id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
289 | https://bio-protocol.org/exchange/protocoldetail?id=289&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Toxoplasma gondii Replication in Naïve and Activated Macrophages
EI Emma Iaconetti*
BL Brian Lynch*
NK Nathaniel Kim
DM Dana G. Mordue
*Contributed equally to this work
Published: Vol 2, Iss 22, Nov 20, 2012
DOI: 10.21769/BioProtoc.289 Views: 12340
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
Toxoplasma gondii is an obligate intracellular protozoan parasite that causes the disease toxoplasmosis. Chronic infection is established through the formation of tissue cysts predominantly in cardiac and neurologic tissues. A defining characteristic of T. gondii is its ability to evade the host’s immune defenses; specifically, T. gondii can invade and persist within host phagocytes, using them to disseminate to the brain and central nervous system where cysts are then formed. This protocol is used to evaluate the ability of Toxoplasma gondii to survive and replicate within naive and activated murine bone marrow-derived macrophages at the level of single infected cells. In the following protocol macrophages are naive or activated with IFN-γ and LPS but different activation stimuli can be utilized as well as different host cell populations and diverse inhibitors. Parasite replication is determined by evaluating the number of parasites per vacuole over time using immunofluorescence staining for parasties and microscopic analysis. Kinetic determination of parasite number per vacuole accurately reflects parasite replication over time as vacuoles-containing parasites do not fuse with one another. Isolation of murine bone marrow-derived macrophages, preparation of conditioned L929 cells for collection of macrophage colony-stimulating factor, and staining for fluorescence microscopy included in the protocol has broad applicability. This protocol works well for pathogens like Toxoplasma gondii that reside in vacuoles that do not fuse with one another and that can be visualized by microscopy.
Keywords: Toxoplasma Macrophages Cell-autonomous immunity Nitric oxide
Materials and Reagents
Note: source of reagents is not critical to experiment.
Murine bone marrow derived macrophages (see protocol below)
Rabbit polyclonal antibody against Toxoplasma gondii (Fitzgerald Laboratories)
Alexa Fluor® 488-conjugated goat anti-rabbit IgG (H + L) (Life Technologies, Invitrogen™, catalog number: A-11012 )
Dulbecco’s modified ragle medium high glucose (DMEM) (1x) (Life Technologies, Invitrogen™, catalog number: 10313-039 )
Fetal calf serum (FCS) (Hyclone, catalog number: SH30396.03 ); heat inactivated 56 °C for 30 min
L-gluatamine (Hyclone, catalog number: SH30034.01 )
Penicillin/streptomycin (Hyclone, catalog number: SV30010 )
L929 cell (ATCC CCL1) conditioned media as a source of macrophage colony-stimulating factor (M-CSF) for maturation of bone marrow-derived macrophages (see protocol below)
Dulbeccos PBS (Ca2+ free and Mg2+ free) (DPBS) (Hyclone, catalog number: SH30028.02 )
Toxoplasma gondii parasites (tachyzoites), Tachyzoites are the haploid replicating stage of Toxoplasma gondii that can be grown in vitro in human fibroblast cells or other host cell types.
Lipopolysaccharide (LPS) (List Biological from E. Coli O55: B5 #203)
Recombinant murine IFN-γ (Pepro Tech, catalog number: 50813665 )
Aminoguanidine (Thermo Fisher Scientific, Acros Organics, catalog number: AC40078-1000 ) - inhibitor of inducible nitric oxide synthase
Sodium nitroprusside (SNP) (Thermo Fisher Scientific, catalog number: AC211640000 ) - nitric oxide donor
16% methanol-free paraformaldehyde EM grade (Electron Microscopy Sciences, catalog number: 15710 )
Triton X100 (Sigma-Aldrich, catalog number: T9284-500 )
Mounting media such as Vectashield containing DAPI to stain nucleus (Vector Laboratories, catalog number: H-1200 )
Cover slips for the chamber slides (22 x 50 x 1) (Thermo Fisher Scientific, catalog number: 12-548-5E )
4% paraformaldehyde
KCl
KH2PO4
NaCl
Na2HPO4
DPBS (we purchase it but the recipe is below) (see Recipes)
D10 media (see Recipes)
BMC media (see Recipes)
Blocking buffer (see Recipes)
Wash buffer (see Recipes)
Equipment
Fluorescence microscope with 100x phase or DIC objective
Tabletop centrifuge capable of holding 15 or 50 ml centrifuge tubes
Humidified CO2 incubator at 37 °C
Bacteriological petri plates (100 mm x 15 mm) (Thermo Fisher Scientific, catalog number: 0875712 )
Zeiss inverted Axiovert 200
Hemocytometer
8-well chamber slides (BD Biosciences, catalog number: 354118 ) or cover slips inserted into wells in a 24 well plate
Sterile plastic 50 ml centrifuge tubes (brand is not important)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Host defense > Murine
Immunology > Immune cell isolation > Macrophage
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,890 | https://bio-protocol.org/exchange/protocoldetail?id=2890&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Extracellular Double-stranded RNA Uptake and Subcellular Localization Using Flow Cytometry and Confocal Microscopy
TN Tan A Nguyen
LW Lachlan Whitehead
KP Ken C Pang
Published: Vol 8, Iss 12, Jun 20, 2018
DOI: 10.21769/BioProtoc.2890 Views: 6252
Edited by: Ivan Zanoni
Reviewed by: Laura CampisiKristofor K. Ellestad
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
Double-stranded RNA is a potent pathogen-associated molecular pattern (PAMP) produced as a by-product of viral replication and a well-known hallmark of viral infection. Viral dsRNAs can be released from infected cells into the extracellular space and internalized by neighboring cells via endocytosis. Mammals possess multiple pattern recognition receptors (PRRs) capable of detecting viral dsRNAs such as endosomal toll-like receptor 3 (TLR3) and cytosolic RIG-I-like receptors (RLRs) which lead to the production of type I interferons (IFNs). Thus, intracellular localization of viral dsRNA can provide insight into the downstream signaling pathways leading to innate immune activation. Here, we describe a quantitative method for measuring extracellular dsRNA uptake and visualizing subcellular localization of internalized dsRNA via flow cytometry and confocal microscopy respectively.
Keywords: Double-stranded RNA Endosomes Lysosomes Viruses Poly(I:C) TLR3 RIG-I MDA-5 Confocal microscopy Flow cytometry
Background
Double-stranded RNAs (dsRNAs) are a common by-product of viral replication and are potent activators of antiviral immunity via the production of type I interferon (IFN) and other pro-inflammatory cytokines (Nellimarla and Mossman, 2014). Viral dsRNAs are sensed within endosomes by TLR3 (Matsumoto et al., 2003) or in the cytosol by the RIG-I-like receptors (RLRs), RIG-I and MDA-5 (Kato et al., 2006). During lytic infections, these dsRNAs can be released into the extracellular space where they bind surface receptors on neighboring cells, such as class A scavenger receptors (SR-A) and Raftlin, and are subsequently internalized via clathrin-mediated endocytosis (Itoh et al., 2008; DeWitte-Orr et al., 2010; Watanabe et al., 2011; Dansako et al., 2013).
In our previous study, we found out that the protein SID1 transmembrane family member 2 (SIDT2) localizes to late endosomes and lysosomes and that loss of SIDT2 leads to subcellular accumulation of the synthetic dsRNA analog, poly(I:C), while not affecting initial endocytosis-mediated internalization (Nguyen et al., 2017). To do so, we developed and utilized flow cytometry and confocal microscopy-based approaches to quantitatively measure poly(I:C) uptake and subcellular localization respectively in vitro. In this protocol, we describe a further refinement of these assays to allow for high-throughput assessment of internalization and subcellular localization of different dsRNAs. These methods allow for further dissection of dsRNA trafficking during viral infection and the downstream effects of these dsRNAs on innate immune signaling.
Materials and Reagents
8 well microscope slide (ibidi, catalog number: 80826 )
24 well tissue culture plate (Corning, Falcon®, catalog number: 353047 )
Sterile filtered pipette tips (0.5 µl to 1,000 µl) (Corning, Axygen, catalogue numbers: TF-300-L-R-S , TF-20-L-R-S , TF-200-L-R-S and TF-1000-L-R-S )
10 cm culture dishes (Corning, Falcon®, catalog number: 353003 )
10 ml centrifuge tubes (SARSTEDT, catalog number: 62.9924.284 )
1.5 ml microcentrifuge tubes (Sigma-Aldrich, catalog number: EP0030120086 )
1.2 ml Micro Titertube (Thermo Fisher Scientific, Quality Scientific Plastics, catalog number: 845-Q )
Serological pipettes, individually wrapped, 10 ml (Corning, Falcon®, catalog number: 356551 )
Mammalian cell line of interest, here: mouse embryonic fibroblasts (see Note 1)
70% (v/v) ethanol (Chem Supply, catalog number: EA043 )
Dulbecco’s modified Eagle medium (DMEM) or other suitable complete growth medium for culture of cell line of interest
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F9423 )
Phosphate-buffered saline (PBS) (sterile) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190250 )
Penicillin/streptomycin solution (Sigma-Aldrich, catalog number: P4333 )
Poly(I:C)-fluorescein (InvivoGen, catalog number: tlrl-picf )
Poly(I:C)-rhodamine (InvivoGen, catalog number: tlrl-picr )
dsRNA specific monoclonal antibody (J2, SCICONS English and Scientific Consulting, catalog number: 10010200 )
RNase A enzyme (Sigma-Aldrich, catalog number: R4875 )
1x trypsin-EDTA solution (Sigma-Aldrich, catalog number: 59430C )
Paraformaldehyde (PFA) powder (Sigma-Aldrich, catalog number: 158127 )
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
DAPI (4’,6-Diamidine-2’-phenylindole dihydrochloride) powder (Sigma-Aldrich, catalog number: D9542 )
ImmersolTM Immersion Oil (Carl Zeiss, catalog number: 4449620000000 )
Complete growth medium (see Recipes)
10% FBS/PBS (see Recipes)
4% paraformaldehyde (w/v) (see Recipes)
Permeabilization buffer (see Recipes)
DAPI solution (see Recipes)
Equipment
Pipetting aid (Thermo Fisher Scientific, catalog number: 9531 )
Micropipettes from 0.5 µl to 1 ml (Mettler-Toledo International, Rainin, model: Pipet-LiteTM XLS+ )
Hemocytometer
Class II biological safety cabinet/tissue culture hood
Humidified CO2 incubator (95% air, 5% CO2, 37 °C)
Inverted light microscope (phase contrast)
37 °C water bath
Vacuum aspiration system with glass Pasteur pipettes
Table top centrifuge equipped with a swing-out rotor for 10 ml conical tubes
Microcentrifuge
LSRFortessa X20 (BD, BD Biosciences, model: LSRFortessaTM X-20 ) or equivalent flow cytometer
LSM 780 confocal laser scanning microscope (ZEISS, model: LSM 780 ) or equivalent microscope
Software
FIJI/ImageJ
Zeiss ZEN package
Microsoft Excel
FlowJo
GraphPad Prism 7
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nguyen, T. A., Whitehead, L. and Pang, K. C. (2018). Quantification of Extracellular Double-stranded RNA Uptake and Subcellular Localization Using Flow Cytometry and Confocal Microscopy. Bio-protocol 8(12): e2890. DOI: 10.21769/BioProtoc.2890.
