/25 G x 5/8”, Microlance 3, BD, catalog number: 300600 )
40 x 0.13 mm borosilicate glass coverslips (VWR, catalog number: 631-0177 )
Silicone cones (flexiPERM Cone shape A, Greiner Bio One International)
These are at the time of writing available only on special order–phone Greiner–and delivery times can be long enough to make forward planning important. The cones can be re-used for years.
Note: We know of no suitable substitutes.
100 mm sterile Petri dishes (for dissection–surface quality is irrelevant) (Cell Star®, Greiner Bio One International, catalog number: 664160 )
60 x 15 mm sterile Petri dishes (Cell Star®, Greiner Bio One International, catalog number: 628160 )
Note: We use Greiner but expect that others will also be suitable.
Glass Pasteur pipettes (150 mm, Volac, catalog number: D810 )
Timed-mated mice at E11.5 (E10.5 is also suitable but is a more challenging dissection)
Sterile distilled water
100% methanol
Eagle’s minimal essential medium with Earle’s salts and non-essential amino acids (Sigma-Aldrich, catalog number: M5650 )
Foetal bovine serum (FBS) (Biochrom, catalog number: S 0415 )
Penicillin-streptomycin (Sigma-Aldrich, catalog number: P4333 )
Phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: 79382 )
Anti-laminin (Sigma-Aldrich, catalog number: L9393 )
FITC anti-rabbit (Sigma-Aldrich, catalog number: F0382 )
EmbryoMax® Penicillin-streptomycin solution, 100x (Sigma-Aldrich, catalog number: TMS-AB2-C )
Hydrogen peroxide (Sigma-Aldrich, catalog number: H1009 )
Ammonium hydroxide (Sigma-Aldrich, catalog number: A6899 )
Cleaning solution (see Recipes)
Dissecting medium (see Recipes)
Culture medium (see Recipes)
Hydration buffer (see Recipes)
Equipment
Forceps
Scalpel (curved blade, e.g., D-form, type 22, Swann Morton, catalog number: 0108 )
80 °C oven
Note: We use a Gallenkamp Hotbox size 1, but any 80 °C oven should be suitable.
Cell culture incubator at 37 °C, 5% CO2
Note: We use a NuAire 5500E (NuAire, model: NU-5500E ), but any stable incubator should work as well.
Dissecting microscopes
Note: We use ZEISS Stemi 2000C microscopes (ZEISS, model: Stemi 2000-C ) with transilluminating stages, but have demonstrated the technique in other laboratories with other models of dissecting microscope. The precise type of microscope is not important, but transillumination (rather than epi-illumination) is.
Clean area
Note: We do not use safety cabinets (for the non-pathogen-infected samples we use), because the vibration of the fans is a nuisance. We do use simple cabinets about the size of a safety cabinet, made from Perspex, to provide shelter from dust moved by Edinburgh winds blowing through ill-fitting antique lab windows).
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Elhendawi, M. and Davies, J. A. (2018). Sebinger Culture: A System Optimized for Morphological Maturation and Imaging of Cultured Mouse Metanephric Primordia. Bio-protocol 8(4): e2730. DOI: 10.21769/BioProtoc.2730.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > Organ culture
Developmental Biology > Morphogenesis > Organogenesis
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,731 | https://bio-protocol.org/exchange/protocoldetail?id=2731&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Registration and Alignment Between in vivo Functional and Cytoarchitectonic Maps of Mouse Visual Cortex
Jun Zhuang
QW Quanxin Wang
Marc Takeno
JW Jack Waters
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2731 Views: 5580
Edited by: Jyotiska Chaudhuri
Reviewed by: Salma MerchantKathrin Sutter
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
This protocol describes a method for registration of in vivo cortical retinotopic map with cytochrome c oxidase (CO) labeled architectonic maps of the same mouse brain through the alignment of vascular fiducials. By recording surface blood vessel pattern and sequential alignment at each step, this method overcomes the challenge imposed by tissue distortion during perfusion, mounting, sectioning and histology procedures. This method can also be generalized to register and align other types of in vivo functional maps like ocular dominance map and spatial/temporal frequency tuning map with various anatomical maps of mouse cortex.
Keywords: Architectonic map Retinotopic map Registration Cortex flattening Tangential section Vasculature Cytochrome c oxidase
Background
The mouse visual cortex can be segregated into functionally distinct visual areas by in vivo retinotopic mapping (Marshel et al., 2011; Garrett et al., 2014; Zhuang et al., 2017) or by neuronal track-tracing techniques aided by architectonic structures (Olavarria and Montero, 1989; Wang and Burkhalter, 2007). These different visual areas have distinct response properties and corticocortical connectivity (Andermann et al., 2011; Marshel et al., 2011; Roth et al., 2012; Wang et al., 2011 and 2012). These results suggest that mouse visual areas form segregated visual streams processing different types of visual information (Murakami et al., 2017; Smith et al., 2017). Studying the mouse visual system in the context of visual area maps is essential to understanding the organization of visual cortex. However, although the functional maps and structure maps are broadly similar, the two maps have been shown not matching perfectly (Zhuang et al., 2017). For example, the primary visual cortex (V1) appears as an upward triangle in both maps, but the lateral edge of V1 in retinotopic map can be up to 300 micrometers more medial than that in anatomical map (Zhuang et al., 2017). Since the smallest visual areas in mouse cortex are only a few hundred micrometers wide, ignoring this mismatch will potentially bias our interpretation of visual area functions. Furthermore, both types of maps vary significantly across different individuals. Therefore, to study the functions of identified visual areas, it is important to be able to reliably generate and compare functional and anatomical maps in the same animal. However, the tissue distortion during perfusion, mounting, sectioning and histological procedure makes it difficult to directly compare functional maps recorded in vivo with anatomical maps recorded after histology. Here we describe a method to overcome these challenges, allowing direct comparison between these two types of maps.
Materials and Reagents
Sponge (Patterson Veterinary Supply, catalog number: 07-847-3539 )
Metal clips (Universal Small Binder Clips, Universal, catalog number: UNV10200 )
Razor Blade (VWR, catalog number: 55411-050 )
Spatula (Fine Science Tools, catalog number: 10090-13 )
Gelatin subbed slides (SouthernBiotech, catalog number: SLD01-CS )
Cover glass (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 12450S )
Corning 500 ml filter system, 0.45 μm (Corning, catalog number: 430770 )
Corning 24-well plate (Corning, Falcon®, catalog number: 351147 )
Corning disposable Petri dish (100 x 15 mm, Corning, Falcon®, catalog number: 351029 )
DyLight 649-labeled tomato lectin (Vector Laboratories, catalog number: DL-1178 )
Dry ice
Tissue-Tek OCT Compound (Sakura Finetek, VWR, catalog number: 4583 )
10x phosphate buffered saline (PBS) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9625 )
Ethyl alcohol, 200 proof (Fisher Scientific, catalog number: 16-100-826)
Manufacturer: Pharmco-Aaper, catalog number: 241ACS200CSGP .
DPX mountants (Electron Microscopy Science, catalog number: 13512 )
Paraformaldehyde (Sigma-Aldrich, catalog number: 441244 )
Sodium hydroxide solution (NaOH) (1 N, Sigma-Aldrich, catalog number: S2770 )
Hydrochloric acid (HCl) (36.5-38%, Sigma-Aldrich, catalog number: H1758 )
Sodium phosphate monobasic (NaH2PO4) (anhydrous, Sigma-Aldrich, catalog number: S3139 )
Sodium phosphate dibasic (Na2HPO4) (anhydrous, Sigma-Aldrich, catalog number: 255793 )
Sucrose (Sigma-Aldrich, catalog number: S8501 )
3,3’-Diaminobenzidine (DAB, 1 mg/ml, Sigma-Aldrich, catalog number: D5637 )
Trizma HCl (Sigma-Aldrich, catalog number: T5941 )
Trizma base (Sigma-Aldrich, catalog number: T6066 )
Cobalt(II) chloride (CoCl2) (Sigma-Aldrich, catalog number: 232696 )
Cytochrome c (Sigma-Aldrich, catalog number: C2506 )
Catalase (10,000-40,000 U/mg, 20-50 mg/ml, Sigma-Aldrich, catalog number: C30 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Xylene (Merck, catalog number: XX0060 )
4% (w/v) formaldehyde (4% PFA in PBS) (see Recipes)
1% (w/v) formaldehyde (1% PFA in PBS) (see Recipes)
0.2 M phosphate-buffer (PB) solution with 20% (w/v) sucrose stock (pH 7.4) (see Recipes)
5 mg/ml DAB stock in 0.05 M Tris-HCl buffer (pH 7.6) (see Recipes)
Preincubation solution, 0.05 M Tris-HCl Buffer Stock Solution (see Recipes)
Incubation solution (see Recipes)
Rinse solution, 0.1 M PB with 10% sucrose (pH 7.4) (see Recipes)
Equipment
Fume hood (Labcono)
4 °C fridge (Panasonic Healthcare, model: SR-L6111W-PA ; VWR, catalog number: 89031-974 )
Scale (analytical balance, A&D Weighing, model: GH-252 )
Hot plate stirrer (VWR, catalog number: 97042-646 )
B10P Benchtop PH meter (VWR, catalog number: 89231-662 )
Microtome (MICROM, model: Sliding Microtome HM 400R )
Widefield microscope for both bright field and fluorescence imaging (ZEISS, model: Axio Imager 2 )
Dissecting microscope (Leica Microsystems, model: Leica MZ10 F )
Shaker (Corning, model: LSETM Low Speed )
Incubator (Quincy Lab, model: Model 10 lab oven )
Peristaltic pump (Harvard Apparatus, model: MA1-55-7766 )
Software
Fiji (Schindelin et al., 2012) with TrakEM2 plugin (Cardona et al., 2012)
Procedure
In vivo imaging
Make two small fiducial marks indicating the anterior and medial directions of the cranial window respectively. Record vasculature structure image of the cranial window via a fluorescence or a brightfield image (using a green wavelength may give better image contrast of blood vessels). Name it image A. Generate in vivo retinotopic maps through the cranial window (i.e., intrinsic signal Juavinett et al., 2017 or fluorescence retinotopic map Zhuang et al., 2017). Name it image B. Image A and image B should be perfectly co-registered by nature given the imaging optical axis is perpendicular to the cranial window (Figure 2A/B).
Perfusion and cortex flattening (modified from Wang and Burkhalter, 2007)
Perform mouse cardiac perfusion under isoflurane anesthesia (5% isoflurane, Gage et al., 2012) with the following steps of perfusion fluids.
Saline wash 10 ml/min for 100 ml.
5 µg/ml DyLight 649 lectin 5 ml/min for 25 ml to label blood vessel.
Wait for 5 min for DyLight lectin to adsorb to tissue.
1% PFA (see Recipes) 5 ml/min for 90 ml.
With brain within the skull, acquire fluorescence image of cranial window (filter setting: 655/670 nm). The fiducial marks made in Procedure A should be visible. Name it image C (Figure 2C).
Collect brain tissue. Since the animal was perfused by 1% PFA, the brain tissue will be relatively soft for cortex flattening. Be careful not to make any damage.
Optional: Acquire bright field and fluorescence images (filter setting: 655/670 nm) of surface vasculature of the whole brain using a dissecting scope. The major surface blood vessels should be visible in the bright field image (can be registered with image A) and the DyLight labeled blood vessels should be visible in the fluorescence image (can be registered with image D).
Isolate the cortical sheet of windowed hemisphere (the procedure can be done in a Petri dish sitting on ice). Carefully keep track of the orientation of cortical sheet. For video guidance, please see this EJN video protocol (made by Hoey Sarah, Universität Zürich): http://www.ejnnews.org/video-protocol-isolation-adult-mouse-hippocampi/.
Separate the two hemispheres of the brain with a razor blade. Keep the windowed hemisphere and discard the other hemisphere.
Cut off olfactory bulb with a razor blade.
Cut off brain tissue posterior to the neocortex (this include cerebellum, posterior midbrain and hind brain) with a razor blade.
From the medial side, gently pull out the thalamus, septum and striatum by using a spatula. Cut off these subcortical tissue.
Gently flip the hippocampal formation out and then separate it from cortex using a spatula.
Flatten the isolated cortical sheet on a slide glass with the pia surface against the glass. Cover the other side of the cortical sheet with a piece of sponge. Cover the sponge with another piece of the slide glass. Space the two slides with two coins (we used United State dimes with thickness of 1.35 mm). Clip the both sides of slides (Figure 1).
Figure 1. Sketch of the device used to flatten cortical sheet
Immerse the ‘sandwich’ made in Step B6 in 1% PFA overnight (in a Petri dish in 4 °C fridge). Make sure the whole ‘sandwich’ is fully submerged.
Remove 1% PFA and add 4% PFA (see Recipes) in the dish overnight.
Remove 4% PFA and add 20% sucrose in the dish overnight.
Remove the clips and remove the cortical sheet. Cut the outer edge of the sheet so that it is in an asymmetric shape and the orientation of the cortex (anterior, posterior, medial and lateral) is easy to identify.
Take a fluorescence vasculature image (filter setting: 655/670 nm) of the flattened and cut cortex sheet before sectioning. Name it image D (Figure 2D).
Tangential sectioning of flattened cortical sheet
Note: This is the crucial step and do it with extra caution.
Sufficiently cool the platform with dry ice before mounting (~10 min) the tissue and keep the platform frozen (dry ice always presented in the wells at the both end of the platform) for the whole sectioning process.
Embed flattened cortex sheet in OCT with cortical surface facing up on microtome platform.
Quickly put one glass slide on top of the cortex sheet before it freezes. Apply gentle pressure with fingers on the slides so that it flattens the tissue surface until it freezes.
Raise and adjust the platform against the dissecting blade, until the blade is perfectly aligned with the top surface of the glass slide. Lock the platform.
Lower the platform and warm the top glass slide with a finger to defrost the top surface. Remove top glass slide. Now the top surface of the cortical tissue should be perfectly parallel to the dissecting blade.
Slowly raise the platform until the frozen tissue touches the blade.
Check the alignment between frozen tissue surface and the blade carefully. Try very thin sections (~5 µm) to adjust alignment.
Cut the first section with 150 µm thickness. This is to make sure the first section is across the whole cortical surface and contains sufficient surface vasculature for later alignment.
Cut the remaining sections with 100 µm or 50 µm thickness through the whole cortex.
Soak the sections in 1x PBS in sequence in a 24-well plate.
CO staining (modified from Tootell et al., 1988)
Wash the sections with excess PBS (pH 7.4), 3 x 5 min, ~40 ml per wash.
Mount the sections on gelatin coated slides. Wait until completely dry.
Preincubate sections with pre-incubation solution (see Recipes) at room temperature for 10 min.
Rinse 4 x 5 min with rinse solution.
Incubate sections with incubation solution (see Recipes) for 1-6 h at 37-40 °C in the dark (or foil covered).
Check staining every 0.5-1 h until the reaction is sufficiently advanced and terminate the reaction by observing darkness of the tissue.
Rinse sections with rinse solution (3 x 3 min, see Recipes)
Rinse sections with dH2O (1 x 3 min)
Dry mount (all procedure should be performed under a fume hood)
Dry and defat through series of EtOH 50%, 70%, 90%, 3 min each.
Wash with 100% EtOH: 2 x 3 min.
Wash with xylene 1 x 5 min.
Coverslip with DPX right after xylene without drying the xylene.
Let the DPX solidify overnight.
Take brightfield images of the sections (image series E, for example of a section across layer 4 in this series see Figure 2E, showing architectonic labeling of primary sensory cortices and retrosplenial cortex).
Data analysis
Adjust the contrast and pixel resolution of images A, C, D, E so that the vasculature and cytoarchitectonic features are prominent and they all have roughly same pixel size.
Image B should go through same transformations as image A, so that they remain co-registered (Figure 2A/B).
Load all images into ImageJ TrakEM2 plugin.
Use in vivo images (image A/B) as reference and align other images progressively. Align image C to image A/B → align image D to image A/B/C → align image series E to image A/B/C/D.
Use non-linear transformation function (inside the TrakEM2 plugin) to align vasculature fiducials between adjacent image layers.
Use surface vasculature to align images A, C, D (Figure 2F).
Use the section outline and ascending/descending vessel cross sections to align image D and image series E (Figure 2G).
Once all images are co-registered, hide all the intermediate image layers and superimpose image B and the image showing the most prominent cytoarchitectonic features in image series E. The overlay image allows a direct comparison between the in vivo functional map and the CO labeled architectonic map (Figure 2H).
Figure 2. Images acquired at different steps and registration among them. A-E. Images from key steps in the processing of tissue from an Emx1-Ai96 mouse, each aligned to the CO image. A/B. Brightfield image of surface vasculature with overlaid visual area map. C. Fluorescence image of whole-mount brain, after perfusion, in which a subset of the surface vasculature is labeled with DyLight 649-lectin conjugate. D. Fluorescence image of the flattened cortex. E. Bright field image of a section through layer four after CO staining. F. Overlaid fluorescence images of surface vasculature in whole-mount (red, panel C) and after flattening (green, panel D). G. Overlaid images of the surface vasculature and CO staining in posterior barrel cortex and anterior V1. The contrast of the vasculature image is inverted for clarity. Arrowheads indicate small, circular regions that do not stain for CO and likely result from transverse cuts through ascending/descending vessels. Note the alignment of these putative vessels with likely locations of ascending/descending vessels in the fluorescence image of surface vasculature. H. Field sign map (panel A/B) aligned to chemoarchitectonic borders from the CO image (panel E). Borders of primary visual cortex, auditory cortex, and of barrels in primary somatosensory cortex) were drawn manually. Modified from Zhuang et al., 2017. Scale bar is 1 mm in panel H.
Notes
The duration of Steps B2-B6 (after perfusion to flattening) should be as short as possible, longer delays may cause the brain to harden and affect the result of flattening.
In images C (recorded in Step B2) and D (recorded in Step B11), only a subset of the cortical surface vasculature in image A (recorded in Procedure A) will be labeled.
In image C recorded in Step B11, same cortical surface vasculature as that in image B should be visible.
When rinsing the sections during CO staining, the rotation speed of the shaker should be less than 20 rpm to avoid displacing sections from the slide.
DAB is GHS07, GSH08 hazardous material. Handle with caution.
Paraformaldehyde is GHS02, GHS05, GHS07, GHS08 hazardous material. Handle with caution.
The resolution of image D, image E and image series F should be high enough that the cross sections of ascending/descending vessels are visible (we used ~3 μm/pixel).
Sometimes inverting the contrast of some images during image alignment may help visualize the fiducials across images.
For image alignment, any image analysis software allowing the use of independent layers and nonlinear/warping transformations may be used; however, a suitable and widely available software is the TrakEM2 function (Cardona et al., 2012) in Fiji software (https://fiji.sc/, Schindelin et al., 2012).
Recipes
4% (w/v) formaldehyde (4% PFA in PBS, under fume hood)
For 1 L of 4% formaldehyde, add 800 ml of PBS to a glass beaker on a stir plate in a fume hood. Heat while stirring to approximately 60 °C. Take care that the solution does not boil
Add 40 g of paraformaldehyde powder to the heated PBS solution
The powder will not immediately dissolve into solution. Slowly raise the pH by adding 1 N NaOH dropwise from a pipette until the solution clears
Once the paraformaldehyde is dissolved, the solution should be cooled and filtered
Adjust the volume of the solution to 1 L with PBS
Recheck the pH, and adjust it with small amounts of dilute HCl to approximately 6.9
The solution can be aliquoted and frozen or stored at 2-8 °C for up to one month
1% (w/v) formaldehyde (1% PFA in PBS, under fume hood)
For 1 L of 4% formaldehyde, add 800 ml of PBS to a glass beaker on a stir plate in a fume hood. Heat while stirring to approximately 60 °C. Take care that the solution does not boil
Add 10 g of paraformaldehyde powder to the heated PBS solution
The powder will not immediately dissolve into solution. Slowly raise the pH by adding 1 N NaOH dropwise with a pipette until the solution clears
Once the paraformaldehyde is dissolved, the solution should be cooled and filtered
Adjust the volume of the solution to 1 L with PBS
Recheck the pH, and adjust it with small amounts of dilute HCl to approximately 6.9
The solution can be aliquoted and frozen or stored at 2-8 °C for up to one month
0.2 M PB solution with 20% (w/v) sucrose stock (pH 7.4, 1,000 ml)
NaH2PO4 (anhydrous) 0.04 M: 4.8 g
Na2HPO4 (anhydrous) 0.16 M: 22.72 g
Sucrose: 200 g
Adjust pH to 7.4
Add distilled water to 1,000 ml
5 mg/ml DAB stock in 0.05 M Tris-HCl buffer (pH 7.6, 100 ml, under fume hood)
500 mg DAB
Tris-HCl: 0.788 g
Tris base: 0.606 g
Adjust pH to 7.6
Add distilled water to 100 ml
Aliquot into 1 ml, frozen (-20 °C) for storage
Pre-incubation solution, 0.05 M Tris-HCl Buffer Stock Solution (500 ml) with 275 mg/L CoCl2 and 10% sucrose (pH 7.4, 500 ml)
Tris-HCl: 3.305 g
Tris base: 0.485 g
CoCl2: 137.5 mg (final concentration: 275 mg/L)
Sucrose: 50 g (final concentration: 10% w/v)
Adjust pH to 7.4
Add distilled water to 500 ml
Incubation solution (25 ml, under fume hood)
0.2 M PB with 20% sucrose (pH 7.4): 20 ml
4 ml DAB stock solution (5 mg/ml, final DAB concentration: 0.5 mg/ml)
3 mg cytochrome c (final concentration: 0.075 mg/ml)
0.008 ml catalase (final concentration: 64-640 units/ml)
0.1 ml DMSO (final concentration: 0.25%)
Add distilled water to 25 ml (to reduce over reacting, this can be diluted to 40 ml)
Rinse solution, 0.1 M PB with 10% sucrose (pH 7.4) (200 ml)
0.2 M PB with 20% sucrose (pH 7.4): 100 ml
Add distilled water to 200 ml
Acknowledgments
The project described here was supported by the Allen Institute for Brain Science and award number R01NS078067 from the National Institute of Mental Health. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the National Institutes of health and the National Institute of Neurological Disorders and Stroke. We thank the many staff members of the Allen Institute, especially the In Vivo Sciences team for surgeries and Marina Garrett for advice. We thank the Allen Institute founders, Paul G Allen and Jody Allen, for their vision, encouragement and support. The authors declare that there is no conflict of interest.
References
Andermann, M. L., Kerlin, A. M., Roumis, D. K., Glickfeld, L. L. and Reid, R. C. (2011). Functional specialization of mouse higher visual cortical areas. Neuron 72(6): 1025-1039.
Cardona, A., Saalfeld, S., Schindelin, J., Arganda-Carreras, I., Preibisch, S., Longair, M., Tomancak, P., Hartenstein, V. and Douglas, R. J. (2012). TrakEM2 software for neural circuit reconstruction. PLoS One 7(6): e38011.
Gage, G. J., Kipke, D. R. and Shain, W. (2012). Whole animal perfusion fixation for rodents. J Vis Exp (65).
Garrett, M. E., Nauhaus, I., Marshel, J. H. and Callaway, E. M. (2014). Topography and areal organization of mouse visual cortex. J Neurosci 34(37): 12587-12600.
Juavinett, A. L., Nauhaus, I., Garrett, M. E., Zhuang, J. and Callaway, E. M. (2017). Automated identification of mouse visual areas with intrinsic signal imaging. Nat Protoc 12(1): 32-43.
Marshel, J. H., Garrett, M. E., Nauhaus, I. and Callaway, E. M. (2011). Functional specialization of seven mouse visual cortical areas. Neuron 72(6): 1040-1054.
Murakami, T., Matsui, T. and Ohki, K. (2017). Functional segregation and development of mouse higher visual areas. J Neurosci 37(39): 9424-9437.
Olavarria, J. and Montero, V. M. (1989). Organization of visual cortex in the mouse revealed by correlating callosal and striate-extrastriate connections. Vis Neurosci 3(1): 59-69.
Roth, M. M., Helmchen, F. and Kampa, B. M. (2012). Distinct functional properties of primary and posteromedial visual area of mouse neocortex. J Neurosci 32(28): 9716-9726.
Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J. Y., White, D. J., Hartenstein, V., Eliceiri, K., Tomancak, P. and Cardona, A. (2012). Fiji: an open-source platform for biological-image analysis. Nat Methods 9(7): 676-682.
Smith, I. T., Townsend, L. B., Huh, R., Zhu, H. and Smith, S. L. (2017). Stream-dependent development of higher visual cortical areas. Nat Neurosci 20(2): 200-208.
Tootell, R. B., Hamilton, S. L., Silverman, M. S. and Switkes, E. (1988). Functional anatomy of macaque striate cortex. I. Ocular dominance, binocular interactions, and baseline conditions. J Neurosci 8(5): 1500-1530.
Wang, Q. and Burkhalter, A. (2007). Area map of mouse visual cortex. J Comp Neurol 502(3): 339-357.
Wang, Q., Gao, E. and Burkhalter, A. (2011). Gateways of ventral and dorsal streams in mouse visual cortex. J Neurosci 31(5): 1905-1918.
Wang, Q., Sporns, O. and Burkhalter, A. (2012). Network analysis of corticocortical connections reveals ventral and dorsal processing streams in mouse visual cortex. J Neurosci 32(13): 4386-4399.
Zhuang, J., Ng, L., Williams, D., Valley, M., Li, Y., Garrett, M. and Waters, J. (2017). An extended retinotopic map of mouse cortex. Elife 6: e18372.
Copyright: Zhuang et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Zhuang, J., Wang, Q., Takeno, M. and Waters, J. (2018). Registration and Alignment Between in vivo Functional and Cytoarchitectonic Maps of Mouse Visual Cortex. Bio-protocol 8(4): e2731. DOI: 10.21769/BioProtoc.2731.
Zhuang, J., Ng, L., Williams, D., Valley, M., Li, Y., Garrett, M. and Waters, J. (2017). An extended retinotopic map of mouse cortex. Elife 6: e18372.
Download Citation in RIS Format
Category
Neuroscience > Sensory and motor systems > Visual system
Neuroscience > Neuroanatomy and circuitry > Cortex
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,732 | https://bio-protocol.org/exchange/protocoldetail?id=2732&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Characterization of Amyloid Fibril Networks by Atomic Force Microscopy
M Mirren Charnley
JG Jay Gilbert
OJ Owen G. Jones
NR Nicholas P. Reynolds
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2732 Views: 7801
Edited by: Vivien Jane Coulson-Thomas
Reviewed by: Vijaykrishna RaghunathanAnca Flavia Savulescu
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Dense networks of amyloid nanofibrils fabricated from common globular proteins adsorbed to solid supports can improve cell adhesion, spreading and differentiation compared to traditional flat, stiff 2D cell culture substrates like Tissue Culture Polystyrene (TCPS). This is due to the fibrous, nanotopographic nature of the amyloid fibril networks and the fact that they closely mimic the mechanical properties and architecture of the extracellular matrix (ECM). However, precise cell responses are strongly dependent on the nanostructure of the network at the cell culture interface, thus accurate characterization of the immobilized network is important. Due to its exquisite lateral resolution and simple sample preparation techniques, Atomic Force Microscopy (AFM) is an ideal technique to characterize the fibril network morphology. Thus, here we describe a detailed protocol, for the characterization of amyloid fibril networks by tapping mode AFM.
Keywords: Amyloid nanofibrils Atomic force microscopy Self-assembly Roughness analysis Protein aggregation Biomaterials
Background
Networks of non-toxic amyloid fibrils assembled from common globular proteins (Jung et al., 2008; Lara et al., 2011) adsorbed to solid supports have applications in a wide variety of fields (Dharmadana et al., 2017; Wei et al., 2017). Particularly interesting is their applications in eukaryotic cell culture and biomaterials in general (Reynolds et al., 2013, 2014 and 2015; Gilbert et al., 2017b). This is largely due to the fact that networks of amyloid fibrils have morphologies and mechanical properties that closely resemble the local microenvironment of many cell types (the ECM). Such amyloid fibril networks have the added attraction that they are simple to fabricate, inexpensive and possess well-defined chemistries that can be easily reproduced.
As expected, the response of cells grown on these amyloid fibril networks is highly dependent on the nanoscale properties of the fibril network itself. For instance, small changes in fibril diameter, nanoscale roughness, surface coverage and fibril morphology have been shown to affect cell attachment and spreading (Reynolds et al., 2014 and 2015). Thus, it is important to accurately characterize the nanotopography and surface roughness of the immobilized networks before using them for cell culture applications. AFM is a powerful technique to perform this analysis as it requires little sample preparation, possesses nanoscale lateral resolution and sub-nanometer vertical resolution (Reynolds et al., 2014 and 2015; Gilbert et al., 2017a and 2017b; Reynolds et al., 2017). Additionally, parameters such as nanoscale roughness can be extracted by post imaging analysis. In this protocol, we will describe the process of imaging a dense network of amyloid fibrils (fabricated from the protein Hen Egg White Lysozyme) on solid (mica) substrates by AFM. We will also describe the most common steps of post-processing analysis, namely flattening (removal of sample tilt and bowing artefacts) and roughness analysis.
Materials and Reagents
AFM Metal Specimen discs Diameter 15 mm (ProSciTech, catalog number: GA530-15 )
Muscovite Mica disks, grade V-1 diameter 12.5 mm (ProSciTech, catalog number: G51-12 )
STKYDOT adhesive pads (Bruker Nano, catalog number: STKYDOT )
Equipment
Cole-Parmer Precision Tweezer Set, Stainless Steel (Cole-Parmer Instrument, catalog number: 07387-16 )
Multimode 8 Atomic Force Microscope (AFM) with Nanoscope V controller (Bruker Nano, model: Multimode 8 )
Tapping Mode AFM tips (Approx. Resonant Frequency = 300 kHz, force constant 40 N/m) (Bruker Nano, model: RTESPA-300 )
Software
Nanoscope Analysis Software (Bruker Version 1.7)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Charnley, M., Gilbert, J., Jones, O. G. and Reynolds, N. P. (2018). Characterization of Amyloid Fibril Networks by Atomic Force Microscopy. Bio-protocol 8(4): e2732. DOI: 10.21769/BioProtoc.2732.
Download Citation in RIS Format
Category
Biochemistry > Protein > Self-assembly
Cell Biology > Cell imaging > Atomic force microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,733 | https://bio-protocol.org/exchange/protocoldetail?id=2733&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Amyloid Fibril Networks
M Mirren Charnley
JG Jay Gilbert
OJ Owen G. Jones
NR Nicholas P. Reynolds
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2733 Views: 7764
Edited by: Vivien Jane Coulson-Thomas
Reviewed by: Christopher J. Poon
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Networks of amyloid nanofibrils fabricated from common globular proteins such as lysozyme and β-lactoglobulin have material properties that mimic the extracellular microenvironment of many cell types. Cells cultured on such amyloid fibril networks show improved attachment, spreading and in the case of mesenchymal stem cells improved differentiation. Here we describe a detailed protocol for fabricating amyloid fibril networks suitable for eukaryotic cell culture applications.
Keywords: Amyloid fibrils Self-assembly Biomaterials Stem cell culture Cell attachment Biomimetic materials Protein aggregation
Background
A wide variety of proteins and peptides can adopt non-native structures and aggregate into amyloid fibrils possessing a common cross β-sheet secondary structure (Nelson et al., 2005). Amyloid fibrils are the pathological hallmarks of a number of neurodegenerative diseases (Chiti and Dobson, 2006), however, there is a growing consensus that mature amyloid fibrils are non-toxic by-products and the toxic species are soluble oligomers, pre-fibrillar aggregates (Kayed et al., 2003), or perhaps the process of aggregation itself (Reynolds et al., 2011). Additionally, a number of functional amyloids with essential physiological features have been discovered in a wide range of organisms (including humans) (Chiti and Dobson, 2006).
Non-toxic synthetic amyloid fibrils can be made from inexpensive, readily available, food grade proteins (Jung et al., 2008; Lara et al., 2011) and have a number of important applications in a wide range of technologies (Dharmadana et al., 2017; Wei et al., 2017). For example 2D and 3D networks of amyloid fibrils have physical and mechanical properties that mimic the local microenvironment of many eukaryotic cells, namely the extracellular matrix (ECM), thus are promising biomimetic materials for cell culture applications (Reynolds et al., 2014 and 2015; Gilbert et al., 2017). Here we describe in detail a protocol to fabricate aqueous suspensions of amyloid fibrils and their subsequent adsorption onto solid supports where they have been shown to control cell adhesion (Reynolds et al., 2014), spreading (Reynolds et al., 2015) and direct the differentiation of Mesenchymal Stem Cells (MSCs) (Gilbert et al., 2017).
Materials and Reagents
Personal Protective Equipment (PPE): Gloves (latex or nitrile), lab coat and safety glasses
15 ml polypropylene centrifuge tubes (Corning, catalog number: 430791 )
Millex-GP Syringe Filter, 0.22 μm, Polyethersulfone, 33 mm diameter, non-sterile (Merck, catalog number: SLGP033NB )
Syringe PP/PE without needle, Luer slip tip, 5 ml (Sigma-Aldrich, catalog number: Z116866 )
Spectra/Por 1 RC Dialysis Membrane Tubing (6-8 kDa MWCO, 25.5 mm diameter) (Fisher Scientific, catalog number: 08-670C)
Manufacturer: Spectrum Medical Industries, catalog number: 132660 .
Dialysis tubing clamps (50 mm) (Sigma-Aldrich, catalog number: Z371092 )
Pyrex crystallizing dish (used as oil bath) (Capacity 2.5 L) (diameter x height = 190 x 100 mm) (Corning, PYREX®, catalog number: 3140-190 )
BRAND pipette tips (volume 0.1-20 μl), non-sterile (BRAND, catalog number: 732222 )
Corning universal fit pipette tips, non-sterile, volume 1-200 μl (Corning, catalog number: 4865 ) and volume 100-1,000 μl (Corning, catalog number: 4867 )
Muscovite Mica disks, grade V-1 diameter 12.5 mm (ProSciTech, catalog number: G51-12 )
Double sided tape (for cleaving mica) (Agar Scientific, catalog number: AGG263 )
Headspace glass vials (20 ml) (Sigma-Aldrich, catalog number: 27306 )
β-Lactoglobulin from bovine milk ≥ 90% (PAGE), freeze-dried powder (Sigma-Aldrich, catalog number: L3908 )
Lysozyme from chicken egg white ≥ 90%, freeze-dried powder (Sigma-Aldrich, catalog number: L6876 )
Hydrochloric acid, ACS Reagent, 37% (Sigma-Aldrich, catalog number: 258148 )
Sodium hydroxide, BioXtra, ≥ 98% Anhydrous Pellets (Sigma-Aldrich, catalog number: S8045 )
Silicone oil (Sigma-Aldrich, catalog number: 85409 )
Hanna pH standard buffer solutions, pH 10 (Sigma-Aldrich, catalog number: Z655155), pH 7 (Sigma-Aldrich, catalog number: Z655139)
Manufacturer: Hanna, catalog numbers: HI 6010 and HI 6007 .
Ricca Chemical Buffer, Reference Standard pH 1.68 (Fisher Scientific, catalog number: 1492-16 )
10% lysozyme (or β-Lactoglobulin) solution for purification (see Recipes)
2% lysozyme (or β-Lactoglobulin) solution for fibril formation (see Recipes)
Equipment
BRAND glass beaker with spout 600 ml (BRAND, catalog number: 90648 )
Hanna bench pH/ISE meter HI4222 (Sigma-Aldrich, catalog number: Z655333EU)
Manufacturer: Hanna Instruments, model: HI-4222 .
Note: This product has been discontinued.
Laboratory centrifuge (Sigma Laborzentrifugen, catalog number: Sigma 3-30KHS )
12159 rotor (Sigma Laborzentrifugen, catalog number: 12159 )
Barnstead E-pure (MilliQ) Water Filtration Device (producing water with a resistivity of ≥ 18.2 MΩ) (Thermo Fisher Scientific, Thermo FisherTM, catalog number: D4631 )
Labco digital hotplate stirrer (Labtek, catalog number: 400.100.105 )
Note: This product has been discontinued.
Spinbar magnetic stirrer bars PTFE coated polygon 60 x 8 mm (Sigma-Aldrich, catalog number: Z266353 ) and 12.7 x 3 mm (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F37119-0127 )
Aldrich Clamp Holder (Sigma-Aldrich, catalog number: Z243620 )
Aldrich Benchclamp 3-prong (Sigma-Aldrich, catalog number: Z556645 )
Support Stand with Rod (Sigma-Aldrich, catalog number: Z509442 )
BRAND Ice bucket with lid 4.5 L (BRAND, catalog number: 156100 )
Gilson PIPETMAN
Classic P20 max volume 20 μl (Gilson, catalog number: F123600 )
Classic P200 max volume 200 μl (Gilson, catalog number: F10005M )
Classic P1000 max volume 1,000 μl (Gilson, catalog number: F123602 )
Martin Christ Alpha 1-2LDplus Entry Laboratory Freeze Dryer (Martin Christ, model: Alpha 1-2LDplus , catalog number: 101530), equipped with 50 ml single-neck round-bottom flasks (Sigma-Aldrich, catalog number: Z414484 )
An air or nitrogen sauce (for drying samples, post rinse)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Charnley, M., Gilbert, J., Jones, O. G. and Reynolds, N. P. (2018). Preparation of Amyloid Fibril Networks. Bio-protocol 8(4): e2733. DOI: 10.21769/BioProtoc.2733.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Mesenchymal stem cell
Biochemistry > Protein > Self-assembly
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,734 | https://bio-protocol.org/exchange/protocoldetail?id=2734&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Flow Cytometric Quantification of Fatty Acid Uptake by Mycobacterium tuberculosis in Macrophages
EN Evgeniya V. Nazarova
MP Maria Podinovskaia
DR David G. Russell
Brian C. VanderVen
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2734 Views: 11311
Edited by: Longping Victor Tse
Reviewed by: Shalini Low-Nam
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
Mycobacterium tuberculosis (Mtb) has evolved to assimilate fatty acids from its host. However, until recently, there was no reliable way to quantify fatty acid uptake by the bacteria during host cell infection. Here we describe a new method to quantify fatty acid uptake by intracellular bacilli. We infect macrophages with Mtb constitutively expressing mCherry and then metabolically label them with Bodipy-palmitate. Following the labeling procedure, we isolate Mtb-containing phagosomes on a sucrose cushion and disrupt the phagosomes with detergent. After extensive washes, the isolated bacteria are analyzed by flow cytometry to determine the level of Bodipy-palmitate signal associated with the bacteria. Using a Mtb mutant strain defective in fatty acid uptake in liquid culture we determined that this mutant assimilated 10-fold less Bodipy-palmitate than the wild type strain during infection in macrophages. This quantitative method of fatty acid uptake can be used to further identify pathways involved in lipid uptake by intracellular Mtb and possibly other bacteria.
Keywords: Fatty acid Uptake Mycobacterium tuberculosis Macrophage Intracellular Mycobacteria Bodipy
Background
The ability of Mycobacterium tuberculosis (Mtb) to assimilate host-derived lipids (fatty acids and cholesterol) enables survival of the pathogen within its host (Russell et al., 2010; Lovewell et al., 2016). This idea is supported by upregulation of cholesterol and fatty acid metabolism-related genes by Mtb inside of macrophage, during mouse infection and in human lung tissue (Schnappinger et al., 2003; Rachman et al., 2006; Rohde et al., 2007; Fontán et al., 2008; Tailleux et al., 2008; Homolka et al., 2010; Rohde et al., 2012). The importance of cholesterol metabolism for Mtb during infection is supported by genetic studies and by identification of new antituberculosis compounds targeting cholesterol metabolism (Pandey and Sassetti, 2008; Wipperman et al., 2014; VanderVen et al., 2015). However, discovery of the specific machinery devoted to fatty acid uptake in Mtb is hindered not only by apparent redundancy of dedicated genes (Cole et al., 1998) but also by a paucity of reliable assays. Metabolic labeling with radioactive substrate has been the accepted approach to assess efficiency of fatty acid intake by bacterium in broth culture (Forrellad et al., 2014). This method is extremely challenging to apply for intracellular Mtb, and few groups have reported successful use of this approach (Daniel et al., 2011). Alternatively, TEM and staining with lipophilic dyes such as Bodipy 493/503, Nile Red, Oil Red can facilitate detection of lipids inside of mycobacteria during infection (Daniel et al., 2011; Podinovskaia et al., 2013; Caire-Brändli et al., 2014). However, neither of these labeling approaches directly assess the active import of substrate, but instead indicate the total amount of accumulated lipids. Therefore, a means of metabolic labeling of active fatty acid import by Mtb during infection that is tractable to downstream characterization is sorely needed.
Recently, it was shown that fluorescent fatty acids can be delivered effectively to intracellular bacteria and can be detected by microscopy (Podinovskaia et al., 2013). These observations led us to develop a new method of flow-cytometry based quantification of fluorescent fatty acid uptake by Mtb within its host cell. This assay allowed us to demonstrate that a ∆lucA::hyg Mtb strain is defective in fatty acid uptake during macrophage infection (Nazarova et al., 2017) (Figure 1). We believe that this methodology opens the door to genetic screens to further understand mechanisms involved in fatty acid uptake by Mtb and possibly other intracellular pathogens during infection in host cells.
Figure 1. Overview of the method used to quantify fatty acid uptake by M. tuberculosis during infection in macrophages
Materials and Reagents
Serological pipets, 5 ml, 10 ml, 25 ml and 50 ml (Corning, Costar®, catalog numbers: 4487 , 4488 , 4489 and 4490 )
Pipette tips, 20 μl, 100 μl, 200 μl, 1 ml (Biotix, Neptune®, catalog numbers: BT20 , BT100 , BT200 ; Thermo Fisher Scientific, Thermo Scientific, catalog number: 2079-HR )
T25 (sterile 25 cm2 tissue culture flasks with filtered cap) (TPP, catalog number: 90026 )
T75 or T150 (sterile 75 cm2 or 150 cm2 tissue culture flasks with filtered cap) (TPP, catalog numbers: 90076 or 90151 )
Sterile 1 ml tuberculin syringe with 25 gauge needle (BD, catalog number: 309626 )
Cell scrapers, 25 cm (SARSTEDT, catalog number: 83.1830 )
15 ml conical tube (SARSTEDT, catalog number: 62.554.100 )
50 ml conical tube (SARSTEDT, catalog number: 62.547.100 )
Glasstic® slides with grids (KOVA International, catalog number: 87144 )
150 x 15 mm Petri dish (VWR, catalog number: 25384-326 )
2 ml screw-cap tubes (VWR, catalog number: 16466-042 )
FACS tubes (VWR, catalog number: 60818-496 )
3 ml syringe (with Luer-LokTM tip, BD, catalog number: 309657 )
Disposable plastic OD cuvettes with square caps (Fisher Scientific, FisherbrandTM catalog numbers: 14-955-128 and 14-385-999 )
Mycobacterium tuberculosis constitutively expressing mCherry (pMV306 smyc’::mCherry (Kanr)) Source: Russell and VanderVen lab (Nazarova et al., 2017)
Bone marrow-derived murine macrophages (BALB/c mice, THE JACKSON LABORATORIES, catalog number: 000651 )
Note: Differentiation is described in detail in Nazarova et al. (2017).
L cells (NCTC clone 929 [L cell, L-929, derivative of Strain L]) (ATCC, catalog number: CCL-1 )
Phosphate-buffered saline (PBS) 1x (Mediatech, catalog number: 21-040 )
Tyloxapol (Acros Organics, catalog number: 422370050 )
Middlebrook 7H9 Broth Base (BD, DifcoTM, catalog number: 271310 )
Distilled water
Glycerol (VWR, catalog number: 97062-452 )
Middlebrook OADC Enrichment (BD, BBLTM, catalog number: 212351 )
Kanamycin sulfate (IBI Scientific, catalog number: IB02120 )
Heat inactivated fetal bovine serum (Thermo Fisher Scientific, GibcoTM, catalog number: 10437028 )
Note: Heat inactivated at 56 °C for 30 min.
200 mM L-glutamine (100x) (Mediatech, catalog number: 25-005 )
100 mM sodium pyruvate (Mediatech, catalog number: 25-000 )
Penicillin-streptomycin solution 100x (Mediatech, catalog number: 30-002 )
Dulbecco’s modification of Eagle’s medium (DMEM) 1x (Mediatech, catalog number: 10-017 )
Glucose (dextrose) (Fisher Scientific, catalog number: BP350-1 )
Bovine serum albumin (BSA) (Roche Diagnostics, catalog number: 03116964001 )
Gelatin from cold water fish skin (Sigma-Aldrich, catalog number: G7765 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C4901 )
Magnesium chloride (MgCl2) (AMRESCO, catalog number: J364 )
Fatty acid-free BSA (Roche Diagnostics, catalog number: 03117057001 )
100% ethanol, 200 Proof (Decon Labs, catalog number: V1016 )
BodipyTM FL C16 (Bodipy-palmitate) (Thermo Fisher Scientific, InvitrogenTM, catalog number: D3821 )
BodipyTM FL C12 (Thermo Fisher Scientific, InvitrogenTM, catalog number: D3822 )
BodipyTM 558/568 C12 (Thermo Fisher Scientific, InvitrogenTM, catalog number: D3835 )
Potassium chloride (KCl) (Mallinckrodt Chemicals or Avantor Performance Materials, MACRON, catalog number: 6858-04 )
Sucrose (Avantor Performance Materials, J.T. Baker, catalog number: 4097 )
Ethylenebis(oxyethylenenitrilo)tetraacetic acid (EGTA) (Avantor Performance Materials, J.T. Baker, catalog number: L657 )
HEPES (VWR, catalog number: BDH4162 )
TweenTM 80 (Fisher Chemical, catalog number: T164-500 )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: 158127 )
20% tyloxapol (see Recipes)
7H9 OADC media(see Recipes)
Kanamycin 25 mg/ml (see Recipes)
D10 media (see Recipes)
L-cell conditioned media (see Recipes)
BMDM media (see Recipes)
Basal uptake buffer (BUB) (see Recipes)
1% fatty acid-free BSA (see Recipes)
4 mM Bodipy-palmitate (see Recipes)
Cuvette buffer (see Recipes)
Homogenization buffer (see Recipes)
20% Tween 80 (see Recipes)
0.05% tyloxapol (see Recipes)
4% PFA (see Recipes)
Equipment
Pipette controller (Drummond Scientific, model: Pipet-Aid®, catalog number: 4-000-101 )
Pipettors (MIDSCI, Alphapette, models: A-20 , A-100 , A-200 , A-1000 )
37 °C, 6% CO2 incubator
56 °C water bath
Refrigerator (4 °C)
-20 °C freezer
Spectrophotometer compatible with absorbance measurements at 600 nm (Cole-Parmer, Jenway, model: 6320D )
Beckman Allegra 6KR centrifuge (Beckman Coulter, model: Allegra® 6KR KneewellTM)
GH-3.8 rotor (Beckman Coulter, model: GH-3.8 Rotor )
Inverted microscope with enough resolution to detect cells of macrophage size (Olympus, model: IMT-2 with 10x objective)
Beckman Microfuge® 18 Centrifuge (Beckman Coulter, model: Microfuge® 18 )
Flow cytometer (BD, model: FACS LSR II )
Software
FlowJo (BD)
Procedure
Bacterial culture
Mycobacterium tuberculosis strains are grown at 37 °C in 7H9 OADC media (see Recipes) in standing culture in T25 flasks until mid-log phase (OD600 ~0.6). Bacterial cultures are started from frozen stocks and maintained for no more than 5 passages. Constitutive expression of fluorescent protein by Mtb is required for further detection. We used Mtb Erdman strains with an integrated pMV306 plasmid expressing mCherry from smyc promoter (smyc’::mCherry). This plasmid confers kanamycin resistance, therefore growth media contains kanamycin at a final concentration of 25 μg/ml (see Recipes).
Notes:
Do not grow more than 10 ml of bacterial culture in a T25 flask to ensure sufficient amount of oxygen available to Mtb. To estimate timing for bacterial culture growth, consider that Mtb divides approximately once in two days when grown in standing culture. More details on bacterial culture growth for macrophage infection can be found in (Nazarova and Russell, 2017).
We advise testing your wild type strain constitutively expressing fluorescent protein for ability to efficiently intake Bodipy-palmitate during macrophage infection by microscopy. We have noticed that in Mtb Erdman strain expression of mCherry under strong promoter (smyc’ or hsp60’) from replicating plasmid impacts Bodipy-palmitate uptake. However CDC1551 strain with the same plasmid demonstrated high level of fatty acid uptake. Additionally, care should be taken to determine by confocal microscopy if Bodipy-palmitate accumulates within bacteria versus on their surface.
Macrophage isolation and culturing
Macrophages of various origins can be used. We differentiated macrophages from bone marrow cells from BALB/c mice and maintained in BMDM media (see Recipes) with antibiotics at 37 °C and 6.0% CO2 for 10 days before infection.
Infection
The day before infection seed macrophages in antibiotic-free BMDM media into T150 tissue culture flasks (3 x 107 cells and 40-50 ml of BMDM media per flask) to obtain confluent monolayers. If macrophages are of limited numbers one T75 flask with 1 x 107 cells would provide sufficient results, however, two T150 flasks (6 x 107 cells) would give easily detectable pellet of bacteria at the end of the experiment.
On the day of infection measure optical density of mid-log Mtb culture. Assuming that OD600 of 0.6 equals 108 bacteria/ml, centrifuge required amount of culture at 3,300 rpm (~2,500 x g) for 12 min in Beckman Allegra 6KR centrifuge, GH-3.8 rotor. We infect macrophages at MOI of 4:1, therefore to infect 6 x 107 cells we need 2.4 x 108 bacteria. To ensure that sufficient numbers of bacteria are pelleted we routinely centrifuge 3 ml of bacteria at OD600 = 0.6.
Notes: As estimation of bacterial numbers may vary, one may want to determine it on their own. However, to achieve higher replicability in terms of MOI, we advise adhering to our estimation. More details on macrophage infection can be found in (Nazarova and Russell, 2017).
Following centrifugation, remove the supernatant and resuspend the bacterial pellet in 1.5 ml of BUB (see Recipes). Pass bacterial suspension through a 1 ml tuberculin syringe with 25 gauge needle 12-20 times the same syringe and needle. Add 3.5 ml of BUB to the suspension to obtain 5 ml in total and mix thoroughly.
Add 2.4 ml of bacterial suspension to each T150 flask containing 3 x 107 cells. Mix well, but gently. Incubate at 37 °C and 6% CO2 for 4 h.
Remove extracellular bacteria by replacing with fresh pre-warmed antibiotic free BMDM media. Infected macrophages are maintained in BMDM medium at 37 °C and 6% CO2 for 3 days. Changing media on the second day of infection is optional.
Labeling
On the day of labeling (third day of infection) pre-warm sterile 1% fatty acid-free BSA (see Recipes) in PBS at 37 °C for 30-60 min. Add 4 mM stock of Bodipy-palmitate (see Recipes) to obtain 100 μM concentration. For labeling one T75 flask add 50 μl of 4 mM Bodipy-palmitate stock to 1.95 ml of 1% fatty acid-free BSA. Mix well by vortexing until the solution turns green. Keep at 37 °C and protect from light.
Notes:
The day of labeling can be chosen with consideration of the questions you are trying to address. We tested uptake of Bodipy-palmitate at various stages of macrophage infection, and noted that before the third day of infection the uptake levels are not sufficient to be detected.
In addition to Bodipy-palmitate, we have tested Bodipy FL C12 and Bodipy 558/568 C12. Bodipy FL C12 accumulated in intracellular bacteria as efficiently as Bodipy-palmitate, while Bodipy 558/568 C12 was poorly assimilated by Mtb. We chose to use Bodipy-palmitate as fatty acids of the length (16 carbons) are more commonly found in the membranes of macrophages infected with Mtb.
For labeling one T75 flask add 1.6 ml of 100 μM Bodipy-palmitate in 1% fatty acid-free BSA (from Step 1 of Labeling) to 18.4 ml of pre-warmed cuvette buffer (see Recipes) such that the final concentration of the labeled lipid is 8 μM, mix well. Use 15 ml for labeling one T75 flask, and 30 ml for labeling one T150 flask. Increase volumes in Steps 1 and 2 (Labeling) accordingly for larger infections.
Remove media from infected macrophages and replace with cuvette buffer containing Bodipy-palmitate (volumes are described in Step 2 of Labeling). Incubate the infected macrophages with label at 37 °C and 6.0% CO2 for 1 h.
After the 1 h labeling period, remove the cuvette buffer containing the Bodipy-palmitate and add fresh pre-warmed cuvette buffer without label for 1 h. Use 15 ml for one T75 flask, and 30 ml for one T150 flask. Proceed to the next step right after 1 h incubation without label.
Note: Alternatively, Bodipy-palmitate in 1% fatty acid-free BSA can be added directly to infected macrophages cultured in BMDM media. Label chase can be performed in fresh pre-warmed BMDM medium as well. No cuvette buffer is needed in this case. From our experience, either way of labeling gives comparable results.
Isolation of intracellular bacteria
Note: This portion of the protocol is based on phagosome isolation described in (Pethe et al., 2004).
Remove cuvette buffer from labeled infected cells, and quickly rinse with 10 ml of Homogenization buffer (see Recipes).
Add 15 ml of ice-cold Homogenization buffer, incubate at 4 °C for 10-15 min, and harvest macrophages by scraping off from each flask with cell scrapers. Transfer the cells to a 50 ml conical tube and pellet the cells by centrifugation at 1,500 rpm (514 x g) for 10 min in Beckman Allegra 6KR centrifuge, GH-3.8 rotor. This and all the following centrifugations are done at 4 °C to block any further uptake of lipids by bacteria.
Remove supernatant, resuspend pellet in 1.5 ml of Homogenization buffer by pipetting and transfer the cells to a 15 ml conical tube. Lyse the cells by 25-70 passages through a 1 ml tuberculin syringe with 25 gauge needle. Monitor cell lysis under a microscope using glasstic slides with 100 grids. Continue until > 95% of the cells are lysed, when intact cells are replaced by cell debris.
Note: For safety purposes place glass slide with infected material in 150 x 15 mm Petri dish.
Increase the volume to 5 ml by adding Homogenization buffer, resuspend well. Centrifuge cell lysate at 800 rpm (~146 x g) for 10 min in Beckman Allegra 6KR centrifuge, GH-3.8 rotor.
Transfer the supernatant (suspension of phagosomes) into a new 15 ml conical tube. The pellet mainly consists of nuclei and unlysed cells and is discarded.
To the suspension add 20% Tween 80 (see Recipes) to a final concentration of 0.1%, mix well and leave at 4 °C for 15 min to lyse Mtb containing vacuoles.
Quickly agitate by shaking and isolate the bacteria by centrifugation at 2,500 rpm (1,430 x g) for 15 min in Beckman Allegra 6KR centrifuge, GH-3.8 rotor.
Remove supernatant and resuspend the bacterial pellet in 10 ml of 0.05% tyloxapol in PBS (see Recipes). Centrifuge bacteria down at 3,300 rpm (~2,500 x g) for 15 min in Beckman Allegra 6KR centrifuge, GH-3.8 rotor.
Optional: repeat the previous step to further remove labeled fatty acids adhered to bacterial cell surface.
Note: Non-specific binding of bodipy-palmitate to the bacterial cell surface produces background signal. However, if tested strains/conditions produce a significant difference in specific uptake of label, this background noise wouldn’t impact results greatly.
Remove supernatant and fix bacteria in 4% PFA (see Recipes) for 24 h in 2 ml screw-cap tube.
Note: If you have flow cytometer in BSL3 facility, bacteria can be analyzed live immediately after isolation and without fixation.
Data analysis
Isolated bacteria should be analyzed within few days following collection, ideally the next day.
Centrifuge fixed samples at 10,000 rpm (9,000 x g) for 5 min in Beckman Microfuge® 18 Centrifuge.
Remove supernatant, resuspend pellet in 1-2 ml of 0.05% tyloxapol in PBS and transfer into FACS tube.
Pass suspension through 1 ml tuberculin syringe with 25 gauge needle 12-20 times to obtain a single cell bacterial suspension.
Analyze immediately on flow cytometer (BD FACS LSR II ) using described gating strategy (Figure 2). Select population of a medium size in forward and side scatter to exclude clumps and small debris, focus on mCherry(PE-Texas Red)-positive population (bacteria), and compare FITC signal from the Bodipy-palmitate between your samples. Since there is minimal overlap between mCherry and Bodipy signals, compensation is not needed. As a negative control use mCherry-positive bacteria not exposed to labeling.
Notes:
Bodipy-palmitate also accumulates in membranes of cell organelles, which are excluded from analysis, because they are mCherry-negative.
Collect as many events as possible, minimum 50,000. For analysis in Figure 2 we collected 1,000,000 events.
Quantify acquired data using FlowJo by determining mean fluorescence of Bodipy signal from mCherry-positive bacteria.
Figure 2. Gating strategy for analysis of Bodipy-palmitate uptake by intracellular Mtb. The population of a medium size is selected in forward and side scatter, and analyzed further for level of mCherry signal. Bodipy palmitate signal is determined for the mCherry-positive population representing bacteria. Panel on the right is a representative of detected Bodipy-palmitate signal associated with three different strains: wild type (black), ∆lucA::hyg (red) and complemented strain (blue). Grey histogram represents mCherry-positive bacteria not exposed to labeling. (Adapted from Nazarova et al., 2017)
Recipes
20% tyloxapol (20 ml)
Using 3 ml syringe add 4 ml of tyloxapol to 16 ml of distilled water in 50 ml conical tube
Heat up at 56 °C, vortex occasionally, until tyloxapol goes into a viscous but clear solution
Filter-sterilize (0.22 μm), store at room temperature for up to 12 months
7H9 OADC media (1 L)
Dissolve 4.7 g 7H9 DifcoTM Middlebrook 7H9 Broth Base and 2 ml glycerol in 900 ml of distilled water
Aseptically add 2.5 ml of sterile 20% tyloxapol to a final concentration of 0.05% and 100 ml of BBLTM Middlebrook OADC Enrichment, mix
Filter-sterilize (0.22 μm), store at room temperature
Kanamycin 25 mg/ml (10 ml)
Add 250 mg kanamycin sulfate to 10 ml distilled water, mix by vortexing
Filter-sterilize (0.22 μm), aliquot and store at -20 °C
D10 media (1 L)
Add 100 ml heat inactivated fetal bovine serum (10% final concentration), 10 ml 200 mM L-glutamine (2 mM final), 10 ml 100 mM sodium pyruvate (1 mM final), 10 ml penicillin, 100x streptomycin solution to Dulbecco’s modified Eagle’s medium DMEM so that total volume is 1 L
Filter-sterilize (0.22 μm), store at 4 °C for no longer than 2 months
Preheat at 37 °C before use
L-cell conditioned media
Frozen cells are thawed into D10 media and grown for 12-14 days in T150 tissue culture flasks at 37 °C and 6% CO2
Conditioned media is collected, and cell debris is removed by centrifugation at 1,500 rpm (514 x g) for 10 min on Beckman Allegra 6KR centrifuge, GH-3.8 rotor
Supernatant is aliquoted and stored at -20 °C
BMDM media (1 L)
Add 100 ml heat inactivated fetal bovine serum (10% final concentration), 10 ml 200 mM L-glutamine (2 mM final), 10 ml 100 mM sodium pyruvate (1 mM final), 100 ml L-cell-conditioned media (10% final concentration) to Dulbecco’s modified Eagle’s medium DMEM so that total volume is 1 L. Add 10 ml penicillin-streptomycin solution (100x) for media to culture macrophages before infection
Filter-sterilize (0.22 μm), store at 4 °C for no longer than 2 months
Preheat at 37 °C before use
Basal uptake buffer (BUB)
Add 2.25 g glucose, 2.5 g bovine serum albumin, 0.5 ml gelatin, 50 mg CaCl2, 50 mg MgCl2 to 500 ml PBS, mix
Filter-sterilize (0.22 μm), store at 4 °C for no longer than 6 months
1% fatty acid-free BSA (50 ml)
Dissolve 500 mg of fatty acid-free BSA in 50 ml PBS
Filter-sterilize (0.22 μm), aliquot and store at -20 °C
4 mM Bodipy-palmitate
Add 526 μl of 100% ethanol to 1 mg of Bodipy-palmitate, mix by vortexing
Store at -20 °C, protect from light
Cuvette buffer (1 L)
Dissolve 101 mg CaCl2, 200 mg KCl, 102 mg MgCl2, 901 mg glucose in 1 L of PBS
Filter-sterilize (0.22 μm) and store at room temperature
A few days before use add heat inactivated fetal bovine serum to final concentration of 10% to obtain the desired volume, filter-sterilize (0.22 μm) and store at 4 °C
Preheat at 37 °C before use
Homogenization buffer (500 ml)
Dissolve 42.75 g sucrose, 95 mg EGTA, 2.38 g HEPES, 250 μl gelatin in 400 ml of distilled water
Adjust pH to 7.0
Fill up with distilled water to the final volume 500 ml
Filter-sterilize (0.22 μm). Store and keep throughout use at 4 °C
20% Tween 80 (20 ml)
Using 3 ml syringe add 4 ml of Tween 80 to 16 ml of distilled water in 50 ml conical tube
Heat up at 37 °C, vortex occasionally, until Tween 80 goes into solution
Filter-sterilize (0.22 μm), store at room temperature
0.05% tyloxapol (250 ml)
Aseptically add 625 μl of sterile 20% tyloxapol to 250 ml PBS, mix
Filter-sterilize (0.22 μm), store at room temperature
4% PFA (500 ml)
Mix 20 g of PFA in PBS while heating up. Avoid boiling, otherwise formaldehyde will be formed
Aliquot and store at -20 °C. Thaw at room temperature before use
Acknowledgments
We thank Linda Bennett for excellent technical support. This work was supported by the NIH grants (AI099569 and AI119122) to BCV and (AI080651 and AI134183) to DGR. This protocol was developed and reported in the previous publication (Nazarova et al., 2017). The authors declare no conflicts of interest or competing interests.
References
Caire-Brändli, I., Papadopoulos, A., Malaga, W., Marais, D., Canaan, S., Thilo, L. and de Chastellier, C. (2014). Reversible lipid accumulation and associated division arrest of Mycobacterium avium in lipoprotein-induced foamy macrophages may resemble key events during latency and reactivation of tuberculosis. Infect Immun 82(2): 476-490.
Cole, S. T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., Gordon, S. V., Eiglmeier, K., Gas, S., Barry, C. E., 3rd, Tekaia, F., Badcock, K., Basham, D., Brown, D., Chillingworth, T., Connor, R., Davies, R., Devlin, K., Feltwell, T., Gentles, S., Hamlin, N., Holroyd, S., Hornsby, T., Jagels, K., Krogh, A., McLean, J., Moule, S., Murphy, L., Oliver, K., Osborne, J., Quail, M. A., Rajandream, M. A., Rogers, J., Rutter, S., Seeger, K., Skelton, J., Squares, R., Squares, S., Sulston, J. E., Taylor, K., Whitehead, S. and Barrell, B. G. (1998). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393(6685): 537-544.
Daniel, J., Maamar, H., Deb, C., Sirakova, T. D. and Kolattukudy, P. E. (2011). Mycobacterium tuberculosis uses host triacylglycerol to accumulate lipid droplets and acquires a dormancy-like phenotype in lipid-loaded macrophages. PLoS Pathog 7(6): e1002093.
Fontán, P., Aris, V., Ghanny, S., Soteropoulos, P. and Smith, I. (2008). Global transcriptional profile of Mycobacterium tuberculosis during THP-1 human macrophage infection. Infect Immun 76(2): 717-725.
Forrellad, M. A., McNeil, M., Santangelo Mde, L., Blanco, F. C., Garcia, E., Klepp, L. I., Huff, J., Niederweis, M., Jackson, M. and Bigi, F. (2014). Role of the Mce1 transporter in the lipid homeostasis of Mycobacterium tuberculosis. Tuberculosis (Edinb) 94(2): 170-177.
Homolka, S., Niemann, S., Russell, D. G. and Rohde, K. H. (2010). Functional genetic diversity among Mycobacterium tuberculosis complex clinical isolates: delineation of conserved core and lineage-specific transcriptomes during intracellular survival. PLoS Pathog 6(7): e1000988.
Lovewell, R. R., Sassetti, C. M. and VanderVen, B. C. (2016). Chewing the fat: lipid metabolism and homeostasis during M. tuberculosis infection. Curr Opin Microbiol 29: 30-36.
Nazarova, E. V., Montague, C. R., La, T., Wilburn, K. M., Sukumar, N., Lee, W., Caldwell, S., Russell, D. G. and VanderVen, B. C. (2017). Rv3723/LucA coordinates fatty acid and cholesterol uptake in Mycobacterium tuberculosis. Elife 6.
Nazarova, E. V. and Russell, D. G. (2017). Growing and handling of Mycobacterium tuberculosis for macrophage infection assays. Methods Mol Biol 1519: 325-331.
Pandey, A. K. and Sassetti, C. M. (2008). Mycobacterial persistence requires the utilization of host cholesterol. Proc Natl Acad Sci 105: 4376-4380.
Pethe, K., Swenson, D. L., Alonso, S., Anderson, J., Wang, C. and Russell, D. G. (2004). Isolation of Mycobacterium tuberculosis mutants defective in the arrest of phagosome maturation. Proc Natl Acad Sci U S A 101(37): 13642-13647.
Podinovskaia, M., Lee, W., Caldwell, S. and Russell, D. G. (2013). Infection of macrophages with Mycobacterium tuberculosis induces global modifications to phagosomal function. Cell Microbiol 15(6): 843-859.
Rachman, H., Strong, M., Ulrichs, T., Grode, L., Schuchhardt, J., Mollenkopf, H., Kosmiadi, G. A., Eisenberg, D. and Kaufmann, S. H. (2006). Unique transcriptome signature of Mycobacterium tuberculosis in pulmonary tuberculosis. Infect Immun 74(2): 1233-1242.
Rohde, K. H., Abramovitch, R. B. and Russell, D. G. (2007). Mycobacterium tuberculosis invasion of macrophages: linking bacterial gene expression to environmental cues. Cell Host Microbe 2(5): 352-364.
Rohde, K. H., Veiga, D. F., Caldwell, S., Balazsi, G. and Russell, D. G. (2012). Linking the transcriptional profiles and the physiological states of Mycobacterium tuberculosis during an extended intracellular infection. PLoS Pathog 8(6): e1002769.
Russell, D. G., VanderVen, B. C., Lee, W., Abramovitch, R. B., Kim, M. J., Homolka, S., Niemann, S. and Rohde, K. H. (2010). Mycobacterium tuberculosis wears what it eats. Cell Host Microbe 8(1): 68-76.
Schnappinger, D., Ehrt, S., Voskuil, M. I., Liu, Y., Mangan, J. A., Monahan, I. M., Dolganov, G., Efron, B., Butcher, P. D., Nathan, C. and Schoolnik, G. K. (2003). Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: Insights into the phagosomal environment. J Exp Med 198(5): 693-704.
Tailleux, L., Waddell, S. J., Pelizzola, M., Mortellaro, A., Withers, M., Tanne, A., Castagnoli, P. R., Gicquel, B., Stoker, N. G., Butcher, P. D., Foti, M. and Neyrolles, O. (2008). Probing host pathogen cross-talk by transcriptional profiling of both Mycobacterium tuberculosis and infected human dendritic cells and macrophages. PLoS One 3(1): e1403.
VanderVen, B. C., Fahey, R. J., Lee, W., Liu, Y., Abramovitch, R. B., Memmott, C., Crowe, A. M., Eltis, L. D., Perola, E., Deininger, D. D., Wang, T., Locher, C. P. and Russell, D. G. (2015). Novel inhibitors of cholesterol degradation in Mycobacterium tuberculosis reveal how the bacterium's metabolism is constrained by the intracellular environment. PLoS Pathog 11(2): e1004679.
Wipperman, M. F., Sampson, N. S. and Thomas, S. T. (2014). Pathogen roid rage: cholesterol utilization by Mycobacterium tuberculosis. Crit Rev Biochem Mol Biol 49(4): 269-293.
Copyright: Nazarova et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Nazarova, E. V., Podinovskaia, M., Russell, D. G. and VanderVen, B. C. (2018). Flow Cytometric Quantification of Fatty Acid Uptake by Mycobacterium tuberculosis in Macrophages. Bio-protocol 8(4): e2734. DOI: 10.21769/BioProtoc.2734.
Nazarova, E. V., Montague, C. R., La, T., Wilburn, K. M., Sukumar, N., Lee, W., Caldwell, S., Russell, D. G. and VanderVen, B. C. (2017). Rv3723/LucA coordinates fatty acid and cholesterol uptake in Mycobacterium tuberculosis. Elife 6.
Download Citation in RIS Format
Category
Microbiology > Microbial metabolism > Lipid
Immunology > Immune cell function > Macrophage
Cell Biology > Cell metabolism > Lipid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,735 | https://bio-protocol.org/exchange/protocoldetail?id=2735&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Establishment of Mesenchymal Stem Cells from Wharton’s Jelly of Human Umbilical Cord
UG Umesh Goyal
CJ Chitra Jaiswal
Malancha Ta
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2735 Views: 17517
Reviewed by: Vasiliki Koliaraki
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Mesenchymal stem cells (MSCs) are currently considered as ‘medicinal signaling cells’ and a promising resource in regard to cell-based regenerative therapy. Umbilical cord is a human term perinatal tissue which is easily attainable, and a promising source of stem cells with no associated ethical concerns. MSCs have been isolated from different regions of the umbilical cord and Wharton’s jelly (WJ) is the gelatinous matrix that surrounds and provides protection to the umbilical cord blood vessels. Being more primitive, MSCs from human umbilical cord exhibit greater proliferative capacity and immunosuppressive ability as compared to adult stem cells which gives them a therapeutic advantage. To meet the requirements for cell therapy, it is important to generate MSCs at a clinical scale by following steps which are not time consuming or labor intensive. Here we present a simple, efficient protocol for isolation of MSCs from WJ of human umbilical cord by explant culture method which is reproducible and also, cost effective.
Keywords: Umbilical cord Wharton’s jelly Mesenchymal stem cells Isolation Explant Cell culture
Background
Mesenchymal stem cells (MSCs) have a remarkable clinical potential to treat a wide range of debilitating diseases, mainly due to their unique immunomodulatory role and regenerative capacity (Caplan and Sorrell, 2015). They exist in many tissues (Hass et al., 2011) and have been observed to be perivascular in vivo (Caplan and Correa, 2011). The niche of the source or the source itself, could lead to important functional differences between the various MSC types (Kwon et al., 2016). Though bone marrow is the most well studied and best characterized source of MSCs, there are certain limitations associated with it (Liu et al., 2016). An appealing and convenient alternative choice of MSC source is the fetus-derived umbilical cord, which is discarded after birth and provides an easily accessible and non-controversial source of stem cells for therapy (El Omar et al., 2014). Umbilical cord MSC-based trials are still at early phase, though no cell rejection, tumor formation or long-term adverse effects have been reported from them (Zhang et al., 2017). Moreover, they have been successfully used in experimental animal disease models. For convincingly establishing safety and therapeutic efficacy of umbilical cord-MSCs, followed by their use in clinical applications, a vast number of MSCs need to be generated for transplantations (Bartmann et al., 2007).
MSCs have been isolated from different compartments of the umbilical cord and Wharton’s jelly (WJ), is the connective tissue surrounding the umbilical cord vessels (Troyer and Weiss, 2008). Being a primitive stromal cell population, WJ-MSCs offer the advantage of faster proliferation rate and reduced immunogenicity as compared to adult tissue derived MSCs (Liu et al., 2016). Hence, successful isolation of robustly proliferating healthy MSCs from WJ of human umbilical cord, which retain all the basic MSC properties, assumes importance. Here we describe step-by-step an explant method of isolation procedure followed by establishment of MSC culture from WJ of human umbilical cord. This method of isolation eliminates the use of any enzymatic treatment making it more economical, and getting rid of batch-to-batch variations and endotoxin contaminations likely to be associated with enzymatic preparations. The isolated WJ-MSCs expressed MSC-characteristic surface antigens and were positive for the expression of CD73, CD90 and CD105 and negative for CD34.
Materials and Reagents
15 and 50 ml centrifuge tubes (Corning, catalog numbers: 430791 and 430829 respectively)
1.5 ml microcentrifuge tube (Corning, Axygen®, catalog number: MCT-150-C )
90 mm Petri dish sterile (Tarsons, catalog number: 460090 )
35 mm cell culture dish (Corning, Falcon®, catalog number: 353001 )
1 ml blunt-end pipette tips
Corning® 1.2 ml External Threaded Polypropylene Cryogenic Vial, Self-Standing with Conical Bottom (Corning, catalog number: 430658 )
FACS tubes (Corning, Falcon®, catalog number: 352054 )
Millex-GP Syringe Filter Unit, 0.22 µm, polyether sulfone, 33 mm, gamma sterilized (Merck, catalog number: SLGP033RS )
20 ml and 5 ml syringes*
Sterile Scalpel blade No. 20 (HiMedia Laboratories, catalog number: LA771 )
0.5-10 µl microtips (Corning, Axygen®, catalog number: T-300 )
20-200 µl pipette tips (Corning, Axygen®, catalog number: T-200-C )
100-1000 µl pipette tips (Corning, Axygen®, catalog number: T-1000-C )
Biohazards disposable waste bags*
Plastic beaker*
0.9% w/v saline*
Antibiotic-Antimycotic (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 15240096 )
Isopropanol*
Autoclaved distilled water
Absolute ethanol (Merck, catalog number: 1.00983.0511 )
Sodium hypochlorite solution (Merck, catalog number: 1.93607.1021 )
Dulbecco’s phosphate-buffered saline (DPBS), No calcium, no magnesium (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 )
TrypLETM Express Enzyme (1x), no phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 12604013 )
Trypan blue solution 0.4% (Sigma-Aldrich, catalog number: T8154 )
Flow cytometry antibodies (Table 1)
Table 1. Flow cytometry antibodies
S. No.
Antigen (CD marker)
Antibody
Manufacturer
Dilution
1.
CD73
Anti-Human CD73 PE
BD, BD PharmingenTM,
catalog number: 550257
1.5 µl in 50 µl of cell suspension
2.
CD90
Anti-Human CD90 PE
BD, BD PharmingenTM,
catalog number: 555596
1.5 µl in 50 µl of cell suspension
3.
CD105
Anti-Human CD105-PE
R&D Systems,
catalog number: FAB10971P
1 µl in 50 µl of cell suspension
4.
CD34
Anti-Human CD34
BD, BD PharmingenTM,
catalog number: 550761
1 µl in 50 µl of cell suspension
S. No.
Isotype antibody
Manufacturer
Dilution
1.
IgG1, kappa
BD, BD PharmingenTM,
catalog number: 550617
1µl of 1:16 dilution in 50 µl of cell suspension (for CD73 and CD34) 1.5 µl in 50 µl cell suspension for CD90
2.
IgG1
R&D Systems,
catalog number: IC002P
1µl of 1:16 dilution in 50 µl cell suspension
KnockOutTM D-MEM high glucose no glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 10829018 )
Note: DMEM-F12 or DMEM, high glucose could also be used in place of KnockOutTM D-MEM (Nekanti et al., 2010).
L-Glutamine (200 mM) (Thermo Fisher Scientific, GibcoTM, catalog number: 25030149 )
Fetal bovine serum (FBS) mesenchymal stem cell qualified (Thermo Fisher Scientific, GibcoTM, catalog number: 12662029 )
Note: The source, grade and lot number of FBS play a critical role in MSC culture establishment.
Penicillin-Streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140148 )
Phosphate buffered saline tablets (Sigma-Aldrich, catalog number: P4417 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog numbers: D2650 )
Sheath fluid ( BD Biosciences, BD FACS FlowTM, catalog number: 342003 )
MSC isolation media (see Recipes)
MSC growth media (see Recipes)
1x sterile phosphate buffer saline, pH 7.4 (see Recipes)
MSC freezing mixture (see Recipes)
*Note: This item can be ordered from any standard company.
Equipment
Laminar flow hood* (EuroClone, model: S@feflowTM 0.9 , catalog number: LD80000)
Surgical tools including scalpel holder, forceps (large and small), pointed scissors
Incubator (BINDER, model: C 150 CO2 Incubator, catalog number: 9040-0078 )
Centrifuge 5810 R (Eppendorf, model: 5810 R , catalog number: 5811000320)
Haemocytometer depth 0.1 mm* (Rohem Instruments Private limited, http://www.sciencecorner.co.in/Rohem.php)
Mr. FrostyTM Freezing Container (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 5100-0001 )
-20 °C freezer* (Celfrost, model: BSF 150 )
-86 °C Upright Ultra-Low Temperature Freezer (Revco value, Thermo Fisher Scientific, Thermo ScientificTM, model: ULT-1386-3 )
Liquid nitrogen tank (Thermo Fisher Scientific, Thermo ScientificTM, model: Model 8031 )
Flow cytometer (BD Biosciences, BD FACSCaliburTM)
Inverted microscope* (Nikon Instruments, model: Eclipse TS100 )
Refrigerator* (SAMSUNG, model: RT31 , 2007)
2-20 μl single channel variable pipette* (Eppendorf, model: Research® plus , catalog number: 3120000038)
20-200 μl single channel variable pipette* (Eppendorf, model: Research® plus , catalog number: 3120000054)
100-1,000 μl single channel variable pipette* (Eppendorf, model: Research® plus , catalog number: 3120000062)
Autoclave*(Tuttnauer, model: 3850 ML )
*Note: This item can be ordered from any standard company.
Software
BD Cell Quest pro
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Goyal, U., Jaiswal, C. and TA, M. (2018). Isolation and Establishment of Mesenchymal Stem Cells from Wharton’s Jelly of Human Umbilical Cord. Bio-protocol 8(4): e2735. DOI: 10.21769/BioProtoc.2735.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Mesenchymal stem cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
How many days can we expect to start finding MSCs after isolation?
2 Answers
13 Views
Oct 27, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,736 | https://bio-protocol.org/exchange/protocoldetail?id=2736&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assaying Mechanonociceptive Behavior in Drosophila Larvae
NH Nina Hoyer
MP Meike Petersen
Federico Tenedini
Peter Soba
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2736 Views: 8710
Reviewed by: Jay Z Parrish
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
Drosophila melanogaster larvae have been extensively used as a model to study the molecular and cellular basis of nociception. The larval nociceptors, class IV dendritic arborization (C4da) neurons, line the body wall of the animal and respond to various stimuli including noxious heat and touch. Activation of C4da neurons results in a stereotyped escape behavior, characterized by a 360° rolling response along the body axis followed by locomotion speedup. The genetic accessibility of Drosophila has allowed the identification of mechanosensory channels and circuit elements required for nociceptive responses, making it a useful and straightforward readout to understand the cellular and molecular basis of nociceptive function and behavior. We have optimized the protocol to assay mechanonociceptive behavior in Drosophila larvae.
Keywords: Nociception Noxious touch Drosophila melanogaster Somatosensory network Mechanosensory
Background
Nociception, the innate ability to detect and avoid noxious stimuli, is highly conserved across the animal kingdom. Drosophila melanogaster larvae are capable to detect and avoid a variety of noxious stimuli including noxious touch, heat and light (Tracey et al., 2003; Hwang et al., 2007; Xiang et al., 2010). Mechanical stimulation above a certain threshold (> 30 mN) elicits a stereotyped rolling escape response at all larval stages (Almeida-Carvalho et al., 2017), which is thought to have evolved to avoid ovipositor injection by parasitic wasps such as L. boulardi (Hwang et al., 2007). This escape response is mediated by activation of nociceptive C4da neurons, which possess sensory dendrites covering the entire body wall allowing the animal to detect noxious cues. C4da neurons express several mechanosensory channels belonging to the DEG/ENaC family (pickpocket [ppk], ppk26/balboa) (Zhong et al., 2010; Gorczyca et al., 2014; Guo et al., 2014; Mauthner et al., 2014), a mechanosensitive TrpA1 isoform (Zhong et al., 2012), piezo (Kim et al., 2012) and the Trp channel painless (Tracey et al., 2003), all of which are required for normal mechanonociceptive responses.
The escape response can be assayed by using a von Frey filament exerting a force between 30-120 mN, which activates mechanosensory channels in C4da neurons (Hwang et al., 2007; Kim et al., 2012). Recent work has also shed light on circuit mechanisms required for mechanonociceptive responses. Mechanically induced escape responses require co-activation of class II da (C2da) and class III da (C3da) sensory neurons, as silencing of either subset impaired rolling behavior (Hu et al., 2017). Moreover, this sensory integration is specific for mechanonociception and in addition requires neuropeptide-mediated feedback. We provide a detailed protocol from our recent work (Hu et al., 2017), which employed a mechanonociception assay based on previously described methods (Hwang et al., 2007; Caldwell and Tracey, 2010; Zhong et al., 2010). We typically use a mechanical force of 45-50 mN, which elicits weak responses after the first stimulus, but enhanced responses after a second subsequent stimulus. This approach allows assaying changes in sensitivity and sensitization of mechanonociceptive responses, which can be coupled with genetic approaches to identify molecular and network components required for normal escape behavior.
Materials and Reagents
Drosophila vials (wide, K-Resin) (Dutscher, catalog number: 789002 )
Flugs® fly plugs, plastic vials (wide) (Dutscher, catalog number: 789035 )
Omniflex monofilament fishing line Shakespeare (6 lb test, diameter 0.23 mm) (Zebco, Tulsa, USA)
Petri dishes (Ø 10 cm) (SARSTEDT, catalog number: 82.1473 )
Fly stocks
Chromsome, Bloomginton stock center No.:
w1118 (X, BL 6326)
w*; ppk-Gal4 (X, 3rd, BL 32079)
w*;UAS-TNTE (X, 3rd, BL 28997)
w*; TrpA11 (X, 2nd , BL 36342)
Agar Kobe I (Carl Roth, catalog number: 5210.4 )
Agar plates (see Recipes)
Fly food (see Recipes)
Agar (strings) (Gewürzmühle Brecht, Eggenstein, catalog number: 00262 )
Corn flour (Davert, Newstartcenter, catalog number: 17080 )
Soy flour (Davert, Newstartcenter, catalog number: 46985 )
Brewer’s yeast (ground) (Gewürzmühle Brecht, Eggenstein, catalog number: 03462 )
Malt syrup (MeisterMarken–Ulmer Spatz, Bingen am Rhein, catalog number: 728985 )
Treacle (molasses) (Grafschafter Krautfabrik, Meckenheim, catalog number: 01939 )
Nipagin (Methyl 4-hydroxybenzoate) (Sigma-Aldrich, catalog number: 54752-1KG-F )
Propionic acid (Carl Roth , catalog number: 6026.3 )
Equipment
Brush (Size 1, Boesner, model: Da Vinci Nova Serie 1570 , catalog number: D15701)
Forceps (Dumont, #3) (Fine Science Tools, catalog number: 11231-30 )
Light source (white light) LED Schott KL 1500 LCD (Pulch und Lorenz, catalog number: 150.200)
Manufacturer: SCHOTT, model: KL 1500 LCD .
SZX7 stereo microscope (Olympus, model: SZX7 )
Software
Origin Pro 9.0 (OriginLab, Northampton, USA) or similar for statistical analysis
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hoyer, N., Petersen, M., Tenedini, F. M. and Soba, P. (2018). Assaying Mechanonociceptive Behavior in Drosophila Larvae. Bio-protocol 8(4): e2736. DOI: 10.21769/BioProtoc.2736.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Sensorimotor response
Neuroscience > Sensory and motor systems > Animal model
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,737 | https://bio-protocol.org/exchange/protocoldetail?id=2737&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assaying Thermo-nociceptive Behavior in Drosophila Larvae
MP Meike Petersen
Federico Tenedini
NH Nina Hoyer
FK Fritz Kutschera
Peter Soba
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2737 Views: 7056
Reviewed by: Jay Z ParrishAdler R. Dillman
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
Thermo-nociception, the detection and behavioral response to noxious temperatures, is a highly conserved action to avoid injury and ensure survival. Basic molecular mechanisms of thermal responses have been elucidated in several model organisms and are of clinical relevance as thermal hypersensitivity (thermos-allodynia) is common in neuropathic pain syndromes. Drosophila larvae show stereotyped escape behavior upon noxious heat stimulation, which can be easily quantified and coupled with molecular genetic approaches. It has been successfully used to elucidate key molecular components and circuits involved in thermo-nociceptive responses. We provide a detailed and updated protocol of this previously described method (Tracey et al., 2003) to apply a defined local heat stimulus to larvae using a fast-regulating hot probe.
Keywords: Drosophila Nociception Temperature Thermo-nociception Sensory neurons Larvae Hot probe assay
Background
Drosophila larvae respond to thermal stimuli above 40 °C with an escape response (Tracey et al., 2003), likely to prevent cell damage and injury. The activation of nociceptive sensory neurons, class IV dendritic arborization (C4da) neurons, is necessary and sufficient for this response (Hwang et al., 2007). Applying a local thermo-nociceptive stimulus using a heated probe (> 40 °C, Figures 1, 5, 6) typically triggers a stereotyped behavior consisting of a 360° rolling motion along the larval body axis and increased speed of locomotion. Previous studies have shown that the transient receptor potential (Trp) channel painless (Tracey et al., 2003) and TrpA1 (Neely et al., 2011; Zhong et al., 2012) are the sensory channels responding to noxious heat in this system, as their expression and function in C4da neurons is required for nociceptive escape response.
Although mechano- and thermos-nociceptive stimulation of larvae result in very similar rolling escape responses (Hwang et al., 2007; Tracey et al., 2003; Zhong et al., 2012), the involved neuronal networks seem to differ. Despite the need to touch the animal with the heated probe, gentle touch-sensitive neurons (C2da and C3da) do not play a role in the behavioral response to noxious temperatures, but are essential for mechano-nociceptive responses (Hu et al., 2017). Activation of C4da neurons with noxious heat elicits in neuronal burst firing (Terada et al., 2016), which might be sufficient to elicit strong downstream network responses to induce escape behavior. Moreover, thermo-sensitive TrpA1 expressing neurons in the CNS respond to temperature gradients and are sufficient to induce rolling behavior (Luo et al., 2017). Thus thermo- and mechano-nociception might employ distinct subsets of the nociceptive network.
Using thermo-nociceptive assays together with genetic approaches in this system has led to the identification of several molecular components (Neely et al., 2010; Honjo et al., 2016), including pathways regulating thermal sensitivity (Babcock et al., 2011; Im et al., 2015). This makes the larval nociceptive system an attractive model to identify key components and circuit mechanisms regulating thermo-nociception.
Here, we provide a detailed protocol to conduct hot probe thermo-nociception assays as used in our recent work (Hu et al., 2017), which is based on the previously developed and described method by Tracey et al. (2003). We built a custom hot probe (Figure 1) with fast control of temperature required for consistent behavioral responses. Similar setups and protocols have also been employed in various other studies with comparable results (Neely et al., 2011; Chattopadhyay et al., 2012; Zhong et al., 2012). Our protocol and setup allow assaying behavioral responses to a locally applied hot stimulus depending on C4da and downstream neuron function (Figure 6).
Materials and Reagents
Petri dishes 10 cm Ø (SARSTEDT, catalog number: 82.1473 )
Fly stocks
Chromosome, Bloomington stock center No.:
w1118 (X, BL 6326)
w*; ppk-Gal4 (X, 3rd, BL 32079)
w*;UAS-TNTE (X, 3rd, BL 28997)
Agar Kobe I (Carl Roth, catalog number: 5210.4 )
Agar plates (see Recipes)
Fly food (see Recipes)
Agar (strings) (Gewürzmühle Brecht, Eggenstein, Germany, catalog number: 00262 )
Corn flour (Davert, Newstartcenter, catalog number: 17080 )
Soy flour (Davert, Newstartcenter, catalog number: 46985 )
Brewer’s yeast (ground) (Gewürzmühle Brecht, Eggenstein, Germany, catalog number: 03462 )
Malt syrup (MeisterMarken – Ulmer Spatz, Bingen am Rhein, Germany, catalog number: 728985 )
Treacle (molasses) (Grafschafter Krautfabrik, Meckenheim, catalog number: 01939 )
Nipagin (Methyl 4-hydroxybenzoate) (Sigma-Aldrich, catalog number: 54752-1KG-F )
Propionic acid (Carl Roth , catalog number: 6026.3 )
Equipment
Brush (Size 1, Boesner, model: Da Vinci Nova Serie 1570 , catalog number: D15701)
Forceps Dumont #3 (Fine Science Tools, catalog number: 11231-30 )
Camera Basler ace acA2040-25gc (Basler, catalog number: 105716 )
Stereoscope ZEISS Stemi-2000C (Pulch und Lorenz, catalog number: 455053-0000-000)
Manufacturer: ZEISS, model: Stemi-2000C .
External light souce LED Schott KL 1500 LCD (Pulch und Lorenz, catalog number: 150.200)
Manufacturer: SCHOTT, model: KL 1500 LCD .
Hot probe, custom made (see below, Figure 1):
Thermometer Greisinger electronic GTH1170 (Conrad, catalog number: 100599-62 )
Electrolube polyurethane (Electrolube, catalog number: UR5634RP250G )
Electronic parts (see supplementary material)
Temperature control device and hot probe design:
In principle, a commercially available and precise temperature-controlled soldering iron as used in several other studies (Neely et al., 2011; Tracey et al., 2003; Zhong et al., 2012) should provide sufficient accuracy to perform this assay. Here, we designed a temperature control device to keep the temperature very precisely at a constant value of 46 °C (Figure 1). One problem is the high temperature loss when the probe dips into the water film on the agar plate, which results in lower and variable temperatures on the larva. To prevent this caveat, the device has to regulate the temperature very fast to keep the previously set values. One such design has been previously developed and employed (Babcock et al., 2009) by using a custom-built temperature controller.
Figure 1. Hot probe setup and design. A-C. Custom built controller for setting the temperature with connected probe. D. The temperature-controlled hot probe consists of a diode (Z-diode or regular diode) with one wire shortened and shaped as a probe tip (facing left). The second wire is connected to the electronic controller and the diode is sealed and insulated with a polyurethane resin to prevent excessive temperature leakage. An external temperature sensor (thermocouple, e.g., Greisinger electronic GTH1170) can be optionally included by soldering the sensor to the probe for external temperature monitoring.
For our hot probe design, our in-house workshop employed a universal diode (1N4001) or alternatively, a Z-diode as a heating element. The diode is heated by a constant and precisely controlled direct current. The forward voltage is independent of the current (which is kept constant), but only depends on the temperature of the barrier layer of the diode. This allows using the occurring voltage for precise measurement and regulation of the barrier layer temperature.
One of the two conducting diode wires functions as the hot probe and should be shaped as follows: The protruding wire is shortened to 4-5 mm and 1.6 by 0.9 mm width, similarly to the previously described size and shape (Tracey et al., 2003). The tip of the hot probe should be spatula shaped and should not have any sharp edges. When the temperature of the tip is below 40 °C, touching the larva should not cause rolling behavior. It should also be as short as possible (4-5 mm) to prevent unnecessary heat loss and large temperature differences between the tip and the diode barrier layer, where the temperature is measured.
Voltage measurement and temperature regulation are achieved using an appropriate electronic system (built in-house and custom programmed) connected to the second diode wire. It displays the current temperature and adjusts the power at the diode tip to maintain the desired constant temperature. The precise circuit and block diagram, electronic parts and custom programming are provided as supplementary material.
Calibration of hot probe diode:
The insulated diode is placed in a 37 °C water reservoir (~1 L bottle with a magnetic stirrer, the temperature measured with a high precision reference thermometer). A very short impulse (2-10 msec only to prevent significant heating of the diode) is used to measure the voltage of the diode barrier layer at 37 °C. The same forward voltage measurement is performed at 55 °C. The forward voltage change between the two calibration points linearly correlates with the temperature and thus allows using the diode voltage for temperature measurement and control within this temperature range.
Software
Video software
Stream Pix6 (Norpix Inc., Montreal, Quebec, ordered from Rauscher GmbH, Germany, art. no. Streampix STP-6-S-STD)
Windows VLC Media Player (www.videolan.org)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Petersen, M., Tenedini, F. M., Hoyer, N., Kutschera, F. and Soba, P. (2018). Assaying Thermo-nociceptive Behavior in Drosophila Larvae. Bio-protocol 8(4): e2737. DOI: 10.21769/BioProtoc.2737.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Sensorimotor response
Neuroscience > Sensory and motor systems > Animal model
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,738 | https://bio-protocol.org/exchange/protocoldetail?id=2738&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transient Gene Expression for the Characteristic Signal Sequences and the Estimation of the Localization of Target Protein in Plant Cell
MB Mikhail Berestovoy
AT Alexander Tyurin
KK Ksenia Kabardaeva
YS Yuriy Sidorchuk
AF Artem Fomenkov
AN Alexander Nosov
Irina Goldenkova-Pavlova
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2738 Views: 8253
Edited by: Arsalan Daudi
Reviewed by: Jian ChenAlexandros Alexandratos
Original Research Article:
The authors used this protocol in Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2013
Abstract
We have proposed and tested a method for characterization of the signal sequences and determinations of target protein localization in a plant cell. This method, called the AgI-PrI, implies extraction of protoplasts from plant tissues after agroinfiltration. The suggested approach combines the advantages of two widely used methods for transient gene expression in plants–agroinfiltration and transfection of isolated protoplasts. The AgI-PrI technic can be applied to other plant species.
Keywords: Agroinfiltration Protoplast isolation Tobacco Transient expression Signal sequences Subcellular localization
Background
To date, the following techniques for transient expression of genes in plants have been developed and widely used: agroinfiltration, biolistics of plant explants and transfection of protoplasts using polyethylene glycol or electroporation. The effectiveness of these approaches has been clearly demonstrated. Each strategy for transient expression of genes in plants, along with benefits, has its limitations and disadvantages, such as the difficulties in the fine imaging of recombinant reporter proteins in plant cell compartments owing to intricate shapes of plant epidermal cells (agroinfiltration), a low efficiency of transformation and the necessity of specialized equipment and auxiliary material (for biolistics), as well as complex preparatory procedures required for a high yield of viable protoplasts and their effective transfection. This is the reason for developing and testing new methods for transient expression of genes in a plant cell, preferably by improving the experimental protocols and preserving the physiological significance of the results of the studies. Since the cellular localization of proteins in living organisms, including plants, is closely interrelated with their functions, a fine visualization of proteins in living cells becomes an important tool for assessing the functions of the proteins.
Materials and Reagents
Pipettes (Corning, Costar®, catalog number: 4101 )
Inoculation loop
Petri dishes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 101IRR )
Syringe without a needle (B. Braun Melsungen, catalog number: 4645103C )
Scalpel
Nylon mesh, pore size, 40 µm (Sterile Cell Strainers, Corning, catalog number: 431750 )
10-ml tubes (Corning, Axygen®, catalog number: SCT-10ML )
Agrobacterium tumefaciens strain GV3101 (Mohamed et al., 2004; strain is available in the collection of the Institute of Plant Physiology and can be provided to researchers for experiments)
Nicotiana benthamiana (Sheludko et al., 2007; seeds are available in the collection of the Institute of Plant Physiology and can be provided to researchers for experiments)
LB medium (MP Biomedicals, catalog number: 113002042 )
Rifampicin (Fisher Scientific, catalog number: BP26791 )
Gentamicin (Thermo Fisher Scientific, GibcoTM, catalog number: 15750060 )
Kanamycin (Thermo Fisher Scientific, GibcoTM, catalog number: 11815024 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Tris-HCl, pH 7.0 (Roche Diagnostics, catalog number: 10812846001 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C1016 )
Acetosyringone (Abcam, catalog number: ab146533 )
MES (Sigma-Aldrich, catalog number: 69892 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Merck, catalog number: 1058860500 )
Calcium chloride dihydrate (CaCl2·2H2O) (AMRESCO, catalog number: 0556-500G )
Ammonium phosphate monobasic (NH4H2PO4) (Sigma-Aldrich, catalog number: A3048 )
Sorbitol (Sigma-Aldrich, catalog number: S1876 )
Potassium hydroxide (KOH) (AppliChem, catalog number: 211514 )
Cellulase Onozuka R10 (Kinki Yakult)
Pectinase Macerozyme R10 (Kinki Yakult)
Driselase (Sigma-Aldrich, catalog number: D9515 )
Calcium nitrate tetrahydrate (Са(NО3)2·4H2O) (Sigma-Aldrich, catalog number: C2786 )
Potassium phosphate monobasic (KH2PO4) (Fisher Scientific, catalog number: P285 )
Magnesium sulfate (MgSO4) (Acros Organics, catalog number: AC413485000 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Ferric chloride (FеСl3) (Sigma-Aldrich, catalog number: 157740 )
MS medium (Sigma-Aldrich, catalog number: M5519 )
Sucrose (MP Biomedicals, catalog number: 04802536 )
Solution 1 (see Recipes)
Solution 2 (see Recipes)
Solution 3 (see Recipes)
Solution 4 (see Recipes)
Solution 5 (see Recipes)
Knop’s solution (see Recipes)
Agroinfiltration buffer (see Recipes)
Equipment
Incubator Shaker (Biosan, model: ES-20 , catalog number: BS-010111-AAA)
Centrifuge (Eppendorf)
Transilluminator (Vilber, model: ETX-F26.M , catalog number: Vilber Lourmat 2131 2600 1)
Microscope Axio Imager Z2 (ZEISS, model: Axio Imager Z2 ) equipped with digital camera (ZEISS, model: AxioCam MRc5 ), filter set No. 38 (38 Endow GFP shift free (EX BP 470 nm/40 nm, BS FT 495 nm, EM BP 525 nm/50 nm), ZEISS, catalog number: 000000-1031-346 ) and module ApoTome (ZEISS, model: ApoTome )
Software
ZEN, AxioVision 4.8 (ZEISS)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Berestovoy, M. A., Tyurin, A. A., Kabardaeva, K. V., Sidorchuk, Y. V., Fomenkov, A. A., Nosov, A. V. and Goldenkova-Pavlova, I. V. (2018). Transient Gene Expression for the Characteristic Signal Sequences and the Estimation of the Localization of Target Protein in Plant Cell. Bio-protocol 8(4): e2738. DOI: 10.21769/BioProtoc.2738.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,739 | https://bio-protocol.org/exchange/protocoldetail?id=2739&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Arabidopsis thaliana Plant Traits Using the PHENOPSIS Phenotyping Platform
WR Wojciech Rymaszewski
MD Myriam Dauzat
AB Alexis Bédiée
GR Gaëlle Rolland
NL Nathalie Luchaire
CG Christine Granier
JH Jacek Hennig
DV Denis Vile
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2739 Views: 8997
Edited by: Tie Liu
Reviewed by: Paweł KrajewskiJason Liang Pin Ng
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
High-throughput phenotyping of plant traits is a powerful tool to further our understanding of plant growth and its underlying physiological, molecular, and genetic determinisms. This protocol describes the methodology of a standard phenotyping experiment in PHENOPSIS automated platform, which was engineered in INRA-LEPSE (https://www6.montpellier.inra.fr/lepse) and custom-made by Optimalog company. The seminal method was published by Granier et al. (2006). The platform is used to explore and test various ecophysiological hypotheses (Tisné et al., 2010; Baerenfaller et al., 2012; Vile et al., 2012; Bac-Molenaar et al., 2015; Rymaszewski et al., 2017). Here, the focus concerns the preparation and management of experiments, as well as measurements of growth-related traits (e.g., projected rosette area, total leaf area and growth rate), water status-related traits (e.g., leaf dry matter content and relative water content), and plant architecture-related traits (e.g., stomatal density and index and lamina/petiole ratio). Briefly, a completely randomized (block) design is set up in the growth chamber. Next, the substrate is prepared, its initial water content is measured and pots are filled. Seeds are sown onto the soil surface and germinated prior to the experiment. After germination, soil watering and image (visible, infra-red, fluorescence) acquisition are planned by the user and performed by the automaton. Destructive measurements may be performed during the experiment. Data extraction from images and estimation of growth-related trait values involves semi-automated procedures and statistical processing.