Download Citation in RIS Format
Category
Immunology > Immune cell imaging > Confocal microscopy
Cell Biology > Cell imaging > Confocal microscopy
Molecular Biology > RNA > RNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,891 | https://bio-protocol.org/exchange/protocoldetail?id=2891&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Characterizing the Transcriptional Effects of Endolysin Treatment on Established Biofilms of Staphylococcus aureus
LF Lucía Fernández
SG Silvia González
DG Diana Gutiérrez
AC Ana Belén Campelo
BM Beatriz Martínez
AR Ana Rodríguez
PG Pilar García
Published: Vol 8, Iss 12, Jun 20, 2018
DOI: 10.21769/BioProtoc.2891 Views: 4874
Edited by: Modesto Redrejo-Rodriguez
Reviewed by: Benoit Chassaing
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
Biofilms are the most common lifestyle of bacteria in both natural and human environments. The organized structure of these multicellular communities generally protects bacterial cells from external challenges, thereby enhancing their ability to survive treatment with antibiotics or disinfectants. For this reason, the search for new antibiofilm strategies is an active field of study. In this context, bacteriophages (viruses that infect bacteria) and their derived proteins have been proposed as promising alternatives for eliminating biofilms. For instance, endolysins can degrade peptidoglycan and, ultimately, lyse the target bacterial cells. However, it is important to characterize the responses of bacterial cells exposed to these compounds in order to improve the design of phage-based antimicrobial strategies.
This protocol was developed to examine the transcriptional responses of Staphylococcus aureus biofilm cells exposed to endolysin treatment, as previously described in Fernández et al. (2017). However, it may be subsequently adapted to analyze the response of other microorganisms to different antimicrobials.
Keywords: Biofilms Endolysins Staphylococcus aureus RNA-seq Responses to antimicrobials
Background
It is becoming increasingly clear that subinhibitory doses of antimicrobials may have a regulatory effect on different phenotypes of the target microbes, including biofilm formation, metabolism or virulence. Therefore, studying the potential impact of a novel compound on the target cells at low-level concentrations should be a part of the development process. Indeed, a very effective antibacterial agent that triggers production of virulence factors or antibiotic resistance determinants may not be a good candidate for therapeutic application. On the other hand, considering the physiological differences between biofilm and planktonic cells, it seems logical that the effect of new antibiofilm agents should be analyzed on biofilm-forming cells. Here, we describe a protocol for the analysis of transcriptional responses of biofilm cells upon exposure to subinhibitory concentrations of endolysins, phage-derived proteins that show great promise as biofilm removal agents. Thus, the transcriptome of endolysin-treated cells was compared to control cells by RNA-seq and differential expression of selected genes was later confirmed by RT-qPCR.
Materials and Reagents
Standard Petri dishes (Labbox, catalog number: PDIP-09N-500 )
Sterile 10 ml polystyrene culture tubes (Deltalab, catalog number: 300903 )
Cuvettes for OD600 reading (Deltalab, catalog number: 303103 )
1.5 ml microcentrifuge tubes (SARSTEDT, catalog number: 72.690.001 )
12-well microtiter plates with Nunclon Delta surface (Thermo Fisher Scientific, Nunc, catalog number: 150628 )
Sterile plastic loops (1 μl) (VWR, catalog number: 612-9351 )
MicroAmp® Fast optical 96-well reaction plate with barcode (Thermo Fisher Scientific, Applied Biosystems, catalog number: 4346906 )
MicroAmp® optical adhesive film (Thermo Fisher Scientific, Applied Biosystems, catalog number: 4311971 )
Frozen stock of Staphylococcus aureus (for example, S. aureus IPLA1 from our laboratory collection) stored in glycerol at -80 °C
Filtered LysH5 endolysin stock stored in NaPi buffer with 30% glycerol at -80 °C (~350 μg/ml = 5.8 μM) purified as described previously (Gutiérrez et al., 2014)
Agarose for electrophoresis (Conda, catalog number: 8008 )
Glass beads, acid washed (≤ 106 µm, sterile) (Sigma-Aldrich, catalog number: G4649 )
RNA protect® Bacteria Reagent (QIAGEN, catalog number: 76560 )
IllustraTM RNAspin Mini Kit (GE Healthcare, catalog number: 25050071 )
Chloroform (Merck, catalog number: 1024451000 )
Ethanol (Fisher Scientific, catalog number: BP28184 )
SUPERase-InTM RNase Inhibitor (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2694 )
Turbo DNA-free kitTM (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM1907 )
DL-Dithiothreitol (Sigma-Aldrich, catalog number: D0632-5G )
Phenol, Molecular Biology Grade (Merck, Calbiochem, catalog number: 516724-100GM )
iScriptTM Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories, catalog number: 1708841 )
Power SYBR® Green PCR Master Mix (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4367659 )
Bacteriological agar (ROKO S.A.)
D(+)-Glucose (Merck, catalog number: 1.08337.1000 )
Sodium chloride (NaCl) (Merck, catalog number: 1.06404.1000 )
Potassium chloride (KCl) (VWR, BDH, catalog number: 437025H )
Sodium phosphate dibasic (Na2HPO4) (VWR, AnalaR NORMAPUR, catalog number: 102495D )
Potassium phosphate monobasic (KH2PO4) (Merck, catalog number: 1048731000 )
Sodium dihydrogen phosphate monohydrate (NaH2PO4·H2O) (ITW Reagents Division, AppliChem, catalog number: 131965.1211 )
UltraPureTM Tris Buffer (Thermo Fisher Scientific, catalog number: 15504020 )
Glacial acetic acid (Merck, catalog number: 1.00063.2500 )
0.5 M EDTA (pH 8.0) (Alfa Aesar, USB, catalog number: J15701 )
TSB medium (tryptic soy broth, Scharlab, catalog number: 02-200-500 ) (see Recipes)
TSA agar plates (see Recipes)
TSB medium supplemented with glucose (TSBG) (see Recipes)
Phosphate buffered saline (PBS) solution (see Recipes)
Sodium phosphate (NaPi) buffer (see Recipes)
Tris-acetate-EDTA (TAE) buffer (see Recipes)
Equipment
Pipettes (volume ranges: 1 μl-10 μl, 2 μl-20 μl, 20 μl-200 μl, 200 μl-1,000 μl)
Shaking (250 rpm) and static incubators at 25 °C and 37 °C
Spectrophotometer
Note: It is used to measure optical density (OD600) of cell culture.
Epoch microplate spectrophotometer (BioTek Instruments, model: Epoch )
Refrigerated centrifuge (Eppendorf, model: 5415 R )
FastPrep®-24 (MP Biomedicals, catalog number: 116004500 )
Gel electrophoresis apparatus (Bio-Rad Laboratories, Mini-Sub® Cell GT Cell)
Vortex
7500 Fast Real-Time PCR System (Thermo Fisher Scientific, Applied Biosystems, catalog number: 4351107 )
Illumina HiSeq2000 platform
Computer equipped with four Intel Xeon E5-4650 v2 2.4GHz 25M 8GT/s 10-core processors, 256 GB RAM, and running CentOS Linux release 7.3.1611
Note: The computer is for carrying out computation.
Software
FastQC (http://www.bioinformatics.babraham.ac.uk/projects/download.html#fastqc)
BowTie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml) (Langmead and Salzberg, 2012)
EDGE-Pro (http://ccb.jhu.edu/software/EDGE-pro/) (Magoc et al., 2013)
DEseq2 (http://bioconductor.org/packages/release/bioc/html/DESeq2.html) (Love et al., 2014)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fernández, L., González, S., Gutiérrez, D., Campelo, A. B., Martínez, B., Rodríguez, A. and García, P. (2018). Characterizing the Transcriptional Effects of Endolysin Treatment on Established Biofilms of Staphylococcus aureus. Bio-protocol 8(12): e2891. DOI: 10.21769/BioProtoc.2891.
Download Citation in RIS Format
Category
Microbiology > Microbial biofilm > Response to antimicrobials
Molecular Biology > Protein > Activity
Molecular Biology > RNA > RNA sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,892 | https://bio-protocol.org/exchange/protocoldetail?id=2892&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Visualization of RNA at the Single Cell Level by Fluorescent in situ Hybridization Coupled to Flow Cytometry
AC Alice Coillard
ES Elodie Segura
Published: Vol 8, Iss 12, Jun 20, 2018
DOI: 10.21769/BioProtoc.2892 Views: 6066
Edited by: Ivan Zanoni
Reviewed by: Shanie Saghafian-Hedengren
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
The protocol described here has been developed to detect RNA at the single cell level. Fluorescent probes hybridize to target RNAs and are detected by flow cytometry after multiple amplification steps. Different types of RNA can be detected such as mRNA, long noncoding RNA, viral RNA or telomere RNA and up to 4 different target probes can be used simultaneously. We used this protocol to specifically measure the expression of two transcription factor mRNAs, MAFB and IRF4, in human monocytes.
Keywords: RNA Flow cytometry In situ Hybridization Single cell Human
Background
RT-qPCR is one major technique used to easily assess RNA expression. Cells are lysed and analyzed in bulk. Hence, cell heterogeneity is lost. In particular, it is impossible using RT-qPCR to address whether subpopulations may be identified based on the expression of RNA. RNA Fluorescent In Situ Hybridization (FISH) is a way to detect RNA in single cells. This technique requires hybridization of fluorescent probes on RNA targets that are then detected using an imaging system such as a confocal microscope. However, this method is time-consuming and allows the analysis of a limited number of individual cells.
We demonstrated by RT-qPCR that human monocytes cultured in RPMI with M-CSF, IL-4, and TNFa express after three hours the transcription factors MAFB and IRF4 (Goudot et al., 2017). MAFB and IRF4 are involved in the differentiation of monocytes into monocyte-derived macrophages (mo-mac) and monocyte-derived DC (mo-DC) respectively. To decipher whether monocytes express both transcription factors or if this expression is mutually exclusive, we performed in situ hybridization coupled to flow cytometry using PrimeFlow RNA assay.
Materials and Reagents
P1000, P200, P20 pipettes tips (any supplier)
15 and 50 ml conical tubes (any supplier)
PrimeFlow RNA tubes (Thermo Fisher Scientific, catalog number: 19197 )
PrimeFlow® RNA 96-well plate (Thermo Fisher Scientific, catalog number: 44-17005 )
PrimeFlow® RNA Wash Buffer (Thermo Fisher Scientific, catalog number: 00-19180 )
Fixable Viability Dye eFluorTM 506 (Thermo Fisher Scientific, eBioscienceTM, catalog number: 65-0866-14 )
PrimeFlow® RNA Fixation Buffer 1A (Thermo Fisher Scientific, catalog number: 00-18100 )
PrimeFlow® RNA Fixation Buffer 1B (Thermo Fisher Scientific, catalog number: 00-18200 )
PrimeFlow® RNA Fixation Buffer 2 (8x) (Thermo Fisher Scientific, catalog number: 00-18400 )
PrimeFlow® RNA Permeabilization Buffer (10x) (Thermo Fisher Scientific, catalog number: 00-18300 )
PrimeFlow® RNase Inhibitors (100x) (Thermo Fisher Scientific, catalog number: 00-16002 )
PrimeFlow® RNA Target Probe Diluent (Thermo Fisher Scientific, catalog number: 00-19185 )
PrimeFlow® RNA Label Probe Diluent (Thermo Fisher Scientific, catalog number: 00-19183 )
PrimeFlow® Compensation kit (Thermo Fisher Scientific, catalog number: 88-17001 )
PrimeFlow® RNA Storage Buffer (Thermo Fisher Scientific, catalog number: 00-19178 )
AlexaFluor 647 IRF4 (Thermo Fisher Scientific, PF-204, assay ID: VA1-13919-PF) and AlexaFluor 488 MAFB (Thermo Fisher Scientific, PF-204, assay ID: VA4-16783-PF) probe sets
PBS (Eurobio, catalog reference: CS1PBS01-01 )
EDTA (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575020 )
Human serum (BioWest, catalog number: S4190-190 )
RPMI-Glutamax medium (Thermo Fisher Scientific, GibcoTM, catalog number: 61870010 )
Penicillin and streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Fetal calf serum (Biosera, catalog number: FB-1001 )
M-CSF (Miltenyi Biotec, catalog number: 130-096-492 )
IL-4 (Miltenyi Biotec, catalog number: 130-093-922 )
TNFa (Miltenyi Biotec, catalog number: 130-094-014 )
FICZ (Enzo Life Sciences, catalog number: BML-GR206-0100 )
Flow cytometry buffer (see Recipes)
Culture medium for monocyte differentiation (see Recipes)
Equipment
P1000, P200, P20 pipettes
Incubator
Fridge
Freezer
Metal heat block (if 1.5 ml tubes are used)
Refrigerated centrifuge for Eppendorf tubes (Eppendorf, model: 5424R ) or plates (Eppendorf, model: 5810R )
Flow cytometer with 3 lasers (488 nm, 561 nm, 633 nm)
Software
FlowJo V10 (Tree Star)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Coillard, A. and Segura, E. (2018). Visualization of RNA at the Single Cell Level by Fluorescent in situ Hybridization Coupled to Flow Cytometry. Bio-protocol 8(12): e2892. DOI: 10.21769/BioProtoc.2892.
Download Citation in RIS Format
Category
Immunology > Immune cell staining > Flow cytometry
Developmental Biology > Cell growth and fate > Differentiation
Cell Biology > Cell staining > Nucleic acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,893 | https://bio-protocol.org/exchange/protocoldetail?id=2893&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Implementation of Blue Light Switchable Bacterial Adhesion for Design of Biofilms
Fei Chen
Seraphine V. Wegner
Published: Vol 8, Iss 12, Jun 20, 2018
DOI: 10.21769/BioProtoc.2893 Views: 6156
Edited by: Elizabeth Libby
Reviewed by: Timo A LehtiKumari Sonal Choudhary
Original Research Article:
The authors used this protocol in Dec 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2017
Abstract
Control of bacterial adhesions to a substrate with high precision in space and time is important to form a well-defined biofilm. Here, we present a method to engineer bacteria such that they adhere specifically to substrates under blue light through the photoswitchable proteins nMag and pMag. This provides exquisite spatiotemporal remote control over these interactions. The engineered bacteria express pMag protein on the surface so that they can adhere to substrates with nMag protein immobilization under blue light, and reversibly detach in the dark. This process can be repeatedly turned on and off. In addition, the bacterial adhesion property can be adjusted by expressing different pMag proteins on the bacterial surface and altering light intensity. This protocol provides light switchable, reversible and tunable control of bacteria adhesion with high spatial and temporal resolution, which enables us to pattern bacteria on substrates with great flexibility.
Keywords: Bacterial adhesion Optogenetics nMag-pMag Photoswitching Biofilm
Background
Controlling the biofilm formation is crucial to understand the social interactions between bacteria in naturally occurring biofilm (Flemming et al., 2016). This is also particularly important for the biotechnological application of biofilms in biocatalysis, biosensing and waste treatment (Zhou et al., 2013; Jensen et al., 2016). The biofilm formation always begins with the bacterial adhesion to a substrate, which determines the spatial organization in biofilms (Liu et al., 2016; Nadell et al., 2016). Many strategies have been proposed to control bacterial adhesion such as modifying bacterial surface with bio-orthogonal reactive groups via liposome fusion (Elahipanah et al., 2016), immobilization of adhesive molecules on the substrates (Sankaran et al., 2015; Zhang et al., 2016; Peschke et al., 2017) and conjugating surface tags on bacteria (Poortinga et al., 2000; Rozhok et al., 2005; Lui et al., 2013). Among these, the light responsive approaches provide the highest spatiotemporal control, which is important to precisely control the fine structure of the biofilms. For instance, azobenzene linkers have been used as a photoswitchable tool to reversibly control the bacterial adhesion to substrates by altering the presentation of mannose, which is recognized by the bacterial surface receptor FimH (Voskuhl et al., 2014; Weber et al., 2014; Sankaran et al., 2015). In addition, azobenzene-based molecules have also been used to control bacteria adhesion to mammalian cells (Mockl et al., 2016), bacterial quorum sensing (Van der Berg et al., 2015) and biofilm formation (Hu et al., 2016) with UV-light. One of the major drawbacks of using UV-light is that it is toxic to bacteria. In this protocol, we present a new approach of how to control bacterial adhesion to substrates with blue light based on photoswitchable proteins. Besides being a non-invasive, reversible and tuneable technique to control bacterial adhesion to substrates, it also provides high spatiotemporal control required to form well-defined biofilms. Photoswitchable proteins are commonly used in the field of optogenetics to regulate gene expression, receptor activation and protein localization in cells with visible light (Müller and Weber, 2013; Tischer and Weiner, 2014). These optogenetic systems are very sensitive to visible light, bioorthogonal and noninvasive. Furthermore, these proteins are genetically encoded so they can be sustainably expressed in the cell. Here, we used the blue light responsive proteins, nMag and pMag, as photoswitches control bacterial adhesion. These proteins heterodimerize under blue light (480 nm) and dissociate from each other in the dark (Kawano et al., 2015). The strength and back conversion kinetics of the nMag and pMag interaction are different for the point mutants. The point mutant pMagHigh (and nMagHigh) has a stronger interaction with its binding partners and slower back conversion, while the opposite is true for the mutant pMagFast1 (and nMagFast1) (Zoltowski et al., 2009).
In our method we display the first interaction partner of the photoswitchable proteins, pMagHigh, pMag or pMagFast1 on the surface of E. coli using the circularly permutated OmpX (outer membrane protein X) protein (Daugherty, 2007). The pMag variants are attached through their C-terminal to the OmpX protein. The second interaction partner the photoswitchable protein, nMagHigh, is immobilized through a His6-tag at its C-terminal on a glass substrate with a PEG (polyethylene glycol) coating, which contains a Ni2+-NTA group (Schenk et al., 2014). This setup allows bacteria expressing pMag proteins on their surfaces to adhere to nMagHigh functionalized substrates under blue light when the two proteins interact but not in the dark. (Figure 1)
Figure 1. The engineered E. coli that express pMag proteins on their surface adhere to nMagHigh modified substrates under blue light. In the dark, the pMag-nMag interaction is reversed, which leads to the detachment of the bacteria from the substrate. Reproduced with permission from Chen and Wegner (2017).
Materials and Reagents
Pipette tips (STARLAB, catalog number: S1111-6700 )
50 ml Falcon tube (Greiner Bio One International, catalog number: 227261 )
1.5 ml Eppendorf tube (Eppendorf, catalog number: 0030120086 )
0.2 ml PCR tubes (Thermo Fisher Scientific, catalog number: AB0620 )
0.45 µm cellulose filter (Carl Roth, catalog number: KH55.1 )
Ni-NTA column (GE Healthcare, catalog number: 17524801 )
50 ml syringe (VWR, catalog number: 53548-010)
Manufacturer: Air-Tite Products, catalog number: 4850001000 .
20 x 20 mm glass slides (VWR, catalog number: 631-0122 )
Notes: The glass slide is used as the glass surface for the protein functionalization and bacterial experiments.