Keywords: Phenotyping PHENOPSIS Water deficit Arabidopsis thaliana Growth
Background
Phenotyping of plant traits is an important aspect of plant sciences. It can be defined as a set of methodologies used to measure plant traits with certain accuracy and precision at different scales of organization (Fiorani and Schurr, 2013). A renaissance of plant phenotyping was brought by the development of automated phenotyping platforms and the creation of new tools for image analysis (Granier and Vile, 2014). Automated plant phenotyping is useful in many aspects of plant biology, such as ecophysiology (Vile et al., 2012), genetics (Bac-Molenaar et al., 2016), and molecular biology (Baerenfaller et al., 2012). It is then important for the broader readership to understand how these platforms work and what can be achieved. This protocol focuses on one particular installation, namely PHENOPSIS (Granier et al., 2006). PHENOPSIS is a custom-made phenotyping platform (growth chamber, automaton, and computer software), manufactured by Optimalog company and it is especially well-suited for analyses of small plants, such as Arabidopsis thaliana. The platform enables growing up to 504 A. thaliana plants simultaneously. Each plant is grown in a separate pot. Each pot can be automatically weighed and watered to a target value, thus it is feasible to monitor soil water content (SWC) individually and automatically adjust it. This feature of the platform makes it perfect for the application of water deficit treatments. PHENOPSIS automatically takes images of plant rosettes. Images can be of four types: RGB zenithal, RGB lateral, infrared, and fluorescence. In addition, many other non-destructive or destructive measurements are also available with some human involvement, e.g., transpiration, stomatal conductance, phenological stage, individual leaf area, epidermal cell density, extent of endoreduplication, and root weight. Because each of these measurements would require a separate lengthy manual, this protocol focuses on the basic platform operation, as well as measurements of leaf morphology and water status. The video of the platform in action is available online (http://bioweb.supagro.inra.fr/phenopsis/InfoBDD.php).
Materials and Reagents
Double-sided tape (Scotch 12 x 6.3 mm dispensed, permanent, clear)
Single-sided tape (Crystal clear tape Scotch 19 x 33 mm)
Template sheets for leaf scanning
Outer pots (APTE Society, http://www.apte.fr/)
Inner perforated pots (outer pots hand perforated with a Dremel 4000)
Pot labels (Point label, soft plastic 1.3 x 6 cm, BIER: http://www.fournitures-horticoles.com/magasin/catproduits.php?idgdf=9)
Wooden toothpicks
Microscope slide (Knittel Glass 76 x 26 mm, Starfrost)
Pencil
Fine permanent marker (Staedtler permanent, Lumacolor)
Cylindrical containers for soil drying (50 x 50 mm, Servilab, catalog number: 8668770 )
Paper bags for plant tissue drying (7 x 12 cm: http://www.beaumont-group.fr/produit/kraft-blanchi-frictionne-neutre-2/)
Scalpel (Swann-Morton, Carbon Steel Surgical blades)
Pincers (S MurrayTM Stainless Steel Watchmaker Forceps 11 cm, Fisher Scientific)
A. thaliana seeds
Agricultural soil (from Mauguio city, near Montpellier, France: N 43 37′ 01″, E 4 00′ 33″)
Compost (Neuhaus N2)
Clear nail polish (Maybelline New York, express Finish 40)
Ammonium dihydrogen phosphate (H2PO4NH4) (VWR, catalog number: 21305.290 )
Potassium nitrate (KNO3) (VWR, catalog number: 26869.291 )
Fe (E.D.D.H.A) (SEQUESTRENE 138 FE 100 SG)
Nitric acid (HNO3) 52% (VWR, catalog number: 20412.362 )
Boric acid (H3BO3) (Merck, catalog number: 1.00165.0100 )
Manganese(II) sulfate monohydrate (MnSO4·H2O) (VWR, catalog number: 25303.233 )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (Sigma-Aldrich, catalog number: C2857-250G )
Note: This product has been discontinued.
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Avantor Performance Materials, J.T. Baker, catalog number: 4382-01 )
Ammonium molybdate tetrahydrate, (NH4)6Mo7O24∙4H2O (Sigma-Aldrich, catalog number: A7302-100G )
Nutrient solution (see Recipes)
Microelement solution (see Recipes)
Equipment
PHENOPSIS phenotyping platform (Figure 1)
Growth chamber
Robotic arm (custom made by Optimalog: https://www.optimalog.com/phenopsis)
Precision balance (Precisa, model: XB620C )
Watering tubes
RBG camera (Prosilica GC1600 (Allied Vision Technologies, model: PROSILICA GC 1600 ) with Computar Varifocal Megapixel M3Z1228C-MP (CBC, Computar, model: M3Z1228C-MP ), 12-36 mm, monture C zoom lens)
Controlling computer (Dell)
Laptop computer for phenological stage notations (HP ProBook 650 G1 (HP Development, model: HP ProBook 650 G1 ), Intel Core i3-4000M Dual Core, 8 GB 1600 DDR3L 2DM)
Desktop scanner (Epson, model: Epson Perfection 4990 Photo )
Desktop computer for image analyses (HP Compaq Pro 6300 MT PC+ (HP Development, model: HP Compaq Pro 6300 Microtower ) Intel Core i5-3470 3.2 G 6 M HD 2500 CPU, GB DDR3-1600 DIMM (2 x 4 GB) RAM + 250 GB 7200 RPM 3.5 HDD, AMD Radeon HD 7450 DP)
Tablet monitor with a pen (Wacom, model: Cintiq 22HD )
Stereo microscope with camera attachment (Leitz DMRB, Manta G-201B camera)
Green LED lamp (Bulb LED GU10 Spot 1 W = 10 W green)
Figure 1. PHENOPSIS phenotyping platform. A. Overview of the growth chamber; B-C. Robotic arm with RBG camera and watering tube visible; D. Precision balance; E. A screenshot from Optimalog software controlling the platform.
Software
Microsoft Excel
ImageJ v1.51 (https://imagej.nih.gov/ij/) (Schneider et al., 2012)
PHENOPSIS ImageJ macros (http://bioweb.supagro.inra.fr/phenopsis/MacroImageJ.php)
Application for automaton control:
OPTIMA PLC software (https://optimalog.com/index.php?q=optimaplc_presentation)
Camera control: ProsilicaGigE (RGB Camera, Allied Vision); optionally: ThermaCAM Researcher (IR Camera, Flir), ImagingWin (Fluorescence camera, Walz)
Note: All the software is adapted by Optimalog to be used with Phenopsis.
R v3.4.1 (https://www.r-project.org/)
Software for monitoring of environmental conditions:
Campbell Logger Net (https://www.campbellsci.com/loggernet)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Rymaszewski, W., Dauzat, M., Bédiée, A., Rolland, G., Luchaire, N., Granier, C., Hennig, J. and Vile, D. (2018). Measurement of Arabidopsis thaliana Plant Traits Using the PHENOPSIS Phenotyping Platform. Bio-protocol 8(4): e2739. DOI: 10.21769/BioProtoc.2739.
Rymaszewski, W., Vile, D., Bediee, A., Dauzat, M., Luchaire, N., Kamrowska, D., Granier, C. and Hennig, J. (2017). Stress-related gene expression reflects morphophysiological responses to water deficit. Plant Physiol 174(3): 1913-1930.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant physiology > Abiotic stress
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
274 | https://bio-protocol.org/exchange/protocoldetail?id=274&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Promoter Orientation of Prokaryotic Phase-variable Genes by PCR
S Stacey L. Bateman
PS Patrick Seed
Published: Vol 2, Iss 20, Oct 20, 2012
DOI: 10.21769/BioProtoc.274 Views: 9927
Original Research Article:
The authors used this protocol in Mar 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2012
Abstract
One major mechanism of phase variable gene expression in prokaryotes is through inversion of the promoter element for a gene or operon. This protocol describes how to detect the promoter orientation of a phase-variable gene by PCR. This protocol, including primer design, is specific to detection of the promoter orientations of hyxR, a LuxR-like response regulator in Extraintestinal Pathogenic Escherichia coli (ExPEC) isolates (Bateman and Seed, 2012); however, this protocol can be generalized to other organisms and genes to discriminate prokaryotic promoter inversions by PCR through size discrimination of the amplification products. Expression of hyxR is regulated through bidirectional phase inversion of the upstream promoter region mediated by a member of the family of site-specific tyrosine recombinases called Fim-like recombinases. The recombinases recognize inverted DNA repeat sequences flanking the promoter and produce a genomic rearrangement, orientating the promoter in favor or disfavor of gene expression.
Materials and Reagents
Escherichia coli (E. coli) isolate UTI893
Sterile distilled, deionized water (diH2O)
Agarose, molecular biology grade, standard sieve
Ethidium Bromide, 1 mg/ml in distilled, deionized water (diH2O) (or other agent to visualize DNA)
Taq polymerase (1 U/μl) with 10x NH4 buffer (APEX Bioresearch Products, catalog number: 42-409 )
10 mM dNTP mix, PCR grade (Life Technologies, catalog number: 18427-013 )
Tryptone
Yeast extract
NaCl
Tris base
Boric acid
EDTA (pH 8.0)
SDS
Glycerol
Xylene cyanol
Bromophenol blue
hyxR phase-specific primers, 100 μM stock solution [Integrated DNA Technologies (IDT)]
5’ – ACTGATAATAACCAGAGGCTTCTT – 3’
5’ – CAGTGATTAACTTTCGAACATATTG – 3’
5’ – GCGAAAGTTAATCACTGGTATGACC – 3’
Tris-Borate-EDTA (TBE) (10x stock) (see Recipes)
10x DNA Loading Dye (see Recipes)
Luria-Bertani broth (LB) culture medium (Sigma-Aldrich, catalog number: L3022-250G (see Recipes)
2% TBE agarose gel with EtBr (see Recipes)
20 ml 10x DNA Loading dye6 (xylene cyanol/bromophenol blue) (see Recipes)
Equipment
37 °C Incubator for bacteria with aeration
Thermal cycler (Bio-Rad Laboratories)
Gel electrophoresis system (Owl Separation Systems)
UV Transilluminator with photo documentation (Bio-Rad Laboratories)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bateman, S. L. and Seed, P. (2012). Promoter Orientation of Prokaryotic Phase-variable Genes by PCR. Bio-protocol 2(20): e274. DOI: 10.21769/BioProtoc.274.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,740 | https://bio-protocol.org/exchange/protocoldetail?id=2740&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Plate Assay to Determine Caenorhabditis elegans Response to Water Soluble and Volatile Chemicals
TM Takashi Murayama
Ichiro N. Maruyama
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2740 Views: 8281
Reviewed by: Gert JansenYan Wang
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
The nematode Caenorhabditis elegans is widely used for behavioral studies ranging from simple chemosensation to associative learning and memory. It is vital for such studies to determine optimal concentrations of attractive and aversive chemicals that C. elegans can sense. Here we describe a resource localization assay in which a chemical compound of interest is placed in two compartments of a quadrant plate in order to determine optimal concentrations of the chemical in behavioral studies. Using the assay, we determined the optimal concentration of a water-soluble attractant, KCl, as an unconditioned stimulus for the study of associative learning and memory. In this protocol, we also describe a chemotaxis assay using a square agar plate spotted with an aversive olfactory cue, 1-nonanol, as a conditioned stimulus.
Keywords: Attractant Aversive stimulus Chemosensory behavior Learning and memory Plate assay
Background
The nematode Caenorhabditis elegans has extensively been used as a model organism for the study of animal behaviors. C. elegans senses a variety of water-soluble and volatile chemicals that are mainly mediated by amphids, the largest chemosensory organs (Ward, 1973; Dusenbery, 1974; Bargmann and Horvitz, 1991; Bargmann et al., 1993). It is essential for the behavioral study to determine precise concentrations of chemicals that can be sensed by C. elegans. To determine optimal concentrations of water-soluble attractants for C. elegans, Wicks et al. (2000) used a quadrant agar plate for the behavioral assay in which a chemical of interest was mixed with agar in two compartments and this assay has widely been used for many chemicals (e.g., Jansen et al., 2002; Ortiz et al., 2009; Murayama and Maruyama, 2013; Sassa et al., 2013). Chemotaxis assay has also been used to measure the sensitivity of C. elegans to volatile compounds spotted on an agar plate (Bargmann et al., 1993; Troemel et al., 1997). C. elegans is also an excellent model organism for the study of associative learning and memory, in which water-soluble chemicals and volatile chemicals were used as an unconditioned stimulus (US) and a conditioned stimulus (CS) (Amano and Maruyama, 2011; Nishijima and Maruyama, 2017). For effective conditioning of worms, concentrations of CS and US are crucial parameters. The resource localization assay with quadrant agar plates and a chemotaxis assay on square agar plates were successfully used to define optimal concentrations of US and CS for the study of learning and memory. Therefore, these assays could be applied for many other attractive and repulsive chemicals in C. elegans behavioral analysis.
Materials and Reagents
Latex gloves
1.5 ml plastic tubes, sterile (Eppendorf, catalog number: 0030123328 )
1.0 ml pipette tips, sterile (Thermo Fisher Scientific, Thermo Scientific, catalog number: H-111-R100NS-Q )
0.2 ml pipette tips, sterile (Quality Scientific Plastics, Thermo Fisher Scientific, Thermo Scientific, catalog number: TTW110RS-Q )
10 ml Serological pipettes, sterile (As One, catalog number: 2-5237-04 )
50 ml Serological pipettes, sterile (As One, catalog number: 2-5237-06 )
Bottle top 0.2-µm filter units, sterile (Thermo Fisher Scientific, Thermo Scientific, catalog number: 566-0020 )
Combitips advanced 50 ml, sterile (Eppendorf, catalog number: 0030089480 )
Petri dishes, sterile (Kord-Valmark, catalog number: 2901 )
Quadrant Petri dishes, sterile (Kord-Valmark, catalog number: 2913 )
Square Petri dishes with grids, sterile (Simport, catalog number: D210-16 )
Wild-type C. elegans strain N2 (available at Caenorhabditis Genetics Center [CGC], https://cbs.umn.edu/cgc/home)
E. coli OP50 (available at Caenorhabditis Genetics Center [CGC], https://cbs.umn.edu/cgc/home)
1-Nonanol (Sigma-Aldrich, catalog number: 131210-100ML )
Ethanol (99.5%) (Wako Pure Chemical Industries, catalog number: 057-00451 )
Chloroform (Nacalai Tesque, catalog number: 08401-65 )
LB medium capsules (MP Biomedical, catalog number: 3002-021 )
Sodium chloride (NaCl) (Nacalai Tesque, catalog number: 31320-05 )
Bacto agar (BD, catalog number: 214010 )
Bacto peptone (BD, catalog number: 211677 )
Potassium dihydrogen phosphate (KH2PO4) (Nacalai Tesque, catalog number: 28721-55 )
Di-potassium hydrogen phosphate (K2HPO4) (Nacalai Tesque, catalog number: 28726-05 )
HEPES (Nacalai Tesque, catalog number: 17514-15 )
Sodium hydroxide (NaOH) (Wako Pure Chemical Industries, catalog number: 198-13765 )
Calcium chloride dihydrate (CaCl2·2H2O) (Nacalai Tesque, catalog number: 06730-15 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Nacalai Tesque, catalog number: 21003-75 )
Potassium chloride (KCl) (Nacalai Tesque, catalog number: 28514-75 )
D-sorbitol (Sigma-Aldrich, catalog number: S1876-1KG )
Gelatin (Wako Pure Chemical Industries, catalog number: 073-06295 )
Cholesterol (Wako Pure Chemical Industries, catalog number: 034-03002 )
LB broth (see Recipe 1)
NGM plates (see Recipe 2)
1.0 M potassium phosphate (pH 6.0) (see Recipe 3)
1.0 M HEPES-NaOH (pH 7.2) (see Recipe 4)
1.0 M CaCl2 (see Recipe 5)
1.0 M MgSO4 (see Recipe 6)
Agar for resource localization assay plates (see Recipe 7)
2.0% Molten agar (see Recipe 8)
0.25% Aqueous gelatin solution (see Recipe 9)
5.0 mg/ml cholesterol (see Recipe 10)
Chemotaxis assay plates (see Recipe 11)
Doubly deionized water (ddH2O; see Recipe 12)
Equipment
Safety goggles
A laboratory coat
Worm pick
Dental burner (Phoenix-Dent, model: APT-3 )
Bunsen burner (EISCO)
Incubator (SANYO, model: MIR-553 )
Heating magnetic stirrer (Thermo Fisher Scientific, Thermo Scientific, model: SP131324 )
Magnetic stirrer bar
1.0 L beaker
Pipet-Aid® XP (Drummond Scientific, model: Pipet-Aid® XP, catalog number: 4-000-101 )
Multipette M4 (Eppendorf, catalog number: 4982000012 )
P20 pipetman (Gilson, catalog number: F123600 )
P100 pipetman (Gilson, catalog number: F123615 )
P1000 pipetman (Gilson, catalog number: F123602 )
Kimwipes S-200 (Nippon Paper Crecia, catalog number: 62011 )
Osmometer (Gonotec, model: Osmomat 030-D )
Autoclave (Tomy Digital Biology, model: SX-300 )
Aspirator
Stereomicroscope (Olympus, model: SZX16 )
Water purification system (Merck, model: Elix® Essential 10 UV )
Water purification system (Merck, model: Milli-Q® Synthesis A10® )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Murayama, T. and Maruyama, I. N. (2018). Plate Assay to Determine Caenorhabditis elegans Response to Water Soluble and Volatile Chemicals. Bio-protocol 8(4): e2740. DOI: 10.21769/BioProtoc.2740.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Chemotaxis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,741 | https://bio-protocol.org/exchange/protocoldetail?id=2741&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Bacterial Attachment to Tissue Sections
BI Batya Isaacson
TH Tehila Hadad
GB Gilad Bachrach
Ofer Mandelboim
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2741 Views: 7401
Edited by: Andrea Puhar
Reviewed by: Sofiane El-Kirat-ChatelMigla Miskinyte
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
Here we describe a method to test bacterial adhesion to paraffin embedded tissue sections. This method allows examining binding of different bacterial strains, transfected with a fluorescent protein reporter plasmid to various tissues, to better understand different mechanisms such as colonization. This assay provides a more physiological context to bacterial binding, than would have been achieved using adhesion assays to cell lines. The sections can be imaged using fluorescent microscopy and adhesion of various bacterial strains can be quantified and tested, simultaneously.
Keywords: Host-pathogen interactions Bacterial attachment Bacterial colonization
Background
Many types of bacteria, both commensal and pathogenic, express various adhesion molecules, allowing them binding to different surfaces of the host (Gur et al., 2015; Abed et al., 2016; Isaacson et al., 2017). This adhesion is crucial, as it is the first step of colonization and plays a role in both competition and survival, in different environments (Schilling et al., 2001). Many of these adhesins are lectins, binding sugar moieties on glycoproteins on various kinds of cells, such as epithelial cells and others (Abed et al., 2016; Isaacson et al., 2016). Over the years, many groups studying host-pathogen interactions used cell lines and tissue culture in order to try to understand bacterial adhesion to cells. Tissue sections give a more physiological context to the colonization study, as they provide organization and structures that are almost impossible to obtain using in vitro tissue culture. Furthermore, in immortalized or cancerous cells, the expression pattern of surface molecules, to which bacteria can bind, might be altered. In order to better understand physiological context of bacterial adherence, in both normal and pathological conditions, we chose to employ bacterial attachment to tissue sections.
Materials and Reagents
Plastic 50 ml tubes for centrifugation (Greiner Bio One International, catalog number: 227270 )
1.5 ml tubes for transformation
Petri dishes for bacteria (FL MEDICAL, catalog number: 29052 )
Inoculation loop, 10 μl (Greiner Bio One International, catalog number: 731171 )
Ice box with ice
Slide jars for washing
Superfrost Plus glass slides (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: J1800AMNT )
Coverslip (Bar Naor, catalog number: BNBB024050A1 )
Pipette tips (20-200 μl, 100-1,000 μl)
Escherichia coli strain of interest (for example CFT073)
Plasmids for fluorescent protein reporter expression (see references for examples)
Calcium chloride (Sigma-Aldrich, catalog number: C5670 )
Glycerol anhydrous (Avantor Performance Materials, J.T. Baker, catalog number: 2136 )
Phospho-buffered saline (PBS 10x) (HyLabs, catalog number: BP-507/1Ld )
Paraformaldehyde (PFA) (Bar Naor, catalog number: BN15711 )
Xylene (Sigma-Aldrich, catalog number: 534056 )
Ethanol (Sigma-Aldrich, catalog number: E7023 )
ProLongTM Glass Antifade Mountant (Thermo Fisher Scientific, InvitrogenTM, catalog number: P36980 )
Hoechst 33258 (Sigma-Aldrich, catalog number: 94403 )
Dehydrated culture media, LB Broth (BD, DifcoTM, catalog number: 244620 )
Agar purified for microbiology (Sigma-Aldrich, catalog number: 05038 )
Erythromycin (Sigma-Aldrich, catalog number: E6376 )
Ampicillin (Bio Basic, catalog number: AB0028 )
Tris (Avantor Performance Materials, J.T. Baker, catalog number: 4109-1 )
Sodium chloride (Avantor Performance Materials, J.T. Baker, catalog number: 3624-19 )
Polyoxyethylene 20 sorbitan monolaurate (Tween 20) (Sigma-Aldrich, catalog number: 93774 )
Bovine serum albumin (BSA) (VWR, Ameresco, catalog number: 97061-420 )
Fetal bovine serum (FBS) (Biological Industries, catalog number: 04-0071A )
Triton X-100 (Avantor Performance Materials, J.T. Baker, catalog number: X198-07 )
LB medium (see Recipes)
LB agar plates with antibiotics (see Recipes)
TBSS solution (10x) (see Recipes)
Blocking solution (see Recipes)
Equipment
Pipettes
Autoclave
Spectrophotometer (600 nm wavelength)
Shaker
Micro centrifuge
Incubator
Thermoblock
Chemical hood
Fluorescence microscope (TL-Nikon)
Software
ImagePro Analyzer 7.0 software
Software for statistical analysis (GraphPad Prism software version 6.0 or later, for example)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Isaacson, B., Hadad, T., Bachrach, G. and Mandelboim, O. (2018). Quantification of Bacterial Attachment to Tissue Sections. Bio-protocol 8(5): e2741. DOI: 10.21769/BioProtoc.2741.
Download Citation in RIS Format
Category
Immunology > Host defense > Murine
Microbiology > Microbe-host interactions > Ex vivo model
Cell Biology > Tissue analysis > Tissue imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,742 | https://bio-protocol.org/exchange/protocoldetail?id=2742&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Flight and Climbing Assay for Assessing Motor Functions in Drosophila
SM Steffy B Manjila
GH Gaiti Hasan
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2742 Views: 11169
Reviewed by: Serge Birman
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
Motor control requires the central nervous system to integrate different sensory inputs and convey this information to the relevant central pattern generator for execution of motor function through motor neurons and muscles. Proper motor control is essential for any mobile organism to survive and interact with the external environment. For flying insects, motor control is required for flying, walking, feeding and mating apart from other more advanced behaviours such as grooming and aggression. Any perturbation to the sensory input or malfunctioning of neural connections to the motor output can result in motor defects. Here, we describe simple protocols for assessing flight and climbing ability of fruit flies, which can be used as two general tests to assess their motor function.
Keywords: Tethers Air-puff Cold anaesthesia Cylinder
Background
Coordinated motor functions are important for every mobile organism for survival as the major needs of finding food, shelter, mates and escaping from predators involve motor activity. Here we describe protocols to assess the flight and climbing ability of both individual and groups of Drosophila melanogaster. Both these protocols have been used extensively in earlier studies (Agrawal and Hasan, 2015; Pathak et al., 2015; Richhariya et al., 2017).
Part I: Flight protocol
Materials and Reagents
Plastic tray of approximately 22 x 18 x 5 cm
Petri dish of ~9 cm diameter (Fisher Scientific, catalog number: 12033333; Manufacturer: Pyrex, catalog number: 1480/08D ) with its outer side covered with Whatman filter paper (GE Healthcare, catalog number: 1001-918 ) (Figure 1A)
Tethers made of stainless steel rod (diameter 0.2 cm) attached to stainless steel wire (diameter 0.01 cm) (Figure1B)
Polystyrene foam of approximately 10 x 6 x 5 cm
One glass slide (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3011-002 )
Round synthetic hair brush, size 4 (Camlin, series 66, size 4)
Fly strains to be tested of either sex, aged 3-4 days
Ice
Transparent nail polish
Equipment
Wide field microscope (Olympus, model: SZX9 )
Timer/stop watch (Fisher Scientific, catalog number: S02272 )
Empty glass vials for cold anaesthesia
Behaviour room with controlled temperature (~25 °C) and humidity (~60%)
JVC colour video camera–ModelTK-C1481BEG (JVCKENWOOD, model: TK-C1481BEG )
Software
Origin 8.0 software (MicroCal, Origin Lab, Northampton, MA, USA)
Streampix digital video recording software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Manjila, S. B. and Hasan, G. (2018). Flight and Climbing Assay for Assessing Motor Functions in Drosophila. Bio-protocol 8(5): e2742. DOI: 10.21769/BioProtoc.2742.
Pathak, T., Agrawal, T., Richhariya, S., Sadaf, S. and Hasan, G. (2015). Store-operated Calcium entry through orai is required for transcriptional maturation of the flight circuit in Drosophila. J Neurosci 35(40): 13784-13799.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,743 | https://bio-protocol.org/exchange/protocoldetail?id=2743&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Murine Pancreatic Islets Transplantation under the Kidney Capsule
TJ Tatiana Jofra
GG Giuseppe Galvani
FG Fousteri Georgia
GS Gregori Silvia
NG Nicola Gagliani
Manuela Battaglia
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2743 Views: 9846
Edited by: Ruth A. Franklin
Reviewed by: Sylvaine YouSara Johnson
Original Research Article:
The authors used this protocol in Feb 2006
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2006
Abstract
Type 1 diabetes (T1D) is an autoimmune disease caused by the lack of insulin-producing pancreatic beta cells leading to systemic hyperglycemia. Pancreatic islet transplantation is a valid therapeutic approach to restore insulin loss and to promote adequate glycemic control. Pancreatic islet transplantation in mice is an optimal preclinical model to identify new therapeutic strategies aiming at preventing rejection and optimizing post-transplant immuno-suppressive/-tolerogenic therapies.
Islet transplantation in preclinical animal models can be performed in different sites such the kidney capsule, spleen, bone marrow and pancreas. This protocol describes murine islet transplantation under the kidney capsule. This is a widely accepted procedure for research purposes. Stress caused in the animals is minimal and it leads to reliable and reproducible results.
Keywords: Type 1 diabetes Pancreatic islets Islet transplantation Murine model
Background
Many alternative sites for islet implantation have been reported so far in small animal models and the ideal site must be selected according to the technical advantages of the procedure to be used and for the purpose of the experiments. Bearing in mind that the kidney capsule is an extravascular site and it is not immunoprotected, pancreatic islet transplantation under the kidney capsule remains a surgical procedure with low mortality rates leading to hyperglycemia reversion within a few days. In addition, transplantation under the kidney capsule allows histological studies and formal demonstration of islet function (Cantarelli and Piemonti, 2011; Elisa Cantarelli et al., 2013).
Materials and Reagents
Cotton applicators, sterile (CARLO ERBA Reagents, catalog number: 9.413 161 )
30 G x ½ in. needle (BD, catalog number: 305106 )
2 ml slip tip syringe (BD, catalog number: 302204 )
BD INTRAMEDICTM PE 50 (BD, catalog number: B427411 )
Petri dish, Falcon® 50 x 9 mm Sterile (Corning, Falcon®, catalog number: 351006 )
P200 pipette tip (SARSTEDT, catalog number: 70.760.002 )
Eppendorf tubes volume 1.5 ml (Sigma-Aldrich, catalog number: T9661-1000EA)
Manufacturer: Eppendorf, catalog number: 022363204 .
Silicone tubing adapter (2Biological Instruments, catalog number: SFM3-1550 )
1 ml syringe with 25 G needle (Ettore Pasquali, catalog number: 11.3500.05 )
Suture Dermalon 5/0 19 MM (Covidien, catalog number: 1756-21 )
Collagenase P (Roche Diagnostics, catalog number: 11213865001 )
Betadine (MEDA PHARMA SpA, Farmacie Coli, catalog number: 023907076 )
Avertin (Sigma-Aldrich, catalog number: T48402 )
Sodium chloride ((NaCl) (CARLO ERBA Reagents, catalog number: FC72101100000 )
Ketoprofen (PFIZER ITALIA Srl DIV.VET)
RPMI 1640 medium (Lonza, catalog number: 12-167F )
L-glutamine (Lonza, catalog number: 17-605E )
HEPES buffer (Lonza, catalog number: 17-737E )
Pen-Strep (Lonza, catalog number: 17-602E )
Fetal bovine serum (Euroclone, catalog number: ECS0180L )
Hank’s balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14175079 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
Histopaque®-1077 (Sigma-Aldrich, catalog number: H8889 )
RPMI/glutamine/HEPES/Pen-Strep/FBS (see Recipes)
HBSS/Ca/HEPES (see Recipes)
Equipment
Forceps (Graefe forceps, 100 mm, curved (ProSciTech, catalog number: T131C ), Tweezers, style 3 (ProSciTech, catalog number: T03-212 )
Scissor (ProSciTech, catalog number: TS103-200SB )
Surgical Shaver (2Biological Instruments, catalog number: 2BTOSRC )
Cautery (Global medical solutions, catalog number: BAA00 )
Thermostatic bath (Thermo Fisher Scientific, Thermo ScientificTM, model: TSGP02 )
Inverted microscope (Compact, Modular Stereo, Leica, model: Leica M60 )
Incubator at 37 °C with 5% CO2, relative humidity ambient to 80% [e.g., Series II 3110 Water-Jacketed CO2 incubators (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM II 3110 Series )]
Pipetman P20/P200/P1000 (Gilson)
Microsyringe 25 μl Hamilton syringe (Hamilton, catalog number: 80401 )
Heating pad 25 x 40 cm, Two Temperature Range (2Biological Instruments, LCPH)
Herasafe KS, Class II biological safety cabinet with UV surface disinfection irradiator (Thermo Fisher Scientific, Thermo ScientificTM, model: HerasafeTM KS II , catalog number: 51022481)
Software
Prism software (GraphPad, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jofra, T., Galvani, G., Georgia, F., Silvia, G., Gagliani, N. and Battaglia, M. (2018). Murine Pancreatic Islets Transplantation under the Kidney Capsule. Bio-protocol 8(5): e2743. DOI: 10.21769/BioProtoc.2743.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Cell Biology > Cell Transplantation > Allogenic Transplantation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,744 | https://bio-protocol.org/exchange/protocoldetail?id=2744&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Barnes Maze Procedure for Spatial Learning and Memory in Mice
MP Matthew W. Pitts
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2744 Views: 16645
Edited by: Oneil G. Bhalala
Reviewed by: Emma PuighermanalArnau Busquets-Garcia
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
The Barnes maze is a dry-land based rodent behavioral paradigm for assessing spatial learning and memory that was originally developed by its namesake, Carol Barnes. It represents a well-established alternative to the more popular Morris Water maze and offers the advantage of being free from the potentially confounding influence of swimming behavior. Herein, the Barnes maze experimental setup and corresponding procedures for testing and analysis in mice are described in detail.
Keywords: Spatial memory Mouse Hippocampus Cognition Behavior
Background
The Barnes maze is a dry-land based behavioral test that was originally developed by Carol Barnes to study spatial memory in rats (Barnes, 1979) and later adapted for use in mice (Bach et al., 1995). Conceptually, it is similar to the Morris water maze (MWM) (Morris, 1984), in that it is a hippocampal-dependent task where animals learn the relationship between distal cues in the surrounding environment and a fixed escape location. For mice, the typical Barnes maze setup consists of an elevated circular platform with 40 evenly-spaced holes around the perimeter. An escape tunnel is mounted underneath one hole while the remaining 39 holes are left empty. Both bright light and open spaces are aversive to rodents, thus serve as motivating factors to induce escape behavior. The escape tunnel is maintained at a fixed location for the duration of training, which involves multiple daily trials spread over several days. During the course of training, rodents typically utilize a sequence of three different search strategies (random, serial, spatial) to learn the location of the escape tunnel. Following sufficient acquisition training, the escape tunnel is removed and a probe trial is administered to assess spatial reference memory.
Although the MWM is the dominant model for assessing spatial learning in rodents, the Barnes maze offers several important advantages worth noting. First and foremost, the Barnes maze does not involve swimming and the potential confounding factors associated with it. Swimming is stressful, as detailed in studies documenting that MWM training increases plasma corticosterone levels to a greater extent than that of the Barnes maze (Harrison et al., 2009). In addition, the swim conditions utilized in most MWM protocols elicit reductions in core body temperature that can affect performance (Iivonen et al., 2003). Moreover, rodents often take to floating, which is thought to represent a state of behavioral despair and is considered an index of ‘depressive-like’ behavior in the widely utilized Porsolt forced swim test (Porsolt et al., 1977). Finally, as noted above, the Barnes maze allows clear delineation of the three possible search strategies used by the mouse during performance of each trial.
Materials and Reagents
Tissue paper (Georgia-Pacific Consumer Products, catalog number: 48100 )
70% ethanol in a spray bottle
C57BL/6J adult male mice (Purchased from Jackson Labs, 3-5 months of age)
Equipment
Well-lit (~1,000 lux) testing room with a holding room located nearby (Figure 1A)
Barnes maze apparatus (TSE Systems, catalog number: 302050-BM/M ), includes:
Circular PVC platform* (diameter = 122 cm; thickness = 1 cm) containing 40 equally spaced holes (diameter = 5 cm) (Figure 1B)
Gray PVC start chamber* consisting of a base plate and a cover (Figure 1C)
PVC escape tunnel* that can be mounted under any of the 40 escape holes (Figure 1D)
Aluminum support frame* (height = 80 cm) for circular PVC platform (Figure 1E)
Overhead camera (Panasonic, catalog number: WV-BP332 , Figure 1F)
Three distal visual cues (length/width ~30 cm) surrounding the platform (Figure 1G)
Loudspeaker for 90 dB white noise (Sony, catalog number: SS-MB150H )
Windows-based PC computer (Dell, model: OptiPlex 780 ) connected to the camera
Tally counter
Figure 1. Barnes maze experimental setup. A. Layout of behavioral testing room and adjacent room used for analysis. B-F. Images of the Barnes maze platform (B), start chamber (C), escape tunnel (D), aluminum support frame (E), overhead camera (F), a single visual cue (G).
Software
TSE VideoMot2 video tracking software (TSE Systems)
GraphPad Prism version 5.0 (GraphPad Software)
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Pitts, M. W. (2018). Barnes Maze Procedure for Spatial Learning and Memory in Mice. Bio-protocol 8(5): e2744. DOI: 10.21769/BioProtoc.2744.
Pitts, M. W., Kremer, P. M., Hashimoto, A. C., Torres, D. J., Byrns, C. N., Williams, C. S. and Berry, M. J. (2015). Competition between the brain and testes under selenium-compromised conditions: Insight into sex differences in Selenium metabolism and risk of neurodevelopmental disease. J Neurosci 35(46):15326-38.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,745 | https://bio-protocol.org/exchange/protocoldetail?id=2745&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Large Scale Field Inoculation and Scoring of Maize Southern Leaf Blight and Other Maize Foliar Fungal Diseases
Shannon M. Sermons
PB Peter J. Balint-Kurti
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2745 Views: 8057
Edited by: Zhibing Lai
Reviewed by: Guan-Feng Wang
Original Research Article:
The authors used this protocol in Feb 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2011
Abstract
Field-grown maize is inoculated with Cochliobolus heterostrophus, causal agent of southern leaf blight disease, by dropping sorghum grains infested with the fungus into the whorl of each maize plant at an early stage of growth. The initial lesions produce secondary inoculum that is dispersed by wind and rain, causing multiple cycles of infection that assures a high uniform disease pressure over the entire field by the time of disease scoring, which occurs after anthesis. This method, with slight modifications, can also be used to study the maize fungal diseases northern leaf blight (caused by Exserohilum turcicum) and gray leaf spot (Cercospora zeae-maydis).
Keywords: Maize Cochliobolus heterostrophus Inoculation Fungal disease
Background
Southern leaf blight (SLB), caused by Cochliobolus heterostrophus (Drechs.) Drechs. [anamorph = Bipolaris maydis (Nisikado) Shoemaker], is a widespread maize disease which causes significant yield losses in hot, humid tropical and sub-tropical regions, such as the southeastern USA, parts of India, Africa, Latin America and Southern Europe. In 1970-71 an SLB epidemic caused by C. heterostrophus race T infecting hybrids carrying Texas male-sterile cytoplasm (cms-T) caused an estimated 15% loss in total maize production in the US (Ullstrup, 1972). After the 1970 epidemic, cms-T maize was replaced by race T-resistant, normal cytoplasm maize.
Currently, race O is the predominant cause of SLB in the US and worldwide (Wang et al., 2017). SLB resistance to C. heterostrophus race O is quantitatively inherited with primarily additive or partially dominant gene action (Holley and Goodman, 1989). Under experimental conditions, yield losses due to infection with C. heterostrophus race O as high as 46% have been observed (Fisher et al., 1976; Byrnes and Pataky, 1989). However, losses in commercial production are generally much less severe (Mueller et al., 2016).
This approach to inoculation and rating is based on methodology developed by Carson et al. (2004), though similar methods had been used in numerous previous studies (e.g., Fisher et al., 1976). We have used it in a number of studies to screen germplasm for SLB resistance and to elucidate its genetic basis (Balint-Kurti et al., 2006; 2007 and 2008b; Zwonitzer et al., 2009 and 2010; Kump et al., 2011; Negeri et al., 2011; Belcher et al., 2012; Santa-Cruz et al., 2014; Yang et al., 2017). We have also used an essentially identical method to assess resistance to two other foliar fungal diseases; Gray leaf spot caused by Cercospora zeae-maydis (e.g., Balint-Kurti et al., 2008a) and northern leaf blight (NLB) caused by Exserohilum turcicum (e.g., Balint-Kurti et al., 2010; Chung et al., 2010; Zwonitzer et al., 2010). This method has provided reliable data with high correlations between replications and environments.
Materials and Reagents
Petri dishes, 100 x 15 mm (Genesee Scientific, catalog number: 32-107G )
Micro-spatula (VWR, catalog number: 82027-518 )
Parafilm M (Bemis, catalog number: PM999 )
50-ml conical tubes (Corning, Falcon®, catalog number: 352070 )
15-ml sterile tube
Garbage bag large enough to line cooler
Newspapers
Gloves
Identi-plug foam plugs (Jaece Industries, catalog number: L800-E )
Aluminum foil
Small metal beads (Ballistic Products, #4 shot SHZ04 or similar)
Isolates of Cochliobolus heterostrophus frozen in 50% glycerol
Sorghum grain (wheat or barley may also be used)
Note: The sorghum should not be treated with any chemicals or fungicides. Sorghum intended for birdseed, also called milo, is ideal.
Difco Potato Dextrose Agar (PDA) media (BD, DifcoTM, catalog number: 213400 )
A small quantity of 70% ethanol in a glass container with a lid
Tween-20
V8 juice
Agar
CaCO3
V8-agar medium (see Recipes)
Equipment
Laminar flow workbench (NuAire, model: AireGardTM ES NU-301 , catalog number: 301-630)
Incubator (Percival Scientific, model: I-35LL )
Tongs or large tweezers
Scalpel (EISCO, catalog number: BIO182A )
1 L Erlenmeyer flasks (Corning, PYREX®, catalog number: 5100-1L )
Autoclave
Alcohol lamp (such as C&A Scientific, catalog number: 97-5313 ) filled with ethanol
Plastic buckets
Ventilated trays (Buckhorn, catalog number: BT28220522 )
Oscillating fan (Air King, catalog number: 9119 )
Cooler
Pails
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sermons, S. M. and Balint-Kurti, P. J. (2018). Large Scale Field Inoculation and Scoring of Maize Southern Leaf Blight and Other Maize Foliar Fungal Diseases. Bio-protocol 8(5): e2745. DOI: 10.21769/BioProtoc.2745.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,746 | https://bio-protocol.org/exchange/protocoldetail?id=2746&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Histone Deubiquitination Assay in Nicotiana benthamiana
Shujing Liu
Lars Hennig
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2746 Views: 5499
Reviewed by: Tohir Bozorov
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Histone modifications are a group of post-translational modifications on histones which can alter chromatin structure and affect gene expression. Histone ubiquitination is a histone modification found in particular on histone H2A and H2B. Histone ubiquitination can be reversed by ubiquitin-specific proteases (UBP). Here, we describe an in vivo assay for histone deubiquitination activity. After infiltrating UBP12 into Nicotiana benthamiana leaves, H2Aub was visualized by immunocytochemistry. Nicotiana benthamiana leaves, which show high agro infiltration efficiency, were used for transient UBP12 expression for a labor- and time-saving protocol. Reduced H2Aub levels indicated histone deubiquitination activity of UBP12. The clear visualization of nuclei of N. benthamiana leaves makes this method able to easily measure the level of histone modification in vivo by using specific antibodies, providing robust clues of protein function. Thus, this protocol is a powerful complementation to in vitro assays of histone deubiquitination activity.
Keywords: Histone deubiquitination Immunocytochemistry H2Aub in vivo
Background
Histone modifications play important roles in regulating chromatin structure and gene expression. Best studied histone modifications include methylation, acetylation, phosphorylation, ubiquitination and sumoylation. However, enzymes introducing or removing specific histone modifications are not always known. Powerful in vitro assays can establish the catalytic potential of histone modifying enzymes but in vivo methods are desirable to confirm that in vitro specificity reflects in vivo activity. Here, we describe a flexible protocol to test activity of histone modifying enzymes in the plant N. benthamiana. Although we used the protocol to test activity of ubiquitin specific protease (UBP) on ubiquitylated H2A, it can also easily be adopted to other histone modifications for which specific antibodies are available.
Materials and Reagents
50 ml and 15 ml screw cap tubes (SARSTEDT, catalog numbers: 62.547.254 and 62.554.002 )
2 ml and 1.5 ml microtubes (SARSTEDT, catalog numbers: 72.695.500 and 72.690.001 )
5 ml syringe (BD plastipak, BD, catalog number: 302187 )
Razor blade (Feather Safety Razor, catalog number: 02.015.00.024 )
Petri dish, 9.2 cm diameter (SARSTEDT, catalog number: 82.1473.001 )
CellTrics® (pore size 30 μm) (Sysmex, catalog number: 04-0042-2316 )
Absorbent paper (Kimberly-Clark, catalog number: 3020 )
Microscopic slides and cover slips (VWR, catalog number: 631-1551 and 631-9430 )
Nicotiana benthamiana wild-type plants (seeds kindly provided by Dr. Savenkov, Uppsala), 4-6 weeks old (cultivated at 24 °C，16 h light, 8 h dark, 60% humidity); mature leaves (flat surface and edge) are used
Agrobacterium tumefaciens strain GV3101 harboring pUBC-UBP12-CFP plasmid (Derkacheva et al., 2016)
Agrobacterium tumefaciens strain GV3101 harboring pUBC-H3.3-CFP plasmid (Derkacheva et al., 2016)
Agrobacterium tumefaciens strain GV3101 harboring viral RNA silencing suppressor p19 (kindly provided by E. Savenkov, Uppsala)
LB broth high salt (Duchefa Biochemie, catalog number: L1704.2500 )
Formaldehyde (Sigma-Aldrich, catalog number: F8775 )
Antibody anti-H2Aub (Cell Signaling Technology, catalog number: 8240 )
Antibody anti-H4 (Merck, EMD Millipore, catalog number: 05-858 )
Antibody Alexa Fluor 555 conjugated goat anti-rabbit Kit (Thermo Fisher Scientific, Invitrogen, catalog number: A31629 )
VECTASHIELD® mounting medium with 1 μg/ml DAPI (Vector Laboratories, catalog number: H-1200 )
Bovine serum albumin (BSA) (Carl Roth, catalog number: 3737.2 )
MES (Duchefa Biochemie, catalog number: M1503 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M9272 )
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
Tris base (VWR, catalog number: 28811.364 )
EDTA disodium salt (Na2-EDTA) (Sigma-Aldrich, catalog number: ED2SS )
Sodium chloride (NaCl) (Merck, catalog number: 567441 )
37% HCl (Merck, catalog number: 1.00317.2500 )
Spermine (Sigma-Aldrich, catalog number: 85590 )
Potassium chloride (KCl) (Merck, catalog number: 529552 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Sodium dihydrogen phosphate dihydrate (NaH2PO4·2H2O) (Merck, EMD Millipore, catalog number: 106342 )
Sodium hydrogen phosphate (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Infiltration medium (see Recipes)
Tris buffer (see Recipes)
LB01 lysis buffer (see Recipes)
PBS buffer (see Recipes)
Equipment
Centrifuges (Eppendorf, model: 5804 R and Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM PicoTM 17 )
Surgical scissors (DIMEDA Instrumente, catalog number: 08.340.11 )
Laminar hood
Pipettes (Gilson, model: PIPETMAN® Classic, P2 , P20 , P200 , P1000 )
Humid incubator
Confocal microscope (ZEISS, model: LSM 780 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, S. and Hennig, L. (2018). Histone Deubiquitination Assay in Nicotiana benthamiana. Bio-protocol 8(5): e2746. DOI: 10.21769/BioProtoc.2746.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,747 | https://bio-protocol.org/exchange/protocoldetail?id=2747&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Coupling Exonuclease Digestion with Selective Chemical Labeling for Base-resolution Mapping of 5-Hydroxymethylcytosine in Genomic DNA
Aurélien A. Sérandour
SA Stéphane Avner
GS Gilles Salbert
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2747 Views: 6575
Edited by: Gal Haimovich
Reviewed by: Omar Akil
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
This protocol is designed to obtain base-resolution information on the level of 5-hydroxymethylcytosine (5hmC) in CpGs without the need for bisulfite modification. It relies on (i) the capture of hydroxymethylated sequences by a procedure known as ‘selective chemical labeling’ (see Szulwach et al., 2012) and (ii) the digestion of the captured DNA by exonucleases. After Illumina sequencing of the digested DNA fragments, an ad hoc bioinformatic pipeline extracts the information for further downstream analysis.
Keywords: 5-Hydroxymethylcytosine Selective chemical labeling Exonuclease digestion CpG
Background
The methylation of cytosine in genomic DNA can be read by proteins and is mainly translated into gene silencing. Most CpG dinucleotides in the genome are methylated, including those located in gene regulatory regions such as enhancers. However, when required, these CpGs can be demethylated through oxidation of the methyl group by Ten Eleven Translocation (TET) enzymes and replacement by unmethylated cytosines by the base excision repair system. 5-Hydroxymethylcytosine (5hmC) is the first oxidative derivative of 5-methylcytosine, and mapping this modified base in the genome provides information on the regions undergoing active demethylation. Although selective chemical labeling (SCL) allows very specific detection of 5hmC, the resolution of this technique is limited by the size of the DNA fragments, especially when several CpGs are present in the captured DNA. In order to improve resolution, we have introduced a digestion step using exonucleases which trim the DNA molecule up to close proximity of the hydroxymethylated cytosines (Sérandour et al., 2016). Appropriate bioinformatic treatment of the sequencing reads then assigns hydroxymethylation score to the captured CpGs.
Materials and Reagents
Pipette tips (TipOne, STARLAB, catalog numbers: S1161-1800 , S1182-1830 , and S1181-3810 )
0.65 ml Bioruptor microtubes (Diagenode, catalog number: C30010011 )
0.5 ml and 2 ml DNA LoBind tubes (Eppendorf, catalog numbers: 0030108035 and 0030108078 )
Micro Bio-Spin 6 column (Bio-Rad Laboratories, catalog number: 7326221 )
1.5 ml Lobind tubes (Eppendorf, catalog number: 0030108051 )
2 ml Lobind tubes (Eppendorf, catalog number: 0030108078 )
DNeasy Blood & Tissue Kit (QIAGEN, catalog number: 69504 )
100-bp DNA marker (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15628019 )
E-gel EX agarose gel 2% (Thermo Fisher Scientific, InvitrogenTM, catalog number: G401002 )
β-Glucosyltransferase (β-GT) and associated reaction buffer (New England Biolabs, catalog number: M0357S )
DBCO-PEG4-Biotin (Sigma-Aldrich, catalog number: 760749 )
UDP-6-N3-Glc (Active Motif, catalog number: 55020 )
DMSO (Sigma-Aldrich, catalog number: D8418 )
QIAquick Nucleotide Removal Kit (QIAGEN, catalog number: 28304 )
Dynabeads M-280 streptavidin (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11205D )
NEBuffer 2 (New England Biolabs, catalog number: B7002S )
10x NEBuffer 4 (New England Biolabs, catalog number: M0357S )
ATP (10 mM) (New England Biolabs, catalog number: P0756S )
dNTP solution mix (New England Biolabs, catalog number: N0447S )
T4 DNA polymerase (New England Biolabs, catalog number: M0203S )
DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs, catalog number: M0210S )
T4 PolyNucleotide Kinase (New England Biolabs, catalog number: M0201S )
T4 DNA ligase high concentration (New England Biolabs, catalog number: M0202T )
Nuclease-free water (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9937 )
SCL-exo P7 adapter: annealing of 2 oligonucleotides (5’ Phos = phosphorylated 5’ end):
P7 exo-adapter reverse: 5’ Phos-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-OH 3’
P7 exo-adapter forward: 5’ OH-GATCGGAAGAGCACACGTCT-OH 3’
Phi29 polymerase (New England Biolabs, catalog number: M0269S )
Lambda exonuclease (New England Biolabs, catalog number: M0262S )
RecJf exonuclease (New England Biolabs, catalog number: M0264S )
Glycogen (5 mg/ml) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9510 )
Sodium chloride (NaCl) (Acros Organics, catalog number: AC207790050 )
EtOH (100%) (VWR, catalog number: 20821.310 )
SCL-exo P7 primer:
5’ OH-GACTGGAGTTCAGACGTGTGCT-OH 3’
Agencourt AMPure XP (Beckman Coulter, catalog number: A63880 )
Qiagen MinElute PCR Purification Kit (QIAGEN, catalog number: 28004 )
SCL-exo P5 adapter: annealing of 2 oligonucleotides:
P5 exo-adapter reverse: 5’ OH-AGATCGGAAGAGCG-OH 3’
P5 exo-adapter forward: 5’ OH-TACACTCTTTCCCTACACGACGCTCTTCCGATCT-OH 3’
NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, catalog number: M0541S )
SCL-exo universal P5 PCR primer (* = Phosphorothioates S-linkage):
5’ OH-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACG*A-OH 3’
SCL-exo index P7 PCR primer (* = Phosphorothioates S-linkage) (index sequences come from TruSeq LT):
Index 2:
5’ OH-CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Index 4:
5’ OH-CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Index 5:
5’ OH-CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Index 6:
5’ OH-CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Index 7:
5’ OH-CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Index 12:
5’ OH-CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Index 13:
5’ OH-CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Index 14:
5’ OH-CAAGCAGAAGACGGCATACGAGATGGAACTGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Index 15:
5’ OH-CAAGCAGAAGACGGCATACGAGATTGACATGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Index 16:
5’ OH-CAAGCAGAAGACGGCATACGAGATGGACGGGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Index 18:
5’ OH-CAAGCAGAAGACGGCATACGAGATGCGGACGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Index 19:
5’ OH-CAAGCAGAAGACGGCATACGAGATTTTCACGTGACTGGAGTTCAGACGTGTGC*T-OH 3’
Notes (concerning the oligonucleotides):
All oligonucleotides were produced by Sigma-Aldrich, purified by HLPC and resuspended in water at 100 μM final.
The SCL-exo P7 adapter and the SCL-exo P5 adapter were obtained by mixing pairs of complementary oligonucleotides in 4 volumes of Annealing buffer (see Recipes) and annealed by heating for 5 min at 95 °C then let cool down slowly to room temperature.
The oligonucleotides designed for SCL-exo were adapted from the P5 and P7 oligonucleotide sequences from Illumina ©2007-2012 Illumina, Inc. All rights reserved. Derivative works created by Illumina customers are authorised for use with Illumina instruments and products only. All other uses are strictly prohibited.
Agilent High Sensitivity DNA Kit (Agilent Technologies, catalog number: 5067-4626 )
Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32854 )
EDTA (500 mM, pH 8.0) (AppliChem, catalog number: A4892,0500 )
HEPES (1 M) (GibcoTM, catalog number: 15630056 )
Na deoxycholate (Sigma-Aldrich, catalog number: D6750 )
NP-40, IGEPAL® CA-630 (Sigma-Aldrich, catalog number: I8896 )
Lithium chloride (LiCl) (Sigma-Aldrich, catalog number: 62476 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Merck, catalog number: 442611 )
Ammonium sulfate ((NH4)2SO4) (Merck, catalog number: 101217 )
DTT (Sigma-Aldrich, catalog number: D9779 )
Tris (MP Biomedicals, catalog number: 04819638 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: H9892 )
Formamide for molecular biology (Sigma-Aldrich, catalog number: F9037 )
1x PBS (Fisher Scientific, catalog number: BP399 )
Annealing buffer (see Recipes)
RIPA buffer (see Recipes)
Nick Repair buffer low DTT 10x (see Recipes)
TE buffer (see Recipes)
Elution buffer (see Recipes)
Binding & Washing (B&W) buffer (see Recipes)
Equipment
PIPETMAN ClassicTM Pipets (Gilson, catalog numbers: F123600 , F144801 , F123602 and F123615 )
Bioruptor Pico with water cooler (Diagenode, catalog numbers: B01060001 and B02010003 )
E-gel Power Snap Electrophoresis Device (Thermo Fisher Scientific, InvitrogenTM, catalog number: G8100 )
Qubit 3 Fluorometer (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q33216 )
Refrigerated centrifuge (Eppendorf, model: 5424 R )
Thermocycler ProFlex PCR system (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4484073 )
ThermoMixer C and Eppendorf ThermoTop (Eppendorf, catalog numbers: 5382000015 and 5308000003 )
DynaMag-2 Magnet (Thermo Fisher Scientific, catalog number: 12321D )
Speed-Vac Savant (Thermo Fisher Scientific, catalog number: DNA120-115 )
2100 Bioanalyzer Instrument (Agilent Technologies, model: 2100, catalog number: G2939BA )
Mini centrifuge (Bio-Rad Laboratories, catalog number: 1660603 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sérandour, A. A., Avner, S. and Salbert, G. (2018). Coupling Exonuclease Digestion with Selective Chemical Labeling for Base-resolution Mapping of 5-Hydroxymethylcytosine in Genomic DNA. Bio-protocol 8(5): e2747. DOI: 10.21769/BioProtoc.2747.
Download Citation in RIS Format
Category
Systems Biology > Epigenomics > 5-hydroxymethylcytosine
Molecular Biology > DNA > DNA modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,748 | https://bio-protocol.org/exchange/protocoldetail?id=2748&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Polyhydroxybutyrate (PHB) Content in Ralstonia eutropha Using Gas Chromatography and Nile Red Staining
JJ Janina R. Juengert*
SB Stephanie Bresan*
DJ Dieter Jendrossek
*Contributed equally to this work
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2748 Views: 16106
Edited by: Dennis Nürnberg
Reviewed by: Benoit Chassaing
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
Ralstonia eutropha H16 produces and mobilizes (re-utilizes) intracellular polyhydroxybutyrate (PHB) granules during growth. This protocol describes the visualization of intracellular Nile red stained PHB granules and the quantification of PHB by gas chromatography. Our first method describes how to analyze PHB granules by fluorescence microscopy qualitatively. Our second approach enables the conversion of PHB to volatile hydroxycarboxylic acid methyl esters by acidic methanolysis and their quantification by gas chromatography. Through this method, it is possible to obtain an absolute quantification of PHB, e.g., per cell dry weight.
Keywords: Polyhydroxybutyrate (PHB) Gas chromatography Nile red Acidic methanolysis Ralstonia eutropha
Background
Polyhydroxyalkanoates (PHA), especially polyhydroxybutyrate (PHB), are energy and carbon storage compounds in many prokaryotic species, ensuring bacterial survival under stress conditions (Anderson and Dawes, 1990; Pötter and Steinbüchel, 2006; Jendrossek and Pfeiffer, 2014; Bresan et al., 2016). An industrial application of these biopolymers is the production of biodegradable plastic (Chen, 2009; Riedel et al., 2015) and the research on potential medicinal components (Wu, 2009; Zonari et al., 2015; Pacheco et al., 2015; Giretova et al., 2016). Ralstonia eutropha H16, a Gram-negative facultative chemolithoautotrophic β-proteobacterium, is a model organism for PHB accumulation as it can accumulate up to 80% of its cell dry weight of PHB. Within the cells, PHB forms granules or so-called carbonosomes covered with different surface proteins (Jendrossek and Pfeiffer, 2014; Bresan et al., 2016). PHB is synthesized from its parent substance acetyl-CoA in a 3-step reaction. The first step is a condensation reaction of two acetyl-CoA molecules by the acetyl-CoA-acetyltransferase PhaA. Acetoacetyl-CoA is then reduced to (R)-3-hydroxybutyryl-CoA by the acetoacetyl-CoA-reductase PhaB. The last step includes an essential non-redundant reaction: the polymerization of (R)-3-hydroxybutyryl-CoA to PHB by the PHB synthase called PhaC (Figure 1).
Figure 1. Biosynthesis of PHB
A fast and easy way to detect intracellular PHB is a microscopy approach using Nile red staining. Nile red (also known as Nile blue oxazone) is a lipophilic fluorescent dye used to visualize hydrophobic cell structures such as membranes or lipid-like inclusions (PHB, triacyl-glycerides) (Spiekermann et al., 1999). Nile red binds to PHB granules and can easily be detected by fluorescence microscopy. Its colors (i.e., fluorescent emission wave lengths) vary from dark red (for binding to polar membrane lipids) to an intense yellow-gold emission (for binding to neutral lipids in intracellular storages). The emission (> 590 nm) and excitation (560 nm) wavelengths characteristic of the Nile red hydrophobic compound adducts also depend on solvent polarity (Spiekermann et al., 1999); in most polar solvents Nile red shows no or only little fluorescence.
Gas chromatography (GC) can be used to quantify PHB and to determine its monomeric composition. PHB decomposes at temperatures below its boiling point. Therefore, PHB must be converted into products that are stable and volatile at the temperature of the GC-column. This is achieved by conversion of PHB into volatile hydroxycarboxylic acid methyl esters, hereafter, methyl esters (Figure 2) (Brandl et al., 1988). The methyl esters interact specifically with the solid phase thereby allowing a separation of different hydroxyalkanoate methyl esters in case co-polyesters of different hydroxyalkanoates have to be analyzed. Measuring the time point of appearance and the area under the resulting compound peak of the detector signals in the chromatogram enable its quantitative and qualitative determination.
Figure 2. Acidic methanolysis of PHA
Materials and Reagents
Microscope slides (e.g., Carl Roth, catalog number: H868.1 )
Cover slips (e.g., Carl Roth, catalog number: H873.2 )
2 ml reaction tubes (e.g., SARSTEDT, catalog number: 72.695.500 )
50 ml Falcon tubes (e.g., SARSTEDT, catalog number: 62.559.001 )
6 ml culture tubes with screw-cap with chloroform resistant PTFE seal (e.g., DWK Life Sciences, DURAN, catalog number: 26 135 11 5 )
GC glass vial (e.g., Brown, catalog number: 155710 )
50 ml Omnifix® Syringes (e.g., B.Braun Medical, catalog number: 4591281 )
Sterile filter Filtropur S 0.2 (e.g., SARSTEDT, catalog number: 83.1826.001 )
Scalpel blade (e.g., Gebrüder Martin, KLS Martin, catalog number: 10-155-24-04 )
Pipette tips 1,000 μl (e.g., SARSTEDT, catalog number: 70.762.010 )
Pipette tips 200 μl (e.g., SARSTEDT, catalog number: 70.760.002 )
Pipette tips 10 μl (e.g., VWR, catalog number: 53509-070 )
1.5 ml tubes (e.g., SARSTEDT, catalog number: 72.690.001 )
0.3 ml limited volume inserts (e.g., Brown, catalog number: 155650 )
Septa (e.g., Brown, catalog number: 155615 )
Organisms
Ralstonia eutropha H16 (alternative strain designations: Hydrogenomonas eutropha H16, Alcaligenes eutrophus H16, Wautersia eutropha H16, Cupriavidus necator H16). DSM 428 (Deutsche Sammlung für Mikroorganismen and Zellkulturen GmbH, https://www.dsmz.de/). Wild type strain produces PHB and related short-chain-length PHA
Ralstonia eutropha H16-PHB-4 (DSM 541), PHB negative mutant of strain H16 because of mutation G320A in the PHB synthase (phaC) gene (Raberg et al., 2014)
PHB (e.g., Sigma-Aldrich, catalog number: 363502 )
Agarose standard (e.g., Carl Roth, catalog number: 3810.4 )
Nitrogen gas (e.g., Air Liquide, ALPHAGAZTM 1 Stickstoff, catalog number: P0271L50R2A001 )
Helium gas (e.g., Air Liquide, ALPHAGAZTM 1 Helium, AIR LIQUIDE Deutschland, catalog number: P0251L50R2A001 )
Synthetic air (e.g., Air Liquide, ALPHAGAZTM 1 Luft, AIR LIQUIDE Deutschland, catalog number: P0291L50R2A001 )
Octane (e.g., Sigma-Aldrich, catalog number: 74821 )
Nile red (e.g., Sigma-Aldrich, catalog number: N3013 )
DMSO (e.g., Carl-Roth, catalog number: 7029.2 )
Trichloromethane/Chloroform (e.g., Carl Roth, catalog number: 6340.2 )
Methanol for GC (e.g., VWR, catalog number: 20864.320 )
Methyl benzoate (e.g., Sigma-Aldrich, catalog number: M29908 )
Sulphuric acid 96% (e.g., Carl Roth, catalog number: 4623.1 )
Fructose
Nutrient broth (e.g., BD, DifcoTM, catalog number: 231000 )
Na2HPO4·12H2O
KH2PO4
NH4Cl
MgSO4·7H2O
CaCl2·7H2O
Ferric ammonium citrate
ZnSO4
MnCl2·4H2O
H3BO3
CoCl2·6H2O
CuCl2·2H2O
NiCl2·6H2O
NaMoO4·2H2O
D-Gluconic acid sodium salt (e.g., Sigma-Aldrich, catalog number: G9005 )
NB medium (see Recipes)
Mineral salts medium (see Recipes)
D-Gluconic acid sodium salt solution (20% stock solution) (see Recipes)
Nile red solution (see Recipes)
Equipment
100 ml Erlenmeyer flasks (e.g., DWK Life Sciences, DURAN, catalog number: 21 216 24 )
500 ml Erlenmeyer flasks (e.g., DWK Life Sciences, DURAN, catalog number: 21 216 44 )
3 L Erlenmeyer flasks (e.g., DWK Life Sciences, DURAN, catalog number: 21 216 68 )
Incubation shaker (e.g., INFORS HT)
Pipettes (e.g., Thermo Scientific)
Spatula
Centrifuge (e.g., Eppendorf, model: 5417 C )
Freeze-dryer (e.g., Christ, model: Alpha 1-2 LDplus )
Rotary vane pumps (e.g., Pfeiffer Vacuum, model: DUO 5 M )
Analytical balance (e.g., Sartorius, model: A 200 S )
Fume hood
Oil bath (e.g., Memmert)
Gas chromatograph (e.g., Agilent Technologies, model: Agilent 7890A ; flame ionization detector (FID))
Gastight syringe for GC (e.g., VWR, catalog number: 5490572)
Manufacturer: Hamilton, model: 1701 SN CTC .
CTC automated sample injector (e.g., Agilent Technologies, catalog number: G6501-CTC )
GC column DB-WAX (e.g., Agilent Technologies, catalog number: 122-7032 )
Fluorescence microscope with a Plan Apo objective (100x/1.4 oil) (e.g., Nikon Instruments, model: Eclipse Ti-E )
Nile red-Filter (Excitation: 562/40 nm/Emission: 594 (long pass), e.g., AHF Analysentechnik AG, Tübingen, Germany, www.ahf.de/)
Liner 4 mm ID LPD (e.g., Agilent Technologies, catalog number: 5183-4647 )
Freezer
Sterile bench (e.g., HERA safe)
Refrigerated Falcon centrifuge (e.g., Sigma Zentrifugen, model: 4K15 )
Vortex
Laboratory glass bottles (e.g., DWK Life Sciences, DURAN, catalog number: 21 801 54 5 )
Autoclave
Software
GC ChemStation Rev. B.04.01 SP1, Agilent
Excel, Microsoft, Redmont, USA
Nikon imaging software
ImageJ Fiji vl.50c
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Juengert, J. R., Bresan, S. and Jendrossek, D. (2018). Determination of Polyhydroxybutyrate (PHB) Content in Ralstonia eutropha Using Gas Chromatography and Nile Red Staining. Bio-protocol 8(5): e2748. DOI: 10.21769/BioProtoc.2748.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Biochemistry > Other compound > Poly-β-hydroxybutyrate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,749 | https://bio-protocol.org/exchange/protocoldetail?id=2749&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Fluorescent Dye Method Suitable for Visualization of One or More Rat Whiskers
JR Jacopo Rigosa
AL Alessandro Lucantonio*
GN Giovanni Noselli*
AF Arash Fassihi
EZ Erik Zorzin
FM Fabrizio Manzino
FP Francesca Pulecchi
Mathew E Diamond
*Contributed equally to this work
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2749 Views: 5988
Reviewed by: Soyun KimEmmanuelle Berret
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
Visualization and tracking of the facial whiskers is critical to many studies of rodent behavior. High-speed videography is the most robust methodology for characterizing whisker kinematics, but whisker visualization is challenging due to the low contrast of the whisker against its background. Recently, we showed that fluorescent dye(s) can be applied to enhance visualization and tracking of whisker(s) (Rigosa et al., 2017), and this protocol provides additional details on the technique.
Keywords: Whisker Tracking Fluorescence Dye Tactile perception Barrel cortex
Background
Over the last 10 years, neuroscientists have begun to focus on sensorimotor processing in behaving rodents. A critical step is to be able to quantify the signals that enter the nervous system from the outside world. For whisker-mediated touch, visualization and tracking of the facial whiskers are required in order to characterize the sensory input. Though many approaches have been employed, only high-speed videography has proven adequate for measuring whisker motion and deformation during interaction with an object. However, whisker visualization and tracking is challenging for multiple reasons, primary among them the low contrast of the whisker against its background. This protocol details a technique for increasing contrast by rendering whiskers fluorescent.
Materials and Reagents
Latex gloves (DOCzero)
Face mask (Benefis)
Eppendorf PCR tube (2 ml)
Cotton pads or gauzes (Megapharma)
Cotton swabs (DaklaPack)
Laboratory film (Parafilm)
Borosilicate glass capillary inside Ø 0.58 mm (Hilgenberg) of 5 cm length
Syringe (Nipro Europe N.V.)
Standard aluminum foil
Animals: Wistar rats (450-550 g) from Envigo-Harlan
Notes:
Wistar rats (450-550 g) individually housed or with one cage mate. 14/10 light/dark cycle.
In principle, the method can be applied to any whiskered animal, but bleaching darker whiskers could require longer time and could produce less satisfactory results, affecting the quality of the fluorescence.
Epigel (Ceva, Italy)
Hydrogen peroxide (diluted solution 3%)
Blue bleaching powder (DECO+)
Distilled water (Marco Viti Farmaceutici)
Kitchen vinegar
Domitor (Medetomidine hydrochloride)
Antisedan (Atipamezole hydrochloride)
Equipment
Cage for rat (Tecniplast, catalog number: 1291H )
Note: Rat is isolated in cage.
Animal scale
Pulse-oximeter
1 x scissor (Swiss Scissors, 9 cm) (World Precision Instruments, catalog number: 504613 )
1 x tweezer (#7, World Precision Instruments, catalog number: 504504 )
Tissue and heating pad for body thermoregulation (Panlab s.l.)
Fluorescent dye
Note: We used and tested hair semi-permanent fluo rinse (‘UV Red’ or ‘UV Green’, Star Gazer).
Excitation light
Note: We used a custom made lamp with 7 bulbs: ILH-OO01-DEBL-SC211-WIR200, Wavelength 455 nm, Flux @700 mA 1,400 mW, Radiance angle ± 60°; concentrator lens FA11205_Tina-D-OSL FWHM angle ± 6°. The light was custom made to yield uniform illumination from different directions: this improves the homogeneity of the light emitted by the fluorescent dye and then improves the image quality. Each bulb was assembled using a commercial LED coupled with a compound parabolic concentrator (CPC), also called a ‘Winston cone’, in order to collect and project into the arena all the available light.
Black neoprene (RS Components, catalog number: 733-6753 )
Note: We covered the experimental setup with black neoprene because a black, non-reflective, background helps in increasing the overall contrast of the image.
Safety goggles (Univet, catalog number: 5X7.03.00.04 )
Note: Absorbance > 4 for Wavelength < 510 nm. Certification 0068/ETI-DPI/070-2009 Rev.2.
High-speed camera and lens
Note: Camera and lens depend on the experimenter’s choice. We used the camera CamRecord 450 (Optronis) combined with Computar TV lens–50 mm 1:1.3 lens. Each investigator must choose the video device according to frame-rate required by the experiment: for high resolution rat whisker kinematics 1,000 fps is an acceptable frame rate (Fassihi et al., 2014 and 2017). Attention has to be paid to the camera frame rate: the higher the rate, the stronger the light should be. For a frame rate of 1,000 fps, the duration of a single frame is 1 msec, giving the maximum exposure time. We used the entire frame duration, 1 msec, as exposure time. Lower exposure times typically generate better still images but require additional light: a trade-off has to be optimized according to the specific requirements of each individual experimental setup. In case the experimenter wants to reduce the intensity of the stimulus light, or in case a different (e.g., less bright) camera lens is used, some cameras allow setting of the internal gain of the sensor: this improves the sensitivity of the camera sensor at the cost of getting more salt-pepper noise in the resulting images.
Long-pass filter
Note: Long-pass filter is needed to visualize one or multiple whiskers stained with different dyes. We tested FEL0500 Long-pass filter cut-on wavelength 500 nm (Thorlabs) to visualize multiple fluorescent dyes and red/orange plexiglass to visualize only the red fluorescent dye. The filter choice should fit the lens dimension, while plexiglass, which is sold in sheets, can be cut to suit custom design, then it can be adapted to the lens dimension. As for camera and lens, the filter has to be chosen to match the dye color and suppress the color of the illumination source. This prevents the camera sensor from being bloomed by the source, while receiving the lower-intensity light emitted by the fluorescent dye.
Procedure
Dye application
Notes:
No sterile techniques are required for this protocol.
Wear gloves and mask during the entire procedure.
Prepare in advance a fresh hair discoloration preparation:
Considering that it has an unpleasant and strong smell, you might consider using a hood.
Fill at least one PCR tube with bleaching powder and the hydrogen peroxide, close the tube and mix it.
A viscous preparation must be obtained to avoid it dripping off the whisker.
Prepare in advance cotton pads (or gauzes) soaked in distilled water and vinegar.
Wear protective goggles before switching the excitation source on.
Before starting this protocol, the rat should be sedated (see Procedure B: ‘Animal sedation’: follow the ‘pre-anesthesia’ and ‘anesthesia’ procedures).
Place the rat on the heating pad and set the body temperature to 37 °C.
Put the Epigel on the rat’s eyes to protect them from light and dryness.
Apply the discoloration preparation (Figure 1A) on all whiskers using cotton swabs. Since its smell is quite strong, avoid placing it close to the rat’s nose, because breathing it can reverse the effect of Domitor.
Wait between 30 min and 1 h to bleach whiskers.
Rinse the whiskers using distilled water with a cotton pad (Figure 1B).
Dry the whiskers with air-flow or a cotton pad (Figure 1C).
Place the rat’s head under illumination and tilt it a bit to reach the whisker(s) you are interested in.
Isolate selected whiskers (Figure 1D)
Cut a piece of Parafilm to cover the rat’s snout and cheeks (e.g., 6 cm L x 6 cm H).
Make a small hole to let the whisker pass through. You can use a glass capillary or a tweezer to isolate the whisker, in both cases paying attention not to damage the whisker or the rat’s skin.
The resulting working surface allows application of the dye(s) only on a selected subset of whiskers. This is very important in order to prevent the unwanted application of the dye.
Flatten the working surface at the base of the selected whisker(s) to allow the application of the dye on the complete whisker(s) length.
Apply the fluorescent dye on whisker(s) (Figure 1E). For each whisker:
Cut a piece of Parafilm of circa 2 cm width and slightly longer than the whisker.
Fill the syringe with the fluorescent dye and eject it abundantly onto the Parafilm in order to soak the whisker along its entire length. In order to avoid air bubbles, which would locally prevent staining, spread the dye with a cotton swab.
The whisker now adheres weakly to the Parafilm because soaked in a gel. Any movement can make the whisker slip away. It will be helpful to hold the Paraffin film or even tighten it with aluminum foil.
Wait between 30 min and 1 h from the last application to let the dye diffuse inside the cuticle.
Remove the excessive dye and rinse the whisker(s) using a cotton pad or a gauze wet with vinegar, which tends to close the cuticle in complete safety for the animal.
Notes:
Clean one whisker at a time. Use a different cotton pad (or gauze) for each whisker in order to not mix the color).
Since the vinegar smell is quite strong, avoid placing it close to the rat’s nose, because breathing it can reverse the effect of Domitor.
Visualization test (Figure 1F): wear the protective glasses, turn off all the room lights and turn on the lamp.
Figure 1. Dye application procedure. A. Whisker bleaching; B. Removal of bleaching factor; C. Whiskers drying in airflow; D. Isolation of a single whisker with paraffin film; E. Application of the dye; F. Visualization test. This figure was adapted using images from Supplementary Figure 1 of Rigosa et al., 2017.
Set the shutter speed of the high speed camera according to experimenter’s needs.
Note: The higher the shutter speed, the shorter the exposure time, the darker the grabbed image. Choose the highest exposure time possible for brightest images.
Simulate experimental conditions placing the animal in a box covered with neoprene and installing the lamp at the proper distance upon experimenter’s needs.
Note: Light conditions and reflections strongly depend on the neoprene and lamp installation.
Visualize the whisker(s) and adjust the camera gain (Figures 2 and 3).
Note: If the background is much darker than the visualized whisker, the gain of the camera sensor can be safely increased without introducing salt and pepper noise to the image. This feature depends on the specific camera model.
Follow the guidelines for Post-anesthesia (see Procedure B: ‘Animal sedation’) to recover the rat.
In case the visualization is not sufficient (e.g., the whisker did not absorb the dye along its entire length), plan another application of the dye. In case the time left before the current sedation ends is not sufficient for immediate re-staining, ask your veterinarian when another sedation for the same animal could be feasible.
Figure 2. High-speed video setup. A cage equipped with a licking sensor is used to trigger and synchronize the high-speed video recording with the licking behavior. The field of view is illuminated using the custom made lamp and the optical path to the camera sensor was filtered using an orange transparent plexiglass.
Figure 3. Grabbed frame from high-speed video. A behaving rat is illuminated using 4 LEDs of the lamp and an orange plexiglass plate as an optical filter. The video was shot at 1,000 frames per second. This figure was adapted using images from Supplementary Figure 3 of Rigosa et al., 2017.
Animal sedation
Notes:
This protocol was performed without sterile techniques.
Inform yourself about the features of Domitor: time of effect, site of injection, which reflexes are suppressed and time of recovery.
Set ambient temperature to the room temperature (25 °C) and keep it constant.
Wear gloves and mask during the entire procedure.
The sedation should last between 2.5 and 3 h.
Between two sedations the rat needs 24 h of recovery.
Avoid more than two sedations a week.
Do not obstruct the animal breathing with anything while it is sedated.
Do not disturb the animal sedation with strong odors (e.g., by approaching the discoloration preparation or the vinegar).
Pre-anesthesia procedure
Make sure that the rat drank water in the last 5 h.
Make sure that the rat is housed alone in the cage.
Bring the rat to a silent and quiet place with constant room temperature.
Weigh the rat and calculate the dose for the anesthetic; the dose of Domitor (Medetomidine hydrochloride) is 0.5 mg/kg [1 mg/ml] intraperitoneal (IP).
Prepare the anesthetic in the syringe, ready to be injected.
Anesthesia procedure
From now on, the procedure should be as fast as possible to reduce the risk of stressing the animal.
Make the IP injection:
Restrain the animal, expose the abdomen and inject in the lower right quadrant to avoid inner organs.
Note: In alternative, grasp the rat by the tail and raise its belly, with its posterior legs lifted, inner organs will move towards the head, reducing the risk of missing the target of the shot.
Don’t keep the animal in the restrained position for a long time; it is unnatural and stressful.
Inject the anesthetic IP in a single shot.
Place the rat in the cage
Use a heating pad or cover the rat body with a tissue or aluminum foil to diminish heat dissipation.
Place the cage in a dark room.
After 10 min test the reflexes (tail, hind paw, corneal).
If the animal is sedated, apply the dye.
During sedation, constantly monitor the heart beating and the breathing rate.
Post-anesthesia procedure
Put the rat back in the cage.
Prepare the dose of the Antisedan (Atipamezole hydrochloride), standard dose for IP injection is 0.2 ml.
Make the IP injection.
Cover the rat with a tissue to keep its body temperature at 37 °C until it wakes up.
Notes
The whisker staining (protocol ‘Dye application’) is executed on the sedated animal (protocol ‘Animal sedation’). The sedation should last between 2.5/3 h and between two sedation there should be a resting period of at least 24 h, and in any case no more than twice a week.
The dye is subject to photo-bleaching. Though in Rigosa et al. (2017) a time constant of about 14 h was reported (i.e., ca. 25,000 trials of 2 sec each), this result depends on the light density and the amount of dye that was absorbed by the whisker sample. If necessary, the investigator can re-stain the same whisker, as this would not alter its mechanical properties. If staining multiple whiskers, the investigator can obtain the same result by staining one whisker at a time across different sessions.
Acknowledgments
The authors declare no competing financial interests. We acknowledge the financial support of the Human Frontier Science Program (http://www.Hfsp.org; project RG0015/2013), the European Research Council Advanced grants CONCEPT (http://erc.europa.eu; project 294498) and MicroMotility (project 340685), and Italian MIUR grant HANDBOT (http://hubmiur.pubblica.istruzione.it/web/ricerca/home; project GA 280778). GN gratefully acknowledges support by SISSA through the excellence program NOFYSAS 2012. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
Fassihi, A., Akrami, A., Esmaeili, V. and Diamond, M. E. (2014). Tactile perception and working memory in rats and humans. PNAS 111: 2331-2336.
Fassihi, A., Akrami, A., Pulecchi, F., Schönfelder, V. and Diamond, M. E. (2017). Transformation of perception from sensory to motor cortex. Curr Biol 27: 1585-1596.
Rigosa, J., Lucantonio, A., Noselli, G., Fassihi, A., Zorzin, E., Manzino, F., Pulecchi, F. and Diamond, M. E. (2017). Dye-enhanced visualization of rat whiskers for behavioral studies. Elife 6.
Copyright: Rigosa et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Rigosa, J., Lucantonio, A., Noselli, G., Fassihi, A., Zorzin, E., Manzino, F., Pulecchi, F. and Diamond, M. E. (2018). A Fluorescent Dye Method Suitable for Visualization of One or More Rat Whiskers. Bio-protocol 8(5): e2749. DOI: 10.21769/BioProtoc.2749.
Rigosa, J., Lucantonio, A., Noselli, G., Fassihi, A., Zorzin, E., Manzino, F., Pulecchi, F. and Diamond, M. E. (2017). Dye-enhanced visualization of rat whiskers for behavioral studies. Elife 6.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Neuroscience > Sensory and motor systems > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
275 | https://bio-protocol.org/exchange/protocoldetail?id=275&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Intracellular Macrophage Infections with E. coli under Nitrosative Stress
S Stacey L. Bateman
PS Patrick Seed
Published: Vol 2, Iss 20, Oct 20, 2012
DOI: 10.21769/BioProtoc.275 Views: 13519
Original Research Article:
The authors used this protocol in Mar 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2012
Abstract
Escherichia coli (E. coli) produces disseminated infections of the urinary tract, blood, and central nervous system where it encounters professional phagocytes such as macrophages, which utilize reactive nitrogen intermediates (RNI) to arrest bacteria. In vitro, extraintestinal pathogenic E. coli (ExPEC) can survive within bone marrow-derived macrophages for greater than 24 h post-infection within a LAMP1+ vesicular compartment, and ExPEC strains, in particular, are better adapted to intracellular macrophage survival than commensal strains (Bokil et al., 2011). This protocol details an intracellular murine macrophage-like cell infection, including modulation of the host nitrosative stress response, to model this host-pathogen interaction in vitro. To accomplish this, RAW 264.7 murine macrophage-like cells are pre-incubated with either L-arginine, an NO precursor, or IFNγ to yield a high nitric oxide (NO) physiological state, or L-NAME, an inducible NO synthase (iNOS)-specific inhibitor, to yield a low NO physiological state. This protocol has been successfully utilized to assess the contribution of a novel ExPEC regulator to intracellular survival and the nitrosative stress response during macrophage infections (Bateman and Seed, 2012), but can be adapted for use with a variety of E. coli strains or isogenic deletions.
Materials and Reagents
E. coli isolate UTI89 (Note 1) (or other ExPEC strain)
Luria-Bertani broth (LB) culture medium
RAW 264.7 mouse macrophage-like cells (Note 2)
DMEM [high glucose (HG), 4,500 mg/L]
Fetal bovine serum (FBS) (Sigma-Aldrich)
1x Phosphate buffered saline (PBS)
Gentamicin (50 mg/ml stock)
L-arginine
L-NAME (Cayman Chemical Company)
IFNγ, recombinant mouse (EMD Millipore, catalog number: IF005 )
1% Triton-X 100 (see Recipes)
RAW 264.7 media (DMEM + 10% FBS) (see Recipes)
1 M L-arginine stock solution (see Recipes)
1M L-NAME stock Solution (see Recipes)
Equipment
24 well tissue culture trays
Table-top swinging bucket centrifuge with microtray adaptors
37 °C incubator with aeration (for liquid bacterial cultures)
37 °C incubator with 5% CO2 [for macrophage cultures (Note 3)]
Spectrophotometer
0.2 micron filter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bateman, S. L. and Seed, P. (2012). Intracellular Macrophage Infections with E. coli under Nitrosative Stress. Bio-protocol 2(20): e275. DOI: 10.21769/BioProtoc.275.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Microbiology > Microbe-host interactions > In vitro model
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,750 | https://bio-protocol.org/exchange/protocoldetail?id=2750&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Terminal Deoxynucleotidyl Transferase Mediated Production of Labeled Probes for Single-molecule FISH or RNA Capture
Imre Gaspar
Frank Wippich
Anne Ephrussi
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2750 Views: 11358
Edited by: Gal Haimovich
Reviewed by: Joshua S TitlowKarthik Krishnamurthy
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Arrays of short, singly-labeled ssDNA oligonucleotides enable in situ hybridization with single molecule sensitivity and efficient transcript specific RNA capture. Here, we describe a simple, enzymatic protocol that can be carried out using basic laboratory equipment to convert arrays of PCR oligos into smFISH and RAP probesets in a quantitative, cost-efficient and flexible way.
Keywords: Terminal deoxynucleotidyl transferase Labelled terminator nucleotide Probe production Single molecule FISH (smFISH) RNA capture RNA affinity purification (RAP)
Background
The use of multiple, singly-labeled, short oligonucleotides of synthetic origin has vastly improved the detection of specific transcripts with high specificity and single molecule sensitivity (Femino et al., 1998; Raj et al., 2008). Such probe molecules have improved penetration and require milder hybridization conditions than the classically used long nucleic acid probes, resulting in better preservation of the structure of the specimen (e.g., Little et al., 2015, Gaspar et al., 2017a). Since in this design multiple oligonucleotides–typically 24-96–target different portions of the same transcript, there occurs an accumulation of signal on the specific target molecules over the aspecific background, as opposed to the equal signal produced by long multiply labeled probes (Raj et al., 2008). Moreover, as the labeling of the individual short probes is quantitative–as opposed to the stochastic labelling of the long probes–the signal intensity directly and linearly correlates with the transcript copy number at a given spot, allowing precise recording/counting of the target RNA molecules (Raj et al., 2008, Little et al., 2015). Until now, the production of smFISH probe arrays has depended on chemical synthesis and labeling that rendered such single molecule FISH application inflexible and costly. Here, we describe an effective and cost-efficient enzymatic three-pot probe production (3P3) assay that makes use of terminal deoxynucleotidyl transferase (TdT) and custom labeled terminator nucleotides to convert any custom-assembled array of cheap PCR oligos into smFISH probes bearing fluorescent or non-fluorescent labels of the experimenter’s choice (Gaspar et al., 2017b). These enzymatically produced 3P3 probes are chemically nearly identical to smFISH probes from other sources. Thus the same protocols–optimized for a given specimen under study–can be used to perform single molecule FISH (reviewed in Gaspar and Ephrussi, 2015) and RNA capture analyses(see e.g., Gaspar et al., 2017a and Khong et al., 2017).
Materials and Reagents
1.5 ml Eppendorf tube (e.g., Sigma-Aldrich, catalog number: Z336769 )
0.2 ml thin-walled PCR tube (e.g., Corning, catalog number: 6571 )
2 cm thick adhesive tape (Tesa)
Glass slides (e.g., VWR, catalog number: 631-0411 ) and coverslips (e.g., 22 x 22 x 0.17 mm, Marienfeld-Superior, catalog number: 0107052 ) for sample preparation
15 ml tubes (e.g., Corning, Falcon®, catalog number: 352097 )
0.22 μm filter (e.g., Corning, catalog number: 431227 )
3 cm wide foldback paperclips (e.g., Staples, catalog number: WW-9130156 )
Amine reactive labels (tested and working):
BDP-FL-NHS (Lumiprobe, catalog number: 11420 )
Atto-tec Atto488-NHS (Atto-tec, catalog number: AD 488-31 ), Atto532-NHS (Atto-tec, catalog number: AD 532-31 ), Atto565-NHS (Atto-tec, catalog number: AD 565-31 ) and Atto633-NHS (Atto-tec, catalog number: AD 633-31 )
AlexaFluor488-NHS (Thermo Fisher Scientific, InvitrogenTM, catalog number: A20000 )
Abberior STAR 470SXP-NHS (Abberior, catalog number: 1-0101-008-3 ) and Abberior STAR RED-NHS (Abberior, catalog number: 1-0101-011-3 )
biotin-NHS (Sigma-Aldrich, catalog number: H1759 )
Anhydrous DMSO (e.g., Sigma-Aldrich, catalog number: 276855 )
Optional: silica gel (e.g., Merck, catalog number: 1.01969.1000 ) (see Note 1)
Amino-11-ddUTP (Lumiprobe, catalog number: 15040 ) or 5-propargylamino-ddUTP (Jena Biosciences, catalog number: NU-1619 )
1 M NaHCO3, pH 8.4 (e.g., Sigma-Aldrich, catalog number: S5761 )
A custom designed target specific array of non-overlapping ssDNA oligonucleotides (desalting purification is sufficient, see Software section for the design)
20 U/μl Terminal deoxynucleotidyl transferase (TdT) with 5x TdT buffer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EP0161 )
1-3 M Na-acetate, pH 5.5 (e.g., Sigma-Aldrich, catalog number: S2889 )
5 mg/ml linear acrylamide (e.g., Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9520 )
Ethanol (e.g., Merck, EMD Millipore, catalog number: 1.00983 )
100% ethanol, -20 °C
80% ethanol, 4 °C
70% ethanol, RT
Nuclease free ddH2O (e.g., New England Biolabs, catalog number: B1500S )
40% Acrylamide/Bis solution, 29:1 (e.g., Bio-Rad Laboratories, catalog number: 1610146 )
Urea (e.g., Sigma-Aldrich, catalog number: U5378 )
N,N,N’,N’-Tetramethylethylenediamine (TEMED) (e.g., Sigma-Aldrich, catalog number: T9281 )
10% (w/v) ammonium persulfate (APS) (e.g., Sigma-Aldrich, catalog number: A3678 )
6x gel loading dye (e.g., New England Biolabs, catalog number: B7021S )
SYBR-GOLD (e.g., Thermo Fisher Scientific, InvitrogenTM, catalog number: S11494 )
Optional: colorimetric Biotin Assay Kit (e.g., Sigma-Aldrich, catalog number: MAK171 ) (see Note 8)
20 mg/ml Proteinase-K (e.g., Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2546 )
Mounting medium
VectaShield (Vector Laboratories, catalog number: H-1000 )
80% TDE (see Recipes)
Pierce® Avidin agarose (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 20219 )
Dynabeads® MyOneTM C1 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 65001 )
Quick-RNATM MicroPrep Kit (Zymo Research, catalog number: R1050 )
Tris-HCl pH 7.0 (e.g., Sigma-Aldrich, Roche Diagnostics, catalog number: 10812846001 )
Colorimetric Biotin Assay Kit (Sigma-Aldrich, catalog number: MAK171 )
Tris base (e.g., Sigma-Aldrich, catalog number: T1503 )
Ethylenediaminetetraacetic acid (EDTA) (e.g., Sigma-Aldrich, catalog number: E5391 )
Sodium chloride (NaCl) (e.g., Merck, catalog number: 106404 )
Potassium chloride (KCl) (e.g., Merck, catalog number: 104936 )
Potassium dihydrogen phosphate dihydrate (KH2PO4·2H2O) (e.g., Merck, catalog number: 104873 )
Sodium phosphate dibasic (Na2HPO4) (e.g., Merck, catalog number: 106342 )
EM-grade paraformaldehyde (e.g., Electron Microscopy Sciences, catalog number: 15710 )
Triton X-100 (e.g., Sigma-Aldrich, catalog number: X100 )
Boric acid (e.g., Merck, catalog number: 100165 )
Ethylene carbonate (e.g., Sigma-Aldrich, catalog number: E26258 )
50 mg/ml heparin (e.g., Sigma-Aldrich, catalog number: H3393 )
10 mg/ml salmon sperm DNA (e.g., Sigma-Aldrich, catalog number: D7656 )
2,2’-Thiodiethanol (Sigma-Aldrich, catalog number: 166782 )
20% (v/v) SDS (e.g., Sigma-Aldrich, catalog number: 05030 )
PMSF (e.g., Sigma-Aldrich, catalog number: P7626 )
cOmplete® mini EDTA-free protease inhibitor (Roche Diagnostics, catalog number: 11836170001 )
RiboLock RNase Inhibitor (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EO0381 )
Sodium citrate (e.g., Sigma-Aldrich, catalog number: S1804 )
TE buffer (see Recipes)
1x PBS (see Recipes)
Fixative (see Recipes)
PBT (see Recipes)
1.5x PAGE loading buffer (see Recipes)
1x and 10x TBE (see Recipes)
15% PA - 8 M Urea stock (see Recipes)
20x SSC buffer (see Recipes)
2x full-HYBEC (see Recipes)
2x wash-HYBEC (see Recipes)
Lysis buffer (see Recipes)
Capturing hybridization buffer (see Recipes)
Low salt wash buffer (see Recipes)
High salt wash buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
Optional: inert gas (e.g., Argon) glove-box (e.g., Inert Technology, model: PureLab HE 2GB ) (see Note 1)
PCR machine with programmable hot-lid (e.g., Bio-Rad Laboratories, catalog number: 1851148 )
-20 °C freezer
Refrigerated table-top centrifuge (e.g., Eppendorf, catalog number: 5426000018 )
Erlenmeyer flask
Handcast PAGE system including a 1 mm spacer plate (e.g., Bio-Rad Laboratories, catalog number: 1653311 ), a short plate (e.g., Bio-Rad Laboratories, catalog number: 1653308 ) and a 15-well comb (e.g., Bio-Rad Laboratories, catalog number: 4560016 )
Vertical Electrophoresis Cell (e.g., Bio-Rad Laboratories, catalog number: 1658005 )
Electrophoresis power supply (e.g., Bio-Rad Laboratories, catalog number: 1645050 )
Gel documentation system with filters to image fluorescence of SYBR-GOLD and the fluorescent dye used for labeling (e.g., Bio-Rad Laboratories, catalog number: 17001402 )
P2, P200 and P1000 pipettes
Rocking thermoblock (e.g., Eppendorf, model: ThermoMixer® C , catalog number: 5382000015)
Microscope for imaging (we use a Leica SP8 (Leica, model: Leica TCS SP8 ) equipped with a 63x NA=1.4 oil immersion objective and two HyD detectors)
Tissue grinder (e.g., DWK Life Sciences, Kimble, catalog numbers: 8853000015 or 8853000040 )
Rotator (e.g., Cole-Parmer, Stuart, model: Rotator SB3 )
Magnetic rack (e.g., New England Biolabs, catalog number: S1507S )
Moisture free chamber (see Note 1)
UV/VIS spectrophotometer (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 8000 , catalog number: ND-8000-GL)
Nutator (e.g., Labnet International, model: S0500 )
Software
A probe designer algorithm, e.g., the StellarisTM Probe Designer
(https://www.biosearchtech.com/support/tools/design-software/stellaris-probe-designer, registration required) or the provided smFISHprobe_finder.R script (Supplementary File 1, see Notes 2 and 17)
MS Office Excel to run the interactive probe_calculator.xls sheet (Supplementary File 2)
ImageJ/FIJI (https://imagej.nih.gov/ij/) with the xsPT plugin (https://github.com/Xaft/xs/blob/master/_xs.jar)
Optional: deconvolution software, e.g., Huygens Essentials (https://svi.nl/Huygens-Essential) or DeconvolutionLab2 (Sage et al., 2017; http://bigwww.epfl.ch/deconvolution/deconvolutionlab2/)
R (preferentially with RStudio) for data analysis
smFISH_analysis.R to analyze the sensitivity and specificity of smFISH (Supplementary File 3)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gáspár, I., Wippich, F. and Ephrussi, A. (2018). Terminal Deoxynucleotidyl Transferase Mediated Production of Labeled Probes for Single-molecule FISH or RNA Capture. Bio-protocol 8(5): e2750. DOI: 10.21769/BioProtoc.2750.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Oocyte
Cell Biology > Cell imaging > Fluorescence
Molecular Biology > RNA > RNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,751 | https://bio-protocol.org/exchange/protocoldetail?id=2751&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Dual-sided Voltage-sensitive Dye Imaging of Leech Ganglia
YT Yusuke Tomina
Daniel A. Wagenaar
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2751 Views: 6948
Edited by: Oneil G. Bhalala
Reviewed by: Menghon CheahCarey Y. L. Huh
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
In this protocol, we introduce an effective method for voltage-sensitive dye (VSD) loading and imaging of leech ganglia as used in Tomina and Wagenaar (2017). Dissection and dye loading procedures are the most critical steps toward successful whole-ganglion VSD imaging. The former entails the removal of the sheath that covers neurons in the segmental ganglion of the leech, which is required for successful dye loading. The latter entails gently flowing a new generation VSD, VF2.1(OMe).H, onto both sides of the ganglion simultaneously using a pair of peristaltic pumps. We expect the described techniques to translate broadly to wide-field VSD imaging in other thin and relatively transparent nervous systems.
Keywords: Voltage-sensitive dye imaging Whole-brain recording VoltageFluor Microdissection Dye-loading process
Background
A double-sided microscope is a wide-field fluorescence imaging system consisting of a pair of microscopes precisely aligned for viewing a neuronal preparation from opposite sides and with distinct focal planes at once (Tomina and Wagenaar, 2017). By combining this optical system with a new-generation voltage-sensitive dye (VSD), VoltageFluor (Miller et al., 2012; Woodford et al., 2015), fluorescence signals that encode membrane voltages with high fidelity can be simultaneously captured from neurons at different depths. We applied this pan-neuronal recording system to the nervous system of the medicinal leech, in which we elicited fictive behaviors and quantitatively manipulated membrane potential of identifiable neurons using electrophysiological methods (Tomina and Wagenaar, 2017). Fictive behaviors were induced in an isolated nervous system: local bending was elicited by intracellular stimulation of a pressure-sensitive neuron, while swimming and crawling were elicited by extracellular stimulation of a lateral nerve of a segmented ganglion and nerves of tail brain, respectively. We were able to analyze the dynamics of almost all individual identifiable neurons within a functional unit of the leech nervous system, allowing us to construct functional maps of the roles played by these neurons in various behaviors. The imaging technique potentially is applied to other nervous systems that have multiple layers of somata such as the pedal ganglia of Aplysia.