Parafilm (Sigma-Aldrich, Bemis, catalog number: P7668 )
Aluminum foil (Carl Roth, catalog number: 1770.1 )
35 mm Petri dish (SARSTEDT, catalog number: 82.1135.500 )
Dialysis tubing (Repligen, Spectrum, catalog number: 132592 )
Plasmid pB33eCPX (Addgene plasmid) (Addgene, catalog number: 23336 )
GFP and mCherry pTrc99A plasmids (Prof. Victor Sourjik lab, Chen and Wegner, 2017)
nMagHigh pET-21b(+) plasmid (Genescript, Chen and Wegner, 2017)
nMagHigh-eCPX plasmid (homemade, Chen and Wegner, 2017)
Note: The nMagHigh gene is inserted between the KpnI and SacI cutting sites of pB33eCPX.
pMag-eCPX, pMagHigh-eCPX, pMagFast1-eCPX plasmids (homemade, Chen and Wegner, 2017)
Note: The different pMag variants are generated by point mutagenesis from the nMagHigh-eCPX plasmid using QuikChange II Site-Directed Mutagenesis Kit.
E. coli K12 MG1655 (DSMZ, catalog number: 18039 )
BL21(DE3) competent E. coli (homemade, Chen and Wegner, 2017)
DH5α competent E. coli (homemade, Chen and Wegner, 2017)
PBS Tablets (Thermo Fisher Scientific, GibcoTM, catalog number: 18912014 )
Mowiol (Sigma-Aldrich, catalog number: 81381 )
LB medium (Carl Roth, catalog number: X968.3 )
Ampicillin (Carl Roth, catalog number: HP62.2 )
IPTG (Sigma-Aldrich, catalog number: I6758 )
PMSF (Sigma-Aldrich, catalog number: P7626 )
DTT (Sigma-Aldrich, catalog number: D0632-10G )
PEG-azide (homemade)
Triethylamine (Sigma-Aldrich, catalog number: T0886 )
Toluene, anhydrous (Alfa Aesar, catalog number: 41464-AK )
EDTA (Sigma-Aldrich, catalog number: 798681 )
NiCl2 (Sigma-Aldrich, catalog number: 339350 )
Chloramphenicol (Sigma-Aldrich, catalog number: C0378 )
L-arabinose (Sigma-Aldrich, catalog number: A3256 )
Paraformaldehyde, reagent grade (Sigma-Aldrich, catalog number: P6148 )
Tris Base (Sigma-Aldrich, catalog number: T1503 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Imidazole (Sigma-Aldrich, catalog number: I2399 )
L-Ascorbic acid (Sigma-Aldrich, catalog number: A5960 )
NTA-alkyne (homemade, Schenk et al., 2014)
PEG azide (homemade, Schenk et al., 2014)
Copper sulfate (CuSO4) (Sigma-Aldrich, catalog number: 451657 )
30% H2O2 (Carl Roth, catalog number: 8070.4 )
H2SO4 (Sigma-Aldrich, catalog number: 30743)
TEM (Transmission electron microscopy) grid (Ted Pella, catalog number: 1GC150 )
Centrifuge tubes 500 ml and 50 ml (Thermo Fisher Scientific, catalog numbers: 3141-0500 , 3119-0050 )
Methanol (Fisher Scientific, catalog number: 10224490 )
N2 gas (Westfalen)
Ethyl acetate (VWR, catalog number: 23882.321 )
Picodent twinsil 22 (Picodent, catalog number: 13001000 )
Buffer A (see Recipes)
Buffer B (see Recipes)
Click reaction solution (see Recipes)
Riranha solution (see Recipes)
Equipment
Dumont #7 Tweezers (Carl Roth, catalog number: K344.1 )
Note: Dumont #7 Tweezers is used to pick up the glass slides.
0.1-2.5 μl, 0.5-10 μl, 10-100 μl, 100-1,000 μl Pipettes (Eppendorf, catalog numbers: 3123000012 , 3123000020 , 3123000047 , 3123000063 )
Vortexer (neoLab, catalog number: 7-0092 )
Microcentrifuge (VWR, model: Micro Star 17, catalog number: 521-1646 )
High-speed centrifuge (Beckman Coulter, model: Avanti® J-26S )
Rotors for high-speed centrifuge (Beckman Coulter, models: JA-10 , JA-25.50 )
Incubator (VWR, catalog number: 444-0732 )
Sonicator (OMNI, model: Sonic Ruptor 400 )
Invert fluorescence microscope (Leica Microsystems, model: Leica DMi8 )
Ultrasonic cleaner (BANDELIN electronic, model: Sonorex Super RK 31 )
Blue LED panel (Albrillo, model: LL-GL003 )
OD Meter (Biochrom, BioWave, model: WPA CO8000 )
Nanodrop (Thermo Fisher Scientific, model: NanoDropTM 8000 )
Software
ImageJ
Originlab
Note: Oringinlab is used for data analysis.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, F. and Wegner, S. V. (2018). Implementation of Blue Light Switchable Bacterial Adhesion for Design of Biofilms. Bio-protocol 8(12): e2893. DOI: 10.21769/BioProtoc.2893.
Download Citation in RIS Format
Category
Microbiology > Microbial biofilm > Biofilm culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,894 | https://bio-protocol.org/exchange/protocoldetail?id=2894&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transient Expression Assay in NahG Arabidopsis Plants Using Agrobacterium tumefaciens
PC Pepe Cana-Quijada
Eduardo R. Bejarano
RL Rosa Lozano-Durán
Tábata Rosas-Díaz
Published: Vol 8, Iss 12, Jun 20, 2018
DOI: 10.21769/BioProtoc.2894 Views: 8798
Edited by: Zhibing Lai
Reviewed by: Araceli Castillo GarrigaShunping Yan
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
Agrobacterium-mediated transient expression has greatly contributed to research in molecular plant biology but has low efficiency and inconsistency in Arabidopsis thaliana (Arabidopsis). Here, we describe a simple, efficient and fast protocol to make transient gene expression in NahG Arabidopsis plants using Agrobacterium tumefaciens. This protocol has been successfully used to assess protein sub-cellular localization and accumulation, enzyme activity, and protein-protein interaction. In addition, this assay overcomes the use of Nicotiana benthamiana plants as a surrogate system for transient gene expression assays. Finally, the use of this protocol does not require complex inoculation methods or specific growth conditions, and can be used with different Agrobacterium strains with similar results.
Keywords: NahG Arabidopsis Agrobacterium Transient expression Transient transformation Protein accumulation
Background
Agrobacterium tumefaciens (hereafter referred to as Agrobacterium)-mediated transient transformation assays have greatly contributed to research in molecular plant biology. These methods have many advantages over the laborious and time-consuming stable transformation approaches including, among others, a higher efficiency, simplicity, and fast, consistent results when the transient transformation assays are carried out in Nicotiana benthamiana. On the other hand, these assays are inefficient and lack robustness when carried out in the model plant Arabidopsis thaliana (hereafter referred to as Arabidopsis), forcing Arabidopsis researchers to use N. benthamiana as a heterologous system, which entails obvious limitations and might generate misleading results.
Many efforts have been made in the past to increase the efficacy of Agrobacterium-mediated transient transformation in Arabidopsis (reviewed in Krenek et al., 2015). Recently, we described a protocol to perform transient gene expression using NahG Arabidopsis plants, overcoming previous limitations (Rosas-Díaz et al., 2017). Using Arabidopsis NahG plants, which contain low levels of salicylic acid (SA) due to the expression of an SA hydroxylase from the bacterium Pseudomonas putida (Lawton et al., 1995), we have been able to obtain high accumulation of marker proteins such as GUS and GFP, and carry out sub-cellular localization and protein-protein interaction experiments. Remarkably, this protocol for transient expression can be used with, at least, three widely used Agrobacterium strains, LBA4404, GV3101 and C58C1. In summary, this protocol shows that expression of the NahG transgene greatly enhances the efficiency of Agrobacterium-mediated transformation in rosette leaves in Arabidopsis, enabling the routine use of this technique in the model plant.
Materials and Reagents
Materials
Soil mix or substrate such as Compo Sana® Universal Ligera (COMPO, TSUSTPROF25L)
Plant pots such as Desch vol 11 (Desch Plantpak, catalog number: 1055278 )
Seed tray–40 cavities
Plant trays
Cling film
Syringes 1 ml or 2 ml
Tissue paper
Petri dishes
Falcon tubes
Eppendorf tubes
Pipette tips
Sterile toothpicks
Syringe filter 0.22 µm
Biological materials
Arabidopsis thaliana NahG seeds (Lawton et al., 1995)
Agrobacterium tumefaciens strain (LBA4404, GV3101 or C58C1) carrying a binary vector with the gene of interest
Reagents
Sterile deionized water
Glycerol (CARLO ERBA Reagents, catalog number: 453752 )
NaCl (AppliChem, catalog number: 121659.1210 )
Tryptone (Biolife, catalog number: 412290 )
Yeast Extract (AppliChem, catalog number: 403687.1210 )
Bacteriological agar (MICROKIT, catalog number: BCB006+ )
MES (2-(N-morpholino) ethanesulfonic acid) (Sigma-Aldrich, catalog number: M2933 )
MgCl2 (AppliChem, catalog number: 131396.1210 )
DMSO (Sigma-Aldrich, catalog number: M81802 )
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
Rifampicin (Duchefa Biochemie, catalog number: R0146.0005 )
Tetracycline (Sigma-Aldrich, catalog number: T3383 )
Gentamycin (Sigma-Aldrich, catalog number: G3632 )
Spectinomycin (Duchefa Biochemie, catalog number: S0188.0005 )
Kanamycin (Sigma-Aldrich, catalog number: K4378 )
LB medium (see Recipes)
1 M MES (see Recipes)
1 M MgCl2 (see Recipes)
0.1 M Acetosyringone (see Recipes)
Infiltration solution (see Recipes)
Antibiotics solution (depending on construct and Agrobacterium strain, see Recipes)
Equipment
Sterile Erlenmeyer flasks
Plant growth chamber capable of sustaining 21 °C under short-day conditions (8 h light/16 h dark) with 140-150 µmol m-2 sec-1 light intensity (Radiber SA, catalog number: AGP-1400 )
Spectrophotometer capable of OD600 measurements such as Shimadzu UV-1601 (Shimadzu, catalog number: 206-67001-34 )
Automatic P1000, P200 and P20 micropipettes
Incubator set at 28 °C such as Incubator D-6450 Hanau (Heraeus Instruments, model: D-6450 )
Incubator shaker capable of sustaining 28 °C and 180 rpm such as New BrunswickTM I26 (Eppendorf, New Brunswick scientific, model: I26, catalog number: M1324-0000 )
Centrifuge for 50 ml tubes such as Rotofix 32A (Hettich, catalog number: 1206-01 )
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cana-Quijada, P., Bejarano, E. R., Lozano-Durán, R. and Rosas-Díaz, T. (2018). Transient Expression Assay in NahG Arabidopsis Plants Using Agrobacterium tumefaciens. Bio-protocol 8(12): e2894. DOI: 10.21769/BioProtoc.2894.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Biotic stress
Cell Biology > Cell imaging > Confocal microscopy
Systems Biology > Interactome > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,895 | https://bio-protocol.org/exchange/protocoldetail?id=2895&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
ChIP-seq Experiment and Data Analysis in the Cyanobacterium Synechocystis sp. PCC 6803
Joaquín Giner-Lamia
Miguel A. Hernández-Prieto
Matthias E. Futschik
Published: Vol 8, Iss 12, Jun 20, 2018
DOI: 10.21769/BioProtoc.2895 Views: 11746
Edited by: Modesto Redrejo-Rodriguez
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Nitrogen is an essential nutrient for all living organisms. In cyanobacteria, a group of oxygenic photosynthetic bacteria, nitrogen homeostasis is maintained by an intricate regulatory network around the transcription factor NtcA. Although mechanisms controlling NtcA activity appear to be well understood, the sets of genes under its control (i.e., its regulon) remain poorly defined. In this protocol, we describe the procedure for chromatin immunoprecipitation using NtcA antibodies, followed by DNA sequencing analysis (ChIP-seq) during early acclimation to nitrogen starvation in the cyanobacterium Synechocystis sp. PCC 6803 (hereafter Synechocystis). This protocol can be extended to analyze any DNA-binding protein in cyanobacteria for which suitable antibodies exist.
Keywords: ChIP-seq Cyanobacteria Synechocystis Nitrogen NtcA
Background
To maintain homeostasis, bacteria frequently need to adjust gene expression in response to environmental changes. Many of these adjustments are controlled by transcriptional factors (TF) that sense metabolic signals and activate or repress target genes. However, reflecting the traditionally laborious tasks necessary to characterize the activity and scope of TFs in vivo, our knowledge of their binding sites in bacteria is still limited. Only recently, the combination of chromatin immunoprecipitation with high-throughput sequencing analysis has opened the door to rapid determination of genome-level regulons. In particular, ChIP-seq uses the capacity of next-generation sequencing (NGS) to identify numerous DNA sequences in parallel. An attractive feature of ChIP-seq, compared to microarrays, is that there is no restriction to certain regions, such as promoter sequences, and the whole genome can be investigated for TF binding sites.
In cyanobacteria, the global regulator for nitrogen assimilation and metabolism is NtcA, a TF belonging to the CRP (cAMP receptor protein) family (Herrero et al., 2001). In Synechocystis, NtcA controls the cellular response to nitrogen availability by binding as a dimer to the promotor or intragenic regions of its target genes containing the consensus sequence GTAN8TAC (Herrero et al., 2001; Giner-Lamia et al., 2017). In the absence of ammonium, NtcA activates the expression of genes for nitrogen assimilation pathways but also acts as a transcriptional repressor of other genes, such as gifA and gifB, which encode for the glutamine synthetase inactivating factors IF7 and IF17 (García-Domínguez et al., 2000).
The protocol detailed herein has been optimized for immunoprecipitation of DNA from Synechocystis cells using antibodies against NtcA, followed by NGS to identify the specific binding sites of NtcA during early acclimation to nitrogen depletion. Following this protocol, we identified 192 genomic regions bound by NtcA (51 in ammonium-replete conditions and 141 after 4 h of nitrogen starvation) (Giner-Lamia et al., 2017). This protocol can be extended to study other TFs in cyanobacteria. Although the bioinformatic component is applicable to any sequenced prokaryote, the wet-lab component needs to be optimized to ensure efficient DNA extraction.
Materials and Reagents
2 ml screw-cap conical tubes (Thermo Fisher Scientific, catalog number: 3462 )
Glass beads, acids-washed 425-600 µm (Sigma-Aldrich, catalog number: G8772-10G )
0.5 ml PCR tubes (Eppendorf, catalog number: 0030124537 )
1.5 ml tubes (Eppendorf, catalog number: 022363204 )
15 and 50 ml FalconTM tubes (Corning, catalog numbers: 352070 )
DynaMagTM-2 Magnet (Thermo Fisher Scientific, catalog number: 12321D )
Synechocystis sp. PCC 6803 cells grown on a plate of BG110C-agar (Stanier et al., 1971)
NH4Cl (Sigma-Aldrich, catalog number: 254134 )
TES (Sigma-Aldrich, catalog number: T1375 )
37% Formaldehyde (Sigma-Aldrich, catalog number: F8775 )
Glycine (Sigma-Aldrich, catalog number: 50046 )
NaCl (Sigma-Aldrich, catalog number: S7653-250G )
EDTA (Sigma-Aldrich, catalog number: E9884 )
Agarose (NZYTech, catalog number: MB02702 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Sodium deoxycholate (Sigma-Aldrich, catalog number: 30970 )
Protease inhibitor cocktail tablets SIGMAFAST (Sigma-Aldrich, catalog number: S8820-2TAB )
NP-40 (Sigma-Aldrich, catalog number: 74385 )
LiCl (Sigma-Aldrich, catalog number: L9650 )
Anti-NtcA antibody (Giner-Lamia et al., 2017)
SDS (Sigma-Aldrich, catalog number: L3771 )
BSA (Sigma-Aldrich, catalog number: B4287 )
DNase-free RNase A solution (Thermo Fisher Scientific, catalog number: EN0531 )
Proteinase K (Thermo Fisher Scientific, catalog number: 25530049 )
Phenol:Chloroform:Isoamyl alcohol (25:24:1) (Sigma-Aldrich, catalog number: P2069 )
CaCl2 (Sigma-Aldrich, catalog number: 449709 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
MnCl2·4H2O (Sigma-Aldrich, catalog number: 221279 )
ZnSO4·7H2O (Sigma-Aldrich, catalog number: Z1001 )
Na2MoO4·2H2O (Sigma-Aldrich, catalog number: 331058 )
CuSO4 (PubChem, catalog number: 24462 )
Co(NO3)2·6H2O (Sigma-Aldrich, catalog number: 239267 )
MgSO4·7H2O (Sigma-Aldrich, catalog number: 63138 )
CaCl2·2H2O (Sigma-Aldrich, catalog number: 223506 )
Citric acid (Sigma-Aldrich, catalog number: 251275 )
Na2-EDTA (Sigma-Aldrich, catalog number: 27285 )
Na2CO3 (Sigma-Aldrich, catalog number: S1641 )
Fe-NH4 citrate (Sigma-Aldrich, catalog number: F5879 )
Boric acid, H3BO3 (Sigma-Aldrich, catalog number: B6768 )
100% freezer-cold ethanol
MiniElute PCR purification kit (QIAGEN, catalog number: 28004 )
dsDNA assay kit (Thermo Fisher Scientific, catalog number: Q32851 )
SsoFastTM EvaGreen® Supermix (Bio-Rad Laboratories, catalog number: 172-5200 )
PearceTM Protein G Magnetic Beads (Thermo Fisher Scientific, catalog number: 88847 )
Bradford Protein Assay (Bio-Rad Laboratories, catalog number: 5000001 )
5x Tris-buffered saline (TBS) buffer (see Recipes)
Lysis buffer (see Recipes)
Block solution (see Recipes)
Wash buffer 1 (see Recipes)
Wash buffer 2 (see Recipes)
5x IP solution (see Recipes)
Tris-EDTA (TE) + NaCl Solution (see Recipes)
Proteinase K solution (see Recipes)
Trace metal mix A5 (see Recipes)
Autoclaved BG110C medium liquid (see Recipes) (Stanier et al., 1971)
Autoclaved BG110C+NH4 medium liquid (see Recipes) (Stanier et al., 1971)
Equipment
Micropipettes (1,000, 100, 20 and 10 µl)
2 L flask and 2 x 1 L flask
Orbital Shaker (VWR, model: 3600 )
FastPrep-24 instrument (MP Biomedicals, catalog number: 116004500 )
Eppendorf Thermomixer R Mixer, 1.5 ml Block (Eppendorf, model: ThermoMixer® R , catalog number: 5355)
Eppendorf MiniSpin plus® (Eppendorf, model: MiniSpin plus® )
Eppendorf centrifuge Falcon (Eppendorf, model: 5810R )
MyCyclerTM Thermal Cycler System (Bio-Rad Laboratories, catalog number: 1709703 )
Sonicator ultrasonic Processor XL (QSonica, model: XL-2020 )
Quibit® 2.0 Fluorometer (Thermo Fisher Scientific, model: Quibit® 2.0 )
CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, catalog number: 1855201 )
HiSeqTM 2000 Sequencing System (Illumina)
Personal computer with a minimum of 2 GB of RAM and 2 GHz dual-core processor, a minimum of 25-50 GB of hard-drive space
Software
FastQC (v0.11.5)
(https://www.bioinformatics.babraham.ac.uk/projects/fastqc/)
Bowtie2 (v2.3.4.1)
(http://bowtie-bio.sourceforge.net/bowtie2/index.shtml [Langmead and Salzberg, 2012])
Samtools (v1.7)
(http://samtools.sourceforge.net [Li et al., 2009])
DeepTools (v2.0)
(http://deeptools.readthedocs.io/en/latest/content/changelog.html [Ramírez et al., 2016])
Model-based Analysis of ChIP-Seq (MACS) (v1.4.1)
http://liulab.dfci.harvard.edu/MACS/ [Zhang et al., 2008])
BayesPeak (v1.22.0)
(http://bioconductor.org/packages/release/bioc/html/BayesPeak.html [Spyrou et al., 2009])
Integrative Genomics Viewer (IGV) (v2.3)
(http://software.broadinstitute.org/software/igv/ [Robinson et al., 2011])
ChIPseeker (v1.6.7)
(https://bioconductor.org/packages/release/bioc/html/ChIPseeker.html [Yu et al., 2015])
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Giner-Lamia, J., Hernández-Prieto, M. A. and Futschik, M. E. (2018). ChIP-seq Experiment and Data Analysis in the Cyanobacterium Synechocystis sp. PCC 6803. Bio-protocol 8(12): e2895. DOI: 10.21769/BioProtoc.2895.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > DNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,896 | https://bio-protocol.org/exchange/protocoldetail?id=2896&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Increasing the Membrane Permeability of a Fern with DMSO
MG Marcelo Garcés
Published: Vol 8, Iss 12, Jun 20, 2018
DOI: 10.21769/BioProtoc.2896 Views: 4349
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Cell membrane prevents the entrance of extra molecules (e.g., transcription and translation inhibitors) into the cell. For studying the physiological effects of transcription and translation inhibitors on Hymenophyllum caudiculatum fronds, we incubate fronds with 0.1% DMSO to test if this increases cell membrane permeability relative to incubation with ultrapure water. The study showed that DMSO could significantly improve the cell membrane permeability of filmy fronds.