For successful VSD imaging with a double-sided microscope, three procedures are critical: (1) dissection of the target nervous system, (2) dye loading, and (3) VSD imaging itself. These procedures were not explained in detail in our previous paper (Tomina and Wagenaar, 2017), nor in other studies using the same type of dyes (Miller et al., 2012, Moshtagh-Khorasani et al., 2013, Woodford et al., 2015, Frady et al., 2016).
As part of the dissection process, removing the sheath from the surface of the target ganglion is necessary to ensure that the dye can reach the neurons. For keeping a preparation in a healthy state, it is important to handle the preparation in an adequate way and to load the dye into cells for an appropriate length of time. During VSD imaging, the nervous system must be strictly immobilized in order to suppress motion artifact. All those steps are critical for successful whole-ganglion VSD imaging using a double-sided microscope. This protocol provides the detailed procedures to realize wide-field VSD imaging in a whole ganglion of the leech.
Materials and Reagents
Dissection
Microdissection container, comprising:
The lid of a 35-mm plastic Petri dish (e.g., Nunclon Delta, Thermo Fisher Scientific, catalog number: 153066 )
1.5-mm thick layer of transparent PDMS (Sylgard 184 elastomer, 0.5 mg kit, Dow Corning, catalog number: 4019862 )
Disk of transparent PDMS (13 mm diameter, 0.65 mm thick) with a rectangular window (1.6 x 2.6 mm) cut out of it (Sylgard 184, as above)
Nylon head insect pins #6 (Emil Artl Elephant brand)
Small pins (Fine Science Tools, catalog number: 26002-10 )
Tungsten wires, 50 μm diameter (California Fine Wire, catalog number: MS138 )
Artificial pond water (0.1 % ocean strength salt solution) (e.g., Sea salt, Instant Ocean, catalog number: SS15-10 )
Nervous system of a leech
Note: We use adult medicinal leeches Hirudo verbana (2.5-3 years old), a standard species in neuroethology field, purchased from Niagara Leeches (Niagara Falls, NY, www.leeches.bi). H. medicinalis would be equally acceptable. Leeches were maintained in an aquarium tank (250 x 500 x 300 mm) half filled with artificial pond water with aeration at 15 °C and subjected to 12:12 light:dark cycle.
Coarse dissection container, comprising:
Enclosure (AN-1321, Bud Industries, Digi-Key Electronics, catalog number: 377-1740-ND )
Small aquarium pebbles (e.g., Imagitarium Mini White Aquarium Gravel, PetCo)
Dark PDMS (Sylgard 170 silicone, 0.9 kg kit, Dow Corning, catalog number: 1696157 )
Dye loading
Dye-loading dish connected with an outflow capillary, comprising:
The lid of a 35-mm plastic Petri dish (e.g., Nunclon Delta, Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 153066 )
Capillary glass, standard 1.2 x 0.68 mm, 4” (A-M Systems, catalog number: 627000 )
Epoxy glue (e.g., Slow-cure 30 min Epoxy, Bob Smith Industries Inc.)
Transparent PDMS (Sylgard 184 elastomer, 0.5 kg kit, Dow Corning, catalog number: 4019862 )
Tube for perfusion (Masterflex C-flex tubing, Cole-Parmer Instrument, catalog number: 06424-13 )
Volume-restricting well:
A 3-mm thick slab of PDMS, 25 mm in diameter, with a 16-mm diameter hole cut out of it
1,000 μl pipette tips (e.g., VWR, catalog number: 83007-380 )
200 μl pipette tips (e.g., VWR, catalog number: 53508-783 )
10 μl pipette tips (e.g., Thermo Fisher Scientific, Thermo Scientific, catalog number: 490014-502 )
70% EtOH
VoltageFluor solution
VF2.1(OMe).H (provided by Evan Miller, University of California, Berkeley. Reported in Woodford et al., 2015)
Note: An alternative product can be commercially purchased: FluoVolt Membrane Potential Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: F10488 ).
Dimethyl Sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D4540 )
Pluronic acid (PowerLoadTM Concentrate 100x, Thermo Fisher Scientific, InvitrogenTM, catalog number: P10020 )
Hirudo verbana physiological saline (see Recipes)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P3911 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: 223506 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M9272 )
Glucose (Sigma-Aldrich, catalog number: DX0145 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
VF2.1(OMe).H solution (see Recipes)
VSD imaging
Note: Refer to Tomina and Wagenaar (2017) for details on building a double-sided microscope. Here we describe the use of the microscope.
Recording dish, comprising:
Lid of a 35-mm Petri dish (e.g., Nunclon Delta, Thermo Fisher Scientific, catalog number: 153066 )
PDMS substrate (Sylgard 184 elastomer, see above)
Round cover glass (diameter: 18 mm, thickness: 0.2 mm, Fisher Scientific, Fisherbrand, catalog number: 12-546 )
Medical dressing (Tegaderm transparent film dressing, 3M, catalog number: 9505W , e.g., Amazon)
Modeling clay (Crayola, any color is fine)
Lens cleaning paper (e.g., Tiffen, catalog number: EK1546027T , e.g., Adorama)
Glass capillaries for intracellular recording (standard-wall 1.00 x 0.75 mm with filament, 4”, A-M Systems, catalog number: 615000 )
Suction electrodes for extracellular recording, comprising:
Glass capillary (standard-wall 1.20 x 0.68 mm, 4”, A-M Systems, catalog number: 627000 )
Stainless steel blunt needle with Luer (Component Supply, catalog number: NE-252PL )
2.5-mm mono jack (e.g., CUI, Digi-Key Electronics, catalog number: MJ-2506 )
5-ml Luer-Lok tip Syringe (BD, catalog number: 309646 )
Silver wire (200 μm diameter, California Fine Wire, catalog number: 100183 )
Cast acrylic base, 2” x 0.5” x 0.25”
Petroleum jelly (e.g., Vaseline)
Equipment
Dissection
Microsurgical knife, 5.0 mm blade (SharpPoint, Surgical specialties, catalog number: 72-1551 )
Coarse dissection scissors (e.g., Heritage, model: Electricians Scissors 103C ) for cutting body wall tissue
Medium dissection scissors (e.g., Natsume Seisakusho, catalog number: MB-54-1 ) for dissecting connective and nerve tissues
Microdissection scissors: 2-mm cutting edge vannas spring scissors (Fine Science Tools, catalog number: 15000-03 ) for desheathing of a leech ganglion
Fine forceps (e.g., Dumont #5 Dumostar, Fine Science Tools, catalog number: 11295-10 )
Coarse forceps (e.g., Peer-Vigor Tweezer Swiss #5, Peer, catalog number: 57.0805 )
Stereomicroscope
Note: We use a ZEISS Stemi 2000-CS with W10x/21 eye pieces at 6.5-50x magnification for most of the dissection and a ZEISS SteREO Discovery V8 with 10x/23 eye pieces and a custom focus drive at 80x magnification for desheathing (ZEISS, models: Stemi 2000-CS and SteREO Discovery.V8 ).
LED illuminator with dual gooseneck light guide (Dolan-Jenner Fiber-Lite, model: Mi-LED-US-DG )
Cooling plate base for dissection:
DC Power supply (30 V x 10 A DC, e.g., Yescom, model: 15SDS019-DCP3010D-09 )
Peltier modules (TE Technology, model: HP-127-1.4-2.5-72P )
0.25”-thick aluminum
18-gauge stainless steel
Aquarium glue
Dye loading
Perfusion pump head (Easy-Load II Head, Masterflex L/S, Cole-Parmer Instrument, catalog number: EW-77201-60 )
Perfusion pump driver (Economy drive, Masterflex L/S, Cole-Parmer Instrument, catalog number: 07554-80 )
Miniature dovetail stage (Siskiyou, catalog number: DT3-100 )
Glass cutting ceramic tile (Sutter Instrument, catalog number: CTS )
Pipettor 100-1,000 μl (e.g., VWR, catalog number: 89079-974 )
Pipettor 20-200 μl (e.g., VWR, catalog number: 89079-970 )
Pipettor 0.5-10 μl (e.g., VWR, catalog number: 89079-960 )
Vortexer (e.g., VWR, model: VM-3000 , catalog number: 58816-121)
Note: This product has been discontinued.
Centrifuge (e.g., Spectrafuge, Labnet International, model: C1301-R )
LED illuminator with dual gooseneck light guide (Dolan-Jenner Fiber-Lite, model: Mi-LED-US-DG )
Red filter for illuminator (660-nm long-pass, 0.5” diameter, Edmund Optics, catalog number: 66-045 )
Instrument for drilling a hole in dye-loading/recording dishes (e.g., a lathe such as: Jet Tools, model: BDB-1340A , catalog number: 321102AK)
Optical imaging
Upright fluorescent microscope (Olympus, model: BX51 )
Fluorescence train of an inverted fluorescent microscope (Olympus, model: IX51 )
Water-immersion 20x objective lens for top microscope (Olympus, model: XLUMPlanFLN20XW )
5x objective lens top microscope (Olympus, model: MPlan FLN )
20x objective lens for bottom microscope (Olympus, model: UCPlanFLN )
Vibration isolation table (e.g., Newport, models: LW3048B-OPT or VIS3048-SG2-325A )
Blue LED (LedEngin, model: LZ1-10B200 )
LED controller (according to Wagenaar, 2012)
CCD cameras (Photometrics, model: QuantEM 512SC )
Intracellular amplifiers (A-M Systems, model: Model 1600 )
Four-channel differential amplifier (A-M Systems, model: Model 1700 )
Flaming/Brown micropipette puller (Sutter Instrument, model: P-97 )
Data acquisition board (National Instruments, model: NI USB-6221 )
Procedure
Making tools
Coarse dissection container:
Fill the base of the container with aquarium pebbles to about half its height.
Pour black Sylgard (PDMS) into the container up to 10 mm from the top.
Note: It is critical that the pebbles are generously covered.
Leave the PDMS to set overnight at room temperature or in a lab oven set to 65 °C.
Microdissection container:
Pour 0.65-mm thick layer of transparent Sylgard (PDMS) into one plastic Petri dish, and a 2-mm thick layer into another.
Allow the PDMS to set (as above).
Use a microsurgical knife to cut a disk (13 mm in diameter) with an open window (1.6 x 2.6 mm) out of the 0.65-mm thick PDMS layer.
Dye-loading dish (Figure 1):
Into the center of a plastic Petri dish, drill a hole of just over 1.2 mm diameter for a capillary to fit through using a belt drive bench lathe.
Heat capillary glass over a gas flame and shape it into an ‘L’ with a short leg of 7 mm. Cut the long leg to 10 mm.
Insert the short leg of the L into the hole from the outside.
Glue the capillary to the dish with epoxy glue.
Connect the end of the capillary with a short tube connected to a short (18 mm) straight capillary. This short capillary is connected to the tubing of the perfusion pump.
Pour a 2-mm-thick base layer of PDMS into the Petri dish and let it set overnight.
Cut a 2-mm-diameter hole out of the PDMS directly over the capillary and verify that liquid can pass through the capillary.
Figure 1. Double-sided dye-loading system. A. Top view of a dye-loading dish. In the center of the dish there is an outflow hole for loading dye onto the bottom surface of the ganglion. The hole is connected to capillary and tube for circulation pumping. A well formed with PDMS substrate around the hole helps reduce the required volume of VSD solution. The dish is placed on two aluminum blocks so that the dish, the capillary, and the tube are stably positioned. B. Side view of a dye-loading dish. Glass capillary inserted into the bottom hole of the dish is stabilized with epoxy glue (yellow matter). (For cleaning, the dish and tube can be separated by pulling out the non-glued part of capillary and tube.) C. Spatial arrangement of outflows and intakes of the dye-loading system. PDMS disk with a target ganglion on its center window is put in the center of the well so that the outflow from the bottom side reaches the bottom surface of the ganglion. Intake capillaries are positioned close to the edge of the well so as not to bump the PDMS disk. Top outflow is placed just above the top surface of the ganglion.
Recording dish
Make a hole (14 mm in diameter) in the center of the plastic dish.
Note: This can be easily done using a laser cutter, a lathe, or a mill. We have found it difficult to achieve clean holes with a handheld drill.
Place an 18 mm diameter round cover glass on the bottom of the center hole, apply PDMS around the rim of the cover glass to adhere it to the Petri dish, and leave it to set overnight.
Pour transparent Sylgard (PDMS) into the dish to a thickness of 1.5 mm, again leaving it to set overnight.
Cut a circle out of the PDMS slightly larger than the hole in the bottom of the dish.
Completely remove any pieces of PDMS substrate from the cover glass.
Dissection (Video 1: Coarse dissection, Video 2: Microdissection)
Video 1. Isolation of the leech nervous system (a short chain of ganglia). 1. Anesthetize a leech in ice-cold saline. 2. Pin down the leech’s head and tail, using insect pins on a coarse dissection container. 3. Cut the dorsal skin along with the midline with a pair of dissection scissors. 4. Cut open the skin and pin it down. 5. Find a target ganglion for imaging. 6. Use a microsurgical knife to expose a lateral nerve root to be extracellularly recorded, if needed. 7. Dissect away the blood sinus surrounding the target ganglion. 8. Dissect away the blood sinus with the lateral nerves of the ganglion. 9. Isolate a short chain of ganglia. 10. Aspirate the isolated preparation into a pipette.
Video 2. Double-sided desheathing of a leech ganglion. 1. Position a disk of transparent PDMS in the center of the container. 2. Transfer the ganglion into a microdissection container filled with cold saline. 3. Place the ganglion over the disk of transparent PDMS. 4. Use short pieces of tungsten wire to pin down sinus (the ganglion’s ventral side is up). 5. Stretch the connectives to apply tension to the ganglion’s sheath. 6. Zoom in on the target ganglion. 7. Remove the ventral sheath from the glial packet in the following order: the posterior, the central, and the lateral glial packets. 8. Check that the cells are not displaced or damaged. 9. Unpin the ganglion, flip the dorsal side up, then pin it down. 10. Zoom in on the ganglion. 11. Remove the dorsal sheath from the lateral glial packets (posterior to anterior). 12. Check that the cells are not displaced or damaged. 13. Unpin the ganglion, flip the ventral side up, then pin it down. 14. Check that the cells are not displaced or damaged.
Place a leech in a saline-filled plastic container with an ice cube made of frozen saline and allow the leech to cool down for 10-20 min before dissection.
Note: When anesthetized sufficiently, leeches do not show the fast reflexive twisting-like response that unanesthetized leeches display when pinned down at their head or tail.
Transfer the leech to a ‘coarse dissection container’ (see ‘Materials and Reagents’) that has been kept in a fridge or freezer.
Use insect pins to immobilize the leech for dissection.
Note: Throughout the dissection, keep the container set on a cooling plate (see ‘Equipment’) and use a stereomicroscope for all procedures.
Cut away tissue as needed to isolate the central nervous system of the leech (either the whole nerve cord or a short chain of ganglia).
Note: The blood sinus surrounding the nervous system needs to be dissected away only around the ganglion targeted for imaging, not around any other ganglia.
Aspirate the isolated preparation into a pipette and transfer it into a microdissection container (see ‘Materials and Reagents’) filled with saline.
Place this container on a cooling plate and use a high-magnification stereomicroscope for the remaining steps.
Position the disk of transparent PDMS (see ‘Materials and Reagents’) in the center of the container.
Place the target ganglion over disk, ventral side up, centered over the window so that the PDMS substrate does not touch the dorsal side of the ganglion.
Use short pieces of tungsten wire to pin down blood sinus tissue that surrounds the lateral nerve roots to the disk.
Using micro-scissors or a microsurgical knife, carefully and cleanly remove the sheath from the ventral and dorsal surfaces of the ganglion with the following steps:
Remove the ventral sheath (Figure 2A).
Carefully unpin the ganglion as necessary to flip it upside down over the window in the PDMS disk, taking care not to damage any neurons in the process.
Remove the dorsal sheath (Figure 2B).
Note (very important): Throughout the procedure, keep the ganglion cool by replacing the saline in the dish with fresh cold saline every 2-3 min using plastic pipettes until ready for dye loading. Time after desheathing is critical. Desheathing should be done within 15-20 min.
Figure 2. Desheathed ganglion. For voltage-sensitive dye loading, sheath tissue covering the target ganglion (e.g., the 10th segmental ganglion) is removed from both ventral (A) and dorsal (B) sides. ‘R’ indicates the right side of the ganglion, i.e., the animal’s right side when oriented dorsal side up. Scale bars = 100 μm.
Dye loading
Prepare 2 ml of VSD solution (800 nM VF2.1(OMe).H) in leech saline containing 1% pluronic acid, see Recipes) and leave it at room temperature for at least an hour in the dark.
Note: Using freshly made cold VSD solution results in significantly compromised staining and hence a dramatic drop in signal quality. Make sure that dye loading is carried out under dim red light to avoid bleaching the dyes.
Place the ‘volume-restricting well’ into the ‘dye-loading dish’ (see ‘Materials and Reagents’), centered over the bottom outflow capillary.
Position the top outflow capillary loosely over the center of the well.
Fill the well with VSD solution, and dip the two intake capillaries into the solution near the edge of the well.
Set both peristaltic pumps to a flow rate of about 1.1 ml/min (speed knob level 2), and verify that perfusion works well.
Note: Make sure that no bubbles accumulate inside the outflow capillaries. If bubbles are stuck inside the capillaries, temporarily increase the pumping speed to eject the bubbles. Removing bubbles must be done before initiation of VSD staining.
Transfer the PDMS disk with the ganglion still attached to it into the well in the dye-loading dish and use one or two insect pins to secure it with the ganglion hanging over the outflow capillary (Figure 1A).
Note: The ganglion is ‘hanging’ below the disk at this time with the dorsal side facing down.
Bring the top outflow capillary close to the ganglion (about 1-mm distance; Figure 1C) and use both peristaltic pumps to circulate the VSD solution (1.1 ml/min flow rate) for 8 min.
Flip the PDMS disk with the ganglion attached to it upside down within the well (so the ganglion is on top of the disk and the dorsal side is facing up), taking care to keep it centered over the bottom outflow capillary.
Use both peristaltic pumps to circulate the VSD solution for a further 12 min.
Note: For well-balanced brightness on the both sides of the imaged preparation, what will be the bottom of the preparation must be stained more strongly than the top because the excitation light onto the top focus plane is brighter than that onto the bottom focus plane. The top outflow more efficiently stains a ganglion than the bottom outflow, so the choice of 8 min circulation in Step C7 and 12 min in Step C9 causes the dorsal side to be more strongly stained than the ventral side. This is by design: it compensates for the reduced excitation efficiently at what will be the bottom side of the ganglion during imaging.
Gently wash the preparation with cold saline after dye loading and completely replace VSD-containing saline with normal cold saline.
Clean the outflows tubes and capillaries by circulating with 70% EtOH and distilled water.
Note: This can be done after imaging.
Optical imaging
Stabilize the target ganglion for imaging by tightly pinning down blood sinus tissue that surrounds the nerve roots to the PDMS disk and by sandwiching adjacent connectives between small pieces of medical dressing (Figure 3C), which must also be pinned down, to minimize any motion artifacts.
Place a small amount of petroleum jelly along the rim of the cover glass of a ‘recording dish’ (see ‘Materials and Reagents’; Figure 3A).
Place the disk with the ganglion in the center of the recording dish, pushing it down into the petroleum jelly.
Pull blood sinus tissue around the adjacent connectives from the ganglion so that the tissue can be tightly pinned down onto the periphery PDMS substrate of the recording dish (Figure 3B).
Clean the bottom surface of the cover glass with lens cleaning paper before imaging.
Figure 3. A recording dish for double-sided VSD imaging. A. Top view of the center area of recording dish (top) and a schematic frontal section view (bottom). Before placing a PDMS disk with a preparation into the dish, petroleum jelly is applied to the periphery of the cover glass. B. Top view of PDMS disk with a preparation set on the cover glass (top) and a schematic frontal section view (bottom). To minimize motion artifacts, tension is created by pinning the blood sinus tissues around the adjacent ganglia down onto the PDMS substrate of the outer area of the dish. C. An adjacent connective sandwiched between two pieces of medical dressing (top) and a schematic frontal section view (bottom). The pieces of medical dressing are pinned down onto the PDMS disk.
Place the recording dish on the stage of a double-sided microscope (Figures 4A and 4B).
Adjust the orientation of preparation using top (upright) microscope under red light exposure.
Prepare for extracellular and/or intracellular recording by positioning electrodes near target nerves or cell bodies (Figure 4C).
Note: Time interval between the end of dye-loading and the beginning of VSD imaging is typically 20-25 min. Spending much more time here may negatively impact the health of the ganglion.
Figure 4. Double-sided microscope. A. Overview of a double-sided microscope. The fluorescence train of an Olympus BX upright microscope is mounted with a custom focus rack on top of the body of an Olympus IX inverted microscope. Images are acquired with two CCD cameras. B. Top and bottom 20x objectives precisely aligned for dual-sided VSD imaging. A recording dish is put in the cutout (white) of the plastic stage. Sticky clay is used for fixing the position of the dish. C. Simultaneous electrophysiology and double-sided VSD imaging. The top side of the preparation is accessible to both intracellular and extracellular electrodes.
Aspirate target nerves into suction electrodes and/or impale target cells.
Bring top and bottom surfaces of the ganglion coarsely into focus using top and bottom objectives.
Adjust the brightness of images to obtain the best brightness but not to saturate the CCD cameras using the intensity control of the LED controller or the aperture stop of the microscope.
Determine the final focus for top and bottom imaging.
Note (important): Throughout all these preparations, frequently replace saline with cold saline.
Start VSD imaging/electrophysiological trial using VScope (Wagenaar, 2017).
Note: Make sure that optical imaging is carried out in dark surroundings.
After finishing the VSD imaging experiment, acquire snapshots of both top and bottom aspects of the ganglion at different focusing depths for later creation of ‘focus-stacked’ images of the ganglion (Figure 5). These will be used for drawing for Regions of Interest (ROIs) in VScope.
Figure 5. Visualizing the ganglion. A. Single snapshot image of the ventral aspect of the 10th ganglion as captured by top camera. B. The same image after processing with adaptive contrast enhancement (ACE) filter. C. Focus-stacked image constructed from multiple snapshots of the ventral aspect at different depths. D. The same image after processing with ACE filter. Scale bars = 100 μm.
Data analysis
Even during an ongoing experiment, VScope (Wagenaar, 2017) can be used to check if the acquired optical signals show neuronal activity (spontaneous activity, stimulus-induced response, or fictive behavior). The rest of the analysis is usually performed after the end of an experiment.
Draw ROIs in focus-stacked images using VScope’s ‘adaptive contrast enhancement’ filter (Figure 5), and then transfer ROI information to individual trials.
Load the data into Octave using the functions provided with VScope.
Clean up VSD imaging data using motion correction and debleaching algorithms (Tomina and Wagenaar, 2017).
Perform further statistical analysis as relevant to your experiment, e.g., using Octave (Figure 6).
Check that intracellular recording matches VSD signals from selected neurons to confirm the reliability of optical recording. Also check whether stereotypical motor patterns are observed in representative neurons like ventral/dorsal motor neurons (DI1, VI2, DE3, and VE4) especially when experiments involve fictive behaviors (Figure 6).
Figure 6. Double-sided VSD imaging. A and B. Dual surface images (ventral in A; dorsal in B) simultaneously captured with two CCD cameras. Scale bars = 100 μm. C. Selected electrophysiological and VSD traces during fictive swimming: Extracellular recording from a nerve root in a posterior segment (DP nerve of 13th ganglion) showing rhythmic dorsal excitatory motor neuron bursts; Intracellular recording and simultaneous optical signal from left AE cell (a motor neuron, marked with *) show matching membrane potential oscillations; VSD signals from the ventral surface: bilateral AE cells and Retzius cells (a neuromodulatory neuron); VSD signals from the dorsal surface: dorsal and ventral inhibitory and excitatory motor neurons DI-1, VI-2, DE-3, and VE-4. Scale bars = 1 sec for time, 10 mV for membrane potential and 0.2% ΔF/F for fluorescence signals.
Note: Sample data, codes and detailed application manual are available in Dryad Digital Repository (https://doi.org/10.5061/dryad.m20kh).
Notes
Dissection should be done quickly and efficiently (typically 10-30 min for the isolation of the leech nervous system, 15-20 min for double-sided desheathing), and saline should be replaced with cold fresh saline frequently (every 2-3 min) with a pipette, because the health of the leech nervous system is critical for the success of experiments.
To suppress motion artifact from contractile tissue within sheath around the nerve cords, connectives and lateral nerves should be physically stretched by pinning down the remaining blood sinus onto PDMS substrate after dye loading. If non-negligible motion artifact is observed during imaging, the strength of its stretch should be increased.
Stocks of VF2.1 (OMe).H dissolved in DMSO should be kept in the refrigerator at 4 °C. To maintain the quality of staining condition, do not keep the dye at room temperature or in the deep freezer.
Note: According to a manual of a commercial product of VoltageFluor (FluoVolt Membrane Potential Kit), this product should be stored at 2-8 °C.
We qualitatively assess how well our specimens were stained using the fluorescent images and signals obtained during the experiment (examples shown in Figures 5 and 6). This is presently the only way to confirm that the staining process went well. Looking for visual changes in a ganglion during dye loading does not provide reliable information regarding the quality of staining.
Note: We recommend that beginners of VSD imaging in the leech first practice to obtain consistent results between intracellular recordings and VSD signals by targeting a Retizus cell or any other cells that are easy to impale.
Recipes
Hirudo verbana physiological saline
Note: Adjust pH to 7.4 with NaOH or HCl.
800 nM VF2.1(OMe).H solution (1 ml)
Aliquot 8 μl of 100 μM VF2.1(OMe).H (stock solution in DMSO, kept in the refrigerator) in a micro-tube and keep them in the refrigerator in advance
Mix this with 10 μl of pluronic acid
Add leech saline to make its final volume 1 ml and vortex it
Note: This recipe applies to commercially available VoltageFluor dye.
Acknowledgments
We thank Evan Miller for supplying the VF2.1(OMe).H dye; Annette Stowasser for her role in developing a prototype of the double-sided microscope and many helpful conversations; Angela Bruno for useful discussions regarding data analysis; Ng Cai Tong for reading and checking the manuscript. This work was supported by the Burroughs Welcome Fund through a Career Award at the Scientific Interface and by the National Institute of Neurological Disorders and Stroke through grant R01 NS094403 (both to DAW). YT was supported by JSPS Overseas Research Fellowships. This protocol was adapted from procedures published in Tomina and Wagenaar (2017). The authors of this work declare no conflicts of interest.
References
Frady, E. P., Kapoor, A., Horvitz, E. and Kristan, W. B., Jr. (2016). Scalable semisupervised functional neurocartography reveals canonical neurons in behavioral networks. Neural Comput 28(8): 1453-1497.
Miller, E. W., Lin, J. Y., Frady, E. P., Steinbach, P. A., Kristan, W. B., Jr. and Tsien, R. Y. (2012). Optically monitoring voltage in neurons by photo-induced electron transfer through molecular wires. Proc Natl Acad Sci U S A 109(6): 2114-2119.
Moshtagh-Khorasani, M., Miller, E. W. and Torre, V. (2013). The spontaneous electrical activity of neurons in leech ganglia. Physiol Rep 1(5): e00089.
Tomina, Y. and Wagenaar, D. A. (2017). A double-sided microscope to realize whole-ganglion imaging of membrane potential in the medicinal leech. Elife 6.
Wagenaar, D. A. (2012). An optically stabilized fast-switching light emitting diode as a light source for functional neuroimaging. PLoS One 7(1): e29822.
Wagenaar, D. A. (2017). VScope – data acquisition and analysis for voltage-sensitive dye imaging using multiple cameras and electrophysiology. Journal of Open Research Software 5: 23.
Woodford, C. R., Frady, E. P., Smith, R. S., Morey, B., Canzi, G., Palida, S. F., Araneda, R. C., Kristan, W. B., Jr., Kubiak, C. P., Miller, E. W. and Tsien, R. Y. (2015). Improved PeT molecules for optically sensing voltage in neurons. J Am Chem Soc 137(5): 1817-1824.
Copyright: Tomina and Wagenaar. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Tomina, Y. and Wagenaar, D. A. (2018). Dual-sided Voltage-sensitive Dye Imaging of Leech Ganglia. Bio-protocol 8(5): e2751. DOI: 10.21769/BioProtoc.2751.
Tomina, Y. and Wagenaar, D. A. (2017). A double-sided microscope to realize whole-ganglion imaging of membrane potential in the medicinal leech. Elife 6.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Live-cell imaging
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,752 | https://bio-protocol.org/exchange/protocoldetail?id=2752&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Visualization of RNA 3’ ends in Escherichia coli Using 3’ RACE Combined with Primer Extension
XW Xun Wang
HJ Heung Jin Jeon
MN Monford Paul Abishek N
JH Jin He
HL Heon M. Lim
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2752 Views: 7823
Edited by: Gal Haimovich
Reviewed by: Yi Zhang
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
In this assay, 3’ RACE (Rapid Amplification of cDNA 3’ Ends) followed by PE (primer extension), abbreviated as 3’ RACE-PE is used to identify the mRNA 3’ ends. The following protocol describes the amplification of the mRNA 3’ ends at the galactose operon in E. coli and the corresponding visualization of the PCR products through PE. In PE, the definite primer is 5’ end-labeled using [γ-(32) P] ATP and T4 polynucleotide kinase, which anneals to the specific DNA molecules within the PCR product of the 3’ RACE. The conventional PE can only be used to locate the 5’ end of an mRNA transcript since reverse transcriptase (RTase) polymerizes only in the 5’ → 3’ direction. Thus, Taq polymerase is used instead of RTase, PCR is performed. Therefore, we are able to locate the 3’ end of the mRNA using this assay. The relative amount of the 3’ end can be directly visualized and quantified by way of separating DNA products in a denaturing 8% urea-PAGE (Polyacrylamide Gel Electrophoresis) gel. The exact position of the 3’ ends can be sequenced by comparison of these final DNA products with the corresponding DNA sequencing ladder.
Keywords: 3’ RACE Primer extension RNA 3’ ends E. coli Galactose operon
Background
The synthesis of the mRNA 3’ end is an important step in E. coli that produces a stable messenger RNA (mRNA). In eukaryotic cells, the mRNA 3’ end formation is through a cleavage from an internal phosphodiester bond, followed by the addition of a poly (A) tail; whereas in prokaryotic cells, the 3’ ends of mRNAs are generated by termination of transcription or by processing of the primary transcript (Altman and Robertson, 1973; Nudler and Gottesman, 2002; Zhao et al., 1999). Therefore, it is important to analyze the exact position and relative quantity of mRNA 3’ end to understand the mechanism of mRNA generation.
3’ RACE assay is a particular procedure to obtain the 3’ end sequence information of a defined RNA transcript (Sambrook and Russell, 2006). Generally, the experiment procedure starts with ligating the 3’ end of RNA to a synthetic RNA oligo, followed by the synthesis of cDNA using RTase and a complementary primer (3RP) to the RNA oligo. Subsequently, specific cDNA is amplified by PCR using the gene-specific primer and the primer, 3RP. Usually, RACE products are directly sequenced, however, based on our modified procedure, PCR products undergo another concluding step of primer extension (PE), which uses Taq polymerase instead of RTase. The labeled primer integrated into the PCR products are extended in a denaturing PAGE gel which makes us visualize and quantify each product. The scheme of 3’ RACE-PE is presented in Figure 1. The polycistronic gal operon encodes amphibolic enzymes for the amphibolism of the sugar D-galactose (Holden et al., 2003). Using this method, we have identified and quantitated the 3’ ends of the gal operon mRNAs in wild type and mutant strains (Lee et al., 2008; Wang et al., 2014 and 2015).
Figure 1. An illustration of the procedure 3’ RACE-PE in E. coli
Materials and Reagents
Pipettes tips (DNase/RNase-free, Sorenson Bioscience)
1.5 ml centrifuge tube (SARSTEDT, catalog number: 72.690.001 )
Cell culture flasks (Corning, catalog number: 3056 )
20 x 150 mm Test tube (Karter Scientific Labware Manufacturing, catalog number: 212W5 )
Sephadex G-50 column (GE Healthcare, catalog number: 27-5330-01 )
Whatman 3MM paper (GE Healthcare, catalog number: 3017-915 )
Kodak CL-XPosure Film (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 34090 )
Gloves (Ultra TEX Glove, Taeshin Bio Science, catalog number: UT-11 )
E. coli strains (CGSC, the coli genetic stock center) (an example)
Lysozyme (Roche Diagnostics, catalog number: 10837059001 )
TRIZOL (Molecular Research Center, catalog number: TR 118 )
Chloroform (Merck, Sigma-Aldrich, catalog number: C2432 )
Isopropanol (Merck, Sigma-Aldrich, catalog number: I9516 )
Ethanol (Merck, Sigma-Aldrich, catalog number: E7023 )
RNA storage solution (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM7001 )
Alkaline phosphatase (Takara Bio, catalog number: 2250A )
DNase I (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2222 )
RNasin® Ribonuclease Inhibitors (Promega, catalog number: N2111 )
PCI (Phenol:Chloroform:Isoamyl Alcohol) Solution 25:24:1 (Merck, Sigma-Aldrich, catalog number: 77617 )
Sodium acetate (Merck, Sigma-Aldrich, catalog number: S2889 )
RNase and DNase-free water (Bioneer, catalog number: C-9011 )
T4 RNA ligase (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2141 )
The synthesized 3’ RACE RNA oligo: 3’-inverted deoxythymidine (3’-idT) RNA (Dharmacon)
3RP primer (5’AGCATGCGGCCGCTAAGAAC3’)
dNTP mix (10 mM each) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0191 )
HotStarTaq Plus DNA Polymerase (QIAGEN, catalog number: 203603 )
Gal-specific primers (Table 1)
Table 1. Sequence of each galactose operon gene specific primers are listed
T4 Polynucleotide Kinase (New England Biolabs, catalog number: M0201L )
ATP, [γ-32P]- 6,000 Ci/mmol (PerkinElmer, catalog number: NEG002Z250UC )
5’ end labeled PE primer (5’ GAGAGTAGGGAACTGCCA 3’)
5x Developer (Vivid X-RAY DEVELOPER, Duksan (DS) Lab, catalog number: 0514_00004 )
5x Fixer (Vivid X-RAY RAPID FIXER, Duksan (DS) Lab, catalog number: 0514_00003 )
Tryptone (BD, DifcoTM, catalog number: 211705 )
Yeast extract (BD, DifcoTM, catalog number: 212750 )
Sodium chloride (NaCl) (Merck, Sigma-Aldrich, catalog number: 746398 )
Galactose (Merck, Sigma-Aldrich, catalog number: G5388 )
Acrylamide (Merck, Sigma-Aldrich, catalog number: V900845 )
Bis-acrylamide (Merck, Sigma-Aldrich, catalog number: V900301 )
5x TBE (Bioneer, catalog number: C-9002 )
Urea (Merck, Sigma-Aldrich, catalog number: U5128 )
Ammonium persulfate (Merck, Sigma-Aldrich, catalog number: 248614 )
TEMED (Merck, Sigma-Aldrich, catalog number: T9281 )
Formamide (Merck, Sigma-Aldrich, catalog number: F9037 )
0.5 M EDTA, pH 8.0 (Bioneer, catalog number: C-9007 )
Xylene cyanol (Sigma-Aldrich, catalog number: X4126 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
1 M Tris-HCl, pH 8.0 (Bioneer, catalog number: C-9006 )
Sucrose (Merck, Sigma-Aldrich, catalog number: S7903 )
Omniscript RT Kit (QIAGEN, catalog number: 205111 )
Sigmacote (Sigma-Aldrich, catalog number: SL2 )
LB + 0.5% galactose (see Recipes)
8% sequencing solution (see Recipes)
8% Urea-PAGE gel (see Recipes)
2x gel loading mix (see Recipes)
Protoplasting buffer (see Recipes)
Equipment
Automatic pipette aid (Thermo Fisher Scientific, Thermo ScientificTM, model: S1 Pipette Filler )
Pipettes (Gilson Company, USA)
37 °C shaking incubator (Hanbaek Scientific Co., Korea (S))
37 °C and 42 °C heat block (FINEPCR, Korea (S))
Spectrophotometer (BECKMAN COULTER, USA)
Vortex-Genie 2 (Scientific Industries, model: Vortex-Genie 2 )
4 °C micro-centrifuge (Beckman Coulter, USA)
NanoDrop 1000 (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 1000 )
PCR machine (Bio-Rad Laboratories, USA)
Shallow fixer tray (Bio-Rad Laboratories, USA)
Sequencing gel electrophoresis apparatus (LABREPCO, USA)
X-ray cassette (Duksan (DS) Lab, Korea (S))
Power supply (Bio-Rad Laboratories, USA)
Autoclave (Dong Won Scientific Corp, Korea (S))
Software
ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, X., Jeon, H. J., Abishek N, M. P., He, J. and Lim, H. M. (2018). Visualization of RNA 3’ ends in Escherichia coli Using 3’ RACE Combined with Primer Extension. Bio-protocol 8(5): e2752. DOI: 10.21769/BioProtoc.2752.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > RNA
Molecular Biology > RNA > 3' end analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,753 | https://bio-protocol.org/exchange/protocoldetail?id=2753&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo Analysis of Cyclic di-GMP Cyclase and Phosphodiesterase Activity in Escherichia coli Using a Vc2 Riboswitch-based Assay
YL Ying Liu*
Hyunhee Kim*
Ute Römling
*Contributed equally to this work
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2753 Views: 6688
Edited by: Dennis Nürnberg
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
Cyclic di-guanosine monophosphate (c-di-GMP) is a ubiquitous second messenger that regulates distinct aspects of bacterial physiology. It is synthesized by diguanylate cyclases (DGCs) and hydrolyzed by phosphodiesterases (PDEs). To date, the activities of DGC and PDE are commonly assessed by phenotypic assays, mass spectrometry analysis of intracellular c-di-GMP concentration, or riboswitch-based fluorescent biosensors. However, some of these methods require cutting-edge equipment, which might not be available in every laboratory. Here, we report a new simple, convenient and cost-effective system to assess the function of DGCs and PDEs in E. coli. This system utilizes the high specificity of a riboswitch to c-di-GMP and its ability to regulate the expression of a downstream β-galactosidase reporter gene in response to c-di-GMP concentrations. In this protocol, we delineate the construction of this system and its use to assess the activity of DGC and PDE enzymes.
Keywords: Cyclic di-guanylate monophosphate (c-di-GMP) Diguanylate cyclase (DGC) Phosphodiesterase (PDE) Riboswitch β-Galactosidase
Background
Cyclic-di-GMP is an important and ubiquitous second messenger in bacteria, which regulates a variety of processes, such as motility-to-sessility transition, biofilm formation, virulence, and cell cycle progression (Römling et al., 2013). The GG(D/E)EF domain has diguanylate cyclase (DGC) activity and it is responsible for the synthesis of c-di-GMP from two GTPs, which is a two-step reaction with 5’-pppGpG as intermediate and two molecules of pyrophosphate as by-products (Ryjenkov et al., 2005). Phosphodiesterases (PDE) with an EAL or an HD-GYP domain hydrolyze c-di-GMP into linear 5’-pGpG (Schmidt et al., 2005) and GMP (Ryan et al., 2006), respectively.
Several tools have been developed to monitor intracellular cyclic di-nucleotide levels and to identify proteins involved in cyclic di-nucleotide signaling, for example, protein-based fluorescence resonance energy transfer (FRET) biosensor (Christen et al., 2010), riboswitch-based fluorescent biosensor (Kellenberger et al., 2015), and riboswitch-based dual-fluorescence reporter (Zhou et al., 2016). However, these tools monitor altered fluorescence of reporters and require the access to flow cytometry or fluorescence microscopy. Here, we report the development of an alternative assay to monitor the intracellular c-di-GMP concentration, namely by monitoring the alteration in β-galactosidase activity in agar-growing cells. For that, the Vc2 riboswitch (Sudarsan et al., 2008) is fused translationally to lacZY and integrated into the chromosome of E. coli strain TOP10. Vc2 is an ‘off’ riboswitch from Vibrio cholerae and thus down-regulates the expression of β-galactosidase when c-di-GMP is bound (Figure 1). The stable integration into the Tn7 attachment site in the chromosome of E. coli avoids copy number effects and eliminates the need to use an antibiotic resistance marker. Changes in c-di-GMP levels are subsequently translated to the alteration in β-galactosidase expression, which is reflected by the color change of the colony growing on an agar plate containing 5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal). This assay can be used, for instance, to reveal the function of proteins under physiological condition and to assess the enzymatic activity of proteins that are challenging to be purified and tested in vitro. However, the Vc2-based assay described here is a qualitative assessment of the change in intracellular c-di-GMP concentration. Quantification is not crucial for a screening assay, but would be advantageous in, for example, measuring the activity of enzymes. We have demonstrated that the Vc2-based assay can be exploited to verify the activity of both DGCs and PDEs in vivo (El Mouali et al., 2017).
Figure 1. The principle of a riboswitch-based screening system. The Vc2 riboswitch is located upstream of the β-galactosidase open reading frame to control its expression in response to the variation in c-di-GMP concentration. When c-di-GMP is present in high abundance due to the overexpression of DGCs, the expression of β-galactosidase is down-regulated resulting in a white colony on an X-gal containing plate. In contrast, when PDEs are overexpressed, generating low intracellular c-di-GMP concentration, the colony is blue. In E. coli TOP10 wild type cells, there are residual amounts of c-di-GMP, resulting in a light blue colony (adapted from El Mouali et al., 2017).
Materials and Reagents
PCR tubes
Petri dish 92 x 16 mm (SARSTEDT, catalog number: 82.1472.001 )
Syringe filters, 0.2 μm pore size (SARSTEDT, catalog number: 83.1826.001 )
Microcentrifuge tubes of 1.5 ml (SARSTEDT, catalog number: 72.690.001 )
Pipette tips (1,000 μl: SARSTEDT, catalog number: 70.762.100 ; 1-200 μl: Corning, catalog number: 4804 ; 0.1-10 μl: Gilson, catalog number: F171103 )
Spectrophotometer cuvettes (SARSTEDT, catalog number: 67.742 )
3-part disposable HSW SOFT-JECT® syringes (5 ml: Henke Sass Wolf, catalog number: 5050.X00V0 ; 10 ml: Henke Sass Wolf, catalog number: 5100.X00V0 )
Aluminum foil
Plasmids used in this study:
Calcium chloride competent E. coli TOP10 cells (Hanahan, 1983)
Primers used in this study (ordered from Sigma-Aldrich):
aThe restriction sites are underlined.
GenElute Plasmid Miniprep Kit (Sigma-Aldrich, catalog number: PLN350 )
Sterile distilled, deionized water (diH2O)
Phusion High-fidelity DNA polymerase (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: F530S )
dNTP mix (10 mM each) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0192 )
Agarose (Sigma-Aldrich, catalog number: A9539 )
SmartLadder for DNA: 200-10,000 bp (Eurogentec, catalog number: MW-1700-10 )
GelRedTM nucleic acid gel stain (Biotium, catalog number: 41003 )
NotI restriction enzyme (New England Biolabs, catalog number: R0189S )
PacI restriction enzyme (New England Biolabs, catalog number: R0547S )
PCR purification kit (QIAGEN, catalog number: 28106 )
Rapid DNA ligase kit (Roche Diagnostics, catalog number: 10716359001 )
Taq DNA polymerase with standard Taq buffer (New England Biolabs, catalog number: M0273S )
Sodium chloride (Sigma-Aldrich, catalog number: S7653 )
Tryptone (BD, BactoTM, catalog number: 211705 )
Yeast extract (BD, BactoTM, catalog number: 212750 )
Agar (BD, DifcoTM, catalog number: 281230 )
Tris base (Sigma-Aldrich, catalog number: 93350 )
Glacial acetic acid (Sigma-Aldrich, catalog number: ARK2183 )
EDTA (Sigma-Aldrich, catalog number: E9884 )
Ampicillin sodium salt (Sigma-Aldrich, catalog number: A9518 )
Gentamicin sulfate salt (Sigma-Aldrich, catalog number: G3632 )
L-(+)-arabinose (Sigma-Aldrich, catalog number: A3256 )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sigma-Aldrich, catalog number: I6758 )
Dimethyl sulfoxide (Sigma-Aldrich, catalog number: D8418 )
5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) (Roche Diagnostic, catalog number: 10703729001 )
LB (Luria-Bertani) medium (see Recipes)
LB (Luria-Bertani) agar (see Recipes)
TAE buffer (see Recipes)
100 mg/ml ampicillin stock (see Recipes)
30 mg/ml gentamicin stock (see Recipes)
100 mM IPTG stock (see Recipes)
20 mg/ml X-gal stock (see Recipes)
Equipment
Erlenmeyer flasks (50 ml/100 ml/250 ml)
Pipettes [e.g., PIPETMAN® P20 (Gilson, catalog number: F123600 ), P200 (Gilson, catalog number: F123601 ), or P1000 (Gilson, catalog number: F123602 )]
SureCycler 8800 thermal cycler (Agilent Technologies, model: SureCycler 8800 , catalog number: G8800A)
HeraeusTM PicoTM 17 Microcentrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM PicoTM 17 , catalog number: 75002410)
Mini-Sub® cell GT Horizontal Electrophoresis System (Bio-Rad Laboratories, catalog number: 1704406 )
15-well comb (Bio-Rad Laboratories, catalog number: 1704464 )
Sub-Cell GT UV-Transparent Mini-Gel Tray (Bio-Rad Laboratories, catalog number: 1704436 )
Electrophoresis power supply
Heraeus® microbiological incubator (Thermo Fisherer Scientific, Thermo ScientificTM, model: Heraeus® microbiological incubator )
Multitron Standard shaker (INFORS HT)
Gel DocTM XR+ Gel Documentation System (Bio-Rad Laboratories, catalog number: 1708195 )
BioPhotometer (Eppendorf, model: 6131 )
NanoDropTM 2000c Spectrophotometers (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000c , catalog number: ND-2000C)
Thermomixer compact (Eppendorf, model: 5350 )
Digital camera
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, Y., Kim, H. and Römling, U. (2018). In vivo Analysis of Cyclic di-GMP Cyclase and Phosphodiesterase Activity in Escherichia coli Using a Vc2 Riboswitch-based Assay. Bio-protocol 8(5): e2753. DOI: 10.21769/BioProtoc.2753.
Download Citation in RIS Format
Category
Microbiology > Microbial signaling > Secondary messenger
Microbiology > Microbial cell biology > Cell-based analysis
Molecular Biology > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,754 | https://bio-protocol.org/exchange/protocoldetail?id=2754&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mono Sodium Urate Crystal-induced Peritonitis for in vivo Assessment of Inflammasome Activation
Marianne R. Spalinger
Michael Scharl
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2754 Views: 8442
Edited by: Jia Li
Reviewed by: Lokesh KalekarKathrin Sutter
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Due to its particulate material, mono-sodium urate (MSU) crystals are potent activators of the NOD-like receptor NLRP3. Upon activation, NLRP3 induces the formation of inflammasome complexes, which lead to the production and release of mature IL-1β. Bioactive IL-1β is a potent activator of innate immune responses and promotes recruitment of inflammatory cells, including neutrophils from the blood into damaged/inflamed tissues. This protocol describes a method to study in vivo inflammasome activation via intraperitoneal injection of MSU crystals. MSU-injection results in a drastic increase of intraperitoneal IL-1β levels, promoting neutrophil infiltration. Early-stage neutrophil numbers correlate with the amount of released IL-1β and can be used as a read-out for the extent of in vivo inflammasome activation. In addition, this protocol might also be used as a sterile peritonitis model, to investigate mechanisms of neutrophil recruitment to the peritoneum, or as a means to obtain large numbers of in vivo activated neutrophils.
Keywords: (sterile) Peritonitis Inflammasome IL-1 NLRP3 NOD-like receptors Innate immunity Neutrophil recruitment
Background
Innate immune cells recognize pathogens through a set of pattern recognition receptors (PRR), which bind to evolutionarily conserved structures on the pathogen surfaces or through ligation of other danger-associated molecular patterns. One family of these receptors are the NOD-like receptors (NLR), which react to the intracellular presence of invading pathogens and/or intracellular danger signals (Meylan et al., 2006). Several PRR, including some NLRs are capable of inducing the formation of so-called inflammasome complexes, which mediate the proteolytic activation of pro-IL-1β, pro-IL-18, and other IL-1 family cytokines (Martinon et al., 2002). Due to the potent pro-inflammatory nature of IL-1β and IL-18, inflammasome activation is a highly regulated, two-step process, involving limited transcription of pro-IL-1β/pro-IL-18, and highly regulated activation of inflammasome receptors (Martinon et al., 2009). NLRP3, one of the most studied inflammasome receptors, responds to a great variety of intracellular danger-associated molecular patterns, including bacterial cell wall components (Martinon et al., 2004), damaged mitochondria (Zhou et al., 2011), and particulate materials (Martinon et al., 2006). Due to their particulate structure, mono sodium urate (MSU) crystals are very potent NLRP3 activators (Martinon et al., 2006), which are widely used for in vitro studies of NLRP3 activation.
In addition to its use for in vitro experiments, MSU can also be used to study the in vivo relevance of inflammasome activation. Here, we described an MSU-induced peritonitis model to easily and quickly study the in vivo relevance and extent NLRP3-inflammasome activation, e.g., upon genetic deletion of proteins that are involved in NLRP3 activation (Chen et al., 2006, Spalinger et al., 2016). In the MSU-induced peritonitis, the first wave of infiltrating immune cells consists mainly of neutrophils, and in the early phase of peritonitis, the number of infiltrating neutrophils correlates with the extent of inflammasome activation and with the production of mature IL-1β (Chen et al., 2006; Spalinger et al., 2016).
Materials and Reagents
Pipette tips
Insulin syringes (BD, catalog number: 324826 )
5 ml syringes (BD, catalog number: 302187 )
25 G needles (Terumo, catalog number: GS-351 )
50 ml tubes (Corning, Falcon®, catalog number: 352070 )
FACS tubes with lid (Corning, Falcon®, catalog number: 352058 )
Mice: C57BL/6 adult females (THE JACKSON LABORATORY, catalog number: 000664 )
Note: This protocol has been developed for C57BL/6 mice. For other mouse strains, MSU concentration and optimal time until peritoneal lavage should be titrated.
Mono-sodium urate (MSU) crystals (InvivoGen, catalog number: tlrl-msu )
Fluorescent antibody against Ly6G (for example, AlexaFluor647 anti-Ly6G [clone 1A8], BioLegend, catalog number: 127609 )
Fluorescent antibody against Ly6B.2 (also known as 7/4 antigen; for example Fitc anti-Ly6B.2 [clone REA115], Miltenyi Biotec, catalog number: 130-103-318 )
Fluorescent antibody against CD3ε (for example, PE-CF594 anti-CD3ε [clone 145-2C11], BD, BD Biosciences, catalog number: 562286 )
Fluorescent antibody against CD45 (for example, Pacific Blue anti-CD45 [clone 30F11], BioLegend, catalog number: 103126 )
Live-dead discriminator (for example Zombie NIR Fixable Viability Kit, BioLegend, catalog number: 423105 )
Mouse IL-1 beta/IL-1F2 DuoSet ELISA kit (R&D Systems, catalog number: DY401 )
Substrate Reagent Pack (R&D Systems, catalog number: DY999 ) for ELISA
Dulbecco’s modified PBS (Sigma-Aldrich, catalog number: D8537-500ML )
Fetal calf serum (for example, PAN-Biotech, catalog number: P40-47100 )
FACS buffer (see Recipes)
Equipment
Pipettes
Dissection tools (sharp scissors and forceps)
Neubauer cell counting chamber or automated cell counter
Refrigerated benchtop centrifuge
Flow cytometer
ELISA plate reader
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Spalinger, M. R. and Scharl, M. (2018). Mono Sodium Urate Crystal-induced Peritonitis for in vivo Assessment of Inflammasome Activation. Bio-protocol 8(5): e2754. DOI: 10.21769/BioProtoc.2754.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Immunology > Inflammatory disorder > Inflammasome
Cell Biology > Cell-based analysis > Inflammatory response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,755 | https://bio-protocol.org/exchange/protocoldetail?id=2755&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Boron Uptake Assay in Xenopus laevis Oocytes
SW Sheliang Wang
NM Namiki Mitani-Ueno
Junpei Takano
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2755 Views: 7310
Edited by: Tie Liu
Reviewed by: Harrie van Erp
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Boron (B) is essential for plant growth and taken up by plant roots as boric acid. Under B limitation, B uptake and translocation in plants are dependent on the boric acid channels located in the plasma membrane. Xenopus leavis oocyte is a reliable heterologous expression system to characterize transport activities of boric acid channels and related major intrinsic proteins (aquaporins). Here, we outline the protocols for expression of boric acid channels and boric acid uptake assay in Xenopus leavis oocytes.
Keywords: Boric acid Boron ICP-MS NIP Xenopus leavis oocytes
Background
Boron is essential for plant growth but is toxic when it is accumulated. Boron has structural functions in the cell wall through cross-linking of pectic polysaccharides at rhamnogalacturonan II regions (Funakawa and Miwa, 2015). In solution, B exists primarily as boric acid at physiological pH [B(OH)3 + H2O ⇆ B(OH)4- + H+ (pKa = 9.24)]. Boric acid is a small neutral molecule and thus shows significant passive diffusion across biological membranes (Dordas et al., 2000). In addition, plants utilize boric acid channels belonging to major intrinsic protein (MIP, aquaporin) family and borate exporters (BOR family) to maintain B homeostasis (Takano et al., 2008).
Initially, maize PIP1 was expressed in Xenopus leavis oocytes and shown to facilitate boric acid uptake by 30% over the water-injected oocytes (Dordas et al., 2000). Then, Arabidopsis NIP5;1 was shown to facilitate boric acid uptake five to nine-fold over the water-injected oocytes (Takano et al., 2006). Together with the finding that Arabidopsis mutants lacking NIP5;1 activity showed lower B uptake into roots and severe growth defects under low B conditions, NIP5;1 was identified as a boric acid channel. NIP5;1 homologs, NIP6;1 and NIP7;1 from Arabidopsis, Lsi1 (NIP2;1) from rice, NIP2;1 from barley, and TLS1 (NIP3;1) from maize were also shown to facilitate boric acid uptake using Xenopus oocytes (Tanaka et al., 2008; Li et al., 2011, Mitani-Ueno et al., 2011; Schnurbusch et al., 2010; Durbak et al., 2014). Importantly, OsLsi1 transported boric acid, silicic acid, arsenite, and water, and AtNIP5;1 transported boric acid, arsenite, and water, but not silicic acid in Xenopus oocytes (Mitani-Ueno et al., 2011). Xenopus oocytes were also used for characterization of barley Bot1, a borate exporter for high-B tolerance, by electrophysiology (Nagarajan et al., 2015).
As another heterologous expression system, yeast Saccharomyces cerevisiae has been used for transport studies of B. In this system, Arabidopsis BOR1 and yeast ScBOR1 decreased B concentrations in the cells, and thus were characterized as borate exporters (Takano et al., 2002; Takano et al., 2007). In contrast, expression of AtNIP5;1 and its rice ortholog OsNIP3;1 increased boric acid uptake (Hanaoka et al., 2014). As a convenient but indirect assay, survival assay has been employed using Saccharomyces cerevisiae. Expression of BOR1 homologs conferred tolerance to toxic B conditions (Nozawa et al., 2006; Miwa et al., 2007; Sutton et al., 2007; Cañon et al., 2013; Hayes et al., 2015) and expression of NtXIP1;1, AtNIP4;1, HvPIP1;3 and HvPIP1;4 increased sensitivity (Fitzpatrick and Reid 2009; Bienert et al., 2011; Di Giorgio et al., 2016).
Nevertheless, Xenopus oocytes expression system is advantageous for ‘quantitative’ transport studies (Miller and Zhou, 2000; Yesilirmak and Sayers, 2009). It has apparently low intrinsic transport activity for many substrates. It tends to produce comparable levels of membrane proteins in the plasma membrane dependent on the amount of injected cRNA. Recently we utilized these merits for analysis of AtNIP5;1 variants. AtNIP5;1 is localized on the soil-side plasma membrane domain of the outermost root cell layers of roots (Takano et al., 2010). We found that the phosphorylated state of conserved threonine residues in ‘TPX’ repeat in N-terminal region of AtNIP5;1 is associated with the polar localization of NIP5;1 (Wang et al., 2017). Using the AtNIP5;1 variant in which conserved threonines were substituted to alanine, we showed that the polar localization is important for efficient B translocation in plant roots. Importantly, the direct boric acid uptake assay in X. laevis oocytes clarified that the threonine residues are not involved in the boric acid uptake activity of NIP5;1 channel (Wang et al., 2017).
Here, we describe the protocol of boric acid transport assay using Xenopus oocytes (Figure 1) and inductively coupled plasma-mass spectrometry (ICP-MS), which is applicable for various other metalloids and metals.
Materials and Reagents
Glass capillaries (Drummond Scientific, catalog number: 3-000-203-G/X )
Slide glass
Parafilm M (LMS, catalog number: 94-2542-5 )
Petri dishes (Diameter: 3.5 cm and 9.0 cm, LMS, Japan)
Pipette tips
2 ml Eppendorf tube (Eppendorf, catalog number: 022363344 )
Eppendorf safe-lock tubes,1.5 ml (Eppendorf, catalog number: 0030120086 )
Metal-free tube without lids (DigiTUBEs, GL Sciences, catalog number: 8520-50112 )
Syringe with needle
Polypropylene mesh (0.8 mm, Spectrum, catalog number: 146492 )
DigiFILTER 0.45 μm (SCP SCIENCE, catalog number: 010-500-070 )
Xenopus leavis oocytes treated with collagenase (Kitagawa Institute, hita, Japan)
Note: Protocol of harvesting of ovaries from female Xenopus laevis is available (Shi and Carattino, 2017).
pXBG-ev1 vector (Preston et al., 1992; Figure 2)
Gel extraction kit (Sigma-Aldrich, catalog number: NA1111 )
TE buffer
Ultra pure water produced using the MILLI-Q ADVANTAGE A10 purification system (Millipore)
Note: To prepare samples for ICP-MS, do not use glassware made by borosilicate to avoid contamination of B.
mMESSAGE mMACHINE T3 Transcription Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM1348)
Mineral oil (NACALAI TESQUE, CAS number: 8020-83-5)
Boric acid (Wako Pure Chemical Industries, catalog number: 029-02191 )
Nitric acid (HNO3) (For boron determination, Wako Pure Chemical Industries, catalog number: 140-05415 )
Boron standard solution (B 1,000, Wako Pure Chemical Industries, catalog number: 025-16581 )
Modified Barth’s Saline (MBS) buffer with or without Ca2+ (see Recipes)
Sodium chloride (NaCl, Wako Pure Chemical Industries, catalog number: 191-01665 )
Potassium chloride (KCl, Wako Pure Chemical Industries, catalog number: 163-03545 )
Sodium bicarbonate (NaHCO3, NACALAI TESQUE, catalog number: 31212-25 )
Tris-HCl (pH 7.6, Sigma-Aldrich, Roche Diagnostics, catalog number: 10708976001 )
Calcium nitrate tetrahydrate (Ca(NO3)2·4H2O, Wako Pure Chemical Industries)
Calcium chloride dihydrate (CaCl2·2H2O, Wako Pure Chemical Industries, catalog number: 039-00431 )
Magnesium sulfate heptahydrate (MgSO4·7H2O, Wako Pure Chemical Industries, catalog number: 131-00405 )
Sodium penicillin (Wako Pure Chemical Industries, catalog number: 168-23191 )
Streptomycin sulfate (Wako Pure Chemical Industries, catalog number: 196-08511 )
Equipment
Dual-Stage Glass Micropipette (NARISHIGE, model: PC-10 )
Confocal laser scanning microscope (Leica Microsystems, model: Leica TCS SP8 )
Fluorescent microscope (Olympus, model: MVX-10 )
Nanoliter injector (Drummond Scientific, model: Nanoject II )
Stereo microscope (Nikon, model: SMZ-2T )
Incubator (Advantec, model: THS030PA )
Heat digestion system (GL Sciences, model: DigiPREP Jr )
ICP-MS (PerkinElmer, model: ELAN DRC-e )
Autosamplers (PerkinElmer, model: ESI )
Ultrapure water system (Merck, model: MILLI-Q® ADVENTAGE A10 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, S., Mitani-Ueno, N. and Takano, J. (2018). Boron Uptake Assay in Xenopus laevis Oocytes. Bio-protocol 8(5): e2755. DOI: 10.21769/BioProtoc.2755.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > Protein
Plant Science > Plant physiology > Nutrition
Cell Biology > Cell-based analysis > Transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,756 | https://bio-protocol.org/exchange/protocoldetail?id=2756&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Synthetic Genetic Interaction (CRISPR-SGI) Profiling in Caenorhabditis elegans
JC John A. Calarco
AN Adam D. Norris
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2756 Views: 7689
Edited by: Gal Haimovich
Reviewed by: Manish Chamoli
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Genetic interaction screens are a powerful methodology to establish novel roles for genes and elucidate functional connections between genes. Such studies have been performed to great effect in single-cell organisms such as yeast and E. coli (Schuldiner et al., 2005; Butland et al., 2008; Costanzo et al., 2010), but similar large-scale interaction studies using targeted reverse-genetic deletions in multi-cellular organisms have not been feasible. We developed a CRISPR/Cas9-based method for deleting genes in C. elegans and replacing them with a heterologous fluorescent reporter (Norris et al., 2015). Recently we took advantage of that system to perform a large-scale, reverse genetic screen using null alleles in animals for the first time, focusing on RNA binding protein genes (Norris et al., 2017). This type of approach should be similarly applicable to many other gene classes in C. elegans. Here we detail the protocols involved in generating a library of double mutants and performing medium-throughput competitive fitness assays to test for genetic interactions resulting in fitness changes.
Keywords: C. elegans Genetics Combinatorial genetics RNA binding protein Fitness
Background
Large-scale genetic interaction screens using reverse-genetic null alleles have not previously been feasible in animals. RNAi has been used to study genetic interactions in C. elegans by knocking down expression of a large number of different genes in the presence of a single mutant background (Baugh et al., 2005; Lehner et al., 2006). However, this strategy is limited by the variable efficacy of RNAi knockdown, thereby complicating the interpretation of the results. We developed a method for efficient editing of the C. elegans genome (Norris et al., 2015) and recently expanded upon that method to enable large-scale genetic interaction profiling in animals using null alleles for the first time. We focused our initial efforts on neuronally-expressed RNA binding protein genes, which have been shown in a number of cases to act combinatorially (Gracida et al., 2016; Norris et al., 2014). We found widespread genetic interactions among the set of RNA binding proteins we studied, and similar strategies should be broadly applicable to other gene classes as well.
Materials and Reagents
Platinum Wire for worm pick, 30 gauge 0.254 mm diameter (e.g., Genesee Scientific, catalog number: 59-30P6 )
Worm pick handle (e.g., Genesee Scientific, catalog number: 59-AWP )
6 cm Petri dishes (e.g., Fisher Scientific, catalog number: FB0875713A)
Manufacturer: Corning, catalog number: 431762 .
Wild-type (N2) male and hermaphrodite worms (available from CGC, strain N2)
Monobasic potassium phosphate (KH2PO4) (e.g., Sigma-Aldrich, catalog number: 1551139 )
Solid KOH
Sodium chloride (NaCl) (e.g., Genesee Scientific, catalog number: 18-214 )
Agar (e.g., Genesee Scientific, catalog number: 20-249 )
peptone (e.g., Genesee Scientific, catalog number: 20-261 )
Cholesterol (Sigma-Aldrich, catalog number: C8667 )
95% ethanol (e.g., Sigma-Aldrich, catalog number: 792799 )
Calcium chloride (CaCl2) (e.g., Sigma-Aldrich, catalog number: C1016 )
Magnesium sulfate (MgSO4) (e.g., Sigma-Aldrich, catalog number: M7506 )
1 M potassium phosphate (pH 6)
Nematode Growth Media (NGM) (see Recipes)
Equipment
Fluorescent dissecting stereomicroscope with high sensitivity for single-copy fluorescence detection (e.g., ZEISS, model: Axio Zoom.V16 or Leica, model: Leica M165 FC )
25 °C incubator (e.g., VWR, Sheldon Manufacturing, model: Model 2005 )
Autoclave
Procedure
Creation of double mutants
The generation of single mutants using CRISPR/Cas9 has been covered elsewhere (Norris et al., 2015). This protocol begins with two single mutant worms in which the genes of interest have been deleted and replaced by compatible heterologous fluorescent reporters. In this example, the reporters are myo-2::GFP (expressed in pharyngeal muscles) and myo-3::GFP (expressed in body wall muscles).
To create a male strain necessary for crossing, there are two options:
Cross ~5 wild-type (N2) male worms (available from CGC) with ~5 hermaphrodites of mutant strain #1 to create male progeny that are heterozygous for the mutation (verify by ensuring the males are fluorescent).
Obtain homozygous males of mutant strain #1 according to standard protocols (He, 2011a).
Cross males from mutant strain #1 with hermaphrodites from mutant strain #2 (see Figure 1).
Figure 1. Crossing strategy to create double mutant worms from individual single mutant strains. GFP is used to distinguish homozygous mutants (P0 and F2 panels, brighter fluorescence) from heterozygous mutants (F1 panel, dimmer fluorescence).
Pick a single cross-progeny hermaphrodite containing both GFP markers (both myo-2::GFP and myo-3::GFP) onto a new plate. These worms correspond to double heterozygotes (i.e., mutant1/+; mutant2/+). Allow these hermaphrodites to self-fertilize.
To obtain double-homozygous strains, pick worms with brighter GFP expression coming from both promoters. On a good-quality fluorescence dissection scope, you should be able to tell a difference in brightness between a strain with one copy (heterozygous mutant) and two copies (homozygous mutant) of the GFP transgene (see Figure 2).
Note: Alternatively, pick a larger number of worms to individual plates and determine double homozygotes as worms with progeny that are 100% fluorescent for both transgenes.
Figure 2. Fluorescent brightness reveals mutant genotypes. Worms imaged in situ on NGM plates demonstrating that homozygous mutants (left) are noticeably brighter than heterozygous mutants (right).
Competitive fitness assay
The competitive fitness assay (Figure 3A) provides a simple and relatively high-throughput method for assessing phenotypes of large numbers of mutants and can be performed immediately after strain generation.
Pick equal numbers of wild-type (N2) and mutant worms onto one seeded NGM plate (see Recipes).
Note: We find that 4 staged L4s of each genotype (i.e., 4 wild-type L4s and 4 mutant L4s) on a 6 cm plate works best to support 2 generations of growth without starving out the plate.
Incubate plate at 25 °C for 5 days.
Under a fluorescent stereomicroscope count the number of fluorescent (mutant) worms versus non-fluorescent (wild-type) worms. We prefer to count from pre-defined locations on each plate (e.g., 50 worms from the middle of the plate, 50 from the periphery, and 50 from in between).
Notes:
We recommend counting all hatched worms regardless of stage.
For ease of counting, worms can be treated with anesthetic or cooled at 4 °C for an hour or longer.
Figure 3. The competitive fitness assay. A. Schematic overview of competitive fitness assays; B. Representative visualization of synthetic effect (ɛ) calculation for a genetic interaction between the genes exc-7 and mbl-1.
Data analysis
These data analysis steps are an expansion of those detailed in Norris et al. (2017).
For robustness, 3 biological replicates should be performed, each on a different day and different plate.
Relative fitness scores can be calculated by the following formula:
% mutant/% expected (i.e., 50%) = relative fitness
This will yield a relative fitness value ranging from 0 (strong loss of fitness) to 2 (strong increase in fitness), with a value of 1 indicating no change of fitness compared to wild-type.
To generate an expected fitness value (see Figure 3B for representative example) for a double mutant (Fexp1,2) based on the null hypothesis of no genetic interaction between mutant 1 (F1) and mutant 2 (F2), use the following formula (Mani et al., 2008; Baryshnikova et al., 2010):
Fexp1,2 = F1 x F2
To compare the observed fitness of the double mutant (Fobs1,2) to the expected fitness values:
ɛ = Fobs1,2 - Fexp1,2
This yields the ‘synthetic effect’ score (ɛ). Negative ɛ values indicate a strain with lower fitness than expected, and positive ɛ values indicate a strain with higher fitness than expected.
To report statistically significant results, we set a conservative threshold of |ɛ| ≥ 0.20. For strains passing the |ɛ| ≥ 0.20 threshold, a Fisher’s exact test is applied to the aggregate observed values and the null-expectation values with a Bonferroni-corrected P-value of < 0.01 used as the significance threshold.
Notes
Ensure that worm strains are treated identically for at least 3 days before they are picked onto competition assay plates (e.g., healthy, unstarved, uncrowded plates grown at the same temperature).
The competition assay can be adapted to a variety of different types of mutants and conditions; the only requirement is that the two strains to be compared have some easily-distinguishable feature (e.g., fluorescence)
Recipes
1 M potassium phosphate (pH 6) (1 L)
Dissolve 136.1 g KH2PO4 in about 800 ml dH2O
Adjust pH to 6.0 with solid KOH (approx. 15 g) before bringing up to volume
Make 100 ml aliquots and autoclave
Nematode Growth Media (NGM)
Note: Recipe from ‘Common Worm Media and Buffers’ (He, 2011b).
For 1 L medium
3 g NaCl
17 g agar
2.5 g peptone
1 ml cholesterol (5 mg ml-1 in 95% EtOH)
975 ml ddH2O
Autoclave, and then add the following sterile solution (autoclaved)
1 ml 1 M CaCl2
1 ml 1 M MgSO4
25 ml 1 M potassium phosphate (pH 6) (to avoid precipitation, mix between addition of MgSO4 and potassium phosphate)
Typically pour 60 x 6 mm plate (~10 ml of media per plate) and store NGM plates in plastic boxes with covers at room temperature
Acknowledgments
This protocol was adapted from Norris et al., 2017. Support for AN was supplied by the Floyd B. James Endowed Professorship (Southern Methodist University). Support for JC was supplied by NIH Office of the Director (NIH Early Independence Award DP5OD009153) and Natural Sciences and Engineering Research Council of Canada (Discovery Grant RGPIN-2017-06573). There are no conflicts of interest or competing interest.
References
Baryshnikova, A., Costanzo, M., Kim, Y., Ding, H., Koh, J., Toufighi, K., Youn, J. Y., Ou, J., San Luis, B. J., Bandyopadhyay, S., Hibbs, M., Hess, D., Gingras, A. C., Bader, G. D., Troyanskaya, O. G., Brown, G. W., Andrews, B., Boone, C. and Myers, C. L. (2010). Quantitative analysis of fitness and genetic interactions in yeast on a genome scale. Nat Methods 7(12): 1017-1024.
Baugh, L. R., Wen, J. C., Hill, A. A., Slonim, D. K., Brown, E. L. and Hunter, C. P. (2005). Synthetic lethal analysis of Caenorhabditis elegans posterior embryonic patterning genes identifies conserved genetic interactions. Genome Biol 6(5): R45.
Butland, G., Babu, M., Diaz-Mejia, J. J., Bohdana, F., Phanse, S., Gold, B., Yang, W., Li, J., Gagarinova, A. G., Pogoutse, O., Mori, H., Wanner, B. L., Lo, H., Wasniewski, J., Christopolous, C., Ali, M., Venn, P., Safavi-Naini, A., Sourour, N., Caron, S., Choi, J. Y., Laigle, L., Nazarians-Armavil, A., Deshpande, A., Joe, S., Datsenko, K. A., Yamamoto, N., Andrews, B. J., Boone, C., Ding, H., Sheikh, B., Moreno-Hagelseib, G., Greenblatt, J. F. and Emili, A. (2008). eSGA: E. coli synthetic genetic array analysis. Nat Methods 5(9): 789-795.
Costanzo, M., Baryshnikova, A., Bellay, J., Kim, Y., Spear, E. D., Sevier, C. S., Ding, H., Koh, J. L., Toufighi, K., Mostafavi, S., Prinz, J., St Onge, R. P., VanderSluis, B., Makhnevych, T., Vizeacoumar, F. J., Alizadeh, S., Bahr, S., Brost, R. L., Chen, Y., Cokol, M., Deshpande, R., Li, Z., Lin, Z. Y., Liang, W., Marback, M., Paw, J., San Luis, B. J., Shuteriqi, E., Tong, A. H., van Dyk, N., Wallace, I. M., Whitney, J. A., Weirauch, M. T., Zhong, G., Zhu, H., Houry, W. A., Brudno, M., Ragibizadeh, S., Papp, B., Pal, C., Roth, F. P., Giaever, G., Nislow, C., Troyanskaya, O. G., Bussey, H., Bader, G. D., Gingras, A. C., Morris, Q. D., Kim, P. M., Kaiser, C. A., Myers, C. L., Andrews, B. J. and Boone, C. (2010). The genetic landscape of a cell. Science 327(5964): 425-431.
Gracida, X., Norris, A. D. and Calarco, J. A. (2016). Regulation of tissue-specific alternative splicing: C. elegans as a model system. Adv Exp Med Biol 907: 229-261.
He, F. (2011a). Making males of C. elegans. Bio-protocol e58.
He, F. (2011b). Common worm media and buffers. Bio-protocol e55.
Lehner, B., Crombie, C., Tischler, J., Fortunato, A. and Fraser, A. G. (2006). Systematic mapping of genetic interactions in Caenorhabditis elegans identifies common modifiers of diverse signaling pathways. Nat Genet 38(8): 896-903.
Mani, R., St Onge, R. P., Hartman, J. L., Giaever, G. and Roth, F. P. (2008). Defining genetic interaction. Proc Natl Acad Sci U S A 105: 3461-3466.
Norris, A. D., Gao, S., Norris, M. L., Ray, D., Ramani, A. K., Fraser, A. G., Morris, Q., Hughes, T. R., Zhen, M. and Calarco, J. A. (2014). A pair of RNA-binding proteins controls networks of splicing events contributing to specialization of neural cell types. Mol Cell 54(6): 946-959.
Norris, A. D., Gracida, X. and Calarco, J. A. (2017). CRISPR-mediated genetic interaction profiling identifies RNA binding proteins controlling metazoan fitness. Elife 6.
Norris, A. D., Kim, H. M., Colaiacovo, M. P. and Calarco, J. A. (2015). Efficient genome editing in Caenorhabditis elegans with a toolkit of dual-marker selection cassettes. Genetics 201(2): 449-458.
Schuldiner, M., Collins, S. R., Thompson, N. J., Denic, V., Bhamidipati, A., Punna, T., Ihmels, J., Andrews, B., Boone, C., Greenblatt, J. F., Weissman, J. S. and Krogan, N. J. (2005). Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile. Cell 123(3): 507-519.
Copyright: Calarco and Norris. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Calarco, J. A. and Norris, A. D. (2018). Synthetic Genetic Interaction (CRISPR-SGI) Profiling in Caenorhabditis elegans. Bio-protocol 8(5): e2756. DOI: 10.21769/BioProtoc.2756.
Norris, A. D., Gracida, X. and Calarco, J. A. (2017). CRISPR-mediated genetic interaction profiling identifies RNA binding proteins controlling metazoan fitness. Elife 6.
Download Citation in RIS Format
Category
Systems Biology > Interactome > Gene network
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,757 | https://bio-protocol.org/exchange/protocoldetail?id=2757&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Intravenous Labeling and Analysis of the Content of Thymic Perivascular Spaces
RR Roland Ruscher
KH Kristin A. Hogquist
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2757 Views: 6438
Edited by: Ivan Zanoni
Reviewed by: Yang FuMeenal Sinha
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
Following development in the thymus, T cells are thought to exit into the periphery predominantly through perivascular spaces (PVS). This exit route is used by conventional T cells, and likely also applies to unconventional T cell subsets, such as precursors of CD8αα and TCRγδ intraepithelial lymphocytes, regulatory T cells and natural killer T cells. Additional cell types might also be found in the PVS and initiate interactions with exiting T cells. The exact content of the PVS, and the processes within, are not well studied. To distinguish vascular from resident cells within various tissues by flow cytometry, intravenous (i.v.) labeling is becoming a commonly employed method. We recently used anti-CD45.2 antibodies and magnetic enrichment to further evaluate this technique, and compared labeled and unlabeled cells in the thymus and blood. This assay can be used to specifically investigate hematopoietic cell subsets within the PVS of the thymus.
Keywords: Perivascular spaces Thymus Thymic emigration Recent thymic emigrants Intravenous labeling
Background
Immature thymocytes undergo a series of maturation steps, including positive and negative selection, which eliminate the majority of developing T cells. The resulting mature T cell pool is thereby shaped towards a higher proportion of beneficial clones and a reduced proportion of dangerous self-reactive clones. The thymus also produces less abundant T cell subsets that generally act to maintain immune system, tissue, and metabolic homeostasis, including: TCRγδ cells, regulatory T (Treg) cells, natural killer T (NKT) cells, intraepithelial lymphocyte (IEL) precursors, and mucosal associated invariant T (MAIT) cells. Mature thymocytes poised to emigrate into the periphery upregulate expression of the receptor (S1PR1) that recognizes sphingosine-1 phosphate (S1P), a lipid molecule present at high concentrations in the blood. S1PR1+ T cells migrate along an S1P gradient and wind up in vascular circulation.
The thymic perivascular spaces (PVS) are basement membrane-separated compartments between the parenchyma and the vasculature. They are thought to facilitate trafficking of cells, especially mature T cells emigrating from the thymus (Mori et al., 2007; Weinreich and Hogquist, 2008; Zachariah and Cyster, 2010). The exact content of the PVS is not well characterized yet, and could include antigen presenting cells such as dendritic cells and macrophages, that carry antigens not normally expressed in the thymus, into this tissue to contribute to thymocyte selection processes.
Intravenous (i.v.) labeling is a technique commonly used to distinguish vasculature-associated circulating cells from those residing within tissues at the time of analysis (Anderson et al., 2014). Cyster and colleagues have used this approach to identify CD4+ emigrating T cells within the PVS, and showed that upon tail-vein injection of CD4-labeling antibody, CD4 T cells in the PVS are positively labeled within 3 min (Zachariah and Cyster, 2010). We sought to establish whether thymic precursors of CD8αα IEL, an agonist selected T cell subset that downregulates both CD4 and CD8 expression during thymic maturation, can also be found in the PVS. In order to do so, we adapted the i.v. labeling approach, using phycoerythrin (PE)-conjugated anti-CD45.2 (for C57BL/6 mice). As CD45 is not T cell specific, but is expressed by hematopoietic cells in general, various cells can be identified within the i.v.-labeled (IV+) fraction. Furthermore, we combined this with magnetic enrichment for the PE-conjugated antibodies. This allowed us to more closely evaluate the perivascular contents.
Materials and Reagents
1.5 ml microcentrifuge tubes (DOT Scientific, catalog number: 509-FTG )
Aluminum foil (Spring Grove)
6-well plates (Corning, Costar®, catalog number: 3506 )
70 μm cell strainers (Corning, Falcon®, catalog number: 352350 )
1 ml insulin syringes (BD, catalog number: 329420 )
3 ml syringes (Covidien, catalog number: 8881513918 )
5 ml polystyrene round-bottom tubes (flow cytometry tubes; Corning, Falcon®, catalog number: 352008 )
15 ml conical centrifuge tubes (Corning, Falcon®, catalog number: 352097 )
96 round-bottom well plates (SARSTEDT, catalog number: 82.1582.001 )
MACS LS columns (Miltenyi Biotec, catalog number: 130-042-401 )
Mice, C57BL/6J, 5-6 weeks old (THE JACKSON LABORATORY, catalog number: 000664 )
Anti-CD45.2 PE clone 104 (Tonbo Biosciences, catalog number: 50-0454-U100 ; 0.2 mg/ml)
Heparin sodium injection (Sagent Pharmaceuticals, NDC 25021-400-10; 10,000 USP units per 10 ml)
Phosphate buffered saline (PBS) (Corning, Mediatech, catalog number: 21-040-CV )
Isoflurane (Piramal Healthcare, 001725CS)
Anti-PE MicroBeads (Miltenyi Biotec, catalog number: 130-048-801 )
Live/Dead Fixable Aqua kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: L34957 )
CD1d-tetramer (PBS57-loaded CD1d-monomers and tetramers available from NIH tetramer core facility; http://tetramer.yerkes.emory.edu)
Anti-CD25 clone PC61 (e.g., BioLegend, catalog number: 102024 )
Anti-TCRβ clone H57-597 (e.g., BD, BD Biosciences, catalog number: 562841 )
Anti-CD4 clone RM4-5 (e.g., BioLegend, catalog number: 100548 )
Anti-CD8α clone 53-6.7 (e.g., BD, BD Biosciences, catalog number: 563332 )
Anti-CD5 clone 53-7.3 (e.g., Thermo Fisher Scientific, eBioscience, catalog number: 47-0051-82 )
Anti-CD122 clone TM-b1 (e.g., Thermo Fisher Scientific, eBioscience, catalog number: 46-1222-82 )
Anti-H-2Kb clone AF6-88.5 (e.g., BD, BD Biosciences, catalog number: 562942 )
Anti-PD-1 clone J43 (e.g., Thermo Fisher Scientific, eBioscience, catalog number: 17-9985-82 )
Anti-NK1.1 clone PK136 (e.g., BioLegend, catalog number: 108705 )
Anti-CD11c clone N418 (e.g., Thermo Fisher Scientific, eBioscience, catalog number: 25-0114-82 )
Anti-I-Ab clone AF6-120.1 (e.g., BioLegend, catalog number: 116421 )
Anti-CD19 clone 1D3 (e.g., Thermo Fisher Scientific, eBioscience, catalog number: 56-0193-82 )
Anti-CD11b clone M1/70 (e.g., Thermo Fisher Scientific, eBioscience, catalog number: 11-0112-41 )
Anti-GR1 clone Gr-1 (e.g., BioLegend, catalog number: 108411 )
Fetal bovine serum (FBS) (Atlanta Biologicals, catalog number: S11150 ), heat inactivated at 65 °C
Ethylenediamine tetraacetate acid (EDTA) (Fisher Scientific, catalog number: BP120-500 )
Sodium azide (Fisher Scientific, catalog number: BP922I-500 )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: A4514-500G )
Potassium bicarbonate (KHCO3) (Fisher Scientific, catalog number: P235-500 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
FACS buffer (see Recipes)
ACK lysis buffer (see Recipes)
MACS buffer (see Recipes)
Equipment
Class-II biosafety cabinet/laminar flow hood
MACS Multistand (Miltenyi Biotec, catalog number: 130-042-303 )
QuadroMACS Separator (Miltenyi Biotec, catalog number: 130-090-976 )
Heat lamp
Timer (Fisher Scientific, catalog number: 14-649-17 )
Benchtop centrifuge (Beckman Coulter, model: Allegra X-12-R )
2,000 ml drop glass jar
Refrigerator (4 °C) (Fisher Scientific, model: IsotempTM General-Purpose Series Lab Refrigerator )
Hemacytometer (Sigma-Aldrich, catalog number: Z359629-1EA )
FACS flow cytometer (BD, model: LSR-II , H10.10)
Software
FlowJo version 10.4.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ruscher, R. and Hogquist, K. A. (2018). Intravenous Labeling and Analysis of the Content of Thymic Perivascular Spaces. Bio-protocol 8(5): e2757. DOI: 10.21769/BioProtoc.2757.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,758 | https://bio-protocol.org/exchange/protocoldetail?id=2758&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Plant Cell Death by Electrolyte Leakage Assay
NH Noriyuki Hatsugai
FK Fumiaki Katagiri
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2758 Views: 22375
Edited by: Andrea Puhar
Reviewed by: Bin Tian
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
We describe a protocol to measure the electrolyte leakage from plant tissues, resulting from loss of cell membrane integrity, which is a common definition of cell death. This simple protocol is designed to measure the electrolyte leakage from a tissue sample over a time course, so that the extent of cell death in the tissue can be monitored dynamically. In addition, it is easy to handle many tissue samples in parallel, which allows a high level of biological replication. Although the protocol is exemplified by cell death in Arabidopsis in response to pathogen challenge, it is easily applicable to other types of plant cell death.
Keywords: Plants Cell death Electrolyte leakage Electrolytic conductivity
Background
When a cell dies and loses the integrity of the cell membrane, electrolytes, such as K+ ions, leak out of the cell. Thus, we can use the amount of electrolytes leaked from a tissue as a proxy for the extent of cell death in the tissue. A simple way to quantify such electrolytes leaked from a tissue is to measure the increase in electrolytic conductivity of water that contains the tissue with dying cells. This electrolyte leakage assay has been applied to plant tissues to assess the relative quantity of cells that died in response to biotic and abiotic stresses, such as pathogen challenge, insect herbivory, wounding, UV radiation, oxidative stress, salinity, drought, cold and heat stress (Demidchik et al., 2014).
The original method was designed to measure the conductivity of the aqueous bathing solution containing plant tissues before and after boiling it, in which the conductivity after boiling was used to normalize tissue size differences (Whitlow et al., 1992). Here we describe a procedure to dynamically monitor electrolyte leakage from leaf disks by measuring at multiple time points the electrolytic conductivity of water on which the leaf disks float in a 12-well plate. It is reasonable to assume that the total amount of electrolytes from tissue samples of the same size, such as disks of the same area punched out from leaves of a similar developmental stage, is comparable and that it is not necessary to measure the electrolytic conductivity after boiling the tissues. We inoculated leaves with the bacterial pathogen, Pseudomonas syringae pv. tomato DC3000 pVSP61-avrRpt2 (Pto DC3000 avrRpt2) in order to trigger a type of programmed cell death, known as hypersensitive cell death. The protocol presented here has been applied to our studies (Igarashi et al., 2013; Bethke et al., 2016; Hatsugai et al., 2016; Hatsugai et al., 2017) and could also be used to quantify plant cell death triggered by any other stimuli. If detailed comparisons of the time courses of the electrolyte leakage are needed, fitting polynomial regression to the time courses is possible (Van Poecke et al., 2007; Qi et al., 2010), as it is easy to obtain electrolytic conductivity measurements at many time points with many replicates.
Materials and Reagents
2 ml microcentrifuge tubes (Fisher Scientific, catalog number: 05-408-138 )
Sterilized tubes for liquid bacterial cultures (Evergreen Scientific, catalog number: 222-2094-050 )
Disposable 1-ml needleless syringes for bacterial inoculation (BD, catalog number: 309659 )
12-well cell culture plates (flat bottom with lid) (Corning, Costar®, catalog number: 3513 )
1-200 μl Pipette tips (Sorenson BioScience, catalog number: 3211 )
50-1,250 μl pipette tips (Sorenson BioScience, catalog number: 3205 )
Arabidopsis thaliana accession Col-0 (Figure 1A)
Note: Arabidopsis thaliana accession Col-0 carries the R gene RPS2, which confers resistance to Pto DC3000 avrRpt2 (Bent et al., 1994; Mindrinos et al., 1994).
Pseudomonas syringae pv. tomato DC3000 pVSP61-avrRpt2 (Pto DC3000 avrRpt2)
Note: Pto DC3000 avrRpt2 delivers the AvrRpt2 effector into plant cells, thereby inducing hypersensitive cell death in Arabidopsis Col-0.
Sterilized ultrapure water (e.g., Milli-Q)
Conductivity standard solution 1.41 mS/cm (HORIBA, model: Y071L, catalog number: 514-22 )
Antibiotics
Kanamycin sulfate (Thermo Fisher Scientific, GibcoTM, catalog number: 11815032 )
Rifampicin (Sigma-Aldrich, catalog number: R3501 )
Bacto proteose peptone No. 3 (BD, catalog number: 211693 )
Glycerol (Fisher Scientific, catalog number: G33-500 )
Dibasic potassium phosphate (K2HPO4) (Fisher Scientific, catalog number: BP363-500 )
Bacto agar (BD, catalog number: 214010 )
Hydrochloric acid (HCl) (Fisher Scientific, catalog number: A508-P500 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: 230391 )
King’s B liquid medium (see Recipes)
Equipment
Walk-in Arabidopsis growth chamber (22 °C, 70% relative humidity, and 12-h/12-h day/night photoperiod) (Conviron, model: BDR40 )
Tissue culture roller rotator drum for bacterial culture at 28 °C (New Brunswick Scientific, model TC-7 )
Centrifuge (Eppendorf, model: 5415 D )
Spectrophotometer to determine the density of bacterial culture (Beckman Coulter, model: DU-800 )
Cork borer (size 4, diameter = 7.5 mm)
Electrolytic conductivity meter (HORIBA, model: B-173 )
Single-channel micropipettor (Eppendorf, 20-200 μl and 100-1,000 μl)
Autoclave
Software
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hatsugai, N. and Katagiri, F. (2018). Quantification of Plant Cell Death by Electrolyte Leakage Assay. Bio-protocol 8(5): e2758. DOI: 10.21769/BioProtoc.2758.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Host-microbe interactions
Plant Science > Plant immunity > Disease bioassay
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
I would like to get a protocol to detect cell death in etiolated roots
2 Answers
10 Views
Dec 14, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,759 | https://bio-protocol.org/exchange/protocoldetail?id=2759&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Phrenic Nerve Hemidiaphragm Assay (MPN)
Giulia Zanetti
SN Samuele Negro
Marco Pirazzini
Paola Caccin
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2759 Views: 8954
Edited by: Andrea Puhar
Reviewed by: Jordi Molgó
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
The neuromuscular junction (NMJ) is the specialized synapse by which peripheral motor neurons innervate muscle fibers and control skeletal muscle contraction. The NMJ is the target of several xenobiotics, including chemicals, plant, animal and bacterial toxins, as well as of autoantibodies raised against NMJ antigens. Depending on their biochemical nature, the site they target (either the nerve or the muscle) and their mechanism of action, substances affecting NMJ produce very specific alterations of neuromuscular functionality.
Here we provide a detailed protocol to isolate the diaphragmatic muscle from mice and to set up two autonomously innervated hemidiaphragms. This preparation can be used to study bioactive substances like toxins, venoms and neuroactive molecules of various origin, or to measure the force of skeletal muscle contraction.
The ‘mouse phrenic nerve hemidiaphragm assay’ (MPN) is an established model of ex vivo NMJ and recapitulates the complexity of neuromuscular transmission in a system easy to control and to manipulate, thus representing a valuable tool to study both NMJ physiology and the mechanism of action of toxins and other molecules acting at this synapse.
Keywords: Electrophysiology Neuromuscular junction Hemidiaphragm assay Phrenic nerve Toxins Botulinum Inhibitors
Background
The neuromuscular junction (NMJ) is the chemical synapse enabling communication between motor neurons and skeletal muscle fibers. This is the best characterized synapse and most of the knowledge on maturation, structure and function of synapses derives from its study (Li et al., 2017). At the NMJ, the action potential running along the motor axon invades the nerve terminal (presynaptic bouton) and induces the fusion of synaptic vesicles with the presynaptic membrane. This triggers the release of acetylcholine (ACh), the neurotransmitter that binds the nicotinic ionotropic ACh receptors (nAChRs) on the postsynaptic muscle fiber. Upon ACh binding to nAChRs, a postsynaptic action potential spreads out along the muscle fiber causing Ca2+ release from the sarcoplasmic reticulum into the cytosol, thereby inducing muscle contraction. At variance from central synapses, NMJs are not protected by anatomical barriers, like the blood brain barrier or the blood nerve barrier, and are exposed to the action of various pathogenic molecules, including chemicals, toxins from plant, animal and bacteria as well as autoantibodies raised against NMJ antigens. Depending on the way they act, these agents produce distinct kinds of injury to the NMJ, eventually leading to impairment of muscle contraction.
The ‘mouse phrenic nerve hemidiaphragm assay’ (MPN) is an established model to study ex vivo NMJ function and offers a valuable tool to investigate the mechanism of action of toxins and molecules that produce NMJ alteration. In addition, MPN can be used to evaluate skeletal muscle contractility and measure diaphragmatic muscle force elicited by electrical stimulation of its phrenic nerve, so providing a model which recapitulates the complexity of the neuromuscular system in a more accessible and isolated environment.
The MPN provided fundamental insights to tackle the mechanism of action of Botulinum Neurotoxins (BoNTs), and it is currently used in many laboratories worldwide to perform qualitative/quantitative analysis of BoNTs. Its employment allows a significant refinement and reduction in the use of animals and results are in good agreement with the classical mouse lethality bioassay (Rasetti-Escargueil et al., 2011; Bigalke and Rummel, 2015).
For this, and because the hemidiaphragm-phrenic nerve intoxicated by BoNTs closely mimics the failure of respiratory muscles occurring in vivo, the MPN is presently listed in the European Pharmacopeia as an alternative method to the mouse bioassay for assaying BoNT/A lots for human use (https://ntp.niehs.nih.gov/iccvam/suppdocs/feddocs/eur/eph_botat-508.pdf). This system is also a valuable tool to test new BoNTs (Zanetti et al., 2017) and the neutralizing potency of antibodies and inhibitors (Rasetti-Escargueil et al., 2011; Azarnia Tehran et al., 2015; Beske et al., 2017).
Besides BoNTs, the MPN can be used to study many other bioactive substances, comprising toxins like phospholipases, myotoxins and complete venoms, neuroactive molecules like peptides, lipids and drugs (Rigoni et al., 2005; Caccin et al., 2006; Bercsenyi et al., 2014; Yan et al., 2014; Caccin et al., 2015), or to measure muscle force in diaphragms from mice pre-treated with autoantibodies involved in myasthenic syndromes (Klooster et al., 2012) or from animal models of neuromuscular diseases (Nascimento et al., 2014).
Here, we describe a very detailed protocol to successfully dissect the mouse diaphragmatic muscle with both the phrenic nerves completely functional. This is a remarkable advantage as it allows obtaining two autonomously innervated hemidiaphragms to be independently used, either as an internal control or to increment the number of experimental data. The small volume of muscle bath-chambers, the possibility of finely control bath concentration of substances used, the easy manipulability of experimental conditions (temperature, washes, etc.) and the possibility to use the muscles for further analysis (immunofluorescence, Western blot, etc.), represent significant advantages as well.
Materials and Reagents
2 µl micropipette
200 µl micropipette
1,000 µl micropipette
Tips for 2, 200 and 1,000 µl micropipettes
Petri dish, 100 x 20 mm, coated with Sylgard (Dow Corning, Sylgard® 184 Silicone Elastomer kit)
Surgical needles (Rudolf, catalog number: RU 5899-01 )
Cotton thread
Mice of desired genotype and age
Hydrogen chloride (HCl) (Sigma-Aldrich, catalog number: H1758 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S5761 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Magnesium chloride, standard solution 1 M (MgCl2) (Honeywell International, Fluka, catalog number: 63020 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
D-(+)-Glucose (Sigma-Aldrich, catalog number: G7528 )
Ringer’s solution (see Recipes)
Equipment
Volumetric flask
Clamp (Bulldog Clamp, Diethrich) (Rudolf, catalog number: RU 3934-16 ; or similar)
2 x scissors (Delicate Surgical Scissors) (Rudolf, catalog number: RU 1503-12 )
2 x forceps (Micro Jewelers Forceps, curved) (Rudolf, catalog number: RU 4240-07 )
Stimulator: 6002 Stimulator (Harvard Apparatus, model: 6002 Basic Stimulator )
2 x micromanipulator (three-dimensional coarse manual manipulator) (NARISHIGE, catalog number: M-152 )
2 x Tension transducer: isometric transducer (Harvard Apparatus, catalog number: 72-4494 )
2 x Lead Screw Positioner (Harvard Apparatus, catalog number: 53-2082W )
2 x Support system (to hold both stimulation chamber and transducer sensors)
2 x Static stimulation chamber (jacketed, total internal volume 5 ml)
Thermostatic bath (Isco, catalog number: GTR190 )
Recording unit: i-WORX 118 system (iWORX, model: iWORX 118 )
Computer compatible with the software
Gas tank (95% O2, 5% CO2) equipped with pressure control (Air Liquide, model: HBS 240-1-2 )
Software
Recording and Analysis: i-WORX 118 system (Dover, NH, USA) interfaced via Labscribe software (iWorx Systems Inc., Dover, NH, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zanetti, G., Negro, S., Pirazzini, M. and Caccin, P. (2018). Mouse Phrenic Nerve Hemidiaphragm Assay (MPN). Bio-protocol 8(5): e2759. DOI: 10.21769/BioProtoc.2759.
Download Citation in RIS Format
Category
Neuroscience > Peripheral nervous system > Skeletal muscle
Cell Biology > Cell signaling > Synaptic transmision
Cell Biology > Tissue analysis > Electrophysiology
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
276 | https://bio-protocol.org/exchange/protocoldetail?id=276&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolate and Sub-fractionate Cell Membranes from Caulobacter crescentus
Khatira Anwari
Published: Vol 2, Iss 20, Oct 20, 2012
DOI: 10.21769/BioProtoc.276 Views: 14048
Original Research Article:
The authors used this protocol in Jun 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2012
Abstract
Cell membranes from Caulobacter can be isolated and separated into inner and outer membranes according their characteristic buoyant densities on a sucrose gradient. Fractionation can be used to determine the localisation of uncharacterised proteins and to enrich protein complexes present in either of these membranes for biochemical analysis such blue-native PAGE and immunoprecipitation.