Keywords: Filmy ferns Membrane permeability DMSO Propidium iodide
Background
One of the most remarkable characteristics of filmy ferns is that the frond, apart from the vascular tissue, is made of a single cell layer and lacks stomata. In our previous work (Garcés et al. 2018), we incubated Hymenophyllum caudiculatum fronds with cycloheximide or actinomycin D to study the effects of translation, or transcription inhibition respectively. If an exogen inhibitor incubated with a filmy fern frond does not affect plant physiology, it may be because the inhibitor fails to enter the cell. In order to improve the entrance of inhibitors into the cell, we tested if an aqueous solution of 0.1% DMSO has effects on cell membrane permeability, visualizing the entrance of propidium iodide (PI) into the cells.
Materials and Reagents
1.5 ml microcentrifuge tubes
Pipette tips
Plain slides 75 x 25 mm (VWR, catalog number: 48300-026 )
Micro cover slides, square 22 x 22 mm (VWR, catalog number: 48366-067 )
Filter (0.22 μm)
DMSO (Sigma-Aldrich, catalog number: D8418 )
Propidium iodide (PI) 10 mg (Sigma-Aldrich, catalog number: P4170 )
Ultrapure water 18.2 MΩcm
PI (Propidium Iodide) stock (see Recipes)
PI-H2O control (see Recipes)
PI-DMSO solution (see Recipes)
Equipment
Pipettes
Confocal laser scanning microscope (Olympus, model: Fluoview FV1000 )
Ultrapure water system (Elga LabWater, model: PureLab Classic )
Software
FV10ASW v.2.0c
ImageJ 2.0.0-rc-41/1.50d
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Garcés, M. (2018). Increasing the Membrane Permeability of a Fern with DMSO. Bio-protocol 8(12): e2896. DOI: 10.21769/BioProtoc.2896.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,897 | https://bio-protocol.org/exchange/protocoldetail?id=2897&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Buried Food-seeking Test for the Assessment of Olfactory Detection in Mice
Cleiton F. Machado
TR Thiago M. Reis-Silva
CL Cassandra S. Lyra
LF Luciano F. Felicio
Bettina Malnic
Published: Vol 8, Iss 12, Jun 20, 2018
DOI: 10.21769/BioProtoc.2897 Views: 9962
Reviewed by: Deepika SuriAlexandra Gros
Original Research Article:
The authors used this protocol in Dec 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2017
Abstract
The sense of smell allows animals to discriminate a large number of volatile environmental chemicals. Such chemical signaling modulates the behavior of several species that depend on odorant compounds to locate food, recognize territory, predators, and toxic compounds. Olfaction also plays a role in mate choice, mother-infant recognition, and social interaction among members of a group. A key assay to assess the ability to smell odorants is the buried food-seeking test, which checks whether the food-deprived mice can find the food pellet hidden beneath the bedding in the animal’s cage. The main parameter observed in this test is the latency to uncover a small piece of chow, cookie, or other pleasant food, hidden beneath a layer of cage bedding, within a limited amount of time. It is understood that food-restricted mice which fail to use odor cues to locate food within a given time period are likely to have deficits in olfactory abilities. Investigators who used the buried food test, or versions of the buried food test, demonstrated that it is possible to evaluate olfactory deficits in different models of murine studies (Alberts and Galef, 1971; Belluscio et al., 1998; Luo et al., 2002; Li et al., 2013). We have recently used this assay to demonstrate that olfactory-specific Ric-8B knock-out mice (a guanine nucleotide exchange factor that interacts with olfactory-specific G-protein) show an impaired sense of smell (Machado et al., 2017). Here we describe the protocol of the buried food-seeking test, as adopted in our assays.
Keywords: Buried food-seeking test Ric-8B knock-out mice Olfactory behavior tests Olfactory impairment Olfactory sensory neuron
Background
The buried food-seeking test was first described in 1971 (Alberts and Galef, 1971). Since then, additional versions of the test have been described. This test has been used to investigate the consequences of olfactory impairment in a variety of situations, such as: analysis of the effects of olfactory function on the performance of female mice in social behavior towards male conspecifics (Yamada et al., 2001), the discrimination of the participation of both the main olfactory system and the vomeronasal organ in behavior (Del Punta et al., 2002) or in animal models of hyposulphataemia, a disturbance in sulphate metabolism (Dawson et al., 2005). It was also used to assess sociability and cognitive function in neuronal cell adhesion molecule (Nrcam) null mice (Moy et al., 2009), to study the effects of the selective non-imidazole histamine H3 receptor antagonist in anxiety and depression-like disorders (Bahi et al., 2014), to analyze the role of endocannabinoids in olfactory sensory neurons (Hutch et al., 2015), and others. There are variations in the buried food test methods used in these studies. For example, some authors used pre-test acclimation in the testing cage to reduce novelty-induced exploratory activity during the olfaction test, while others did not. It is important to note that this acclimation can help in decreasing response variability within groups. In our previous work, we used the buried food test, in association with other motivational, behavioral, and cellular tests, to determinate whether the sense of smell is impaired in olfactory-specific Ric-8B knock-out mice (Machado et al., 2017). The present manuscript describes the protocol of the buried food-seeking test as adopted in our previous assays, in order to observe aspects of olfactory deficits in mice.
Materials and Reagents
Mice should be at least 8-week-old
Notes:
We used 8-week-old C57BL/6J background mice of both sexes, it is important that the animals have the same age.
It is possible to use this protocol with other strains of mice. It might be applicable to rats as well, but needs standardization of procedures, such as: size of the cage, depth of the bedding, size of the chow pellet, as well as food deprivation time.
In females, estrus can effect olfactory discrimination. Considering this, we initially did statistical analysis in separating genders: wild-type (4 males and 5 females), heterozygote (3 males and 3 females) and conditional knock-out mice (4 males and 5 females). However, we observed no differences between genders, so in our final results, we used both genders in all groups. We recommend evaluating the differences between genders before deciding to use mixed-gender groups or not.
Filtered and autoclaved water
Chow pellets (Food stimulus)
Notes:
We used a 2 g pellet of the same chow the animals were regularly fed with.
We used AIN-93G chow (for use during rapid growth, pregnancy and lactation, from Rhoster, described in Reeves et al. (1993), because it was the chow type regularly fed to our animals.
Other types of pleasant foods have been previously used as stimulus, such as: Oreo cookie, Kellog’s Fruit Loops, chow covered in peanut butter and other. We found, however, that Kellog’s Fruit Loops did not stimulate foraging through olfactory cues in the mice. In our experiments, regular food chow pellets showed better results in foraging behavior than the Fruit Loops. This may be due to novelty induced hypophagia, so we recommend the use of food stimulus that the animals are accustomed to in order to avoid novelty induced hypophagia.
Equipment
Experimental animal room
Note: An adequate procedure room is essential for the successful development of the behavior test, since it is sensitive to external distractions. This requirement should be carefully considered during the planning stages. An adequate procedure room consists of an isolated and silent experimentation room, where it is possible to avoid the entrance of people during the test.
Clean mouse cage of a regular size (30.5 cm length x 16 cm width x 16 cm height or similar) (Figure 1) (We used the M.I.C.E.® Animal Care Systems cage [Animal Care Systems, catalog number: M/P 79010 ])
Note: Do not use regular cage lids. The stainless-steel top which holds food and water interferes with observation and should not be included in the setup. If needed, it is best to use acrylic lids.
Figure 1. Layout of the buried food-seeking test. The purpose of this experimental test is to measure the animal's ability to use olfactory cues for foraging. The main parameter measured in this test is the latency to find the hidden food. Latency is defined as the time between when the mouse was placed in the cage and when the mouse uncovered the food pellet. For the test, 8-week-old mice were deprived of food for 24 h but received water ad libitum. Next day, a 2 g pellet of regular chow was buried 8 cm beneath the surface of the fresh bedding in one end of a clean test cage. The site of animal placement and the site at which the pellet was buried remained constant.
Fresh cage bedding to create an 8 cm layer in each cage
Notes:
For each subject, a clean cage washed and dried by the animal care cage washing facility and clean bedding should be used. Do not re-use cages or bedding.
Cage lining: we use Premium Hygienic Animal Bedding LIGNOCEL® FS-14 to bury the pellet.
Portable digital scale (Denver Instrument, model: TR-403 , or equivalent scale)
Note: To weigh the pellet chow, we used a digital scale (Denver Instrument, TR-403, Max = 410 g, d = 0.001g).
Digital stopwatch
Note: The stopwatch is used to monitor the test length.
Digital video camera (optional, we used Sony Cyber-shot 14.1 mega pixels) (Sony, model: DSC-W330 )
Notes:
The presence of a human observer may influence animal behavior. The use of a video camera may help reduce human interference during the test.
All videos were recorded in .avi format and viewed using VLC media player.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Machado, C. F., Reis-Silva, T. M., Lyra, C. S., Felicio, L. F. and Malnic, B. (2018). Buried Food-seeking Test for the Assessment of Olfactory Detection in Mice. Bio-protocol 8(12): e2897. DOI: 10.21769/BioProtoc.2897.
Machado, C. F., Nagai, M. H., Lyra, C. S., Reis-Silva, T. M., Xavier, A. M., Glezer, I., Felicio, L. F. and Malnic, B. (2017). Conditional deletion of Ric-8b in olfactory sensory neurons leads to olfactory impairment. J Neurosci 37(50): 12202-12213.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,898 | https://bio-protocol.org/exchange/protocoldetail?id=2898&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preserve Cultured Cell Cytonemes through a Modified Electron Microscopy Fixation
Eric T. Hall
SO Stacey K. Ogden
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2898 Views: 5655
Edited by: Zinan Zhou
Reviewed by: Tomas AparicioSilvia Caggia
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Immunocytochemistry of cultured cells is a common and effective technique for determining compositions and localizations of proteins within cellular structures. However, traditional cultured cell fixation and staining protocols are not effective in preserving cultured cell cytonemes, long specialized filopodia that are dedicated to morphogen transport. As a result, limited mechanistic interrogation has been performed to assess their regulation. We developed a fixation protocol for cultured cells that preserves cytonemes, which allows for immunofluorescent analysis of endogenous and over-expressed proteins localizing to the delicate cellular structures.
Keywords: MEM-fix Cytonemes Filopodia Microscopy Immunofluorescence Morphogen
Background
Cytonemes are classified as thin (~200 nm diameter) actin based filopodia, over 2 μm in length, which can transport morphogens (Ramírez-Weber and Kornberg, 1999). These signaling structures were first classified and described in detail in the developing Drosophila wing imaginal disc, and have subsequently been observed in mouse, chick and zebrafish model organisms (Ramírez-Weber and Kornberg, 1999; Sanders et al., 2013; Stanganello et al., 2015). In most of these cases, cytoneme detection was only possible with live imaging of over-expressed, fluorescently labeled proteins. Examination of cytonemes of cultured cells has been limited due to traditional fixation protocols failing to preserve these fragile filaments. These complications have been limiting factors in determining the cellular mechanisms driving cytoneme formation and function during development and tissue homeostasis, and determining whether these processes are corrupted in disease.
In order to overcome these limitations, we developed a modified electron microscopy fixative (MEM-fix)-based protocol that preserves cytonemes of cultured cells. Use of MEM-fix allows for the detection of endogenous and over-expressed proteins of interest in the filopodial structures via traditional immunofluorescent protocols (Bodeen et al., 2017). MEM-fix is generated by the addition of glutaraldehyde to a final working concentration of 0.5% to a standard 4% paraformaldehyde fixative solution. Glutaraldehyde, which is commonly used to fix cells for electron microscopy-based studies, was included because of its ability to effectively preserve subcellular structures. Although glutaraldehyde is not an optimal fixative for immunofluorescence microscopy due to its propensity to auto-fluoresce, we determined that addition of 26.4 mM sodium borohydride to the permeabilization buffer was sufficient to mitigate this undesirable side effect (Tagliaferro et al., 1997; Bacallao et al., 2006). Unfortunately, due to glutaraldehyde limiting antibody penetration into cells, MEM-fix is not conducive to staining of cytoplasmic or nuclear proteins, so should be limited to an examination of integral membrane or juxta-membrane proteins.
We recently used this technique to examine Hedgehog (Hh) morphogen transport through cytonemes of cultured Drosophila cells and mouse fibroblasts (Bodeen et al., 2017). Here, we provide an optimized protocol for imaging of cytonemes in NIH3T3 cells, and provide examples of its adaptability to additional cultured mammalian cell lines (Figure 1). MEM-fix protocol modifications to standard cell fixation methods allow for reproducible detection of cytonemes and immunofluorescence-based staining of trans-membrane and membrane-adjacent proteins in cultured cells. MEM-fix also preserves signal of fluorescently-labeled proteins, so is not solely dependent on immuno-detection based methods.
Figure 1. MEM-fix increases preservation of cytonemes in cultured cells compared to paraformaldehyde fixation. A and B. HEK293T cells transfected with Shh. A. Cells fixed with paraformaldehyde show some actin-based protrusions, but do not show Shh (green) positive filaments. B. Cells fixed with MEM-fix contain many cytoneme projections, marked by the presence of F-actin (red) and Shh. Scale bars = 25 µm.
Materials and Reagents
SHARP® Precision Barrier Tips, For P-1000 and Eppendorf 1,000, 1,250 µl (Denville Scientific, catalog number: P1126 )
SHARP® Precision Barrier Tips, For P-200, 200 µl (Denville Scientific, catalog number: P1122 )
SHARP® Precision Barrier Tips, For P-20, 20µl (Denville Scientific, catalog number: P1121 )
SHARP® Precision Barrier Tips, Extra Long for P-2 and P-10, 10 µl (Denville Scientific, catalog number: P1096-FR )
Gold SealTM Rite-OnTM Micro Slides (Thermo Fisher Scientific, catalog number: 3050-002 )
12 mm Microscope Cover Glass-1.5 (Fisher Scientific, catalog number: 12-545-81 )
TPP® centrifuge tubes, volume 50 ml, polypropylene (TPP Techno Plastic Products, catalog number: 91050 )
TPP® centrifuge tubes, volume 15 ml, polypropylene (TPP Techno Plastic Products, catalog number: 91015 )
StericupTM Sterile Vacuum Filter Units 500 ml (Merck, catalog number: SCGPU05RE )
24-well plate (Corning, Falcon®, catalog number: 353226 )
6-well plate NunclonTM Delta Surface (Thermo Fisher Scientific, catalog number: 140675 )
Professional Kimtech ScienceTM KimwipesTM (KCWW, Kimberly-Clark, catalog number: 34155 )
Premium Microcentrifuge Tubes: 1.5 ml (Fisher Scientific, catalog number: 05-408-129 )
NIH3T3 (ATCC, catalog number: CRL-1658 )
Ultrapure water
DMEM (1x) 4.5 g/L D-glucose, [-] L-Glutamine, [-] HEPES, [-] Sodium Pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11960044 )
Opti-MEMTM Reduced Serum Medium (Thermo Fisher Scientific, catalog number: 31985070 )
Pen/Strep, 100x (Merck, catalog number: TMS-AB2-C )
HyCloneTM Cosmic CalfTM Serum (BCS) (GE Healthcare, catalog number: SH30087.03 )
MEM NEAA (100x) MEM Non-Essential Amino Acids (Thermo Fisher Scientific, GibcoTM, catalog number: 11140050 )
L-Glutamine (100x) (100 ml) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 25030081 )
Sodium Pyruvate (100 mM) 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 11360070 )
Lipofectamine® 3000 transfection kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: L3000-015 )
70% (volume) ethanol diluted in water
0.05% Trypsin 0.53 nM EDTA, 1x [-] Sodium Bicarbonate (Corning, catalog number: 25-052-Cl )
DPBS, 1x (Dulbecco's Phosphate-Buffered Saline) (Corning, CellgroTM, catalog number: 21-031-CM )
Sodium phosphate dibasic (Sigma-Aldrich, catalog number: S0876 )
Sodium phosphate monobasic (Sigma-Aldrich, catalog number: S5011 )
Sodium borohydride (Sigma-Aldrich, catalog number: 213462-25G )
Formaldehyde, 16%, methanol free, Ultra Pure EM Grade (Polysciences, catalog number: 18814-10 )
Glutaraldehyde, 8% Aqueous Solution, EM Grade (Electron Microscopy Sciences, catalog number: 16019 )
Normal Goat Serum (10 ml) (Jackson ImmunoResearch, catalog number: 005-000-121 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
Tween 20 (Acros Organics, catalog number: AC233360010 )
Sonic hedgehog (Shh) antibody (H-160), rabbit polyclonal (Santa Cruz Biotechnology, catalog number: sc-9024 )
Alexa FluorTM 633 Phalloidin (Thermo Fisher Scientific, catalog number: A22284 )
Goat anti-Rabbit IgG (H+L) Secondary Antibody, Alexa Fluor 488 (Thermo Fisher Scientific, Invitrogen, catalog number: R37116 )
DAPI Solution (1 mg/ml) (Thermo Fisher Scientific, catalog number: 62248 )
Prolong® Diamond Antifade Mountant (Thermo Fisher Scientific, Invitrogen, catalog number: P36961 )
NIH3T3 media (see Recipes)
NIH3T3 serum/antibiotic-free media (see Recipes)
0.2 M Dibasic Sodium Phosphate solution (see Recipes)
0.2 M Monobasic Sodium Phosphate solution (see Recipes)
Modified electron microscopy fixative (MEM-fix) (see Recipes)
Permeabilization buffer (see Recipes)
PBGT (see Recipes)
Primary antibody solution (see Recipes)
Secondary antibody solution (see Recipes)
Equipment
Eppendorf Research Plus single channel pipette, 100-1,000 µl (Eppendorf, catalog number: 3123000063 )
Eppendorf Research Plus single channel pipette, 20-200 µl (Eppendorf, catalog number: 3123000055 )
Eppendorf Research Plus single channel pipette, 0.5-10 µl (Eppendorf, catalog number: 3123000020 )
Eppendorf Research Plus single channel pipette, 0.1-2.5 µl (Eppendorf, catalog number: 3123000012 )
Allegra X-12R centrifuge (Beckman Coulter, model: Allegra® X-12R , catalog number: 392302)
Heracell VIOS 160i CO2 incubator (at 37 °C and 5% CO2), (Thermo Fisher Scientific, model: HeracellTM VIOS 160i, catalog number: 51030287 )
AE50 analytical balance (Mettler-Toledo International, model: AE50 )
Aspirator
Precision dual-chamber water bath 288 (Thermo Fisher Scientific, catalog number: 2853 )
Biological safety cabinet (The Baker Company, catalog number: B40-112 )
Cell counting chamber (Hausser Scientific, catalog number: 3200 )
FisherbrandTM Fine Point High Precision Forceps (Fisher Scientific, catalog number: 22-327379 )
Confocal laser-scanning microscope (Leica Microsystems, model: Leica TCS SP8 )
Software
Leica Application Suite X (used to generate Tiffs)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hall, E. T. and Ogden, S. K. (2018). Preserve Cultured Cell Cytonemes through a Modified Electron Microscopy Fixation. Bio-protocol 8(13): e2898. DOI: 10.21769/BioProtoc.2898.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling > Fate determination
Developmental Biology > Morphogenesis > Organogenesis
Cell Biology > Cell imaging > Fixed-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,899 | https://bio-protocol.org/exchange/protocoldetail?id=2899&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Separation of Thylakoid Protein Complexes with Two-dimensional Native-PAGE
Marjaana Rantala
VP Virpi Paakkarinen
EA Eva-Mari Aro
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2899 Views: 9028
Reviewed by: Venkatasalam ShanmugabalajiShweta Panchal
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
The hierarchical composition and interactions of the labile thylakoid protein complexes can be assessed by sequential 2D-native gel-electrophoresis system. Mild non-ionic detergent digitonin is used to solubilize labile protein super-and megacomplexes, which are then separated with first-dimension blue native polyacrylamide gel electrophoresis (1D-BN-PAGE). The digitonin derived protein complexes are further solubilized with stronger detergent, β-DM, and subsequently separated on an orthogonal 2D-BN-PAGE to release smaller protein subcomplexes from the higher-order supercomplexes. Here we describe a detailed method for 2D-BN-PAGE analysis of thylakoid protein complexes from Arabidopsis thaliana.