Keywords: Bacteria Membrane Density fractionation Caulobacter
Materials and Reagents
0.2% Bacto Peptone
0.1% yeast extract
MgSO4
CaCl2
Tris (Sigma-Aldrich)
Sucrose (Sigma-Aldrich)
Lysozyme (Sigma-Aldrich)
EDTA-free protease inhibitors (F. Hoffmann-La Roche, catalog number: 11873580001 )
Dnase I (Sigma-Aldrich, catalog number: DN25 )
MgCl2 (Sigma-Aldrich)
EDTA (Sigma-Aldrich)
Na2HPO4
KH2PO4
NH4Cl
FeSO4 (EDTA chelate) (Sigma-Aldrich, catalog number: F0518 )
Glucose
Spheroplasting buffer
Growth media (Rich PYE or Minimal M2G) (see Recipes)
Spheroplasting buffer (see Recipes)
Lysis buffer (see Recipes)
Growth media (Rich PYE or Minimal M2G) (see Recipes)
Sucrose solutions (see Recipes)
TEM buffer (see Recipes)
Equipment
Centrifuges
Peristaltic pump (Bio-Rad Laboratories, catalog number: 731-8140EDU )
High-pressure homogenizer (Avestin Emulsiflex, EmulsiFlex-C5)
7 and 15 ml Dounce homogenizers (WHEATON)
BECKMAN centrifuge, fixed angle rotor (Ti45 or Ti60), swing-out rotor (SW40) and appropriate tubes
Density gradient fractionation system (Brandel, model: BR188 )
Beckman Ultra-Clear tubes
SW40 rotor tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Isolation and purification
Cell Biology > Organelle isolation > Membrane
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,760 | https://bio-protocol.org/exchange/protocoldetail?id=2760&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Construction and Cloning of Minigenes for in vivo Analysis of Potential Splice Mutations
LR Lisa Maria Riedmayr*
SB Sybille Böhm*
SM Stylianos Michalakis
EB Elvir Becirovic
*Contributed equally to this work
Published: Vol 8, Iss 5, Mar 5, 2018
DOI: 10.21769/BioProtoc.2760 Views: 10910
Edited by: Nicoletta Cordani
Reviewed by: Kate HannanPamela Maher
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Disease-associated mutations influencing mRNA splicing are referred to as splice mutations. The majority of splice mutations are found on exon-intron boundaries defining canonical donor and acceptor splice sites. However, mutations in the coding region (exonic mutations) can also affect mRNA splicing. Exact knowledge of the disease mechanism of splice mutations is essential for developing optimal treatment strategies. Given the large number of disease-associated mutations thus far identified, there is an unmet need for methods to systematically analyze the effects of pathogenic mutations on mRNA splicing. As splicing can vary between cell types, splice mutations need to be tested under native conditions if possible. A commonly used tool for the analysis of mRNA splicing is the construction of minigenes carrying exonic and intronic sequences. Here, we describe a protocol for the design and cloning of minigenes into recombinant adeno-associated virus (rAAV) vectors for gene delivery and investigation of mRNA splicing in a native context. This protocol was developed for minigene-based analysis of mRNA splicing in retinal cells, however, in principle it is applicable to any cell type, which can be transduced with rAAV vectors.
Keywords: Minigene mRNA splicing Cloning rAAV Analysis of mutations
Background
A substantial portion of disease-associated mutations (at least 15%) are predicted to result in aberrant mRNA splicing (Cartegni et al., 2002; Singh and Cooper, 2012; Sterne-Weiler and Sanford, 2014). The ‘classical’ splice mutations are those affecting the canonical sequences defining the 5’- and 3’-splice sites (donor and acceptor splice sites, respectively). However, splice mutations can also occur in other non-coding and coding regions (Wang and Cooper, 2007; Scotti and Swanson, 2016). There is growing evidence that the frequency of splice mutations in coding regions (exonic mutations) has been underestimated (Julien et al., 2016; Soukarieh et al., 2016). Exonic splice mutations (i.e., point mutations, insertions or deletions) can induce exon skipping, intron retention or lead to the generation of novel donor or acceptor splice sites. Depending on the gene and exon composition, these mechanisms can have different impacts on the protein level ranging from haploinsufficiency to gain of function. Nevertheless, the exact knowledge of molecular mechanisms underpinning the disease-causing mutations is essential for developing optimal treatments.
mRNA splicing occurs in a highly cell type-specific manner, highlighting the need to analyze the impact of potential splice mutations in the tissue which is primarily affected by the mutation (Wang et al., 2008). Consequently, in the optimal case, mRNA splicing should be analyzed on the native gene and in the native tissue. This option, however, is rather demanding for several reasons:
1) It might require the elaborate generation of genetically modified human cell lines. This impedes a more systematic analysis of splice mutations for a single gene.
2) Many native cell types are highly specialized and their cultured counterparts (if available at all) do not reflect every morphological and molecular hallmark of the native cells including the composition and activity of the splicing machinery.
3) The generation of humanized animal models expressing the respective splice mutation in a given tissue is not only technically challenging, but also time-consuming and costly. Therefore, this approach also appears rather unsuitable for systematic testing of splice mutations for a given gene.
4) Often, native genes are too large to be cloned into classical expression vectors.
One alternative to circumvent a number of these obstacles is to use human minigenes designed for expression in appropriate animal models (e.g., mouse). We have evaluated this approach in recent studies addressing the effects of disease-associated mutations in different genes, e.g., PRPH2, on mRNA splicing (Becirovic et al., 2016b; Nguyen et al., 2016; Khan et al., 2017; Petersen-Jones et al., 2017). For stable and specific ectopic expression of the minigenes, we took advantage of rAAV vectors. These vectors are capable of transducing a variety of different cell types in vivo (Zincarelli et al., 2008; Lisowski et al., 2014). Furthermore, the design, cloning, production and purification of rAAV vectors can be completed in a few weeks and does not require elaborate technical equipment (Becirovic et al., 2016a).
Most native genes including PRPH2 exceed the limited packaging capacity of AAVs (approx. 4.7 kb) (Wu et al., 2010). Therefore, we designed PRPH2 minigenes lacking large intronic parts, which usually do not contain information required for correct mRNA splicing. For genes which do not contain large exon numbers or sizes, shortening of the intronic sections also allows for introducing the entire protein coding region into the rAAV vector-based minigenes.
This strategy (cf. Figure 1) was developed and evaluated to analyze the impact of known disease-linked mutations on mRNA splicing and protein expression in photoreceptor-specific genes, but should in principle also be transferable to other cell types.
Figure 1. Workflow schematic for construction and cloning of minigenes
Materials and Reagents
Isolation of human genomic DNA for cloning of minigenes
1.5 ml Eppendorf tubes (SARSTEDT, catalog number: 72.690.001 )
Scalpel (Swann Morton, catalog number: 0510 )
Gentra Puregene Buccal Cell Kit (QIAGEN, catalog number: 158845 )
2-Propanol (100%, ACS, ISO, Reag. Ph. Eur. grade)
Ethanol (70%, ACS, ISO, Reag. Ph. Eur. grade)
Overlap extension PCR for construction and cloning of minigenes
PCR tubes (BRAND, catalog numbers: 781320 and 781334 )
Expression vector of choice (e.g., pcDNA3.1 vector (+), Thermo Fisher Scientific, InvitrogenTM, catalog number: V79020 )
Double distilled H2O (ddH2O)
Herculase II Fusion DNA Polymerase (Agilent Technologies, catalog number: 600675 )
dNTPs, 10 mM (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0192 )
DNA Loading Dye (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0611 )
GeneRuler 1 kb Plus DNA Ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SM1331 )
EDTA (VWR, catalog number: 20302.293 )
Tris-(hydroxymethyl) aminomethane (VWR, catalog number: 103156X )
Boric acid (VWR, catalog number: 20185.360 )
QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704 )
1x TBE buffer (see Recipes)
Site-directed mutagenesis to introduce point mutations of interest into minigene
PCR tubes (BRAND, catalog numbers: 781320 and 781334 )
QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, catalog number: 210518 )
Double distilled H2O (ddH2O)
Peptone (Applichem, catalog number: 403898.1210 )
Yeast extract (Applichem, catalog number: A1552 )
NaCl (VWR, catalog number: 27810.364 )
D-(+)-Glucose (Sigma-Aldrich, catalog number: 49159 )
Agar (Sigma-Aldrich, catalog number: A5054 )
Appropriate antibiotic for the plasmid vector (e.g., Ampicillin, Carl Roth, catalog number: K029.2 )
LB agar plates containing the appropriate antibiotic for the plasmid vector (see Recipes)
LB medium (see Recipes)
Subcloning of minigenes into rAAV vector
Appropriate rAAV cis vector plasmid (e.g., pAAV-MCS2, Addgene, catalog number: 46954 )
Equipment
Pipettes (e.g., Eppendorf)
Vortexer (Heidolph Instruments, model: Reax top )
Incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: Heraeus B12 Function Line, catalog number: 50042307 )
Microcentrifuge (Eppendorf, model: Centrifuge MiniSpin® , catalog number: 5452000018)
Two water baths (Haake, catalog number: 003-2859 )
Thermocycler (Thermo Fisher Scientific, model: ProFlexTM, catalog number: 4483636 )
NanoDropTM (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: ND-2000C )
Software
Human splicing finder software (e.g., http://www.umd.be/HSF3/)
Tm Calculator Software (e.g., NEB Tm Calculator)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Riedmayr, L. M., Böhm, S., Michalakis, S. and Becirovic, E. (2018). Construction and Cloning of Minigenes for in vivo Analysis of Potential Splice Mutations. Bio-protocol 8(5): e2760. DOI: 10.21769/BioProtoc.2760.
Download Citation in RIS Format
Category
Neuroscience > Sensory and motor systems > Retina
Developmental Biology > Morphogenesis > Cell structure
Molecular Biology > RNA > RNA splicing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,761 | https://bio-protocol.org/exchange/protocoldetail?id=2761&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bacterial Cell Wall Precursor Phosphatase Assays Using Thin-layer Chromatography (TLC) and High Pressure Liquid Chromatography (HPLC)
MP Manuel Pazos
CO Christian Otten
WV Waldemar Vollmer
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2761 Views: 6648
Edited by: Andrea Puhar
Reviewed by: Laura Alvarez MunozTimo Lehti
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
Peptidoglycan encases the bacterial cytoplasmic membrane to protect the cell from lysis due to the turgor. The final steps of peptidoglycan synthesis require a membrane-anchored substrate called lipid II, in which the peptidoglycan subunit is linked to the carrier lipid undecaprenol via a pyrophosphate moiety. Lipid II is the target of glycopeptide antibiotics and several antimicrobial peptides, and is degraded by ‘attacking’ enzymes involved in bacterial competition to induce lysis. Here we describe two protocols using thin-layer chromatography (TLC) and high pressure liquid chromatography (HPLC), respectively, to assay the digestion of lipid II by phosphatases such as Colicin M or the LXG toxin protein TelC from Streptococcus intermedius. The TLC method can also monitor the digestion of undecaprenyl (pyro)phosphate, whereas the HPLC method allows to separate the di-, mono- or unphosphorylated disaccharide pentapeptide products of lipid II.
Keywords: Lipid II Undecaprenyl pyrophosphate Phosphatase activity Peptidoglycan HPLC TLC
Background
The peptidoglycan (PG) sacculus is an essential bacterial macromolecule that protects the cell from bursting due to its turgor and maintains the shape of the cell (Vollmer and Bertsche, 2008; Typas et al., 2012). PG is composed by glycan chains connected by short peptides. The PG from different species varies in the structure of the peptides and presence of secondary modifications (Vollmer et al., 2008). PG precursors are synthesized inside the cell and equipped with a carrier lipid for transport across the membrane prior to their polymerization at the outer leaflet of the cytoplasmic membrane (Barreteau et al., 2008). The universal bacterial carrier lipid is undecaprenyl phosphate (C55-P), which is synthesized in two steps. First, UppS uses farnesyl pyrophosphate (C15-PP) and eight isopentenyl pyrophosphate (C5-PP) molecules to produce the diphosphate form of the carrier lipid (C55-PP), which is then dephosphorylated to C55-P by membrane embedded phosphatases (UppP, or PAP2-type phosphatases) (Manat et al., 2014).
The final precursor for PG synthesis is lipid II, the GlcNAc-MurNAc(pentapepide) building block linked to C55-PP. Lipid II is synthesized in two steps at the inner leaflet of the cytoplasmic membrane from UDP-MurNAc-pentapeptide, UDP-GlcNAc and C55-P by the enzymes MraY and MurG (Bouhss et al., 2008). PG glycosyltransferases (GTases) polymerize lipid II at the outer leaflet of the membrane to glycan chains. This reaction releases C55-PP which is dephosphorylated for new rounds of precursor synthesis and transport.
Peptidoglycan synthesis is a prime target for antibacterial compounds and enzymes. Bacteria and higher organisms often produce antibacterial compounds to target competing bacteria and invading pathogens, respectively (Malanovic and Lohner, 2016). Bacterial competition is particularly fierce in dense populations such as biofilms and soil communities. Whilst the group of actinomycetes are known for their capability to secrete a repertoire of small metabolites that often show antibacterial activity, many Gram-negative bacteria utilize sophisticated type VI secretion systems to target adjacent bacterial cells by antimicrobial enzymes (Russell et al., 2011; 2012 and 2014). Another type of bacterial toxins are colicins, which are secreted by certain strains of Escherichia coli (Cascales et al., 2007). Colicins use energized nutrient uptake systems to enter the periplasm of susceptible strains of E. coli. Most colicins kill the target cell by inserting into the cytoplasmic membrane to form pores (Braun and Patzer, 2013). An exception is colicin M, which has a phosphatase activity against lipid II, cleaving the essential peptidoglycan precursor to disaccharide pyrophosphate and undecaprenol (El Ghachi et al., 2006).
More recently, it was shown that some Gram-positive species use a type VII secretion system to target other bacteria (Cao et al., 2016). So far the best example is Streptococcus intermedius, which uses a type VII secretion system to deliver an antibacterial toxin, TelC, to target bacteria (Whitney et al., 2017). TelC was shown to degrade lipid II and C55-PP to release disaccharide pentapeptide and pyrophosphate, respectively, and undecaprenol. S. intermedius also produces the immunity protein TipC, which inactivates TelC by direct interaction to prevent the lysis of the toxin-producing cell (Whitney et al., 2017). In this methods paper, we provide a detailed description of the TLC and HPLC methods that established the degradation of lipid II and C55-PP by TelC (Whitney et al., 2017). These methods can be generally used to assess the activity and specificity of phosphatases against membrane-bound bacterial cell wall precursors.
Materials and Reagents
Pipette tips (STARLAB, catalog numbers: S1111-3700 , S1113-1700 , S1111-6701 )
1.5 ml micro-tubes (SARSTEDT, catalog number: 72.690.001 )
Aluminium HPTLC silica gel 60 plates, 20 x 20 cm, without fluorescent indicator (Merck, catalog number: 1.05547.0001 )
Glass vials (Soda glass, w/o rim, round bottom, 40 x 8 x 0.8-1.0 mm) (VWR, catalog number: 212-0011 )
pH indicator strips (Merck, catalog number: 1.09531.0001 )
HPLC vials (Agilent Technologies, catalog number: 5182-0553 )
Vial inserts, 400 μl, glass, flat bottom (Agilent Technologies, catalog number: 5181-3377 )
Hypodermic needles (FINE-JECT® for single use) (VWR, catalog number: 613-2022 )
2 ml micro-tubes (SARSTEDT, catalog number: 72.695.500 )
MF-Millipore membrane filter 0.22 μm, mixed cellulose esters (Merck, catalog number: GSWP04700 )
Enzyme of interest/putative phosphatase
Potassium chloride (KCl) (Analytical Reagent Grade) (Fisher Scientific, CAS number: 7447-40-7)
Triton X-100 (Roche Diagnostics, catalog number: 10789704001 )
Lipid II (Lys version) (gift from Eefjan Breukink, University of Utrecht) (Egan et al., 2015)
Note: Lipid II can be produced and purified by previously reported methods (Brötz et al., 1995; Qiao et al., 2017).
Scintillation cocktail ProFlow G+ (Meridian Biotechnologies, catalog number: ProFlow G+ )
Note: Used together with the radioactivity flow-through detector.
Calcium chloride anhydrous (CaCl2) (Melford Laboratories, catalog number: C1103 )
Undecaprenyl monophosphate diammonium salt (Larodan, catalog number: 62-1055 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (VWR, catalog number: 25108.260 )
Farnesyl pyrophosphate ammonium salt (Sigma-Aldrich, catalog number: F6892 )
Isopentenyl pyrophosphate triammonium salt solution (Sigma-Aldrich, catalog number: I0503 )
Undecaprenyl pyrophosphate synthase (UppS) from E. coli, purified as described in Pan et al., 2000
Undecaprenol (Larodan, catalog number: 60-1055 )
n-Butanol (Honeywell International, catalog number: 537993 )
Pyridine, anhydrous 99.8% (Sigma-Aldrich, catalog number: 270970 )
Iodine (Sigma-Aldrich, catalog number: I3380 )
[14C]GlcNAc-labeled lipid II (Lys version) (gift from Eefjan Breukink, University of Utrecht) (Egan et al., 2015)
Chloroform (Sigma-Aldrich, catalog number: 32211-M )
Methanol (Fisher Scientific, catalog number: 10284580 )
Sodium chloride (NaCl) (VWR, catalog number: 27810.295 )
Methanol (CHROMASOLVTM, gradient grade, for HPLC, ≥ 99.9%) (Honeywell International, Riedel-de HaënTM, catalog number: 34885 )
Peptidoglycan synthase PBP1B and its cognate activator LpoB proteins from E. coli, purified as described in Bertsche et al. (2006) and Egan et al. (2014)
Sodium borohydride (Merck, catalog number: 1.06371.0100 )
Milli Q quality water (ddH2O)
Ammonium hydroxide (Honeywell International, catalog number: 05003 )
Acetic acid > 99.8% (Sigma-Aldrich, catalog number: 33209-M )
4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (VWR, catalog number: 441485H )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: P5958-500G )
Sodium hydroxide (NaOH) (VWR, catalog number: 28245.298 )
Sodium hydroxide for HPLC (semiconductor grade, 99.99% trace metals basis) (Sigma-Aldrich, catalog number: 306576 )
ortho-Phosphoric acid, 85-90% (HPLC) (Honeywell International, FlukaTM, catalog number: 79606 )
Boric acid (99.97% trace metals basis) (Sigma-Aldrich, catalog number: 339067 )
Muramidase cellosyl (provided by Höchst AG, Frankfurt, Germany)
Note: Alternatively, the muramidase mutanolysin (Sigma-Aldrich, catalog number: M9901 ) can be used.
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: S2002 )
Mobile phase (see Recipes)
Undecaprenol and undecaprenyl monophosphate diammonium salt (see Recipes)
6 M pyridinium acetate (see Recipes)
n-Butanol/pyridinium acetate pH 4.2 (see Recipes)
HEPES/KOH stock solution (1 M, pH 7.5) (see Recipes)
HEPES/NaOH stock solution (1 M, pH 7.5) (see Recipes)
Sodium phosphate buffer (80 mM, pH 4.8) (see Recipes)
Muramidase cellosyl (0.5 μg μl-1) (see Recipes)
Sodium borate (0.5 M, pH 9.0) (see Recipes)
HPLC buffer A (see Recipes)
HPLC buffer B (see Recipes)
Equipment
Pipettes (Gilson, catalog numbers: F167300 and F167500 )
AccuTherm Microtube Shaking Incubator (Labnet International, model: AccuThermTM, catalog number: I-4002-HCS )
Vacuum concentration system (Labogene, model: MaxiVac Alpha )
Bench top centrifuge, for example Accuspin Micro 17 microcentrifuge (Fisher Scientific, model: accuSpinTM Micro 17 , catalog number: 75002460)
Chemical fume hood
TLC developing chamber (VWR, catalog number: 552-0363 )
Proheat® heat gun (Sigma-Aldrich, catalog number: Z673722-1EA )
Small beaker (Petri dish, Steriplan®) (VWR, catalog number: 391-2840 )
Dry bath (Digital Dry Bath, Labnet International, catalog number: D1100-230V )
HPLC apparatus (Agilent Technologies, model: 1200 Series ) with flow detector for radioactivity (LabLogic Systems, model: Beta-RAM 5 )
ProntoSIL 120-3-C18AQ3um 250 x 4.6 mm HPLC column (Bischoff Chromatography, catalog number: 2546F184PS030 )
IKA RH basic 2 magnetic stirrer (IKA, catalog number: 0003339002 )
Vortex (IKA, model: Minishaker MS2 )
pH meter (Cole-Parmer, Jenway, model: 3510 , catalog number: 351001)
Incubator (Genlab, catalog number: INC/100/DIG )
Brown glass vials (Fisher Scientific, catalog number: 11531474 )
Part I: Thin-layer chromatography assay
Procedure
Enzymatic digestion of lipid II or undecaprenyl pyrophosphate
Note: All reactions are carried out in 1.5 ml microtubes and incubated using a microtube shaking incubator at 800 rpm.
Reactions are carried out in a final volume of 50 μl and set up as described below for each substrate. All enzyme substrates are dried under vacuum and subsequently solubilized in the reaction mixture.
Note: Take into account the constituents present in the storage buffer of the assayed proteins to calculate the buffer mixture.
Lys-type lipid II
Prepare enzyme reactions with final concentrations of 30 mM HEPES/KOH pH 7.5, 150 mM KCl, 0.1% (w/v) Triton X-100, 40 µM lipid II (L-Lys). Add 2 µM phosphatase (e.g., TelCt), phosphatase-inhibitor complex (e.g., TelCt-TipC complex) or no enzyme (control) and incubate for 90 min at 37 °C.
Undecaprenyl monophosphate
Prepare enzyme reactions with final concentrations of 20 mM HEPES/KOH pH 7.5, 150 mM KCl, 1 mM CaCl2, 0.1% (w/v) Triton X-100, 100 µM undecaprenyl monophosphate. Add 2 µM phosphatase (e.g., TelCt) or no enzyme (control) and incubate for 90 min at 37 °C.
Undecaprenyl pyrophosphate synthesis coupled to the degradation by TelCt
Prepare enzyme reactions with final concentrations of 20 mM HEPES/KOH pH 7.5, 50 mM KCl, 0.5 mM MgCl2, 1 mM CaCl2, 0.1% (w/v) Triton X-100, 40 µM farnesyl pyrophosphate, 400 µM isopentenyl pyrophosphate, 10 µM UppS. Add 2 µM phosphatase (e.g., TelCt), phosphatase-inhibitor complex (e.g., TelCt-TipC complex) or no enzyme (control) and incubate for 5 h at 25 °C, followed by an additional incubation for 90 min at 37 °C.
Undecaprenol
Prepare enzyme reactions with final concentrations of 30 mM HEPES/KOH pH 7.5, 150 mM KCl, 0.1% (w/v) Triton X-100 and 100 µM undecaprenol. Incubate for 90 min at 37 °C.
Terminate the reactions by adding 50 µl of n-butanol/pyridine acetate (2:1) pH 4.2.
Vortex for 1 min and centrifuge for 3 min at 17,000 x g using a bench-top centrifuge to separate the organic phase (n-butanol) from the aqueous phase (pyridine-acetate, water).
Note: This step is essential to extract hydrophobic (lipid II, C55-P, C55-OH) and amphiphilic (C55-PP and Triton X-100) substances from the mixture. These substances will be found in the upper, organic phase which will contribute to 1/3 of the total volume.
Thin layer chromatography
Note: All steps are carried out in a chemical fume hood at room temperature if not indicated otherwise. The basic procedure for thin layer chromatography is shown in the published movie (Cockburn and Koropatkin, 2015).
Pour the mobile phase into the developing chamber and adjust the solvent level to 1 cm.
Close the chamber with the lid and allow for saturation of the gaseous phase with solvent (60 min).
Incubate the TLC plate for at least 1 h at 60 °C to remove any humidity left from storage.
Use a pencil to draw a line 1.5 cm from the bottom of the plate and mark sample spots. Sample spots are separated by 2 cm, and the distance from the outer spots to the edge of the plate should be at least 4 cm.
Load the complete organic phase (upper phase, see Step A3) in 10 µl aliquots on the sample spots. After the addition of each aliquot, the spot is dried with a heat gun. Alternatively, the plate is left under a fume hood for each drying step.
Note: It is important that the lower (aqueous) phase is not transferred on the plate, as this will result in smearing of the spots. When using a heat gun, it is important to not overheat the spots, as this can lead to degradation of compounds and additional bands.
Place the TLC carefully in the developing chamber such that the solvent does not reach the spots. Optimally, there should be a distance of 0.5 cm between the solvent level and the pencil line.
The TLC plate is incubated in the chamber with the lid on until the solvent front reaches 4/5 of the plate length, which takes 1.5-2 h.
Staining
Remove the plate from the chamber and dry it with a heat gun. The plate should be completely dried to avoid the appearance of solvent bands during staining.
Place a small beaker with iodine in the chamber and put the lid on. Saturation will take 20-30 min at room temperature.
Place the plate in the development chamber saturated with iodine vapor and incubate it until the spots are clearly visible (20 min-1 h).
Representative examples of each reaction are shown in Figure 1.
Figure 1. Lipid II and C55-PP, but not C55-P, are substrates of TelCt. Thin-layer chromatography analysis of the products obtained in reactions of TelCt (toxin domain of TelC) or TelCt-TipC with (A) C55-P, (B) C55-PP or (C) lipid II. D. C55-OH migrates at the solvent front. Control samples (-) contained no protein. TelCt was active against lipid II and C55-PP and was inhibited by its immunity protein TipC. The figure was adopted from Whitney et al. (2017).
Note: Only lipid II and undecaprenyl monophosphate will appear as sharp bands. Due to its amphiphilic nature undecaprenyl pyrophosphate will appear as a crescent-shaped band between lipid II and undecaprenyl phosphate. The hydrophobic undecaprenol will always migrate at the solvent front, but will be visible after iodine staining.
Data analysis
Take a high-resolution picture and determine the retention factor (Rf) using commercially available programs (e.g., ImageJ). Bands present in control reactions serve as a standard.
Note: The distance is measured from the application line to the middle of the substance spots. For asymmetric spots (here: undecaprenyl pyrophosphate) measure the distance between the application line and lowest point of the spot. Spots in reaction mixtures should have similar Rf values, shape and color as spots derived from the standard compounds.
Part II: High performance liquid chromatography assay
Procedure
Lipid II reactions for HPLC assay
Note: A control reaction, containing the peptidoglycan synthase PBP1B and its cognate activator LpoB, is assayed to polymerize lipid II into short glycan chains with C55-PP at the terminal MurNAc residue.
Dry 10,000 dpm (~1 nmol) of [14C]GlcNAc-labeled lipid II-Lys, stored in chloroform/methanol (1:1), in a glass vial using a vacuum.
Resuspend the lipid II in 5 μl of 0.2% (w/v) Triton X-100 and vortex for 10 sec at 1,800 rpm.
Prepare in a 1.5 ml microtube a reaction buffer mixture with final concentrations of 15 mM HEPES/NaOH, pH 7.5, 10 mM MgCl2, 150 mM NaCl, 0.023% (w/v) Triton X-100 and 0.4 mM CaCl2 (the PBP1B-LpoB control reaction did not contain CaCl2) in a total reaction volume of 100 μl.
Note: Take into account the constituents present in the storage buffer of the assayed proteins to calculate the buffer mixture.
Add 2 μM phosphatase (e.g., TelCt or Colicin M) or phosphatase-inhibitor complex (TelCt-TipC) to the reaction buffer. For a control sample add 0.75 μM PBP1B and 1.5 μM LpoB to the reaction buffer.
Add the reaction mixture to the resuspended lipid II and incubate it for 60 min in a microtube shaking incubator at 37 °C with shaking (800 rpm).
Spin down the condensation using a microcentrifuge.
Reactions with phosphatases (TelCt, TelCt-TipC or Colicin M) are processed as follows:
Adjust the pH of the sample to 3.5-4.0 using 20% phosphoric acid and pH indicator stripes.
Note: Measure the pH by putting 0.3 μl sample onto the pH indicator stripe.
Centrifuge the sample in a microcentrifuge for 15 min at maximum speed and room temperature. Transfer the supernatant into an HPLC vial containing a 400 µl vial insert.
The control reaction with PBP1B-LpoB requires additional steps to digest the peptidoglycan with a muramidase and reduce the resulting unphosphorylated muropeptides. After Step A6 the reaction must be processed as follows:
Incubate samples for 5 min at 100 °C using a dry bath, then spin down the condensation using a microcentrifuge.
Let the samples cool down at room temperature for 2 min.
Add 30 μl of cellosyl buffer (80 mM sodium phosphate, pH 4.8) and 10 µl of 0.5 µg µl-1 cellosyl (or mutanolysin) to the sample.
Incubate the samples for 70 min in a microtube shaking incubator at 37 °C with shaking (800 rpm).
Spin down the condensation using a microcentrifuge.
Boil the reaction for 10 min at 100 °C on a dry bath and centrifuge the sample using a microcentrifuge for 15 min at maximum speed and room temperature.
Punch a hole in the lid of a new 2 ml microcentrifuge tube using a needle.
Note: The hole will allow releasing the H2 gas produced during the reduction step.
Transfer the supernatant to the 2 ml microcentrifuge tube.
Reduce the muropeptides by adding 100 μl of 0.5 M sodium borate, pH 9.0 and a tip of a spatula of solid sodium borohydride (ca. 1 mg).
Incubate the sample for 30 min at room temperature in a microcentrifuge at 4,700 x g to prevent spillage due to gas bubbles.
Adjust the pH of the sample to 3.5-4.0 using 20% phosphoric acid and pH indicator stripes.
Note: Measure the pH by putting 0.3 μl of sample onto the pH indicator stripe.
Centrifuge the sample in a microcentrifuge for 15 min at maximum speed and room temperature. Transfer the supernatant into an HPLC vial containing a 400 µl vial insert.
Detection of lipid II products by HPLC
System and set up conditions:
HPLC connected to a radioactivity flow-through detector
C18 reversed-phase column
Flow rate: 0.5 ml min-1
Column temperature: 55 °C
Wash with 100% methanol for 20 min at room temperature.
Increase column temperature to 55 °C.
Start a linear gradient for 30 min from 100% methanol to 100% Milli Q water, holding 100% Milli Q water for further 20 min.
Wash with HPLC buffer B for 20 min and equilibrate the column with HPLC buffer A for 40 min.
Do a buffer run following the same method used for the samples of interest (Steps B6-B9) but without injecting any sample.
Inject the sample (leave 20 µl of the total reaction volume in the vial insert) and flush the injection loop with HPLC buffer A for 2 min.
Start a linear elution gradient for 60 min from 100% HPLC buffer A to 50% HPLC buffer B, holding 50% HPLC buffer B for further 10 min.
Re-equilibrate the column with 100% HPLC buffer A for 30 min.
Inject the next sample.
Representative HPLC chromatograms of each sample are shown in Figure 2.
Figure 2. TelCt cleaves lipid II between undecaprenyl and pentapeptide-pyrophosphate. A. HPLC chromatograms of the radiolabeled products resultant from reactions containing Lys-Lipid II and the indicated proteins. PBP1B + LpoB reaction was further digested with cellosyl and reduced with sodium borohydride. B. Proposed structures of the main products (peaks 1-3 in panel A) of each reaction. GlcNAc, N-acetylglucosamine; MurNAc-PP, N-acetylmuramic acid pyrophosphate; MurNAc-P, N-acetylmuramic acid phosphate; MurNAc(r), N-acetylmuramitol; L-Ala, L-alanine; L-Lys, L-lysine; D-iGlu, D-isoglutamic acid; D-Ala, D-alanine. The figure was adopted from Whitney et al. (2017).
Data analysis
Each reaction should be assayed in triplicate.
The produced muropeptides are identified based on their retention time, using the software provided with the HPLC system (e.g., LauraTM, LabLogic Systems Ltd).
If needed, the phosphatase product can be verified by mass spectrometry. For this, use 16 nmol of non-radioactive lipid II (Lys version) as substrate to perform the reaction as described above, using a UV detector set at 205 nm, and collect the product fraction. Dry the collected fraction in a SpeedVac and store it at -20 °C until mass spectrometry analysis as reported (Bui et al., 2009).
Note: The products can be collected either manually or using the HPLC collector module.
Recipes
Note: Unless otherwise indicated, all stock solutions are prepared using Milli Q water.
Mobile phase (according to Rick et al., 1998)
Mix components in the following order under gentle stirring:
10 ml water
1 ml 36% ammonium hydroxide
48 ml methanol
88 ml chloroform
Store in a brown glass bottle
Note: Chloroform should be added step-wise and slowly to prevent phase separation.
Undecaprenol and undecaprenyl monophosphate diammonium salt
Prepare 1 mM solutions in chloroform-methanol (2:1, v:v)
Store in brown glass vials at -20 °C
6 M pyridinium acetate
Mix 51.5 ml glacial acetic acid with 48.5 ml of pyridine
n-Butanol/pyridinium acetate pH 4.2 (according to van Heijenoort et al., 1992)
Mix 50 ml n-butanol with 25 ml 6 M pyridinium acetate
HEPES/KOH stock solution (1 M, pH 7.5)
Dissolve 23.83 g N-(2-hydroxyethyl)piperazine-N’-(2-ethanesulfonic acid) (HEPES) in 90 ml of Milli Q water
Adjust pH to 7.5 with potassium hydroxide (1 M)
Adjust to a final volume of 100 ml
HEPES/NaOH stock solution (1 M, pH 7.5)
Dissolve 23.83 g N-(2-hydroxyethyl)piperazine-N’-(2-ethanesulfonic acid) (HEPES) in 90 ml of Milli Q water
Adjust pH to 7.5 with sodium hydroxide (1 M)
Adjust to a final volume of 100 ml
Sodium phosphate buffer (80 mM, pH 4.8)
Dissolve 0.64 g sodium hydroxide (for HPLC) in 150 ml Milli Q water
Adjust pH to 4.8 with phosphoric acid (85% and 20%)
Adjust to a final volume of 200 ml
Muramidase cellosyl (0.5 μg μl-1)
Dissolve 5 mg of freeze-dried muramidase cellosyl stock in 10 ml of 20 mM sodium phosphate, pH 4.8
Aliquot in microtubes and store at -20 °C
Sodium borate (0.5 M, pH 9.0)
Dissolve 3.09 g boric acid in 75 ml Milli Q water
Adjust pH to 9.0 with sodium hydroxide (10 M)
Adjust to a final volume of 100 ml
HPLC buffer A (50 mM sodium phosphate, pH 4.31 with 10 μl of 10% sodium azide per liter of buffer)
Dissolve 4 g sodium hydroxide (for HPLC) in 1,900 ml Milli Q water
Adjust pH to pH 4.31 with phosphoric acid (85% and 20%)
Adjust to a final volume of 2 L
Filter the buffer using a 0.22 μm filter
Add 20 μl of 10% sodium azide
HPLC buffer B (75 mM sodium phosphate, pH 4.95, 15% v/v methanol)
Dissolve 6 g sodium hydroxide (for HPLC) in 1,500 ml Milli Q water
Adjust pH to pH 4.95 with phosphoric acid (85% and 20%)
Adjust to a final volume of 1.7 L
Filter the buffer through a 0.22 μm filter
Add 300 ml of methanol for HPLC
Acknowledgments
This work reports in detail the methods previously used to demonstrate the cleavage site of TelC in peptidoglycan precursors (Whitney et al., 2017). This work was funded by the UK Medical Research Council (MRC) within the Joint Programming Initiative on Antimicrobial Resistance ANR-14-JAMR-0003 (NAPCLI) and the AMR Cross-council initiative Collaborative Grant MR/N002679/1. The authors declare that they have no conflict of interest or competing interest.
References
Barreteau, H., Kovac, A., Boniface, A., Sova, M., Gobec, S. and Blanot, D. (2008). Cytoplasmic steps of peptidoglycan biosynthesis. FEMS Microbiol Rev 32(2): 168-207.
Bertsche, U., Kast, T., Wolf, B., Fraipont, C., Aarsman, M. E., Kannenberg, K., von Rechenberg, M., Nguyen-Disteche, M., den Blaauwen, T., Holtje, J. V. and Vollmer, W. (2006). Interaction between two murein (peptidoglycan) synthases, PBP3 and PBP1B, in Escherichia coli. Mol Microbiol 61(3): 675-690.
Bouhss, A., Trunkfield, A. E., Bugg, T. D. and Mengin-Lecreulx, D. (2008). The biosynthesis of peptidoglycan lipid-linked intermediates. FEMS Microbiol Rev 32(2): 208-233.
Braun, V. and Patzer, S. I. (2013). Intercellular communication by related bacterial protein toxins: colicins, contact-dependent inhibitors, and proteins exported by the type VI secretion system. FEMS Microbiol Lett 345(1): 13-21.
Brötz, H., Bierbaum, G., Markus, A., Molitor, E. and Sahl, H. G. (1995). Mode of action of the lantibiotic mersacidin: inhibition of peptidoglycan biosynthesis via a novel mechanism? Antimicrob Agents Chemother 39(3): 714-719.
Bui, N. K., Gray, J., Schwarz, H., Schumann, P., Blanot, D. and Vollmer, W. (2009). The peptidoglycan sacculus of Myxococcus xanthus has unusual structural features and is degraded during glycerol-induced myxospore development. J Bacteriol 191(2): 494-505.
Cao, Z., Casabona, M. G., Kneuper, H., Chalmers, J. D. and Palmer, T. (2016). The type VII secretion system of Staphylococcus aureus secretes a nuclease toxin that targets competitor bacteria. Nat Microbiol 2: 16183.
Cascales, E., Buchanan, S. K., Duche, D., Kleanthous, C., Lloubes, R., Postle, K., Riley, M., Slatin, S. and Cavard, D. (2007). Colicin biology. Microbiol Mol Biol Rev 71(1): 158-229.
Cockburn, D. and Koropatkin, N. (2015). Product analysis of starch active enzymes by TLC. Bio-protocol 5(20): e1621.
Egan, A. J. F., Biboy, J., van’t Veer, I., Breukink, E. and Vollmer, W. (2015). Activities and regulation of peptidoglycan synthases. Phil Trans R Soc B 370: 20150031.
Egan, A. J., Jean, N. L., Koumoutsi, A., Bougault, C. M., Biboy, J., Sassine, J., Solovyova, A. S., Breukink, E., Typas, A., Vollmer, W. and Simorre, J. P. (2014). Outer-membrane lipoprotein LpoB spans the periplasm to stimulate the peptidoglycan synthase PBP1B. PNAS 111(22): 8197-8202.
El Ghachi, M., Bouhss, A., Barreteau, H., Touze, T., Auger, G., Blanot, D. and Mengin-Lecreulx, D. (2006). Colicin M exerts its bacteriolytic effect via enzymatic degradation of undecaprenyl phosphate-linked peptidoglycan precursors. J Biol Chem 281(32): 22761-22772.
Malanovic, N. and Lohner, K. (2016). Antimicrobial peptides targeting gram-positive bacteria. Pharmaceuticals (Basel) 9(3).
Manat, G., Roure, S., Auger, R., Bouhss, A., Barreteau, H., Mengin-Lecreulx, D. and Touze, T. (2014). Deciphering the metabolism of undecaprenyl-phosphate: the bacterial cell-wall unit carrier at the membrane frontier. Microb Drug Resist 20(3): 199-214.
Pan, J. J., Chiou, S. T. and Liang, P. H. (2000). Product distribution and pre-steady-state kinetic analysis of Escherichia coli undecaprenyl pyrophosphate synthase reaction. Biochemistry 39(35): 10936-10942.
Qiao, Y., Srisuknimit, V., Rubino, F., Schaefer, K., Ruiz, N., Walker, S. and Kahne, D. (2017). Lipid II overproduction allows direct assay of transpeptidase inhibition by β-lactams. Nat Chem Biol 13(7): 793-798.
Rick, P. D., Hubbard, G. L., Kitaoka, M., Nagaki, H., Kinoshita, T., Dowd, S., Simplaceanu, V. and Ho, C. (1998). Characterization of the lipid-carrier involved in the synthesis of enterobacterial common antigen (ECA) and identification of a novel phosphoglyceride in a mutant of Salmonella typhimurium defective in ECA synthesis. Glycobiology 8(6): 557-567.
Russell, A. B., Hood, R. D., Bui, N. K., LeRoux, M., Vollmer, W. and Mougous, J. D. (2011). Type VI secretion delivers bacteriolytic effectors to target cells. Nature 475(7356): 343-347.
Russell, A. B., Peterson, S. B. and Mougous, J. D. (2014). Type VI secretion system effectors: poisons with a purpose. Nat Rev Microbiol 12(2): 137-148.
Russell, A. B., Singh, P., Brittnacher, M., Bui, N. K., Hood, R. D., Carl, M. A., Agnello, D. M., Schwarz, S., Goodlett, D. R., Vollmer, W. and Mougous, J. D. (2012). A widespread bacterial type VI secretion effector superfamily identified using a heuristic approach. Cell Host Microbe 11(5): 538-549.
Typas, A., Banzhaf, M., Gross, C. A. and Vollmer, W. (2012). From the regulation of peptidoglycan synthesis to bacterial growth and morphology. Nat Rev Microbiol 10(2): 123-136.
van Heijenoort, Y., Gomez, M., Derrien, M., Ayala, J. and van Heijenoort, J. (1992). Membrane intermediates in the peptidoglycan metabolism of Escherichia coli: possible roles of PBP 1b and PBP 3. J Bacteriol 174(11): 3549-3557.
Vollmer, W. and Bertsche, U. (2008). Murein (peptidoglycan) structure, architecture and biosynthesis in Escherichia coli. Biochim Biophys Acta 1778(9): 1714-1734.
Vollmer, W., Blanot, D. and de Pedro, M. A. (2008). Peptidoglycan structure and architecture. FEMS Microbiol Rev 32(2): 149-167.
Whitney, J. C., Peterson, S. B., Kim, J., Pazos, M., Verster, A. J., Radey, M. C., Kulasekara, H. D., Ching, M. Q., Bullen, N. P., Bryant, D., Goo, Y. A., Surette, M. G., Borenstein, E., Vollmer, W. and Mougous, J. D. (2017). A broadly distributed toxin family mediates contact-dependent antagonism between gram-positive bacteria. Elife 6: e26938.
Copyright: Pazos et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Pazos, M., Otten, C. and Vollmer, W. (2018). Bacterial Cell Wall Precursor Phosphatase Assays Using Thin-layer Chromatography (TLC) and High Pressure Liquid Chromatography (HPLC). Bio-protocol 8(6): e2761. DOI: 10.21769/BioProtoc.2761.
Whitney, J. C., Peterson, S. B., Kim, J., Pazos, M., Verster, A. J., Radey, M. C., Kulasekara, H. D., Ching, M. Q., Bullen, N. P., Bryant, D., Goo, Y. A., Surette, M. G., Borenstein, E., Vollmer, W. and Mougous, J. D. (2017). A broadly distributed toxin family mediates contact-dependent antagonism between Gram-positive bacteria. Elife 6: e26938.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Lipid
Microbiology > Microbial biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Peptidoglycan
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,762 | https://bio-protocol.org/exchange/protocoldetail?id=2762&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Live-cell Reporter Assay for Noncanonical Wnt Activity
EK Edith P. Karuna
MS Michael W. Susman
HH Hsin-Yi Henry Ho
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2762 Views: 8583
Edited by: Nicoletta Cordani
Reviewed by: Patrick Ovando-Roche
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
Noncanonical Wnt signaling functions independently of the β-catenin pathway to control diverse developmental processes, and dysfunction of the pathway contributes to a number of human pathological conditions, including birth defects and metastatic cancer. Progress in the field, however, has been hampered by the scarcity of functional assays for measuring noncanonical Wnt signaling activity. We recently described the Wnt5a-Ror-Kif26b (WRK) reporter assay, which directly monitors a post-transcriptional regulatory event in noncanonical Wnt signaling. In this protocol, we describe the generation of the stable GFP-Kif26b reporter cell line and a quantitative reporter assay for detecting and measuring Wnt5a signaling activities in live cells via flow cytometry.
Keywords: Noncanonical Wnt reporter Wnt5a signaling Kif26b Regulated degradation Flow cytometry
Background
Historically, transcriptional reporter assays have facilitated the delineation of major signaling pathways. In particular, β-catenin-dependent luciferase- or GFP-based transcriptional reporters have been instrumental in elucidating the molecular mechanisms of the canonical Wnt/β-catenin pathway (Korinek et al., 1997; Fuerer and Nusse, 2010). Although a number of noncanonical Wnt signaling reporters based on JNK-dependent transcription have been described, it remains unclear whether these transcriptional responses are primary or secondary to noncanonical Wnt signaling (Veeman et al., 2003; Nishita et al., 2010; Ohkawara and Niehrs, 2011). Also, a reporter for real-time detection of non-transcriptional Wnt5a-Ror signaling events has not been available. The Wnt5a-Ror-Kif26b (WRK) reporter assay, which directly monitors a non-transcriptional Wnt5a-Ror signaling event, adds to the current repertoire of molecular tools for studying noncanonical Wnt signaling (Ho et al., 2012; Susman et al., 2017).
As described in our recent publication, Wnt5a-Ror signaling modulates the steady-state protein level of the kinesin superfamily member Kif26b by inducing its ubiquitin- and proteasome-dependent degradation (Susman et al., 2017). This reporter assay enables further identification and mechanism-based analysis of other Wnt5a-Ror signaling components, most of which remain unknown or relatively unexplored. In addition, the WRK assay may also facilitate the screening of pharmacological agents in Wnt5a-Ror related diseases such as certain cancers and developmental disorders.
This protocol describes the generation of the stable GFP-Kif26b reporter cell line and a quantitative method of detecting Wnt5a signaling levels in live GFP-Kif26b reporter cells via flow cytometry.
Materials and Reagents
Pipette tips (USA Scientific, catalog numbers: 1122-1832 , 1120-8812 , 1123-1812 , 1121-3812 )
10-cm tissue culture dish (Corning, Falcon®, catalog number: 353003 )
1.5 ml microcentrifuge tubes (Denville Scientific, catalog number: C2170 )
Note: Autoclave before use.
6-well plate
48-well tissue culture plate (Corning, Costar®, catalog number: 3548 )
5 ml round-bottom tubes with 35 µm cell strainer snap cap (Corning, Falcon®, catalog number: 352235 )
NIH/3T3 Flp-In cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: R76107 )
pCAG-GFP (available upon request), or any GFP plasmid suitable for mammalian expression
pEF5-FRT-GFP-Kif26b (Addgene, catalog number: 102862 ) reporter construct
pOG44 Flp-Recombinase expression vector (Thermo Fisher Scientific, InvitrogenTM, catalog number: V600520 )
Recombinant Wnt5a (R&D Systems, catalog number: 654-WN-010 )
Genjet In Vitro Transfection Reagent for NIH/3T3 cells (SignaGen Laboratories, catalog number: SL100488 , 3T3)
Hygromycin B (50 mg/ml solution) (Corning, Mediatech, catalog number: 30-240-CR )
Poly-D-lysine (Sigma-Aldrich, catalog number: P6407-10X5MG )
Wnt-C59 (Cellagen Technology, catalog number: C7641-2s )
Trypsin EDTA (Corning, Mediatech, catalog number: 25-052-CI )
Dulbecco’s modified Eagle’s medium (DMEM) (Corning, Mediatech, catalog number: 15-017-CV )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 16000069 )
Note: The FBS is used directly without heat-inactivation.
Glutamine (100x solution, 200 mM) (Corning, Mediatech, catalog number: 25-005-CI )
Penicillin-streptomycin (100x solution, 100 IU/ml) (Corning, Mediatech, catalog number: 30-002-CI )
Bovine serum albumin (BSA) (Fisher Scientific, catalog number: BP1600-1 )
CHAPS detergent (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 28300 )
Phosphate buffered saline (PBS) (GE Healthcare, catalog number: SH30256.01 )
Growth media (see Recipes)
Wnt control buffer (see Recipes)
Cell resuspension buffer for flow cytometry (see Recipes)
Equipment
Pipetters (e.g., Eppendorf, model: Research® plus )
37 °C, 5% CO2 incubator (e.g., Heracell by Thermo Fisher Scientific)
Centrifuge with cooling capabilities (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM LegendTM Micro 21R )
Fluorescent microscope with 488 nm light source (e.g., Thermo Fisher Scientific, model: EVOS® )
Flow cytometer with 488 nm laser (e.g., BD, model: FACScan )
Software
FlowJo software (FlowJo, LLC; https://www.flowjo.com/)
Procedure
Generation of stable reporter cell lines using the Flp-In NIH/3T3 cell line
Cell plating for transfection
Seed cells at 1.62 M cells/plate in a 10-cm plate in 10 ml of growth media. Culture the cells at 37 °C until they reach 80% confluency (about 18-24 h, Figure 1).
Note: Prepare 1 plate of cells for each reporter construct, plus 1 additional plate for the pCAG-GFP, which serves as both a negative control for the Flp-In and a reference for transfection efficiency.
Figure 1. Confluency (80%) at the time of transfection. Phase contrast, 10x magnification. Scale bar represents 400 μm.
Transfection
One hour before transfection, remove media from cells and replace with 6 ml fresh growth media.
Dilute DNA: In a 1.5 ml microcentrifuge tube, add 1.35 μg pEF5-FRT-GFP-Kif26b and 12.15 μg pOG44 to 675 μl of serum-free media (plain DMEM). In parallel, for the GFP control plate, prepare a tube of 675 μl serum-free media with 13.5 μg of pCAG-GFP but no pOG44. Mix well by pipetting.
Note: Total mass of transfected DNA is 13.5 μg. Transfect with a 1:10 molar ratio of reporter plasmid to flp recombinase; adjust masses according to the size of the plasmid.
Dilute the GenJet transfection reagent: for each plate, prepare a separate 1.5 ml microcentrifuge tube of 40.5 μl GenJet transfection reagent in 675 μl of serum-free media (plain DMEM). Mix well by pipetting.
Add each tube of diluted GenJet solution all at once to each respective DNA solution.
Note: The GenJet solution must be added to the DNA solution, not the reverse. Vortex gently for 4 sec to mix.
Incubate the transfection mixes for 15 min at room temperature. Do not let the incubation proceed for more than 20 min.
Add the transfection mixes drop-wise to their respective plates of cells.
Gently rock the plates to mix well and return the plates to the incubator.
After 12-18 h, check transfection efficiency by visualizing the GFP control plate under a fluorescent microscope (Figure 2). Remove transfection media and replace with 10 ml of growth media.
Figure 2. GFP control plate 12-18 h after transfection. A. Phase contrast channel, 10x magnification. Scale bar represents 400 μm. B. GFP channel, 10x magnification. Scale bar represents 400 μm.
Antibiotic selection
Two days after transfection, split each 10-cm plate into 4 x 10-cm plates in growth media to avoid overcrowding cells during selection (do not use selection antibiotics during the split).
After cells adhere to the plate, remove media and replace with fresh growth media containing 200 μg/ml hygromycin B. Replace with fresh hygromycin media every 3-4 days. Selection should take about 7-10 days. Between 6-20 colonies per plate is typically expected (Figure 3).
Note: A kill curve was conducted to determine that 200 μg/ml hygromycin B is optimal for NIH/3T3 Flp-In cells. The optimal selection concentration may vary slightly depending on the source of hygromycin B and cell lines.
Figure 3. A representative colony at 7 days post-hygromycin B selection. Phase contrast, 4x magnification. Scale bar represents 1,000 μm.
Cells may be pooled from 1 or 2 10-cm plates into a single well of a 6-well plate and passaged in growth media without selection antibiotics.
Note: This step is only performed for the reporter constructs. The GFP control plate, which should yield no colonies, is discarded.
Wnt5a stimulation assay
Experimental design: For a basic Wnt5a stimulation, include one condition for stimulation (+Wnt5a, where Wnt5a-containing media is added) and one condition for control (-Wnt5a, where control buffer-containing media is added) for each reporter cell line. The experiment setup will vary depending on your application of the assay; see Data analysis section for details on other types of stimulations.
Seed reporter cells at 0.09 million/well in the poly-D-lysine-coated 48-well plate in 400 μl growth media per well. Cells should be about 90% confluent.
Notes:
Plate coating is done by adding 200 μl of a poly-D-lysine solution (0.1 mg/ml in water; sterile filtered) to each well of a 48-well plate, incubating at room temperature for 15 min, removing the poly-D-lysine solution, and washing the wells with 400 μl of water three times. Air dry the plate completely (with the lid removed) before plating cells. Coated plates can also be stored at room temperature for future use.
For quantification, we typically plate cells in triplicate wells for each experimental condition.
The next day, gently remove media and replace with 400 μl growth media containing 10 nM Wnt-C59. Wnt-C59 inhibits the processing and secretion of endogenous Wnts. Allow cells to reach 100% confluency in Wnt-C59-containing media (generally one day). Cells should be as confluent as possible on the day of Wnt5a stimulation.
Note: If the monolayer of cells retract or peel off, repeat cell plating. Retracted cells do not signal well.
To stimulate cells with Wnt5a, gently remove media and replace with media containing 10 nM Wnt-C59 and the respective concentration of Wnt5a. For mock stimulation, use media containing Wnt-C59 and Wnt control buffer. If other drugs are used in conjunction with Wnt5a, pretreatment of the drug (typically for 1 h) may be necessary before addition of Wnt5a- and drug-containing media. Avoid disturbing the cell monolayer during media change.
Incubate cells with Wnt5a at 37 °C for 6 h.
To harvest cells for flow cytometry analysis, dissociate the cells with 100 μl trypsin per well at 37 °C for 3-5 min. Neutralize the trypsin with 500 μl of growth media and transfer the cell suspensions to 1.5 ml microcentrifuge tubes.
Centrifuge cells at 12,000 x g at 4 °C for 3 min to pellet the cells.
Remove the supernatant from each sample. Avoid disturbing the pellet.
Resuspend the pellets at room temperature in 100-150 μl flow cytometer buffer. Mix by pipetting until the sample is homogenously resuspended and strain the cell suspension into a round-bottom tube through the strainer cap.
Analyze the cells using a flow cytometer. We routinely use the Becton Dickinson FACScan and analyze 30,000 cells per sample.
Analyze data files in software (e.g., FlowJo). See next section for details.
Data analysis
For general data analysis, gate the live cell population via side scatter and forward scatter parameters in the flow cytometry software to exclude dead cells. The wild-type NIH/3T3 Flp-In parent cell line (i.e., untransfected) is used as a reference for autofluorescence; however, we do not typically gate the cell population based on the GFP signal to ensure that the entire live cell population is included in the reporter analysis. Generate a raw histogram of GFP fluorescence vs. cell count for the live gated population. Overlay the histograms from each sample to be compared to obtain the difference in median fluorescence between each sample population (Figure 4). This difference in medians is expressed as a percentage: [(Control median - stimulated median)/control median] x 100 (labeled as ‘% downregulation’ in Figure 5B). Multiple histograms may be overlaid for comparison or reference (Figure 5A, Figure 7A).
Figure 4. Basic analysis using the WRK reporter assay. Overlaid histograms from one set of samples showing the downregulation of GFP-Kif26b fluorescence in the WRK reporter cell line after Wnt5a stimulation (0.2 μg/ml Wnt5a) for 6 h.
For a dose-response analysis, we analyze a minimum of six samples with varying concentrations of the Wnt5a ligand or small molecule inhibitors, including a 0 dose point. The medians may be plotted against the concentrations to generate the dose-response curve (Figure 5B). For inhibitors, we typically vary the drug concentration in the presence of a fixed concentration of Wnt5a to determine the dose-response relationship.
Figure 5. Example of a dose-response analysis using the WRK reporter assay. Raw histograms (A) and the resulting dose-response curve (B) showing GFP-Kif26b downregulation as a function of Wnt5a concentration in the WRK reporter assay.
For a time course experiment, such as the Kif26b stability analysis shown in Figure 6, we stimulate samples with Wnt5a at regular time intervals until the end of the experiment, when all samples are harvested at once. The medians are plotted against the duration of stimulation.
Figure 6. Example of a time course experiment using the WRK reporter assay. The kinetics of GFP-Kif26b turnover in the absence or presence of Wnt5a stimulation, as measured in the WRK reporter assay. Cycloheximide was used to block new protein synthesis in the reporter cells.
For statistical analysis during quantification, we use a minimum of three biological replicates (cells plated and treated with Wnt5a and/or inhibitors in concurrent cultures). To assess the difference between two sets of data, we perform a two-tailed, unpaired Student’s t-test (Figure 7B). We include error bars for each set of replicates representing the standard error of the mean, which we generate by calculating the standard deviation of the medians of the replicates and dividing that number by the square root of N, where N is the number of replicates (Figure 6, Figure 7B).
Figure 7. Example of a pathway analysis experiment using the WRK reporter assay. Partial blocking of Wnt5a-induced reporter activity after ectopic Shisa2 expression via lentiviral transduction. A. Representative overlaid histograms show the effect of ectopic Shisa2 expression on Wnt5a-induced downregulation of GFP-Kif26b in the WRK reporter line. Shisa2 is an antagonist of the Frizzled family of Wnt receptor (Yamamoto et al., 2005). The effect of Wnt5a or control buffer treatment on the WRK reporter line is included as a reference. B. Quantification of the results shown in panel (A). t-tests were performed for the following comparisons: Control virus vs. no virus, P = 0.0957 (not significant); control virus vs. Shisa2 virus, P < 0.001 (significant).
Notes
Wnt5a signaling as detected by this assay appears to be highly sensitive to cell density. Signaling activity occurs best when cells are as confluent as possible, and activity decreases drastically when cells are less than 100% confluent. Some optimization may be required to determine the most optimal plating conditions for specific cell types and applications.
Recipes
Growth medium
DMEM supplemented with:
10% FBS
1x glutamine (2 mM)
1x penicillin-streptomycin (1 IU/ml)
Wnt control buffer
1x PBS supplemented with:
0.1% bovine serum albumin
0.5% (w/v) CHAPS
Cell resuspension buffer for flow cytometry
1x PBS supplemented with 0.5% FBS
Acknowledgments
This protocol was adapted from the following paper: Susman et al., 2017. We thank Michael Greenberg (Harvard Medical School) for discussions and support. We thank Bridgette McLaughlin at the UC Davis Cancer Center Flow Cytometry core (supported by P30 CA093373) for providing instruments, training and support. The development and characterization of the WRK reporter assay was supported by American Cancer Society grant IRG-95-125-13 and National Institutes of Health grant 1R35GM119574-01 to H.H. Ho, and T32GM007753 to M.W. Susman. The authors declare no conflicts of interest.
References
Fuerer, C. and Nusse, R. (2010). Lentiviral vectors to probe and manipulate the Wnt signaling pathway. PLoS One 5(2): e9370.
Ho, H. Y., Susman, M. W., Bikoff, J. B., Ryu, Y. K., Jonas, A. M., Hu, L., Kuruvilla, R. and Greenberg, M. E. (2012). Wnt5a-Ror-Dishevelled signaling constitutes a core developmental pathway that controls tissue morphogenesis. Proc Natl Acad Sci U S A 109(11): 4044-4051.
Korinek, V., Barker, N., Morin, P. J., van Wichen, D., de Weger, R., Kinzler, K. W., Vogelstein, B. and Clevers, H. (1997). Constitutive transcriptional activation by a β-catenin-Tcf complex in APC-/- colon carcinoma. Science 275(5307): 1784-1787.
Nishita, M., Itsukushima, S., Nomachi, A., Endo, M., Wang, Z., Inaba, D., Qiao, S., Takada, S., Kikuchi, A. and Minami, Y. (2010). Ror2/Frizzled complex mediates Wnt5a-induced AP-1 activation by regulating Dishevelled polymerization. Mol Cell Biol 30(14): 3610-3619.
Ohkawara, B. and Niehrs, C. (2011). An ATF2-based luciferase reporter to monitor non-canonical Wnt signaling in Xenopus embryos. Dev Dyn 240(1): 188-194.
Susman, M. W., Karuna, E. P., Kunz, R. C., Gujral, T. S., Cantu, A. V., Choi, S. S., Jong, B. Y., Okada, K., Scales, M. K., Hum, J., Hu, L. S., Kirschner, M. W., Nishinakamura, R., Yamada, S., Laird, D. J., Jao, L. E., Gygi, S. P., Greenberg, M. E. and Ho, H. H. (2017). Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates. Elife 6.
Veeman, M. T., Axelrod, J. D. and Moon, R. T. (2003). A second canon. Functions and mechanisms of β-catenin-independent Wnt signaling. Dev Cell 5(3): 367-377.
Yamamoto, A., Nagano, T., Takeara, S., Hibi, M. and Aizawa, S. (2005). Shisa promotes head formation through the inhibition of receptor protein maturation for the caudalizing factors, Wnt and FGF. Cell 120(2): 223-35.
Copyright: Karuna et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Karuna, E. P., Susman, M. W. and Ho, H. H. (2018). Quantitative Live-cell Reporter Assay for Noncanonical Wnt Activity. Bio-protocol 8(6): e2762. DOI: 10.21769/BioProtoc.2762.
Susman, M. W., Karuna, E. P., Kunz, R. C., Gujral, T. S., Cantu, A. V., Choi, S. S., Jong, B. Y., Okada, K., Scales, M. K., Hum, J., Hu, L. S., Kirschner, M. W., Nishinakamura, R., Yamada, S., Laird, D. J., Jao, L. E., Gygi, S. P., Greenberg, M. E. and Ho, H. H. (2017). Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates. Elife 6.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling > Apoptosis
Cancer Biology > Cell cycle checkpoints > Cell biology assays
Cell Biology > Cell signaling > Development
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,763 | https://bio-protocol.org/exchange/protocoldetail?id=2763&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Microbial Mutagenicity Assay: Ames Test
UV Urvashi Vijay
SG Sonal Gupta
PM Priyanka Mathur
Prashanth Suravajhala
PB Pradeep Bhatnagar
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2763 Views: 32884
Edited by: Modesto Redrejo-Rodriguez
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
The Microbial mutagenicity Ames test is a bacterial bioassay accomplished in vitro to evaluate the mutagenicity of various environmental carcinogens and toxins. While Ames test is used to identify the revert mutations which are present in strains, it can also be used to detect the mutagenicity of environmental samples such as drugs, dyes, reagents, cosmetics, waste water, pesticides and other substances which are easily solubilized in a liquid suspension. We present the protocol for conducting Ames test in the laboratory.
Keywords: Mutagenicity Carcinogenicity Salmonella strains Gene mutation Revertants
Background
The Microbial Ames test is a simple, rapid and robust bacterial assay consisting of different strains and applications of Salmonella typhimurium/E. coli, used for ascertaining the mutagenic potential (Levin et al., 1982; Gupta et al., 2009). In 1975, Ames and his followers standardized the traditional Ames assay protocol and reappraised in 1980’s (Maron and Ames, 1983). Induction of new mutations replacing existing mutations allows restoring of gene function. The newly formed mutant cells are allowed to grow in the absence of histidine and form colonies, hence this test is also called as ‘Reversion assay’ (Ames, 1971). While traditional Ames test is quite laborious and time consuming for initial monitoring of mutagenic compounds, miniaturization of liquid suspension significantly impacted the usability by making it more convenient. The standard doses (2 µl, 5 µl, 10 µl, 50 µl and 100 µl) were set to evaluate the mutagenicity from lower to higher concentration (Hayes, 1982). Mice liver has been used as a tissue for preparing homogenate 9,000 x g (S9 hepatic fraction) whereas in S9 mix, hepatocytes are used to minimize the mammalian metabolic activation formed in the mice liver. In Ames bioassay, the sensitivity of a compound for mutagenicity is based on the knowledge that a substance which is mutagenic in the presence of liver enzymes metabolizing compound might be a carcinogen (Mathur et al., 2005).
Genetic Approach: The Salmonella/E. coli tester strains: Several strains of Salmonella typhimurium have been used in Ames assay which requires histidine synthesis to assess the mutagenicity. In the histidine operon, each tester strain contains a different mutation. In addition to the histidine mutation, the standard tester strain of Salmonella typhimurium contains other mutations that greatly enhance their ability to detect the mutations (Figure 1). One of the mutations (rfa) causes partial loss of the lipopolysaccharides barrier that coats the surface of the bacteria and increases permeability to large molecules such as benzo[a]pyrene allowing not to penetrate in the normal cell wall (Mortelman and Zeiger, 2000). The mutagens present in the tested samples give rise to induced revertants on a minimal medium (absence of histidine). They are further used to observe revertants in previously mutated strains (that are not able to grow in a medium without histidine). The other mutation (uvrB) is a deletion mutation in which deletion of a gene, coding for the DNA excision repair system, causing gradually increased sensitivity in detecting many mutagens (Ames et al., 1973a). The reason behind this mutation is the deletion excising the uvrB gene emulsifying these bacteria requiring biotin for growth. The standard strains such as TA 97, TA 98, TA 100 and TA 102 contain the R-factor plasmid, pKM101. These R-factor strains are reverted by a number of mutagens that are detected weakly or not at all with the non R-factor parent strains (Ames et al., 1975a).
Figure 1. Genetic approach for assessing the mutagenicity in Salmonella strains (modified from https://en.wikipedia.org/wiki/Ames_test)
Many studies (Ames et al., 1975b; Levin et al., 1982) revealed that development of plasmid pKM101 in TA 1535 and TA 1538 strains leads to complement other isogenic strains such as TA 98, TA 100, TA 104 and TA 102. The his G46 mutation in TA 100 and TA 1535 codes for the first enzyme of histidine biosynthesis (hisG) (Ames et al., 1975b). This mutation, determined by DNA sequence analysis, substitutes proline (-GGG-) for leucine (-GAG-) in the wild type organism (Barnes et al., 1982). The tester strains TA 1535 and its R-factor derivative present in TA 100, detect mutagens which causes base-pair substitutions generally at one of these G-C pairs. The hisD3052 mutation in TA 1538 and TA 98 is in the hisD gene coding for histodinol dehydrogenase. TA 1538 and its R-factor derivative TA 98 detect various frameshift mutagens in repetitive sequences as ‘hot spots’ resulting in a frame shift mutation (Walker and Dobson, 1979; Shanabruch and Walker, 1980) (Table 1).
Table 1. Genotype of the Salmonella strain used for mutagenesis testing
Levin et al. (1982) described a standard strain Salmonella typhimurium bacterium called TA 102 which was used to evaluate the effect of some compounds reacting with nucleotides AT. Tester strain TA102 containing nucleotides AT, present in hisG gene carrying plasmid pAQ1. There are certain mutagenic agents which are detected by TA 102 but not by TA 1535, TA 1537, TA 1538, TA 98 and TA 100 (Wilcox et al., 1990). Before performing experiment, a new set of fresh strains are prepared; and the genotypes are assessed (R-factor, His, rfa and uvrB mutations). For these, we refer readers to many excellent reviews (Walker, 1979; Czyz et al., 2002; Fluckiger-Isler et al., 2004).
Certain carcinogens present in active forms in biological reaction are easily catalyzed by cytochrome-P450. Metabolic activation system is absent in Salmonella, and in order to improve the potentiality of bacterial test systems, liver extracts of Swiss albino mice are used. This serves as a rich source in converting carcinogens to electrophilic chemicals that are incorporated to detect in vivo mutagens and carcinogens (Garner et al., 1972; Ames et al., 1973a). The crude liver homogenate as 9,000 x g S9 fraction contains free endoplasmic reticulum, microsomes, soluble enzymes and some cofactors set with S9 concentration to 10% (Franz and Malling, 1975). The oxygenase requires the reduced form of Nicotinamide Adenine Dinucleotide Phosphate (NADP) which is generally in situ by the action of glucose-6-phosphate dehydrogenase and reducing NADP both work as cofactors in assay (Prival et al., 1984; Henderson et al., 2000). While water is considered as a negative control, sodium azide, 2-nitrofluorine and mitomycin for TA 98, TA 100 and TA 102 without S9 metabolic activation and 2-anthramine with S9 hepatic fraction are used as positive controls for conducting the test (Table 2). Before performing the experiment, fresh solutions must be prepared.
Table 2. Positive controls with and without S9 metabolic activation (DeFlora et al., 1984)
Spontaneous Reversion Control: Each strain of Salmonella contains a specific mutant range. Selection of solvents shows the effect on the frequency range of spontaneous mutant (Maron and Ames, 1983) (Table 3). The range of revertants varies in research laboratories. The spontaneous revertants are visible through unaided eyes (Figure 2).
Table 3. Spontaneous revertants control values for various strain types and number of revertants (Mortelmans and Stocker, 1979)
Figure 2. Spontaneous revertants colonies obtained after addition of waste water from health center in Salmonella mutagenicity assay at different concentrations, viz. 2 µl, 10 µl, 50 µl, 100 µl (Vijay, 2014)
Materials and Reagents
Materials
Tips (1,000 µl, 200 µl, 10 µl) (Tarsons)
Sterile Petri plates (HiMedia Laboratories, catalog number: PW001 )
Erlenmeyer flask and beaker (SchottDuran,10 ml, 250 ml, 500 ml)
Eppendorf tubes (Tarsons,1.5 ml, 2.0 ml)
Metal loop holder (metal loop Ch-2, HiMedia Laboratories, catalog number: LA012 )
L shaped spreader(HiMedia Laboratories, catalog number: PW1085 )
Mutagens
Sodium azide (HiMedia Laboratories, catalog number: GRM1038 )
4-Nitroquinoline N-oxide (Sigma-Aldrich, catalog number: N8141 )
2-Aminofluorene (Sigma-Aldrich, catalog number: A55500 )
Benzo(a)pyrene (Sigma-Aldrich, catalog number: B1760 )
Mitomycin C (Roche Diagnostics, catalog number: 10107409001 )
2,4,7-Trinitro-9-fluorenone (Accustandard, catalog number: R-033S )
4-Nitro-o-phenylenediamine (Sigma-Aldrich, catalog number: 108898 )
Reagents
Oxoid nutrient broth No. 2 (Sigma-Aldrich, catalog number: 70123 )
Note: This product has been discontinued.
70% ethanol
Magnesium sulphate heptahydrate (MgSO4·7H2O) (HiMedia Laboratories, catalog number: RM683 )
Citric acid monohydrate (HiMedia Laboratories, catalog number: GRM1008 )
Potassium phosphate, dibasic (K2HPO4) (anhydrous) (Merck, catalog number: 61788005001730 )
Sodium ammonium phosphate tetrahydrate (NaNH4HPO4·4H2O) (Sigma-Aldrich, catalog number: S9506 )
D-biotin (HiMedia Laboratories, catalog number: TC096 )
L-histidine (HiMedia Laboratories, catalog number: TC076 )
Hydrochloric acid (HCI) (HiMedia Laboratories, catalog number: AS003 )
Potassium chloride (KCl) (Merck, catalog number: 61753305001730 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (HiMedia Laboratories, catalog number: MB040 )
Sodium dihydrogen phosphate monohydrate (NaH2PO4·H2O) (Merck, catalog number: 1063700050 )
Disodium hydrogen phosphate (Na2HPO4) (HiMedia Laboratories, catalog number: TC051 )
NADP (sodium salt) (HiMedia Laboratories, catalog number: RM392 )
D-glucose-6-phosphate (monosodium salt) (Sigma-Aldrich, catalog number: G7879 )
Ampicillin trihydrate (Sigma-Aldrich, catalog number: A6140 )
Sodium hydroxide (NaOH) (Merck, catalog number: 106462 )
Crystal violet (Sigma-Aldrich, catalog number: C6158 )
Agar-Agar (Himedia Laboratories, catalog number: RM026 )
Nutrient broth (HiMedia Laboratories, catalog number: M002 )
Tetracycline (Sigma-Aldrich, catalog number: 87128 )
Dimethylsulfoxide (HiMedia Laboratories, catalog number: TC185 )
Vogel-Bonner medium E (50x) (see Recipes)
0.5 mM histidine/biotin solution (see Recipes)
Salt solution (1.65 M KCl + 0.4 M MgCl2) (see Recipes)
0.2 M sodium phosphate buffer, pH 7.4 (see Recipes)
1 M Nicotinamide Adenine Dinucleotide Phosphate (NADP) solution (see Recipes)
1 M glucose-6-phosphate (see Recipes)
Ampicillin solution (4 mg/ml) (see Recipes)
Crystal violet solution (0.1%) (see Recipes)
Minimal glucose plates (see Recipes)
Histidine/Biotin plates (see Recipes)
Ampicillin and tetracycline* plates (see Recipes)
Nutrient agar plates (see Recipes)
S9 mix (Rat Liver Microsomal Enzymes + Cofactors) (see Recipes)
Sodium azide (see Recipes)
Mitomycin (see Recipes)
2-Anthramine (see Recipes)
Equipment
Orbital shaking incubator (Remi, model: RIS-24(BL) )
Laminar Flow hood (Bio safety cabinet) (Deepak Meditech Pvt Ltd., Steri clean)
Pipettes (Eppendorf, model: Research® plus, catalog number: 3120000062 , 1,000 μl; catalog number: 3120000046 , 200 μl; catalog number: 3120000020 , 10 μl)
Vortex mixer (Labnet International, catalog number: S0100 )
Hot water bath (Daiki Sciences, catalog number: KBLee2001 )
Autoclave (TSC)
Automatic Colony counter (Sonar)
Refrigerator centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: Heraeus Biofuge Primo R )
pH meter (Labindia Analytical Instruments, model: PICO pH Meter , catalog number: PC13330101)
Tissue tearor (Bio Spec Products, catalog number: 985370-04 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Vijay, U., Gupta, S., Mathur, P., Suravajhala, P. and Bhatnagar, P. (2018). Microbial Mutagenicity Assay: Ames Test. Bio-protocol 8(6): e2763. DOI: 10.21769/BioProtoc.2763.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > DNA > DNA damage and repair
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,764 | https://bio-protocol.org/exchange/protocoldetail?id=2764&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Organotypic Explants of the Embryonic Rodent Hippocampus: An Accessible System for Transgenesis
A Archana Iyer *
LS Lakshmi Subramanian*
Shubha Tole
*Contributed equally to this work
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2764 Views: 6513
Edited by: Oneil G. Bhalala
Original Research Article:
The authors used this protocol in Jul 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2011
Abstract
This protocol describes the technique of ex-vivo electroporation to target embryonic hippocampal progenitors in an organotypic slice preparation. This technique allows gene perturbation for examining developmental processes in the embryonic hippocampus while retaining the environment and connectivity of the cells. Gene perturbation can include Cre-mediated recombination, RNAi-mediated knockdown, gene overexpression, or a combination of any of these. Ex-vivo electroporation can be performed at a wide range of embryonic stages, giving temporal control to the experimenter. Spatial control can be achieved more easily by preparing the brain in a Petri dish to target particular regions of the hippocampus. The electroporated explant cultures provide a highly tractable system for the study of developmental processes that include progenitor proliferation, migration and cell fate acquisition.
Keywords: Mouse hippocampus Embryo Electroporation Hippocampal slice Organotypic explant
Background
The hippocampus presents a challenge in terms of accessibility due to its location in the caudomedial telencephalon. The embryonic hippocampus is even more inaccessible, requiring in utero surgical methods for experimental manipulation. Organotypic slice cultures circumvent this problem and at the same time retain many aspects of hippocampal field cytoarchitectonics, including molecular features and connectivity. While there are protocols that describe postnatal culturing of hippocampal explants from rodent brains (Stoppini et al., 1991; Opitz-Araya and Barria, 2011) these do not include genetic manipulation of the cells. The preparation of organotypic explants from the embryonic mouse hippocampus was first described in Tole et al. (1997). We extended this protocol by introducing ex-vivo electroporation of the embryonic brain prior to preparing the organotypic slices. Electroporation of the intact brain after introducing DNA into the telencephalic ventricle ensures that cells residing in and near the ventricular zone are targeted, and therefore provides an excellent means of inducing transgenesis in hippocampal progenitors. Data using this protocol were published in Subramanian et al. (2011). Here, we present detailed step-wise instructions including experimental ‘dos and don’ts’, and also illustrate key steps using photographs and movies, to aid new researchers in setting up this useful procedure.
Some advantages and applications of this protocol are:
1)Temporal control can be achieved by isolating the embryonic hippocampus at the desired stage to access early, mid, or late-gestation progenitors.
2)Spatial control can be achieved by orienting the electrodes to target the hippocampus or different areas of the cortex.
3)Cre-mediated recombination can be employed by electroporating Cre-GFP into embryos carrying the desired floxed alleles.
4)Overexpression constructs can be electroporated.
5)Embryonic lethal strains can be accessed by performing the procedure in the window of viability, and then further development can proceed in the organotypic explant.
Materials and Reagents
Plastic Pasteur pipettes:
3 ml (P-3) and 2 ml (P-1) (Taurus Biomedical)
1.5 ml pipettes (RPI, catalog number: 147500 )
Note: Henceforth these will all be referred to as ‘pipettes’. Procuring the correct size of pipette and cutting the shaft to the correct aperture size (see Figure 1) is key to being able to manipulate brains, hemispheres and explants without damaging them.
Figure 1. Plastic Pasteur pipettes. A. Different sizes of pipettes used in this procedure: #1 (1.5 ml pipette), #2 (2 ml pipette), #3 (3 ml pipette) prepared by cutting #4 as shown. The cut is made just at the point where the pipette shaft diameter begins to taper, approximately 2 cm from the tip. B. Beaker with pipettes being sterilized in alcohol.
35 mm sterile Petri dishes (Laxbro, catalog number: PD-35 TC )
Cell culture 6-well tissue culture plate (Thermo Fisher Scientific, catalog number: 140675 )
Micropipette tip
Glass Capillaries: Thin wall borosilicate tubing without filament (Sutter Instruments, catalog number: B100-75-10 )
100 mm Petri dishes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 150464 )
Sterile blade
Cell Culture Inserts: 0.4 µm (Millicell, Merck, catalog number: PICM03050 )
Aspirator assembly (Sigma-Aldrich, catalog number: A5177-5EA )
50 ml syringe filter unit with 0.22 µm filter (Millex-GP, Merck, catalog number: SLGP033RS ) for sterilizing the culture medium
2 Squirt bottles (Tarsons, catalog number: 561100 ) (containing 70% and 100% ethanol)
pCS2-EGFP plasmid (or any desired plasmid)
Pregnant Swiss mice (SWR/J) (obtained from Tata Institute of Fundamental Research breeding facility)
Absolute ethanol (Merck, catalog number: 107017 )
Leibovitz’s L-15 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 41300039 )
Fast green dye (Sigma-Aldrich, catalog number: F7252 )
Penicillin-streptomycin (P/S) (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Dulbecco’s modified Eagle medium (Thermo Fisher Scientific, GibcoTM,catalog number: 12800017 )
B27TM supplement (50x), serum-free (Thermo Fisher Scientific, GibcoTM, catalog number: 17504044 )
Working solution of DMEM medium (see Recipes)
Equipment
Horizontal flow hood (Kirloskar, Envair Electrodyne, catalog number: KCH-B )
Glass beaker (Borosil, catalog number: 1000D21 )
Tissue chopper (McIlwain, model: MTC/2E )
Stereo microscope (Olympus, catalog number: SZ61 ) placed in a horizontal flow tissue culture hood
Cell culture incubator (Thermo Fisher Scientific, model: HeracellTM 150 )
Fine tools for manipulating embryonic brains:
Dumont # 5 Forceps, Dumostar (Roboz Surgical Instrument, catalog number: RS-4978 )
Dumont # 55, Forceps, Dumostar (Roboz Surgical Instrument, catalog number: RS-4984 )
Micro-dissecting Spring scissors (Roboz Surgical Instrument, catalog number: RS-5603 )
Coarse forceps (Roboz Surgical Instrument, catalog number: RS-5040 ) for handling the chopper stage disc
Fine scissors (Fine Science Tools, catalog number: 14060-11 ) and tissue forceps (Roboz Surgical Instrument, catalog number: RS-8166 ) for opening the dam and removing the uterus
Electrodes (3 mm, BTX, Harvard Apparatus, catalog number: 450487 )
Electroporator (BTX, Harvard Apparatus, model: ECM 830 )
Dual-stage glass micropipette puller (NARISHIGE, model: PC-10 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Iyer, A., Subramanian, L. and Tole, S. (2018). Organotypic Explants of the Embryonic Rodent Hippocampus: An Accessible System for Transgenesis. Bio-protocol 8(6): e2764. DOI: 10.21769/BioProtoc.2764.
Download Citation in RIS Format
Category
Neuroscience > Development > Explant culture
Cell Biology > Tissue analysis > Electroporation
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,765 | https://bio-protocol.org/exchange/protocoldetail?id=2765&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Single-step Precision Genome Editing in Yeast Using CRISPR-Cas9
AA Azat Akhmetov
JL Jon M Laurent
Jimmy Gollihar
EG Elizabeth C Gardner
RG Riddhiman K Garge
AE Andrew D Ellington
AK Aashiq H Kachroo
EM Edward M Marcotte
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2765 Views: 18322
Edited by: Yanjie Li
Reviewed by: Lionel SchiavolinVinay Panwar
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
Genome modification in budding yeast has been extremely successful largely due to its highly efficient homology-directed DNA repair machinery. Several methods for modifying the yeast genome have previously been described, many of them involving at least two-steps: insertion of a selectable marker and substitution of that marker for the intended modification. Here, we describe a CRISPR-Cas9 mediated genome editing protocol for modifying any yeast gene of interest (either essential or nonessential) in a single-step transformation without any selectable marker. In this system, the Cas9 nuclease creates a double-stranded break at the locus of choice, which is typically lethal in yeast cells regardless of the essentiality of the targeted locus due to inefficient non-homologous end-joining repair. This lethality results in efficient repair via homologous recombination using a repair template derived from PCR. In cases involving essential genes, the necessity of editing the genomic lesion with a functional allele serves as an additional layer of selection. As a motivating example, we describe the use of this strategy in the replacement of HEM2, an essential yeast gene, with its corresponding human ortholog ALAD.
Keywords: CRISPR Homologous recombination Humanization Ortholog complementation Genome editing Yeast engineering
Background
Saccharomyces cerevisiae (Baker’s yeast) has a long history as a genetically tractable organism, and there are an array of methodologies to manipulate the yeast genome. However, until recently it has been necessary to apply selection to isolate clones possessing the desired genetic alteration (Kearse et al., 2012; DiCarlo et al., 2013; Lee et al., 2015; Kachroo et al., 2017). In cases where arbitrary, scar-less editing of the genome is desired, the solution is typically a two-step process: First a selectable cassette (containing the URA3 marker, for example), flanked by homology arms targeting the region of interest, and sometimes containing nuclease targeting sites (i.e., I-SceI sites) to aid in the removal of the cassette at the later stage, is knocked in via homologous recombination (HR). The small subpopulation of successful integrants is isolated by selecting for the cassette. Second, the marker is eliminated through highly efficient sequence specific methods such as site-specific recombination or endonuclease cleavage (I-SceI) to generate the desired form of the edited genomic locus. Two steps are necessary because no method was available which is both scar-less and efficient enough such that no selection is required.
The development of CRISPR/Cas9 technology in yeast has eliminated the need for this two-step process. Cas9 efficiently creates double-stranded breaks (DSBs) in yeast DNA at virtually any arbitrary locus–provided a PAM sequence is proximal to the desired cut site. When an appropriate repair template is provided, these DSBs are repaired through the endogenous HR system of yeast. Cas9 directed to the desired genomic locus via the guide RNA sequence creates double-stranded break (DSB) in the genome. The CRISPR target site is retained in cells which fail to repair the target site as expected, which allows Cas9 to repeatedly cleave the same region until HR-mediated editing takes place. Rarely, non-homologous end-joining (NHEJ) can generate mutations which block Cas9 cleavage despite failing to incorporate the expected genomic alterations. More commonly, cells simply succumb to the stress of repeated Cas9-induced genomic cleavages. In an appropriately conducted experiment, the majority of the surviving population tends to be cells which have lost their CRISPR target site by incorporating the desired genomic alteration via HR. Cas9 thus acts as a counter-selection acting directly on genomic sequence, rather than its phenotypic manifestations.
Here, we use an approach developed by Dueber and colleagues (Lee et al., 2015) to rapidly generate single, self-contained plasmids that express both the Cas9 nuclease and guide RNA required for targeting a desired locus. These plasmids, when co-transformed with an appropriate repair template provided as a linear PCR product, allow efficient, precise, single-step replacement of any arbitrary yeast gene with an introduced sequence of interest. Only selection for the Cas9 and gRNA-expressing plasmid is required, which tends to select for correct genomic modification by proxy due to efficiency of targeting and repair. This strategy was used extensively in our ortholog complementation research (Kachroo et al., 2017) to rapidly humanize, bacterialize and plantize many essential yeast genes. A CRISPR based approach is uniquely suited to this case, because it strongly encourages HR with functional alleles. False positives, arising from CRISPR sites being mutated by NHEJ without incorporation of a new allele, are minimal because they are often not viable. Additionally, disruption of the target gene’s function is brief, eliminating the need for constructing and maintaining a complementing plasmid to sustain yeast through an otherwise lengthy engineering process. Further, given that CRISPR selects against sequence regardless of function, it is still possible and practical to alter non-essential genes (or even non-genic regions) with this technique; indeed, we have reported successful humanization of the non-essential yeast gene HEM14 with this method (Kachroo et al., 2017) and we have used this system to incorporate site-directed changes in proteins with high efficiency.
Materials and Reagents
Pipette tips (Mettler Toledo, catalog numbers: 17005872 , 17005874 , 17007089 )
96-well plate (VWR, catalog number: 82006-636 )
0.2 µm filter (Fisher Scientific, catalog number: 09-719C )
Petri plates (VWR, catalog number: 25384-342 )
Yeast (BY4741)
MoClo Yeast Toolkit (YTK, Addgene kit, Addgene, catalog number: 1000000061 ). Toolkit includes plasmids pYTK050, pYTK003, pYTK072, pYTK083, pYTK036, pYTK008, pYTK047, pYTK073, pYTK074, pYTK081 and pYTK084
PCR template for the sequence which will replace the target gene (e.g., cDNA, plasmid-based clone, etc.)
Note: For demonstration purposes, this protocol will assume replacement of S. cerevisiae HEM2 with its human ortholog ALAD.
NEB 5-alpha Competent E. coli (New England Biolabs, catalog number: C2987 )
DNA stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: S33102 )
T7 ligase (New England Biolabs, catalog number: M0318S )
T4 ligase buffer (New England Biolabs, catalog number: B0202S )
Restriction enzymes BsaI (New England Biolabs, catalog number: R0535S ) and BsmBI (New England Biolabs, catalog number: R0580S )
LB plates with antibiotic selection
a.Ampicillin (Sigma-Aldrich, Roche Diagnostics, catalog number: 10835242001 )
b.Spectinomycin (Sigma-Aldrich, catalog number: PHR1426 )
Chloramphenicol (Sigma-Aldrich, catalog number: C0378 )
High-fidelity DNA polymerase for repair template PCR, such as KAPA HiFi (Kapa Biosystems, catalog number: KK2601 )
Zymo DNA Clean&Concentrator-25 kit (Zymo Research, catalog number: D4005 )
Zymo EZ yeast transformation II kit (Zymo Research, catalog number: T2001 )
Optional: 100 mM lithium acetate can be used in place of EZ 1 solution from the EZ competent yeast cell kit. (Lithium acetate can be obtained from Sigma-Aldrich, catalog number: L6883 )
Accuprime Pfx (Thermo Fisher Scientific, InvitrogenTM, catalog number: 12344024 )
Optional: 5-fluoroorotic acid (Sigma-Aldrich, catalog number: F5013 ), if counter-selection will be used (see Procedure E)
D-Sorbitol (Sigma-Aldrich, catalog number: S3889 )
Zymolyase (MP Biomedicals, catalog number: 320921 )
LB Broth, Lennox (BD, catalog number: 240210 )
YPD powder (BD, catalog number: 242820 )
Agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500500 )
Agar (SERVA Electrophoresis, catalog number: 11396 )
Yeast nitrogen base without amino acids (BD, catalog number: 291940 )
Ammonium sulfate (Sigma-Aldrich, catalog number: A4418 )
Dextrose (Avantor Performance Materials, catalog number: 1919 )
SC-Ura dropout powder (Sigma-Aldrich, catalog number: Y1501 )
Zymolyase solution (see Recipes)
Lithium acetate (see Recipes)
LB medium (see Recipes)
YPD agar plates (see Recipes)
SD-Ura agar plates (see Recipes)
Equipment
Thermocycler (Bio-Rad Laboratories, catalog number: 1861096 )
Light source for visualization of DNA stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: G6600 )
12-channel pipette (Mettler Toledo, catalog number: 17013810 )
Standard gel electrophoresis tank and accessories (Bio-Rad Laboratories, catalog number: 1640302 )
Autoclave
Software
Geneious v8.0 (Kearse et al., 2012) or higher, to design gRNA and repair template (replacement gene). Other gRNA design software can be used as well, such as E-CRISP (Heigwer et al., 2014)
BLAT (Kent, 2002)
Procedure
Preparation of CRISPR plasmid (for a diagrammatic overview of the cloning process, see Figure 1)
Figure 1. Overview of the CRISPR/Cas9-gRNA expression vector construction process. In the first step Xs and Ys represent the gRNA sequence selected, and BsmBI recognition site is indicated in bold.
Design two guide RNA (gRNA) sequences targeting the open reading frame (ORF) for the yeast gene to be replaced using Geneious, or a similar tool such as E-CRISP (Heigwer et al., 2014).
gRNA sequences can often have low activity in practice, despite being predicted to be highly efficient by software tools. In order to minimize setbacks due to a gRNA which turns out to function poorly, we advise designing multiple gRNAs from the outset, and taking them through the cloning steps in parallel, up to and including the construction of the CRISPR plasmids. Both plasmids should then be tested for their ability to target the yeast genome and kill cells (described in later steps) to empirically determine and confirm their activity.
We have not noticed a strong effect of the location of the gRNA within the ORF. During homologous repair, DNA can be resected up to several kilobases from the break site (Mimitou and Symington, 2009; Chen et al., 2011), so the gRNA need not be very close to either terminus of the ORF. It is however important to select a gRNA such that the target site is not present after replacement (i.e., the gRNA should target the yeast ORF, but not the replacement gene).
Example: For targeting HEM2, the sequences GGATTATCGGAGATGAATAG (‘sg1’, on the non-coding strand) and CCTGGTACCAAGGATCCAGT (‘sg2’, on the coding strand) were predicted to have high activity (see Figure 2).
Figure 2. Diagram of the native yeast HEM2 locus, showing positions of the example guide RNAs sg1 and sg2
Order forward and reverse oligonucleotides with the gRNA sequence and Golden Gate compatible overlaps:
Forward oligo consists of the 5’ insert GACTTT followed by the 20 bp guide sequence specific to the target gene. Example forward oligo for HEM2 sg1 (underline indicates 5’ Golden Gate overhang): GACTTTGGATTATCGGAGATGAATAG.
Reverse oligo consists of the 3’ insert AAAC, followed by the reverse complement of the 20 bp guide sequence, followed by AA, which complements part of the GACTTT insert on the forward oligo. Example reverse oligo for HEM2 sg1 (underline indicates 3’ Golden Gate overhang): AAACCTATTCATCTCCGATAATCCAA.
Mix forward and reverse oligos (50 µM each) for each gRNA in a total volume of 20 µl and anneal with each other using a thermocycler with the program below. It is unnecessary to phosphorylate the insert.
95 °C for 5 min
55 °C for 15 min
25 °C for 15 min
First Golden Gate cloning reaction to transfer into shuttle vector: Set up cloning reaction with annealed oligos and pYTK050 (Table 1).
A 2:1 molar ratio of insert:plasmid is recommended for optimal Golden Gate cloning of linear DNA.
Table 1. Golden Gate reaction for cloning into shuttle vector
Transform the reaction into competent bacteria and plate with chloramphenicol selection (170 µg/ml). View colonies under UV light and pick the white colonies (those not showing GFP fluorescence), then grow in liquid culture and purify plasmid. The vectors used in Golden Gate reactions described in this protocol are all GFP-dropout vectors: They contain a GFP gene which will be silenced upon successful cloning. Therefore, GFP fluorescence indicates an invalid construct, while successful constructs will lose the GFP gene and the resulting colonies will be white.
Optionally, the plasmid can be sequenced to check for errors or mutations in the gRNA sequence, such as may occur during synthesis.
Second Golden Gate cloning reaction to create gRNA cassette plasmid: Set up cloning reaction which includes connector plasmids ConL1 and ConRE (Table 2).
For best efficiency, all plasmids should be present at the same molarity in plasmid-based Golden Gate assemblies.
Table 2. Golden Gate reaction for making Cas9 and gRNA transcription unit/cassette plasmids with appropriate connectors
Transform the reaction into competent bacteria and plate with ampicillin selection (60 µg/ml). View colonies under UV light and pick the white colonies (those not showing GFP fluorescence), then grow in liquid culture and purify plasmid.
Third and final Golden Gate cloning reaction to construct the yeast-compatible, complete CRISPR plasmid: Set up Golden Gate cloning reaction with connector plasmid from the previous step, and yeast –Ura backbone plasmid, and Cas9 plasmid (Table 3).
Table 3. Golden Gate reaction for making Cas9 and gRNA yeast expression vector
*Cen6-Ura is constructed by assembling YTK plasmids (008, 047, 073, 074, 081, and 084).
Transform the reaction into competent bacteria and plate with kanamycin selection (50 µg/ml). View colonies under UV light and pick the white colonies (those not showing GFP fluorescence), then grow in liquid culture and purify plasmid.
The resulting construct is a self-contained CRISPR plasmid, which when transformed into yeast will cause double-stranded breaks (DSBs) at the locus determined by the gRNA sequence cloned into it. 500 ng of this will be used for each yeast transformation, so if multiple replacements are planned, it is helpful to dilute the CRISPR plasmid to a standardized concentration for easier transformation set up later on.
Preparation of repair template DNA
Design the template DNA using Geneious or any other cloning software. Obtain the genomic sequence of the target yeast gene (‘old gene’), and the coding sequence (CDS) of the replacing gene (‘new gene’). The CDS should not contain introns. Create a gene model for the replaced locus by editing the sequence of the old gene so that it contains the new gene in the correct position (i.e., the desired outcome of replacement).
We find that replacement works best if the original yeast stop codon is left intact. Otherwise, modifying the new gene, for instance to codon optimize for yeast, has proven unnecessary.
Design template PCR primers which anneal to about 25 bp of the 5’ and 3’ ends of the new gene’s CDS, and also the 5’ and 3’ UTR immediately adjacent to the ORF (the homology arms). Figure 3 shows an example of primer design for replacing the yeast HEM2 gene with its human ortholog ALAD. This process is much easier using the gene model constructed in the previous step: The sequence covering the junction points between yeast genome and the new gene CDS can be used directly as primer sequence.
The length of the region complementary to the new gene CDS is determined only by standard PCR efficiency concerns, such as melting temperature. This area will serve as a toehold for the first few cycles of the PCR.
The length of the homology arms is critical for efficient replacement. We find that homologies of at least 70 bp are necessary (in which case the entire primer oligo will be about 90 bp long), and for some genes, 170 bp homologies may be necessary. For even more difficult replacements, longer homology arms can be cloned separately, but we have found that homologies longer than 500 bp are unlikely to increase efficiency further.
Figure 3. Diagrams of example template primer designs for the replacement of HEM2 with hsALAD
Use template PCR primers to amplify a large amount of repair template DNA using a high-fidelity polymerase.
We find that it is helpful to first conduct several test PCRs with different polymerases. Due to the particular design of the template primers, this PCR can sometimes run inefficiently or generate unwanted non-specific products. Different polymerases have different characteristics, and often a reaction which fails with one polymerase will run efficiently with another, rendering laborious PCR optimization unnecessary.
At least 5 µg of template DNA is needed per yeast transformation, which can usually be obtained from a single 50 µl PCR. Difficult replacements can often be facilitated by using more (10 µg) template DNA, and if multiple transformations are to be performed the amount will also need to be scaled up accordingly. Often several PCRs are necessary to produce enough DNA.
If very large amounts of template DNA are needed, or an efficient PCR is difficult to set up, an alternative method is to clone the template sequence onto a plasmid, which can be amplified in bacteria with the template DNA excised using restriction enzymes.
Check the template PCR with agarose gel electrophoresis.
As long as a sufficient amount of the correct template is produced, non-specific products do not necessarily constitute a problem for the replacement. Because the non-specific products usually lack appropriate homologies, they will not be efficiently integrated into the yeast genome. However, if significant amounts of them are present, they will cause over-estimation of template DNA during spectrophotometry-based quantification; thus the amount of template DNA used in the transformation would need to be adjusted accordingly. Alternatively, the PCR can be optimized to reduce non-specific products, or only the correct product can be quantified from the gel using a DNA ladder calibrated for quantity estimation.
Purify template PCR using the Zymo DNA Clean&Concentrator-25 kit. Elute in double distilled water.
Ideally, the volume of DNA included in yeast transformation should be small, so as to not interfere with the transformation reagents. The elution volume should be adjusted accordingly so that the resulting concentration of DNA is not too low. In our experiments, we have found that eluting with 25 µl double distilled water will usually yield 400-800 ng/µl DNA, which is suitable for transformations.
Yeast transformation
Prepare competent yeast cells using the Zymo EZ competent yeast kit according to the kit instructions.
The EZ 1 solution in this kit can be substituted with 100 mM lithium acetate without significant change in transformation efficiency.
The amounts given in the kit manual can be slightly modified: 2 ml yeast culture can be used to produce 100 µl of competent yeast, which is sufficient for two transformations, 50 µl each.
Set up a transformation reaction: Mix 50 µl competent yeast, 500 µl EZ 3 solution, 500 ng of CRISPR plasmid and 5 µg repair template DNA (up to 50 µl total volume). Incubate at 30 °C as directed by kit manual and plate on –Ura medium.
When using a new gRNA for the first time, gRNA efficiency can be estimated with a control transformation, which is performed as stated but without repair DNA. When the CRISPR plasmid is introduced without a repair template, it will repeatedly cleave the target locus, causing toxicity. Very few or no colonies are the ideal outcome, since this indicates highly efficient CRISPR cleavage and low background rate. Cells can survive the CRISPR plasmid uptake without repair DNA if the CRISPR activity is stochastically low (such as due to poor gRNA efficiency) or mutations at the CRISPR target locus can be tolerated (which produces false transformants even in presence of the repair template).
When colonies appear on the –Ura plates, collect up to 12 of them with a pipette tip and suspend in 50 µl water. These suspensions will be screened for confirmed replacements. Yeast suspensions can be stored at 4 °C and used to start new cultures for up to 2 weeks.
Typically, colonies will appear on –Ura plates (Figure 4) after 1-3 days. In some cases, the replacement will impose a significant fitness defect such that up to 6 days may be required for colonies to appear, but we have not encountered cases where colonies from a successful transformation take longer than 6 days to grow.
Figure 4. Representative assay results. Yeast cells are rescued from DSB lethality (center plate) when an appropriate repair template is provided (right plate). The left plate is a negative control of cells carrying a control plasmid with the same selectable marker (URA3) done to estimate the transformation efficiency of the yeast strains being used.
The uracil dropout medium will select against cells which failed to take up the CRISPR plasmid (which confers uracil prototrophy), but because the CRISPR plasmid is toxic to cells unless a successful replacement occurs (eliminating the CRISPR target locus) only cells which have a replaced locus are expected to survive. However, due to spontaneous hypoactivity of the CRISPR system, mutations in the CRISPR target locus (DiCarlo et al., 2013), and cells which manage to survive CRISPR-associated DSBs, there will be a background rate in the form of false transformant colonies which do not carry the correct genomic replacements. To save time, we recommend collecting several transformant colonies and screening them in parallel.
To streamline this process (especially when several replacements are performed in parallel), pick colonies with pipette tips and manually attach them to a multichannel pipette (Figure 5). The multichannel pipette can then be used to suspend all 12 samples in one row of small PCR tubes or a 96-well plate.
Figure 5. Demonstration of colony picking technique with 12-channel pipette
Colony screening via PCR
Design confirmation PCR primers: Primer pairs should be selected such that the forward primer anneals to the yeast UTR while the reverse primer anneals only to the new gene CDS but not the old gene’s ORF. Thus, the product should span the junction point between foreign sequence and native yeast genome. The yeast UTR primer should preferably not overlap the homology region.
Ideally, the product size should be small, about 300 bp, for a faster and more robust PCR.
It is sufficient to check only the 5’ junction point, since it is rare for integration to proceed as expected at one end of the gene but introduce artifacts at the other.
If desired, the absence of the yeast ORF can also be tested by using a reverse primer which anneals to yeast ORF only. However, lack of product from such a primer pair is not sufficient to confirm a clone, since the reaction is liable to fail for unrelated reasons (such as poor lysis of cells).
Prepare lysates of harvested transformants: Mix 5 µl of each yeast suspension with 15 µl zymolyase solution.
Incubate lysates for 30 min at room temperature, then 15 min at 37 °C and 5 min at 95 °C.
Set up 20 µl colony PCRs with confirmation primers and using Accuprime Pfx as the polymerase. Use 1 µl of the lysate as template DNA.
We find that other polymerases do not perform well due to impurities from the yeast lysates.
Due to the impurities introduced by the lysate, the colony PCR may spontaneously fail, leading to false negatives. To ameliorate this problem, a positive control PCR can be performed for each lysate, which is identical to the confirmation PCR but uses primers complementary to an unrelated, unmodified locus in the genome. We use two primers targeting a 500 bp segment of the yeast ERG13 promoter for this purpose (forward CGAACTGGATGAGATGGCCG and reverse CATGCTGCACCTTTTATAGTAATTTGGC).
Check the colony PCRs for product by agarose electrophoresis. Lysates from clones with the correct modifications should generate a product with the confirmation primers. Background false transformants (e.g., mutants) will not produce a band.
A PCR product from the confirmation primers is sufficient evidence of successful integration of the repair template. For further verification, the locus can be sequenced, but we have found that dramatic sequence artifacts rarely occur in clones confirmed by PCR, the most common mutations are single-basepair substitutions or indels, which typically constitute a minority of confirmed clones.
Lack of product from the confirmation primers is inconclusive per se. In such cases, it is worthwhile to consider additional evidence, such as whether the positive control PCR worked (if not, the lysis may have failed).
Confirmed clones can be propagated by starting a new culture from the original suspensions of yeast in water.
Curing of the CRISPR plasmid
Streak original water suspensions of confirmed clones on YPD.
The CRISPR plasmid is low copy and can be spontaneously lost in absence of selection.
Pick 10 colonies from the YPD plate and patch each one on YPD and SD-Ura plates.
Incubate both plates, and collect cells from patches which grew only on YPD but not on SD-Ura.
Isolates which still carry the CRISPR plasmid will grow on uracil dropout medium, but those which have lost the plasmid will not. Typically, 3 days is sufficient to confirm lack of Ura prototrophy, but if slow growth on uracil dropout is suspected, incubation can be extended to up to 6 days to definitively confirm no growth on uracil dropout.
The plasmid can also be cured by counterselecting on 5-fluoroorotic acid (FOA) plates (Boeke et al., 1987). However, there is a possibility that this FOA method will generate some colonies that are not cured of the plasmid but rather have acquired a mutation in the Ura marker (thus continuing to express the gRNA). Thus, FOA counterselection should not be used (as opposed to replicate patches on YPD and –Ura) if it is important to ensure curing of the plasmid, rather than simply abrogating Ura prototrophy. On the other hand, the FOA method can save time if only loss of –Ura heterotrophy is desired, for instance to enable a subsequent transformation with a different Ura-selectable plasmid.
Data analysis
The data analysis needs for this procedure are minimal. Most importantly, when using Geneious to design gRNA sequences, it is desirable to select gRNA sequences that have high predicted on-target activity (automatically calculated by Geneious). gRNA sequences with high predicted activity may have low actual activity, but they will be less likely to exhibit low activity than sequences with low predicted activity. The distance of the gRNA target site can be up to 1 kb away from either homology region without perceptible negative consequence, thus gRNAs should be selected primarily based on high activity rather than location (provided that they lie between the two homology arms).
Notes
We have found that even among gRNAs with high predicted activity, some will fail to induce double-strand breaks with sufficient efficiency for editing. It is highly recommended that for each target locus, several gRNA are designed and tested in parallel, to ensure that at least one will be a sufficiently good DSB inducer for purposes of genome editing.
If a given gRNA exhibits significant off-target activity, the likely outcome is that off-target cleavage will kill most of the transformed yeast cells. Successful, efficient genome editing in yeast relies on lethality associated with DSBs at the target locus being rescued by HR (allowing efficient repair of the DSB) and abrogation of the gRNA target site (preventing further cleavage). In the event off-target activity, HR may likely not take place because no repair template with homology to the off-target site has been supplied, moreover the gRNA site will not be eliminated for the same reason. Further, the confirmation strategy we suggest is such that only repair at the correct locus will produce a positive result. However, it is nevertheless worthwhile to ensure that selected gRNA target sites do not occur at other locations in the genome, where cleavage is not intended. Although it is very unlikely for the combined 23 bp target sequence to appear multiple times in the yeast genome, we recommend confirming that candidate gRNA sites appear only in the target locus using a tool such as BLAT.
gRNA targets consist of a 20 bp sequence (which will also be included in sgRNA sequence and become part of the Cas9 complex) followed by a 3 bp PAM sequence (which takes the form of NGG for Cas9 described in this protocol). The PAM sequence does not become part of the gRNA, but it must be present in the target genome for Cas9 cleavage to occur. This can be verified by attempting to align the gRNA sequence to the sequence of the repair template–typically, CRISPR activity will be very low with more than 5 mismatching basepairs, although mismatches in the PAM and proximal to the PAM appear to have more significance (Kuscu et al., 2014). When replacing with very similar sequences, such that it is difficult to find good gRNA sites unique to the target locus, one strategy that can be adopted is to introduce synonymous mutations in the repair template sequence which alter the PAM site or PAM-proximal nucleotides. Alternatively, recent research suggests that using shorter gRNA may increase specificity, since the 8-17 PAM-proximal nucleotides contribute disproportionately to CRISPR target recognition (Xu et al., 2017).
There is some variability in the yeast transformation step, and depending on how the competent cells were prepared, and how the transformation was performed. Most commonly, the number of resulting colonies will vary somewhat between transformations of identical strains with identical reagents, but usually this variation will be less than tenfold. When a transformation produces a fair number of colonies (at least 10) yet none of them are found to be correct clones upon screening, simply repeating the transformation is unlikely to improve results. The most straightforward avenues of increasing the number of correct clones are to increase the amount of repair template DNA, and to produce repair template DNA with longer homologies.
If no colonies appear after transformation, the reason may be low transformation efficiency. In this case, several troubleshooting steps can be taken (described in detail in the documentation of the Zymo EZ competent yeast kit). We have found the following to be effective:
Thoroughly vortexing the mixture of competent cells and DNA.
Longer incubation time for the transformation (1.5 h instead of the 45 min).
Including more cells in the transformation.
Competent cells seem to perform slightly better when frozen once (slowly in -80 °C) than freshly prepared cells.
When the CRISPR reagents and repair template are transformed into yeast cells, the resulting transforming colonies will be of three kinds with respect to the targeted locus:
Correct transformants which bear the sequence of the repair template.
False transformants which bear the original, unedited sequence.
Mutants.
In our experiments, we have found that the first two classes predominate unless mutants are specifically selected for. Even in the absence of a repair template, the majority of false transformants will not be mutants. Due to the efficient HR system of S. cerevisiae, if the conditions of the experiment are adequate then editing will take place at a very high rate. Thus, typically, the proportion between the first two of the three classes listed above will be such that the transformants are either mostly correct or all false. The third class, or mutants, we have found to be very rare in either case unless specifically selected for. As a consequence, it is rarely necessary to screen a very large number of colonies to determine whether an editing experiment has succeeded. However, it is desirable to collect several confirmed clones to minimize issues caused by artifacts, such as mutant edited sequence caused by errors during PCR (with the reagents and protocols described in this text, we have found clones with mutant edited sequence also be very rare).
Selecting yeast transformants with a single amino-acid dropout medium is normally a straightforward process, and colonies can be seen within 1-2 days of plating. However, occasionally the genome editing process itself, or the resulting edited sequence, can result in a growth defect in the resulting cells. Thus, if no colonies appear, incubating the plate for a longer period can produce colonies. In the most extreme case we observed, it took 6 days for colonies to appear on a uracil dropout medium, but several clones were later confirmed by PCR and sequencing; these clones consistently exhibited slow growth in subsequent culture on rich medium (YPD) as well.
Some combinations of target locus and repair template may lead to a mixture of large and small yeast colonies after transformation. If this occurs, generally it is best to screen an adequate number of colonies for each size class. It may be that the correct edits create much slower growing strains, thus the large colonies are false while the small ones have the desired edit. Conversely, if the desired sequence does not interfere with normal growth, but mutations arising from NHEJ do, then larger colonies will tend to be the correct clones. We have observed examples of either case when humanizing and bacterializing various loci. It is difficult to predict a priori which case will be evident for a given transformation, therefore it is often more practical to screen colonies and recording their size, and also ensuring that each size is adequately represented in the screen.
When picking colonies for the colony PCR screen, only a small quantity of cells is needed. Most likely as little as 1,000 cells will be sufficient to obtain a PCR product. We have often chosen to collect slightly larger numbers of cells to visually confirm their suspension in water by turbidity. However, too many cells lead to incomplete lysis and inhibition of the colony PCR. With cell clumps larger than 1-2 mm the colony PCR will often fail. So ideally, the cells collected from the colony should form only a tiny speck, 0.5 mm or smaller in diameter. It is helpful to include the positive control PCR when screening, to identify samples which failed to produce a PCR product due to poor lysis. Lysis and PCR can be repeated for these samples if needed.
It is possible to adapt the protocol described here for the simultaneous replacement of multiple genes. The Mo Clo toolkit allows for cloning up to 4 different gRNA cassettes on the same CRISPR plasmid; for this, the gRNAs would be captured on pYTK050 as described here, but in the second Golden Gate reaction, instead of the ConL1 and ConRE plasmids, the first gRNA would be cloned with ConL1 and ConR2, the second with ConL2 and ConR3, the third with ConL3 and ConR4 and the fourth with ConL4 and ConRE (this process is explained in detail in Lee et al., 2015). All of these cassette plasmids would then be included in the final Golden Gate reaction to assemble the CRISPR plasmid. Then, during transformation of yeast, templates for each of the included gRNAs will need to be co-transformed. However, multiple replacements are even more dependent on efficient transformation, cleavage and repair than single replacements, and some additional work may be necessary to optimize these parameters in practice.
Recipes
Zymolyase solution (50 ml)
Weigh 9.11 g D-sorbitol
Dissolve in 50 ml distilled, deionized water to make 1 M sorbitol and autoclave
Weigh 0.25 g zymolyase and dissolve in sorbitol solution
Aliquot and store at -20 °C
Lithium acetate, 100 mM (40 ml)
Weigh 0.408 g lithium acetate dehydrate
Dissolve in 40 ml distilled, deionized water
Filter sterilize (0.2 µm filter) and store at room temperature
LB medium (1 L)
Weigh 25 g LB powder
For solid medium, add 15 g agar
Dissolve in distilled, deionized water for 1 L total volume
Autoclave and let it cool to 60-70 °C
Pour in Petri plates so that the medium covers the visible area of the plate
Let plates cool and solidify at room temperature, store at 4 °C
YPD (1 L)
Weigh 50 g YPD powder
For solid medium, add 20 g agar
Dissolve in distilled, deionized water for 1 L total volume
Autoclave and let it cool to 60-70 °C
Pour in Petri plates so that the medium covers the visible area of the plate
Let plates cool and solidify at room temperature, store at 4 °C
SD-Ura (1 L)
Weigh 1.5 g yeast nitrogen base w/o amino acids, 5 g ammonium sulfate, 20 g dextrose, 2 g SC-Ura dropout powder
For solid medium, add 20 g agar
Dissolve in distilled, deionized water for 1 L total volume
Autoclave and let it cool to 60-70 °C
Pour in Petri plates so that the medium covers the visible area of the plate
Let plates cool and solidify at room temperature, store at 4 °C
Acknowledgments
This work was supported by grants from the NIH (R21 GM119021, R01 HD085901, DP1 GM106408, R01 DK110520, R35 GM122480), Army Research Office (ARO) grant W911NF-12–1–0390, and the Welch Foundation (F-1515) to E.M.M. We would like to thank John Dueber & colleagues for producing the excellent plasmid toolkit which greatly facilitated our work. The authors declare no conflicts of interest.
References
Boeke, J. D., Trueheart J., Natsoulis G. and Fink G. R. (1987). 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol 154: 164-75.
Chen, X., Niu, H., Chung, W. H., Zhu, Z., Papusha, A., Shim, E. Y., Lee, S. E., Sung, P. and Ira, G. (2011). Cell cycle regulation of DNA double-strand break end resection by Cdk1-dependent Dna2 phosphorylation. Nat Struct Mol Biol 18(9): 1015-1019.
DiCarlo, J. E., Norville, J. E., Mali, P., Rios, X., Aach, J. and Church, G. M. (2013). Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res 41(7): 4336-4343.
Heigwer F., Kerr G. and Boutros M. (2014). E-CRISP: fast CRISPR target site identification. Nat Methods 11: 122-123.
Kachroo, A. H., Laurent, J. M., Akhmetov, A., Szilagyi-Jones, M., McWhite, C. D., Zhao, A. and Marcotte, E. M. (2017). Systematic bacterialization of yeast genes identifies a near-universally swappable pathway. Elife 6: e25093.
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P. and Drummond, A. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12): 1647-1649.
Kent, W. J. (2002). BLAT – The BLAST-Like Alignment Tool. Genome Res 12(4): 656-64.
Kuscu, C., Arslan, S., Singh, R., Thorpe, J. and Adli, M. (2014). Genome-wide analysis reveals characteristics of off-target sites bound by the Cas9 endonuclease. Nat Biotechnol 32(7): 677-83.
Lee, M. E., DeLoache, W. C., Cervantes, B. and Dueber, J. E. (2015). A highly characterized yeast toolkit for modular, multipart assembly. ACS Synth Biol 4(9): 975-986.
Mimitou, E. P. and Symington, L. S. (2009). DNA end resection: many nucleases make light work. DNA Repair (Amst) 8(9): 983-995.
Xu, X., Duan, D. and Chen, S. (2017). CRISPR-Cas9 cleavage efficiency correlates strongly with target-sgRNA folding stability: from physical mechanism to off-target assessment. Scientific Reports 7(143).
Copyright: Akhmetov et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Akhmetov, A., Laurent, J. M., Gollihar, J., Gardner, E. C., Garge, R. K., Ellington, A. D., Kachroo, A. H. and Marcotte, E. M. (2018). Single-step Precision Genome Editing in Yeast Using CRISPR-Cas9. Bio-protocol 8(6): e2765. DOI: 10.21769/BioProtoc.2765.
Kachroo, A. H., Laurent, J. M., Akhmetov, A., Szilagyi-Jones, M., McWhite, C. D., Zhao, A. and Marcotte, E. M. (2017). Systematic bacterialization of yeast genes identifies a near-universally swappable pathway. Elife 6.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > DNA > Chromosome engineering
Systems Biology > Genomics > Functional genomics
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,766 | https://bio-protocol.org/exchange/protocoldetail?id=2766&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In situ Hybridization (ISH) in Preparasitic and Parasitic Stages of the Plant-parasitic Nematode Meloidogyne spp.
MJ Maëlle Jaouannet
CN Chinh-Nghia Nguyen
MQ Michaël Quentin
SJ Stéphanie Jaubert-Possamai
MR Marie-Noëlle Rosso
Bruno Favery
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2766 Views: 8511
Reviewed by: Eugenio Llorens
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
The spatio-temporal expression pattern of a gene provides important indications to better understand its biological function. In situ hybridization (ISH) uses a labeled complementary single-stranded RNA or DNA probe to localize gene transcripts in a whole organism, a whole organ or a section of tissue. We adapted the ISH technique to the plant parasite Meloidogyne spp. (root-knot nematode) to visualize RNAs both in free-living preparasitic juveniles and in parasitic stages settled in the plant tissues. We describe each step of the probe synthesis, digoxigenin (DIG) labeling, nematode extraction from plant tissue, and ISH procedure.
Keywords: Gene expression pattern Plant pathogen Preparasitic and parasitic stages mRNAs
Background
So far, the stable transformation of plant-parasitic nematode(s) has not been successful. ISH enables the analysis of spatio-temporal gene expression in vivo in whole-mount Meloidogyne spp. nematodes. These root-knot nematodes hatch in the soil as microscopic vermiform juveniles (J2) and infect host plant roots. J2s penetrate the root and migrate to the root vascular cylinder cells. The juveniles settle in the root and develop into J3 and J4 parasitic juveniles that induce the differentiation specialized feeding cells. The nematode eventually develops into a pear-shaped female that will release hundreds of eggs on the root surface. Here, we report a detailed protocol to detect single RNA molecules in preparasitic whole mount J2s and parasitic stages. ISH on parasitic stages requires an additional procedure the day before extraction of the nematodes from infected roots. We describe the detection of transcripts using digoxigenin (DIG)-labeled cDNA probes in nematode whole mount tissues.
Materials and Reagents
Nitrile gloves
RNase-free microcentrifuge tubes (1.5 ml) (e.g., Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: AM12450 )
Sieve of 2.5 mm/250 µm/40 µm/10 µm
50 ml tubes (Corning, Falcon®, catalog number: 352070 )
Paper towel
Microscope slides and cover slip (e.g., Fisher Scientific, catalog number: 12-544-1 )
Autoclaved razor blades
RNase-free filtered tips, e.g.,
20 µl tips (Mettler-Toledo, Rainin, catalog number: 17007957 )
200 µl tips (Mettler-Toledo, Rainin, catalog number: 17002927 )
1,000 µl tips (Mettler-Toledo, Rainin, catalog number: 17014361 )
Root-knot nematodes (e.g., M. incognita Morelos strain, M. enterolobii Godet strain) preparasitic J2s (10,000) or parasitic stages (50)
DIG-labelled ISH probe(s)
Note: See Procedure A for probe synthesis and storage.
Forward and reverse primers designed to allow an amplicon size around 200 bp (e.g., SePOP Desalted oligos from Eurogentec)
PCR-grade dNTPs (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10297117 )
Pfu DNA Polymerase (Promega, catalog number: M7741 )
QIAquick PCR Purification Kit (QIAGEN, catalog number: 28104 )
QIAquick Gel extraction kit (QIAGEN, catalog number: 28704 )
Digoxigenin (DIG) DNA Labeling Kit (Roche Diagnostics, catalog number: 11175025910 )
TE buffer pH 8 (10 mM Tris-HCl, 1 mM EDTA) (e.g., Sigma-Aldrich, catalog number: 93283 )
RNaseZap® RNase Decontamination Solution (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9780 )
70% ethanol
Tap water
Acetone (e.g., VWR, catalog number: 20065.293 )
Methanol (e.g., VWR, catalog number: 20847.307 )
Anti-Digoxigenin-AP-Fab fragments Labelling Mix (Roche Diagnostics, catalog number: 11093274910 )
BCIP 5-bromo-4-chloro-3-indolyl-phosphate, 4-toluidine salt (Roche Diagnostics, catalog number: 11383221001 )
NBT 4-Nitro blue tetrazolium chloride (Roche Diagnostics, catalog number: 11383213001 )
Pectinex® (Sigma-Aldrich, catalog number: P2611 )
Celluclast® (Sigma-Aldrich, catalog number: C2730 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S7907 )
Potassium phosphate, monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P9791 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Magnesium sulfate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: 63138 )
Sucrose (e.g., Sigma-Aldrich, catalog number: S9378 )
10x PBS (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9624 )
37% formaldehyde solution (Sigma-Aldrich, catalog number: F15587 )
Note: This product has been discontinued.
Proteinase K 20 mg/ml (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2546 )
Formamide, deionized (Sigma-Aldrich, catalog number: F9037 )
SSC buffer 20x (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9770 )
Boehringer blocking reagent (Roche Diagnostics, catalog number: 11096176001 )
SDS (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15553027 )
Denhart’s solution (Sigma-Aldrich, catalog number: D2532 )
EDTA pH 8 (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9261 )
Salmon sperm DNA (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15632011 )
tRNA from baker’s yeast (Sigma-Aldrich, catalog number: R8759 , type X-SA)
Maleic acid (Fisher Scientific, catalog number: 10348843)
Manufacturer: Acros Organics, catalog number: 125230051 .
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Sodium hydroxide (NaOH) (VWR, catalog number: 28245.298 )
Tris-base (e.g., Sigma-Aldrich, catalog number: T1503 )
Concentrated HCl (VWR, catalog number: 20248.295 , type 35%)
Deionized water
Nuclease-free water (not DEPC-Treated; Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9938 )
For nematode extraction (see Recipes)
Pectinex® and Celluclast® mix
M9-buffer pH 7
50% sucrose in M9 buffer
RNase-free 1x PBS
For probe, fixation and hybridization, nuclease-free (see Recipes)
Fixative buffer
1 mg/ml Proteinase K solution
tRNA from Baker’s yeast
Hybridization buffer (HB)
Washing buffer 1 (4x SSC + 0.1% SDS)
Washing buffer 2 (0.1x SSC + 0.1% SDS)
10% Boehringer blocking reagent
Filtered maleic acid buffer, pH 7.5
Tris-HCl pH 9.5
Alkaline phosphatase detection buffer pH 9.5 (APB)
Equipment
Pipetmens (e.g., Gilson, models: P2 , P20 , P200 , P1000 )
Thermocycler (e.g., Biometra, model: T3000 )
NanoDrop (e.g., Agilent Technologies, model: Agilent 2100 Bioanalyser , catalog number: G2939)
Microcentrifuge at room temperature (RT) (e.g., Hitachi Koki, model: CT15E ) with fixed-angle rotor (e.g., Hitachi Koki, model: T15A61 )
Centrifuge for 50 ml tube (e.g., Eppendorf, model: 5804 R ) with swing-bucket rotor (e.g., Eppendorf, model: A-4-44 )
50 ml glass beaker (Corning, PYREX®)
Fume hood
Aquarium air pump (Rena Aquatic Supply, model: Model 301 )
Glass plate
Mini hybridization oven (Appligene, catalog number: 001050414 )
Vortexer (e.g., Baxter, catalog number: S8223-1 )
Orbital shaker (VWR)
37 °C water bath
Fridge at 4 °C
-20 °C freezer
-80 °C freezer
Autoclave
Microscope (ZEISS, model: Axioplan 2 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jaouannet, M., Nguyen, C., Quentin, M., Jaubert-Possamai, S., Rosso, M. and Favery, B. (2018). In situ Hybridization (ISH) in Preparasitic and Parasitic Stages of the Plant-parasitic Nematode Meloidogyne spp.. Bio-protocol 8(6): e2766. DOI: 10.21769/BioProtoc.2766.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Nematode
Plant Science > Plant immunity > Host-microbe interactions
Cell Biology > Cell staining > Nucleic acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,767 | https://bio-protocol.org/exchange/protocoldetail?id=2767&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA Cap Methyltransferase Activity Assay
Jackson B. Trotman
Daniel R. Schoenberg
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2767 Views: 6829
Edited by: Gal Haimovich
Reviewed by: Amanda GarnerC. Kiong Ho
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
Methyltransferases that methylate the guanine-N7 position of the mRNA 5’ cap structure are ubiquitous among eukaryotes and commonly encoded by viruses. Here we provide a detailed protocol for the biochemical analysis of RNA cap methyltransferase activity of biological samples. This assay involves incubation of cap-methyltransferase-containing samples with a [32P]G-capped RNA substrate and S-adenosylmethionine (SAM) to produce RNAs with N7-methylated caps. The extent of cap methylation is then determined by P1 nuclease digestion, thin-layer chromatography (TLC), and phosphorimaging. The protocol described here includes additional steps for generating the [32P]G-capped RNA substrate and for preparing nuclear and cytoplasmic extracts from mammalian cells. This assay is also applicable to analyzing the cap methyltransferase activity of other biological samples, including recombinant protein preparations and fractions from analytical separations and immunoprecipitation/pulldown experiments.
Keywords: RNA 5’ Cap Cap methyltransferase RNMT Enzyme activity assay Subcellular fractionation P1 nuclease Thin-layer chromatography
Background
The N7-methylguanosine cap at the 5’ end of an mRNA is a modification essential for proper eukaryotic mRNA processing, localization, and translation. The N7 methyl group is particularly critical for the mRNA life cycle, as it drastically increases the binding affinity of cap-binding proteins (Niedzwiecka et al., 2002) and protects mRNAs from cap-quality control surveillance mechanisms (Jiao et al., 2013). We recently reported that the mammalian RNA guanine-7 methyltransferase (RNMT) functions beyond its canonical role in nuclear co-transcriptional cap synthesis to participate in cytoplasmic RNA recapping (Trotman et al., 2017). We used the protocol presented here to demonstrate that the cap methyltransferase activity of cytoplasmic RNMT is unexpectedly robust relative to nuclear RNMT. Additionally, siRNA-mediated knockdown of RNMT greatly reduced the cap methyltransferase activity of cytoplasmic extracts, suggesting that RNMT is the predominant, if not only cap methyltransferase in the cytoplasm of mammalian cells. Nuclear RNMT exists as a heterodimer with RNMT-activating miniprotein (RAM, Gonatopoulos-Pournatzis et al., 2011), and we demonstrated that cytoplasmic RNMT also binds to RAM. Reduced cytoplasmic cap methyltransferase activity upon RAM knockdown indicated that RAM is a required cofactor for cytoplasmic RNMT.
This protocol is adapted from two earlier publications characterizing human RNMT (Cowling, 2010; Pillutla et al., 1998), with modifications that standardize generation of the substrate RNA, avoid cumbersome phenol-chloroform extractions with radioactive samples, and enable quantification of cap methyltransferase activity. We note that an alternative, nonradioactive assay has been reported for the analysis of cap methyltransferase reactions (Peyrane et al., 2007), but this method requires HPLC instrumentation that may not be available to all labs and may differ from the one presently reported in terms of sensitivity and sample compatibility. Additionally, a fluorescent assay for measuring cap methyltransferase activity was recently described (Aouadi et al., 2017), but this assay indirectly measures activity by monitoring the accumulation of S-adenosylhomocysteine (SAH) and may be incompatible with biological samples containing SAH. We hope that the level of detail in the protocol presented here enables future investigators to easily repeat and build upon our work.
Materials and Reagents
0.2 ml PCR tubes (e.g., BioExpress, GeneMate, catalog number: T-3225-1 )
NucAway Spin Columns (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM10070 )
1.7 ml plastic, sterile, RNase-free microcentrifuge tubes (e.g., BioExpress, GeneMate, catalog number: C-3262-1 )
10 cm or 15 cm culture dishes (e.g., Alkali Scientific, catalog numbers: TD0100 , TD0150 )
Sterile nitrile gloves
Cell lifters (e.g., BioExpress, GeneMate, catalog number: T-2443-4 )
Sterile, RNase-free tips for P10, P20, P100, and P1000 pipets
Plastic, disposable cuvettes for Bradford assay (e.g., Fisher Scientific, catalog number: 14-955-127 )
Plastic wrap (e.g., Saran or Stretch-Tite brand)
Paper labeling tape (e.g., Fisher Scientific, catalog number: 15-901-20H)
Manufacturer: Nevs, catalog number: 1590120H .
Polyethylenimine (PEI) cellulose TLC plates (Macherey-Nagel, catalog number: 801053 ; see Note 2)
Immobilon-FL polyvinylidene difluoride (PVDF) membrane (Merck, catalog number: IPFL00010 )
Scintillation vials compatible with liquid scintillation counter (e.g., DWK Life Sciences, WHEATON, catalog number: 225414 )
U2OS cells (ATCC, catalog number: HTB-96 ) or HEK293 cells (ATCC, catalog number: CRL-1573 )
P1 nuclease (United States Biological, catalog number: N7000 ), resuspended in RNase-free water to 0.625 U/μl
Cap analog GpppG (New England Biolabs, catalog number: S1407 ), resuspended in RNase-free water to 10 mM
Cap analog m7GpppG (New England Biolabs, catalog number: S1404 ), resuspended in RNase-free water to 10 mM
RNase-free water (e.g., from a Millipore Synergy water purification system, 18.2 MΩ cm)
Single-stranded DNA sense oligo
Single-stranded DNA antisense oligo
5’ CATGCAAATTAACCCTCACTAAAGGGAGACCGGAATTCGAGCTCGCCCGGGGATC 3’ for T3 transcription template, resuspended in RNase-free water to 100 μM (e.g., synthesized by Integrated DNA Technologies (IDT); underlined is a T3 promoter sequence, bold sequence matches the transcribed 32-nucleotide (nt) pppRNA)
5’ GATCCCCGGGCGAGCTCGAATTCCGGTCTCCCTTTAGTGAGGGTTAATTTGCATG 3’ for T3 transcription template, resuspended in RNase-free water to 100 μM (e.g., synthesized by IDT)
MEGAscript T3 Transcription Kit (Thermo Fisher Scientific, Ambion, catalog number: AM1138 )
Pre-cast polyacrylamide mini-gels for urea polyacrylamide gel electrophoresis (urea-PAGE; e.g., Bio-Rad Laboratories, catalog number: 4566053 )
Pre-cast polyacrylamide mini-gels for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; e.g., Bio-Rad Laboratories, catalog number: 4568094 )
2x Laemmli Sample Buffer (Bio-Rad Laboratories, catalog number: 1610737 )
SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: S11494 )
RNA size marker (e.g., Thermo Fisher Scientific, InvitrogenTM, catalog number: AM7778 )
2x RNA loading dye (e.g., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0641 )
40 U/μl RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10777019 )
Recombinant triphosphatase-guanylyltransferase capping enzyme (see Note 1)
[α-32P]GTP (3,000 Ci/mmol, PerkinElmer, catalog number: BLU506H250UC )
RNA Clean & Concentrator-5 kit (Zymo Research, catalog number: R1016 )
ScintiSafe Econo 1 scintillation fluid (Fisher Scientific, catalog number: SX20-5 )
Note: This product has been discontinued.
McCoy’s 5A medium (for U2OS cells; Thermo Fisher Scientific, GibcoTM, catalog number: 16600082 )
Dulbecco’s modified Eagle medium (DMEM; for HEK293 cells; Thermo Fisher Scientific, GibcoTM, catalog number: 21013024 )
Fetal bovine serum (FBS; Atlanta Biologicals, catalog number: S10350 )
Phosphate-buffered saline (PBS; e.g., Thermo Fisher Scientific, GibcoTM, catalog number: 10010049 )
Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, catalog number: 5000006 )
Pre-stained protein marker (e.g., Bio-Rad Laboratories, catalog number: 1610393 )
Bovine serum albumin (BSA; e.g., Fisher Scientific, catalog number: BP1600-100 ) dissolved in water to 1 μg/μl
Antibody toward nuclear protein for Western blotting (e.g., rabbit polyclonal anti-nucleolin antibody, 1:5,000 working dilution, Sigma-Aldrich, catalog number: N2662 )
Antibody toward cytoplasmic protein for Western blotting (e.g., mouse monoclonal anti-α-tubulin, 1:10,000 working dilution, Sigma-Aldrich, catalog number: T6199 )
Appropriate secondary antibodies (e.g., for infrared imaging, Thermo Fisher Scientific, Invitrogen, catalog numbers: A-21109 and A-21058 , at 1:10,000 working dilutions)
(Optional) Vaccinia Capping Enzyme (New England Biolabs, catalog number: M2080S )
Dithiothreitol (DTT, Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0861 )
RNase-free 10x Tris/borate/EDTA (TBE) buffer (e.g., Thermo Fisher Scientific, InvitrogenTM, catalog number: 15581 )
Phenylmethylsulfonyl fluoride (PMSF; Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 36978 )
Isopropanol
Tris (e.g., VWR, AMRESCO, catalog number: 0497 )
Glycine (e.g., VWR, AMRESCO, catalog number: 0167 )
SDS
Methanol (e.g., Fisher Scientific, catalog number: A452SK-4 )
Sodium chloride (NaCl; e.g., Fisher Scientific, catalog number: BP358 )
5 M NaCl (e.g., Thermo Fisher Scientific, catalog number: AM9759 )
Concentrated HCl
Tween 20 (e.g., Fisher Scientific, catalog number: BP337 )
32 mM S-adenosylmethionine (SAM; New England Biolabs, catalog number: B9003 )
3 M sodium acetate, pH 5.2 (e.g., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R1181 )
Ammonium sulfate (e.g., Sigma-Aldrich, catalog number: A4418 )
IGEPAL CA-630 (Sigma-Aldrich, catalog number: I8896 )
1 M Tris-HCl, pH 7.5 (e.g., AMRESCO, catalog number: E691 )
1 M magnesium chloride (MgCl2, e.g., Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9530G )
500 mM ethylenediaminetetraacetic acid, pH 8.0 (EDTA; e.g., Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575020 )
Glycerol (e.g., Fisher Scientific, catalog number: BP229-1 )
1 M HEPES pH 7.3 (e.g., AMRESCO, catalog number: J848 )
2 M potassium chloride (KCl; e.g., Alfa Aesar, catalog number: J75896 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 )
Phosphatase inhibitor cocktail 2 (Sigma-Aldrich, catalog number: P5726 )
Phosphatase inhibitor cocktail 3 (Sigma-Aldrich, catalog number: P0044 )
1 M DTT (see Recipes)
1x Tris-buffered saline (TBS; see Recipes)
1x TBE (running buffer for urea-PAGE) (see Recipes)
20 mM DTT (see Recipes)
100 mM PMSF in isopropanol (see Recipes)
10x Tris/glycine (see Recipes)
10% (w/v) SDS (see Recipes)
Tris/glycine/SDS running buffer for SDS-PAGE (see Recipes)
Tris/glycine/methanol/SDS transfer buffer (see Recipes)
20x Tris-buffered saline (TBS) (see Recipes)
3% BSA in TBS (see Recipes)
40% (v/v) Tween 20 (see Recipes)
TBS-T (see Recipes)
1 μM SAM (see Recipes)
500 mM sodium acetate, pH 5.2 (see Recipes)
0.4 M ammonium sulfate
10% IGEPAL CA-630 (v/v) in water (see Recipes)
10x annealing buffer (see Recipes)
4x capping buffer (see Recipes)
YO Lysis Buffer (see Recipes)
YO Buffer A (see Recipes)
10x cap methylation buffer (see Recipes)
Equipment
Eye protection
NanoDrop spectrophotometer (Thermo Fisher, model: NanoDropTM 1000 , catalog number: ND-1000)
Lucite/Plexiglass acrylic benchtop shielding for handling 32P (e.g., Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 6700-2418 )
Geiger counter
Metric (centimeter) ruler
Scissors (e.g., Westcott, catalog number: ACM44217 )
Graphite pencil
Long (at least 18 cm) forceps or tongs (e.g., Fisher Scientific, catalog number: 15-186 )
P10, P20, P100, and P1000 pipets
Thermal cycler (e.g., MJ Research, model: PTC-200 )
Heating block (e.g., Bioer, model: MB 101 )
-80 °C freezer
Handheld 254 nm UV light (e.g., UVP, model: 95-0016-14 )
Liquid scintillation counter (e.g., Beckman Coulter, model: LS 6000IC )
Water-jacketed incubator (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: Forma® Series II) set to 37 °C with 5% CO2
Refrigerated centrifuge (Eppendorf, model: 5415 R )
Programmable rotator-mixer (Grant Instruments, model: PTR-30 ) at 4 °C and set to 10 rpm orbital rotation
UV-vis spectrophotometer (e.g., Beckman Coulter, model: DU 640 ) set to 595 nm
Electrophoresis system for PAGE and membrane transfer (e.g., Bio-Rad Laboratories, catalog number: 1660828EDU )
Opaque western blot incubation boxes (e.g., LI-COR, catalog number: 929-97205 )
Western blot imaging system (e.g., LI-COR, model: Odyssey Imaging Systems )
Rectangular glass TLC chamber (e.g., Miles Scientific, model: A70-22 , formerly Analtech)
Electric hair dryer (optional)
Storage phosphor screen (e.g., GE/Amersham Biosciences)
Light eraser for storage phosphor screen (e.g., Molecular Dynamics Image Eraser)
Typhoon imaging system (e.g., GE Healthcare, Amersham Biosciences, model: Typhoon 9200 )
Software
Microsoft Excel software
ImageQuant TL software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Trotman, J. and Schoenberg, D. R. (2018). RNA Cap Methyltransferase Activity Assay. Bio-protocol 8(6): e2767. DOI: 10.21769/BioProtoc.2767.
Download Citation in RIS Format
Category
Molecular Biology > RNA > RNA capping
Biochemistry > Other compound > Nucleoside triphosphate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,768 | https://bio-protocol.org/exchange/protocoldetail?id=2768&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
CRISPR-mediated Tagging with BirA Allows Proximity Labeling in Toxoplasma gondii
SL Shaojun Long
KB Kevin M. Brown
LS L. David Sibley
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2768 Views: 10916
Edited by: David Cisneros
Reviewed by: Amit Dey
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
Defining protein interaction networks can provide key insights into how protein complexes govern complex biological problems. Here we define a method for proximity based labeling using permissive biotin ligase to define protein networks in the intracellular parasite Toxoplasma gondii. When combined with CRISPR/Cas9 based tagging, this method provides a robust approach to defining protein networks. This approach detects interaction within intact cells, it is applicable to both soluble and insoluble components, including large proteins complexes that interact with the cytoskeleton and unique microtubule organizing center that comprises the apical complex in apicomplexan parasites.
Keywords: Mass spectrometry Protein interaction network Proximity labeling CRISPR BioID Proximity ligation
Background
Analysis of protein-protein interactions is a key endeavor in addressing how proteins assemble and function as macromolecular complexes. Traditionally, protein complexes have been identified through co-immunoprecipitation (co-IP) with subsequent mass spectrometry analysis. However, some protein complex substituents can be artificially lost or gained during the lysis, pull-down, and washing steps of co-IP, which is especially problematic for insoluble membrane or structural proteins that require aggressive solubilization. As an alternative to co-IP, proximity-dependent biotin identification (BioID) provides a ‘snapshot’ of proteins in close proximity to a target protein of interest during normal cellular homeostasis (Roux et al., 2012). BioID utilizes a promiscuous Escherichia coli biotin protein ligase (BirA) fused to a target protein of interest. Biotin supplementation licenses the BirA fusion to biotinylate near-neighbors within 30 nm (Roux et al., 2012; Van Itallie et al., 2013), with a static labeling radius of ≤ 10 nm (Kim et al., 2014). Biotinylated proteins may be captured by affinity chromatography and identified by mass spectrometry (Roux et al., 2012).
Toxoplasma gondii belongs to the phylum Apicomplexa composed of thousands of obligate parasites. Due to ease of in vitro cultivation and genetic manipulation, T. gondii is considered a model organism for studying the biology of apicomplexans. Recently, Chen et al. (2015) adapted BioID for use in T. gondii, identifying several novel protein components of the inner membrane complex (IMC). BioID has since been employed in T. gondii research to identify interactors of kinases (Gaji et al., 2015), calmodulins (Long et al., 2017a), and to define the protein repertoire of other cellular compartments including the parasitophorous vacuole (Nadipuram et al., 2016), sutures of the IMC (Chen et al., 2017), and the apical complex (Long et al., 2017b). Here we will describe the protocol for generating a BirA gene fusions using CRISPR/Cas9 tagging (Shen et al., 2014; Shen et al., 2017), in vivo BirA biotin labeling and purification of biotinylated proteins from parasites, and identification of captured biotinylated proteins by mass-spectrometry. Since analysis of mass spectrometry datasets can be complicated by non-specific hits, we provide a method to filter out false-positive interactions and rank true-positives using Straightforward Filtering IndeX program (SFINX) (http://sfinx.ugent.be/) (Titeca et al., 2016). Candidate interactors that emerge from BioID/SFINX analysis should also be validated by secondary analyses. Therefore we also provide instructions for demonstrating co-localization by a complementary proximity ligation assay.
Materials and Reagents
Pipette tips (Corning, catalog numbers: 4713 , 4712 )
1.7 ml Eppendorf tube (Corning, Costar®, catalog number: 3620 )
T25, T175 flasks (Corning, catalog numbers: 430639 , 431080 )
Syringes 10cc, 20cc (BD, catalog numbers: 302995 , 302830 )
22 G blunt needle (CML Supply, catalog number: 901-22-100M )
D3 polycarbonate membrane (GE Healthcare, catalog number: 110612 )
4 mm electroporation cuvette (Harvard Apparatus, catalog number: 450126 )
24- and 96-well plates (MIDSCI, catalog numbers: TP92024 , TP92696 )
Coverslips (Fisher Scientific, catalog number: 12-545-80 )
2 ml Eppendorf tubes (Fisher Scientific, catalog number: 054-08-138 )
1 L Stericup Filter Units (Merck, Millipore Sigma, catalog number: SCVPU11RE )
Cryovials (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 5000-0050 )
5 ml, 10 ml, 25 ml pipettes (Fisher Scientific, catalog numbers: 13-676-10H , 13-676-10J , 13-676-10K )
C18 CSH column (WATERS, catalog number: 186005295 )
T. gondii RH∆ku80∆hxgprt strain (a gift from Dr. Vernon Carruthers, University of Michigan Medical School, Ann Arbor)
Q5 Site-mutagenesis Kit with E. coli competent cells (New England Biolabs, catalog number: E0554S )
Plasmids available at https://www.addgene.org/
pSAG1::CAS9-U6::sgUPRT (Addgene, catalog number: 54467 )
pLinker-BirA-3HA-HXGPRT-LoxP (Addgene, catalog number: 86668 )
pLinker-6HA-HXGPRT-LoxP (Addgene, catalog number: 86552 )
pLinker-2Ty-HXGPRT-LoxP (Addgene, catalog number: 86664 )
LB broth (BD, catalog number: 244610 )
Ampicillin (Sigma-Aldrich, catalog number: A0166 )
Plasmid Extraction Kit (Macherey-Nagel, catalog number: 740588.250 )
M13 reverse universal primer
Q5 DNA polymerase (New England Biolabs, catalog number: M0491S )
PCR Cleanup Kit (Macherey-Nagel, catalog number: 740609.250 )
Trypsin for tissue culture (Sigma-Aldrich, catalog number: T3924 )
Mycophenolic acid (Sigma-Aldrich, catalog number: M3536 )
Xanthine (Sigma-Aldrich, catalog number: X4002 )
Formaldehyde 10% ultrapure EM grade (Polysciences, catalog number: 04018-1 )
Mouse anti-HA antibodies (BioLegend, catalog number: 901501 )
Rabbit anti-GAP45 (a gift from Dr. Dominique Soldati-Favre, University of Geneva Medical School, Geneva, Switzerland)
Goat anti-Mouse IgG (H+L) Secondary Antibody Conjugated with Alexa Fluor-488 (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11001 )
IRDye 680CW Goat anti-Mouse IgG (H+L) (LI-COR, catalog number: 926-68070 )
Streptavidin Alexa Fluor-488 conjugate (Thermo Fisher Scientific, catalog number: S32354 )
IRDye 800CW streptavidin (LI-COR, catalog number: 925-32230 )
IRDye 680CW Goat anti-rabbit IgG (H+L) (LI-COR, catalog number: 926-68071 )
Goat anti-Rabbit IgG (H+L) Secondary Antibody Conjugated with Alexa Fluor-594 (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11037 )
Liquid nitrogen
FBS (GE Healthcare, catalog number: SH30071.03HI )
20% DMSO
Streptavidin magnetic beads (Thermo Fisher Scientific, PierceTM, catalog number: 88816 )
Ammonium bicarbonate (Sigma-Aldrich, catalog number: 11213 )
DTT
Iodoacetamide (IAM) (Sigma-Aldrich, catalog number: I1149 )
DUOlink In Situ Red Starter Mouse/Rabbit (Sigma-Aldrich, catalog number: DUO92101 )
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 12800017 )
Sodium bicarbonate (Sigma-Aldrich, catalog number: S5761 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
L-glutamine (Sigma-Aldrich, catalog number: G7513 )
Gentamicin (Sigma-Aldrich, catalog number: G1272 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: 1551128 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: 1551139 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: 793639 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
D-biotin (Sigma-Aldrich, catalog number: 47868 )
Note: This product has been discontinued.
Tris (Sigma-Aldrich, catalog number: T1503 )
EGTA (Sigma-Aldrich, catalog number: E3889 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
NP-40 (Sigma-Aldrich, catalog number: I8896 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Deoxycholate (Sigma-Aldrich, catalog number: D6750 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
DOC, deoxycholate (Sigma-Aldrich, catalog number: 30970 )
Lithium chloride (LiCl) (Sigma-Aldrich, catalog number: 62476 )
D10 medium (see Recipes)
Cytomix buffer (see Recipes)
Phosphate-buffered saline (PBS) (see Recipes)
D-biotin stock (see Recipes)
Cytoskeleton buffer (see Recipes)
5x SDS sample buffer (see Recipes)
Buffer 1 (see Recipes)
Buffer 2 (see Recipes)
Buffer 3 (see Recipes)
Buffer 4 (see Recipes)
Equipment
Eppendorf centrifuge (Eppendorf, model: 5810 R )
Incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: Model 370 )
Class II biological safety hood (Baker Co., model: SterilGARD® II, ClassII type A/B3 )
BTX ECM-830 electroporator (Harvard Apparatus, model: ECM 830 )
Hemocytometer (Hausser Scientific, catalog number: 3120 )
Inverted phase contrast microscope (Nikon Instruments, model: Eclipse TS100 )
200 µl pipette
Sonic Dismembrator 550 (Fisher Scientific, model: Model 550 )
Magnetic stand (Thermo Fisher Scientific, catalog number: 12321D )
Odyssey imaging system (LI-COR, model: Odyssey® CLx )
Liquid nitrogen tank (Airgas, model: NI230LT22 )
Q-exactive HF mass spectrometer (Thermo Fisher Scientific, Thermo ScientificTM, model: Q ExactiveTM HF )
Software
sgRNA selection website: http://grna.ctegd.uga.edu/, Mascot, version 2.5.1 (Matrix Science)
SFINX analysis website: http://sfinx.ugent.be/, Scaffold version 4.6.1 (Proteome Software Inc.)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Long, S., Brown, K. M. and Sibley, L. D. (2018). CRISPR-mediated Tagging with BirA Allows Proximity Labeling in Toxoplasma gondii. Bio-protocol 8(6): e2768. DOI: 10.21769/BioProtoc.2768.
Download Citation in RIS Format
Category
Microbiology > Microbial proteomics > Whole organism
Molecular Biology > Protein > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,769 | https://bio-protocol.org/exchange/protocoldetail?id=2769&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Hydrogen Deuterium Exchange Mass Spectrometry of Oxygen Sensitive Proteins
LB Luke Berry
AP Angela Patterson
NP Natasha Pence
JP John W. Peters
BB Brian Bothner
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2769 Views: 8549
Edited by: Vamseedhar Rayaprolu
Reviewed by: Paul Finch
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
The protocol detailed here describes a way to perform hydrogen deuterium exchange coupled to mass spectrometry (HDX-MS) on oxygen sensitive proteins. HDX-MS is a powerful tool for studying the protein structure-function relationship. Applying this technique to anaerobic proteins provides insight into the mechanism of proteins that perform oxygen sensitive chemistry. A problem when using HDX-MS to study anaerobic proteins is that there are many parts that require constant movement into and out of an anaerobic chamber. This can affect the seal, increasing the likelihood of oxygen exposure. Exposure to oxygen causes the cofactors bound to these proteins, a common example being FeS clusters, to no longer interact with the amino acid residues responsible for coordinating the FeS clusters, causing loss of the clusters and irreversible inactivation of the protein. To counteract this, a double vial system was developed that allows the preparation of solutions and reaction mixtures anaerobically, but also allows these solutions to be moved to an aerobic environment while shielding the solutions from oxygen. Additionally, movement isn’t limited like it is in an anaerobic chamber, ensuring more consistent data, and fewer errors during the course of the reaction.
Keywords: HDX-MS Mass spectrometry Anaerobic proteins H/D exchange Protein dynamics Protein-protein interactions Protein-ligand interactions
Background
Many oxygen sensitive proteins are required for organisms to thrive in an anoxic environment. Some of these proteins provide an alternative supply of energy to anaerobic microbes through a process known as Flavin-based electron bifurcation (FBEB) (Lubner et al., 2017). FBEB generates reduced ferredoxin, which can be oxidized to produce energy. Proteins that are capable of reducing ferredoxin are of great interest and have been the focus of recent studies using HDX-MS (Demmer et al., 2016; Lubner et al., 2017; Berry et al., 2018). HDX-MS is a powerful technique for investigating protein stability, dynamics, and ligand binding providing information about the relationship between structure and function. HDX-MS uses the intrinsic property of amide hydrogens to exchange with hydrogens in solution to track changes in the structure and dynamics of a protein/protein complex. By preparing buffers with heavy water (D2O) instead of monoisotopic water (H2O), amide hydrogens on a protein will exchange with the deuterium in solution. The rate of exchange for a given amino acid is influenced by the stability of hydrogen bonds in the secondary structure, as well as the tertiary and quaternary interactions within a single protein or protein complex. Using mass spectrometry, deuterium incorporation is determined by measuring the shift in isotope distribution between deuterated and non-deuterated samples. HDX-MS has been applied to a large number of proteins and protein complexes across a wide range of conditions. To successfully study these proteins with HDX-MS, it was imperative to establish a means of performing this reaction on the benchtop to avoid heavy traffic into and out of an anaerobic chamber which is time consuming and burdensome. The problem was then how to allow manipulation of the sample while keeping the protein sample anaerobic for an extended period of time in an aerobic environment. To solve this problem, the reaction mixture and protein stock solutions were placed into a double vial system that allowed addition and removal of sample while maintaining strict anaerobic conditions. The logic behind the setup was to create an airlock. Vials are placed under positive pressure with nitrogen gas with a screw cap vial, inside a larger crimp vial that contains reductant. With this double barrier system, small volumes of air can be trapped in the outer vial and do not contact the sample.
Materials and Reagents
VerexTM vial kit, 9 mm, screw top, polypropylene, 300 μl + PTFE/silicone cap, blue, 1,000/pk (Phenomenex, catalog number: AR0-9991-13 )
Clear glass serum vial with 20 mm crimp top finish, 10 ml, 100/case (DWK Life Sciences, WHEATON, catalog number: 225278 )
Curwood Parafilm MTM laboratory wrapping film (Bemis, catalog number: PM996 )
Costar Microcentrifuge Tubes 0.65 ml, 500/bag (Corning, catalog number: 3208 )
Onyx Monolithic C18 column, 100 x 2 mm (Phenomenex, catalog number: CH0-8467 )
Alternative column (see Notes for a detailed explanation): Onyx Monolithic C18 column, 100 x 3 mm (Phenomenex, catalog number: CH0-8158 )
Model 1701 and 1702 small RN syringes, 10 μl (26s gauge) and 25 μl (22s gauge), 2” needle point style 2 (Hamilton, catalog numbers: 80030 and 80230 )
Unlined aluminum open-top seals, 20 mm, 1,000/case (DWK Life Sciences, WHEATON, catalog number: 224178-05 )
20 mm stopper, straight plug, ultra-pure (DWK Life Sciences, WHEATON, catalog number: W224100-405 )
200 μl Pipet Tips (VWR, catalog number: 53508-810 )
Liquid nitrogen
Purified ferredoxin (Fd) in 50 mM Ammonium Acetate buffer at pH 6.8 in H2O (stock concentration 150 μM) from Pf
Note: pH adjusted with 1 N HCl.
Purified NADH-dependent ferredoxin-NADP+ oxidoreductase (Nfn) in 20 mM Tris, 150 mM NaCl buffer at pH 8 in H2O (stock concentration 16.5 mg/ml) from the organism Pyrococcus furiosus (Pf)
Note: pH adjusted with 1 N HCl.
Sodium dithionite (Merck, catalog number: 1065051000 )
Nicotinamide adenine dinucleotide (NAD+, Cayman Chemical, catalog number: 16077 , 500 mg)
Nicotinamide adenine dinucleotide (NADH, Cayman Chemical, catalog number: 16078 , 500 mg)
Nicotinamide adenine dinucleotide phosphate (NADP+, Cayman Chemical, catalog number: 10004675 , 50 mg)
Nicotinamide adenine dinucleotide phosphate (NADPH, Cayman Chemical, catalog number: 9000743 , 25 mg)
99.5% formic acid (Fisher Scientific, catalog number: A117-50 )
Pepsin from porcine gastric mucosa (Sigma-Aldrich, catalog number: P6887-1G )
Sodium acetate trihydrate (Fisher Scientific, catalog number: S607-500 )
Ammonium acetate, ≥ 99% (Sigma-Aldrich, catalog number: 09689-250G )
37% hydrochloric acid (= 12.1 M) (Merck, catalog number: HX0603-3 )
Sodium hydroxide (Fisher Scientific, catalog number: BP359-500 )
Deuterium oxide (Sigma-Aldrich, catalog number: 151882-100G )
Tris base (Merck, catalog number: 648311-5KG )
Sodium chloride (Fisher Scientific, catalog number: BP358-212 )
HPLC grade water (Fisher Scientific, catalog number: W5-4 )
HPLC grade acetonitrile (Fisher Scientific, catalog number: A998-4 )
Nanopure water (purified in-house using a Millipore Q-Gard 2)
Tris base, NaCl buffer (pH 7.0) in deuterium oxide (see Recipes)
Tris base, NaCl buffer (pH 7.0) in H2O (see Recipes)
Tris base, NaCl, sodium dithionite buffer (pH 7.0) in H2O (see Recipes)
Equipment
HPLC stack for separation of peptides generated via pepsin digestion (e.g., 1290 Infinity series HPLC stack manufactured by Agilent Technologies) (Agilent Technologies, model: 1290 Infinity Series )
LC/MS Q-TOF system for sample analysis/data acquisition (e.g., 6538 UHD Accurate-Mass Q-TOF LC/MS manufactured by Agilent Technologies) (Agilent Technologies, model: 6538 UHD Accurate-Mass Q-TOF LC/MS )
Glove box capable of maintaining anaerobic conditions under positive inert gas pressure (e.g., MBraun, model: UNIlab Plus Glove Box Workstation )
Nitrogen tank
20 mm Kebby standard crimper for aluminum seals (Medical Laboratory Supply, catalog number: 2001-00-C01A )
Fisher Scientific isotemp 110 water bath (Fisher Scientific, model: FisherbrandTM IsotempTM, catalog number: S63077Q )
Note: This product has been discontinued.
Milli-Q purification system (Merck, catalog number: QGARD00D2 )
Pipettes (10 μl and 100 μl) (Eppendorf, catalog numbers: 022478886 and 022478924 )
Software
Microsoft Excel 2016 on Windows 7
UCSF Chimera v. 1.11.2
MassHunter Workstation Software Qualitative Analysis v. B.06.00 (Agilent Technologies)
HDExaminer v. 1.3.0 beta 6 (Sierra Analytics, Inc.)
MassHunter Workstation Software LC/MS Data Acquisition for 6200 series TOF/6500 series Q-TOF v. B.05.01 (Agilent Technologies)
Peptide Analysis Worksheet Freeware Edition (PAWs, ProteoMetrics–freeware edition)
SearchGUI v. 3.2.18 (Compomics)
Peptide Shaker v. 1.16.9 (Compomics)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Berry, L., Patterson, A., Pence, N., Peters, J. W. and Bothner, B. (2018). Hydrogen Deuterium Exchange Mass Spectrometry of Oxygen Sensitive Proteins. Bio-protocol 8(6): e2769. DOI: 10.21769/BioProtoc.2769.
Download Citation in RIS Format
Category
Biochemistry > Protein > Interaction
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
277 | https://bio-protocol.org/exchange/protocoldetail?id=277&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Glycolate Oxidase Activity Assay in Plants
AK Amita Kaundal
CR Clemencia M. Rojas
KM Kirankumar S. Mysore
Published: Vol 2, Iss 20, Oct 20, 2012
DOI: 10.21769/BioProtoc.277 Views: 12078
Original Research Article:
The authors used this protocol in Jan 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2012
Abstract
Glycolate oxidase is located in the peroxisome and is involved in the photorespiratory cycle which recovers some of the carbon loss during photosynthesis. Glycolate oxidase converts glycolate to glyxoylate with the concomitant production of H2O2.In this assay, the H2O2 generated, in the presence of HRP, oxidizes O-dianisidine into a colored O-dianisidine radical cation that can be quantified spectrophotometrically. The amount of color produces is directly proportional to the glycolate oxidase activity.
Materials and Reagents
Sucrose
HEPES
EDTA
DTT
L-cysteine
MgCl2
PVP
BSA
Complete, Mini, EDTA-free Protease Inhibitor Cocktail Tablets (F. Hoffmann-La Roche, catalog number: 04693159001 ).
Bio-Rad Protein Assay (Bio-Rad Laboratories, catalog number: 500-0006 )
Horseradish peroxidase(HRP) (Sigma-Aldrich, catalog number: P8375 )
O-Dianisidine (Sigma-Aldrich, catalog number: D9143 )
Sodium glycolate (Thermo Fisher Scientific, Acros Organics,catalog number: 351570250 )
Potassium phosphate
Triton X-100
Protein extraction buffer (see Recipes)
Glycolate oxidase assay buffer (see Recipes)
Equipment
Microtiter plate reader (Infinite M200 Pro, Tecan)
Microcentrifuge (AqquSpin Micro R) (Thermo Fisher Scientific)
96-well microtiter plate flat bottom(BD Biosciences, catalog number: 353075 )
2 ml-microcentrifuge tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Activity
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,770 | https://bio-protocol.org/exchange/protocoldetail?id=2770&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Biochemical Analysis of Dimethyl Suberimidate-crosslinked Yeast Nucleosomes
Yuichi Ichikawa
PK Paul D. Kaufman
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2770 Views: 6616
Edited by: Yanjie Li
Reviewed by: Kristin ShinglerEmilia Krypotou
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
Nucleosomes are the fundamental unit of eukaryotic chromosome packaging, comprised of 147 bp of DNA wrapped around two molecules of each of the core histone proteins H2A, H2B, H3, and H4. Nucleosomes are symmetrical, with one axis of symmetry centered on the homodimeric interaction between the C-termini of the H3 molecules. To explore the functional consequences of nucleosome symmetry, we designed an obligate pair of H3 heterodimers, termed H3X and H3Y, allowing us to compare cells with single or double H3 alterations. Our biochemical validation of the heterodimeric X-Y interaction included intra-nucleosomal H3 crosslinking using dimethyl suberimidate (DMS). Here, we provide a detailed protocol for the use of DMS to analyze yeast nucleosomes.
Keywords: Chromatin Nucleosome Histone Protein-protein interaction Crosslink Streptavidin affinity chromatography
Background
Post-translational modifications of histone proteins affect every aspect of chromosome biology, including transcription, replication, repair, and recombination. Because nucleosomes contain two copies of each core histone, modifications could be symmetric (same modifications on both H3 tails, e.g., K27me on both H3 tails within a nucleosome (Voigt et al., 2012)) or asymmetric (modifications on a single H3 tail, e.g., K27me on a single H3 tail within a nucleosome (Voigt et al., 2012)). Recent studies have demonstrated that nucleosomes in mammalian cells indeed display some asymmetric modifications (Voigt et al., 2012; Shema et al., 2016). To allow experimental manipulation of nucleosomal symmetry in vivo, we designed a pair of altered histone H3 proteins that have obligate heterodimeric interactions, termed H3X (L126A, L130V) and H3Y (L109I, A110W, L130I) (Ichikawa et al., 2017). Yeast cells expressing both H3X and H3Y are viable, but inviable if cells express only H3X or H3Y.
For biochemical validation of H3X-H3Y interactions within individual nucleosomes, we generated yeast strains expressing the bacterial biotin ligase BirA, N-terminal V5-tagged H3X and N-terminal biotin-accepting epitope tagged H3Y (Beckett et al., 1999). BirA is an enzyme that attaches biotin to a specific acceptor epitope, enabling us to purify the biotinylated molecules by streptavidin affinity chromatography. We treated extracts from yeast cells with dimethyl suberimidate (DMS), a crosslinking agent that contains a primary amine reactive imidoester group at each end of an 8-atom spacer arm (Figure 1A). DMS produces well-characterized crosslinks within histone octamers, including links between the two H3 molecules (Figure 1B; Kornberg and Thomas, 1974; Thomas, 1989). Therefore, this method can be used to report on the composition of asymmetric epitope tags.
Crosslinked samples are digested with micrococcal nuclease (MNase) to generate a soluble population of chromatin fragments containing approximately mononucleosome-sized DNA molecules (we note that DMS crosslinking prevents generation of a uniform ladder of MNase-digested products, Figure 1C). Biotin-tagged, MNase-digested chromatin is then purified via streptavidin-agarose affinity purification in the presence of high salt (2 M NaCl). This salt concentration is sufficient to remove DNA from histones (Bartley and Chalkley, 1972), avoiding interference from any neighbor nucleosomes that survived the MNase digestion. Bound proteins are then analyzed by Western blotting (Figure 1D). The DMS crosslinking efficiency of the X-Y heterodimeric pairs was around 10%, nearly identical to wild-type H3 homodimeric pairs; additionally, approximately 20% of the crosslinked heterodimers in the input fractions were precipitated by streptavidin-agarose (Ichikawa et al., 2017). We applied this method to analyze the extent of homodimerization of H3X or H3Y, as well as X-Y heterodimerization (Ichikawa et al., 2017). To examine this, we quantified X-Y dimer bands rather than the monomer, because these DMS crosslinked species represent direct H3-H3 interactions within individual nucleosomes.
Figure 1. Biochemical validation of asymmetric nucleosome formation in vivo. A. Chemistry of DMS cross-linking. DMS reacts with primary amines of proteins to form amidine bonds. B. Schematic for DMS crosslink of H3X and H3Y heterodimer. Yeast strains expressed V5-tagged H3X and Biotin-tagged H3Y, as indicated. C. DNA samples purified from MNase-digested chromatin from each time point (0, 10, 20 min) were analyzed by electrophoresis on a 1.5% TAE agarose gel, and stained with ethidium bromide. Note that after DMS crosslinking, the MNase-digested DNA fragments do not display the characteristic polynucleosomal ladder of uncrosslinked chromatin. D. Immunoblot analysis of V5-H3X and biotin-H3Y interactions. The left two lanes show total uncrosslinked and DMS-crosslinked chromatin, and right lanes show MNase-digested chromatin (Input), flow through fraction (Unbound) and streptavidin-precipitated biotinylated-H3 (Bound). Samples were separated by 17% SDS-PAGE, transferred to a membrane, and probed with anti-V5 antibody.
Materials and Reagents
200 μl and 1,000 μl Pipette tips (Corning, Axygen®, catalog numbers: RFL-222-C , RFL-1200-C )
1.5 ml O-ring screw-cap tubes (Fisher Scientific, catalog number: 02-707-353 )
1.5 ml microfuge tubes (Corning, Axygen®, catalog number: MCT-150-C )
0.5 ml glass beads (Bio Spec Product, catalog number: 11079105 )
26 gauge needle (BD, catalog number: 305115 )
12 x 75 mm plastic tube (Corning, Falcon®, catalog number: 352008 )
Nitrocellulose blotting membrane (GE Healthcare, catalog number: 10600004 )
Examination gloves (Fisher Scientific, catalog number: 19-130-1597D )
Biotin (Sigma-Aldrich, catalog number: B4501 )
Dimethyl suberimidate (DMS) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 20700 )
Trichloroacetic acid (TCA) (Fisher Scientific, catalog number: BP555 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Acros Organics, catalog number: 197530010 )
Calcium chloride dihydrate (CaCl2·2H2O) (Merck, Millipore Sigma, catalog number: 102382 )
Disodium ethylenediamine tetraacetate (EDTA) (Fisher Scientific, catalog number: S311 )
Ethylene glycol tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E4378 )
RNase A (Sigma-Aldrich, Roche Diagnostics, catalog number: 10109169001 )
Proteinase K (Sigma-Aldrich, catalog number: P2308 )
Ammonium acetate (NH4Ac) (Fisher Scientific, catalog number: A637 )
Phenol:Chloroform:Isoamyl Alcohol (PCI) (Thermo Fisher Scientific, catalog number: 15593031 )
2-Propanol (Fisher Scientific, catalog number: A416 )
Ethanol (Decon Labs, catalog number: 2701 )
TE (10 mM Tris-Cl, 1 mM EDTA, pH 8.0).
6x gel loading dye (New England Biolabs, catalog number: B7042 )
Agarose (Fisher Scientific, catalog number: BP160 )
Ethidium bromide (Sigma-Aldrich, catalog number: E7637 )
CL2B Sepharose beads (Sigma-Aldrich, catalog number: CL2B300 )
Streptavidin Sepharose beads (GE Healthcare, catalog number: 17-5113-01 )
Insulin (Sigma-Aldrich, catalog number: I1882 )
Clarity Western ECL Substrate (Bio-Rad Laboratories, catalog number: 1705060 )
Primary antibody: anti-V5 tag (Thermo Fisher Scientific, Invitrogen, catalog number: R960-25 )
Secondary antibody: anti-Mouse IgG (Thermo Fisher Scientific, Invitrogen, catalog number: 31430 )
Nonfat dry milk (Walmart, Great Value)
Yeast nitrogen base without amino acids (United States Biological, catalog number: Y2025 )
Glucose (Merck, Millipore Sigma, catalog number: DX0145 )
Micrococcal Nuclease (MNase) (Worthington Biochemical, catalog number: LS004797 )
Tris hydroxymethyl aminomethane (Tris) (Fisher Scientific, catalog number: BP152 )
Sodium tetraborate decahydrate (Na borate) (Sigma-Aldrich, catalog number: S9640 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271 )
Hydrochloric acid (HCl) (Fisher Scientific, catalog number: A144 )
Phenylmethylsulfonyl fluoride (PMSF) (RPI, catalog number: P20270 )
Sodium dodecylsulfate (SDS) (RPI, catalog number: L22010 )
Glycerol (Fisher Scientific, catalog number: G33 )
Bromophenol blue (Sigma-Aldrich, catalog number: B7021 )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Tween 20 (Sigma-Aldrich, catalog number: P2287 )
Acetic acid, Glacial (Fisher Scientific, catalog number: A38 )
40% acrylamide solution (Bio-Rad Laboratories, catalog number: 1610140 )
2% Bis solution (Bio-Rad Laboratories, catalog number: 1610142 )
Ammonium persulfate (Fisher Scientific, catalog number: BP179 )
Tetramethylethylenediamine (TEMED) (Bio-Rad Laboratories, catalog number: 1610800 )
Sodium bicarbonate (NaHCO3) (Fisher Scientific, catalog number: S233 )
Sodium carbonate (Na2CO3) (Fisher Scientific, catalog number: S263 )
Sodium hydroxide (NaOH) (Fisher Scientific, catalog number: S318 )
Methanol (Fisher Scientific, catalog number: A412 )
Synthetic media (see Recipes)
MNase (see Recipes)
Extraction (E) buffer (see Recipes)
2x SDS-sample buffer (SB) (see Recipes)
Wash (W) buffer (see Recipes)
17% SDS-PAGE gel (see Recipes)
5% stacking gel (see Recipes)
1x SDS-running buffer (see Recipes)
40x Na carbonate buffer (see Recipes)
Blotting buffer (see Recipes)
TBST (Tris-buffered saline + Tween 20) (see Recipes)
Equipment
P20, P200 and P1000 Pipettes (Gilson)
Labquake Tube Shaker/Rotators (Thermo Fisher Scientific)
Swing bucket rotor (Beckman Coulter, model: GH 3.8 )
Shaker incubator (INFORS HT)
Mini-Beadbeater-96 (Bio Spec Product)
Tabletop centrifuge (Beckman Coulter, model: Allegra 6R )
Centrifuge for microcentrifuge tubes (Eppendorf, model: 5415 D )
ChemiDoc Touch Imaging System (Bio-Rad Laboratories, model: ChemiDoc Touch Imaging System )
Vortex-Genie 2 (Scientific Industries, model: Vortex-Genie 2 )
Water bath (Precision Scientific, catalog number: 66551 )
Vertical Mini-Gel systems (C.B.S. Scientific, model: MGV102 )
Transfer electrophoresis unit (Hoefer, model: TE22 )
EASY-CAST Electrophoresis System (Thermo Fisher Scientific, Thermo ScientificTM, model: OwlTM Easy-CastTM B1 )
Power Supply (Bio-Rad Laboratories, model: PowerPacTM Basic )
Software
Image Lab (Bio-Rad Laboratories)
Procedure
Day 1
Pick a single colony from a plate, and inoculate an overnight culture of cells in 15 ml of synthetic media. Grow at 30 °C, 170 rpm in a shaker incubator. Do this 1-2 days beforehand, depending on growth rate of strain.
Day 2
Inoculate the overnight culture grown on day 1 into 110 ml of synthetic media supplemented with 250 nM biotin. Biotin is added to favor in vivo biotinylation of the tagged H3 proteins. The amount of cells to inoculate depends on growth rate (see below; typically, inoculate 3 OD units of cells of most X-Y strains into 110 ml media, which are then grown for 12 h). Grow at 30 °C, 170 rpm in a shaker incubator.
Day3
Cross-linking H3 dimers with DMS
Harvest at desired cell density. The desired cell density is 0.25 at OD600; don’t use more than 100 ml of cells at OD600 = 0.3 per Streptavidin-pull down described below, in order to assure that chromosomes are adequately digested with 20 μl MNase to generate mostly monosomes.
Spin down cells in Swing bucket rotor at 2,000 x g for 10 min at 4 °C. Gently pour off supernatant.
Resuspend cells in 0.5 ml E buffer at 4 °C and transfer to a 1.5 ml O-ring screw-cap tube. Spin down in microfuge 20 sec at max speed at 4 °C. Remove supernatant.
Wash 3 times with 1 ml E buffer by vortex. Spin down in microfuge 20 sec at max speed at 4 °C. Remove supernatant. Thorough washing is important here to remove amine-containing compounds that will impair crosslinking.
Resuspend each tube of cells completely in 900 μl E buffer at 4 °C, and add 0.5 ml glass beads.
Bead beat: 3 times of 1 min beating (2,100 rpm) in the Mini-Beadbeater-96 (5 min between pulses, on ice).
Heat a 26 gauge needle with a gas burner (Figure 2A), and puncture the tube bottom with the red-hot needle (Figure 2B). Place into a 12 x 75 mm plastic tube (‘FACS tube’) (Figure 2C) and spin for 2 min at 365 x g in a tabletop centrifuge at 4 °C (Figure 2D). Discard screwcap tube with glass beads (Figure 2E).
Figure 2. Step by step photos of the procedure Day 3, Step A7
Resuspend pellet in the liquid (a mixture of E buffer and cell lysate on the bottom of FACS tube) completely, and transfer to a 1.5 ml microfuge tube.
Make DMS stock 11 mg/ml in E buffer (typically 1 ml) at room temperature. This stock should be made freshly every time.
Remove 0 min aliquot, 100 μl for SDS-PAGE. Add 1/10 volume 100% TCA. Incubate at room temperature for 10 min. Spin down in a microfuge for 10 min at max speed at room temperature. Remove supernatant, wash pellet with 1 ml of acetone at room temperature. Leave the lid open for 30 min to air-dry the pellet. Resuspend air dried pellet in 50 μl 2x SB. Store at -20 °C.
Add 1/10 volume of 11 mg/ml DMS to a final concentration of 1 mg/ml. Incubate at room temperature with rotating for 60 min.
Add 1/20 volume of 1 M Tris-HCl, pH 7.5 to a final concentration of 50 mM for quenching the DMS crosslinking and further rotation for 15 min at room temperature.
Remove 60 min aliquot, 100 μl for SDS-PAGE. Add 1/10 volume 100% TCA to the aliquot, process as above.
Go next step (MNase digestion) immediately after the cross-linking.
MNase digestion
Add 1/100 volume of 1 M MgCl2 to a final concentration of 10 mM (really 8 mM final, since E buffer contains 2 mM EDTA), and add 1/100 volume of 0.1 M CaCl2 to a final concentration of 1 mM to the DMS-crosslinked sample (the remaining amount after Step A-13, approximately 800 μl) at room temperature. Take 100 μl to generate an un-digested DNA sample for gel analysis. Store on ice.
Equilibrate at 37 °C in a water bath for 5 min.
Add 20 μl of MNase, invert the tubes 5 times and incubate at 37 °C for 20 min.
Add 1/25 volume of 0.25 M EDTA/EGTA to a final concentration of 10 mM and invert 5-10 times to inhibit MNase. Take 100 μl to generate an MNase-digested DNA sample. Spin at 8,000 x g for 1 min, 4 °C, take supernatant for Streptavidin-pull down.
Gel analysis of MNase digestion
For DNA purification, add 5 μl of RNase A (10 mg/ml) to the 100 μl sample aliquots and incubate at 37 °C for 30 min.
Add 5 μl of 20% SDS and 2 μl of Proteinase K (20 mg/ml). Incubate at 65 °C for 3 h.
Add 200 μl of 7.5 M NH4Ac and 300 μl of ddH2O.
Add 600 μl of PCI and vortex. Spin for 5 min in a microfuge at max speed.
Take aqueous phase, and precipitate with 1 volume of 2-propanol.
Spin down for 20 min at max speed at room temperature right after isopropanol precipitation.
Wash pellet with 1 ml of 70% ethanol, spin for 5 min and air dry for 1 h.
Resuspend pellet in 10 μl of TE.
Add 2 μl of 6x loading buffer and run on 1.5% TAE agarose gel containing 0.5 μg/ml ethidium bromide at 5 V/cm for 50 min.
Streptavidin-pull down
Equilibrate CL2B Sepharose beads with E buffer at 4 °C. To block the beads, add 10 μg insulin per 40 μl slurry for each sample, rotate for 30 min at 4 °C. Add MNase digested samples (described at Step B4) to 40 μl slurry preblocked CL2B Sepharose beads, rotate for 30-60 min at 4 °C.
Spin at 8,000 x g for 1 min, 4 °C. Take 30 μl supernatant + 30 μl 2x SB as ‘Input’ sample. Store at -20 °C.
Transfer the supernatant into a new 1.5 ml tube. Add 30 μl slurry streptavidin-Sepharose beads preblocked with insulin (use 10 μg insulin per 30 μl slurry for each sample, process as above), rotate 2 h at 4 °C.
Spin at 8,000 x g for 1 min, 4 °C. Take 30 μl supernatant + 30 μl 2x SB as ‘Unbound’ sample.
Wash beads three times with 1 ml W buffer at 4 °C, by rotating at 4 °C for 5 min each time. Spin at 8,000 x g for 1 min at 4 °C, then discard supernatant.
After the last wash, remove all supernatant with a 26 gauge needle on a vacuum. Resuspend the beads in 50 μl 2x SB. Store at -20 °C.
Western blot
Boil samples at 100 °C for 10 min.
Load 10 μl of 0 min and 60 min samples, 15 μl of Input samples and 8 μl of Bound samples. Run on 17% SDS-PAGE gels in 1x SDS-running buffer at constant 8 mA while bromophenol blue goes through the stacking gel, and 18 mA as it goes through the resolving gel. Continue running for 15 min after bromophenol blue runs off the bottom to improve the resolution of histones. Total run time is approximately 2 h.
Transfer to Nitrocellulose membrane in blotting buffer at constant 0.5 A for 48 min.
Block the membrane in 5% milk/TBST for 1 h at room temperature.
Incubate membrane overnight at 4 °C with anti-V5 antibody (1:10,000 dilution in 5% milk/TBST).
Wash the membrane three times each for 10 min with 5% milk/TBST.
Incubate the membrane with secondary antibody (anti-Mouse IgG 1:15,000 dilution in 5% milk/TBST) at room temperature for 1 h.
Wash the membrane three times each for 10 min with TBST.
Remove the TBST and incubate the membrane with 1 ml ECL (enhanced chemiluminescence) solution for 10 min. Detect by using ChemiDoc Touch Imaging System (Chemiluminescent Blot mode, at the highest resolution).
Data analysis
H3-H3 crosslinked species were quantified with Bio-Rad ‘Image Lab’ software, using the ‘Volume Tools’. The area of the band was defined by surrounding it with a rectangle box (Figure 3). The same volume area was used to measure background signals, which were subtracted from the band intensity. The percentage of precipitated H3 dimer was calculated with following formulas:
Total input = ‘Band intensity of H3 dimer on input lane’ x ‘Total volume of input fraction’/‘Loading volume of input fraction’
Total bound = ‘Band intensity of H3 dimer on bound lane’ x ‘Total volume of bound fraction’/‘Loading volume of bound fraction’
Percentage of precipitated H3 dimer = (Total bound/Total input) x 100
The mean and standard deviation were calculated from the values of 3 independent replicate experiments.
Figure 3. Data analysis with Bio-Rad image Lab. Areas of the H3-H3 dimer bands and the blanks were defined by surrounding it with a rectangle box using the ‘Volume Tools’.
Notes
Use fresh cells (don’t freeze cells before the crosslink).
Use fresh DMS stock.
Note that during bead beating, visible aggregates appear, and many of these remain in the screwcap tube with the discarded glass beads at Step A7 of the DMS cross-link section. This is normal and does not indicate a problem.
60 min of incubation during the DMS crosslinking reaction at Step A11 was sufficient for us to obtain crosslinked H3 dimers. However, you can change the incubation time depending on your purpose and sample conditions.
PVDF membranes can be used for the Western blot, but in our experience Nitrocellulose membranes detect histones more sensitively.
Acrylamide is toxic. Wear examination gloves when you make SDS-PAGE gels.
Recipes
Synthetic media
0.67% yeast nitrogen base without amino acids
2% glucose
Note: No pH adjustment.
MNase
20 U/μl in 10 mM Tris-HCl pH 7.4
Extraction (E) buffer
20 mM Na borate
0.35 M NaCl
2 mM EDTA
Adjust pH to 9.00 with HCl
1 mM PMSF (added freshly)
2x SDS-sample buffer (SB)
0.1 M Tris-HCl pH 6.8
2% SDS
20% glycerol
0.02% bromophenol blue
1/50 volume of 2-mercaptoethanol
Wash (W) buffer
10 mM Tris-HCl pH 8.0
1 mM EDTA
2 M NaCl
0.2% Tween 20
17% SDS-PAGE gel (0.75 mm thickness, 14-well comb)
2.13 ml of 40% acrylamide
0.18 ml of 2% bisacrylamide
1.875 ml of 1.0 M Tris-HCl pH 8.8
25 μl of 20% SDS
0.78 ml of H2O
20 μl of 10% ammonium persulfate
5 μl of TEMED
5% stacking gel
0.31 ml of 40% acrylamide
0.18 ml of 2% bisacrylamide
0.31 ml of 1.0 M Tris-HCl pH 6.8
12.5 μl of 20% SDS
1.69 ml of H2O
10 μl of 10% ammonium persulfate
5 μl of TEMED
1x SDS-running buffer
25 mM Tris
192 mM glycine
0.1% SDS
40x Na carbonate buffer
251 mM NaHCO3
173 mM Na2CO3
Adjust pH to 9.5 with NaOH
Blotting buffer
1x Na carbonate buffer
20% methanol
TBST
25 mM Tris-HCl pH 8.0
137 mM NaCl
2.68 mM KCl
0.1% Tween 20
Acknowledgments
This work was supported by NIH grant R01GM100164. The authors have no conflicts of interest or competing interests.
References
Bartley, J. A. and Chalkley, R. (1972). The binding of deoxyribonucleic acid and histone in native nucleohistone. J Biol Chem 247(11): 3647-3655.
Beckett, D., Kovaleva, E. and Schatz, P. J. (1999). A minimal peptide substrate in biotin holoenzyme synthetase-catalyzed biotinylation. Protein Sci 8(4): 921-929.
Ichikawa, Y., Connelly, C. F., Appleboim, A., Miller, T. C., Jacobi, H., Abshiru, N. A., Chou, H. J., Chen, Y., Sharma, U., Zheng, Y., Thomas, P. M., Chen, H. V., Bajaj, V., Muller, C. W., Kelleher, N. L., Friedman, N., Bolon, D. N., Rando, O. J. and Kaufman, P. D. (2017). A synthetic biology approach to probing nucleosome symmetry. Elife 6: e28836.
Kornberg, R. D. and Thomas, J. O. (1974). Chromatin structure; oligomers of the histones. Science 184(4139): 865-868.
Shema, E., Jones, D., Shoresh, N., Donohue, L., Ram, O. and Bernstein, B. E. (2016). Single-molecule decoding of combinatorially modified nucleosomes. Science 352(6286): 717-721.
Thomas, J. O. (1989). Chemical cross-linking of histones. Methods Enzymol 170: 549-571.
Voigt, P., LeRoy, G., Drury, W. J., 3rd, Zee, B. M., Son, J., Beck, D. B., Young, N. L., Garcia, B. A. and Reinberg, D. (2012). Asymmetrically modified nucleosomes. Cell 151(1): 181-193.
Copyright: Ichikawa and Kaufman. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Ichikawa, Y. and Kaufman, P. D. (2018). Biochemical Analysis of Dimethyl Suberimidate-crosslinked Yeast Nucleosomes. Bio-protocol 8(6): e2770. DOI: 10.21769/BioProtoc.2770.
Ichikawa, Y., Connelly, C. F., Appleboim, A., Miller, T. C., Jacobi, H., Abshiru, N. A., Chou, H. J., Chen, Y., Sharma, U., Zheng, Y., Thomas, P. M., Chen, H. V., Bajaj, V., Muller, C. W., Kelleher, N. L., Friedman, N., Bolon, D. N., Rando, O. J. and Kaufman, P. D. (2017). A synthetic biology approach to probing nucleosome symmetry. Elife 6.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,771 | https://bio-protocol.org/exchange/protocoldetail?id=2771&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Colibactin-associated Genotoxicity in HeLa Cells by In Cell Western (ICW) Using γ-H2AX as a Marker
Sophie Tronnet
EO Eric Oswald
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2771 Views: 6985
Edited by: Andrea Puhar
Reviewed by: Isabel Silva
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
The genotoxin colibactin is produced by several species of Enterobacteriaceae. This genotoxin induces DNA damage, cell cycle arrest, senescence and death in eukaryotic cells (Nougayrède et al., 2006; Taieb et al., 2016). Here we describe a method to quantify the genotoxicity of bacteria producing colibactin following a short infection of cultured mammalian cells with colibactin producing E. coli.
Keywords: Colibactin Infection Escherichia coli Genotoxin DNA damage γ-H2AX
Background
The genotoxin colibactin is a polyketide nonribosomal peptide hybrid compound produced by several species of Enterobacteriaceae. This toxin, synthesized by a machinery encoded on a 54 kb genomic locus, the pks island, induces DNA damages, cell cycle arrest, senescence and death in eukaryotic cells (Nougayrède et al., 2006; Taieb et al., 2016). The genotoxic activity of colibactin is dependent on a direct host cell-bacteria interaction and cannot be recapitulated from culture supernatant, killed bacteria, or bacterial lysates instead of life bacteria. Visualization and quantification of the colibactin genotoxic effect on eukaryotic cells can be assessed by quantification of the megalocytosis phenotype (for a protocol see Bossuet-Greif et al., 2017) or quantification of the double-strand DNA breaks in the host cell nucleus by a comet assay (revealing DNA fragmentation) or phosphorylation of the H2AX histone, a marker of double-strand DNA breaks. The phosphorylation of the histone H2AX is characterized as an early and sensitive reaction to genotoxic agents (Audebert et al., 2010). H2AX phosphorylation was demonstrated to be 10-100 times more sensitive than the comet assay in vitro as well as in vivo (Audebert et al., 2010). The quantification of phosphorylated histone H2AX (γ-H2AX) can be processed by the In-Cell Western Assay, an immunochemical assay that uses fluorescence to detect and quantify proteins in fixed cells (Audebert et al., 2010). Here we describe an adapted assay allowing the measurement of γ-H2AX in 96-well plate using In-Cell Western, following a short infection of cultured mammalian cells with colibactin-producing bacteria (Martin et al., 2013; Bossuet-Greif et al., 2016; Tronnet et al., 2017).
Materials and Reagents
Black tissue culture plate 96 wells flat bottom (Greiner Bio One International, catalog number: 655090 )
Parafilm
Aluminum foil
pks+ and pks- Escherichia coli strains (stored in LB 20% glycerol at -80 °C)
Note: Strains typically used as positive controls in the authors’ laboratory are probiotic strain Nissle 1917 or the commensal strain M1/5. Strains used as a negative control are the K-12 strain MG1655. Our lab can provide these strains.
HeLa cells (ATCC, catalog number: CCL-2 ), 20 passages maximum
Lennox L broth base (LB medium; Thermo Fisher Scientific, InvitrogenTM, catalog number: 12780029 )
Dulbecco’s modified Eagle medium (DMEM) with 25 mM HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 42430 )
Hanks’ balanced salt solution (HBSS; Sigma-Aldrich, catalog number: H8264 )
Gentamicin solution 50 mg/ml (Sigma-Aldrich, catalog number: G1397 )
Dulbecco’s phosphate buffered saline (PBS; Sigma-Aldrich, catalog number: D8537 )
Dulbecco’s modified Eagle medium (DMEM), high glucose, GlutaMax Supplement, pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 31966021 )
Fetal bovine serum (FBS; Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Non-essential amino acids solution (NEAA) 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 11140035 )
Paraformaldehyde (PFA) 20% (Electron Microscopy Sciences, catalog number: 15713 )
10x PBS (Sigma-Aldrich, catalog number: D1408 )
Ammonium chloride (NH4Cl; BioUltra, Sigma-Aldrich, catalog number: 09718-250G )
TritonTM X-100 (Sigma-Aldrich, catalog number: X100-500ML )
MAXblock blocking medium (Active Motif, catalog number: 15252 )
Phosphatase inhibitor PHOSTOP (10x, Roche Diagnostics, catalog number: 04906837001 )
RNase (Sigma-Aldrich, catalog number: R6513 )
Sodium chloride (NaCl; Sigma-Aldrich, catalog number: S7653 )
Sodium azide (Sigma-Aldrich, catalog number: S8032 )
Rabbit monoclonal anti-γ-H2AX antibody (Cell Signaling Technology, catalog number: 9718 )
IRDyeTM 800CW-conjugated goat anti-rabbit secondary antibody (2 mg/ml, Biotium (distributor Interchim), catalog number: 20078 )
RedDotTM2 (200x in DMSO, Biotium (distributor Interchim), catalog number: 40061 )
HeLa cell culture medium (see Recipes)
Fixation solution (see Recipes)
Neutralization solution (see Recipes)
10% Triton X-100 (see Recipes)
Permeabilization solution (see Recipes)
Blocking solution (see Recipes)
Permeabilization solution (see Recipes)
PST buffer (see Recipes)
100x azide (see Recipes)
Anti-γ-H2AX solution (see Recipes)
Secondary antibody solution (see Recipes)
Equipment
37 °C, 5% CO2 incubator for cell cultures
37 °C incubator for bacterial cultures
Microplate reader with 680 and 800 nm channels (here, Odyssey Infrared Imaging Scanner, Li-Cor ScienceTec, Les Ulis, France)
Microplate reader for absorbance measurement at 600 nm (TECAN Infinite Pro)
Colorimeter to measure the absorbance at 600 nm of bacterial cultures (Biochrom, model: WPA CO7500 )
Variable Speed Rocker (VWR, catalog number: 75832-308 )
Chemical safety hood
Clean bench
Inverted microscope (Olympus, model: CKX31 )
Pipettes and multichannel micropipette 30-300 µl
Software
GraphPad Prism 6.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tronnet, S. and Oswald, E. (2018). Quantification of Colibactin-associated Genotoxicity in HeLa Cells by In Cell Western (ICW) Using γ-H2AX as a Marker. Bio-protocol 8(6): e2771. DOI: 10.21769/BioProtoc.2771.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vitro model
Cell Biology > Cell staining > Protein
Biochemistry > Protein > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,772 | https://bio-protocol.org/exchange/protocoldetail?id=2772&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Alphavirus Purification Using Low-speed Spin Centrifugation
Vamseedhar Rayaprolu
JR Jolene Ramsey
JW Joseph Che-Yen Wang
SM Suchetana Mukhopadhyay
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2772 Views: 10571
Edited by: Dennis Nürnberg
Reviewed by: Kathrin SutterJia Meng
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Chemical and sedimentation procedures are used to purify virus particles. While these approaches are successful for wild-type viruses, they are often not feasible for purifying mutant viruses with assembly defects. We combined two published methods (Atasheva et al., 2013; Moller-Tank et al., 2013), to generate a protocol that uses low-speed centrifugation to purify both wildtype and mutant enveloped virus particles at high yield with minimal handling steps. This protocol has successfully been used to purify alphavirus particles for imaging and structural studies (Wang et al., 2015; Ramsey et al., 2017).
Keywords: Enveloped virus purification Centrifugation Assembly mutants
Background
Virus purification is traditionally based on chemical precipitation (e.g., PEG) or density gradient centrifugation. Centrifugation protocols involve pelleting particles at high speeds (> 100,000 x g) or through sedimentation matrices such as cesium, Nycodenz, Iodixanol, sucrose, glycerol, or tartrate. After sedimentation in the gradient, the purified virus sample usually requires additional steps to remove the gradient matrix, concentrate the purified particles, and buffer exchange into a stabilizing buffer for downstream applications. These approaches include dialysis, centrifugation through a centrifugal filter, or PEG precipitation. While these approaches will produce purified particles, there are several drawbacks: (1) overall yields can be low, (2) time required for the purification can extend to a week, (3) morphologically heterogeneous particles are not purified with equal efficiency, (4) particles can be damaged in the process, and (5) assembly mutants often do not survive the purification process making certain downstream analyses challenging.
The protocol described here uses a gentle approach to purify enveloped virus particles. We used minimal centrifugal force to reduce damage to particles which is observed as increased morphological heterogeneity in negative-stain transmission electron microscopy (TEM) or total loss of fragile particles by TEM or infectivity assays. In addition, we wanted to reduce the manipulation of purified virions post-purification. By merging two protocols from the literature (Atasheva et al., 2013; Moller-Tank et al., 2013), we are able to purify different Alphaviruses (Sindbis [Ramsey et al., 2017], Ross River [Wang et al., 2015], Chikungunya [Mukhopadhyay and Wang, unpublished data] and assembly mutants of each) via low-speed centrifugation (LSC). No additional steps for gradient matrix removal, sample concentration, or buffer exchange are necessary. We are also able to use this protocol to purify viruses from different cell lines (mammalian and arthropod). These purified particles have been used for cryo-EM, mass spectrometry, and protease cleavage studies.
Materials and Reagents
Pipette tips
Note: Filter tips are not necessary unless you routinely use when working with your virus of choice.
150 mm cell culture dishes (Greiner Bio One International, catalog number: 639160 , or equivalent)
Sterile polypropylene 50 ml conical tubes (Corning, catalog number: 430921 , or equivalent)
Serological pipets, 5 and 10 ml (DWK Life Sciences, KIMBLE, catalog numbers: 56900-5110 and 56900-10110 , or equivalent)
Kimwipes (KCWW, Kimberly-Clark, catalog number: 34155 , or equivalent)
Cotton swabs (Ted Pella, catalog number: 80907 , or equivalent)
pH test strips (Hach, catalog number: 2601300 )
EM grids Formvar/Carbon 300 mesh (Ted Pella, catalog number: 01753-F )
BHK-21 cells (ATCC, catalog number: CCL-10 )
C6/36 cells (ATCC, catalog number: CRL-1660 )
1x sterile PBS (Corning, catalog number: 21-040-CM , or equivalent)
Coomassie blue
Page Ruler Prestained Protein Ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 22616 )
MEM media (Corning, catalog number: 15-010-CV , or equivalent)
100x L-glutamine (Corning, catalog number: 25-005-CV , or equivalent)
100x MEM nonessential amino acids (Corning, catalog number: 25-025-Cl , or equivalent)
100x antibiotic-antimycotic (Corning, catalog number: 30-004-Cl , or equivalent)
FBS (Corning, catalog number: 35-010-CV , or equivalent)
Sterile virus production serum free media (VP-SFM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11681020 , or equivalent)
HEPES (Fisher Scientific, catalog number: BP310-1 , or equivalent)
Sodium chloride (NaCl) (Fisher Scientific, catalog number: BP358-10 , or equivalent)
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: EDS-100G , or equivalent)
Hydrochloric acid (HCl)
Uranyl acetate (Electron Microscopy Sciences, catalog number: 22400 , or equivalent)
MEM complete media (see Recipes)
Supplemented VP-SFM (see Recipes)
HEPES-NaCl-EDTA (HNE) Resuspension buffer (see Recipes)
1% uranyl acetate (see Recipes)
Equipment
Pipettes
Tissue culture incubator, temperature and CO2 regulated (Thermo Fisher Scientific, Thermo ScientificTM, model: Forma 3130 , or equivalent)
Refrigerated table-top centrifuge with fixed angle rotor (Eppendorf, model: 5804 R , with F34-6-38 rotor, or equivalent)
Biosafety cabinet (Thermo Fisher Scientific, Thermo ScientificTM, model: 1300 Series Class II, Type A2 , catalog number: 1323TS, or equivalent)
Adjustable tilt rocker (Reliable Scientific, model: 55 rocking shaker )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rayaprolu, V., Ramsey, J., Wang, J. C. and Mukhopadhyay, S. (2018). Alphavirus Purification Using Low-speed Spin Centrifugation. Bio-protocol 8(6): e2772. DOI: 10.21769/BioProtoc.2772.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,773 | https://bio-protocol.org/exchange/protocoldetail?id=2773&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ciliary Assembly/Disassembly Assay in Non-transformed Cell Lines
MS Masaki Saito*
KS Kensuke Sakaji*
WO Wataru Otsu
CS Ching-Hwa Sung
*Contributed equally to this work
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2773 Views: 9320
Edited by: Ralph Thomas Boettcher
Reviewed by: Chris TibbittMurugappan Sathappa
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
The primary cilium is a non-motile sensory organelle whose assembly and disassembly are closely associated with cell cycle progression. The primary cilium is elongated from the basal body in quiescent cells and is resorbed as the cells re-enter the cell cycle. Dysregulation of ciliary dynamics has been linked with ciliopathies and other human diseases. The in vitro serum-stimulated ciliary assembly/disassembly assay has gained popularity in addressing the functions of the protein-of-interest in ciliary dynamics. Here, we describe a well-tested protocol for transfecting human retinal pigment epithelial cells (RPE-1) and performing ciliary assembly/disassembly assays on the transfected cells.
Keywords: Primary cilium Acetylated α-tubulin Ciliary assembly Ciliary disassembly RPE-1 cells Short hairpin RNA
Background
Primary cilia are hair-like sensory organelles that appear at the G0/G1 phase, and are disassembled prior to the S phase of the cell cycle (Tucker et al., 1979). Previous studies have confirmed that certain non-transformed cell types (i.e., RPE-1 cells, 3T3 fibroblasts, and mouse embryonic fibroblasts [MEFs]) can be starved to induce quiescence and ciliary formation. Subsequent re-addition of serum triggers biphasic ciliary resorption, which peaks at 2 h and 24 h following stimulation (Tucker et al., 1979; Li et al., 2011). This phenomenon lays the foundation for the serum-stimulated ciliary assembly/disassembly assay commonly used in the literature to identify proteins involved in ciliary assembly and disassembly (Pugacheva et al., 2007; Saito et al., 2017). MEFs derived from transgenic mice (in which the gene-of-interest is deleted) are often used to investigate the dynamic role of a given protein in the ciliary assembly/disassembly assays. When the specific MEF types are not accessible, one may modify the expression level of the targeted protein in naive RPE-1 cells (or 3T3 or MEFs) using transfection of cDNA or short hairpin RNA. We describe the protocol of these procedures that are routinely carried out in the lab. To unambiguously identify the cell autonomous effect on ciliary assembly or disassembly in the transfected cells, we typically ‘tag’ the transfected cells with green fluorescence via the expressed GFP or GFP-fusion protein.
Materials and Reagents
10 µl pipette tips (Corning, catalog number: 4110 , or Denville Scientific, catalog number: P1096 )
200 µl pipette tips (FUKAEKASEI and WATSON, catalog number: 110-705Y , or Denville Scientific, catalog number: P1122 )
1,000 µl pipette tips (FUKAEKASEI and WATSON, catalog number: 110-706B , or Denville Scientific, catalog number: P2103-N )
100 mm cell culture dish (AS ONE, Violamo, catalog number: 2-8590-03 , or Corning, catalog number: 430167 )
1.5 ml microcentrifuge tube (Sorenson BioScience, catalog number: 11510 , or National Scientific, catalog number: CN1700-BP )
Precleaned, sterile 12-13 mm micro-glass coverslips (Matsunami Glass, catalog number: C013001 , or Thermo Fisher Scientific, catalog number: 12CIR-1.5 )
35 mm cell culture dish (Corning, Falcon®, catalog number: 353001 , or Corning, catalog number: 430165 )
15 ml centrifuge tube (FUKAEKASEI and WATSON, catalog number: 1332-015S , or Corning, catalog number: 430053 )
24-well plate (NuncTM, Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 142475 , or Corning, catalog number: 3527 )
Parafilm
14 x 16 cm glass (or plastic) plates
Micro-slide glass (Matsunami Glass, catalog number: S024410 )
0.22 µm filter (Corning, catalog number: 431097 , or Advantec MFS, catalog number: 25CS020AS )
RPE-1 cells (ATCC, catalog number: CRL-4000 )
Midi-prepared, or maxi-prepared plasmid (> 1 µg/µl is preferred)
Note: We typically have the cDNA (under the CAG or CMV promoter) or short hairpin RNA (shRNA; under the U6 promoter) inserted in the same plasmid that also expresses GFP (e.g., pCAGIG vector).
0.05% Trypsin-0.53 mM EDTA (Wako Pure Chemical Industries, catalog number: 202-16931 )
Fetal bovine serum (FBS) (PAA Laboratories, catalog number: A15-701 )
Dulbecco’s modified Eagle medium/Ham’s F-12 (DMEM/F12) (Wako Pure Chemical Industries, catalog number: 048-29785 )
Methanol
Monoclonal anti-acetylated α-tubulin (Ac-Tub) antibody, clone 6-11B-1 (Sigma-Aldrich, catalog number: T6793 )
Anti-Tubulin Antibody, Detyrosinated (Merck, catalog number: AB3201 )
Monoclonal anti-γ-tubulin antibody, clone GTU-88 (Sigma-Aldrich, catalog number: T5326 )
Polyclonal anti-GFP tag antibody (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-6455 )
Goat anti-mouse IgG (H+L) antibody, Alexa Fluor 568 (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11004 )
Goat anti-mouse IgG2b antibody, Alexa Fluor 568 (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-21144 )
Goat anti-mouse IgG1 antibody, Alexa Fluor 647 (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-21240 )
Goat anti-Rabbit IgG (H+L) antibody, Alexa Fluor 488 (Thermo Fisher Scientific, InvitrogenTM, catalog number: R37116 )
Fluorescent mounting medium (Agilent Technologies, Dako, catalog number: S302380-2 , code number: S3023) or ProLong Gold Antifade Mountant (Thermo Fisher Scientific, InvitrogenTM, catalog number: P36930 )
Nail polish
Dulbecco’s modified Eagle medium (DMEM) (NACALAI TESQUE, catalog number: 08458-16 )
100 mM pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11360070 )
10x D-PBS (-) (Wako Pure Chemical Industries, catalog number: 048-29805 )
Calcium chloride dihydrate (CaCl2·2H2O) (Wako Pure Chemical Industries, catalog number: 031-00435 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Wako Pure Chemical Industries, catalog number: 135-00165 )
16% Paraformaldehyde (PFA) aqueous solution (Electron Microscopy Science, catalog number: 15710 )
Ammonium chloride (NH4Cl) (Wako Pure Chemical Industries, catalog number: 017-02995 )
Bovine serum albumin (BSA) (Wako Pure Chemical Industries, catalog number: 010-15114 )
Triton X-100 (GE Healthcare, catalog number: 17-1315-01 )
Sodium azide (NaN3) (Wako Pure Chemical Industries, catalog number: 190-01272 )
4’,6-Diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, InvitrogenTM, catalog number: D1306 )
Growth medium (see Recipes)
PBS for cell culture (see Recipes)
2x PBSc/m (see Recipes)
PBSc/m (see Recipes)
4% PFA/PBSc/m (see Recipes)
50 mM NH4Cl (see Recipes)
BTPAD (see Recipes)
Equipment
5% CO2/95% air tissue culture incubator (SANYO, model: MCO-18AIC )
Water bath (TOKYO RIKAKIKAI, Eyela, model: NTT-1200 )
Hemocytometer chamber (Erma, catalog number: 03-303-1 )
Low-speed centrifuge (TOMY SEIKO, model: LC-100 ; Eppendorf, model: 5702 )
Pipette 20 µl (Pipetman P) (Gilson, catalog number: F123600 )
Pipettes 200 µl (Pipetman P) (Gilson, catalog number: F123601 )
Pipettes 1,000 µl (Pipetman P) (Gilson, catalog number: F123602 )
For Procedure B1:
NeonTM transfection system (Thermo Fisher Scientific, InvitrogenTM, catalog number: MPK5000 )
For Procedure B2:
NucleofectorTM device (Lonza, model: NucleofectorTM I )
Cuvettes PlusTM Electroporation Cuvettes & transfer tips (BTX, catalog number: 45-0135 )
Amaxa® Cell Line Nucleofector® Kit V (Lonza, catalog number: VCA-1003 )
Forceps (Fine Scientific Tool, Dumont, model: #5/45 )
Autoclave (TOMY SEIKO, model: LBS-245 )
Epifluorescent microscope (Carl Zeiss, model: Axioplan 2 imaging ) equipped with objective lens (EC Plan-Neofluar 40x/0.75, Carl Zeiss, catalog number: 440350-9903-000 )
Confocal microscope (ZEISS, model: LSM-780 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Saito, M., Sakaji, K., Otsu, W. and Sung, C. (2018). Ciliary Assembly/Disassembly Assay in Non-transformed Cell Lines. Bio-protocol 8(6): e2773. DOI: 10.21769/BioProtoc.2773.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Proliferation
Developmental Biology > Cell signaling > Ligand
Cell Biology > Cell-based analysis > Organelle motility
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,774 | https://bio-protocol.org/exchange/protocoldetail?id=2774&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Intracellular ROS in Caenorhabditis elegans Using 2’,7’-Dichlorodihydrofluorescein Diacetate
Dong Suk Yoon
ML Myon-Hee Lee
DC Dong Seok Cha
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2774 Views: 14776
Edited by: Neelanjan Bose
Reviewed by: Michael Enos
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Reactive oxygen species (ROS) are generated during normal metabolic processes under aerobic conditions. Since ROS production initiates harmful radical chain reactions on cellular macromolecules, including lipid peroxidation, DNA mutation, and protein denaturation, it has been implicated in a wide spectrum of diseases such as cancer, cardiovascular disease, ischemia-reperfusion and aging. Over the past several decades, antioxidants have received explosive attention regarding their protective potential against these deleterious reactions. Accordingly, many analytical methodologies have been developed for the evaluation of the antioxidant capacity of compounds or complex biological samples. Herein, we introduce a simple and convenient method to detect in vivo intracellular ROS levels photometrically in Caenorhabditis elegans using 2’,7’-dichlorofluorescein diacetate (H2DCFDA), a cell permeant tracer.
Keywords: Reactive oxygen species 2’,7’-Dichlorofluorescein diacetate C. elegans Antioxidant
Background
In situ detection of intracellular reactive oxygen species (ROS) levels in the living organism using fluorescent probe 2’,7’-dichlorofluorescein diacetate (H2DCFDA) has been broadly performed by those researchers who work in the field of oxidative stress and related diseases. The non-polar and non-ionic probe, H2DCFDA, can easily penetrate the cellular membrane and is enzymatically deacetylated by esterases. This biochemical reaction turns H2DCFDA into the non-fluorescent compound H2DCF which is then rapidly oxidized to highly fluorescent 2’,7’-dichlorofluorescein (DCF) in the presence of ROS (Figure 1A). Therefore, fluorescence signals from H2DCFDA probe demonstrate important information for the quantification of ROS at single cell level (Labuschagne and Brenkman, 2013). The Caenorhabditis elegans model system provides an excellent in vivo experimental environment for evaluating molecular mechanisms of ROS pathophysiology due to their short lifespan, simplicity, and ease of genetic manipulation (Labuschagne and Brenkman, 2013; Miranda-Vizuete and Veal, 2017; Yoon et al., 2017) (Figure 1B). Here, we describe a simple protocol to measure the levels of time-course ROS generation in C. elegans using H2DCFDA under normal and heat- or chemically-induced oxidative stress conditions. Using this protocol, we determined the effects of H2DCFDA concentration and number of tested worms on DCF fluorescence signal (Figure 2).
Figure 1. ROS detection. A. Production of florescent DCF by intracellular ROS. B. Measurement of intracellular ROS using molecular probe (H2DCFDA) in C. elegans.
Figure 2. Change in DCF fluorescence signals depends on experimental conditions. A. The expression of gcs-1(promoter)::GFP (oxidative stress marker) transgene by oxidative stress. Heat (30 °C for 2 h) induced the expression of gcs-1(promoter)::GFP transgene in the intestines of live nematodes. B. Concentration-response curves were plotted in terms of the mean value of DCF fluorescence signals induced by 12.5, 25, 50, and 100 μM of H2DCFDA using 50 nematodes for each experiment. C. Changes in DCF fluorescence signals depending on the number of tested nematodes (10, 20, 50, and 100) were assessed using 25 μM of H2DCFDA.
Materials and Reagents
1.5 ml microcentrifuge tube (Corning, Axygen®, catalog number: MCT-150-C )
Conical tube, 15 ml (Corning, Falcon®, catalog number: 352096 )
Slide glass (VWR, catalog number: 48300-025 )
96-well microplate, black (SPL Life Sciences, catalog number: 30496 )
60 mm Petri dish (SPL Life Sciences, catalog number: 10060 )
Platinum wire, 0.2 mm (Alfa Aesar, catalog number: 45093 )
Caenorhabditis elegans strain, wild-type [N2] (Caenorhabditis Genetics Center, University of Minnesota: https://cgc.umn.edu)
Escherichia coli OP50 strain (Caenorhabditis Genetic Center)
Distilled water
2’,7’-Dichlorofluorescein diacetate (Sigma-Aldrich, catalog number: D6883 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D2650 )
Methyl viologen dichloride hydrate (Merck, catalog number: 856177 )
Cholesterol (Sigma-Aldrich, catalog number: C8667 )
Ethanol (Sigma-Aldrich, catalog number: E7023 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S5886 )
Bacto-peptone (BD, BactoTM, catalog number: 211677 )
Agar (Sigma-Aldrich, catalog number: A1296 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C1016 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Potassium phosphate, dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P3786 )
Potassium phosphate, monobasic (KH2PO4) (Sigma-Aldrich, catalog number: 795488 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S8045 )
Sodium hypochlorite (NaClO) (Sigma-Aldrich, catalog number: 425044 )
5 mg/ml cholesterol (see Recipes)
Nematode growth medium (NGM) agar plates (see Recipes)
M9 buffer (see Recipes)
Bleaching solution (see Recipes)
Equipment
Shaking incubator (Benchtop Shaking Incubator, VWR, model: Model 1570 )
Micropipette (VWR International)
Incubators for stable temperature (VWR SIGNATURE 20-cuft Model 2020 B.O.D. -10 °C to 45 °C Low Temp Incubator) (VWR, Advanced Instruments, model: Model 2020 )
Tabletop centrifuge (VWR, model: VWR® Mini Centrifuge C1413V )
Dissecting stereomicroscope (Stereo Microscope with Apochromatic Optics Leica S8 APO) (Leica Microsystems, model: Leica S8 APO )
Fluorophotometer (Promega, model: GloMax®-Multi Microplate Multimode Reader )
Vortex mixer (Standard Heavy-Duty Vortex Mixer, VWR, catalog number: 97043-562 )
Autoclave (Hanshin Medical, model: HS-2321SD )
Software
Microsoft Office 2017 Excel (Microsoft Corporation, Redmond, USA)
IBM SPSS statistics 24 (IBM Corporation, New York, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yoon, D. S., Lee, M. and Cha, D. S. (2018). Measurement of Intracellular ROS in Caenorhabditis elegans Using 2’,7’-Dichlorodihydrofluorescein Diacetate. Bio-protocol 8(6): e2774. DOI: 10.21769/BioProtoc.2774.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling > Stress response
Biochemistry > Other compound > Oxygen
Cell Biology > Cell signaling > Intracellular Signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,775 | https://bio-protocol.org/exchange/protocoldetail?id=2775&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection and Analysis of Circular RNAs by RT-PCR
Amaresh C Panda
MG Myriam Gorospe
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2775 Views: 26525
Edited by: Gal Haimovich
Reviewed by: Omar AkilWilliam C. W. Chen
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al., 2017b; Panda et al., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al., 2015 and 2017; Panda et al., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.
Keywords: Circular RNA Backsplice junction Divergent primer RT-PCR RNase R
Background
CircRNAs are covalently closed, single-stranded RNAs lacking 5’ or 3’ ends. Although their genesis is poorly understood, they can arise from pre-mRNAs by a process called backsplicing (Panda et al., 2017d; Jeck et al., 2013). CircRNAs have been reported to be abundant, ubiquitously expressed, and conserved across species (Jeck et al., 2013). A number of studies have established that circRNAs can regulate gene expression by acting as competitors of pre-mRNA splicing, as decoys for microRNAs, as sponges for RBPs, and possibly also as substrates for translation (Panda et al., 2017d). In recent years, more than one hundred thousand circRNAs have been reported bioinformatically from high-throughput RNA sequencing (RNA-seq) (Glazar et al., 2014). Unfortunately, there is little overlap among different bioinformatic pipelines and there is no ‘gold standard’ method to validate the accuracy of circRNAs identified by different bioinformatic tools (Szabo and Salzman, 2016). However, RT-PCR has been widely used for validation of circRNAs identified by RNA-seq. This protocol describes the design of divergent primers which face away from each other on the linear RNA, so that they can only amplify the circRNAs, and not the linear RNAs with the same sequence. The PCR amplicon for the detection of circRNAs using divergent primers spans the backsplice junction of circRNAs. This method has been successfully used in several studies for the detection and quantification of circRNAs.
Materials and Reagents
Standard pipette tips with a volume capacity of 10 µl, 20 µl, 200 µl, and 1 ml
Nuclease-free 1.7-ml microcentrifuge tubes (Denville Scientific, catalog number: C2171 )
ThermoGridTM rigid strip 0.2-ml PCR tubes [(Denville Scientific, catalog number: C18064 (1000859) ]
MicroAmp® optical 384-well reaction plate (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4309849 )
Optical adhesive film (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4311971 )
Dulbecco’s phosphate-buffered saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14040-133 )
Total RNA isolation-miRNeasy Mini Kit (QIAGEN, catalog number: 217004 )
(Optional) TRIzol reagent (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 15596018 )
Nuclease-free water (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9930 )
RiboLock RNase inhibitor (40 U/µl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EO0381 )
RNase R (Lucigen, Epicentre, catalog number: RNR07250 )
dNTP mix (10 mM each) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0193 )
Random primers (150 ng/µl) (Sigma-Aldrich, Roche Diagnostics, catalog number: 11034731001 )
Maxima reverse transcriptase (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EP0741 )
KAPA SYBR® FAST ABI prism 2x qPCR master mix (Kapa Biosystems, catalog number: KK4605 ), or SYBR Green from other vendors
QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704 )
TBE Buffer, 10x, Molecular Biology Grade (Sigma-Aldrich, catalog number: 574795-1L )
1 Kb Plus DNA Ladder (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10787018 )
UltraPureTM Agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500500 )
Ethidium bromide solution (Sigma-Aldrich, catalog number: E1510-10ML )
2% agarose gel (see Recipes)
Equipment
Manual Pipettes set of 2 µl, 20 µl, 200 µl and 1,000 µl (Mettler-Toledo, Rainin, catalog number: 17014393 , 17014392 , 17014391 , and 17014382 )
Cell scraper (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 179707PK )
Vortex mixer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88880018 )
UV transilluminator
Refrigerated centrifuge (Eppendorf, model: 5430 R )
NanoDropTM One/OneC Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDrop OneTM , catalog number: ND-ONE-W)
PCR strip tube rotor, mini centrifuge C1201 [Denville Scientific, catalog number: C1201-S (1000806) ]
Eppendorf® Thermomixer® C (Eppendorf, model: Thermomixer® C , catalog number: 5382000015)
Veriti® 96-well thermal cycler (Thermo Fisher Scientific, Applied BiosystemsTM, model: VeritiTM 96-Well, catalog number: 4375786 )
OwlTM EasyCastTM B1 Mini Gel Electrophoresis Systems (Thermo Fisher Scientific, Thermo ScientificTM, model: OwlTM EasyCastTM B1 , catalog number: B1)
Gel imaging system (ProteinSimple, catalog number: FluorChem E system )
MPS 1000 mini plate spinner (Next Day Science, catalog number: C1000 )
QuantStudio 5 Real-Time PCR System, 384-well (Thermo Fisher Scientific, Applied BiosystemsTM, model: QuantStudioTM 5, catalog number: A28140 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Panda, A. C. and Gorospe, M. (2018). Detection and Analysis of Circular RNAs by RT-PCR. Bio-protocol 8(6): e2775. DOI: 10.21769/BioProtoc.2775.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Molecular biology technique
Molecular Biology > RNA > RNA detection
Molecular Biology > RNA > qRT-PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
cDNA linear or circular?
2 Answers
42 Views
Mar 18, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,776 | https://bio-protocol.org/exchange/protocoldetail?id=2776&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Mesenchymal Stem Cells Attachment to Endothelial Cells
SW Shan Wang
CM Chris D. Madsen
YW Yaojiong Wu
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2776 Views: 6868
Reviewed by: Chao Wang
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
Mesenchymal stem cells (MSCs) have shown profound therapeutic potential in tissue repair and regeneration. However, recent studies indicate that MSCs are largely entrapped in lungs after intravenous delivery and die shortly. The underlying mechanisms have been poorly understood. We have provided evidence to show that excess expression and activation of integrins in culture-expanded MSCs is a critical cause of MSCs adhesion to endothelial cells of the lung microarteries resulting in the entrapment of the cells (Wang et al., 2015). Therefore, it may be meaningful to test the adhesive ability of MSCs to endothelial cells in vitro before intravenous administration to avoid their lung vascular obstructions. Here we report a simple method to measure MSCs attachment to endothelial cells.
Keywords: Mesenchymal stem cells Endothelial cells Cell adhesion Integrins
Background
Mesenchymal stem cells (MSCs) are emerging as an extremely promising therapeutic agent, and numerous clinical trials for a variety of diseases are underway (Salem and Thiemermann, 2010). Intravenous infusion of MSCs has been a popular delivery route for MSCs therapies in recent clinical trials because of its convenience and safety (Wu and Zhao, 2012). However, increasing evidence has indicated that MSCs cause considerable vascular obstructions following intravascular injection. Upon intravenous infusion, more than 80% of MSCs are entrapped in the lungs, and only less than 1% of MSCs are detected in the acute ischemic heart or brain (Lee et al., 2009; Toma et al., 2009).
Recent studies suggest that MSCs are largely stuck in the precapillary microvessel after intravenous administration and most of them die shortly of local ischemia (Toma et al., 2009). Therefore, it has become an increasing concern over the safety and efficacy of intravascularly administered MSCs. The mechanisms of vascular obstructions of MSCs have not been fully understood.
Our data have indicated that excess expression of integrins in MSCs is an important cause for their lung entrapment, which leads to attachment of the cells to endothelial cells in the lungs, thus reducing their trafficking and homing to inflamed tissues. Functional blockade of integrins in MSCs, especially after integrin β1 blockade, significantly decreases their attachment to endothelial cells, resulting in a substantial reduction of MSCs entrapped in the lungs, elevated levels of circulating MSCs in the blood, and increased engraftment of the cells to inflamed tissues (Wang et al., 2015). Here we provide a methodology for measuring the attachment of MSCs to endothelial cells in vitro.
Materials and Reagents
24-well plates (Corning, Costar®, catalog number: 3524 )
12-well plates (Corning, catalog number: 3512 )
10 cm plates (Corning, catalog number: 353003 )
Pipette (Corning, catalog number: 4100 )
15- or 50-ml conical centrifuge tubes (Corning, catalog number: 430052 , 430828 )
Human bone marrow-derived MSCs (Lonza, catalog number: PT-2501 )
Human umbilical vein endothelial cells (HUVECs) (Lonza, catalog number: CC-2517 )
Human lung microvascular endothelial cells (HMVECs-L) (Lonza, catalog number: CC-2527 )
Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 41966052 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, Gibco TM, catalog number: 10270106 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
EGM-2 MV SingleQuot Kit Supplements & Growth Factors (Lonza, catalog number: CC-4147 )
EGMTM-2 MV BulletKitTM Medium (Lonza, catalog number: CC-3202 )
Endothelial basal medium-2 (EBM-2) (Lonza, catalog number: CC-3156 )
Fibronectin (Sigma-Aldrich, catalog number: F0556 )
Sterile phosphate buffer saline (PBS), pH 7.2 (Thermo Fisher Scientific, GibcoTM, catalog number: 20012068 )
Hank’s balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14025092 )
Vitronectin (Sigma-Aldrich, catalog number: V8379 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Lipophilic fluorophore 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) (Sigma-Aldrich, catalog number: 468495 )
Trypsin-EDTA (0.25%), phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Mouse anti-human integrin β1 antibody (Merck, catalog number: MAB1987 )
Mouse anti-human integrin β1 activated antibody (Merck, catalog number: MAB2079Z )
Anti-human integrin α5 (Merck, catalog number: MAB1956Z )
Anti-human CD51/CD61 (integrin αVβ3) purified (Thermo Fisher Scientific, eBioscienceTM, catalog number: 14-0519 )
Mouse isotype IgG (Sigma-Aldrich, catalog number: M6898 )
Tumor necrosis factor-α (TNF-α) (PeproTech, catalog number: 300-01A )
Medium 199 (Sigma-Aldrich, catalog number: M4530 )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: P6148 )
Ficoll-paque Plus solution (GE Healthcare, catalog number: 17-1440-02 )
Dead Cell Apoptosis Kit with Annexin V Alexa FluorTM 488 & Propidium Iodide (PI) (Thermo Fisher Scientific, InvitrogenTM, catalog number: V13241 )
Human leucocytes (see Recipes)
Equipment
Traceable Nano Timer (Fisher Scientific, catalog number: 14-649-83 )
Centrifuge (Eppendorf, catalog number: 5810 R )
Hemocytometer (Hirschmann Instruments, catalog number: 8100103 )
CO2 incubator (Panasonic, model: MCO-19AIC (UV))
Fluorescence microscope (Leica Microsystems, catalog number: Leica DMI6000 B )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, S., Madsen, C. D. and Wu, Y. (2018). Measurement of Mesenchymal Stem Cells Attachment to Endothelial Cells. Bio-protocol 8(6): e2776. DOI: 10.21769/BioProtoc.2776.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Mesenchymal stem cell
Cell Biology > Cell-based analysis > Cell adhesion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,777 | https://bio-protocol.org/exchange/protocoldetail?id=2777&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Spared Nerve Injury Model of Neuropathic Pain in Mice
Joseph Cichon
Linlin Sun
Guang Yang
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2777 Views: 16626
Reviewed by: Gary Liu
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
Experimental models of peripheral nerve injury have been developed to study mechanisms of neuropathic pain in living animals. The spared nerve injury (SNI) model in rodents is a partial denervation model, in which the common peroneal and tibial nerves are injured, producing consistent and reproducible tactile hypersensitivity in the skin territory of the spared, intact sural nerve. SNI-operated mice require less force applied to the affected limb to elicit a withdrawal behavior as compared to sham mice. This effect is observed as early as 2 days after surgery and lasts for at least 1 month. We describe detailed surgical procedures to establish the SNI mouse model that has been widely used for investigating mechanisms of neuropathic pain.
Keywords: Mouse pain model SNI surgery Peripheral nerve injury Neuropathic pain
Background
Partial nerve injury animal models have been developed for the purpose of studying the molecular, cellular, and circuit mechanisms of neuropathic pain (Bennett and Xie, 1988; Seltzer et al., 1990; Kim and Chung, 1992). A partial denervation model enables researchers to investigate structural and functional changes in diverse groups of neuronal and non-neuronal cells. Studies can be performed during the initiation, progression (also known as acute) and maintenance (chronic) phases of neuropathic pain, as well as at different anatomical sites along the pain pathway including distal vs. proximal peripheral nerve fibers, dorsal root ganglion, spinal cord, subcortical and cortical areas. The spared nerve injury (SNI) model involves partial nerve injury where the common peroneal and tibial nerves are injured, producing consistent and reproducible pain hypersensitivity in the territory of the spared sural nerve (Decosterd and Woolf, 2000; Shields et al., 2003). This model has proved to be robust, demonstrating substantial and prolonged changes in behavioral measures of mechanical sensitivity and thermal responsiveness (Bourquin et al., 2006). These features closely mimic the cardinal symptoms of clinically described neuropathic pain disorders.
Materials and Reagents
Cotton-wool applicator
Double edge razor blades (Baili, catalog number: BP005 )
Povidone-Iodine Prep Pad (Dynarex, catalog number: 1108 )
6-0 nylon suture (Surgical Specialties, Look, catalog number: 916B )
8-0 nylon suture (Fine Science Tools, catalog number: 12051-08 )
C57BL/6J male mice, 8-12 weeks of age (THE JACKSON LABORATORY, catalog number: 000664 )
Sterile Lubricant Eye Ointment (Stye)
Ketamine hydrochloride (Ketathesia, NDC 11695-0702-1)
Xylazine Sterile Solution (AnaSed, NDC 59399-110-20)
Sterile saline
Ketamine and xylazine (KX) mixture (see Recipes)
Equipment
Stereomicroscope (Olympus, model: SZX10 )
LED surgical light (Schott ACE light source with EKE lamp, Schott, model: A20500 )
Dissecting scissors and forceps (Fine Science Tools, catalog numbers: 14094-11 , 14084-09 , 15000-08 , 11150-10 )
Fine forceps (Fine Science Tools, catalog number: 11253-20 )
Vannas spring scissors (Fine Science Tools, catalog number: 15000-08 )
Electronic von Frey Anesthesiometer (IITC Life Science, catalog number: 2392 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cichon, J., Sun, L. and Yang, G. (2018). Spared Nerve Injury Model of Neuropathic Pain in Mice. Bio-protocol 8(6): e2777. DOI: 10.21769/BioProtoc.2777.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,778 | https://bio-protocol.org/exchange/protocoldetail?id=2778&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Reduced Representation Bisulfite Sequencing in Maize
FH Fei-Man Hsu
Chung-Ju Rachel Wang
Pao-Yang Chen
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2778 Views: 7315
Edited by: Renate Weizbauer
Reviewed by: Annis Elizabeth Richardson
Original Research Article:
The authors used this protocol in Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2013
Abstract
DNA methylation is an epigenetic modification that regulates plant development (Law and Jacobsen, 2010). Whole genome bisulfite sequencing (WGBS) is a state-of-the-art method for profiling genome-wide methylation patterns with single-base resolution (Cokus et al., 2008). However, for an organism with a large genome, e.g., the 2.1 Gb genome of maize, WGBS may be very expensive. Reduced representation bisulfite sequencing (RRBS) has been developed in mammalian studies (Smith et al., 2009). By digesting the genome with MspI with a size selection range of approximately 40-220 bp, CG-rich regions covering only ~1% of the human genome can be specifically sequenced. However, unlike mammalian genomes, plant genomes do not exhibit clear CpG islands. Therefore the original RRBS protocol is not suitable for plants. Accordingly, we developed an in silico pipeline to select specific enzymes to generate a region of interest (ROI)-enriched, e.g., promoter-enriched, reduced representation genome in plants (Hsu et al., 2017). By digesting the maize genome with MseI and selecting 40-300 bp segments, we sequenced about one-fourth of the maize genome while preserving 84.3% of the promoter information. The protocol has been successfully established in maize and can be broadly used in any genome. Our in silico pipeline is combined with the RRBS library preparation protocol, allowing for the computational analysis and experimental validation.
Keywords: Bisulfite sequencing DNA methylation Epigenetics Maize Methylome
Background
DNA methylation is a heritable epigenetic modification that plays an important role in many developmental processes of animals, plants and fungi by regulating gene expression and the chromatin structure (Law and Jacobsen, 2010). WGBS is a genome-wide scale method for profiling DNA methylation at single-base resolution, although high sequencing costs are required to achieve sufficient coverage (Cokus et al., 2008). In mammals, RRBS has been developed to specifically sequence CG-dense regions, e.g., CpG islands (Smith et al., 2009). In this protocol, we aimed to adapt RRBS for plants. To be specific, we developed an in silico pipeline (Figure 1) to performed enzyme selection by targeting specific genome regions to generate RRBS methylomes and provided an experimental validation protocol.
Our method has been successfully established in the maize genome, one of the major global crops, which has a 2.1 Gb genome (Hsu et al., 2017). In addition to its large size, 85% of the maize genome consists of various repetitive sequences (Schnable et al., 2009). This feature could cause multiple mapping, i.e., many short reads from sequencing, which need to be discarded. These characteristics make targeted bisulfite sequencing (BS-seq) more cost-effective. mCHH islands were found to be located upstream of transcription start sites (TSSs) with higher methylation level (Gent et al., 2013; Li et al., 2015). We therefore aimed to perform promoter-enriched RRBS in maize, and an in silico pipeline was developed for enzyme selection.
Our in silico pipeline currently has 85 pre-installed restriction enzymes. Users can easily append more enzymes. A genome FASTA file, refFlat annotation file, and repeat gff3 annotation file are the required input files to run this pipeline. ROIs, including promoters, exons, introns, splicing sites, repeats, UTRs and intergenic regions are pre-selected for enrichment analysis. As soon as the input files are prepared, users can run our pipeline to select ideal enzymes by typing simple commands. Users can also verify the prediction by performing RRBS library construction following the experimental protocol provided and performing sequencing.
Figure 1. Flowchart of maize RRBS in silico pipeline
Materials and Reagents
Pipette tips
Note: Low retention tips are recommended.
1.5 ml microcentrifuge tubes (Eppendorf, catalog number: 0030108051 )
PCR tubes (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: A30588 )
Clean razor blade
Qubit dsDNA BR Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32850 ) (used to quantify double strand DNA in combination with Qubit Fluorometer)
MseI (New England Biolabs, catalog number: R0525S ) (used to digest maize genomic DNA, CutSmart Buffer is included)
Note: The enzyme could be replaced according to the in silico enzyme selection result in Procedure A.
Agarose
Note: For the gel size selection, we recommend low melting point agarose.
TBE buffer (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15581044 )
AMPure XP (Beckman Coulter, catalog number: A63881 )
Absolute ethanol
Note: To dilute, use DNase/RNase-free distilled water.
1 M Tris-HCl (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15568025 )
Note: To dilute, use DNase/RNase-free distilled water.
NEBuffer 2 (New England Biolabs, catalog number: B7002S )
Klenow Fragment (3’→5’ exo-) (New England Biolabs, catalog number: M0212S ) (used to end-repair and A-tail DNA)
T4 DNA Ligase (New England Biolabs, catalog number: M0202S , T4 DNA ligation buffer is included) (used to ligate sequencing adaptors)
100-bp DNA ladder
QIAquick Gel Extraction Kit (QIAGEN, catalog numbers: 28704 , 28706 )
EpiTect Fast Bisulfite Conversion Kit (QIAGEN, catalog number: 59824 )
Note: Keep this kit at an appropriate temperature according to the manufacturer’s guide.
TruSeq DNA LT Sample Prep Kit (Illumina, catalog number: FC-121-2001 )
PfuTurbo DNA Polymerase (Agilent Technologies, catalog number: 600250 )
DNase/RNase-free distilled water (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977015 )
Deoxynucleotide (dNTP) Solution Set (New England Biolabs, catalog number: N0446S )
MinElute PCR Purification Kit (QIAGEN, catalog number: 28004 )
10 mM dNTP mix (see Recipes)
5x RRBS dNTP mix (see Recipes)
Equipment
Pipettes:
Thermo Fisher Scientific, Thermo ScientificTM, model: P5000, catalog number: 4641110N
Thermo Fisher Scientific, Thermo ScientificTM, model: P1000, catalog number: 4641100N
Thermo Fisher Scientific, Thermo ScientificTM, model: P300, catalog number: 4641090N
Thermo Fisher Scientific, Thermo ScientificTM, model: P200, catalog number: 4641080N
Thermo Fisher Scientific, Thermo ScientificTM, model: P100, catalog number: 4641070N
Thermo Fisher Scientific, Thermo ScientificTM, model: P20, catalog number: 4641060N
Thermo Fisher Scientific, Thermo ScientificTM, model: P10, catalog number: 4641030N
Thermo Fisher Scientific, Thermo ScientificTM, model: P2, catalog number: 4641010N
Qubit 2.0 Fluorometer (Thermo Fisher Scientific, Invitrogen, model: Qubit® 2.0 Fluorometer , catalog number: Q32866)
Heating block (Eppendorf, model: ThermoMixer comfort , catalog number: 5355000011)
Incubator (Only Science, Firstek, model: S300 )
Thermocycler
Thermo Fisher Scientific, Applied BiosystemsTM, model: GeneAmpTM PCR System 9700 , catalog number: 4413750
Bio-Rad Laboratories, model: T100TM Thermal Cycler, catalog number: 1861096
Centrifuge
Eppendorf, model: Centrifuge MiniSpin® plus , catalog number: 5453000011
Eppendorf, model: Centrifuge 5424 , catalog number: 5424000410
GYROZEN, model: 1730R
Magnetic stand
Thermo Fisher Scientific, DynaMagTM-2 Magnet, catalog number: 12321D
Thermo Fisher Scientific, Applied BiosystemsTM, DynaMagTM-PCR Magnet, catalog number: 492025
Software
System requirements: Linux/Unix or Mac OS, python 2.7+, R 3.2.0
Python and R scripts and a tutorial are available at: https://gitlab.com/fmhsu0114/maize_RRBS
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hsu, F., Wang, C. R. and Chen, P. (2018). Reduced Representation Bisulfite Sequencing in Maize. Bio-protocol 8(6): e2778. DOI: 10.21769/BioProtoc.2778.
Download Citation in RIS Format
Category
Systems Biology > Epigenomics > DNA methylation
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > DNA sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,779 | https://bio-protocol.org/exchange/protocoldetail?id=2779&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Design of Hybrid RNA Polymerase III Promoters for Efficient CRISPR-Cas9 Function
JM Joshua Misa
CS Cory Schwartz
IW Ian Wheeldon
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2779 Views: 8399
Edited by: David Cisneros
Reviewed by: Michael TschernerSadri Znaidi
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
The discovery of the CRISPR-Cas9 system from Streptococcus pyogenes has allowed the development of genome engineering tools in a variety of organisms. A frequent limitation in CRISPR-Cas9 function is adequate expression levels of sgRNA. This protocol provides a strategy to construct hybrid RNA polymerase III (Pol III) promoters that facilitate high expression of sgRNA and improved CRISPR-Cas9 function. We provide selection criteria of Pol III promoters, efficient promoter construction methods, and a sample screening technique to test the efficiency of the hybrid promoters. A hybrid promoter system developed for Yarrowia lipolytica will serve as a model.
Keywords: Synthetic biology CRISPR-Cas9 RNA polymerase III promoters Hybrid promoters sgRNA Yarrowia lipolytica
Background
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a collection of DNA sequences found in bacteria that contain snippets of viral DNA from previous exposures (Marraffini and Sontheimer, 2010). The snippets are referred to as spacer DNA, and they are flanked by short, repetitive palindromic sequences. Bacteria use these stored spacer sequences as a template to express RNA to recognize and attack specific viruses if they are exposed again. When combined with CRISPR-associated (Cas) proteins, CRISPR-Cas systems can recognize and cut foreign DNA or RNA, destroying the virus and protecting the host from repeated infections (Barrangou, 2013).
A specific CRISPR system, the type II CRISPR-Cas9 from Streptococcus pyogenes, has been modified into a simpler system for use in genomic editing. With this system, researchers are able to design specific single-guide RNA (sgRNA) sequences that are complementary to a 20 bp sequence of a gene of interest that has an upstream protospacer adjacent motif (PAM; ‘NGG’) (Jinek et al., 2012). When the designed sgRNA complexes with the Cas9 protein, the assembled ribonucleoprotein binds to and introduces a double strand break (DSB) in the target DNA sequence. In genome editing applications, this DSB is then repaired by a cell’s native repair mechanisms. In the absence of an introduced repair template, the nonhomologous end-joining DNA repair pathway is normally used to repair the break in most eukaryotes (Moore and Haber, 1996). Repair via nonhomologous end-joining frequently results in an indel mutation that causes a frameshift mutation and disrupts the gene’s function. The simple programmability of the sgRNA sequences allows for unprecedented precision in genomic edits. In addition, the portability of the CRISPR-Cas9 system has allowed precise genome editing and other applications in organisms where it was previously tedious or impossible (Mali et al., 2013; Wang et al., 2013; Lobs et al., 2017b; Schwartz et al., 2017b and 2017c). The efficiency of the CRISPR-Cas9 system has been shown to correlate with sgRNA expression (Hsu et al., 2013; Ryan et al., 2014; Yuen et al., 2017). Because of this, a range of strategies for sgRNA expression have been developed. RNA polymerase II promoters, which primarily serve to drive expression of mRNA, have been used because they are widely studied and offer a high degree of control over expression (Deaner et al., 2017). More commonly for CRISPR systems, RNA polymerase III (Pol III) promoters have been used to drive sgRNA expression. Pol III promoters natively drive expression of smaller RNAs, most notably tRNAs, and yield higher transcript levels (Schwartz et al., 2016). To increase functional sgRNA expression levels even higher, Pol III promoters concatenated with tRNAs have been used (Xie et al., 2015; Schwartz et al., 2016; Lobs et al., 2017a). Implementation of synthetic hybrid Pol III promoter systems can improve CRISPR-Cas9 mediated genome editing for efficient gene disruption.
Materials and Reagents
10 µl pipette tips (Fisher Scientific, FisherbrandTM, catalog number: 02-707-438 )
200 µl pipette tips (Fisher Scientific, FisherbrandTM, catalog number: 02-707-417 )
1,000 µl pipette tips (Fisher Scientific, FisherbrandTM, catalog number: 02-707-403 )
1.5 ml microcentrifuge tubes (Fisher Scientific, FisherbrandTM, catalog number: 05-408-129 )
0.2 ml PCR tubes (Fisher Scientific, FisherbrandTM, catalog number: 14-230-215 )
100 x 15 mm Petri dishes (Fisher Scientific, FisherbrandTM, catalog number: FB0875712 )
14 ml culture tubes (Corning, Falcon®, catalog number: 352057 )
Competent DH5α Escherichia coli (New England Biolabs, catalog number: C2987I )
Yarrowia lipolytica strain Po1f (ATCC, catalog number: MYA-2613 )
pCRISPRyl (Addgene, catalog number: 70007 ) or Episomal Cas9 plasmid (see Notes)
Q5 HF polymerase (New England Biolabs, catalog number: M0491L )
YeaStarTM Genomic DNA Kit (Zymo Research, catalog number: D2002 )
DNA Clean & ConcentratorTM (Zymo Research, catalog number: D4004 )
Gibson Assembly Master mix (New England Biolabs, catalog number: E2611L )
ZyppyTM Plasmid Miniprep Kit (Zymo Research, catalog number: D4037 )
CutSmart Buffer (New England Biolabs, catalog number: B7204S )
AvrII restriction enzyme (New England Biolabs, catalog number: R0174S )
Taq DNA polymerase (New England Biolabs, catalog number: M0273L )
Yeast extract (BD, DifcoTM, catalog number: 212750 )
Peptone (BD, DifcoTM, catalog number: 211677 )
Glucose (Fisher Scientific, FisherbrandTM, catalog number: D16-10 )
Agar (Sigma-Aldrich, catalog number: A7002-1KG )
Yeast nitrogen base without amino acids (BD, DifcoTM, catalog number: 291940 )
Complete Supplemental Mixture without Leucine (CSM-leu) (Sunrise Science, catalog number: 1005-010 )
Complete Supplemental Mixture (CSM) (SunriseScience, catalog number: 1001-010 )
Oleic acid (MP Biomedicals, catalog number: 0215178125 )
Tween 20 (Sigma-Aldrich, catalog number: P9416-50ML )
LB broth (Sigma-Aldrich, catalog number: L3022-1KG )
Ampicillin (Sigma-Aldrich, catalog number: A0166 )
YPD media/agar (see Recipes)
SD-leu media/agar (see Recipes)
SD oleic acid agar (see Recipes)
LB agar (see Recipes)
Equipment
Pipettes (Gilson, model: PIPETMANTM Variable Volume, catalog number: F167370 )
Benchtop microcentrifuge (Eppendorf, model: 5424 , catalog number: 022620401)
PCR thermocycler (Bio-Rad Laboratories, model: T100TM, catalog number: 1861096 )
Incubation shaker (Infors, model: Multitron Standard )
Incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: HerathermTM IGS60, catalog number: 51028063 )
Gel electrophoresis tank (Bio-Rad Laboratories, model: Wide Mini-Sub®, catalog number: 1704468 )
Gel electrophoresis power supply (Bio-Rad Laboratories, model: PowerPacTM Basic, catalog number: 1645050 )
Gel imager (Bio-Rad Laboratories, model: Gel DocTM XR+, catalog number: 1708195 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Misa, J., Schwartz, C. and Wheeldon, I. (2018). Design of Hybrid RNA Polymerase III Promoters for Efficient CRISPR-Cas9 Function. Bio-protocol 8(6): e2779. DOI: 10.21769/BioProtoc.2779.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA modification
Microbiology > Microbial genetics > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
278 | https://bio-protocol.org/exchange/protocoldetail?id=278&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of NADPH Oxidase Activity in Plants
AK Amita Kaundal
CR Clemencia M. Rojas
KM Kirankumar S. Mysore
Published: Vol 2, Iss 20, Oct 20, 2012
DOI: 10.21769/BioProtoc.278 Views: 20920
Original Research Article:
The authors used this protocol in Jan 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2012
Abstract
NADPH oxidase is a membrane-bound enzyme that generates (O2-) by transferring electrons from NADPH to molecular oxygen O2. O2-is spontaneously dismasted to the more stable form H2O2. Both O2-and H2O2 are forms ofreactive oxygen species (ROS), which are involved in regulation of many cellular activities such as transcription, intracellular signaling, and host defense. The NADPH oxidase - dependent generation of O2- in total membrane fraction of plant tissue has been determined by the reduction of the tetrazolium salt XTT by O2-. In the presence of O2-, XTT generates a soluble yellow formazan that can be quantified spectrophotometrically.
Materials and Reagents
Sucrose
HEPES
EDTA
DTT
L-cysteine
MgCl2
PVP
Complete, Mini, EDTA-free Protease Inhibitor Cocktail Tablets (F. Hoffmann-La Roche, catalog number: 04693159001 )
BSA
Bio-Rad Protein Assay (Bio-Rad Laboratories, catalog number: 500-0006 )
Tris-HCl
Sodium 3,3'-( -[(phenylamino)carbonyl] -3,4-tetrazolium)-bis (4-methoxy-6-nitro) benzene-sulfonic acid hydrate (XTT) (Sigma-Aldrich, catalog number: X4626 )
NADPH (Sigma-Aldrich, catalog number: N1630 )
Protein extraction working solution (see Recipes)
Equipment
Microtiter plate reader (Infinite M200 Pro, Tecan)
Microcentrifuge (AqquSpin Micro R) (Thermo Fisher Scientific)
Ultracentrifuge ( Optima TLX , Beckman)
Microtiter plate (BD Biosciences, catalog number: 353075 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kaundal, A., Rojas, C. M. and Mysore, K. S. (2012). Measurement of NADPH Oxidase Activity in Plants. Bio-protocol 2(20): e278. DOI: 10.21769/BioProtoc.278.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Activity
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,780 | https://bio-protocol.org/exchange/protocoldetail?id=2780&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Commensal Escherichia coli Strains from Feces of Healthy Laboratory Mice or Rats
Tingting Ju
Benjamin P. Willing
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2780 Views: 9403
Edited by: David Cisneros
Reviewed by: Wolf Dieter Röther
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
The colonization abundance of commensal E. coli in the gastrointestinal tract of healthy laboratory mice and rats ranges from 104 to 106 CFU/g feces. Although very well characterized, the family that E. coli belongs to has a very homogeneous 16S rRNA gene sequence, making the identification from 16S rRNA sequencing difficult. This protocol provides a procedure of isolating and identifying commensal E. coli strains from a healthy laboratory mouse or rat feces. The method can be applied to isolate commensal E. coli from other laboratory rodent strains.
Keywords: Commensal Escherichia coli Isolation Laboratory rodents
Background
Escherichia coli is a Gram-negative, facultative anaerobe which constitutes only a minor fraction of the vertebrate gut microbiota, but plays a key role in microbial interaction, immune modulation and metabolic functionalities (Tenaillon et al., 2010). Being one of the best-characterized model microorganisms, commensal E. coli strains have been increasingly studied to unravel the mechanisms through which gut commensal microbes adapt to the unique niche and impact host physiology. However, the high homology among different strains raises difficulties in identification and characterization of commensal E. coli based on a 16S rRNA sequencing approach. Thanks to the development of next-generation sequencing techniques and large-scale analyses of whole genomes, we are able to identify commensal E. coli strains isolated from the gastrointestinal tract of different hosts according to the presence of virulence genes in the genome. In this protocol, we show an approach to isolate and identify commensal E. coli strains from a laboratory mouse or rat using selective culture media and whole genome sequencing. However, it should be noted that the presence of commensal E. coli in laboratory animals depends on the vendor and environmental conditions of the facility.
Materials and Reagents
Gloves and masks (KCWW, Kimberly-Clark, catalog number: 52817 ; Cardinal Health, Insta-Gard, catalog number: AT7511-WE )
1.5 ml centrifuge tube (sterile) (Fisher Scientific, catalog number: 05-408-129 )
Wide bore tips, 0-200 μl (Corning, Axygen®, catalog number: T-1005-WB-C )
Thin-wall PCR tubes (Fisher Scientific, catalog number: 14-230-225 )
Tips, 0.1-10 μl, 0.1-1 ml (sterile) (Fisher Scientific, catalog numbers: 02-707-474 ; 02-707-480 )
Cell spreader (Fisher Scientific, catalog number: 08-100-11 )
Petri dishes (100 x 15 mm) (Fisher Scientific, catalog number: FB0875713 )
15 ml conical sterile polypropylene centrifuge tubes (Thermo Fisher Scientific, NuncTM, catalog number: 339650 )
Sterile 0.22 μm filter (Corning, catalog number: 431219 )
1 ml syringe (BD, catalog number: 309659 )
A healthy NIH Swiss mouse (Harlan Laboratories Inc., Indianapolis, IN) and Sprague-Dawley (SD) rat (Charles River Canada, St. Constant, QC)
70% ethanol diluted from 100% ethanol (Commercial Alcohols, catalog number: P016EAAN )
Agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500500 )
Tris-Acetate-EDTA (TAE) (50x stock) (Fisher Scientific, catalog number: BP13321 )
SYBR Safe DNA gel stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: S33102 )
6x DNA loading dye (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0611 )
1 kb Plus DNA ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SM1331 )
GeneJET gel extraction and DNA cleanup micro kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: K0832 )
PureLink genomic DNA mini kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: K182001 )
Nextera XT DNA library preparation kit (Illumina, catalog number: FC-131-1096 )
Nextera XT DNA library preparation index kit (Illumina, catalog number: FC-131-1002 )
Nextera XT DNA library preparation kit (Illumina, catalog number: FC-131-1096 )
Nextera XT DNA library preparation index kit (Illumina, catalog number: FC-131-1002 )
QubitTM 1x dsDNA HS assay kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q33230 )
PhiX control kit (Illumina, catalog number: FC-110-3001 )
MiSeq reagent kit V3 (Illumina, catalog number: MS-102-3003 )
Sodium phosphate dibasic (Na2HPO4) (Fisher Scientific, catalog number: S373-500 )
Potassium phosphate monobasic (KH2PO4) (Fisher Scientific, catalog number: P285-500 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-500 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: P217-500 )
Hydrochloric acid (HCl) (Fisher Scientific, catalog number: A144-500LB )
MacConkey agar (BD, catalog number: 212123 )
Luria-Bertani (LB) broth (Sigma-Aldrich, catalog number: L3022 )
Glycerol (Fisher Scientific, catalog number: BP229-1 )
DNA Taq polymerase with 50 mM MgCl2 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10342020 )
Oligo primers 27F/1492R (Weisburg et al., 1991)
27F: 5’-AGAGTTTGATCMTGGCTCAG-3’
1492R: 5’-TACGGYTACCTTGTTACGACTT-3’
Deoxynucleotide triphosphates (dNTPs) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10297-018 )
PCR grade water (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9932 )
Sodium hydroxide (NaOH) (Fisher Scientific, catalog number: SS266-1 )
1x phosphate buffered saline (PBS) (pH 7.4) (see Recipes)
MacConkey agar (see Recipes)
LB broth (see Recipes)
Glycerol stock of bacterial isolates (see Recipes)
PCR reaction mix (see Recipes)
0.1 N NaOH (see Recipes)
Equipment
Forceps (sterilized by autoclave)
Vortex (Fisher Scientific, catalog number: 02215365 )
Pipettes [e.g., P1000 (Eppendorf, catalog number: 3120000062 ), P200 (Eppendorf, catalog number: 3120000054 ), P10 (Eppendorf, catalog number: 3120000020 )]
Thermal cycler (Thermo Fisher Scientific, Applied Biosystems, model: GeneAMP PCR System 9700 )
Microwave (RCA, catalog number: RMW733 )
Gel electrophoresis system (Fisher Scientific, model: FB300 )
UV transilluminator with photo documentation (Azure Biosystems, model: Azure c200 )
Incubator (37 °C) (Thermo Fisher Scientific, Thermo Scientific, model: Model 370 )
Shaking incubator (37 °C) (Eppendorf, New BrunswickTM, model: I26 )
QubitTM 3.0 fluorometer (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q33216 )
QubitTM assay tubes (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32856 )
Illumina MiSeq instrument (Illumina, model: MiSeqTM System, catalog number: SY-410-1003 )
Autoclave (Beta Star Life Science Equipment, model: C2002BS )
-80 °C freezer (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM 900 Series , 989)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ju, T. and Willing, B. P. (2018). Isolation of Commensal Escherichia coli Strains from Feces of Healthy Laboratory Mice or Rats. Bio-protocol 8(6): e2780. DOI: 10.21769/BioProtoc.2780.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Microbiology > Microbial cell biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,781 | https://bio-protocol.org/exchange/protocoldetail?id=2781&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantifying Symmetrically Methylated H4R3 on the Kaposi’s Sarcoma-associated Herpesvirus (KSHV) Genome by ChIP-Seq
RS Roxanne C. Strahan
KH Kayla S. Hiura
Subhash C. Verma
Published: Vol 8, Iss 6, Mar 20, 2018
DOI: 10.21769/BioProtoc.2781 Views: 6775
Edited by: Alka Mehra
Reviewed by: Stefan de VriesPrashanth N Suravajhala
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
Post-translational modifications to histone tails contribute to the three-dimensional structure of chromatin and play an important role in determining the relative expression of nearby genes. One such modification is symmetric di-methylation of arginine residues, which may exhibit different effects on gene expression including blocking the binding of transcriptional activators, or recruiting repressive effector molecules. Recent ChIP-Seq studies have demonstrated the importance of cross-talk between different histone modifications in gene regulation. Thus, to acquire a comprehensive understanding of the combined efforts of these epigenetic marks, ChIP-Seq must be utilized for identifying specific enrichment on the chromatin. Tumorigenic herpesvirus KSHV, employs epigenetic mechanisms for gene regulation, and by evaluating relative abundance of multiple histone modifications in a thorough, unbiased way, using ChIP-Seq, we can get a superior insight concerning the complex mechanisms of viral replication and pathogenesis.
Keywords: KSHV Viral chromatin ChIP-Seq Arginine methylation
Background
Kaposi’s sarcoma-associated herpesvirus (KSHV) is an oncogenic human virus with two distinct phases during its lifecycle. After initial infection, KSHV establishes a persistent life-long infection in the host that is particularly problematic to the immune-compromised individuals. KSHV can cause various tumors in HIV/AIDS patients including Kaposi’s sarcoma, and multiple B-cell lymphomas (Chang et al., 1994; Cesarman et al., 1995; Russo et al., 1996; Soulier et al., 1995). With a large genome of about 165,000 bp, which encodes nearly 90 different open reading frames, KSHV has ample tools to evade the host immune surveillance system, alter host-cell growth pathways and produce infectious progeny virions.
During the latent phase only a fraction of the viral genes is expressed, which are oncogenic in nature and also help in replication and passaging of the viral episomes into the divided tumor cells (Uppal et al., 2014; Purushothaman et al., 2016). However, many factors including viral co-infection (HIV) and other stimulus such as, hypoxia, oxidative stress, or immune-suppressant medications can trigger the virus to shift into the active, lytic phase of the lifecycle leading to the production of infectious progeny virions, which egress from host cells surface to infect surrounding tissues (Purushothaman et al., 2015). These complex processes are carried out in a coordinated fashion with specific genes expressed in a sequential manner during the switch to a lytic (virus-producing) phase of the viral life cycle (Purushothaman et al., 2015; Aneja and Yuan, 2017).
KSHV employs epigenetic mechanisms to carefully regulate differential gene expression needed to maintain the virus in a specific phase of the lifecycle. Upon infection and entry into the human cells, viral genome acquires cellular histones, similar to the host genomes, and persists in euchromatin (transcription-permissive) or heterochromatin (transcription-repressive) states (Toth et al., 2013; Uppal et al., 2015). By these means, KSHV is able to restrict gene expression during latency to only a minimal subset of genes and is yet poised to rapidly shift into lytic replication phase. The development of KSHV-induced malignancies involves both phases of the lifecycle, thus it is essential for researchers to have a clear understanding of the mechanisms of how these epigenetic changes regulate viral genes expression.
Epigenetic regulation of gene expression relies on conformational changes to chromatin that alter the availability of certain proteins for transcription (Bernstein et al., 2007). One of the best-studied ways organisms induce conformational changes to the chromatin is through histone-tail modifications. Histone residues may be ‘modified’ by the addition of different molecules to specific residues on the histone proteins (Bannister and Kouzarides, 2011). While several modifications have been identified, two of the most-commonly studied types are lysine residue acetylation or lysine residue methylation and they can dictate the transcriptional state of the genes occupied by those modified histones (Zhang et al., 2015). For example, lysine acetylation is generally considered an ‘activating’ mark that upregulates gene expression. Another activating mark is histone 3, lysine 4 trimethylation (H3K4me3), yet another modification on histone H3 at lysine 27 in the same fashion (H3K27me3) is a ‘repressive’ mark, leads to transcriptional silencing (Bannister and Kouzarides, 2011).
Histone lysine acetylation (H3ac), H3K4me3, and H3K27me3 levels have been assessed on the KSHV genome but the landscape of other histone modifications during lytic reactivation had not yet been ascertained (Gunther and Grundhoff, 2010; Toth et al., 2010 and 2013). So, when proteomic interaction studies conducted in our lab suggested that a lytic viral protein, ORF59, could be involved in chromatin remodeling, particularly in regards to arginine methylation, we set out to study the histone arginine methylation. Our recent study, ‘KSHV encoded ORF59 modulates histone arginine methylation of the viral genome to promote viral reactivation’ examined the enrichment of a specific histone modification H4R3me2s (histone 4 arginine 3 symmetric di-methylation) across the viral genome (Strahan et al., 2017). H4R3me involves first the mono-methylation of the arginine followed by the addition of another methyl group in either a symmetric, or asymmetric fashion (H4R3me2s or H4R3me2a, respectively) (Di Lorenzo and Bedford, 2011). Arginine methylation is important for various several cellular processes including RNA processing, DNA repair, transcription, signal transduction, and chromatin remodeling (Pahlich et al., 2006). While the addition of methyl groups on arginine residues increases hydrophobicity that blocks hydrogen bonding but the overall charge is not altered so the binding between nucleic acids or other proteins remains undisturbed (Pahlich et al., 2006). Various protein arginine methyltransferases (PRMTs) are expressed in multiple subcellular locales to modify the protein arginine residues of nuclear as well as cytoplasmic proteins (Bedford and Clarke, 2009).
Interestingly, the conformational difference between asymmetrically modified H4R3me2 and symmetrically H4R3me2 affects transcriptional activation/repression very distinctly. Symmetrically modified H4R3me2 favors the repression of gene expression and transcriptional silencing, while in contrast asymmetrically modified H4R3me2 favors upregulation of gene transcription (Di Lorenzo and Bedford, 2011).
In order to specifically capture the symmetrically modified, H4R3me2s chromatin, it was first absolutely essential to verify that the antibody used for ChIP-Seq purposes would not cross-react with H4R3me2a. Anti-H4R3me2s antibody was obtained and the specificity to the symmetrically modified H4R3me2 was tested before using for immunoprecipitating chromatin from KSHV infected cells. Following the confirmation of its specificity, we proceeded to perform ChIP-Seq from latent and lytically reactivating KSHV positive TRExBCBL1-RTA cells. The advantage of using TRExBCBL1-RTA cells (KSHV infected cell line) was to induce the expression of Replication and Transcription Activator (RTA) by tetracycline/doxycycline, which is both necessary and sufficient to trigger lytic reactivation (Nakamura et al., 2003). The ChIP assay was performed similarly to previously done ChIP-Seq assays that include the following basic steps: harvest the cells and cross-link with formaldehyde, isolate and shear chromatin, immunoprecipitate DNA-protein complexes of interest, purify the DNA, and prepare sequencing libraries from the immunoprecipitated and respective inputs DNA (Figure 1). To obtain a more thorough understanding of the chromatin remodeling role of viral protein ORF59, we needed to test the relative enrichment of several different factors at the KSHV genome including H4R3me2s, ORF59, PRMT5, COPR5. Each of these ChIPs were done in triplicate and samples were combined for library preparation. ChIP-Seq experiments traditionally use approximately 20 million cells per sample; however, to quantify H4R3me2s (and enrichment of other factors as well) on the KSHV genome, we chose to use a modified Low-Cell ChIP protocol with 5 million cells per sample instead (Park, 2009). To accomplish this, the chromatin-shearing step of the ChIP assay was optimized using the Diagenode Bioruptor® Pico to improve the efficiency of the DNA immunoprecipitation.
Figure 1. Flow-chart depiction of H4R3me2s ChIP. Cells from latent and lytic KSHV-positive cells were cross-linked to preserve DNA-protein interactions and the DNA was sheared into small fragments. DNA fragments were then immunoprecipitated, purified, and subjected to next-generation sequencing.
Another unique challenge faced in assessing chromatin structure of viral genomes is that H4R3me2s ChIP assay isolates both viral and cellular host DNA bound to H4R3me2s; and furthermore, upon lytic reactivation viral genomes are multiplied resulting in drastically different levels of viral DNA between two samples with an approximately identical number of cells (Figure 2). For this reason, we assessed H4R3me2s levels at a very early time point during lytic reactivation (12 h), before viral genome copies have had a chance to accumulate and possibly bias the downstream ChIP-Seq. As a result of these careful adjustments, we were able to successfully quantify relative enrichment of a repressive chromatin mark on the viral genome during two different phases of the lifecycle and demonstrate a novel chromatin-remodeling role for the early viral protein, ORF59.
Figure 2. Schematic depiction of H4R3me2s role in KSHV lytic reactivation. H4R3me2s is an abundant hallmark of transcriptionally silent, heterochromatin and must be removed to favor active gene transcription.
Materials and Reagents
Materials
Pipette tips
1.5 ml Bioruptor® Pico Microtubes with Caps (Diagenode, catalog number: C30010016 )
Illumina NextSeq 500 Mid Output KT v2 (150 cycles) (Illumina, catalog number: FC-404-2001 )
Note: Researchers should select the most appropriate flow cell for their experimental specifications. To sequence arginine methylation on the KSHV genome, this specific flow cell was sufficient.
Chemicals/stock solutions
Protease inhibitors (leupeptin, aprotinin, sodium fluoride, pepstatin, and phenylmethylsulfonyl fluoride) (Sigma-Aldrich, catalog number: S8830 )
Pierce 16% formaldehyde (w/v), Methanol-Free (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 28906 )
1 M glycine
Bioruptor® Pico sonication beads (Diagenode, catalog number: C01020031 )
RNase A, 20 mg/ml
1.5% agarose gel
Specific ChIP grade antibodies
Note: To quantify H4R3me2s on the KSHV genome, following ChIP grade antibodies were used, rabbit anti-H4R3me2s (Active Motif, catalog number: 61187 ), rabbit anti-Histone H4 (Active Motif, catalog number: 61299 ), rabbit anti-control IgG (ChIP grade—Cell Signaling Technology, catalog number: 2729 ).
1x TE
5 M NaCl
7.5 M ammonium acetate
100% ethanol
GlycoBlue Coprecipitant (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9516 )
Proteinase K
QIAGEN MinElute PCR purification Kit (QIAGEN, catalog number: 28004 )
Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32851 )
NEXTflexTM ChIP Seq Kit (Illumina compatible) (Bioo Scientific, catalog number: NOVA-5143-02 )
NEXTflexTM ChIP Seq Barcodes - 12 (Illumina compatible) (Bioo Scientific, catalog number: NOVA-514120 )
KAPA Library Quantification Complete Kit (Universal), kit code KK4824 (Kapa Biosystems, catalog number: 07960140001 )
Agilent Bioanalyzer High Sensitivity DNA chip Kit (Agilent Technologies, catalog number: 5067-4626 )
0.5 M PIPES, pH 8.0
1.7 M KCl
10% Nonidet-P40 (NP-40)
0.5 M EDTA, pH 8.0
1 M Tris-HCl pH 8.1
Magnetic Protein A, and G beads
Protein A Mag Sepharose (GE Healthcare, catalog number: 28944006 )
Protein G Mag Sepharose (GE Healthcare, catalog number: 28944008 )
Salmon sperm DNA, sheared 10 mg/ml (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9680 )
10% Triton X-100
10% SDS
1 M NaHCO3
Buffers
1x PBS (137 mM NaCl, 10 mM phosphate, 2.7 mM KCl, and a pH of 7.4)
Buffer D Chromatin Shearing Buffer (Diagenode, catalog number: C01020030 )
Cell lysis buffer (see Recipes)
ChIP dilution buffer (see Recipes)
ChIP Magnetic A+G beads (see Recipes)
ChIP Low Salt Wash (see Recipes)
ChIP elution buffer (see Recipes)
Equipment
Pipettes
Tabletop Eppendorf centrifuge, refrigerated and non-refrigerated
Bioruptor® Pico Sonication device (Diagenode, catalog number: B01060001 )
Magnetic stand
Water bath
Tube rotators
Thermocycler
Qubit Fluorometer (Thermo Fisher Scientific)
Agilent 2100 Bioanalyzer (Agilent Technologies, model: Agilent 2100 , catalog number: G2939BA)
Quantitative PCR machine
Vortexer
Illumina NextSeq 500 (Illumina, model: NextSeq 500 )
Note: The Illumina NextSeq machine used for these studies is the property of the Nevada Genomics Center, who performed all sequencing runs for this study.
Software
CLC workbench 10.0.1 (Licensed from QIAGEN, Germantown, MD)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Strahan, R. C., Hiura, K. S. and Verma, S. C. (2018). Quantifying Symmetrically Methylated H4R3 on the Kaposi’s Sarcoma-associated Herpesvirus (KSHV) Genome by ChIP-Seq. Bio-protocol 8(6): e2781. DOI: 10.21769/BioProtoc.2781.
Download Citation in RIS Format
Category
Systems Biology > Epigenomics > Sequencing
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,782 | https://bio-protocol.org/exchange/protocoldetail?id=2782&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Small-scale DNA Extraction Method for Maize and Other Plants
China Lunde
Published: Mar 20, 2018
DOI: 10.21769/BioProtoc.2782 Views: 7269
Reviewed by: Joëlle Schlapfer
Download PDF
Ask a question
Favorite
Cited by
Abstract
Corn, or maize, is a major cereal crop and model monocot. Two of its benefits are ease of pollination and tractable genetics. For a comparison of development between maize and the dicot model, Arabidopsis, see Lunde and Hake, 2005. For an example of how this protocol might be used for a double mutant analysis see Lunde and Hake, 2009. Here, we provide a protocol for easy DNA extraction without phenol or chloroform. Therefore, this protocol is suitable for use in schools or laboratories that lack fume hoods.
Keywords: DNA extraction Corn Maize Classroom Plant Biology
Materials and Reagents
3.2 mm chrome beads (Bio Spec Products, catalog number: 11079132c )
Microfuge 1.5 ml tubes (such as USA Scientific, catalog number: 1615-5500 )
Pipette tip
Ice
Tris-HCl (CAS 1185-53-1)
EDTA (CAS 6381-92-6)
Sodium chloride (NaCl) (CAS 7647-14-5)
Potassium acetate (KAC) (CAS 127-08-2)
SDS (CAS 151-21-3)
ddH2O
Isopropanol
70% ethanol
RNase (such as Sigma-Aldrich, catalog number: R6513 )
Extraction buffer (see Recipes)
5 M potassium acetate (KAC) (see Recipes)
TE with 1% RNase (see Recipes)
Equipment
Ball Mill (such as Retsch, model: Mixer Mill MM 301 )
QIAGEN adapter (QIAGEN, catalog number: 69982 )
Microcentrifuge (such as Eppendorf, model: 5417 C )
Pipette (such as Eppendorf, model: Research® plus , series in 100-1,000 μl volume)
Vortex (such as Scientific Industries, model: Vortex-Genie 2 )
Water bath (such as Fisher Scientific, model: Isotemp 2025 )
pH meter (such as Thermo Fisher Scientific, Thermo ScientificTM, model: Orion StarTM A111 )
Standard refrigerator (Such as Fisher Isotemp series)
Spectrophotometer (such as Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 1000 , catalog number: ND-1000)
Optional equipment
Hand drill (such as DeWalt, model: D21009 )
Blue plastic pestle (such as DWK Life Sciences, KIMBLE, catalog number: 749521-1500 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > DNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,783 | https://bio-protocol.org/exchange/protocoldetail?id=2783&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Microfluidic Device for Massively Parallel, Whole-lifespan Imaging of Single Fission Yeast Cells
SJ Stephen K Jones Jr
ES Eric C Spivey
JR James R Rybarski
IF Ilya J Finkelstein
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2783 Views: 7889
Edited by: Yannick Debing
Reviewed by: Heather Cartwright
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Whole-lifespan single-cell analysis has greatly increased our understanding of fundamental cellular processes such as cellular aging. To observe individual cells across their entire lifespan, all progeny must be removed from the growth medium, typically via manual microdissection. However, manual microdissection is laborious, low-throughput, and incompatible with fluorescence microscopy. Here, we describe assembly and operation of the multiplexed-Fission Yeast Lifespan Microdissector (multFYLM), a high-throughput microfluidic device for rapidly acquiring single-cell whole-lifespan imaging. multFYLM captures approximately one thousand rod-shaped fission yeast cells from up to six different genetic backgrounds or treatment regimens. The immobilized cells are fluorescently imaged for over a week, while the progeny cells are removed from the device. The resulting datasets yield high-resolution multi-channel images that record each cell’s replicative lifespan. We anticipate that the multFYLM will be broadly applicable for single-cell whole-lifespan studies in the fission yeast (Schizosaccharomyces pombe) and other symmetrically-dividing unicellular organisms.
Keywords: Cellular aging Lifespan Microdissection Microfluidics Lithography Fabrication
Background
Cellular aging results in the cumulative decline of cellular function that eventually leads to mortality. Most studies of cellular aging focus on the replicative lifespan of model unicellular organisms, such as budding yeast Saccharomyces cerevisiae (Nyström and Liu, 2014; Wasko and Kaeberlein, 2014; Wierman and Smith, 2014; Ruetenik and Barrientos, 2015). The replicative lifespan (RLS) of a cell is defined as the number of daughters produced by a mother cell over the course of its life (Henderson and Gottschling, 2008; Sutphin et al., 2014). RLS studies have greatly expanded our understanding of cellular aging in mitotically active cells. For example, in budding yeast, old mothers preferentially retain misfolded proteins and other cellular senescence factors from the budding daughter cells (Aguilaniu et al., 2003; Hughes and Gottschling, 2012; Liu et al., 2010; Saka et al., 2013; Zhou et al., 2014; Paoletti et al., 2016). This feat is achieved by restricting the flow of these ‘senescence factors’ across the bud septum, preventing their accumulation in the rejuvenated daughters (Shcheprova et al., 2008; Higuchi-Sanabria et al., 2014). Whether senescence factors are also segregated in symmetrically dividing cells is unclear (Wang et al., 2010; Coelho et al., 2013; Nakaoka and Wakamoto, 2017). Indeed, relatively little is known about the mechanisms and causes of aging in symmetrically dividing cells.
Whole-lifespan cellular aging studies require the separation of aging cells from their progeny. Pioneering, early studies in budding yeast removed daughter cells from their mothers via manual microdissection (Mortimer and Johnston, 1959). Since the first such study in 1959, manual microdissection still remains a popular, albeit laborious method for studying replicative aging in most unicellular organisms (Mortimer and Johnston, 1959; Kennedy et al., 1994; Barker and Walmsley, 1999; Fu et al., 2008). However, the low-throughput and laborious nature of this assay limits our current understanding of replicative aging. Most recently, removal of progeny cells has been automated in microfluidic devices that capture and retain individual aging cells (Wang et al., 2010; Lee et al., 2012; Xie et al., 2012; Zhang et al., 2012; Tian et al., 2013; Crane et al., 2014; Nobs and Maerkl, 2014; Jo et al., 2015; Liu et al., 2015; Nakaoka and Wakamoto, 2017; Spivey et al., 2017). Using such devices, relatively large cohorts of individual cells (100 s to 1,000 s of cells) can then be tracked independently from one another. However, most of these approaches focused on prokaryotic cells or the asymmetrically dividing budding yeast (Spivey and Finkelstein, 2014; Chen et al., 2017).
Here, we describe the fabrication and assembly of a microfluidic device for capturing and imaging thousands of fission yeast cells over their entire replicative lifespans. The multiplexed fission yeast lifespan microdissector (multFYLM) enables the experimentalist to track the lifespan of over a thousand fission yeast cells (Spivey et al., 2017). The cells may be continuously imaged for up to six independent populations for over a week, yielding high-resolution imaging over each cell’s replicative lifespan. The multFYLM is constructed of silicone elastomer using templates manufactured via UV photo-lithography. The protocol contained herein details construction of the multFYLM, loading with fission yeast cells, and image collection using a fluorescent microscope. We anticipate that this protocol will be broadly useful for long-term imaging of rod-shaped eukaryotic cells and will shed light on diverse biological processes, including cell cycle regulation, chromatin dynamics, proteome homeostasis, and cellular aging.
Materials and Reagents
Microfabrication
SU-8 2005 photoresist (Microchem)
SU-8 2010 photoresist (Microchem)
P-doped silicon wafers (University Wafers, catalog number: 452 ; 100 mm-diameter; test-grade)
Custom quartz photomasks (Compugraphics)
Photomask design files available at:
https://github.com/finkelsteinlab/FYLM_mask_files/raw/master/l1-151030.gds
https://github.com/finkelsteinlab/FYLM_mask_files/raw/master/l2-151030.gds
SU-8 developer (Microchem)
Acetone (Pharmco-Aaper, Midland Scientific, catalog number: 329000000CSGF )
Isopropanol (Fisher Chemical, catalog number: BP26184 )
Cyclopentanone (Sigma-Aldrich, catalog number: W391018-1KG-K )
multFYLM assembly
50 ml conical tubes (Genesee Scientific, Olympus Plastics, catalog number: 21-108 )
Large Petri dish (150 mm; Fisher Scientific, catalog number: FB0875714 )
200 µl pipette tips (Genesee Scientific, catalog number: 23-150RL )
Biopsy punch (P125; 1 mm Acu-punch; Acuderm)
Glass coverslips (48 x 65 mm #1; Gold Seal, Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3335 )
Aluminum foil (Fisher Scientific, catalog number: 01-213-102 )
Razor blades (duridium style, single edge; Gem/Star)
Lab tape (Fisher Scientific, catalog number: 15-901-10R )
Nanoports (IDEX Health & Science, catalog number: N-333 ; 12 x; 10-32 thread; headless knurled head)
Polydimethylsiloxane (PDMS; Dow Corning, Sylgard 184, Fisher Scientific, catalog number: 50-366-794)
Manufacturer: Electron Microscopy Sciences, catalog number: 2423610 .
Hellmanex III (Hellma Analytics)
Ethanol (Pharmco-Aaper, catalog number: 111000200CSPP )
Microscope and microfluidics setup
PFA Tubing (IDEX Health & Science, catalog number: 1512L ; 1/16” OD)
Coned nut and ferrule (IDEX Health & Science, catalog number: F-333N ; 12 x; 10-32 thread; headless knurled head)
Inline filter (IDEX Health & Science, catalog number: P-272 ; 6 x)
Luer adapter (IDEX Health & Science, catalog number: P-658 ; 6 x; ¼-28 thread; Luer-Lok thread)
Flangeless nut (IDEX Health & Science, catalog number: P-215 ; 6 x; ¼-28 thread)
Union (IDEX Health & Science, catalog number: P-704-01 ; 6 x; 10-32 thread)
Cell loading and image acquisition
Test tubes (14 ml; Corning, catalog number: 352051 )
Large gauge syringe needles (16 G 1.5”; BD, catalog number: 305198 )
Large syringes (100 ml; Veterinary Concepts, catalog number: 60271 )
10 ml syringes (Luer-Lok tip; BD, catalog number: 309604 )
Steriflip vacuum filtration tubes (50 ml; 20 μM nylon net; Millipore Sigma, catalog number: SCNY00020 )
Petri dishes (100 mm; Fisher Scientific, catalog number: FB0875713 )
Stericup-GP filter sterilizing module (500 ml; 0.22 µm PES; Millipore Sigma, catalog number: SCGPU05RE )
Yeast strains
Bovine serum albumin (Sigma-Aldrich, catalog number: A2153 )
Agar powder (Sigma-Aldrich, catalog number: A1296 )
YES 225 powder (250 g; Sunrise Science, catalog number: 2011-250 )
YES 225 agar media (Recipe 1)
YES 225 liquid media (Recipe 2)
Equipment
Microfabrication
1 L flask (No. 1000; Corning, Pyrex®, catalog number: 1000-1L )
Suss MA-6 Mask Aligner (Suss MicroTec Lithography GmbH)
Spin Coater (Laurell Technologies)
Hot plate (Cimarec+; Thermo Fisher Scientific, Thermo Scientific, catalog number: HP88857100 )
Anisotropic RIE Plasma Etcher (Nordson March, catalog number: CS170IF )
Hot-Hand Protector Mitt (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F38000-0001 )
multFYLM assembly
Mini labroller (Labnet)
Plasma Cleaner (Harrick Plasma, catalog number: PDC-32G )
Laboratory oven (Ecotherm, Precision)
Dissection microscope (AmScope, catalog number: SM-1T-PL )
Fine tweezers (Fisher Scientific, catalog number: 16-100-103 )
Sonicator (Bransonic, catalog number: 2510R-DTH )
Rocker/agitator (Belly Dancer; Stovall Life Science)
Bunsen burner (accuFlame; Fisher Scientific, catalog number: 03-902Q )
Centrifuge (Beckman Coulter, model: Avanti® J-26XP )
Centrifuge rotor (Beckman Coulter, model: JLA-16.250 )
Microscope and microfluidics setup
Epifluorescence imaging microscope (Eclipse Ti; Nikon)
Focus maintenance system (Nikon Perfect Focus, Nikon)
CMOS camera (Andor, model: Zyla 5.5 sCMOS )
10x, 0.3 NA objective (Plan Fluor; Nikon)
60x, 0.95 NA objective (Plan Apo Lambda; Nikon)
Computer-controlled microscope stage (Proscan III motorized stage; Prior)
Objective heater (Bioptechs, catalog number: 150819-19 )
Appropriate filters for fluorescent imaging
eGFP (Chroma, catalog number: 49002 )
mKO (Chroma, catalog number: 49010 )
E2Crimson (Chroma, catalog number: 49015 )
Light source shutter (SmartShutter; Sutter Instrument)
Shutter controller (Lambda SC; Sutter Instrument)
Computer-controlled syringe pump (KD Scientific, model: LEGATO® 210 )
Note: This pump is configured for two syringes. If more than two syringes are required, either multiple pumps can be used, or adapters can be fabricated (Figure 4) to allow additional syringes to be driven.
Light source (Newport, model: SOLA-SE-II ; Lumencorp)
Cell loading and image acquisition
Shaking incubator (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4333 )
Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000c )
Autoclave (Consolidated Sterilizer Systems, model: ADV-PLUS )
Vacuum desiccator (5.8 L Pyrex glass; Corning, PYREX®, catalog number: 3121-200 )
Vacuum pump (Welch Vacuum, catalog number: 2546 , B-01)
Mini vortexer (Fisher Scientific, catalog number: 02-215-365 )
Note: This product has been discontinued.
Bunsen burner (accuFlame; Fisher Scientific, catalog number: 03-902Q )
Environmental chamber/multFYLM microscope stage
Chamber design file available at:
https://github.com/finkelsteinlab/FYLM_mask_files/blob/master/FYLMChamber.scad
Software
NIS-Elements Advanced Research (v4.30.02; Nikon Instruments)
Procedure
Microfabrication
multFYLM microfabrication follows conventional soft lithography methods. The first step is to generate a patterned mold, which can be used to cast devices in elastomeric silicone (PDMS). Such molds, or ‘master’ structures are created on silicon wafers, using UV lithography to deposit patterns on the surface in an epoxy resin (SU-8). The patterns are dictated by masks, which restrict the ability of a UV light source to cross-link the resin. Their alignment is critical to the proper patterning on the wafer, as features of the final master are contained on each of the two masks. A developer is used to remove unexposed resin, leaving a master that is now ready for use (Figure 1). A master can be used repeatedly for at least two years to make hundreds of multFYLM devices.
Note: The procedures detailed below should be performed in a cleanroom. All instrument settings are unique to the equipment used and included as a guideline. These settings will need to be adjusted to match the instruments available in a user’s cleanroom. All microfabrication steps should be completed in a single day; although suitable stopping points may exist, they have not been tested.
Figure 1. Overview of the multFYLM design. The multFYLM contains six independent paths. Media enters through each nanoport at the top of the device (Entry), and then follows the path indicated by blue arrows, before exiting through nanoports at the bottom of the device (Exit).
Rinse the polished wafer surface with acetone, isopropanol, and then water.
Air-dry the wafer while setting up the plasma cleaner.
Set the hotplate to 200 °C.
Plasma cleaning
Plasma clean the wafer to yield an ultra-clean surface, so that resin patterns may be deposited on the surface with high resolution and adherence.
Turn on the plasma cleaner and gas controller.
Create a plasma cleaning program (Table 1) that will clean the wafer with a 30/70 ratio of O2 to N2. More time does not necessarily yield a better surface.
Table 1. First plasma cleaning program
Break the chamber vacuum, and load the wafer with the polished side up.
Note: Manual operation works best for bleeding the vacuum.
Run the cleaning program.
Change the RF tuning switch to Auto, then start the program.
Reverse power flow should be minimized during plasma flow, via adjustment of the C1 and C2 switches.
Upon program completion, allow vacuum bleeding to finish, then stop the program.
Remove wafer.
Re-establish chamber vacuum to promote instrument longevity and cleanliness.
Turn off components.
Prepare the mask aligner
Turn on the mask aligner components, so they can equilibrate before use.
Turn on gas and vacuum lines.
Turn on the mask aligner.
Start UV lamp–it requires a 10-min warm up period.
Prepare wafer for first exposure
Deposit the first layer of resin evenly on the wafer surface to yield a resin thickness of 5-6 µm. Alignment, spin parameters and resin application are all critical for proper deposition.
Place the wafer directly on a hotplate with the polished surface face up for 20 min at 200 °C.
Note: This step assures that the wafer is dry. The temperature of the wafer does not have to be maintained once removed from the hotplate, but one should proceed quickly to the next step. A hot-hand protector mitt may be used to transfer the wafer between instruments.
Place a 100-mm carousel on the spin coater.
Carefully transfer the wafer to the very center of the carousel, opening the vacuum line to firmly hold the wafer in place. An off-center wafer will not yield an even layer of SU-8 in Step A21.
Turn on the spin coater, and set the spin coater program:
10 sec at 500 rpm, acceleration level 2 (266 rpm/sec).
35 sec at 1,500 rpm, acceleration level 4 (532 rpm/sec).
Run the program, adding two drops of cyclopentanone to the wafer surface once the speed reaches 1,500 rpm.
Add 6 ml of SU-8 2005 resin to the wafer surface as evenly as possible–avoid dripping SU-8 over the sides of the wafer.
Wait 3 min while bubbles rise to the surface of the SU-8 on the wafer.
Run the program from Step A17.
The cover should be lifted slowly to avoid dripping SU-8 onto the freshly-spun wafer.
Dampen a wipe with cyclopentanone and remove the SU-8 bead remaining on the edge of the wafer surface. Alternatively, an edge-bead removal protocol may be used if the spin coater is so equipped.
Release vacuum pressure and remove the wafer from the carousel.
Note: The resulting layer of SU-8 should be uniform. If not, the wafer must be cleaned with isopropanol and the procedure restarted from Step A1.
Heat the wafer from room temperature to 95 °C on a hotplate that is initially off.
Leave the wafer on the hotplate at 95 °C for 4 min.
Turn off the hotplate and let the wafer cool down on it for 10 min.
Expose wafer with the first mask
Install the first mask and the resin-covered wafer into the mask aligner. Expose the wafer to UV light long enough to produce patterns in the resin at sufficient resolution. Under-exposure results in incomplete patterning or diminished features, while over-exposure results in enlarged features and low resolution.
Adjust the mask aligner parameters (Table 2). The parameters here should only be used as a guideline.
Table 2. Mask aligner parameters for the first layer
Set mask 1 into the mask holder.
Remove and install the correct mask holder for 100-mm wafers.
Set the mask in the holder chrome-side face up, using vacuum to hold the mask in.
Position the mask in the approximate center of the viewable region.
Load wafer into the wafer holder.
Align wafer with the mask, using alignment marks as a guide.
Expose the wafer to UV light, and wait for the exposure to complete.
Remove the wafer.
Remove unexposed photoresist from the wafer
Use developer to remove the unexposed resin from the wafer surface; this process reveals the deposited features. Excessive developing will cause the deposited features to be washed off.
Place wafer back on a cooled hotplate.
Heat up to 95 °C, then incubate at that temperature for one minute.
Place wafer in a 1 L flask photoresist-side up.
Pour developer over wafer to cover it completely.
Allow developing to proceed for 30 sec with agitation.
Remove wafer.
Rinse wafer surface with fresh developer.
Rinse wafer surface with isopropanol.
Dry the wafer using pressurized N2.
Prepare the wafer for second exposure
Deposit the second layer of resin evenly on the wafer surface to yield a resin thickness of 20-30 µm. Both the resin and spin parameters have been optimized for depositing a resin layer with the proper characteristics for the second exposure.
Clean the wafer surface in the plasma cleaner following Steps A4-A10 but with the following program (Table 3).
Table 3. Second plasma cleaning program
Place the wafer directly on a hotplate with the polished surface face up for 20 min at 200 °C.
Note: This step assures that the wafer is dry. The temperature of the wafer does not have to be maintained once removed from the hotplate, but one should proceed quickly to the next step. A hot-hand protector mitt may be used to transfer the wafer between instruments.
Place a 100-mm carousel on the spin coater.
Carefully transfer the wafer to the very center of the carousel, opening the vacuum line to firmly hold the wafer in place. An off-center wafer will not yield an even layer of SU-8 in Step A21.
Set the spin coater program:
a. 14 sec at 500 rpm, acceleration level 2 (266 rpm/sec).
b. 37 sec at 3000 rpm, acceleration level 4 (532 rpm/sec).
Add 6 ml of SU-8 2010 to the wafer surface as evenly as possible–avoid dripping SU-8 over the sides of the wafer.
Wait 9 min while bubbles rise to the surface of the SU-8 on the wafer.
Close cover and run the program from Step A48.
The cover should be lifted slowly to avoid dripping SU-8 onto the freshly-spun wafer.
Dampen a wipe with cyclopentanone and remove the SU-8 bead remaining on the edge of the wafer surface. Alternatively, an edge-bead removal protocol may be used if the spin coater is so equipped.
Release vacuum pressure and remove the wafer from the carousel.
Heat the wafer from room temperature to 85 °C on a hotplate that is initially off.
Leave the wafer on the hotplate at 85 °C for 15 min.
Turn off the hotplate and let the wafer cool down on it for 10 min.
Expose wafer with the second mask
Install the second mask and the resin-covered wafer into the mask aligner. Expose the wafer to UV light long enough to produce patterns in the resin at sufficient resolution. Alignment at this step is critical, as it ensures that features produced using the second mask will overlay properly with those already on the wafer surface.
Adjust the mask aligner parameters (Table 4). The parameters here should only be used as a guideline.
Table 4. Mask aligner parameters for the second layer
Set mask 2 into the mask holder.
Remove and install the correct mask holder for 100-mm wafers.
Set the mask in the holder chrome-side face up, using vacuum to hold the mask in.
Position the mask in the approximate center of the viewable region.
Load wafer into the wafer holder.
Adjust the position of the wafer such that it is aligned with the mask, using the alignment marks on the second mask and the wafer (from the first exposure).
Expose the wafer to UV light, and wait for the exposure to complete.
Remove the wafer.
Remove unexposed photoresist from the wafer
Use developer to remove the unexposed resin from the wafer surface. This process reveals the deposited features. Excessive developing will cause the deposited features to be washed off.
Place wafer back on a cooled hotplate.
Heat up to 85 °C, then incubate at that temperature for ten minutes.
During the incubation, remove the second mask from the mask aligner, and then turn off the mask aligner and UV lamp.
Place wafer in a 1 L flask photoresist-side up.
Pour developer over wafer to cover it completely.
Allow developing to proceed for 3 min with agitation.
Remove wafer.
Rinse wafer surface with fresh developer.
Rinse wafer surface with isopropanol.
Repeat Steps A72-A73.
Dry the wafer using pressurized N2.
multFYLM assembly
Assembly of the multFYLM via soft-lithography proceeds once the master structure is complete. The master structure is used as a mold for PDMS. Before the PDMS hardens, ports are added to allow media flow into the microfluidic structures. Once the silicone has set, it is cleaned and adhered to a large cover glass. The thin, transparent cover glass forms the base of the multFYLM and allows imaging of cells that are captured within the individual arms of the device.
Cast the multFYLM in polydimethylsiloxane (PDMS)
Prepare a PDMS solution according to the manufacturer’s protocol (Figure 2). Wrap the master structure with tape to create a vertical barrier for the PDMS. Pour half of the solution onto the master structure. Soft-bake the first layer until it is tacky, then place a clean port over each conduit passage present on the master structure. Pour the remaining PDMS onto the first layer, then bake it until all the PDMS has fully hardened.
Figure 2. Soft lithography. A. Paper tape surrounds the wafer containing the SU-8 master to keep the PDMS in place while it sets. B. First layer of PDMS. C. Layer one is semi-hardened. D. Nanoports are placed on the first layer. E. The second PDMS layer is poured around the nanoports. F. The fully-cured multFYLM, removed from the master structure.
Preheat oven to 75 °C.
Mix 30 g of PDMS with 3 g of the hardening agent in a 50 ml conical tube. Install the cap.
Mix the PDMS solution on a lab roller for 45 min at room temperature.
Clean 12 nanoports in 2% Hellmanex in a bath sonicator for 20 min on the sonication setting (nanoports can also be cleaned ahead of time).
Rinse the nanoports thoroughly in filtered DI water.
Place the nanoports in 70% EtOH in the bath sonicator for 20 min on the sonication setting.
Create a barrier around the circumference of the patterned wafer, using standard lab tape.
a. At least 2 mm of the tape should extend evenly below the circumference of the wafer.
b. Tape adhesion is critical in order to avoid PDMS leaking from the wafer surface.
Set the wafer inside a large (150 mm) Petri dish.
Centrifuge the mixed PDMS solution at room temperature at > 400 x g for 90 sec to remove large bubbles.
Pour 13 g PDMS onto the wafer, allowing it to wet the entire surface evenly.
Dry the nanoports at 70 °C on a hotplate for 30 min.
Remove residual air bubbles by placing the wafer in a vacuum desiccator for 15 min at 60-70 cmHg.
Remove the vacuum rapidly to remove bubbles still trapped in the PDMS. Repeat if necessary.
Place the wafer with PDMS in the oven at 70 °C for 15 min.
Test the PDMS on the wafer for proper hardness.
PDMS should be semi-solid and very tacky, making a small peak when probed with a 200 µl pipette tip.
If not, place it back in the oven, checking every few minutes for proper hardness.
Using a dissection scope, delicately place each of the twelve nanoports over the end of each media conduit of the PDMS as seen in the wafer’s pattern.
Avoid placing a nanoport down more than once on the PDMS surface. Multiple placements can damage multiple fluid passages, and a misaligned port may prevent fluid flow to the corresponding passage.
Pour 14 g PDMS onto the wafer, allowing it to wet the entire surface evenly.
Place the wafer in a vacuum desiccator for 15 min at 60-70 cmHg. This removes any air that may be trapped under the nanoports, ensuring a good seal between the nanoports and the PDMS.
Return the wafer to the oven (70 °C) for 3 h, or until fully cured.
Cut, clean and assemble the multFYLM
Remove the multFYLM from the master structure, then use a razor blade to trim away excess PDMS. Use a biopsy punch to make a direct path from each molded conduit to the nanoport on the opposite side of the multFYLM. Ultraclean the multFYLM and a large cover glass, then adhere them to one another. This completes assembly of the multFYLM.
Place a cover glass in a Petri dish containing a 2% Helmannex solution for one hour with agitation on a rocker.
Rinse the cover glass twice with diH2O.
Rinse the cover glass twice with isopropanol.
Place the cover glass in a large Petri dish containing a single layer of aluminum foil.
Set the dish on a hotplate at 70 °C for at least two hours to dry.
Carefully remove the tape from the circumference of the patterned wafer and multFYLM.
Carefully peel the cast multFYLM from the wafer surface.
Peel gently as to avoid splitting the polymerized PDMS.
Do not touch the surface that was in contact with the patterned wafer.
Invert the multFYLM in the Petri dish, ports-side down.
Cut away excess PDMS from the patterned/ported region of the multFYLM using a new, sharp razor blade.
Position the multFYLM under a dissection microscope.
Using a 1 mm biopsy punch, gently punch a hole through the center of each nanoport from the bottom surface through to the top surface.
Note: The punched region should include the conduit that the nanoport was placed over.
Remove the ‘punched-out’ core of PDMS from the biopsy punch using fine tweezers before withdrawing the biopsy punch from the multFYLM.
Remove the biopsy punch from the multFYLM with light pressure and a slight rotating motion to avoid separating the nanoport from the PDMS.
Inspect the nanoports and remove any remaining PDMS particles with the fine tweezers.
Submerge the multFYLM in a beaker containing 100% isopropanol and place the beaker in the bath sonicator for 30 min on the sonication setting.
Remove the multFYLM from the beaker and place it ports-side down in a large Petri dish containing a single layer of aluminum foil.
Set the dish on a hotplate at 70 °C for two hours to dry.
Place the recently-dried multFYLM and cover glass in the plasma cleaner, with the surfaces that will contact the cover glass facing up.
Turn on the plasma cleaner.
Turn on the vacuum to evacuate the chamber for at least one minute.
Turn the RF setting to ‘high’ for 20 sec.
Immediately remove the components from the plasma cleaner.
Adhere the cover glass and multFYLM by carefully setting the cleanest side of the cover glass onto the center of multFYLM.
Apply light pressure to the multFYLM to assure that it has fully-adhered to the cover glass.
For best results, the multFYLM should be used within several hours of assembly. Alternatively, the multFYLM may be stored in 70% ethanol for extended, sterile storage.
The completed multFYLM should be stored in a container to avoid contamination.
Microscope and microfluidics setup
Whole-lifespan imaging adds additional technical challenges to operating any microfluidic device. First, the microfluidic system must provide fresh media to the captured cells while also removing waste. Imperfections in the flow path can cause air bubbles that dislodge cells, potentially disrupting a multi-day experiment. Moreover, additional precautions must be taken to remove cells that are trapped upstream of the multFYLM. This is because these cells may grow into microcolonies during multFYLM operation, ultimately obstructing the flow of fresh media to the device. Second, the microscope should be equipped with stable optical and mechanical components for up to a week of continuous imaging. An active feedback focus-finding system ensures that the multFYLM can be imaged for several days without requiring any user intervention. Similarly, a light source (i.e., LED lamp) that does not change in output intensity or spectrum during a week of continuous operation is recommended. Finally, we recommend that the entire device is enclosed in an incubator jacket that maintains optimal growth conditions for the desired cells (see Equipment D8).
Prepare microfluidic tubing
Clean all the microfluidic fittings (Figure 3) that will be used for attaching to the multFYLM, then fit them onto microfluidic tubing. It is necessary to put a right angle in the tubing immediately after the fittings that will attach to the nanoports, otherwise the tubing will not clear the environmental chamber and microscope components.
Figure 3. Microfluidic fittings
Submerge all microfluidic fittings in a beaker containing 2% Hellmannex detergent and sonicate in a bath sonicator for 20 min on the sonication setting.
Rinse all fittings with diH2O three times.
Submerge all microfluidic fittings in a beaker containing 100% ethanol and sonicate in a bath sonicator for 20 min on the sonication setting.
Rinse all fittings with 100% ethanol.
Dry all the fittings in a Petri dish on a hotplate at 70 °C for 30 min or longer.
Cut twelve sections of tube to the length of 60 cm. Cut ends to be as square as possible.
Using a Bunsen burner as an aid, permanently bend a 95° angle into one end of each tube, approximately 17 mm from the end.
For six tubes that will become the waste lines, attach the following fittings at the bent end:
F-333N coned nut, threads away from the bend.
F-142N ferrule, blunt end towards the bend. The tubing should extend beyond the ferrule by 1-2 mm.
For six tubes that will become the media lines, attach the following fittings:
F-333N coned nut, threads away from the bend.
F-142N ferrule, blunt end towards the bend. The tubing should extend beyond the ferrule by 1-2 mm.
P-215 flangeless nut, threads toward the straight end.
P-272 ferrule, blunt end away from the flangeless nut.
P-658 Luer adapter, screwed onto the flangeless nut, sandwiching the ferrule.
Connect each media line to a waste line using P-235 connectors.
Note: Tubing should be prepared ahead of time, and can be stored in ethanol or sterile water until use.
Prepare the microscope for imaging
Turn on the microscope and peripherals, so that they can warm up before the experiment begins. The NIS Elements software (or other control software) should also be opened, as some peripherals may not turn on completely without a signal from the correctly-configured software.
Turn on the following components:
Microscope
Camera
Shutter controller
Stage
Objective heater–set to achieve 30 °C within the multFYLM. The heater should be installed on the 60x air objective. The temperature setting should be determined empirically, as a higher programmed temperature will likely be required to account for heat loss.
Stage heater–set to achieve 30 °C within the multFYLM. The temperature setting should be determined empirically, as a higher programmed temperature will likely be required to account for heat loss.
LED light source
White light source
Start the NIS Elements software suite.
Select ‘Neo/Zyla’ as the image grabber if prompted.
Move the 10x objective into position.
Cell loading and image acquisition
Below, we describe a protocol to maximize the number of cells that are captured in the multFYLM. Since the multFYLM contains many fine passages, it can become clogged with cell clumps or other debris. Care must be taken while preparing and loading the media and cells to avoid any particles or cell clumps. Further, air can easily dislodge captured cells, and so it should be purged from any upstream components in the fluid path. Use sterile techniques to prevent other microbes from contaminating cells in the multFYLM.
Image acquisition of cells in the multFYLM requires image collection at dozens of locations, regular time intervals, multiple Z planes, and filters corresponding to the range of fluorophores present. While an in-focus Z plane is used for the majority of imaging, the out-focus Z plane allows for greater certainty in defining the cell boundaries. Care should be taken when selecting fluorophores and filters, as spectral separation allows for unambiguous attribution of fluorescence to individual fluorophores.
Prepare media and cells
Make a liter of degassed, filtered YES 225 media, and culture the yeast strains so that they will be in exponential growth-phase on the first day of the experiment.
Prepare one liter of YES 225 agar media (Recipe 1).
Prepare one liter of YES 225 liquid media (Recipe 2).
Prepare 1 ml of sterile 20% BSA solution in a conical tube.
Streak cells from glycerol stocks onto the agar plates four days prior to the start of the experiment. Plates should be incubated at 30 °C until colonies are well-formed, then left at room temperature.
Select a 2-3 day-old colony and inoculate 10 ml of YES 225 media in a test tube.
Incubate the cell culture overnight in a shaking incubator at 30 °C.
When the optical density at 595 nm (OD595) of the cell culture reaches 0.1, inoculate a fresh test tube containing 10 ml of YES 225 media.
Incubate the new cell culture in a shaking incubator at 30 °C until the OD595 is 0.5 to 1.0 (4-6 h).
Degas the YES 225 media by placing it in a vacuum desiccator with the bottle cap loose for 15 min. This should be done just prior to loading the media into syringes.
Connect and clean media/waste lines
Load the prepared media into syringes large enough to hold enough media for the entire experimental time course. Clean the media and waste lines using ethanol and sterile water, as sterility is essential to experimental success. Install the multFYLM in the environmental chamber, then connect the waste lines (Figure 4).
Figure 4. Epifluorescent microscope prepared for imaging of the multFYLM. A. The complete multFYLM microfluidic path. B. Microfluidic fittings connect lines to the multFYLM.
Turn on the syringe pump.
Determine how many flowpaths within the multFYLM will be used.
Only three or four of the available six flowpaths are typically used due to spatial constraints and image collection rates. All six flowpaths can be used if the image collection rate is infrequent enough, the lines do not over-torque the multFYLM, and all areas can be observed by the microscope.
Fill N 10 ml syringes (‘N’ equal to as many flowpaths that will be used) with 70% ethanol.
Load these syringes into the syringe holder on the syringe pump.
Connect N media/waste line sets to each ethanol syringe.
Set the syringe pump parameters and run:
Syringe: B-D Plastipak 10 ml syringe
5 min
1 ml/min
Fill N 10 ml syringes with diH2O.
Replace the ethanol syringes with the water syringes.
Rerun the pump according to Step C15.
Load N syringes with the degassed YES media.
Attach a large syringe needle to the syringe to aid in loading the syringe without introducing any air bubbles.
Any air in the syringes should be removed immediately.
Replace the water syringes with the YES media syringes.
Set the syringe pump parameters and run it to replace the water in the lines with YES media:
Custom syringe–diameter 31.75 mm
1 min
1 ml/min
Retrieve the multFYLM and attach it to the heated stage insert using spring metal clips or lab tape.
By convention, the multFYLM is oriented as parallel to the imaging area as possible, with entrance ports oriented closest to the user. The entrance ports lead to the end of the microfluidic pattern that is not directly accessible to the waste trenches at the periphery of the channels intended to hold the cells.
Detach the waste lines from media lines and attach them to the exit channels of the multFYLM.
Take care to avoid placing lines over regions that will be imaged during the experiment.
Connecting lines to all six paths concurrently is difficult. It is generally advisable to run no more than three or four flowpaths in parallel.
Be sure to perform this task in as sterile a manner as possible.
Media lines should be kept sterile until connected. Storing them in an open conical tube is typically sufficient to prevent contamination.
Load cells into the multFYLM
Carefully vortex and load cells into each entry port, then attach the media lines while avoiding introduction of any air. Establish a program for the syringe pump that typically provides a consistent flow rate, with an occasional, increased flow rate; this will help dislodge any debris that might otherwise clog the passages of the multFYLM.
Transfer 400 µl of each cell culture into separate microfuge tubes.
Add 100 µl of sterile 20% BSA solution to each tube.
Vortex each tube for one minute.
Using a micropipette, transfer 40 µl of cell solution to each appropriate entry port.
Take care to introduce as little air as possible. This volume assures that enough liquid is present to allow a drop-to-drop connection with the media line without over-filling the nanoport during setup.
The pipette tip should be held just above the base of the port to avoid introducing air to the flowpath.
The cells may be observed using white light and the 10x objective. They should begin to flow into the multFYLM due to surface tension.
Set the syringe pump at a rate of 40 µl/min and run.
As YES media begins to exit each media line, gently attach it to an entry port.
Be very careful while attaching: use a drop-to-drop connection strategy to avoid introducing air to the flowpaths, and do not torque on the multFYLM. Ports can easily separate, or the cover glass can crack.
Observe the cells using white light and the 10x objective. They should be filling the channels of the microfluidic flowpath, starting near the entry ports first (Figure 5A).
Create a program for the pump with the following parameters:
One minute at a flow rate of 55 µl/min
Fourteen minutes at 5 µl/min.
Repeat 725 times.
Once cells have filled most of the channels to be observed, start the above program.
Figure 5. Schizosaccharomyces pombe cells loaded into the multFYLM. A. 10x image of cells within a single flowpath immediately following the loading process. B. 60x image of cells viewable within the defined region of interest (ROI).
Begin image acquisition
Using the NIS Elements software, set up a multi-dimensional acquisition strategy that will capture images of cells in each compartment of the multFYLM at regular time intervals, an in-focus and out-of-focus Z plane, and all filter sets necessary for the emission of the fluorophores in use (Table 5). Other software suites may be used, though the following directions are specific to NIS Elements.
Move the 60x air objective into place.
Obtain focus, then turn on the Perfect Focus System (PFS) using the PFS button on the front of the microscope.
Using the stage controller, bring the left-most flowpath in use into view.
Change the Region of Interest (ROI) to the same size as the viewable area of cell channels.
In the Zyla settings menu in NIS Elements, use the ‘Commands’ > ‘ROI’ > ‘Load ROI’ drop-down menu and then select the *.CAMROI file downloaded from below.
Camera ROI file:
https://github.com/finkelsteinlab/FYLM_mask_files/blob/master/FYLM_ROI_2X2_new.camroi
In the same sub-menu, select ‘Use current ROI’ (Figure 5B).
Under the ND Acquisition menu, set the folder and file names.
Path: Location where the generated files will be stored.
Filename: Name of the files to be generated. A three-digit number will be appended to the end automatically.
Under the ND Acquisition menu, set Time:
The interval and total duration of the image collection. Frequency is dependent on the number of channels that will be collected, but for white light-only images, a 2 min interval is reasonable.
It is recommended that the duration be 36 h or less, to balance file size with image collection restart frequency.
Under the ND Acquisition menu, set Z:
In-focus (as determined using PFS)
4 µM offset (Step: 4, 2 steps, Below: -4, Above: 0)
Under the ND Acquisition menu, set λ:
Optical configurations should be set up for each fluorescent image filter set. Exposure times should be determined experimentally.
Select all optical configurations that will be used during the experiment.
Fluorescent images do not need to be collected at every time period (reduces the likelihood of photo-toxicity), and frequency can be set using T Pos.
Z-depth is selectable. It is recommended that fluorescent images only be collected at the ‘Home’ Z Pos.
Under the ND Acquisition menu, set XY:
X-Y positions should be tiled across the observable cells.
It is recommended that positions be defined in a loop pattern to avoid large changes in the focal plane, which can lead to loss of focus mid-experiment.
Once all parameters have been set (Table 5), press ‘Run’.
Table 5. Example parameters for multi-dimensional image acquisition
Observe the first few rounds of imaging to assure that everything remains as set.
The experiment should be observed at least once a day to check for errors and to collect a new image file. Downstream analysis is optimized for files containing 24 h of data.
After 24 h, press ‘Finish’ to complete one day’s collection.
This will also save the file, though saving can be assured by accessing ’Save’ in the ‘File’ menu.
If prompted, it is not necessary to complete the current loop before finishing.
Image analysis software may now be used to create videos and analyze the collected data.
Data analysis
Information on how data collected using this methodology is analyzed can be found in these references (Greenstein et al., 2017; Spivey et al., 2017).
Notes
During microfabrication, the type and volume of photoresist, and the spin parameters can be varied to alter the height of the deposited features. Similarly, the type of photoresist and exposure time and intensity can be varied to alter the resolution and width of the deposited features. This can be particularly useful for capturing cells with slightly larger dimensions.
A common failure point during multFYLM assembly is punching out the PDMS from the center of the nanoports. Often, removal of the punch results in the nanoport lifting away from the PDMS, creating a small pocket of air. With care, such pockets of air can later be expelled when the coverglass is pressed to the PDMS. If pockets remain, they can become a reservoir for air that will dislodge cells while passing through the multFYLM, or for other cells that can clump and block the passageways as the experiment proceeds.
Loading the multFYLM with cells often works best with a freshly-assembled device, as the interior is still quite dehydrated, thus media and cells readily flow into it in order to rehydrate the surfaces. If the multFYLM has been stored for a length of time, it is advisable to run one ml of 70% ethanol, then one ml of water through the device backwards, so that air is not trapped in the exit channels. Otherwise, trapped air will not be displaced from the exit pathways, and adjacent channels will not yield the required pressure differential necessary for subsequent cell loading.
Recipes
YES 225 agar media (1 L)
36.13 g YES 225 powder, 20 g agar; add diH2O up to 1 L total volume
Autoclave, then pour 25 ml into individual Petri plates using sterile technique
YES 225 liquid media (1 L)
36.13 g of the YES 225 powder; add diH2O up to 1 L total volume.
Filter sterilize the solution–this will also remove small particulates that can lead to clogged passages. Autoclave treatment is not sufficient, as it will sterilize the solution but will not remove particulates
Acknowledgments
We would like to thank members of the Finkelstein laboratory for their input and advice during the development and preparation of this method. This work was generously supported by the following grants and fellowships: the American Federation for Aging Research (AFAR-020 to I.J.F.), the Welch Foundation (F-1808 to I.J.F.), and the NIH (F32 AG053051 to S.K.J.). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Science Foundation. This protocol was adapted from prior designs (Spivey et al., 2014; Spivey et al., 2017).
References
Aguilaniu, H., Gustafsson, L., Rigoulet, M. and Nystrom, T. (2003). Asymmetric inheritance of oxidatively damaged proteins during cytokinesis. Science 299(5613): 1751-1753.
Barker, M. G. and Walmsley, R. M. (1999). Replicative ageing in the fission yeast Schizosaccharomyces pombe. Yeast 15(14): 1511-1518.
Chen, K. L., Crane, M. M. and Kaeberlein, M. (2017). Microfluidic technologies for yeast replicative lifespan studies. Mech Ageing Dev 161(Pt B): 262-269.
Coelho, M., Dereli, A., Haese, A., Kuhn, S., Malinovska, L., DeSantis, M. E., Shorter, J., Alberti, S., Gross, T. and Tolic-Norrelykke, I. M. (2013). Fission yeast does not age under favorable conditions, but does so after stress. Curr Biol 23(19): 1844-1852.
Crane, M. M., Clark, I. B., Bakker, E., Smith, S. and Swain, P. S. (2014). A microfluidic system for studying ageing and dynamic single-cell responses in budding yeast. PLoS One 9(6): e100042.
Fu, X. H., Meng, F. L., Hu, Y. and Zhou, J. Q. (2008). Candida albicans, a distinctive fungal model for cellular aging study. Aging Cell 7(5): 746-757.
Greenstein, R.A., Jones, S.K., Spivey, E.C., Rybarski, J.R., Finkelstein, I., and Al-Sady, B. (2017). A memory element imposes epigenetic behavior on intrinsically labile RNAi-induced heterochromatin spread. BioRxiv 237479.
Henderson, K. A. and Gottschling, D. E. (2008). A mother’s sacrifice: what is she keeping for herself? Curr Opin Cell Biol 20: 723-728.
Higuchi-Sanabria, R., Pernice, W. M., Vevea, J. D., Alessi Wolken, D. M., Boldogh, I. R. and Pon, L. A. (2014). Role of asymmetric cell division in lifespan control in Saccharomyces cerevisiae. FEMS Yeast Res 14(8): 1133-1146.
Hughes, A. L. and Gottschling, D. E. (2012). An early age increase in vacuolar pH limits mitochondrial function and lifespan in yeast. Nature 492(7428): 261-265.
Jo, M. C., Liu, W., Gu, L., Dang, W. and Qin, L. (2015). High-throughput analysis of yeast replicative aging using a microfluidic system. Proc Natl Acad Sci U S A 112(30): 9364-9369.
Kennedy, B. K., Austriaco, N. R., Jr. and Guarente, L. (1994). Daughter cells of Saccharomyces cerevisiae from old mothers display a reduced life span. J Cell Biol 127(6 Pt 2): 1985-1993.
Lee, S. S., Avalos Vizcarra, I., Huberts, D. H., Lee, L. P. and Heinemann, M. (2012). Whole lifespan microscopic observation of budding yeast aging through a microfluidic dissection platform. Proc Natl Acad Sci U S A 109(13): 4916-4920.
Liu, B., Larsson, L., Caballero, A., Hao, X., Öling, D., Grantham, J. and Nyström, T. (2010). The polarisome is required for segregation and retrograde transport of protein aggregates. Cell 140: 257-267.
Liu, P., Young, T. Z. and Acar, M. (2015). Yeast replicator: A high-throughput multiplexed microfluidics platform for automated measurements of single-cell aging. Cell Rep 13: 634-644.
Mortimer, R. K. and Johnston, J. R. (1959). Life span of individual yeast cells. Nature 183(4677): 1751-1752.
Nakaoka, H. and Wakamoto, Y. (2017). Aging, mortality, and the fast growth trade-off of Schizosaccharomyces pombe. PLoS Biol 15(6): e2001109.
Nobs, J. B. and Maerkl, S. J. (2014). Long-term single cell analysis of S. pombe on a microfluidic microchemostat array. PLoS One 9(4): e93466.
Nyström, T. and Liu, B. (2014). The mystery of aging and rejuvenation - a budding topic. Curr Opin Microbiol 18: 61-67.
Paoletti, C., Quintin, S., Matifas, A. and Charvin, G. (2016). Kinetics of formation and asymmetrical distribution of Hsp104-Bound protein aggregates in yeast. Biophys J 110(7): 1605-1614.
Ruetenik, A. and Barrientos, A. (2015). Dietary restriction, mitochondrial function and aging: from yeast to humans. Biochim Biophys Acta 1847(11): 1434-1447.
Saka, K., Ide, S., Ganley, A. R. and Kobayashi, T. (2013). Cellular senescence in yeast is regulated by rDNA noncoding transcription. Curr Biol 23(18): 1794-1798.
Shcheprova, Z., Baldi, S., Frei, S. B., Gonnet, G. and Barral, Y. (2008). A mechanism for asymmetric segregation of age during yeast budding. Nature 454(7205): 728-734.
Spivey, E. C. and Finkelstein, I. J. (2014). From cradle to grave: high-throughput studies of aging in model organisms. Mol Biosyst 10(7): 1658-1667.
Spivey, E. C., Jones, S. K., Rybarski, J. R., Saifuddin, F. A. and Finkelstein, I. J. (2017). An aging-independent replicative lifespan in a symmetrically dividing eukaryote. Elife 6.
Spivey, E. C., Xhemalce, B., Shear, J. B. and Finkelstein, I. J. (2014). 3D-printed microfluidic microdissector for high-throughput studies of cellular aging. Anal Chem 86(15): 7406-7412.
Sutphin, G. L., Delaney, J. R. and Kaeberlein, M. (2014). Replicative life span analysis in budding yeast. Methods Mol Biol 1205: 341-357.
Tian, Y., Luo, C. and Ouyang, Q. (2013). A microfluidic synchronizer for fission yeast cells. Lab Chip 13(20): 4071-4077.
Wang, P., Robert, L., Pelletier, J., Dang, W. L., Taddei, F., Wright, A. and Jun, S. (2010). Robust growth of Escherichia coli. Curr Biol 20(12): 1099-1103.
Wasko, B. M. and Kaeberlein, M. (2014). Yeast replicative aging: a paradigm for defining conserved longevity interventions. FEMS Yeast Res 14(1): 148-159.
Wierman, M. B. and Smith, J. S. (2014). Yeast sirtuins and the regulation of aging. FEMS Yeast Res 14(1): 73-88.
Xie, Z., Zhang, Y., Zou, K., Brandman, O., Luo, C., Ouyang, Q. and Li, H. (2012). Molecular phenotyping of aging in single yeast cells using a novel microfluidic device. Aging Cell 11(4): 599-606.
Zhang, Y., Luo, C., Zou, K., Xie, Z., Brandman, O., Ouyang, Q. and Li, H. (2012). Single cell analysis of yeast replicative aging using a new generation of microfluidic device. PLoS One 7(11): e48275.
Zhou, C., Slaughter, B. D., Unruh, J. R., Guo, F., Yu, Z., Mickey, K., Narkar, A., Ross, R. T., McClain, M. and Li, R. (2014). Organelle-based aggregation and retention of damaged proteins in asymmetrically dividing cells. Cell 159(3): 530-542.
Copyright: Jones Jr et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Jones Jr, S. K., Spivey, E. C., Rybarski, J. R. and Finkelstein, I. J. (2018). A Microfluidic Device for Massively Parallel, Whole-lifespan Imaging of Single Fission Yeast Cells. Bio-protocol 8(7): e2783. DOI: 10.21769/BioProtoc.2783.
Spivey, E. C., Jones, S. K., Rybarski, J. R., Saifuddin, F. A. and Finkelstein, I. J. (2017). An aging-independent replicative lifespan in a symmetrically dividing eukaryote. Elife 6.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Ageing
Microbiology > Microbial cell biology > Cell imaging
Cell Biology > Cell imaging > Microfluidics
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,784 | https://bio-protocol.org/exchange/protocoldetail?id=2784&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sacral Spinal Cord Transection and Isolated Sacral Cord Preparation to Study Chronic Spinal Cord Injury in Adult Mice
Carmelo Bellardita
MM Maite Marcantoni
PL Peter Löw
OK Ole Kiehn
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2784 Views: 6929
Edited by: Oneil G. Bhalala
Reviewed by: Andreas HuschHélène M. Léger
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Spinal cord injury (SCI) is characterized by multiple sensory/motor impairments that arise from different underlying neural mechanisms. Linking specific sensory/motor impairments to neural mechanism is limited by a lack of direct experimental access to these neural circuits. Here, we describe an experimental model which addresses this shortcoming. We generated a mouse model of chronic spinal cord injury that reliably reproduces spasticity observed after SCI, while at the same time allows study of motor impairments in vivo and in an in vitro preparation of the spinal cord. The model allows for the combination of mouse genetics in in vitro and in vivo conditions with advanced imaging, behavioral analysis, and detailed electrophysiology, techniques which are not easily applied in conventional SCI models.
Keywords: Spinal cord injury Complete transection in vitro preparation Sacral spinal cord Spasticity
Background
Spinal cord injury results in devastating sensory-motor disabilities. Extensive work in animal models has investigated the pathophysiological state of spinal circuits after SCI. Most studies in spinal cord injury are carried out in animal models relevant for clinical evaluation of motor impairment and recovery after SCI (Sharif-Alhoseini et al., 2017). One of the main limitations of these models is the difficulty to relate clinical features of sensory-motor dysfunction to specific cellular mechanism(s). In the last decade, new insights into possible cellular mechanisms underlying motor impairments after SCI have come from transection models of SCI. Here, the sacral spinal cord is surgically transected resulting in paralysis only of the tail muscles. This model was first introduced in cats (Ritz et al., 1992), and later in rats (Bennett et al., 1999), and has provided insights into cellular mechanisms underlying sensory-motor dysfunction after injury (Bennett et al., 2001). Nevertheless, the genetic tools for manipulating neuronal activity in cats and rats are very limited. In contrast, mice allow electrophysiology to be combined with genetics for identification and manipulation of the activity of specific neurons in the spinal cord (Jiang and Heckman, 2006; Kiehn, 2016). In recent efforts, these advantages have allowed optical approaches (e.g., optogenetics, calcium imaging of defined neuronal subtypes) to be used for dissection of the neural mechanisms underlying muscle spasms after SCI (Bellardita et al., 2017). In this protocol, we describe the technical aspects of sacral spinal cord transection in adult mice, and the subsequent use of in vitro sacral spinal cord preparations for direct examination of the neural mechanisms which cause spasm in chronic spinal cord injury.
Materials and Reagents
Glass micropipettes (Harvard Apparatus, catalog number: GC150F-10 )
Wood stick cotton tip swabs (Medline Scientific, catalog number: 300230S )
Non-sterile gauze swabs (Kruuse, catalog number: 160120 )
Surgery cover 60 x 90 cm (Kruuse, catalog number: 141770 )
Absorbent swabs (Kettenbach, catalog number: 001911 )
Suture, straight cutting needles, non-absorbable (eSutures, Ethicon, catalog number: K889H )
Hypodermic needles 26 G brown 16 mm (BD, Microlance, catalog number: 304300 )
23-Gauge needle (PrecisionGlide IM; BD, catalog number: 305145 )
Vetbond tissue adhesive (3M, catalog number: 1469C )
Surgical glue (3M, Vetbond, catalog number: 372146 )
Facial Tissue (VWR, catalog number: 115-0600 )
Bench liner paper (ScienceWare, VWR, catalog number: 470145-292 )
8 weeks old mice (JAX Mice Strain; THE JACKSON LABORATORY, catalog number: 000664 )
Note: All experiments should be performed in accordance with relevant guidelines and regulations. The local Swedish and Danish ethical committees approved all procedures described here.
100% oxygen (O2)
Isoflurane (Baxter, catalog number: 1001936060 )
Lidocaine Hydrochloride (Sigma-Aldrich, catalog number: BP214 )
Betadine® Surgical Scrub (povidone-iodine, 7.5%)
Xilocaine (1%)
Buprenorphine hydrochloride (Reckitt Benckiser Healthcare, 0.3 mg/ml)
Carprofen (Canidryl, catalog number: 122964 )
Physiologic solution (0.9% sodium chloride) (Grovet, Braun Ecotainer, catalog number: 99512 )
Viscotears liquid gel for dry eyes (Novartis, catalog number: 2082642 )
70% ethanol
Sylgard (Sigma-Aldrich, catalog number: 761028-5EA )
Sodium chloride (NaCl, Sigma-Aldrich, catalog number: 433209 )
Note: This product has been discontinued.
Potassium chloride (KCl, Sigma-Aldrich, catalog number: P9541 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
Sodium bicarbonate (NaHCO3, Sigma-Aldrich, catalog number: S5761 )
Magnesium sulfate heptahydrate (MgSO4·7H2O, Sigma-Aldrich, catalog number: 63138 )
Potassium phosphate monobasic (KH2PO4, Sigma-Aldrich, catalog number: 92214 )
Calcium chloride (CaCl2, Sigma-Aldrich, catalog number: 449709 )
Magnesium chloride (MgCl2, Sigma-Aldrich, catalog number: V000149 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Ringer’s solution (see Recipes)
Oxygenated modified artificial cerebrospinal fluid (mACSF, see Recipes)
Equipment
Forceps (Fine Science Tools, catalog number: 11251-10 )
Toothed forceps (Fine Science Tools, catalog number: 11154-10 )
Vannas Spring scissors–Micro-serrated (Fine Science Tools, catalog number: 15007-08 )
Dumont No. 2 laminectomy forceps (Fine Science Tools, catalog number: 11223-20 )
Fine Scissors–Tungsten Carbide (Fine Science Tools, catalog number: 14568-09 )
Fine Scissors–Tungsten Carbide & ToughCut (Fine Science Tool, catalog number: 14558-11 )
Rechargeable animal clipper (Wahl Arco)
Scalpel (Fine Science Tools, catalog number: 10020-00 )
Temperature-controlled variable heat pad (K&H Manufacturing, model: 1009 )
Diaphragm vacuum pump-lubricated-single-stage (Environmental Express, catalog number: EE0753280 )
Isofluorane vaporizer (Soarmed, model: MSS-3 )
Procedure
Complete lesion of the sacral spinal cord
Prepare a clean and disinfected area dedicated to rodent surgery with only the equipment related to surgery (Figure 1A). Place the surgical instruments in an area which can be easily accessed during the procedure (Figure 1B).
Prepare a glass pipette with a diameter of 50-100 μm from a glass capillary (Figure 1C). The glass capillary is pulled, and the tip is then manually adapted to the spinal cord. Connect the glass pipette to a vacuum pump through a series of silicon tubes of increasing diameter. The pulled glass pipette will be used in the surgery for suction-transection of the spinal cord.
Weigh the mouse before surgery. Monitor the weight of the animal for the next 15 days to evaluate for the potential loss of weight after surgery.
Place the mouse in a sealed induction chamber with 5% isoflurane/95% oxygen until it is deeply anesthetized (Figure 1A.2).
Move the mouse from the induction chamber to the area dedicated to the surgery and prepare it for the surgery (Figure 1D):
Position the mouse ventral side down on a heating pad to maintain body temperature (37 °C) constant during the entire procedure (Figure 1D.1).
Use 2% isofluorane for the entire period of the surgery. Deliver isofluorane to the mouse through a facial mask (Figure 1D.2).
Check reflexes of the animal to verify an appropriate state of anesthesia. There should be no pinch-evoked reflexes. We assessed the pedal withdrawal reflex by pinching the tail and the metacarpal region of the hind foot.
Secure the animal to make sure it will not move during the surgery (as might be caused by touching the dorsal roots). Secure the animal with strips of tape attached to the limbs. Avoid excessive stretching of the limbs, which may damage joints as well as impair the animal’s breathing (Figure 1D.3).
Shave the back of the mouse along the rostrocaudal axis of the spinal column. Apply sodium iodine to the shaved area and leave it for 5 min (Figure 1D.4). Apply eye ointment to protect the eyes during surgery.
Remember to avoid resting your hands or instruments on the mouse thorax. The external pressure may interfere with respiration and/or blood circulation.
Apply a surgical cover to the body of the mouse, leaving a window at the point of incision (Figure 1D.5).
Localization of the second sacral segment and transection:
Use two fingers to localize the T12 vertebral body. The T12 vertebra has the longest spinous process of all vertebrae, and if the spine of the mouse is put into flexion, the T12 vertebra protrudes outward in the spinal column. With a scalpel, make a longitudinal incision of the skin from approximately the T12 to the L4 vertebral bodies (Figure 1E).
The second sacral segment (S2) of the spinal cord lies beneath the rostral part of L2 vertebral body, on the boundaries between the L1 and L2 vertebral body. The spinous process of L2 points rostrally, and should be used as a landmark for making a deep vertical incision with a small eye scissor. If the cut is performed vertically, it will reveal the ligamentum flavum between the L1 and L2 vertebral bodies (Figure 1F). For a better understanding of the anatomical landmarks, and especially the relationship between lumbar vertebral bodies and the spinal cord in adult mice, refer to Harrison et al., 2013.
Cut the ligamentum flavum with the eye scissor. The spinal cord will appear with a dorsal artery lying in the midline (Figure 1G).
Apply Xilocaine (1%) on the top of the cord to prevent movements elicited by touching the spinal cord or the dorsal roots. Wait for the drug to take effect (about half a minute) and then use fine forceps to position the dorsal roots as lateral as possible. In the case of other structural damage (e.g., bones, arteries, tendons), the surgeon should consider discluding the animal from subsequent analysis.
If the cut to the ligamentum flavum is performed correctly, no other damage will be caused to the surrounding tissue (muscles, ligament or skin), and no blood should be visible.
Starting on one side of the cord, use the glass pipette attached to vacuum suction to remove the S2 spinal tissue. Keep aspirating tissue until a complete discontinuity is observed between the rostral and the caudal ends of the cord, in total corresponding to one segment.
Suture the surgical wound and let the animal recover:
Suture the muscle around the spinal column at the injury site to protect the cord, and use veterinary glue close the skin.
Give post-surgery treatment of Buprenorphine (0.1 mg/kg), Carprofen (5 mg/kg) and, if necessary, 0.3 ml of sterile physiologic solution subcutaneously for 2 to 5 days post-surgery.
Turn the anesthesia off and place the mouse back in the cage with a heating pad to keep the animal warm for a period of 1-2 h. The animal may be housed alone for the first week, and thereafter, if the recovery is complete, it may be housed with another animal. Special cage bedding is not necessary.
Monitor the animal daily for signs of distress, including weight loss (a > 10% drop in body weight should be avoided), dehydration, or infection. In any of these cases, the surgeon should consult with a veterinarian for suggestions and solutions.
The injury should only cause paralysis of the tail muscles, and should not affect the bladder or hindlimbs. However, during daily postoperative care it is important to monitor for bladder dysfunction, which can sometimes occur if the injury site is too rostral.
Note: The limited visibility caused by a small working area during the surgery makes it difficult to reliably evaluate the completeness of the lesion. Therefore, all lesions should be evaluated visually after the end the experiment after dissection of the cord (Figures 1I-1L).
Figure 1. Lesion of the sacral spinal cord in adult mice. A. Area prepared for the surgery with easy access to the necessary equipment: 1) Dissection microscope; 2) Induction chamber for anesthesia; 3) Facial mask for anesthesia; 4) Isofluorane vaporizer; 5) Heating pad; 6) Glass pipette for aspirating the spinal cord connected to the vacuum pump; 7) Vacuum cleaner; 8) Device for surgical instrument sterilization. B. Surgical instruments for lesioning the sacral spinal cord with (from left to right): scissors, forceps, eye ointment, veterinary glue, and suture. C. Glass pipette and vacuum pump for aspirating the spinal cord. D. A mouse prepped for the lesioning procedure. 1) Heating pad; 2) Facial mask to deliver anesthesia; 3) Strips of tape for preventing sudden movements; 4) Area of interest shaved and prepped with sodium iodine; 5) Green cover for the mouse body with a work window in the area of interest. E. Surgical incision of the skin in the area of interest. F. Schematic of the surgery area with the vertebral body L1 and L2 with the second sacral segment of the spinal cord. G. Incision at the level of the L2 vertebral body after cutting the ligamentum flavum. H. Aspiration of the spinal cord using the glass pipette. I-L. Examples of dissected, lesioned sacral cords two months after SCI with either an incomplete (I) or complete (L) lesion.
Dissection of the sacral spinal cord of adult chronic spinalized mice
Prepare a clean disinfected area dedicated to rodent surgery with easy access to the equipment necessary for isolation of the spinal cord (similar to that of Figure 1A).
Place the animal in a chamber for induction of anesthesia (5% isofluorane/95% oxygen), and move the animal from the induction chamber to the dissection table when deeply anesthetized. Check reflexes as in Step A4c.
Place the mouse on a bench liner paper (Scienceware) and apply isofluorane (2%) through the facial mask. Check the reflexes of an appropriate state of anesthesia as in Step A5c. Apply strips of tape to secure the limbs, shave the back, and clean the area with alcohol (Figure 2A).
Note: In this step, the animal does not have to be positioned on a heating pad as a lower temperature will decrease the metabolism, improving the dissection of the cord; eye ointment is not necessary since the procedure will last few minutes.
Laminectomy along the site of interest:
Identify T12 as described above.
Cut the skin from about the T12 vertebral body to L5 vertebral body. Keep in mind that the second sacral segment of the spinal cord is beneath the second vertebral body of the lumbar spinal cord (L2).
Expose the spinal column by cutting the muscles and tendons around it (Figure 2B).
Localize the spinous process of the T13 vertebral body (the T13 vertebra has the last pair of ribs attached), and start a dorsal laminectomy (a surgical procedure removing the dorsal portion of the vertebrae) in the rostro-caudal direction.
Begin to perfuse the spinal column with cold mACSF (20 ml/min) to slow down metabolism and reduce blood flow in the site of interest.
Proceed with the laminectomy by cutting the left and right sides of the vertebral body with the scissor.
Avoid damaging the spinal cord with the scissor, which can sometimes occur when moving the tip of the scissor from the left to right sides of the vertebrae (or vice versa). Damage may result in contusion or bruises of the spinal cord.
Use a continuous flow (20 ml/min) of cold (~4 °C), oxygenated mACSF on the spinal cord.
Isolation of the sacral spinal cord:
When the spinal column is exposed form the caudal lumbar segments to the cauda equina, the laminectomy is complete (Figure 2C).
Give pure oxygen to the mouse through the facial mask for about 5 min to increase blood oxygenation levels.
Cut the skin at the level of the abdominal muscles and save the abdominal artery. This cut will cause a decrease in blood pressure, preventing an overflow of blood at the level of the cord during isolation.
Cut the cord at the level of the caudal lumbar segments and proceed cutting the ventral roots on the right and left sides of the cord to isolate it from the spinal column.
Pay special attention when you reach the site of the lesion. At the level of the injury, the dura mater is often attached to the vertebral body, requiring careful detachment of the spinal cord and dura from the rest of the spinal column.
Once the cord is completely detached, move it in a dissection chamber with a continuous flow (20 ml/min) of cold oxygenated-mACSF.
Carefully and completely remove the dura mater from the spinal cord to allow greater diffusion of oxygenation into the tissue. Cut the spinal cord, the dorsal root and the ventral roots to decrease the length and allow an easier recognition of the different segments and roots during the experiment (Figure 2C).
Once all roots of the cord are cut and the isolation of the cord is complete, the spinal cord can be moved to a perfusion chamber covered with Sylgard (Figure 2D). Provide a continuous flow of mACSF at room temperature (3-7 ml/min).
In vitro preparation of the sacral spinal cord for simultaneous calcium imaging of spinal interneurons and ventral root recording:
Move the spinal cord to the recording chamber. The recording chamber has a Sylgard bottom and a Sylgard ‘bridge’ attached which allows the cord to be placed in an L-shaped position (Figure 2E), such that the coronal plane of the spinal cord can be imaged with an objective lens.
Keep a continuous flow of oxygenated Ringer solution for the duration of the experiment.
The cord is pinned down ventral side up from the most caudal end to ensure mechanical stability. The rostral end of the cord leans onto the bridge and a bended minute pin is used as a hook to keep the cord in place (Figure 2E).
Suction electrodes are used for recording motor activity (S4-Co1) and stimulating dorsal roots.
Calcium imaging is performed by lowering the objective over the region of interest (Figure 2F) once the glass suction electrodes are connected to the roots.
Notes:
The procedure from the Step B5 to the Step B6 should not take more than a minute otherwise the preparation’s viability may be compromised.
The dissection of the sacral spinal cord in lesioned mice (Procedure B) should be performed > 2 months after lesion for studying chronic spinal cord injury.
Figure 2. Dissection of the sacral spinal cord from adult mouse. A. Adult lesioned mouse under anesthesia and prepped for dissection of the sacral spinal cord. B. Incision of the skin and isolation of the spinal column from muscles and tendons. C. Isolated sacral spinal cord after dissection. D. Recording chamber for simultaneous calcium imaging of spinal interneurons and recording of motor activity. E. Sacral spinal cord positioned in the recording chamber with the transverse cut facing the microscope. F. Example of spinal neurons from a spinal cord of a Vglut2Cre (Borgius et al., 2010):: Rosa26-LSL-GCaMP3 (Ai38) mouse during calcium imaging. Scale bar = 20 µm.
Data analysis
The effect of the injury, its reproducibility, and quantification of the electrophysiological and calcium imaging data are conceptualized and quantified in our study ‘Spatiotemporal correlation of spinal network dynamics underlying spasms in chronic spinalized mice’ (Bellardita et al., 2017).
Notes
The quality of the lesion is largely dependent on the manual skills of the surgeon. These techniques require experience with identification of anatomical structures, and it can be common for newly trained surgeons to disturb the lumbar dorsal/ventral root–with negative consequence to the sensory/motor function of the hindlimbs.
During aspiration of the cord, the main dorsal artery should be left intact. Severing the dorsal artery during the procedure can result in degeneration of the spinal cord below the injury site. This effect may present behaviorally as flaccidity of the tail, and is typically referred to as dead tail syndrome.
For obtaining high quality recordings in the in vitro preparation, special care should be used in maintaining the temperature of the solution during the laminectomy close to 4 °C to reduce cellular death.
Recipes
Ringer’s solution
111 mM NaCl
3 mM KCl
11 mM glucose
25 mM NaHCO3
1.25 mM MgSO4
1.1 mM KH2PO4
2.5 mM CaCl2
Oxygenated in 95% O2 and 5% CO2 to obtain a pH of 7.4 and maintained at 22-24 °C
Oxygenated modified artificial cerebrospinal fluid
125 mM Choline-Cl
1.9 mM KCl
1 mM CaCl2
7 mM MgCl2
1.2 mM KH2PO4
10 mM HEPES
25 mM glucose
Note: Storing of the solutions is important. The solutions can be saved in refrigeration < 10 °C and must be transparent. In case of any concern about the possibility of contamination or bacterial growth, the solution should be replaced.
Acknowledgments
This work was supported by the European Research Council (LocomotorIntegration), NINDS, Novo Nordisk Foundation, Laureate Program. The authors declare that they have no conflicts or competing interests.
References
Bellardita, C., Caggiano, V., Leiras, R., Caldeira, V., Fuchs, A., Bouvier, J., Low, P. and Kiehn, O. (2017). Spatiotemporal correlation of spinal network dynamics underlying spasms in chronic spinalized mice. Elife 6:e23011.
Bennett, D. J., Gorassini, M., Fouad, K., Sanelli, L., Han, Y. and Cheng, J. (1999). Spasticity in rats with sacral spinal cord injury. J Neurotrauma 16: 69-84.
Bennett, D. J., Li, Y. and Siu, M. (2001). Plateau potentials in sacrocaudal motoneurons of chronic spinal rats, recorded in vitro. J Neurophysiol 86: 1955-1971.
Borgius, L., Restrepo, C. E., Leao, R. N., Saleh, N. and Kiehn, O. (2010). A transgenic mouse line for molecular genetic analysis of excitatory glutamatergic neurons. Mol Cell Neurosci 45: 245-257.
Harrison, M., O'Brien, A., Adams, L., Cowin, G., Ruitenberg, M. J., Sengul, G. and Watson, C. (2013). Vertebral landmarks for the identification of spinal cord segments in the mouse. Neuroimage 68: 22-29.
Jiang, M. C. and Heckman, C. J. (2006). In vitro sacral cord preparation and motoneuron recording from adult mice. J Neurosci Methods 156: 31-36.
Kiehn, O. (2016). Decoding the organization of spinal circuits that control locomotion. Nat Rev Neurosci 17(4): 224-38.
Ritz, L. A., Friedman, R. M., Rhoton, E. L., Sparkes, M. L. and Vierck, C. J., Jr. (1992). Lesions of cat sacrocaudal spinal cord: a minimally disruptive model of injury. J Neurotrauma 9: 219-230.
Sharif-Alhoseini, M., Khormali, M., Rezaei, M., Safdarian, M., Hajighadery, A., Khalatbari, M. M., Safdarian, M., Meknatkhah, S., Rezvan, M., Chalangari, M., Derakhshan, P. and Rahimi-Movaghar, V. (2017). Animal models of spinal cord injury: a systematic review. Spinal Cord 55(8): 714-721.
Copyright: Bellardita et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Bellardita, C., Marcantoni, M., Löw, P. and Kiehn, O. (2018). Sacral Spinal Cord Transection and Isolated Sacral Cord Preparation to Study Chronic Spinal Cord Injury in Adult Mice. Bio-protocol 8(7): e2784. DOI: 10.21769/BioProtoc.2784.
Bellardita, C., Caggiano, V., Leiras, R., Caldeira, V., Fuchs, A., Bouvier, J., Low, P. and Kiehn, O. (2017). Spatiotemporal correlation of spinal network dynamics underlying spasms in chronic spinalized mice. Elife 6:e23011.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Neuroscience > Nervous system disorders > Cellular mechanisms
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,785 | https://bio-protocol.org/exchange/protocoldetail?id=2785&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Nitrate Reductase Activity Assay from Arabidopsis Crude Extracts
JK Joo Yong Kim
HS Hak Soo Seo
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2785 Views: 9196
Edited by: Renate Weizbauer
Reviewed by: Venkatasalam ShanmugabalajiAswad Khadilkar
Original Research Article:
The authors used this protocol in Jul 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2011
Abstract
Nitrate reductase (NR) reduces the major plant nitrogen source, NO3-, into NO2-. NR activity can be measured by its final product, nitrite through its absorbance under optimized condition. Here, we present a detailed protocol for measuring relative enzyme activity of NR from Arabidopsis crude extracts. This protocol offers simple procedure and data analysis to compare NR activity of multiple samples.
Keywords: Nitrate reductase in vitro NR activity assay Nitrite concentration
Background
Nitrogen is crucial macronutrient required by plants and is mainly absorbed in the form of nitrate. Nitrate reductase is the first enzyme of the nitrogen assimilation in higher plants. Homodimers of plant nitrate reductase catalyze the NAD(P)H-dependent reduction of nitrate to nitrite as follows:
NO3- + NADH + H+ → NO2- + NAD+ + H2O
Methods to measure NR activity may be a powerful tool to investigate biological factors influencing NR activity (Park et al., 2011). Nitrogen assimilation affects the contents of amino acid in plant, thus regulating NR activity could be used for increasing quality of some crop (Croy and Hageman, 1970; Dalling and Loyn, 1977; Ruan et al., 1998).
In this protocol, increased nitrite concentrations during limited time in optimized buffer condition are acquired as comparable values. Nitrite concentration is measured by its absorbance at 540 nm through Griess assay. Briefly, nitrite forms a diazonium salt with sulfanilic acid, then N-(1-naphthyl) ethylenediamine dihydrochloride is formed colored azo compound. It is possible to compare the values to determine how samples have different NR activity. Furthermore, the values could be converted to exact increased nitrite concentration through a simple process.
Materials and Reagents
3MTM MicroporeTM surgical tape (3M, MicroporeTM, catalog number: 1530-1 )
Reaction tube, 1.5 ml (Greiner Bio One International, catalog number: 616201 )
150 x 25 mm (d x h) plastic Petri dish (SPL Life Sciences, catalog number: 10151 )
Cuvette (Ratiolab, catalog number: 2712120 )
Arabidopsis seeds
Ethanol (Merck, EMSURE®, catalog number: 1009831011 )
Liquid nitrogen
Potassium nitrite (Sigma-Aldrich, catalog number: P8394 )
Murashige & Skoog medium including vitamins (Duchefa Biochemie, catalog number: M0222 )
MES monohydrate (Duchefa Biochemie, catalog number: M1503 )
Potassium hydroxide (Merck, catalog number: 814353 )
Sucrose (Duchefa Biochemie, catalog number: S0809 )
Plant agar (Duchefa Biochemie, catalog number: P1001 )
Tris-HCl (Duchefa Biochemie, catalog number: T1513 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: EDS )
Sodium molybdate dihydrate (Na2MoO4·2H2O) (Sigma-Aldrich, catalog number: M1003 )
Flavin adenine dinucleotide disodium salt hydrate (FAD-Na2) (Sigma-Aldrich, catalog number: F8384 )
Dithiothreitol (DTT) (Duchefa Biochemie, catalog number: D1309 )
Bovine serum albumin (BSA) (Merck, Probumin®, catalog number: 821006 )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: 78830 )
Sodium nitrate (NaNO3) (Sigma-Aldrich, catalog number: S5506 )
Sodium phosphate dibasic (Na2HPO4) (Bio Basic, catalog number: S0404 )
Sodium phosphate monobasic, anhydrous (NaH2PO4) (Bio Basic, catalog number: SB0878 )
Nicotinamide adenine dinucleotide (NADH) (Sigma-Aldrich, catalog number: 43420 )
Hydrochloric acid (HCl) (DAEJUNG CHEMICAL & METALS, catalog number: 4090-4405 )
Sulfanilamide (Sigma-Aldrich, catalog number: S9251 )
N-(1-naphthyl) ethylenediamine dihydrochloride (Sigma-Aldrich, catalog number: 222488 )
MS agar media (see Recipes)
Extraction buffer (see Recipes)
Reaction buffer (see Recipes)
1% sulfanilamide solution (see Recipes)
0.05% N-(1-naptyl) ethylenediamine hydrochloride (see Recipes)
Equipment
Pipette kit (Gilson, model: PIPETMAN® Classic, catalog number: F167300 )
2 L flask (DWK Life Sciences, Duran®, catalog number: 21 216 63 )
Arabidopsis growth chamber (Hanbaek, model: HB-301L-3 )
Stainless steel tweezers
Mortar & pestle (Silico & Chemico Porcelain Works, catalog number: J-753 )
Centrifuge (Thermo Fisher scientific, model: SorvallTM LegendTM 17 , catalog number: 75002431)
Spectrophotometer (Biochrom, model: Libra S22 )
Magnetic stirrer (Vision Scientific, model: VS-130SH )
Stirring bar
pH meter (Fisher Scientific, model: accumetTM AB15 )
Autoclave (Hanbaek, model: HB-506-6 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kim, J. Y. and Seo, H. S. (2018). In vitro Nitrate Reductase Activity Assay from Arabidopsis Crude Extracts. Bio-protocol 8(7): e2785. DOI: 10.21769/BioProtoc.2785.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant biochemistry > Other compound
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
is it for NR actucal activity or maximum activity?
0 Answer
4 Views
Sep 8, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,786 | https://bio-protocol.org/exchange/protocoldetail?id=2786&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Tracking Lipid Transfer by Fatty Acid Isotopolog Profiling from Host Plants to Arbuscular Mycorrhiza Fungi
AK Andreas Keymer*
CH Claudia Huber*
WE Wolfgang Eisenreich
CG Caroline Gutjahr
*Contributed equally to this work
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2786 Views: 7197
Edited by: Amey Redkar
Reviewed by: Didier ReinhardtAdam Idoine
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
Lipid transfer from host plants to arbuscular mycorrhiza fungi was hypothesized for several years because sequenced arbuscular mycorrhiza fungal genomes lack genes encoding cytosolic fatty acid synthase (Wewer et al., 2014; Rich et al., 2017). It was finally shown by two independent experimental approaches (Jiang et al., 2017; Keymer et al., 2017; Luginbuehl et al., 2017). One approach used a technique called isotopolog profiling (Keymer et al., 2017). Isotopologs are molecules, which differ only in their isotopic composition. For isotopolog profiling an organism is fed with a heavy isotope labelled precursor metabolite. Subsequently, the labelled isotopolog composition of metabolic products is analysed via mass spectrometry. The detected isotopolog pattern of the metabolite(s) of interest yields information about metabolic pathways and fluxes (Ahmed et al., 2014). The following protocol describes an experimental setup, which enables separate isotopolog profiling of fatty acids in plant roots colonized by arbuscular mycorrhiza fungi and their associated fungal extraradical mycelium, to elucidate fluxes between both symbiotic organisms. We predict that this strategy can also be used to study metabolite fluxes between other organisms if the two interacting organisms can be physically separated.
Keywords: Arbuscular mycorrhiza Lotus japonicus Isotopolog profiling Stable isotope labelling Rhizophagus irregularis MSR medium Inter-organismic lipid transfer Root organ culture Nurse plant system
Background
Arbuscular mycorrhiza fungi are biotrophic organisms. As such, they cannot be cultivated independently but rely on interaction with host plants to stay alive and complete their life cycle. This characteristic makes it challenging to study the two symbiotic organisms and especially the fungus separately.
To cultivate, treat and harvest the fungus separately from the host root, a 2-compartmented Petri dish system was developed and used for labelling studies in previous work (Bécard and Fortin, 1988; Pfeffer et al., 1999; Trépanier et al., 2005). This system is composed of two compartments; one containing a Ri (root-inducing) T-DNA transformed carrot root (Mosse and Hepper, 1975), which hosts the fungus (‘carrot compartment’) and another one, which contains only the fungus (fungal compartment), because the extraradical mycelium has grown across the border, which divides the two compartments. Kuhn et al. (2010) have advanced this setup to colonize Medicago truncatula tester plants in the fungal compartment.
In this protocol, we used this previous knowledge and further modified the system to our needs. Combining this growth system with stable isotopolog labelling and profiling (Eisenreich et al., 2013) enables analysis of plant and fungal metabolites separately from each other to gain information about metabolite fluxes between the two symbionts.
Materials and Reagents
Growth system setup
Fine sandpaper (60 µm)
2-Compartmented Petri dish (diam. 9.4 cm) (Greiner Bio One International, catalog number: 635161 )
Square Petri dishes (12 cm) (Greiner Bio One International, catalog number: 688161 )
Pipette tips
Scalpel
Parafilm
2.0 ml Eppendorf tubes
1.5 ml Eppendorf tubes
Black card-sheet paper (50 x 70 cm; 150 g/m2)
Adhesive tape
Sterile Rhizophagus irregularis spores (Agronutrition, Carbonne, France; LOT: 000300195)
1% NaClO solution
Bacto agar (BD, BactoTM, catalog number: 214010 )
EtOH
[U13C6]-Glucose (Sigma-Aldrich, catalog number: 389374 )
10% KOH
Ink & vinegar staining solutions (Vierheilig et al., 1998)
Liquid nitrogen
MSR plate with carrot root organ culture (Bécard and Fortin, 1988)
MSR plate with colonized carrot root organ culture (Bécard and Fortin, 1988)
Sucrose
Gelrite (Duchefa Biochemie, catalog number: G1101 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: M2773 )
Potassium nitrate (KNO3) (Sigma-Aldrich, catalog number: P8291 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Calcium nitrate tetrahydrate (Ca(NO3)2·4H2O) (Sigma-Aldrich, catalog number: C2786 )
Calcium pantothenate (B5) (Sigma-Aldrich, catalog number: 705837 )
Biotin (B7) (Sigma-Aldrich, catalog number: B4639 )
Nicotinic acid (B3) (Sigma Aldrich; catalog number: N0761 )
Pyridoxine (B6) (Sigma-Aldrich, catalog number: P5669 )
Thiamine (B1) (Sigma-Aldrich, catalog number: T1270 )
Cyanocobalamine (B12) (Sigma-Aldrich, catalog number: V6629 )
NaFeEDTA (Sigma-Aldrich, catalog number: E6760 )
Manganese(II) sulfate tetrahydrate (MnSO4·4H2O) (Merck, catalog number: 102786 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: Z1001 )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: B6768 )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (Sigma-Aldrich, catalog number: C8027 )
Sodium molybdate dihydrate (Na2MoO4·2H2O) (Sigma-Aldrich, catalog number: M1651 )
Ammonium molybdate tetrahydrate ((NH4)6Mo7O24·4H2O) (Sigma-Aldrich, catalog number: M1019 )
Sodium citrate dihydrate (Sigma-Aldrich, catalog number: W302600 )
Citric acid monohydrate (Sigma-Aldrich, catalog number: C1909 )
MSR-medium (w/3% gelrite, w/10% sucrose) (see Recipes)
Solution 1: Macroelements
Solution 2: Calcium nitrate
Solution 3: Vitamins
Solution 4: NaFeEDTA
Solution 5: Microelements
MSR medium (w/ 3% gelrite, w/o 10% sucrose) (see Recipes and adjust accordingly)
Note: Refer to MSR-medium (w/ 3% gelrite, w/10% sucrose) in Recipe section for preparation of this medium.
MSR medium (w/o 3% gelrite, w/o sucrose) (see Recipes and adjust accordingly)
Note: Refer to MSR-medium (w/ 3% gelrite, w/ 10% sucrose) in Recipe section for preparation of this medium.
10 mM citrate buffer (see Recipes)
0.1 M sodium citrate
0.1 M citric acid
Isotopolog profiling
1.5 ml glass vials and screw caps for GC/MS autosampler (VWR, catalog numbers: 548-0018 and 548-0814 )
MeOH containing 3 M HCl (Sigma-Aldrich, catalog number: 33050-U )
Hexane, anhydrous (Sigma-Aldrich, catalog number: 296090 )
Equipment
Growth system setup
Mortar
Rotator
Incubator at 25 °C without lights
Plant growth chamber, set at 24 °C, 16/8 h day/night cycle
Clean bench
Bunsen burner
Microwave
25 ml flasks
Balance
Magnetic stirrer
Stir bars
Forceps
Pipettes
Microcentrifuge
Benchtop N2 container
-80 °C freezer
Isotopolog profiling
Freeze dryer (Christ, Osterode, Germany)
Drying oven
GCMS-QP 2010 plus with autosampler AOC20i and LabSolution software (Shimadzu, model: GCMS-QP 2010 Plus )
Silica capillary column (equity TM-5; 30 m by 0.25 mm, 0.25-µm film thickness; Sigma-Aldrich, Supelco, catalog number: 28089-U )
Software
LabSolution software: https://www.shimadzu.com/an/gc/advflowtech/sw-dl.html
Isotopo: http://www.tr34.uni-wuerzburg.de/software_developments/isotopo/
R (https://www.r-project.org/)
Procedure
Growth system setup
Cultivation of Lotus japonicus seedlings
Lotus japonicus seeds are carefully scarified with sandpaper inside a mortar until the seeds turn slightly grey (Figures 1A-1D). They are then surface sterilized with 1% NaClO for 6 min, washed three times with sterile water and subsequently incubated in sterile water on a rotator for 180 min at room temperature. Imbibed seeds are placed in four rows, each row with 20 seeds, on square Petri dishes (Figure 1E) containing 0.8% Bacto agar and incubated in the dark at 24 °C for 3 days.
Subsequently, the germinated seedlings on square Petri dishes are cultivated for additional 10 days in the light (16 h/8 h day-night cycle) at 24 °C. Then they are used for the two-compartment setup (Figure 1G). The plates are placed into dark-colored flat boxes (Figure 1F) to provide a dark-stimulus to the roots from the bottom and encourage straight growth.
Figure 1. Cultivation of Lotus japonicus seedlings. A and C. Lotus japonicus seeds are carefully scarified with sandpaper inside a mortar until the seeds turn slightly grey. Seeds before (B) and after (D) scarification. E. Imbibed seeds on 0.8% Bacto agar plates. F. Cultivation of seedlings in dark-coloured flat boxes (16 h light/8 h dark for 10 days). G. Seedlings ready for transfer to 2-compartement setups.
Cultivation of carrot root organ culture on 2-compartment test Petri dishes
All steps need to be performed in a clean bench to avoid contamination of root organ culture.
Both compartments (tester & nurse compartment, Figure 2A) of the spilt Petri dish are filled with MSR medium. However, only the MSR medium of the nurse compartment contains 10% sucrose, whereas the MSR medium of the tester compartment does not. Both compartments need to be filled with medium up to the top of the dish in order to assure the availability of sufficient substrate during the entire course of cultivation.
A fresh root piece (about 2.5 cm) of a carrot root organ culture is placed onto the medium in the nurse compartment. The Petri dish is closed, sealed with Parafilm and incubated for 1 week upside down in darkness at 25 °C.
7 days later, the carrot root culture in the nurse compartment is inoculated with R. irregularis. To this end, MSR-agar blocks (about 0.125 cm3) from another root organ culture containing fungal spores and mycelium are placed on two different spots on the growing carrot root culture in the nurse compartment. The plate is sealed and again incubated upside down in total darkness at 25 °C to allow the fungus to colonize the whole plate including the tester compartment.
Incubate for 4 to 6 weeks. The plates need to be checked regularly (about once per week) in order to assure that only the fungus crosses the compartment barrier but the carrot roots do not. If carrot roots grow across the barrier to the tester compartment they need to be pruned using sterile scissors.
When the fungal extraradical mycelium has spread over both compartments (both compartments are covered with fungal hyphae) you can proceed to the next stage.
Placement of two Lotus seedlings into the tester compartment
Clean the lid of the Petri dish with EtOH using a tissue paper to ensure maximum sterility.
Heat forceps in the flame of a Bunsen burner and use the hot forceps to melt three holes (approx. 0.5 cm diameter) into the lid of the Petri dish on the tester compartment side. Two of the holes are needed for Lotus growth and the third is later used for labelled substrate application.
13 days old Lotus seedlings are placed through the prepared lid holes in the tester compartment. Take care that the root is well-attached to the medium and is not hanging loose in the air.
Seal the Petri dish with Parafilm.
Carefully seal the two seedling holes as well as the application hole with Parafilm to avoid contamination.
Cover seedlings immediately with a 2 ml Eppendorf tube (like a mini-greenhouse) to prevent them from drying out. Keep seedlings covered for the first 5 days of incubation.
Build black envelopes yourself from commercially available cardboard sheets to cover the Petri dish such that the roots and fungus are kept in the dark and the Lotus shoots are in the light (Figures 2B-2D).
Incubate for 3 weeks at 24 °C, 16/8 h day/night cycle until the fungus has colonized the root.
Application of [U13C6]-glucose
Labelled glucose is applied 3 weeks after Lotus seedling placement.
100 mg of [U13C6]-glucose are dissolved in 2 ml MSR-medium (w/o sugar, w/o gelrite).
The 2 ml [U13C6]-glucose/MSR solution is carefully pipetted into the tester compartment via the application hole in the lid. Strictly avoid that the labelled glucose solution also drips in the nurse compartment and wait until the liquid has soaked into the agar before moving the plate.
After application of the labelled substrate, the application hole of the Petri dish is sealed again and the setup is incubated in the growth chamber for another week.
Note: One week after the stable isotope-labelled substrate has been added, the tester plants as well as the extraradical mycelium of the fungus are harvested.
Harvest of the tester plants
Both plants are carefully isolated from the plate. By slowly lifting the lid of the Petri dish the attached Lotus plants will be extricated from the medium. Make sure that no gelrite pieces remain on the roots.
Use one of the plants for quantification of root length colonization. Place the root of this plant in 10% KOH. Later stain the root with ink & vinegar (Vierheilig et al., 1998) and quantify root length colonization using a modified gridline intersect method (McGonigle et al., 1990).
The other root system is used for isotopolog profiling. Place it into a 2 ml Eppendorf tube and immediately shock freeze it in liquid nitrogen.
Extraction of the fungal extraradical mycelium
The MSR/gelrite medium of the tester compartment is cut into small pieces (about 0.125 cm3) and transferred into a 25 ml flask filled with citrate buffer.
The buffer containing gelrite pieces is stirred for 15 min using a magnetic stirrer (750 rpm). Within this time the gelrite is dissolved and the fungal mycelium knots together.
When knotted together, transfer the mycelium into a 1.5 ml Eppendorf tube by fishing it from the buffer with forceps.
Centrifuge the tube for 1 min at 9,391 x g and remove the residual liquid.
Subsequently shock freeze the sample in liquid nitrogen and keep it in a -80 °C freezer until mass spectrometry.
Figure 2. Growth system setup. A. Cultivated Lotus japonicus plants in the split Petri dish growth system at 4 weeks post placement. B. Example of a black carton envelope to keep the plate with roots and fungus in the dark. The red adhesive tape serves to close the opening of the paper envelope. C-D. Completed setup ready for incubation without (C) or with (D) Eppendorf tubes to prevent the seedlings from drying out.
Isotopolog profiling
Freeze dry the samples.
Transfer samples to 1.5 ml glass vials.
Derivatize with 500 µl MeOH containing 3 M HCl (Sigma-Aldrich) at 80 °C for 20 h.
Dry the sample using a gentle stream of nitrogen gas.
Add 100 µl dry hexane to dissolve methyl esters of the fatty acids.
Analyze the samples by GC/MS: use a quadrupole GC/MS machine equipped with an autosampler and heated injection port (GCMS-QP 2010 plus; Shimadzu).
GC/MS setup.
Inject an aliquot of the solution in split mode (1:5) at an injector and interface temperature of 260 °C.
Hold the column at 170 °C for 3 min, then increase temperature by a gradient of 2 °C/min to a temperature of 192 °C, afterwards by a temperature gradient of 30 °C/min to a final temperature of 300 °C.
Perform one scan run for each sample, detecting a mass range from m/z 45-600, for unambiguous identification of the fatty acid and for confirmation of the retention times; this is especially important after a longer period, without this special analysis, and after a column change.
Analyse samples in SIM (single ion monitoring) mode (m/z values 267 to 288) at least three times. Retention times for fatty acids 16:1 ω5 (unlabeled m/z 268) and 16:0 (unlabeled m/z 270) are 12.87 min and 13.20 min, respectively. For the analysis of other fatty acids, determine retention times and m/z values in scan runs and implement the values into the SIM method.
Collect data with LabSolution software or the software connected to your GC/MS system.
Calculate overall 13C enrichment and isotopolog composition by comparison with an unlabeled sample according to Ahmed et al. (2014). The software package is open source and can be downloaded by the following link: http://www.tr34.uni-wuerzburg.de/software_developments/isotopo/.
Compare overall 13C excess (average value of 13C atoms incorporated into 16:0/16:1 ω5 fatty acids) as well as isotopomer distribution (M + 1, M + 2, M + 3, … M + 16). For detailed explanation of nomenclature see Eisenreich et al. (2013).
Perform at least three independent labeling experiments.
Data can be displayed as stacked columns as shown in Figure 3.
Figure 3. Schematic representation of the istotopolog profiling pipeline. Analysis of samples via GC/MS SIM results in chromatograms of derivatized fatty acids. The individual mass spectra of 16:0 and 16:1 ω5 are extracted and the isotopomer distribution as well as the 13C overall excess (o.e) of these fatty acids is calculated. The isotopomer patterns can be displayed as stacked bars.
Data analysis
Statistical differences of overall 13C excess values for the different tested plant genotypes are analyzed via ANOVA followed by posthoc Tukey test in R, using at least 3 biological replicates per genotype.
Notes
Differences in root system development, distribution of labelled substrate on the Petri dish and the resulting differences in uptake of labelled substrate by the plant can lead to divergent isotopolog patterns among samples (see Keymer et al., 2017). However, when a metabolite (i.e., lipid) is transferred from the plant to the fungus, the isotopolog pattern among plant root and associated extraradical fungal mycelium is equivalent, notwithstanding the inter-sample variation.
Recipes
MSR-medium (w/ 3% gelrite, w/ 10% sucrose)
Medium preparation for 1 L:
Solution 1
10 ml
Solution 2
10 ml
Solution 4
5 ml
Solution 5
1 ml
Sucrose
10 g
Adjust to pH 5.5
Autoclave
Solution 3
5 ml
Solution 1: Macroelements
39.6 g MgSO4·7H2O
3.8 g KNO3
3.3 g KCl
0.21 g KH2PO4 in 500 ml H2O
Solution 2: Calcium nitrate
17.95 g Ca(NO3)2·4H2O in 500 ml H2O
Solution 3: Vitamins
90 mg calcium panthotenate (B5)
0.1 mg biotin (B7)
100 mg nicotinic acid (B3)
90 mg pyridoxine (B6)
100 mg thiamine (B1)
40 mg cyanocobalamine (B12) in 500 ml H2O
Solution 4: NaFeEDTA
0.4 g NaFeEDTA in 500 ml H2O
Solution 5: Microelements
(1) 1.225 g MnSO4·4H2O in 50 ml adjust to 100 ml
(2) 0.14 g ZnSO4·7H2O in 50 ml adjust to 100 ml
(3) 0.925 g H3BO3 in 50 ml adjust to 100 ml
(4) 1.1 g CuSO4·5H2O in 30 ml adjust to 50 ml
(5) 0.12 g Na2MoO4·2H2O in 50 ml adjust to 100 ml
(6) 1.7 g (NH4)6Mo7O24·4H2O in 50 ml adjust to 100 ml
Mix 100 ml (1) + 100 ml (2) + 100 ml (3) +5ml (4) + 1 ml (5) + 1 ml (6) and adjust to 500 ml to obtain Solution 5
10 mM citrate buffer
180 ml (0.1 M sodium citrate) + 820 ml (0.1 M citric acid) (you need 25 ml per compartment)
For 1.0 L stock solutions:
0.1 M sodium citrate: 29.41 g sodium citrate dehydrate (FW = 294.10 g/mol)
0.1 M citric acid: 21.01 g citric acid monohydrate (FW = 210.14 g/mol)
Acknowledgments
This protocol was developed for the work published in Keymer et al. (2017) financed by the Hans Fischer Gesellschaft e. V. to WE and by the Collaborative Research Center 924 (SFB924) of the Deutsche Forschungsgemeinschaft (DFG) ‘Molecular Mechanisms of Yield and Yield Stability in Plants’ (project B03) to CG. The authors have not conflicts of interest or competing interests.
References
Ahmed, Z., Zeeshan, S., Huber, C., Hensel, M., Schomburg, D., Münch, R., Eylert, E., Eisenreich, W., and Dandekar, T. (2014). ‘Isotopo’ a database application for facile analysis and management of mass isotopomer data. Database (Oxford): bau077.
Bécard, G. and Fortin, J. A. (1988). Early events of vesicular–arbuscular mycorrhiza formation on Ri T-DNA transformed roots. New Phytologist 108: 211-218.
Eisenreich, W., Huber, C., Kutzner, E., Knispel, N. and Schramek, N. (2013). Isotopologue profiling: towards a better understanding of metabolic pathways. In: Weckwerth, W. and Kahl, G. (Eds). The Handbook of Plant Metabolomics. Wiley-Blackwell 26-56.
Jiang, Y., Wang, W., Xie, Q., Liu, N., Liu, L., Wang, D., Zhang, X., Yang, C., Chen, X., Tang, D. and Wang, E. (2017). Plants transfer lipids to sustain colonization by mutualistic mycorrhizal and parasitic fungi. Science 356: 1172-1175.
Keymer, A., Pimprikar, P., Wewer, V., Huber, C., Brands, M., Bucerius, S. L., Delaux, P. M., Klingl, V., Ropenack-Lahaye, E. V., Wang, T. L., Eisenreich, W., Dormann, P., Parniske, M. and Gutjahr, C. (2017). Lipid transfer from plants to arbuscular mycorrhiza fungi. Elife 6: e29107.
Kuhn, H., Kuster, H. and Requena, N. (2010). Membrane steroid-binding protein 1 induced by a diffusible fungal signal is critical for mycorrhization in Medicago truncatula. New Phytol 185(3): 716-733.
Luginbuehl, L. H., Menard, G. N., Kurup, S., Van Erp, H., Radhakrishnan, G. V., Breakspear, A., Oldroyd, G. E. D. and Eastmond, P. J. (2017). Fatty acids in arbuscular mycorrhizal fungi are synthesized by the host plant. Science 356: 1175-1178.
McGonigle, T. P., Miller, M. H., Evans, D. G., Fairchild, G. L. and Swan, J. A. (1990). A new method which gives an objective measure of colonization of roots by vesicular—arbuscular mycorrhizal fungi. New Phytol 115: 495-501.
Mosse, B. and Hepper, C. (1975). Vesicular-arbuscule mycorrhizial infections in root organ cultures. Phys Plant Pathol 5: 215-223.
Pfeffer, P. E., Douds Jr, D. D., Becard, G. and Shachar-Hill, Y. (1999). Carbon uptake and the metabolism and transport of lipids in an arbuscular mycorrhiza. Plant Physiol 120(2): 587-598.
Rich, M. K., Nouri, E., Courty, P. E. and Reinhardt, D. (2017). Diet of arbuscular mycorrhizal fungi: bread and butter? Trends Plant Sci 22(8): 652-660.
Trépanier, M., Becard, G., Moutoglis, P., Willemot, C., Gagne, S., Avis, T. J. and Rioux, J. A. (2005). Dependence of arbuscular-mycorrhizal fungi on their plant host for palmitic acid synthesis. Appl Environ Microbiol 71(9): 5341-5347.
Vierheilig, H., Coughlan, A. P., Wyss, U. and Piche, Y. (1998). Ink and vinegar, a simple staining technique for arbuscular-mycorrhizal fungi. Appl Environ Microbiol 64: 5004-5007.
Wewer, V., Brands, M. and Dormann, P. (2014). Fatty acid synthesis and lipid metabolism in the obligate biotrophic fungus Rhizophagus irregularis during mycorrhization of Lotus japonicus. Plant J 79: 398-412.
Copyright: Keymer et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Keymer, A., Huber, C., Eisenreich, W. and Gutjahr, C. (2018). Tracking Lipid Transfer by Fatty Acid Isotopolog Profiling from Host Plants to Arbuscular Mycorrhiza Fungi. Bio-protocol 8(7): e2786. DOI: 10.21769/BioProtoc.2786.
Keymer, A., Pimprikar, P., Wewer, V., Huber, C., Brands, M., Bucerius, S. L., Delaux, P. M., Klingl, V., Ropenack-Lahaye, E. V., Wang, T. L., Eisenreich, W., Dormann, P., Parniske, M. and Gutjahr, C. (2017). Lipid transfer from plants to arbuscular mycorrhiza fungi. Elife 6: e29107.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Lipid
Microbiology > Microbe-host interactions > Fungus
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,787 | https://bio-protocol.org/exchange/protocoldetail?id=2787&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bacterial Competition Assay Based on Extracellular D-amino Acid Production
LA Laura Alvarez
FC Felipe Cava
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2787 Views: 7873
Edited by: Emily Cope
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Bacteria live in polymicrobial communities under tough competition. To persist in a specific niche many species produce toxic extracellular effectors as a strategy to interfere with the growth of nearby microbes. One of such effectors are the non-canonical D-amino acids. Here we describe a method to test the effect of D-amino acid production in fitness/survival of bacterial subpopulations within a community. Co-cultivation methods usually involve the growth of the competing bacteria in the same container. Therefore, within such mixed cultures the effect on growth caused by extracellular metabolites cannot be distinguished from direct physical interactions between species (e.g., T6SS effectors). However, this problem can be easily solved by using a filtration unit that allows free diffusion of small metabolites, like L- and D-amino acids, while keeping the different subpopulations in independent compartments.
With this method, we have demonstrated that D-arginine is a bactericide effector produced by Vibrio cholerae, which strongly influences survival of diverse microbial subpopulations. Moreover, D-arginine can be used as a cooperative instrument in mixed Vibrio communities to protect non-producing members from competing bacteria.
Keywords: D-amino acid Competition Co-cultivation Viability D-amino acid oxidase (DAAO) assay
Background
Bacteria live in polymicrobial communities where a great diversity of species coexist and compete for the available resources. One of the many tactics that bacteria have devised to persist in a specific niche is the production of toxic extracellular metabolites as a strategy to interfere with growth and/or viability of other microbes. D-amino acids have been known for a long time to have a powerful effect in cell shape and viability in bacterial cultures (Bopp, 1965; Fox et al., 1944; Kobayashi et al., 1948; Yaw and Kakavas, 1952; Lark and Lark, 1959; Grula, 1960; Tuttle and Gest, 1960). However, it has not been until recently that D-amino acids have gained physiological meaning when it was reported that many taxonomically unrelated bacteria could release millimolar concentrations of non-canonical D-amino acids (NCDAAs) to the extracellular medium (Lam et al., 2009). Vibrio cholerae, the causative agent of the diarrheal disease cholerae, presents a periplasmic broad spectrum racemase called BsrV reported to produce a great variety of D-amino acids, mainly D-Met and D-Leu (Lam et al., 2009; Cava et al., 2011). Further studies demonstrated that the main mode of action of these D-amino acids was through their incorporation into the peptidoglycan polymer, an essential bacterial structure that plays a role in morphology determination and cell integrity (Caparros et al., 1992; Lam et al., 2009; Cava et al., 2011). Peptidoglycan is a macromolecule composed of glycan chains crosslinked by short peptides. Interestingly, NCDAAs can be incorporated into the peptidoglycan into the 4th or the 5th residue of the peptide stem of the muropeptide subunits and this editing has a key role in synchronizing cell wall metabolism with growth arrest (Lam et al., 2009; Cava et al., 2011).
A recent study demonstrated that the cell wall is not the only target of non-canonical D-amino acids (Alvarez et al., 2018). V. cholerae and many other bacteria produce a great variety of D-amino acids which have distinct functions (Lam et al., 2009; Alvarez et al., 2018). D-arginine stands out as a fitness modulator of bacterial subpopulations, since it shows a significantly higher growth inhibitory activity against a wide diversity of bacterial species compared with other D-amino acids. In contrast to D-methionine, which has a major modulatory role in cell wall biosynthesis, D-arginine growth inhibition is suppressed by mutations in the chaperone systems and the phosphate uptake machinery in several model organisms, strongly supporting different roles for NCDAAs in bacterial physiology (Alvarez et al., 2018).
Co-cultivation is an excellent method to assess the inhibitory effect of D-arginine in mixed bacterial populations. However, when the competing bacteria present very different growth rates (e.g., V. cholerae and Caulobacter crescentus used in this study), relative cell counting can be challenging. Besides, it might be difficult to assess the role of small metabolites in species competition when other mechanisms, such as cell-to-cell dependent interactions (e.g., T6SS), can occur simultaneously. Here we present a method to assess the effect of small metabolites on bacterial populations. The design is based in the compartmentalization of the competing subpopulations in two independent rooms separated by a filter that permits diffusion of small metabolites such as amino acids. Furthermore, this method can be used to demonstrate the metabolic cooperation between producer and non-producer bacteria (e.g., V. cholerae wild-type and ΔbsrV mutant) that share extracellular D-amino acids to outcompete other species in the environment. Finally, we also describe the methodology to determine the total D-amino acid concentration in the media.
Materials and Reagents
Wired-loop or disposable inoculation loops (SARSTEDT, catalog number: 86.1562.050 )
15 ml test tubes (SARSTEDT, catalog number: 62.554.502 )
Cuvettes (SARSTEDT, catalog number: 67.742 )
150 ml Stericup filtration units, 0.22 µm pore size (Merck, catalog number: SCGPU01RE )
Adhesive tape
Parafilm (Sigma-Aldrich, catalog number: P7793-1EA )
Needles (BD, catalog number: 302200 )
Syringes 1 ml, 10 ml (BD, catalog numbers: 303172 , 307736 )
1.5 ml microtubes (Eppendorf, catalog number: 0030120086 )
Sterile clear flat-bottom 96-well plates with lid (Corning, Falcon®, catalog number: 353072 )
Sterile glass beads 3 mm (Merck, catalog number: 1040150500 )
Petri dishes (SARSTEDT, catalog number: 82.1473 )
Filter units, 0.22 µm pore size (Merck, catalog number: SLGS033SB )
Disposable pipette tips (VWR, catalog numbers: 613-1083 , 613-1079 , 613-1077 )
Bacterial strains: V. cholerae N16961 lacZ+ wild-type, V. cholerae N16961 lacZ- ΔbsrV, Caulobacter crescentus NA1000
Trigonopsis variabilis DAAO (gift from Jose M. Guisan, Catalysis Department, ICP – CSIC, Spain) (Komarova et al., 2012)
L-Arginine (L-Arg) (Sigma-Aldrich, catalog number: A5006-100G )
D-Arginine (D-Arg) (Sigma-Aldrich, catalog number: A2646-5G )
Distilled water
MilliQ water
Hydrochloric acid fuming 37% (HCl) (Merck, catalog number: 1003171000 )
Tryptone (Peptone from casein) (VWR, catalog number: 84610.0500 )
Yeast extract (VWR, catalog number: 84601.0500 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 71376-1KG )
Sodium hydroxide pellets (NaOH) (Merck, catalog number: 1064821000 )
Peptone, meat (enzymatic digest of animal tissue) (VWR, catalog number: 84620.0500 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M2643-500G )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C5670-500G )
Bacteriological agar (VWR, catalog number: 84609.0500 )
Sodium phosphate monobasic monohydrate (NaH2PO4·H2O) (Sigma-Aldrich, catalog number: 71507-250G )
Sodium phosphate dibasic heptahydrate (Na2HPO4·7H2O) (Sigma-Aldrich, catalog number: 431478-250G )
Ortho-phosphoric acid 85% (Merck, catalog number: 1005731000 )
Flavin adenine dinucleotide disodium salt hydrate (FAD) (Sigma-Aldrich, catalog number: F6625-100MG )
o-Phenylenediamine (OPD) (Sigma-Aldrich, catalog number: P23938-5G )
Methanol (VWR, catalog number: 20847.307 )
Horseradish peroxidase (Sigma-Aldrich, catalog number: 77332-100MG )
LB medium (see Recipes)
PYE medium (see Recipes)
Agar plates (see Recipes)
L- and D-amino acid stock solutions (see Recipes)
Sodium phosphate buffer 500 mM pH 7.5 (see Recipes)
DAAO reaction buffer (see Recipes)
Equipment
Laminar flow cabinet
Bunsen burner
Pipettes (Gilson, catalog numbers: F144563 , F144565 , F144566 )
Multichannel pipettes (Gilson, catalog number: F14403 )
Glassware: bottles, measurement cylinders, beakers
pH-meter (VWR, catalog number: 662-1422 )
Autoclave (CertoClav, catalog number: 8510174 )
Incubator (Memmert, catalog number: IN55 )
Shaker incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: MaxQTM 5000, catalog number: SHKE5000 )
Thermomixer with adapter for multi-well plates (Eppendorf, catalog numbers: 5355000011 , 5363000012 )
Spectrophotometer (GE Healthcare, catalog number: 29003605 )
Microplate reader (Biotek, model: EONTM, catalog number: EONC )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Alvarez, L. and Cava, F. (2018). Bacterial Competition Assay Based on Extracellular D-amino Acid Production. Bio-protocol 8(7): e2787. DOI: 10.21769/BioProtoc.2787.
Download Citation in RIS Format
Category
Microbiology > Microbial physiology > Interspecific competition
Microbiology > Microbial signaling > Interspecies communication
Biochemistry > Other compound > Amino acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,788 | https://bio-protocol.org/exchange/protocoldetail?id=2788&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Imaging Cytokine Concentration Fields Using PlaneView Imaging Devices
AO Alon Oyler-Yaniv
Oleg Krichevsky
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2788 Views: 6148
Edited by: Ivan Zanoni
Reviewed by: Marco Di Gioia
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
We describe here a method to visualize concentration fields of cytokines around cytokine-secreting cells. The main challenge is that physiological cytokine concentrations can be very low, in the pico-molar range. Since it is currently impossible to measure such concentrations directly, we rely on cell’s response to the cytokines–the phosphorylation of a transcription factor–that can be visualized through antibody staining. Our devices aim at mimicking conditions in dense tissues, such as lymph nodes. A small number of secreting cells is deposited on a polylysine-coated glass and covered by multiple layers of cytokine-consuming. The cells are left to communicate for 1 h, after which the top layers are removed and the bottom layer of cells is antibody labeled for the response to cytokines. Then a cross-section of cytokine fields can be visualized by standard fluorescence microscopy. This manuscript summarized our method to quantify the extent of cytokine-mediated cell-to-cell communications in dense collection of cells in vitro.
Keywords: Cytokine concentration Cytokine niches Imaging of cytokine fields
Background
The mammalian immune system has evolved to identify and limit the spread of potential pathogens while minimizing collateral tissue damage caused by the immune system itself. To achieve this, immune cells rely on a network of cytokine mediators that enable cell-to-cell communications and broadcast information about the magnitude and nature of the pathogenic insult. Vast arrays of different cytokines bind strongly to their cognate receptors, often with characteristic binding affinities in the nano- or pico-molar range. Immunological niches are generated via cytokine communications. For example, in both the bone marrow and the thymus, secretion of Interleukin-7 (IL-7) by stromal cells supports the survival of proliferating B and T cell progenitors, respectively (Tokoyoda et al., 2004; Alves et al., 2009). The size of the cytokine niche controls the number of maturing progenitors, thereby keeping the blood cell compartments in equilibrium (Böyum, 1968; Weist et al., 2015).
We aim to collect information about the spatial and temporal dynamics of cytokines and how these two parameters influence the immune response. This is an area of immunology that is currently under-studied. Many assays test the effects of cytokines in tissue-culture dishes, where media is well-mixed, leading to homogeneous fields of growth and differentiation factors. The intricate and highly specialized architecture of the secondary lymphoid organs sets up niches where cells sense stimuli such as pathogen components and cytokines, proliferate, mature, differentiate, and die. Cytokine concentration gradients are formed within these niches such that some cells have greater or lesser access to cytokines than others (Liu et al., 2015). Measuring how far cytokines spread from their source, and the gradients they form, is key to unravelling the mechanism of the phenotypic heterogeneity of immune cells in differentiation, proliferation, and death (Feinerman et al., 2010; Busse et al., 2010; Höfer et al., 2012; Müller et al., 2012; Thurley et al., 2015).
Due to the typically low concentrations (pM range) of free cytokines in vivo, direct measurement of cytokine fields is difficult at best and maybe impossible. However, due to their high sensitivity to cytokine and graded, concentration-dependent response, the signaling levels of cells in response to cytokines can itself be used as a bio-sensor for cytokine concentrations (Oyler-Yaniv et al., 2017).
In this protocol, we describe how to directly image the signaling response generated around a cytokine producer in vitro, in conditions that mimic in vivo conditions: high cell density and no convection. Our method is general and can be applied to any cell type and any diffusible stimulus, and only depends on the existence of a specific antibody to target the downstream signaling molecule of interest and/or of live cell reporters.
Materials and Reagents
Pipette tips (USA Scientific, catalog numbers: 1111-1806 , 1111-3800 )
CELLSTAR Filter Cap Cell Culture Flasks T75 (Greiner Bio One International, catalog number: 658175 )
15 ml tube
Glass slides (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4951PLUS4 )
Coverslips (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 25X25-1 )
Silicone rubber compound (PDMS) (Momentive, catalog number: RTV615 )
PVP-treated PCTE Membranes, 13 mm diameter, 400 nm pore (Sterlitech, catalog number: PCT0413100 )
B16-F10 melanoma cells (ATCC, catalog number: CRL-6475 )
Mouse CD4 (L3T4) MicroBeads (Miltenyi Biotec, catalog number: 130-049-201 )
Phorbol 12-myristate 13-acetate (PMA) (Sigma-Aldrich, catalog number: P1585-1MG )
Ionomycin calcium salt (Sigma-Aldrich, catalog number: I0634-1MG )
Ficoll-paque plus (GE Healthcare, catalog number: 17144003 )
Recombinant mouse IL-2 (Thermo Fisher Scientific, eBioscienceTM, catalog number: 14-8021-64 )
Recombinant human IL-2 (gift from Dr. Kendall A. Smith, Cornell University)
Trypsin/EDTA solution (Thermo Fisher Scientific, GibcoTM, catalog number: R001100 )
Phosphate buffered saline (Sigma-Aldrich, catalog number: P4417 )
Glycine (Sigma-Aldrich, catalog number: 50046 )
Ovalbumin peptide SIINFEKL (Sigma-Aldrich, catalog number: S7951-1MG )
Cell Trace Far-Red (DDAO-SE) (Thermo Fisher Scientific, InvitrogenTM, catalog number: C34564 )
Poly-L-lysine solution (Sigma-Aldrich, catalog number: P8920-100ML )
Paraformaldehyde solution, 4% in PBS (Alfa Aesar, Affymetrix, catalog number: J19943 )
Methanol (Sigma-Aldrich, catalog number: MX0490-4 )
Fluoromount Aqueous Mounting Medium (Sigma-Aldrich, catalog number: F4680-25ML )
Triton 100-X (MP Biomedicals, catalog number: 0230022101-1l )
α-CD4, Alexa700, Pacific Blue (BD Bioscience clone RM4-5, BD, catalog numbers: 557956 , 558107 )
α-IL-2Rα, PE (Miltenyi Biotec clone 7D4, Miltenyi Biotec, catalog number: 130-102-593 )
Primary antibody rabbit α-phospho-STAT5 (pY694) (Cell Signaling clone C71E5, Cell Signaling Technology, catalog number: 9314S )
Primary antibody rabbit α-phospho-STAT1 (pY701) (Cell Signaling clone 58D6, Cell Signaling Technology, catalog numbers: 9167L )
Secondary polyclonal antibody α-rabbit IgG, Alexa 488 (Jackson ImmunoResearch, catalog number: 711-176-152 )
RPMI 1640 media with L-glutamine (Biological Industries, catalog number: 01-100-1A )
Heat-inactivated fetal bovine serum (Biological Industries, catalog number: 04-127-1A )
HEPES buffer (Biological Industries, catalog number: 03-025-1B )
Non-essential amino acids (Biological Industries, catalog number: 01-340-1B )
Sodium pyruvate (Biological Industries, catalog number: 03-042-1B )
Penicillin-streptomycin solution (Biological Industries, catalog number: 03-031-5B )
β-Mercaptoethanol (Sigma-Aldrich, catalog number: M3148-25ML )
Complete RPMI (see Recipes)
Equipment
Pipettes
Heraeus centrifuge with microplate swinging rotor (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM BiofugeTM StratosTM )
Zeiss Axiovert 200M microscope (ZEISS, model: Axiovert 200M )
Software
MATLAB, Mathworks Inc.
LabVIEW, National Instruments
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Oyler-Yaniv, A. and Krichevsky, O. (2018). Imaging Cytokine Concentration Fields Using PlaneView Imaging Devices. Bio-protocol 8(7): e2788. DOI: 10.21769/BioProtoc.2788.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Cytokine
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,789 | https://bio-protocol.org/exchange/protocoldetail?id=2789&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessing Prepulse Inhibition of Startle in Mice
CI Christina Ioannidou
GM Giovanni Marsicano
AB Arnau Busquets-Garcia
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2789 Views: 10839
Reviewed by: Xi FengJuan Facundo Rodriguez Ayala
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Animal models are an important tool for studying neuropsychiatric disorders. However, a major challenge for researchers working with laboratory rodents is trying to reproduce ‘core’ symptoms of complex human disorders such as schizophrenia. Despite this challenge, however, it is still conceivable to use animal models designed to reproduce some of the disease’s ‘endo-phenotypes’. One example is the prepulse inhibition (PPI) of the startle reflex. PPI is a form of startle plasticity and is characterized by a normal reduction in startle magnitude that occurs when an intense startling stimulus (or pulse) is preceded by a weaker pre-stimulus (or prepulse). The PPI paradigm is commonly used to evaluate sensorimotor gating and it has been described in numerous species including humans and rodents. Deficits in PPI have been observed in subjects with schizophrenia and other neuropsychiatric diseases, as well as in established animal models of these disorders. The PPI paradigm is therefore largely used to explore genetic and neurobiological mechanisms underlying the sensorimotor gating phenotypes found in these disorders. Thus, it is necessary to set up reliable and reproducible protocols to study PPI in mice.
Keywords: Prepulse inhibition of startle PPI Animal models Schizophrenia Sensorimotor gating
Background
Sensorimotor gating refers to the ability of a sensory event to suppress a motor response (Cryan and Reif, 2012). One form of sensorimotor gating that has been widely studied in humans and rodents is the prepulse inhibition (PPI) of startle. The startle reflex consists of involuntary contractions of whole-body musculature elicited by sufficiently sudden and intense stimuli. Specifically, the acoustic startle response is characterized by an exaggerated flinching response to an unexpected strong auditory stimulus. PPI is a form of startle plasticity and it is characterized by a normal reduction in startle magnitude that occurs when an intense startling stimulus (or pulse) is preceded by a brief, low intensity prestimulus (or prepulse) (Graham, 1975; Hoffman and Ison, 1980). The PPI paradigm is commonly used to evaluate sensorimotor gating and it has been described in numerous species, including humans (Schwarzkopf et al., 1993) and mice (Carter et al., 1999; Frankland et al., 2004). Impaired PPI is observed in schizophrenia (Braff et al., 2001; Swerdlow et al., 2008), as well as other neuropsychiatric disorders including obsessive-compulsive disorder (Ahmari et al., 2012), Tourette’s syndrome (Swerdlow et al., 2001), Huntington’s disease (Swerdlow et al., 1995) and bipolar disorder (Perry et al., 2001). In patients with psychotic disorders, deficits in sensorimotor gating are associated with cognitive fragmentation and psychotic symptoms (Kapur, 2003). As these deficits have been found both in psychotic patients as well as in animal models (Swerdlow and Light, 2016), the PPI paradigm is largely used in the study of neuropsychiatric diseases and has proven a useful tool for studying and characterizing the effects of several anti-psychotics (Xue et al., 2012), and for exploring the mechanisms underlying psychotic-like behaviors (Geyer, 1999; Ouagazzal et al., 2001).
Materials and Reagents
Mice (C57BL6/N mice purchased from Janvier Labs, Le Genest-Saint-Isle, France)
Note: If pharmacological treatments are applied before PPI performance, the reagents will depend on the control or drug solutions prepared. Depending on the treatments applied prior to the testing, the animals can be housed in either single or collective cages.
70% ethanol
Equipment
SR-LAB startle apparatus with digitized electronic output (SR-Lab, San Diego Instruments, catalog number: 2325-0400 ) (Figure 1)
Digital sound level meter (FLIR Systems, Extech, catalog number: 407730 )
Figure 1. SR-LAB startle apparatus. A. Each experimental apparatus consists of an outer, lighted and ventilated, chamber that serves to prevent external noise or vibrations interfering with experiment. B. Inside the chamber a stabilimeter consisting of a Plexiglas cylinder is secured to a platform. C. A piezoelectric accelerometer-indicated by the red arrow-mounted under the cylinder transduces animal movements that are then digitized, rectified, and recorded by a computer and interface assembly. A loudspeaker-indicated by the blue arrow-generates the startling acoustic stimuli, according to the desired settings.
Software
SR-Lab Analysis software (SR-Lab San Diego Instruments, catalog number: 2325-0400)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ioannidou, C., Marsicano, G. and Busquets-Garcia, A. (2018). Assessing Prepulse Inhibition of Startle in Mice. Bio-protocol 8(7): e2789. DOI: 10.21769/BioProtoc.2789.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Sensorimotor response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
279 | https://bio-protocol.org/exchange/protocoldetail?id=279&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Schistosoma haematobium Egg Isolation
C Chi-Ling Fu
MH Michael H. Hsieh
Published: Vol 2, Iss 20, Oct 20, 2012
DOI: 10.21769/BioProtoc.279 Views: 11873
Original Research Article:
The authors used this protocol in Mar 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2012
Abstract
Schistosoma haematobiumis the etiologic agent for urogenital schistosomiasis, a major source of morbidity and mortality for more than 112 million people worldwide. Infection with S. haematobium results in a variety of immunopathologic sequelae caused by parasite oviposition within the urinary tract, which drives inflammation, hematuria, fibrosis, bladder dysfunction, and increased susceptibility to urothelial carcinoma. Since most of the pathology in schistosomasis is directly attributable to the host reaction to eggs and egg-associated antigens, their isolation and study are important experimental techniques. S. haematobium eggs can be collected from infected tissues for injection into other animals or preparation of crude egg extracts. This protocol describes a simple way to isolate eggs.
Schistosomes are a biohazard. Workers should wear latex gloves at all times when handling schistosomal materials or any tissues from infected animals.
Materials and Reagents
Schistosoma haematobium-infected hamster tissues (intestines and livers)
NaCl
1.2% (w/v) NaCl (autoclaved) (see Recipes)
0.85% (w/v) NaCl (autoclaved) (see Recipes)
Equipment
Waring blender, with variable speed control (Eberbach, model: 8580 semi-micro container and 2-speed Waring power base unit)
Stainless steel sieves (Newark Wire Cloth sieve No. 40, 80, 140, 325; mesh openings of 420 μm, 180 μm, 105 μm, and 45 μm)
Plastic spray bottle (e.g. Curtin-Matheson)
Glass Petri dishes with flat bottoms (Corning Incorporated, 100 x 20 mm)
Pasteur pipets
Hematocytometer
Microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Fu, C. and Hsieh, M. H. (2012). Schistosoma haematobium Egg Isolation. Bio-protocol 2(20): e279. DOI: 10.21769/BioProtoc.279.
Fu, C. L., Odegaard, J. I., Herbert, D. R. and Hsieh, M. H. (2012). A novel mouse model of Schistosoma haematobium egg-induced immunopathology. PLoS Pathog 8(3): e1002605.
Download Citation in RIS Format
Category
Immunology > Animal model > Other
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,790 | https://bio-protocol.org/exchange/protocoldetail?id=2790&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Primary Cultures from Human GH-secreting or Clinically Non-functioning Pituitary Adenomas
Roberto Würth
Alessandra Pattarozzi
Federica Barbieri
Tullio Florio
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2790 Views: 6445
Edited by: Oneil G. Bhalala
Reviewed by: Shweta GargJalaj Gupta
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
Pituitary adenomas are among the more frequent intracranial tumors usually treated with both surgical and pharmacological–based on somatostatin and dopamine agonists–approaches. Although mostly benign tumors, the occurrence of invasive behaviors is often detected resulting in poorer prognosis. The use of primary cultures from human pituitary adenomas represented a significant advancement in the knowledge of the mechanisms of their development and in the definition of the determinants of their pharmacological sensitivity. Moreover, recent studies identified also in pituitary adenomas putative tumor stem cells representing, according to the current hypothesis, the real cellular targets to eradicate most malignancies. In this protocol, we describe the procedure to establish primary cultures from human pituitary adenomas, and how to select, in vitro expand, and phenotypically characterize putative pituitary adenoma stem cells.
Keywords: Pituitary adenoma Cancer stem cells Primary cultures
Background
Pituitary adenomas are among the most common intracranial neoplasms (up to 15%) and cross-sectional studies have found a prevalence of around 90 cases per 100,000 inhabitants, with the vast majority being adults over 30 years old. Approximately 10% of unselected pituitaries examined at autopsy (i.e., considering also the pituitaries of subjects without previous diagnosis of pituitary disease) have developed adenomas (Molitch, 2017). Although often benign tumors, the management of pituitary adenomas can be complicated by the clinical syndromes related to hormone hypersecretion, or by the development of aggressive behavior characterized by resistance to treatment, high proliferation rate, rapid recurrence and extrasellar invasion (Carreno et al., 2017). The persistence of stem cells in adult pituitary (Florio, 2011) led to the hypothesis that the development of pituitary adenomas (and possibly of other benign neoplasia) can derive from subpopulations of tumor cells endowed with stem cell properties (mainly self-renewal and differentiation ability), as already established for malignant solid and hematologic tumors.
Recently experimental evidence showed that cancer stem cells (CSC) paradigm also applies to human and mouse pituitary adenomas (Donangelo et al., 2014; Peverelli et al., 2017; Wurth et al., 2017), and it was proposed that oncogenically-transformed CSCs can originate the tumor, clonally. The concept of CSC as tumor-initiating cells (TICs), initially developed for malignant neoplasia, proposes that only a subset of tumor cells, the CSC subpopulations, is responsible of initiating and maintaining tumor growth, causing invasiveness and the formation of metastasis, and conferring drug resistance (Clevers, 2011; Florio and Barbieri, 2012). This theory, leading to a cell hierarchy within a given tumor, replaced the stochastic model of cancerogenesis that proposed the bulk of solid tumors to be composed of cells showing equal tumorigenic potential. A more recent evolution of the CSC model is the ‘dynamic-stemness’ theory, which postulates an interchange between CSCs and more-differentiated (progenitors) cells, determined by epigenetic and microenvironmental signals, transcription factors, miRNAs or the activation of oncogenic pathways (Li and Laterra, 2012).
Besides the relevance from a theoretical point of view, the identification of putative CSCs in pituitary adenomas could represent the basis to identify possible novel pharmacological targets to treat pituitary adenomas, in particular for the more aggressive and poorly responsive subtypes.
Primary cultures from human pituitary adenomas have been used since long to study genetic and pharmacological features of these cells, but the definition of the presence of CSCs within pituitary adenomas raises the issue of their identification and isolation within a non-selected culture, and expansion in vitro to allow genetic, biological and pharmacological studies.
In this protocol, we describe the procedures to establish primary cultures from human pituitary adenomas and to select and expand in vitro putative CSCs (Wurth et al., 2017). Experimental data from their characterization are also reported.
Materials and Reagents
Aluminum foils (Cogepack, catalog number: 30060A )
Petri dishes 60 mm (Eppendorf, catalog number: 0030701119 )
Sterile mono-use scalpel (Paramount Surgimed)
15 ml centrifuge tubes (EUROCLONE, catalog number: ET5015B )
50 ml centrifuge tubes (EUROCLONE, catalog number: ET5050B )
100 µm cell strainer (Corning, Falcon®, catalog number: 352360 )
24-well plates (Eppendorf, catalog number: 0030722116 )
T-25 culture flask (Eppendorf, catalog number: 0030710029 )
Sterile tips
10 μl PCR clean/sterile (Eppendorf, catalog number: 022491202 )
200 μl PCR clean/sterile (Eppendorf, catalog number: 022491296 )
1,000 μl PCR clean/sterile (Eppendorf, catalog number: 0030077857 )
Autoclave indicator tape (Arintha Biotech, catalog number: TS1950 )
LS Columns (Miltenyi Biotec, catalog number: 130-042-401 )
8-well Chamber slides (Corning, Falcon®, catalog number: 354118 )
Coverslip (Menzel-Gläser)
pH paper
Membrane filter 0.45 µm (Merck, catalog number: HAWP04700 )
Sterile phosphate buffered saline (PBS) (EUROCLONE, catalog number: ECB4004L )
70% ethanol
Immune-magnetic sorting (Miltenyi Biotec, catalog number: 130-097-049 )
Ammonium-Chloride-Potassium (ACK) Lysing Buffer (Lonza, catalog number: 10-548E )
Anti-Fibroblast MicroBeads, human (Miltenyi Biotec, catalog number: 130-050-601 )
Normal Goat Serum (NGS) (Sigma-Aldrich, catalog number: G9023 )
CD133 MicroBead Kit–Tumor Tissue, human (Miltenyi Biotec, catalog number: 130-100-857 )
CD133, polyclonal rabbit (Abcam, catalog number: ab28364 )
Notch1 monoclonal mouse (Abcam, catalog number: ab44986 )
CXCR4 monoclonal mouse (R&D Systems, catalog number: MAB21651 )
Oct4, polyclonal rabbit (Abcam, catalog number: ab19857 )
Nestin, polyclonal rabbit (Abcam, catalog number: ab22035 )
D2R, monoclonal mouse (Santa Cruz Biotechnologies, catalog number: sc-5303 )
SSTR2A, polyclonal rabbit (Gramsch Laboratories, catalog number: SS-800 )
AlexaFluor 2nd antibody (488 and 568: Thermo Fisher Scientific, Invitrogen, catalog numbers: A-11008 and A-11004 )
DAPI (Sigma-Aldrich, catalog number: D9542 )
TrypLE-express dissociation reagent (Thermo Fisher Scientific, GibcoTM, catalog number: 12605 )
0.4% trypan blue solution (Bio-Rad Laboratories, catalog number: 145-0013 )
Bovine serum albumin (BSA) heat shock fraction, pH 7, ≥ 98% (Sigma-Aldrich, catalog number: A7906 )
EDTA (CARLO ERBA Reagents, catalog number: 405497 )
Minimum essential medium (MEM)/HAM’S F12 (1:1, EUROCLONE, catalog numbers: ECB2071L and ECB7502L )
Fetal bovine serum (FBS, Thermo Fisher Scientific, GibcoTM, catalog number: 10270098 )
L-glutamine (EUROCLONE, catalog number: BE17-605E )
Penicillin-streptomycin (EUROCLONE, catalog number: ECB3001D )
B27 (50x, Thermo Fisher Scientific, GibcoTM, catalog number: 17504044 )
Leukemia inhibitory factor (LIF, Sigma-Aldrich, catalog number: L5283 )
bFGF (Miltenyi Biotec, catalog number: 130-093-838 )
EGF (Miltenyi Biotec, catalog number: 130-093-825 )
Paraformaldehyde (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 28908 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 71687 )
Glycine (AppliChem, catalog number: A3707 )
Triton X-100 (VWR, catalog number: 437002A )
Glycerol (Sigma-Aldrich, catalog number: 77067 )
Mowiol (Merck, catalog number: 475904 )
Tris buffer (pH 8.5)
Buffer for magnetic cell separator (see Recipes)
Pituitary adenoma stem cell medium (see Recipes)
Standard pituitary adenoma cell medium (see Recipes)
Formaldehyde solution (see Recipes)
100 mM glycine (see Recipes)
0.1% Triton X-100 (see Recipes)
Mowiol solution (see Recipes)
Equipment
Surgical scissors and forceps (Exacta Optech, catalog numbers: 6.236 264 and 9.204 222 )
Autoclave
Pipettes (10, 200, and 1,000 μl, Eppendorf, catalog numbers: 3123000020 , 3123000055 , and 3123000063 )
Tissue culture hood (Euroclone, BIOAIR, model: TopSafe 1.8m Class II )
Water bath (GFL, catalog number: 1083 )
Centrifuge (Eppendorf, models: 5810 R and 5427 R )
CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: 3111 )
Light microscope (Leica, model: Leica DMIL HC TYPE 090-135.001 )
MidiMACSTM Separator (Miltenyi Biotec, catalog number: 130-042-302 ) attached to a MultiStand (Miltenyi Biotec, catalog number: 130-042-303 )
Cell counter (Bio-Rad Laboratories, model: TC20TM )
Software
Statistic software (i.e., PRISM, GraPhad or similar)
ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Würth, R., Pattarozzi, A., Barbieri, F. and Florio, T. (2018). Primary Cultures from Human GH-secreting or Clinically Non-functioning Pituitary Adenomas. Bio-protocol 8(7): e2790. DOI: 10.21769/BioProtoc.2790.
Download Citation in RIS Format
Category
Cancer Biology > Cancer stem cell > Cell biology assays
Stem Cell > Adult stem cell > Cancer stem cell
Cell Biology > Cell viability > Cell proliferation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,791 | https://bio-protocol.org/exchange/protocoldetail?id=2791&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescein Transport Assay to Assess Bulk Flow of Molecules Through the Hypocotyl in Arabidopsis thaliana
SD Salva Duran-Nebreda
GB George W. Bassel
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2791 Views: 6238
Edited by: Jyotiska Chaudhuri
Reviewed by: Smita NairAdam Idoine
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
The bulk transport of molecules through plant tissues underpins growth and development. The stem acts as a conduit between the upper and low domains of the plant, facilitating transport of solutes and water from the roots to the shoot system, and sugar plus other elaborated metabolites towards the non-photosynthetic organs. In order to perform this function efficiently, the stem needs to be optimized for transport. This is achieved through the formation of vasculature that connects the whole plant but also through connectivity signatures that reduce path length distributions outside the vascular system. This protocol was devised to characterize how cell connectivity affects the bulk flow of molecules traversing the stem. This is achieved by exposing young seedlings to fluorescein, for which no specific transporter is assumed to be present in A. thaliana, and assessing the relative concentration of this fluorescent compound in individual cells of the embryonic stem (hypocotyl) using confocal microscopy and quantitative 3D image analysis after a given exposure time.
Keywords: Connectomics Tissue architecture Cellular networks Bulk flow characterization
Background
The link between structure and function has always fascinated biologists, from the design spaces of organs (Eldredge, 1989) to the convergence or divergence of evolutionary paths (Morris, 2003). At a smaller scale, cells are also organized in a robust and tightly controlled manner, intimately related to the functions the tissue performs (Jackson et al., 2017a). The collection of cellular physical interactions that makes up a specific tissue can also be regarded as a network, a cellular connectome. This connectome is especially interesting in plants as shared cell walls impede cellular movement, thus the network dynamics depend only on cell death and replication.
We hypothesize that tissue architecture and thus cell connectomes are relevant to physiological features and organ function. This way, network metrics and quantitative networks analysis can be used to make predictions and gain understanding of biological systems (Duran-Nebreda and Bassel, 2017; Jackson et al., 2017b).
In the current example (Jackson et al., 2017a), we investigated the topological properties of different cell types in the embryonic stem by digitally capturing global cellular interactions using confocal microscopy, revealing systematic arrangements of reduced path length in the atrichoblast (non-hair forming) cell files. To address a possible functional link between the preferential movement of small molecules and this path length distribution, we developed a fluorescein transport assay. This involves exposing the embryos to fluorescein in a non-saturating manner and quantifying cell-type specific fluorescence following cell segmentation. Similar assays using fluorescein either with specific (Konishi et al., 2002; De Bruyn et al., 2011) or non-specific interactions (Wang and Fisher, 1994; Tichauer et al., 2015) exist, some using caged variants that allow for more control in activation and release (Kobayashi et al., 2007; Christensen et al., 2009). However, these did not provide a connection to global cellular connectivity and thus producing a general quantitative framework for structure-function relationships in tissue architecture and bulk transport processes.
Materials and Reagents
94 x 16 mm sterile Petri dishes (Greiner Bio One International, catalog number: 633181 )
Barky Ultipette capillary tips (Barky Instruments International, catalog number: CP-100 )
Aluminum foil or opaque container
Cellview cell culture dish, 35 x 10 mm glass bottom (Greiner Bio One International, catalog number: 627861 )
1.5 ml Eppendorf tube
Arabidopsis thaliana seeds
Sterile distilled water (type I water pH 7.0)
Bleach (Domestos)
Ethanol
Propidium iodide solution (Sigma-Aldrich, catalog number: P4864-10ML )
Murashige and Skoog basal salt mixture with vitamins (Duchefa Biochemie, catalog number: M0222 )
Agar-agar granular powder (Fisher Scientific, catalog number: A/1080/53 )
Fluorescein (Alfa Aesar, catalog number: L13251 )
Potassium hydroxide (Fisher Scientific, catalog number: P/5640/53 )
½ Murashige and Skoog medium (see Recipes)
Fluorescein plates (see Recipes)
Equipment
Tissue culture hood (Azbil Telstar, model: AH-100 )
20 μl pipette (Gilson, model: PIPETMAN P20L )
Small forceps (IDEAL-TEK, model: 4.SA.0 )
Inverted confocal microscope (ZEISS, model: LSM 710 )
Dissection microscope (Leica Microsystems stereo microscope, Leica Microsystems, model: Leica S6 E )
1,000 μl pipette (Gilson, model: PIPETMAN P1000L )
Heated bath or microwave
Water purification system (ELGA LabWater, model: Option-R 7 )
500 ml Pyrex bottles (DWK Life Sciences, DURAN, catalog number: 21 801 44 )
Autoclave (Dixons, catalog number: ST 2228 )
pH-meter (Hanna Instruments, model: pH 210 )
Growth cabinet or room (16 h light photoperiod with light intensity at 150-175 mmol m2 sec-1 at 23 °C and 8 h dark at 18 °C)
Software
ImageJ (Schindelin et al., 2012) with the Bio-formats plug-in
MorphoGraphX (Barbier de Reuille et al., 2015)
Note: Uses the CUDA toolkit, software developers recommend NVidia graphics card and enough memory to handle the stacks being processed.
Procedure
Germinating the seeds
Prepare in advance ½ MS Petri dishes as described in the ‘Recipes’ section.
Prepare a fresh 1/10 dilution of the commercial bleach with distilled water to sterilize the seeds.
Place 60-100 seeds of each ecotype or species in a separate 1.5 ml Eppendorf tube and add 500 μl of the bleach solution to each tube.
Incubate at RT for 5 min, mix by inverting the tube every minute.
Move to the tissue culture hood.
Sterilize the flexible pipette tips with ethanol.
Pipette out the bleach and wash the seeds three times with 500 μl of sterile distilled water.
Pick a string (10-30) of sterile seeds with a P20 pipette and the flexible pipette tips and put the seeds one by one and approximately 5 mm apart in a ½ MS plate.
Cover the Petri dishes with aluminum foil or an opaque container and take them to the growth room or cabinet at 23 °C.
Incubate in complete darkness for 4 days.
Note: This causes the seedlings to be elongated and to contain very little chlorophyll, which reduces autofluorescence of the sample during imaging, yielding better signal.
Fluorescein incubation treatment
Prepare on the same day a batch of fluorescein-agar plates as described in the ‘Recipes’ section.
Move the seedlings from the ½ MS plates to the fluorescein 0.8% agar Petri dishes using the small tweezers. Do not squeeze the seedlings as their walls are very thin at this point, lift them instead by putting the tweezer prongs under the cotyledons with minimal pressure. Place their root onto the agar surface such that the seedling does not fall onto its side. Use the dissection microscope to ease handling of the seedlings. Roots can be gently manipulated into the agar to ensure the seedling remains upright.
Incubate the seedlings in the growth room for 2.5 h under the light source to maximize fluorescein uptake.
Propidium iodide staining
Create a 5 μg/ml propidium iodide solution in water and place it in as many 1.5 ml Eppendorf tubes as needed.
Transfer the seedlings into these Eppendorf tubes (10-20 in each) using the same technique as before to avoid damaging them.
Incubate for 15 min at RT, mix by gently inverting the tube.
Move the seedlings from the Eppendorf tubes to imaging dishes (Cellview cell culture dishes) using a P1000 and a cut pipette tip. The dishes should contain as many non-overlapping samples as possible, usually between 3 and 5. The dissection microscope can be used at this stage to detect and remove damaged samples (cracks in the epidermis, snapped roots or squeezed sections).
Wash once with 300 μl of sterile distilled water and remove as much water as possible by pippeting, in such a way that the seedlings still have a layer of liquid around them. When imaging, add sterile distilled water as needed if the samples dry out.
Imaging
The following list contains a typical list of settings to image these samples:
25x oil immersion objective.
Zoom 1 (this can be changed to better suit the size of the ROI, although systematic warps to the images appear < 0.7 zoom).
Frame size: 2,048 x 2,048. This can be adjusted to the proportions of the ROI.
Bit depth: 16 bits.
Pinhole slice thickness: 1.9 μm (0.47 AU).
Slice interval (z direction): 0.7 μm.
Scan speed: 9.
Averaging: 4-8.
Fluorescein excitation: 488 nm.
Propidium iodide excitation: 535 nm.
Data analysis
The data obtained with this protocol should be processed using the same protocol described previously in Montenegro-Johnson et al. (2015) and Jackson et al. (2017a and 2017b). Namely, the propidium iodide channel is used to perform 3D segmentation of the cell boundaries as it stains cell walls, while the fluorescein signal within each cell is used to characterize bulk flow for each cell type in the hypocotyl. See Figure 1 for a typical example of the obtained confocal stacks before processing. The steps are as follows:
Load the confocal stacks into Fiji using the Bio-formats plugin and export each channel to a TIFF image format stack.
Load each TIFF stack onto MorphoGraphX.
Apply a Gaussian blur (typically 0.3 μm smooth length in each direction) to the propidium iodide channel.
Use the ITK watershed segmentation on the smoothed propidium iodide stack to find the cell boundaries. The threshold used varies depending on the staining and image acquisition settings.
Edit the stacks by fusing oversegmeneted cells as needed.
Create a mesh for the cells with ‘cube size: 2’ and no smooth passes as settings.
Calculate fluorescein concentration using the heat map function with ‘volume’ and ‘internal signal’ settings.
The three ecotypes used in the original study presented different average fluorescent readings, possibly due to innate differences in permeability and/or bulk uptake rates. Some ecotypes also displayed far greater variability than others. For this reason, in order to be pooled together all samples need to be normalized by within-sample mean fluorescence. Then to be comparable between ecotypes all pooled data has to be normalized by ecotype-wide mean corrected fluorescence.
Figure 1. Typical results of imaging Arabidopsis hypocotyls after fluorescein exposure and propidium iodide staining. A. Single confocal stack of an Arabidopsis root, with root hairs visible. Two channels are shown, in grey scale propidium iodide, which stains cell walls, and in green fluorescein moving inside the living cells. B. 3D reconstruction of a hypocotyl from dozens of confocal stacks in MorphoGraphX. Transparency is used to show fluorescein signal accumulated inside the first layer of cells. C. A Transversal clip from the 3D reconstruction reveals a pattern of fluorescein concentration correlating with cell type spatial arrangements. This allows us to address which cells are involved in greater bulk flow through the epidermis.
Recipes
½ Murashige and Skoog medium (Murashige and Skoog, 1962)
2.3 g/L of Murashige and Skoog salt mixture with vitamins
0.8 g/L of agar-agar granulated powder
Add 80% of the final volume of filter-purified water (type I water, > 18.2 MΩ-cm)
Adjust pH with a 1 M KOH solution to 6.2
Top to selected final volume with filter-purified water (type I water, > 18.2 MΩ-cm)
Autoclave and pour into sterile Petri dishes (20 ml/dish) inside a tissue culture hood. Store poured Petri dishes at 4 °C before use (1 month shelf life)
Fluorescein plates
Prepare in advance a 0.8 g/L agar-agar granulated powder mixture (follow the previous recipe but without adding the Murashige and Skoog salt mixture) and store at RT
Prepare a 50 mM fluorescein solution (1,000x stock in 1:1 ethanol:sterile distilled water) and store it avoiding direct light sources (2 months shelf life)
Melt the agar gel with a heated bath, steamer or by microwaving the gel thoroughly
Wait until the solution cools off, reaching 50-60 °C
Add the 1,000x fluorescein stock solution and pour the mix into Petri dishes (15 ml/dish). This need not be sterile and can be poured outside a tissue culture hood
Acknowledgments
This work was supported by BBSRC grants BB/J017604/1, BB/L010232/1 and BB/N009754/1 to GWB, and by Leverhulme Trust Grant RPG-2016–049 to S.D.-N. and GWB. The authors declare no conflict of interest.
References
Barbier de Reuille, P., Routier-Kierzkowska, A. L., Kierzkowski, D., Bassel, G. W., Schupbach, T., Tauriello, G., Bajpai, N., Strauss, S., Weber, A., Kiss, A., Burian, A., Hofhuis, H., Sapala, A., Lipowczan, M., Heimlicher, M. B., Robinson, S., Bayer, E. M., Basler, K., Koumoutsakos, P., Roeder, A. H., Aegerter-Wilmsen, T., Nakayama, N., Tsiantis, M., Hay, A., Kwiatkowska, D., Xenarios, I., Kuhlemeier, C. and Smith, R. S. (2015). MorphoGraphX: A platform for quantifying morphogenesis in 4D. Elife 4: 05864.
Christensen, N. M., Faulkner, C. and Oparka, K. (2009). Evidence for unidirectional flow through plasmodesmata. Plant Physiol 150(1): 96-104.
De Bruyn, T., Fattah, S., Stieger, B., Augustijns, P. and Annaert, P. (2011). Sodium fluorescein is a probe substrate for hepatic drug transport mediated by OATP1B1 and OATP1B3. J Pharm Sci 100(11): 5018-5030.
Duran-Nebreda, S. and Bassel, G. W. (2017). Bridging scales in plant biology using network science. Trends Plant Sci 22(12): 1001-1003.
Eldredge, N. (1989). Macroevolutionary Dynamics: Species, Niches and Adaptive Peaks. McGraw Hill.
Jackson, M. D., Xu, H., Duran-Nebreda, S., Stamm, P. and Bassel, G. W. (2017a). Topological analysis of multicellular complexity in the plant hypocotyl. Elife 6: e26023.
Jackson, M. D. B., Duran-Nebreda, S. and Bassel, G. W. (2017b). Network-based approaches to quantify multicellular development. J R Soc Interface 14(135).
Kobayashi, T., Urano, Y., Kamiya, M., Ueno, T., Kojima, H. and Nagano, T. (2007). Highly activatable and rapidly releasable caged fluorescein derivatives. J Am Chem Soc 129(21): 6696-6697.
Konishi, Y., Hagiwara, K. and Shimizu, M. (2002). Transepithelial transport of fluorescein in Caco-2 cell monolayers and use of such transport in in vitro evaluation of phenolic acid availability. Biosci Biotechnol Biochem 66(11): 2449-2457.
Montenegro-Johnson, T. D., Stamm, P., Strauss, S., Topham, A. T., Tsagris, M., Wood, A. T., Smith, R. S. and Bassel, G. W. (2015). Digital single-cell analysis of plant organ development using 3DCellAtlas. Plant Cell 27(4): 1018-1033.
Morris, S. C. (2003). Life’s solution: inevitable humans in a lonely universe. Cambridge University Press.
Murashige, T. and Skoog, F. (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum 15(3): 473-497.
Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J. Y., White, D. J., Hartenstein, V., Eliceiri, K., Tomancak, P. and Cardona, A. (2012). Fiji: an open-source platform for biological-image analysis. Nat Methods 9(7): 676-682.
Tichauer, K. M., Guthrie, M., Hones, L., Sinha, L., St Lawrence, K. and Kang-Mieler, J. J. (2015). Quantitative retinal blood flow mapping from fluorescein videoangiography using tracer kinetic modeling. Opt Lett 40(10): 2169-2172.
Wang, N. and Fisher, D. B. (1994). The use of fluorescent tracers to characterize the post-phloem transport pathway in maternal tissues of developing wheat grains. Plant Physiol 104(1): 17-27.
Copyright: Duran-Nebreda and Bassel. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Duran-Nebreda, S. and Bassel, G. W. (2018). Fluorescein Transport Assay to Assess Bulk Flow of Molecules Through the Hypocotyl in Arabidopsis thaliana. Bio-protocol 8(7): e2791. DOI: 10.21769/BioProtoc.2791.
Jackson, M. D., Xu, H., Duran-Nebreda, S., Stamm, P. and Bassel, G. W. (2017a). Topological analysis of multicellular complexity in the plant hypocotyl. Elife 6: e26023.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Tissue analysis
Plant Science > Plant cell biology > Cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,792 | https://bio-protocol.org/exchange/protocoldetail?id=2792&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Centromere Chromosome Orientation Fluorescent in situ Hybridization (Cen-CO-FISH) Detects Sister Chromatid Exchange at the Centromere in Human Cells
Simona Giunta
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2792 Views: 8130
Edited by: Gal Haimovich
Reviewed by: Shalini Low-Nam
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Human centromeres are composed of large tandem arrays of repetitive alpha satellite DNA, which are often sites of aberrant rearrangement in cancers (Mitelman et al., 1997; Padilla-Nash et al., 2001). To date, annotation of the human centromere repetitive sequences remains incomplete, greatly hindering in-depth functional studies of these regions essential for chromosome segregation. In order to monitor sister chromatid exchange happening at the centromere (C-SCE) due to recombination and mutagenic events, I have applied the Chromosome-Orientation Fluorescence in situ Hybridization (CO-FISH) technique to centromeres (Cen-CO-FISH) in human cells. This hybridization-based method involves (1) the incorporation of nucleotide analogs through a single round of replication, (2) enzymatic digestion of the newly synthesized DNA strand and (3) subsequent hybridization of single-stranded probes, in absence of a denaturation step. The resulting signal allows to differentially label each sister chromatid based on the 5’-3’ directionality of the DNA and to score aberrant staining patterns indicative of C-SCE. The Cen-CO-FISH method applied to human centromeres revealed that human centromeres indeed undergo recombination in cycling cells resulting in C-SCE, and centromere instability is enhanced in cancer cell lines and primary cells undergoing senescence (Giunta and Funabiki, 2017). Here, I present the detailed protocol of the preparation, experimental procedure and data acquisition for the Cen-CO-FISH method in human cells. It also includes a conceptual overview of the technique, with examples of representative images and scoring guidelines. The Cen-CO-FISH represents a valuable tool to facilitate exploration of centromere repeats.
Keywords: Centromere Fluorescence in situ hybridization CO-FISH Alpha satellite Repetitive DNA Genome stability Recombination Sister chromatid exchange
Background
The human genome project was marked completed in 2003, yet it omitted over 10% of the human repetitive DNA (de Koning et al., 2011), including the centromere. The human centromere is a highly specialized genomic locus (Choo, 1997) playing a critical role during chromosome segregation where it serves as the site of kinetochore assembly to allow interaction with microtubules and sister chromatids separation during cell division (Cheeseman, 2014). Human centromeres are made of characteristic repetitive DNA sequences called alpha-satellites, whose linear assembly remains largely absent from the reference genomes. Here, I present the application of the Cen-CO-FISH technique to label human centromere and monitor recombination events resulting in crossover. Introduced by Bailey and colleagues over 20 years ago (Bailey et al., 1996), the CO-FISH method has been widely applied to detect recombination, fragility, replication timing, fusion and inversions at telomeres repeats, as well as to monitor mitotic segregation patterns and non-random sister chromatid segregation (Bailey et al., 2010). The application of this methodology to centromere, hereby called Cen-CO-FISH method, has revealed that the centromere-specific histone variant CENP-A, and CENP-A associated proteins CENP-C and CENP-T/W, work to prevent centromere instability and this functionality is compromised in cancer cell lines and in primary cells approaching replicative senescence that display higher number of C-SCE (Giunta and Funabiki, 2017). Cen-CO-FISH was used to assess centromere instability in cancer and during cellular senescence in human cells (Giunta and Funabiki, 2017) and it has been previously applied to study recombination (Jaco et al., 2008; de La Fuente et al., 2015) and sister chromatid separation patterns in mouse cells (Falconer et al., 2010). The wide application potentials of this methodology spans from quantitative detection of alpha satellite repeats, centromere recombination resulting in C-SCE, fragility, replication timing, fusion and inversions, as well as to monitor mitotic segregation patterns and non-random sister chromatids segregation (Bailey et al., 2010; Yadlapalli and Yamashita, 2013). Cen-CO-FISH fills the gaps in the missing genetic information that have cast a shadow over the centromere and other repetitive regions, bringing new light into the possibilities for functional exploration of these important loci of our genome.
Materials and Reagents
6 or 10 cm Petri dish (Corning, Falcon®, catalog numbers: 353002 or 353003 )
15 ml Falcon tube (Corning, Falcon®, catalog number: 352097 )
Frosted slides (Superfrost Plus; Fisher Scientific, catalog number: 12-550-15 )
Coverslips (24 x 60 mm) (Fisher Scientific, catalog number: 12-545-M )
Paper towel
Glass Pasteur pipette (Fisher Scientific, catalog number: 13-678-20A )
Gloves and lab coat
Human cells of interest and appropriate medium
Note: This protocol is for adherent cells, changes can be made for use for non-adherent cultures.
5’-Bromodeoxyuridine (BrdU) (MP Biomedicals, catalog number: 100166 )
Note: Prepare 10 mM stock solution in double distilled water (1,000x); make aliquots and store at -20 °C.
5’-Bromodeoxycytidine (BrdC) (Sigma-Aldrich, catalog number: B5002 )
Note: Prepare 10 mM stock solution in double distilled water (1,000x); make aliquots and store at -20 °C.
Colcemid (Roche Diagnostics, catalog number: 10295892001 ; already diluted 10 μg/ml)–Store at 4 °C
Phosphate-buffered saline (PBS)
Trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25300 )
Fetal bovine serum (Atlanta Biologicals)
Potassium chloride (KCl) (Fisher scientific, catalog number: P217-500 )
RNase A (Sigma-Aldrich, catalog number: R5000 )
Note: Prepare stock solution 50 mg/ml in 10 mM Tris-HCl pH 7.2. Aliquot and store at -20 °C.
Hoechst 33258 (Thermo Fisher Scientific, InvitrogenTM, catalog number: H3569 )
Note: Make a 10 μg/ml solution in double distilled water and store at 4 °C away from light.
Exonuclease III and buffer (Promega, catalog number: M1811 )–Keep at -20 °C
DAPI (Sigma-Aldrich, catalog number: D9542 )–0.5 mg/ml stock in water. Keep at 4 °C in the dark for one year
ProLong Gold Anti-fade Reagent (Thermo Fisher Scientific, InvitrogenTM, catalog number: P36934 )
Nail varnish (Sally Hansen, Transparent Harderer)
Methanol (Fisher Scientific, catalog number: A452-4 )
Glacial acetic acid (Fisher Scientific, catalog number: A38C-212 )
Ethanol 100% (Decon, catalog number: 2716 ), 90% and 70%
Blocking reagent (Roche Diagnostics, catalog number: 11096176001 )
Maleic acid (Sigma-Aldrich, catalog number: M0375 )
Sodium chloride (NaCl) (Merck, catalog number: SX0420-5 )
Sodium hydroxide (NaOH) (Fisher Scientific, catalog number: S318-500 )
Tris-HCl pH 7.2 (Sigma-Aldrich, CAS number: 1185-53-1)
Formamide (Fisher Scientific, catalog number: BP228 ; use deionized for hybridization)
Bovine serum albumin (BSA)
Tween-20 (Hoefer, CAS number: GR128-500)
Sodium citrate (Sigma-Aldrich, CAS number: 6132-04-3)
Magnesium chloride (MgCl2) (Fisher Scientific, catalog number: AC41341-5000)
Manufacturer: Acros Organics, catalog number: 413410025 .
Dithiothreitol (DTT) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0861 )
Hypotonic solution (see Recipes)
Fixative solution (see Recipes)
Ethanol dilution (see Recipes)
Blocking solution (see Recipes)
Hybridization solution (see Recipes)
Hybridization wash #1 (see Recipes)
Hybridization wash #2 (see Recipes)
Peptide nucleic acid (PNA) probes (custom probes from PNABio) (see Recipes)
Sodium chloride and sodium citrate buffer (SSC, see Recipes)
Equipment
Pipettes (Gilson)
Centrifuge (Eppendorf, model: 5810 R )
Coplin Jars (Scienceware, Sigma-Aldrich, catalog number: S5641 )
Heating block (VWR)
Water bath (Fisher Scientific, model: IsotempTM 210 )
Stratalinker with 365-nm UV light blubs (Spectralinker XL-1000 1800 UV irradiator) (Spectronics Corporation, model: XL-1000 )
Slides plastic tray–to fit into the Stratalinker
Hybridization chamber (see text for more details)
Orbital shaker
Imaging equipment:
DeltaVision Image Restoration microscope system (Applied Precision/GE Healthcare)
Olympus IX-70 microscope (Olympus, model: IX70 )
100x/1.40 UPLSAPO objective lens
CoolSnap QE CCD camera (Photometrics)
Software
SoftWoRx (Sold by Applied Precision)
Metamorph 7.8 (Sold by Universal Imaging)
Prism 5 (Sold by GraphPad)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Giunta, S. (2018). Centromere Chromosome Orientation Fluorescent in situ Hybridization (Cen-CO-FISH) Detects Sister Chromatid Exchange at the Centromere in Human Cells. Bio-protocol 8(7): e2792. DOI: 10.21769/BioProtoc.2792.
Download Citation in RIS Format
Category
Cancer Biology > Genome instability & mutation > Genetics
Cancer Biology > General technique > Immunological assays
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,793 | https://bio-protocol.org/exchange/protocoldetail?id=2793&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA Purification from the Unicellular Green Alga, Chromochloris zofingiensis
Sean D. Gallaher
MR Melissa S. Roth
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2793 Views: 7009
Reviewed by: Adam IdoineClaudia Catalanotti
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
Chromochloris zofingiensis is a unicellular green alga that is an emerging model species for studies in fields such as biofuel production, ketocarotenoid biosynthesis and metabolism. The recent availability of a high-quality genome assembly facilitates systems-level analysis, such as RNA-Seq. However, cells of this alga have a tough cell wall, which is a challenge for RNA purification. This protocol was designed specifically to breach the cell wall and isolate high-quality RNA suitable for RNA-Seq studies.
Keywords: Chromochloris zofingiensis Algae RNA purification RNA-Seq Cell wall
Background
Chromochloris zofingiensis is a small unicellular green alga from the chlorophyte lineage (Dönz, 1934). Previously, this species has been described in the literature with the genera Muriella, Chlorella, and Mychonastes (Fučíková and Lewis, 2012). There are strong economic interests in C. zofingiensis because it is capable of producing large quantities of lipids for biofuels and shows promise as a source of the commercially valuable nutraceutical astaxanthin (Breuer et al., 2012; Mulders et al., 2014; Liu et al., 2016). Recently, a high-quality, chromosome-level genome assembly and accompanying annotations were published, which facilitates systems level analyses like RNA-Seq (Roth et al., 2017). The following protocol was designed to produce highly purified total RNA, including miRNA, from liquid cultures of C. zofingiensis suitable for RNA-Seq. C. zofingiensis cells are protected by a robust cell wall, which this protocol was designed to penetrate. Starting material for the protocol can be up to 2.5 x 108 total cells. This protocol should yield at least 20 µg of highly purified RNA suitable for the preparation of RNA-Seq libraries by standard kits, such as the Illumina TruSeq Stranded Total RNA kit.
Materials and Reagents
50 ml Falcon tubes (Corning, Falcon®, catalog number: 352070 )
Serological pipettes, 10 ml (Fisher Scientific, catalog number: 13-676-10J )
Lysing Matrix D Tubes (2 ml) (MP Biomedicals, catalog number: 116913050 )
Tapered end, metal spatula (Fisher Scientific, catalog number: 14-374 )
VacConnectors (QIAGEN, catalog number: 19407 )
C. zofingiensis (SAG, catalog number: 211-14 )
Proteose medium (UTEX Culture Collection of Algae, Proteose medium)
Chu’s medium (UTEX Culture Collection of Algae, Chu’s medium)
Liquid nitrogen (LN2) (various)
Wet ice (various)
Dry ice (various)
RNaseZap (250 ml spray bottle) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9780 )
RNase-free ethanol (EtOH) (100% and 70%) (various)
TRIzol (100 ml) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15596026 )
Chloroform:isoamyl alcohol (24:1) (Sigma-Aldrich, catalog number: C0549-1PT )
MaXtract High Density (100 x 15 ml) (QIAGEN, catalog number: 129065 )
miRNeasy Mini Kit (50) (QIAGEN, catalog number: 217004 ), which includes:
QIAGEN miRNeasy mini columnsa.QIAGEN miRNeasy mini columns
1.5 and 2 ml collection tubes
QIAGEN buffer RWT
QIAGEN buffer RPE
RNase-free water
RNase-Free DNase Set (50 samples) (QIAGEN, catalog number: 79254 ), which includes:
RNase-free DNase I
QIAGEN buffer RDD
3 M sodium acetate (NaOAc), pH = 8, RNase-free (various)
1 M Tris hydrochloride (Tris-HCl), pH = 8, RNase-free (various)
5 M sodium chloride (NaCl), RNase-free (various)
0.5 M ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA), pH = 8, RNase-free (various)
10% sodium dodecyl sulfate (SDS) (various)
20 mg/ml Proteinase K (Fisher Scientific, catalog number: BP1700-100 )
Agilent RNA 6000 Nano kit (Agilent Technologies, catalog number: 5067-1511 )
Lysis buffer (see Recipes)
Equipment
Refrigerated centrifuge (Eppendorf, model: 5810 R )
Refrigerated microfuge (Eppendorf, model: 5424 R )
Clean bench
Ice buckets (Corning, catalog number: 432122 )
PIPETMAN Classic pipet (Gilson, model: P20, catalog number: F123600 )
PIPETMAN Classic pipet (Gilson, model: P200, catalog number: F123601 )
PIPETMAN Classic pipet (Gilson, model: P1000, catalog number: F123602 )
Homogenizer (MP Biomedicals, model: FastPrep-24TM 5G )
Homogenizer adaptor (MP Biomedicals, model: CoolPrepTM 24x2mL )
Vacuum manifold (QIAGEN, model: QIAvac 24 Plus )
Heat block (VWR, catalog number: 75838-286 )
Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 )
Bioanalyzer (Agilent Technologies, model: 2100 Bioanalyzer )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gallaher, S. D. and Roth, M. S. (2018). RNA Purification from the Unicellular Green Alga, Chromochloris zofingiensis. Bio-protocol 8(7): e2793. DOI: 10.21769/BioProtoc.2793.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,794 | https://bio-protocol.org/exchange/protocoldetail?id=2794&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generating Loss-of-function iPSC Lines with Combined CRISPR Indel Formation and Reprogramming from Human Fibroblasts
Andrew M. Tidball
PS Preethi Swaminathan
LD Louis T. Dang
JP Jack M. Parent
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2794 Views: 11061
Edited by: David Cisneros
Reviewed by: Sara E HowdenGanesh Swaminathan
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
For both disease and basic science research, loss-of-function (LOF) mutations are vitally important. Herein, we provide a simple stream-lined protocol for generating LOF iPSC lines that circumvents the technical challenges of traditional gene-editing and cloning of established iPSC lines by combining the introduction of the CRISPR vector concurrently with episomal reprogramming plasmids into fibroblasts. Our experiments have produced nearly even numbers of all 3 genotypes in autosomal genes. In addition, we provide a detailed approach for maintaining and genotyping 96-well plates of iPSC clones.
Keywords: Induced pluripotent stem cells Genome editing Disease modeling Cellular reprogramming CRISPR/Cas9 Human fibroblasts
Background
CRISPR/Cas9 technology has allowed easy and specific targeting of a particular genomic location for gene-editing. Combining this technology with the disease modeling and regenerative medicine potential of induced pluripotent stem cells (iPSCs) will continue to have unprecedented impacts on biomedical research. However, adapting the CRISPR/Cas9 system to iPSCs has presented several challenges. The traditional approach for gene-editing in cell lines is to transfect the cells with a plasmid expressing the Cas9 protein and guide RNA (gRNA) after which single clones are generated and screened for the desired genetic alteration. Unfortunately, iPSCs are not amenable to single cell cloning. Several media supplements and cloning approaches have been developed to overcome this difficulty but are still fraught with either expensive equipment (low oxygen incubators), difficult technological steps (survival of FACS sorted single iPSCs), or labor intensive protocols (sub-cloning) (Forsyth et al., 2006; Miyaoka et al., 2014). Moreover, single cell passaging has been linked to increased genomic abnormalities in iPSCs (Bai et al., 2015). Fluorescent or antibiotic resistance genetic markers have been used to overcome issues with clonality and the overall low efficiency of gene-editing in these cells, but require homologous recombination of a large cassette via a targeting plasmid designed with long homology arms (400-800 bp) (Hendel et al., 2014). Designing these plasmids takes a great deal of time.
To overcome many of these obstacles, we utilized a combined approach of simultaneous reprogramming and CRISPR/Cas9 mutagenesis to generate both heterozygous and homozygous loss-of-function (LOF) iPSC lines. This combined approach was first presented by Howden and colleagues for homologous recombination gene-editing (Howden et al., 2015 and 2016), but we have expanded upon and further defined their original results for indel formation in a recent publication (Tidball et al., 2017). This procedure takes advantage of the cloning step inherent to iPSC reprogramming as well as the greater ease of transfection in fibroblast culture (Figure 1). The ability to efficiently generate a large number of clones with a similar proportion of all three genotypes (wild-type/wild-type, wild-type/indel, and indel/indel) will allow rapid development of LOF iPSC lines for disease modeling and basic research.
Figure 1. Overview of the experimental workflow. The protocols in this article are broken into 4 major sections, including: guide RNA and PCR primer design (Step 1), CRISPR plasmid generation and purification (Steps 2-6), fibroblast culture and electroporation with CRISPR and reprogramming plasmids (Steps 7-8), and isolating genomic DNA followed by PCR of the targeted region and sequencing (Steps 11-15).
Materials and Reagents
Materials
1.5 ml Eppendorf tubes (VWR, catalog number: 89000-028 )
10 µl, 200 µl, and 1 ml pipette tips (USA Scientific, catalog numbers: 1111-3700 , 1111-0700 , and 1111-2721 )
14 ml tubes for bacterial culture (Corning, Falcon®, catalog number: 352059 )
Conical flasks (Corning, PYREX®, catalog number: 4980-500 )
10 cm tissue culture dish (Corning, Falcon®, catalog number: 353003 )
6-well plate (Corning, Costar®, catalog number: 3516 )
5 ml, 10 ml, and 25 ml serological pipettes (Aikali Scientific, ASI, catalog numbers: SP205 , SP210 , and SP225 )
96-well plate (Corning, Falcon®, catalog number: 353072 )
Sterile 50 ml disposable pipette basins (Fisher Scientific, catalog number: 13-681-502 )
PCR tube strips (USA Scientific, catalog number: 1402-4700 )
15 ml centrifuge tubes (Fisher Scientific, catalog number: 05-539-12 )
Nalgene General Long-Term Storage Cryogenic Tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 5000-1012 )
Cells
Human foreskin fibroblasts (MTI-GlobalStem, catalog number: GSC-3002 )
Reagents
CRISPR plasmid pX330-U6-Chmeric_BB-CBh-hSpCas9 (Addgene, catalog number: 42230 )
Reprogramming plasmids pCXLE-hOCT3/4-p53shRNA, pCXLE-hUL, and pCXLE-hSK (Addgene, catalog numbers: 27077 , 27080 , 27078 )
Subcloning Efficiency DH5α competent cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18265017 )
BbsI restriction enzyme, supplied with NEBuffer 2.1 (New England Biolabs, catalog number: R3539 )
QIAGEN PCR purification kit (QIAGEN, catalog number: 28104 )
Custom oligonucleotides (Thermo Fisher Scientific)
T4 DNA ligase kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15224017 )
SOC medium (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15544034 )
LB broth base (Thermo Fisher Scientific, InvitrogenTM, catalog number: 12780052 )
LB agar (Thermo Fisher Scientific, InvitrogenTM, catalog number: 22700025 )
Ampicillin sodium salt (Sigma-Aldrich, catalog number: A9518-25G )
QIAGEN Miniprep Kit (QIAGEN, catalog number: 27104 )
Glycerol (Sigma-Aldrich, catalog number: G5516-100ML )
LKO.1 5’ sequencing primer (5’-GACTATCATATGCTTACCGT-3’)
Endo-Free QIAGEN Maxi Prep Kit (QIAGEN, catalog number: 12362 )
Phosphate buffered saline (PBS), pH 7.4 (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
0.25% trypsin solution (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Growth factor depleted Matrigel (Corning, catalog number: 356230 )
Neon Transfection System 100 µl Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: MPK10025 )
TeSR-E7 (STEMCELL Technologies, catalog number: 05910 )
mTeSR1 (STEMCELL Technologies, catalog number: 85850 )
ROCK inhibitor Y-27632 (Tocris Bioscience, catalog number: 1254 )
Accutase (Innovative Cell Technologies, catalog number: AT104 )
ZR-96 Quick-gDNA Kit (Zymo Research, catalog number: D3010 )
GoTaq green master mix (Promega, catalog number: M7122 )
Molecular biology grade water (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977023 )
ZR-96 DNA Sequencing Clean-up Kit (Zymo Research, catalog number: D4052 )
Gel 6x Loading Dye, Purple (New England Biolabs, catalog number: B7024S )
GeneMate LE Quick Dissolve Agarose (BioExpress, GeneMate, catalog number: E-3119-500 )
GelRed Nucleic Acid Gel Stain 10,000x in DMSO (Biotium, catalog number: 41002 )
Accugene 10 TBE Buffer (Lonza, catalog number: 50843 )
Quant-IT PicoGreen dsDNA Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: P7589 )
mFreSR (STEMCELL Technologies, catalog number: 05855 )
Liquid nitrogen
Dulbecco modified Eagle’s medium (high glucose) (Thermo Fisher Scientific, GibcoTM, catalog number: 11965118 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437010 )
Penicillin-streptomycin solution (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
MEM Non-essential amino acids solution 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 11140050 )
Fibroblast growth medium (see Recipes)
Equipment
Portable Pipet-aid (Drummond, model: DP-101, catalog number: 4-000-101 )
Laminar flow hood (Thermo Fisher Scientific, Thermo ScientificTM, model: 1300 Series Class II Type A2 , catalog number: 1335)
Neon electroporator (Thermo Fisher Scientific, InvitrogenTM, catalog number: MPK5000 )
Heraguard ECO Clean Bench (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraguardTM ECO, catalog number: 51029701 )
NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 )
iCycler Thermal cycler (Bio-Rad Laboratories, model: iCycler Thermal cycler )
Water bath (Thermo Electron Corporation, catalog number: 51221073 )
Refrigerator (Frigidaire, model: FFTR2021QW1 )
Tissue culture incubator set at 37 °C, 5% CO2 (Thermo Fisher Scientific, Thermo ScientificTM, model: HeracellTM 150i , catalog number: 51026283)
Thermo Scientific Sorvall St8 120v cell culture centrifuge with plate adapters (Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM St 8 , 120v)
Bright-Line Hemocytometer (Hausser Scientific, catalog number: 3110 )
HandEvac Handheld Aspirator with 8-channel adapter (Argos Technologies, catalog number EV500 )
Olympus CKX41 inverted cell culture microscope (Olympus, model: CKX41 )
Multichannel pipettes (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 4662000 and 4662010 )
Sub-cell GT Electrophoresis cell (Bio-Rad Laboratories, model: Sub-Cell® GT Cell )
Gel Imager
Beckman Coulter DTX 880 Multimode Detector Microplate Reader (Beckman Coulter, model: DTX 880 )
CoolCell LX Freezing Container (Biocision, catalog number: BCS-405 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tidball, A. M., Swaminathan, P., Dang, L. T. and Parent, J. M. (2018). Generating Loss-of-function iPSC Lines with Combined CRISPR Indel Formation and Reprogramming from Human Fibroblasts. Bio-protocol 8(7): e2794. DOI: 10.21769/BioProtoc.2794.
Download Citation in RIS Format
Category
Stem Cell > Pluripotent stem cell > Cell induction
Cell Biology > Cell engineering > CRISPR-cas9
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,795 | https://bio-protocol.org/exchange/protocoldetail?id=2795&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Guanine Nucleotide Exchange Assay Using Fluorescent MANT-GDP
TK Tomoharu Kanie
PJ Peter K. Jackson
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2795 Views: 12972
Edited by: Ralph Thomas Boettcher
Reviewed by: Akira KarasawaSarah Diermeier
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
GTPases are molecular switches that cycle between the inactive GDP-bound state and the active GTP-bound state. GTPases exchange nucleotides either by its intrinsic nucleotide exchange or by interaction with guanine nucleotide exchange factors (GEFs). Monitoring the nucleotide exchange in vitro, together with reconstitution of direct interactions with regulatory proteins, provides key insights into how a GTPase is activated. In this protocol, we describe core methods to monitor nucleotide exchange using fluorescent N-Methylanthraniloyl (MANT)-guanine nucleotide.
Keywords: GTPase N-Methylanthraniloyl (MANT) Nucleotide exchange GEF assay in vitro Fluorescence Fluorescent nucleotides Fluorescent GDP
Background
GTPases are guanine nucleotide binding proteins that regulate a breadth of cellular processes, ranging from protein biosynthesis to cell-cycle progression and from cytoskeletal reorganization to membrane trafficking. GTPases can be thought of as molecular switches that cycle between a GDP-bound ‘off’ state and a GTP-bound ‘on’ state; upon GTP-binding via nucleotide exchange of GDP for GTP, GTPases become active and will bind to down-stream effector proteins to recruit and activate the biological function of these effectors. GTPases bind the γ-phosphate of GTP via interactions with a highly conserved threonine of the switch I loop (G2 domain) and a glycine within a DxxG motif of the switch II loop (G3 domain). Upon GTP hydrolysis, the loss of the interaction with the γ-phosphate causes a dynamic conformational change that turns the GTPase into an off state (Vetter and Wittinghofer, 2001). Typically, small GTPases have a very high affinity for guanine nucleotides, with dissociation constants in the nanomolar to picomolar range (Bos et al., 2007), and therefore require guanine nucleotide exchange factors (GEFs) to lower their nucleotide affinity to allow for rapid activation. Notable exceptions include several highly conserved centrosomal/ciliary small GTPases, such as Rabl2 (Kanie et al., 2017), ARL13B (Ivanova et al., 2017), Ift27/Rabl4 (Bhogaraju et al., 2011), and Arl6 (Price et al., 2012), and many large GTPases, such as the dynamin family (Gasper et al., 2009), which have lower affinities for GDP/GTP, with dissociation constants in the micromolar range. In this configuration, these GTPases can become activated without the use of GEFs via their intrinsic nucleotide exchange. Although small GTPases that show spontaneous exchange may have additional regulatory proteins, finding that a small GTPase has a micromolar affinity for GDP/GTP and is capable of spontaneous exchange may suggest the absence of a traditional GEF and suggest looking for other forms of GTPase regulatory factors (see Kanie et al. [2017] for a notable example).
Fluorescently-labeled guanine nucleotides are more suitable for monitoring nucleotide exchange than radioactive GDP/GTP, as they are safer and allow continuous spectroscopic monitoring and thus provide a more detailed analysis of kinetics. N-Methylanthraniloyl (MANT) is the most widely used fluorescent analog to label guanine nucleotides because it is smaller than most fluorophores and unlikely to cause major perturbations of protein-nucleotide interactions (Hiratsuka, 1983). Another attractive feature of this fluorescent nucleotide is that the emitted fluorescent signal increases dramatically upon binding to a GTPase (typically twice as high as the signal of unbound MANT-guanine nucleotide) (John et al., 1990), allowing one to directly monitor the association and dissociation of guanine nucleotides from GTPases. The most commonly used method to monitor nucleotide exchange is tracking the decrease in the fluorescence of protein-bound MANT-GDP upon addition of an excess amount of GppNHp, a non-hydrolyzable GTP analog. MANT-GDP-bound GTPase can be prepared by the incubation of nucleotide free GTPase with 1.5 fold excess of MANT-GDP (John et al., 1990; Eberth and Ahmadian, 2009). Although this protocol is described in great detail and allows us to save expensive MANT-GDP, it is time-consuming and limited by the accessibility to high performance liquid chromatography. Alternatively, we describe here a simpler protocol where MANT-GDP is loaded onto GTPase by incubating GTPase with 20-fold molar excess of MANT-GDP in the presence of ethylenediaminetetraacetic acid (EDTA). EDTA chelates magnesium ions, which form coordination bonds with the β and γ phosphates of GTP (or β phosphate of GDP) and with the GTPase (Pai et al., 1990; Tong et al., 1991). EDTA significantly lowers the affinity of the GTPase for guanine nucleotide. The loading reaction is stopped by the addition of excess magnesium chloride. Unbound MANT-GDP is removed by gel filtration using a NAP-5 prepacked column and the nucleotide exchange reaction is initiated by the addition of 100-fold molar excess of GppNHp. Exchange is monitored by a decrease in the fluorescent signal as recorded by a spectrometer with excitation wavelength at 360 nm and emission at 440 nm.
Variations on this method are readily accomplished by addition of biochemically pure nucleotide variants, drugs, or purified protein regulatory factors, allowing for a range of mechanistic experiments and definitive tests of biochemical mechanisms.
Materials and Reagents
Microcentrifuge tube (Corning, Costar®, catalog number: 3621 )
50 ml conical tube (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339652 )
Oak ridge tube (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3119-0050 )
15 ml conical tube (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339650 )
(Optional) Amicon ultra concentrator (Merck, catalog number: UFC901024 )
Dialysis tubing (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88242 )
NAP-5 columns (GE Healthcare, catalog number: 17085301 )
Aluminum foil
384-well microplate (Greiner Bio One International, catalog number: 784076 )
(Optional) 96-well microplate (Corning, catalog number: 3686 )
0.2 µm disposable bottle top filter (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 597-4520 )
0.22 µm syringe filter (Merck, catalog number: SLGV033RS )
Disposable cuvettes (Fisher Scientific, catalog number: 14-955-127 )
Multichannel pipette tip (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 7421 )
Rosetta2 bacterial cells (Merck, EMD Millipore, catalog number: 71403 )–Store at -80 °C
Recombinant GTPase
Note: Ideally, the concentration should be 100 µM or greater. See the protocol below for the expression and purification of recombinant GTPases. Store at -80 °C.
Gateway-cloning compatible pGEX6p vector
4x LDS sample buffer (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0008 )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )–Store at 4 °C
GppNHp (Abcam, catalog number: ab146659 )
Note: Dissolve in Milli-Q water to prepare a 50 mM stock solution. Store at -20 °C.
Nu-PAGE gel (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0321BOX )
Coomassie Brilliant Blue R-250 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 20278 )
(Optional) Classical Laemmli sodium dodecyl sulfate (SDS) sample buffer/SDS-polyacrylamide gel electrophoresis (SDS-PAGE) gel
Glutathione Sepharose 4B media (GE Healthcare, catalog number: 17075605 )–Store at 4 °C
GST-PreScission (10 mg/ml)
Note: We prepare GST tagged PreScission by ourselves. 1 µl of our protease cleaves approximately 1 mg of GST-ARL3, a test protein. Alternatively, you can purchase the protease from GE Healthcare, catalog number: 27084301 . Store at -80 °C.
Bradford Reagent Concentrate (Bio-Rad Laboratories, catalog number: 5000006 )–Store at 4 °C
Liquid nitrogen
BSA standard, 2 mg/ml (Thermo Fisher Scientific, catalog number: 23209 )–Store at 4 °C
TritonX-100 (Acros Organics, catalog number: 215682500 )
Milli-Q water
Protease inhibitor tablet (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: A32965 )–Store at 4 °C
Glycerol (Sigma-Aldrich, catalog number: G5516 )
MANT-GDP triethylammonium salt solution (Sigma-Aldrich, catalog number: 69244 )–Store at -20 °C protected from light
Trizma base (Sigma-Aldrich, catalog number: T6066 )
Concentrated HCl (Aqua Solutions, catalog number: H2505-500ML )
Glacial acetic acid (Fisher Scientific, catalog number: A490-212 )
Methanol (Fisher Scientific, catalog number: A412-4 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Sodium hydroxide (Fisher Scientific, catalog number: BP359-500 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014-500G )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670 )
Dithiothreitol (DTT) (Promega, catalog number: V3155 )
Ethylenediaminetetraacetic acid (EDTA) (Fisher Scientific, catalog number: S311 )
LB broth (Fisher Scientific, catalog number: BP9723 )
LB agar (Thermo Fisher Scientific, InvitrogenTM, catalog number: 22700 )
Terrific broth (Fisher Scientific, catalog number: BP24682 )
Carbenicillin (Sigma-Aldrich, catalog number: C3416 )
Ampicillin (Fisher Scientific, catalog number: BP1760 )
Chloramphenicol (Sigma-Aldrich, catalog number: C0378 )
IPTG (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15529019 )–Store at -20 °C
LB media (see Recipes)
TB media (see Recipes)
100 mg/ml ampicillin (see Recipes)
50 mg/ml carbenicillin (see Recipes)
34 mg/ml chloramphenicol (see Recipes)
LB agar plate containing 50 µg/ml carbenicillin and 34 µg/ml chloramphenicol (see Recipes)
1 M IPTG (see Recipes)
1 M Tris-HCl (pH 7.5) (see Recipes)
1 M HEPES-NaOH (pH 7.5) (see Recipes)
5 M NaCl (see Recipes)
1 M MgCl2 (see Recipes)
1 M DTT (see Recipes)
0.25 M EDTA (pH 8) (see Recipes)
10 M NaOH (see Recipes)
Coomassie Brilliant Blue staining solution (see Recipes)
Coomassie Brilliant Blue destaining solution (see Recipes)
Lysis buffer (see Recipes)
PreScission cleavage buffer (see Recipes)
Storage buffer (see Recipes)
Low magnesium buffer (see Recipes)
2x MANT-GDP loading buffer (see Recipes)
Nucleotide exchange buffer (see Recipes)
Note: Unless otherwise noted, materials are stored at room temperature. Frozen proteins and nucleotides can be maintained for at least a year if pure.
Equipment
Milli-Q generator (Merck, model: Milli-Q® Advantage A10, catalog number: Z00Q0V0WW )
250 ml culture flask (Corning, PYREX®, catalog number: 4980-250 )
2,800 ml culture flask (Corning, PYREX®, catalog number: 4424-2XL )
Incubator shaker (Eppendorf, New BrunswickTM, model: Excella® E25 , catalog number: M1353-0002)
Refrigerated centrifuge (Eppendorf, model: 5424 R )
500 ml centrifuge bottle (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3141-0500 )
JA-10 rotor (Beckman Coulter, model: JA-10 , catalog number: 369687)
Avanti J-25I refrigerated centrifuge (Beckman Coulter, model: Avanti J-25I , catalog number: 363106)
JA-17 rotor (Beckman Coulter, model: JA-17 , catalog number: 369691)
Allegra X-15R refrigerated centrifuge (Beckman Coulter, model: Allegra® X-15R , catalog number: 392932)
BioSpectrometer (Eppendorf, catalog number: 6136000010 )
Thermomixer (Fisher Scientific, catalog number: 05-412-401 )
Note: This equipment has been discontinued. Thermomixer C (Fisher Scientific, catalog number: 05-412-503; Manufacturer: Eppendorf, catalog number: 5382000023 ) is available as an alternative. Any type of temperature-controlled mixer with cooling function should work for this experiment.
TECAN Infinite M1000 Microplate reader (TECAN, part number: 30034301 )
Note: There are a number of plates or cuvette-based fluorimeters that can be adapted to this procedure. Those include FluoroMax-4 (Horiba) (Price et al., 2012), Synergy H4 Hybrid Microplate reader (Bio Tek) (Ivanova et al., 2017), and Envision (Perkin-Elmer) (Maurer et al., 2012).
Branson Digital Sonifier (Branson)
Note: This equipment has been discontinued. Branson Ultrasonics Sonifier SFX250/SFX550 (Fisher Scientific, catalog number: 15-345-141; Manufacturer: EMERSON, Branson, catalog number: 101063969R ) is available as an alternative.
360° vertical rotator (Grant Instruments, model: PTR-30 )
Note: This equipment has been discontinued. Grant bio 360° vertical rotator PTR-35 (Grant Instruments, model: PTR-35 ) is available as an alternative.
Lab stand (Humboldt, catalog number: H-21207 )
Vortex mixer (Scientific Industries, model: Vortex-Genie 2 , catalog number: SI-0236)
Multichannel electronic pipette (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2069MTRX )
Note: This equipment has been discontinued. A newer model (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4671020BT ) is available as an alternative.
Autoclave
Software
Microsoft Excel (Microsoft)
GraphPad Prism 7 software (GraphPad Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kanie, T. and Jackson, P. K. (2018). Guanine Nucleotide Exchange Assay Using Fluorescent MANT-GDP. Bio-protocol 8(7): e2795. DOI: 10.21769/BioProtoc.2795.
Download Citation in RIS Format
Category
Biochemistry > Protein > Fluorescence
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,796 | https://bio-protocol.org/exchange/protocoldetail?id=2796&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Evaluation of Root pH Change Through Gel Containing pH-sensitive Indicator Bromocresol Purple
Aparecida L. Silva
KD Keini Dressano
Paulo H. O. Ceciliato
Juan Carlos Guerrero-Abad
Daniel S. Moura
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2796 Views: 8637
Edited by: Arsalan Daudi
Reviewed by: Laia ArmengotVinay Panwar
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
The Rapid Alkalinization Factor (RALF) is a plant hormone peptide that inhibits proton transport causing alkalinization of the extracellular media. To detect the alkalinization response elicited by RALF peptides in root cells, Arabidopsis seedlings are carefully transferred to a gel containing the pH-sensitive indicator bromocresol purple, treated with the peptide and photographed after 30 min. Herein the protocol is optimized for evaluation of exogenous treatment, described in detail and expected results are presented.
Keywords: pH indicator Alkalinization RALF Bromocresol purple
Background
Proton transport is induced by a myriad of signals and is used by plants to coordinate growth, defense and development. Some plant hormone peptides can affect proton transport, causing a strong alkalinization of the extracellular medium (Felix and Boller, 1995; Pearce et al., 2001a). The 5 kDa peptide hormone Rapid Alkalinization Factor (RALF), after being secreted, binds to its receptor FERONIA, and causes the phosphorylation of the plasma membrane H+-Adenosine triphosphatase 2, inhibiting proton transport and alkalinizing the extracellular media (Pearce et al., 2001b; Haruta et al., 2014).
Growth media containing the pH indicator bromocresol purple is an effective method to visualize alkalinization or acidification in the media around the roots. This method has been used previously to show that NaRALF is required for regulating root hair extracellular pH (Wu et al., 2007), and that roots of plants overexpressing AtRALF23 have reduced capacity to acidify the rhizosphere (Srivastava et al., 2009). Growth medium with the pH indicator bromocresol purple was also used by Masachis et al. (2016) to demonstrate that RALF homologs produced by fungal pathogens induced alkalinization of media around the roots of tomato plants.
We have optimized the pH indicator bromocresol purple protocol and using the improved protocol we were able to visualize the alkalinization effect around Arabidopsis roots after AtRALF1 treatment in wild type and mutant seedlings (Dressano et al., 2017). Here we demonstrate how this assay can provide qualitative information on the extracellular pH that surrounds Arabidopsis roots.
Materials and Reagents
Biological material
Arabidopsis thaliana seeds and seedlings (Ecotype Columbia, Col-0)
In-house produced 6xHis AtRALF1 recombinant peptide
Chemicals and materials for seed sterilization and growth
Square Petri dish with Grid 100 mm W x 15 mm H, sterile (Electron Microscopy Sciences, catalog number: 70691 )
Clear plastic wrap
Graduated cylinder 1,000, 100 and 10 ml (Uniglas)
1,000 µl filter tips (NEST Scientific, catalog number: NPT1000-B-B )
200 µl filter tips (NEST Scientific, catalog number: NPT0200-B-Y )
10 µl filter tips (NEST Scientific, catalog number: 301001 )
Gellan Gum Powder (Culture Gel TM Type I- BioTech Grade) (PhytoTechnology Laboratories, catalog number: G434 )
Murashige & Skoog Basal Salt Mixture (PhytoTechnology Laboratories, catalog number: M524 )
Sterile distilled water
Sodium hypochlorite solution
Sodium hypochlorite (NaClO) solution 50% (v/v) (see Recipes)
Chemicals and materials for gel containing the pH-sensitive indicator bromocresol purple
Graduated cylinder 100 ml (Uniglas)
Petri dish 150 x 20 mm sterile
Bromocresol purple free acid reagent Grade (C2H16Br2O5S, AMRESCO, catalog number: 0531-25G )
Calcium sulfate dihydrate (CaSO4·2H2O, Merck, catalog number: 102161 )
Potassium hydroxide (KOH)
Hydrochloric acid (HCl)
Agarose RA (Biotechnology Grade, AMRESCO, catalog number: N605-500G )
Sterile distilled water
Equipment
Weighing balance (RADWAG Wagi Elektroniczne, model: AS 220/C/2 )
Magnetic stirrer (Fisher Scientific)
pH meter (Thermo Orion, PerpHecT LongR meter, model: 350 )
Pipettes (Nichipet EX, P1000, P200, P10)
Beaker 1,000 ml (PHOX, Boro 3.3)
Beaker 250 ml (APRX, Boro 3.3)
Autoclave (Sercon, model: HS 1-0101 )
Laminar flow hood (Pachane, model: PA 440 )
Growth chamber/Controlled environment room
Erlenmeyer (PIREX)
Microwave (BRASTEMP, catalog number: BMJ38ARANA )
Tweezers
Digital camera (Cyber-shot, Sony, model: DSC-H300 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Silva, A. L., Dressano, K., Ceciliato, P. H. O., Guerrero-Abad, J. C. and Moura, D. S. (2018). Evaluation of Root pH Change Through Gel Containing pH-sensitive Indicator Bromocresol Purple. Bio-protocol 8(7): e2796. DOI: 10.21769/BioProtoc.2796.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Plant hormone
Plant Science > Plant physiology > Ion analysis
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,797 | https://bio-protocol.org/exchange/protocoldetail?id=2797&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Spatiotemporal Dynamics of Odor Gradient for Small Animals by Gas Chromatography
AY Akiko Yamazoe-Umemoto
YI Yuishi Iwasaki
Koutarou D. Kimura
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2797 Views: 6459
Edited by: Neelanjan Bose
Reviewed by: Sanjib GuhaKarthik Krishnamurthy
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
Odor is the most fundamental chemical stimulus that delivers information regarding food, mating partners, enemies, and danger in the surrounding environment. Research on odor response in animals is widespread, although studies on experimental systems in which the gradient of odor concentration is quantitatively measured has been quite limited. Here, we describe a method for measuring a gradient of odor concentration established by volatilization and diffusion in a relatively small enclosed space, which has been used widely in laboratories to analyze small model animals such as the nematode Caenorhabditis elegans and the fruit fly Drosophila melanogaster. We first vaporized known amounts of a liquid odorant 2-nonanone in a tank and subjected them to gas chromatographic analysis to obtain a calibration curve. Then, we aspirated a small amount of gas phase from a small hole on an agar plate and measured the odor concentration. By repeating this at different spatial and temporal points, we were able to detect a gradient of the odor concentration that increased over time. Furthermore, by applying these measured values to mathematical models of volatilization and diffusion, we were able to visualize an estimated dynamic change in odor concentration over an agar plate. Combining monitoring of odor concentration change in an agar plate with behavioral monitoring by machine vision will allow us to estimate how the brain computes information regarding odor concentration change in order to regulate behavior.
Keywords: Odorant Gradient Gas chromatograph C. elegans Diffusion Evaporation
Background
Odor is the most fundamental chemical stimulus that conveys the existence of food, reproductive partners, enemies, etc. in the surrounding environment. Small model animals, such as the nematode Caenorhabditis elegans and fruit fly Drosophila melanogaster are suitable for understanding brain responses to odor stimuli at the levels of behavior, neural activity, and molecules because: (1) behavioral responses to odor stimuli can be easily recorded with inexpensive high resolution cameras; (2) responses in multiple neurons/neuronal groups can be measured with calcium imaging and (3) genes responsible for behavioral and neural responses can be identified with various genetic methods (De Bono and Maricq, 2005; Venken et al., 2011).
However, it is difficult to measure the odor concentrations that are actually sensed by these small animals during their behavior in a small arena suited for observation. In general, the measurement of odor concentration requires constant air flow in a device supplying the odorant-containing air to the sensor. Thus, air should be constantly drawn from the air phase of the arena, destroying the odor gradient. Measuring odor gradient in a small behavioral arena has been achieved either by strengthening the air flow for the odor gradient compared to the flow for sampling or by optically measuring the air phase odorant concentration. Gershow et al. (2012) developed a relatively large apparatus (30 x 30 cm) for Drosophila larvae for slow but large (2 L/min) constant parallel flows with different concentrations, in order to create an odor concentration gradient perpendicular to the flow. Louis et al. (2008) used infrared beams to measure integrated concentrations of odor on one axis in a naturally evaporated and diffused gradient, and calculated the gradient shape mathematically based on Gaussian diffusion. The former method allows quantitative measurement of the odor gradient, although it is not based on natural evaporation and diffusion. It also requires specific, controlled apparatus. The latter method is suitable for natural gradients, although it does not allow accurate measurement of specific positions.
Here we report a method to measure a dynamic odor gradient in a widely-used plastic plate by gas chromatography (GC). Observing odor-taxis behaviors on plastic plates with an agar layer is easy and thus is conducted in many laboratories. In addition, we are able to video-record the behaviors using inexpensive USB cameras. Therefore, by measuring temporal changes in the odor gradient on an agar plate, we can obtain clues to estimate brain computations controlling how temporal changes in odor stimuli affect the animal’s behavior.
For measurement, first, specific amounts of liquid odorant are individually volatilized in a vaporizing tank to make gas with known concentrations of odorant. Then, the gas is subjected to GC with different concentrations, in order to calculate a calibration curve for known gas concentrations and GC values. Next, a small amount of gas is sampled from a specific spatio-temporal point on an agar plate with evaporating and diffusing odorant, and subjected to GC analysis. Finally, the entire odor gradient is calculated by the measured concentrations at different spatio-temporal points. In our experiment, measurements suggested that C. elegans responds behaviorally to odor concentration changes as small as ± 0.01 μM/sec in ~2 μM concentration on a natural odor gradient. This is consistent with results from an experiment with artificial and controlled odor concentration changes (Tanimoto et al., 2017).
Materials and Reagents
ø 9 cm sterile Petri dish (IWAKI, catalog number: SH90-15 ) with nematode growth medium (NGM) agar
Note: Pour 10 ml of autoclaved 1.5-2.5% agar solution per dish following the regular sterilized technique to make an agar plate for behavioral analysis. We used NGM agar for C. elegans behavioral analysis. This agar plate can be stored at 4 °C for a few weeks. The plates should be moved to a bench a few hours before the assay and kept without their lids for 15-30 min to dry. Dried plates with lids are placed upside-down on a bench. The plates are not sealed with either Parafilm or sticky tape.
Microliter syringe, 50 μl, cemented needle (Hamilton, catalog number: 80565 )
Note: This is a blunt needle point.
Micro-volume syringe, 5 μl, fixed needle (SGE, catalog number: 001000 )
Plastic disposable syringe, 2.0 ml (Top, catalog number: 5079-01 )
Replacement needle (Luer lock side hole), 23 G x 4 cm (GL Sciences, catalog number: 3008-46004 )
Pasteur pipette (IWAKI, catalog number: 1K-PAS-5P )
Dropper bulb (AS ONE, catalog number: 1-6227-05 )
2-Nonanone (Wako Pure Chemical Industries, catalog number: 132-04173 )
Note: Liquid at room temperature. Although we used only this odorant, this protocol could be used for other odorants as well.
EtOH (Wako Pure Chemical Industries, catalog number: 057-00456 )
Sodium chloride (NaCl) (Wako Pure Chemical Industries, catalog number: 191-01665 )
Bacto peptone (BD, BactoTM, catalog number: 211677 )
Agar (Wako Pure Chemical Industries, catalog number: 010-08725 )
Cholesterol (Wako Pure Chemical Industries, catalog number: 034-03002 )
Calcium chloride dihydrate (CaCl2·2H2O) (Wako Pure Chemical Industries, catalog number: 038-12775 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Wako Pure Chemical Industries, catalog number: 131-00405 )
Dipotassium hydrogenphosphate (K2HPO4) (Wako Pure Chemical Industries, catalog number: 164-04295 )
Potassium dihydrogen phosphate (KH2PO4) (Wako Pure Chemical Industries, catalog number: 169-04245 )
Equipment
Vaporizing tank (FIS, catalog number: DT-T1 ) (Figure 1)
Note: A custom-made acrylic tank of 50 L, equipped with a small metal block with a vaporizing groove, a heater with a temperature controller, and a fan. The odorant liquid is placed in the groove of the metal block through a liquid inlet on the lid, and the metal block is warmed with the heater to facilitate volatilization of the odorant. The fan stirs the air so that the volatilized odorant is distributed equally in the tank.
Figure 1. Vaporizing tank
Gas chromatograph (GC) (Nissha FIS, model: SGVA-N2 ) (Figure 2)
Note: A simple and inexpensive GC optimized for 2-nonanone with a semiconductor detector. Other GC can also be used.
Figure 2. Gas chromatograph
Carrier gas cylinder (Air Liquide, model: Alphagaz 1 )
Note: This was recommended by Nissha FIS Inc.
Vacuum cleaner (Toshiba, catalog number: VC-PC6A , L)
Note: A domestic vacuum cleaner.
Pin vise (Tamiya, Fine Pin Vise D [0.1-3.2 mm])
1 mm drill (Tamiya, Basic Drill Bit set 5 pc)
Software
SGC.exe (Nissha FIS Inc., Hyogo, Japan)
Note: This is a specific software to control this type of GC provided by the manufacturer. Software should be installed on a Windows PC (XP, Vista, or 7) that is connected to the GC. Depending on the GC instrument being used, the manufacturer may have specific analysis software recommendations.
Procedure
Overview: We vaporized specific amounts of liquid 2-nonanone in the vaporizing tank to make 2-nonanone gas of known concentrations, and measured GC values to calculate a calibration curve. Next, a gas phase of 0.2 ml in an agar plate was sampled and measured with the GC. Although we did the following with 2-nonanone, our method should be applicable for other odorants that are vaporized from the liquid at room temperature and can be measured by gas chromatography. Important steps are summarized in Video 1.
Video 1. Important steps for measuring odor gradient. A video demonstrating the important apparatus and operations for the odor measurement.
Measuring known concentrations of 2-nonanone gas for a calibration curve
2-nonanone gas of known concentration can be obtained by vaporizing a specific amount of 2-nonanone liquid in the vaporizing tank (see below). A calibration curve can be obtained by measuring different concentrations of the gas with GC and correlating the measured values. However, the time to reach maximum odor concentration varied for each amount of liquid, likely due to differences in vaporization, diffusion, and trace adhesion to the vaporizing tank wall. Therefore, we monitored temporal changes in odor concentration in the tank to find the optimal time for vaporization of each concentration.
Flow the carrier gas at 0.25-0.35 MPa from the air cylinder connected to the GC.
Note: Do this immediately before turning on the GC.
Turn on the GC immediately after Step A1.
Note: Flowing gas without turning on power will damage the column inside the GC.
Wait until the ‘Ready’ lamp is illuminated.
Notes:
This may take about 90 min.
If the GC is used after a long interval (e.g., more than 2 weeks), the measured value tends to be higher. In that case, use the GC a few days before taking actual measurements. An interval of up to several days has no effect.
The high values recorded after long intervals are attributed to the following: During the interval, the sensor surface is coated with various small compounds in the air. Electrical conduction increases the temperature of the sensor to 300-400 °C, which clarifies the attached compounds and causes transient high sensitivity for several hours.
The directions above are specific to the GC instrument used in this study. Other instrumentation may require adapted methods and steps.
Turn on the electrical switch of the vaporizing tank (Figure 1), and set the temperature at 50 °C: It will take about 10 min to reach 50 °C.
Take an appropriate amount of 2-nonanone liquid (Table 1) with a glass syringe of 5 μl or 50 μl, insert it in the liquid inlet on the lid of the tank, and place the liquid in the vaporizing groove installed on the back side of the lid.
Table 1. Volumes of 2-nonanone liquid for the vaporization
The relationship between the liquid volume and the estimated gas concentration in Table 1 is as follows:
where C is the required gas concentration (mol/L), Vliquid is the amount of liquid (ml) to be added, d is the density of liquid odorant (g/ml), M is the molecular weight (g), and Vtank is the volume of the vaporizing tank (L).
Start SGC.exe on a Windows PC connected to the GC and operate according to the manual.
Press the start button in SGC.exe.
After a certain period of time (see Table 1), carefully insert the replacement needle attached to the disposable syringe from the gas outlet. Extract 0.2 ml and quickly remove the needle from the tank. Carefully insert the needle in the gas inlet of the GC (Figure 2) until it hits the bottom, and immediately infuse the gas inside the syringe.
Note: This step should be completed in about 5-6 sec.
Measurement is started by gas injection. Drawing of the graph (Figure 3) starts and ends automatically. Data is automatically saved. In the default setting, a measurement takes 8 min. The file can be exported as a CSV file.
Figure 3. A representative result of one measurement for 22.9 μM (i.e., 200 μl) of 2-nonanone. The horizontal axis is time (sec), and the vertical axis is the signal (mV).
To measure temporal changes in the measured value for the specific amount of the odorant, odor gas sampling can be performed at different time points for one odorant injection (e.g., 6, 18, 30, and 42 min for 6.8 and 11.1 μM; see Table 1). However, if there is no 8-min interval (e.g., 1, 2, 3, and 4 min for 0.04 and 0.12 μM), clean the tank (see the next section) and start from the gas vaporization.
If gas remains in the tank (likely by adhesion to the wall), vaporization of the residual amount affects the GC value, especially when a small concentration is being measured. In order to avoid this, gas in the tank is removed with a vacuum cleaner, and the wall is wiped with a paper towel containing EtOH, followed by further suction with the vacuum cleaner. After this procedure, remaining gas was not detected in our experiment.
For all conditions, repeat the measurement 3-4 times (once daily and repeat over 3-4 days) and find the time at which the average value is at a maximum (Figure 4). In the case of 2-nonanone, the relationship between odor concentrations and measured values are nicely fitted to two regression lines for concentrations lower and higher than 4 μM (R2 = 0.9991 and 0.9995, respectively; Figure 5) (Tanimoto et al., 2017). In general, for semiconductor detectors, the correlation between the peak height of the signal and signal concentration in a log-log plot is well-fitted by two simple regression lines for lower and higher concentrations. Therefore, these results are adopted as calibration curves for low and high concentrations. Excel (Microsoft) is used for data analysis.
Figure 4. Changes over time of the measured value for different amounts of liquid odor. On each graph, the expected 2-nonanone gas concentration at saturation is shown. The horizontal (vaporizing time) and vertical (sensor output) axes are different in each graph. For 2-nonanone gas with a low saturation concentration of 0.04-0.12 μM, the concentration became saturated immediately and then decreased slightly. This is likely because of adhesion of 2-nonanone to the wall. For each condition, results are shown as mean ± standard error of 3-4 repetitions.
Figure 5. Calibration curve for 2-nonanone. Each dot represents average values of 3-4 experiments, and data on the log-log plot were fitted with two simple regression lines for lower (squares) and higher (triangles) concentrations. This figure was originally published in Tanimoto et al. (2017).
Measuring 2-nonanone gradient on an agar plate
On the back side of the agar plate, mark the positions of odor spot and gas sampling with a pen.
Note: We measured at six points (x, y, z) on the assay plate shown in Figure 6 at 1, 3, 6, 9, and 12 min. The motivations for adopting 6 points (x, y) for measurement are as follows:
Since we examined odor avoidance behavior of C. elegans, the four points on the x axis were chosen to measure the direction avoided by C. elegans, i.e., to measure the spatial gradient along the x direction. In the range of x > 0 in which C. elegans mainly existed, three points were chosen. Only one point was measured in the range x < 0 where C. elegans did not often exist.
To measure the spatial gradient in the y direction, (22, 15) was selected. We chose only one point because the worms did not spread much along the y axis.
Figure 6. Gas sampling from the agar plate [originally published in Tanimoto et al. (2017). Creative Commons Attribution License]
Remove the lid of the agar plate, and push the narrow end of a Pasteur pipette with a dropper bulb against the agar and extract the agar plug to make a hole of ø 1-2 mm in the agar layer. Then close the lid.
From the back of the plate (i.e., the opposite side of the lid), make a hole with a pin vise with a 1 mm drill at the position of the agar hole. This will result in a hole in the same position on the plate and the agar.
If necessary, use cellophane tape to cover the hole from the back side. Turn back one side of the cellophane tape for ease of peeling. This is not necessary for odorants with large molecular weights such as 2-nonanone. We compared outcomes with and without taping, and found no difference.
Spot the liquid odorant at the odor source position (we used 2 μl of 30% 2-nonanone diluted in EtOH), immediately cover the lid, place the plate upside-down (hole up) and leave it on the bench.
Note: In the worm’s odor avoidance assay, worms suspended in a small amount of buffer droplet are spotted at the center of the plate 1.5 min before the odor is spotted (Kimura et al., 2010), and the time of odor spotting is counted as t = 0. In this odor measurement, however, the worms are not spotted for the sake of simplicity.
When an appropriate amount of time (i.e., 1, 3, 6, 9, or 12 min) has passed, remove the tape (if applied) without moving the plate. Carefully insert the replacement needle attached to the plastic 2.0 ml disposable syringe so that the needle hole is positioned in the gas phase 1 mm away from the agar surface (i.e., just below the agar surface in the upside-down plate). Slowly extract 0.2 ml of the gas so as not to disturb the gradient severely. Quickly remove the needle tip from the plate and insert it in the gas inlet of the GC, and inject the gas.
Note: Since sampling may destroy the gradient, only one sample was taken from each plate.
Several samples should be taken (we took 7-9) for each position and time, using the median to calculate the dynamic odor gradient.
Fitting the odor gradient
Model selection
At the beginning of curve fitting, a parametric function needs to be specified for the data. Physical phenomena caused in the assay plate are evaporation of the 2-nonanone-ethanol-mixed solution (30:70, v/v) and diffusion of their gaseous molecules in the three-dimensional closed cylindrical space. Although we previously calculated the evaporation and distribution of 2-nonanone numerically (Yamazoe-Umemoto et al., 2015), in the recent study we employed a phenomenological curve fitting to the measured concentration by least squares method for better understanding of the odor gradient (Tanimoto et al., 2017). After the odor sources are put at the two spots, the 2-nonanone concentration C(t) in the plate increases from zero and asymptotically approaches a constant value over time. In this work, a saturation curve C(t) = a(1-exp(-bt)) was used for fitting, where a and b denote an asymptotic concentration and an increasing rate, respectively. This function is a solution of the rate equation dC(t)/dt = b(a - C(t)) which implies that C(t) changes with the rate proportional to the difference from the asymptotic concentration.
In the measurement, increasing of the 2-nonanone concentration was slow as the distance from the spots is far (Figure 7). A mass transfer by molecular diffusion accounts for this result. Therefore the increasing rate is a decreasing function of the distance r from the spot such as b(r) = b0 exp(-b1 r - b2 r2), where b0 (> 0), b1 and b2 are constant parameters. For good fitting in a relatively short time after putting the odor sources, furthermore, the asymptotic concentration is also a decreasing function of r such as a(r) = a0 exp(-a1 r - a2 r2), where a0 (> 0), a1 and a2 are constant parameters. Because there are two odor sources in the plate, the measured concentrations are fitted to the following function with two saturation curves.
where r1 and r2 are the distances from the position (x, y) on the agar to the two spots (X1, Y1) = (-22, 15) and (X2, Y2) = (-22, -15), respectively.
The radius of the plate is 44 mm (1 mm in the plate thickness).
Two constraint conditions are imposed on the fitting. The first constraint condition is that a(r) and b(r) should be decreasing functions of r at least in the range 0 ≤ r ≤ r0, where r0 is the distance from the spot to the edge of the plate (44, 0). From da(r)/dr = - a0(a1 + 2a2 r) exp(-a1 r - a2 r2) and db(r)/dr = - b0(b1 + 2b2 r) exp(-b1 r - b2 r2), inequality conditions da(r0)/dr ≤ 0 and db(r0)/dr ≤ 0 (decreasing even at r = r0) are expressed as:
under a0 > 0 and b0 > 0. The second constraint condition is that the asymptotic concentration on the odor sources should be lower than the saturation concentration 34.5 μM of the 2-nonanone (Yamazoe-Umemoto et al., 2015). Letting be the distance between the two spots, this condition is expressed as:
Fitting algorithm
The fitting parameters in C(x, y, t) are determined by the Levenberg-Marquardt method which is widely used to solve non-linear minimization problems (Press et al., 1992). Letting be the parameter vector,
the sum of the squared errors is explicitly defined by:
Where un is the n-th measured concentration at position (xn, yn) at time tn (). The inequality constraints are expressed as:
Introducing the following function with logarithmic barriers,
the given constrained minimization problem is approximately replaced by an unconstrained minimization problem. Where μ is a penalty factor whose value is initially large positive and is reduced to zero as is converged. The iterative algorithm to determine which minimizes is as follows.
Step 1: Initial values are set for , μ and λ. Where λ is a damping factor in the Levenberg-Marquardt method and is used in Step 2. is chosen to satisfy the inequality constraints. Initial μ and λ are large positive.
Step 2: The Jacobian matrices J = ({Jij}), G = ({Gij}), the diagonal matrix M and the residual vector are calculated.
Then, the following linear equation of is solved and is calculated.
Where
Step 3: If for a small constant ε, then is determined as a solution, or else go to Step 2 with updating , μ and λ. If , is updated by checking the inequality constraints. μ and λ are reduced by rates α and β (0 < α, β < 1), respectively. If or the inequality constraints are not satisfied, and μ are not updated while λ is increased by a rate 1/β.
Execution and result
In this work, the fitting algorithm is implemented in C language and is compiled by the GNU Compiler Collection. The convergence criterion is ε = 1 x 10-6 . Setting of the decrement rates α and β depends on the choice of an initial . In particular, the slow reduction of μ requires the avoidance of invalid updating of , such that the reduction rate α for μ (μ→αμ) is 0.5 < α < 1. When α < 0.5, the penalty factor μ rapidly converges to 0 and an incorrect solution without inequality constraints is derived. Some combinations of initial parameters and decrement rates are tried for fitting. Furthermore, a converged value of is used as an initial value in new iterations with different μ and λ. Good fitting parameters are a0 = 20.68 μM, a1 = 0.7355 cm-1, a2 = -0.05408 cm-2, b0 = 0.8384 min-1, b1 = 0.7835 cm-1 and b2 = -0.05761 cm-2. Some software tools are useful for the non-linear curve fitting. Optimization Toolbox in MATLAB provides packages for non-linear least squares minimization. Solver Add-in in Microsoft Excel is also available for non-linear curve fitting.
Fitting result is shown in Figure 7. Temporal change of the 2-nonanone gradient is shown in Video 1 in Tanimoto et al. (2017). Although the odor sources spread in a round shape (~5 mm in diameter) in the experiment, their shape in the fitting is considered as a point which has no area. Therefore, the fitted 2-nonanone gradient around the spots became pointy.
When a simple exponential function b(r) = b0 exp(-b1 r) was used for fitting, the result was not good. A higher-order correction of more than r2 term requires for good fitting. When b(r) = b0 exp(-b1 r - b2 r2 - b3 r3) was used for fitting, the result was almost the same as that without the r3 term. Fitting using a polynomial function b(r) = b0 - b1 r - b2 r2 - b3 r3 or a fractional function b(r) = 1/(b0 + b1 r + b2 r2) went bad. Fitting using other saturation curve C(t) = c0 t/(t + c1) or C(t) = c0 t2/(t2 + c1) also went bad.
Figure 7. Temporal change of the measured 2-nonanone concentration at the position (x, y) on the agar. The odor sources were put at (-22, 15) and (-22, -15). The broken lines are the fitting curves.
Data analysis
All data related to this study are already published in Tanimoto et al. (2017).
Notes
We found that variations in odor concentration become considerably smaller with increasing distance from the odor source, i.e., in the right half of the plate. Conversely, variations were greater near the odor source. We consider that this is because diffusion essentially equalizes variation, leading to less variation at greater distances from the source.
In the natural environment, odors are recognized to exist as plumes; they do not produce a smooth gradient. In this experiment, 0.2 ml was aspirated for one measurement, therefore we were not able to detect any spatial differences within this volume. However, based on the model of the smooth 2-nonanone gradient, C. elegans are estimated to respond to a concentration change of about 0.01 μM/sec, which is consistent with behavioral response in a constant odor concentration change in artificial flow (Tanimoto et al., 2017). This suggests that the gradient is indeed smooth, at least in this case caused by volatilization and diffusion in the static space inside the plastic plate.
The shape of the gradient can differ substantially depending on the ratio of volatilization to diffusion. In the case of 2-nonanone, the ratio was appropriate for formation of a reasonable gradient.
The 2-nonanone concentration used in our paradigm is relatively high compared to concentrations of other odorants used in C. elegans odor-taxis analysis, which are in general 10-3-10-4 at odor source (Bargmann et al., 1993). For these odorants, it would be better to use a more sensitive GC. In addition, for these odorants, it may be important to use materials with less adhesion for the vaporizing tank and syringe, such as glass or metal, instead of plastic.
Recipes
NGM plate (for 1 L)
970 ml ddH2O
3 g NaCl
2.5 g peptone
17 g agar
1 ml cholesterol (5 mg/ml EtOH)
Autoclave; wait until 50-60 °C
Add the following autoclaved buffers:
1 ml 1 M CaCl2
1 ml 1 M MgSO4
25 ml 1 M KPO4 buffer (pH 6)
KPO4 buffer (pH 6.0), 1 M
108.3 g KH2PO4
35.6 g K2HPO4
Add ddH2O up to 1L
Autoclave
Acknowledgments
We especially thank K. Tanaka (FIS Inc., Japan) for all the technical support of odor measurement. This work was supported by a Grant-in-Aid for JSPS fellows (A.Y.-U.), the Osaka University Life Science Young Independent Researcher Support Program, Precursory Research for Embryonic Science and Technology from MEXT, and research grants from Mitsubishi Foundation, Shimadzu Science Foundation, and Takeda Science Foundation (K.D.K.). The authors declare that no competing interests exist.
References
Bargmann, C. I., Hartwieg, E. and Horvitz, H. R. (1993). Odorant-selective genes and neurons mediate olfaction in C. elegans. Cell 74(3): 515–527.
De Bono, M. and Maricq, A. V. (2005). Neuronal substrates of complex behaviors in C. elegans. Annu Rev Neurosci 28: 451-501.
Gershow, M., Berck, M., Mathew, D., Luo, L., Kane, E. A., Carlson, J. R. and Samuel, A. D. (2012). Controlling airborne cues to study small animal navigation. Nat Methods 9(3): 290-296.
Kimura, K. D., Fujita, K., and Katsura, I. (2010). Enhancement of odor avoidance regulated by dopamine signaling in Caenorhabditis elegans. J Neurosci 30(48): 16365-16375.
Louis, M., Huber, T., Benton, R., Sakmar, T. P. and Vosshall, L. B. (2008). Bilateral olfactory sensory input enhances chemotaxis behavior. Nat Neurosci 11(2): 187-199.
Press, W. H., Teukolsky, S. A., Vetterling, W. T. and Flannery, B. P. (1992). Numerical recipes in C. Cambridge University Press.
Tanimoto, Y., Yamazoe-Umemoto, A., Fujita, K., Kawazoe, Y., Miyanishi, Y., Yamazaki, S. J., Fei, X., Busch, K. E., Gengyo-Ando, K., Nakai, J., Iino, Y., Iwasaki, Y., Hashimoto, K. and Kimura, K. D. (2017). Calcium dynamics regulating the timing of decision-making in C. elegans. Elife 6: e21629.
Venken, K. J., Simpson, J. H. and Bellen, H. J. (2011). Genetic manipulation of genes and cells in the nervous system of the fruit fly. Neuron 72(2): 202-230.
Yamazoe-Umemoto, A., Fujita, K., Iino, Y., Iwasaki, Y. and Kimura, K. D. (2015). Modulation of different behavioral components by neuropeptide and dopamine signalings in non-associative odor learning of Caenorhabditis elegans. Neurosci Res 99: 22-33.
Copyright: Yamazoe-Umemoto et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Yamazoe-Umemoto, A., Iwasaki, Y. and Kimura, K. D. (2018). Measuring Spatiotemporal Dynamics of Odor Gradient for Small Animals by Gas Chromatography. Bio-protocol 8(7): e2797. DOI: 10.21769/BioProtoc.2797.
Tanimoto, Y., Yamazoe-Umemoto, A., Fujita, K., Kawazoe, Y., Miyanishi, Y., Yamazaki, S. J., Fei, X., Busch, K. E., Gengyo-Ando, K., Nakai, J., Iino, Y., Iwasaki, Y., Hashimoto, K. and Kimura, K. D. (2017). Calcium dynamics regulating the timing of decision-making in C. elegans. Elife 6: e21629.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Chemotaxis
Biochemistry > Other compound > 2-nonanone
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,798 | https://bio-protocol.org/exchange/protocoldetail?id=2798&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Xenopus laevis Oocytes Preparation for in-Cell EPR Spectroscopy
Laura John
Malte Drescher
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2798 Views: 6995
Edited by: Marc-Antoine Sani
Reviewed by: Anca Savulescu
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
One of the most exciting perspectives for studying bio-macromolecules comes from the emerging field of in-cell spectroscopy, which enables to determine the structure and dynamics of bio-macromolecules in the cell. In-cell electron paramagnetic resonance (EPR) spectroscopy in combination with micro-injection of bio-macromolecules into Xenopus laevis oocytes is ideally suited for this purpose. Xenopus laevis oocytes are a commonly used eukaryotic cell model in different fields of biology, such as cell- and development-biology. For in-cell EPR, the bio-macromolecules of interest are microinjected into the Xenopus laevis oocytes upon site-directed spin labeling. The sample solution is filled into a thin glass capillary by means of Nanoliter Injector and after that microinjected into the dark animal part of the Xenopus laevis oocytes by puncturing the membrane cautiously. Afterwards, three or five microinjected Xenopus laevis oocytes, depending on the kind of the final in-cell EPR experiment, are loaded into a Q-band EPR sample tube followed by optional shock-freezing (for experiment in frozen solution) and measurement (either at cryogenic or physiological temperatures) after the desired incubation time. The incubation time is limited due to cytotoxic effects of the microinjected samples and the stability of the paramagnetic spin label in the reducing cellular environment. Both aspects are quantified by monitoring cell morphology and reduction kinetics.
Keywords: Xenopus laevis oocytes in-Cell EPR in-Cell spectroscopy Site-directed spin labeling Microinjection in vivo structure determination Dynamics of biomacromolecules
Background
Electron paramagnetic resonance (EPR) spectroscopy is the method of choice for characterization of paramagnetic systems (Atherton, 1993; Gerson et al., 1994; Jeschke and Schweiger, 2001). Diamagnetic bio-macromolecules can be made accessible for EPR spectroscopy by site-directed spin labeling (SDSL), commonly using nitroxides as spin labels (Hubbell and Altenbach, 1994; Feix and Klug, 2002; Likhtenshtein et al., 2008; Berliner and Reuben, 2012). The combination of SDSL with in-cell EPR spectroscopy is a powerful tool to gain information about structure and dynamics of bio-macromolecules such as proteins or nucleotides in their natural environment (Azarkh et al., 2013; Martorana et al., 2014; Qi et al., 2014; Cattani et al., 2017). The most common experimental procedure for the fledging technique of in-cell EPR is based on the microinjection of the target molecules into oocytes from the African frog Xenopus laevis, which are a widely used eukaryotic cell model (Kay, 1991; Barnard et al., 1982; Mishina et al., 1984; Dawid and Sargent, 1988; Richter, 1999).
The advantages of Xenopus laevis oocytes for in-cell EPR are the large size of approximately 1 mm in diameter (approximately 1 µl cell volume), the resulting easy handling and the fact that only three or five of them are required for an in-cell EPR sample (Qi et al., 2014; Cattani et al., 2017). Consequently, bio-macromolecules can be introduced relatively easily in the quantity required for EPR measurements into the Xenopus laevis oocyte by microinjection. Hence, there have been numerous intracellular distance measurements of spin labelled DNA and proteins performed by double electron-electron resonance (DEER) measurements after microinjection into Xenopus laevis oocytes (Igarashi et al., 2010; Azarkh et al., 2011; Krstic et al., 2011; Azarkh et al., 2013; Martorana et al., 2014; Wojciechowski et al., 2015; Cattani et al., 2017).
Materials and Reagents
Glass capillaries (3.5 inch length, Drummond Scientific, catalog number: 3-000-203-G/X )
Single-use syringe (Sigma-Aldrich, catalog number: Z230723 )
Parafilm (Sigma-Aldrich, catalog number: P7793-1EA )
Petri dish, size 60 x 15 mm (Corning, catalog number: 430166 )
Razor blade (Plano, catalog number: T5016 )
Pasteur capillary pipette (150 mm, WU Mainz)
Brand pipette controller micro-classic (BRAND, catalog number: 25900 )
Q-band sample tubes (quartz glass, 1 mm i.d., Bruker, catalog number: ER 221TUB-Q10 )
Hamilton syringe (Hamilton, catalog number: 80500 )
Petri dish, size 35 x 10 mm (Corning, catalog number: 430165 )
Capillary tube sealing compound (Cha-seal, DWK Life Sciences, Kimble, catalog number: 43510 )
Xenopus laevis oocytes on stage V/VI in MBS buffer (Ecocyte Bioscience, ecocyte-us.com/products/xenopus-oocyte-delivery-service/)
Modified Barth’s Saline (MBS) buffer (1x) (Ecocyte Bioscience) (88 mM NaCl, 1 mM KCl, 1 mM MgSO4, 5 mM HEPES, 2.5 mM NaHCO3, 0.7 mM CaCl2)
Mineral oil (Sigma-Aldrich, catalog number: M5904 )
Liquid nitrogen
3-Maleimido-PROXYL (3-Maleimido-2,2,5,5-tetramethyl-1-pyrrolidinyloxy) (Sigma-Aldrich, catalog number: 253375 )
Equipment
Flaming/Brown Micropipette Puller (Sutter Instrument, model: P-97 )
Nanoject II Auto-Nanoliter Injector (Drummond Scientific, catalog number: 3-000-205A )
Micromanipulator MM33 (Drummond Scientific, catalog number: 3-000-024-R ) with Support Base (Drummond Scientific, catalog number: 3-000-025-SB )
Binocular microscope (ZEISS, model: Stemi 2000-C , attended with an AxiaCam ERc 5s camera (ZEISS, model: AxiaCam ERc 5s ))
Home-built polytetrafluoroethylene holder
Dewar for liquid nitrogen (KGW-Isotherm, catalog number: 1021 )
-80 °C freezer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：John, L. and Drescher, M. (2018). Xenopus laevis Oocytes Preparation for in-Cell EPR Spectroscopy. Bio-protocol 8(7): e2798. DOI: 10.21769/BioProtoc.2798.
Download Citation in RIS Format
Category
Biophysics > EPR spectroscopy > In Cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,799 | https://bio-protocol.org/exchange/protocoldetail?id=2799&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification of RNA Mango Tagged Native RNA-protein Complexes from Cellular Extracts Using TO1-Desthiobiotin Fluorophore Ligand
SP Shanker Shyam Sundhar Panchapakesan
SJ Sunny C. Y. Jeng
PU Peter J. Unrau
Published: Vol 8, Iss 7, Apr 5, 2018
DOI: 10.21769/BioProtoc.2799 Views: 7430
Edited by: Gal Haimovich
Reviewed by: Anca Savulescu
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
A native purification strategy using RNA Mango for RNA based purification of RNA-protein complexes is described. The RNA Mango aptamer is first genetically engineered into the RNA of interest. RNA Mango containing complexes obtained from cleared cellular native extracts are then immobilized onto TO1-Desthiobiotin saturated streptavidin agarose beads. The beads are washed to remove non-specific complexes and then the RNA Mango containing complexes are eluted by the addition of free biotin to the beads. Since the eluted complexes are native and fluorescent, a second purification step such as size exclusion chromatography can easily be added and the purified complexes tracked by monitoring fluorescence. The high purity native complexes resulting from this two-step purification strategy can be then used for further biochemical characterization.
Keywords: RNA Mango TO1-Desthiobiotin RNP complex purification Fluorophore Native purification Non-coding RNAs RNA-protein complexes
Background
Current RNA tags suffer from limitations such as poor KD, large size, potential biological interference or lack of intrinsic fluorescence (Panchapakesan et al., 2015). RNA Mango is small, can be simply integrated into stem-loop structures, in particular, GNRA tetraloops, is biologically tolerated and above all has a high affinity for its thiazole orange-based (TO1) ligand, TO1-Desthiobiotin (TO1-Dtb). This allows Mango tagged complexes to be easily bound and washed on streptavidin beads (summarized in Figure 1). The Mango:TO1-Desthiobiotin complex is highly fluorescent and can be eluted from streptavidin beads by the addition of biotin. The fluorescence of Mango tagged native complexes allows additional purification steps to be used to obtain highly purified native complexes.
Figure 1. Purification of Mango tagged RNA-protein complexes out of native extract. RNA constructs are designed (Procedure A, Figure 2) so that the Mango tag is located in a biologically compatible location. After bacterial expression of this construct, a native extract containing the Mango tagged RNA (Mango tag shown in red highlight), is prepared (Procedure B). Mango tagged RNA and RNA complexes are then bound to streptavidin beads (Black circle containing S) that have been derivatized with TO1-Desthiobiotin (Dtb, Procedure C). The thiazole orange moiety of TO1-Dbt is shown in purple and becomes highly fluorescent once bound by Mango (bright red highlight). Bound complexes are then extensively washed in native conditions (Procedure D). After washing fluorescent Mango tagged complexes can be eluted in native conditions by addition of biotin (Procedure E). Downstream analysis including further purification steps can then be simply implemented (Procedures F and G).
Materials and Reagents
Low retention pipette tips (Fisher Scientific, catalog numbers: 02-717-134 , 02-717-143 , 02-707-511 )
Microcentrifuge tubes, pre-lubricated (Corning, Costar®, catalog numbers: 3206 , 3207 )
96-well black wall, clear bottom, non-binding, non-sterile, Greiner Bio-One microtiter plate (Greiner Bio One International, catalog number: 655906 )
Tricorn XK 16/40 SEC column (GE Healthcare, catalog number: 28988938 )
Bacterial cells (E. coli) with RNA Mango tagged RNA of interest
Liquid nitrogen
TO1-PEG3-Desthiobiotin (ABM, catalog number: G956 )
High capacity streptavidin agarose beads (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 20357 )
Superdex 200 resin (GE Healthcare, catalog number: 17104301 )
SYBR Green II RNA Gel Stain (Thermo Fisher Scientific, InvitrogenTM, catalog number: S7564 )
19:1 Acrylamide:Bis 40% (Thermo Fisher Scientific, catalog number: AM9022 )
N,N,N’,N’-Tetramethylethylenediamine (TEMED) (Sigma-Aldrich, catalog number: T9281 )
Ammonium persulphate (APS) (Bio-Rad Laboratories, catalog number: 1610700 )
Boric acid (ACP Chemicals, catalog number: B2940 )
EDTA (ACP Chemicals, catalog number: E4320 )
Tris base (Fisher Scientific, catalog number: BP152 )
Tris-HCl (Sigma-Aldrich, Roche Diagnostics, catalog number: 10812846001 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
DTT (Sigma-Aldrich, Roche Diagnostics, catalog number: 10197777001 )
Sodium hydroxide (NaOH) (VWR, BDH, catalog number: BDH9292 )
Sodium chloride (NaCl) (ACP Chemicals, catalog number: S2830 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Heparin (Sigma-Aldrich, catalog number: H0777-25KU )
Biotin (Sigma-Aldrich, catalog number: B4501 )
Yeast extract (Fisher Scientific, catalog number: BP1422 )
Tryptone (Fisher Scientific, catalog number: BP1421 )
Potassium hydroxide (KOH) (VWR, BDH, catalog number: BDH9262 )
10x Bacterial Native Extract (BNE) buffer (see Recipes)
10x Buffer A (see Recipes)
10x HEPES KCl (HK) buffer (see Recipes)
10x Binding buffer (see Recipes)
10x Biotin elution buffer (see Recipes)
LB media (see Recipes)
Equipment
Standard personal protective equipment
Pipettes
Peristaltic pump
Fraction collector and appropriate collection tubes
SpectraMax M5 fluorescent plate reader (Molecular Devices, model: SpectraMax M5 )
Temperature controlled room (To be maintained at 4 °C)
Preparative centrifuge, microcentrifuge and benchtop Picofuge
Tube rotator for 1.5 ml tubes
Polyacrylamide gel running equipment
French press
Sorvall RC6+ centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM RC 6 Plus )
Sorvall SLA-1500 rotor (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SLA-1500 )
NanoDrop
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Panchapakesan, S. S. S., Jeng, S. C. Y. and Unrau, P. J. (2018). Purification of RNA Mango Tagged Native RNA-protein Complexes from Cellular Extracts Using TO1-Desthiobiotin Fluorophore Ligand. Bio-protocol 8(7): e2799. DOI: 10.21769/BioProtoc.2799.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > RNA
Biochemistry > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.