Keywords: Native gel electrophoresis Thylakoid membrane Thylakoid protein complexes 2D-BN-PAGE Light harvesting complex Photosystem Photosynthesis
Background
Photosynthetic light reactions take place in the thylakoid membrane, which in higher plants is composed of appressed grana thylakoids and non-appressed stroma thylakoids. The light reactions are catalyzed by multi-subunit protein complexes photosystem (PS) I and II, cytochrome b6f and ATPase. PSII together with its light harvesting antenna complex (LHCII) is most abundant in grana-thylakoids and therefore spatially segregated from stroma thylakoid -located PSI-LHCI complexes (Andersson and Anderson, 1980). The interphase between the grana and stroma thylakoid is enriched in both photosystems (Albertsson, 2001; Suorsa et al., 2015). Mediated by light dependent reversible phosphorylation of LHCII and PSII proteins, the photosystems together with LHCII assemble into larger super- and megacomplexes. PSII core dimer together with two strongly and two moderately bound LHCII-trimers form large C2S2M2 supercomplexes, PSI together with loosely bound LHCII form PSI-LHCII supercomplexes, and finally, PSII and PSI together with L-LHCII form large PSII-LHCII-PSI megacomplexes (Caffarri et al., 2009; Pesaresi et al., 2009; Rantala et al., 2017).
Non-ionic detergents are generally used for isolation of native protein complexes from biological membranes. Mild detergent digitonin maintains weak interactions between protein complexes, but due to its bulky structure, it selectively solubilizes only the non-appressed regions of the thylakoids. However, when supplemented with low ionic strength salt, aminocaproic acid (ACA), digitonin gets access to the partition gap between two grana appressions and solubilizes the entire thylakoid membrane allowing the analysis of the overall organization of labile thylakoid protein complexes (Rantala et al., 2017). Solubilized protein complexes are supplemented with anionic Coomassie G-250 (CBB) dye that binds to the hydrophobic domains of protein complexes providing them with negative charge, and allows their electrophoretic separation according to molecular mass. Since the negative surface charges repel each other, CBB also prevents random protein complex aggregation.
Blue native PAGE (BN-PAGE) enables membrane protein complex separation in their native and functionally active form (Schägger and von Jagow, 1991). Coupling the 1D-BN-PAGE with a second (2D)-BN-PAGE allows the analysis of the subcomplex composition of the digitonin derived large protein super- and megacomplexes: The 1D-BN-gel lane containing the separated protein complexes is treated with slightly stronger detergent, n-dodecyl-β-D-maltoside (β-DM), which more effectively interferes with the interactions between protein complexes, particularly destroying the interaction of LHCII with the two photosystems. The lane is then subjected to the 2D-BN-PAGE for the separation of the dissociated subcomplexes. The composition of the subcomplexes can be further analyzed by electroblotting the 2D-gel and detecting specific proteins with antibodies or by cutting the lanes and subjecting the subcomplexes to denaturing 3D-SDS-PAGE.
This protocol describes optimized thylakoid protein complex isolation method and the analysis of the subcomplex composition of large protein super- and megacomplexes of Arabidopsis thaliana by 2D-BN-BN-PAGE. The method can be used for the analysis of the organization of the photosynthetic protein complexes and for the analysis of subcomplex composition of higher-order protein super- and megacomplexes.
Materials and Reagents
Consumables
Eppendorf microcentrifuge tubes 1.5 ml (Eppendorf, catalog number: 0030121694 )
Falcon, Conical Centrifuge Tubes 15 ml (Corning, catalog number: 352096 )
Culture tubes 5 ml (Lab Depot, catalog number: TLDT8301 )
Finntip Pipette Tips (Finntip Flex 10, 250, 1,000 and 5 ml)
Whatman chromatographic paper (GE Healthcare, catalog number: 1001-931 )
PVDF membrane (Merck, catalog number: IPVH304F0 )
Plant material
Isolated thylakoids from 5-week old Arabidopsis thaliana (isolate thylakoids in the presence of 10 mM NaF in all buffers as described in Järvi et al., 2011)
Reagents
6-aminocaproic acid (Sigma-Aldrich, catalog number: A2504 )
Bis-Tris (Sigma-Aldrich, catalog number: B4429 )
Glycerol (Avantor Performance Materials, J.T. Baker, catalog number: 7044 )
Pefabloc SC (4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride) (Roche Diagnostics, catalog number: 11585916001 )
Sodium Fluoride (NaF) (Avantor Performance Materials, J.T. Baker, catalog number: 3688 )
EDTA disodium salt (Avantor Performance Materials, J.T. Baker, catalog number: 1073 )
Digitonin (Merck, Calbiochem, catalog number: 300410 )
n-dodecyl-β-D-maltoside (Sigma-Aldrich, catalog number: D4641 )
Serva Coomassie Blue G (SERVA Electrophoresis, catalog number: 35050 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Tricine (Sigma-Aldrich, catalog number: T0377 )
TEMED (Tetramethylethylenediamine) (Bio-Rad Laboratories, catalog number: 1610801 )
Liquid nitrogen
Methanol (VWR)
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A7030 )
Acrylamide (AA) (Sigma-Aldrich, catalog number: A9099 )
(N,N'-Methylene)-Bis-Acrylamide (Bis-AA) (Merck, Omnipur, catalog number: 2610 )
APS (Ammonium persulfate) (Bio-Rad Laboratories, catalog number: 1610700 )
Tris (Sigma-Aldrich, catalog number: T1503 )
Glycine (Fisher Scientific, catalog number: 10070150 )
SDS (VWR, catalog number: 442444H )
Antibodies
Lhcb1 (Agrisera, catalog number: AS01 004 )
Phospho (P)-Lhcb1 (Agrisera, catalog number: AS13 2704 )
Lhcb2 (Agrisera, catalog number: AS01 003 )
Phospho (P)-Lhcb2 (Agrisera, catalog number: AS13 2705 )
Stock solutions
Acrylamide solution A: 48% (w/v), 1.5% (w/v) Bis-acrylamide in MQ-water, store at 4 °C
Acrylamide solution B: 20% (w/v), 5% (w/v) Bis-acrylamide in MQ-water, store at 4 °C
APS (Ammonium persulfate): 5% (w/v) solution in MQ-water, store at 4 °C
Digitonin stock solution: 10% (w/v) in MQ-water, store at -20 °C
β-dodecyl maltoside: 10% (w/v) in MQ-water, store at -20 °C
Glycerol: 75% (w/v) solution in MQ-water, store at 4 °C
Pefabloc: 10 mg/ml (w/v) in MQ-water, store at -20 °C
Sucrose: 75% (w/v) in MQ-water, store at -20 °C
Buffers
3x Gel Buffer, store at 4 °C (see Recipes)
25BTH20G resuspension buffer, prepare fresh (see Recipes)
ACA buffer (see Recipes)
Detergent buffer A (4% Digitonin), prepare fresh (see Recipes)
Detergent buffer B (1% β-DM), prepare fresh (see Recipes)
CBB buffer, -20 °C (see Recipes)
Anode buffer for BN, store at 4 °C (see Recipes)
Blue cathode buffer for BN, store at 4 °C (see Recipes)
Clear cathode buffer for BN, store at 4 °C (see Recipes)
Transfer buffer, store at 4 °C (see Recipes)
BN-PA: 3.5-12.5% separation gel, 3% stacking gel (see Recipes)
Equipment
Dual gel caster with 10 x 8 cm plates (Hoefer, catalog number: SE215 )
Hoefer gradient maker SG5 (or any gradient maker containing two 5 ml chambers)
0.75 mm T-spacers (Hoefer, catalog number: SE2119T-2-.75 )
1 mm T-spacers (Hoefer, catalog number: SE2119T-2-1.0 )
Sample gel comb, 0.75 mm, 10 wells (Hoefer, catalog number: SE211A-10-.75 )
2D comb (flat) with a reference well, 1.0 mm thick
Mighty Small SE250 vertical electrophoresis system (Hoefer, catalog number: SE250 )
Ismatec IPC-pump
Power supply, PowerPac HV (Bio-Rad Laboratories, catalog number: 164-5056 )
Centrifuge (Eppendorf, model: 5424R )
FinnpipetteTM F2 Variable Volume Single-Channel Pipettes
Cold room (4 °C)
Freezer (-20 °C)
Photo scanner (e.g., Perfection V300 Photo, Epson, model: V300 )
Rocker-Shaker (Biosan, model: MR-12, catalog number: BS-010130-AAI )
Semi-dry blotting system (Hoefer, catalog number: TE77X )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rantala, M., Paakkarinen, V. and Aro, E. (2018). Separation of Thylakoid Protein Complexes with Two-dimensional Native-PAGE. Bio-protocol 8(13): e2899. DOI: 10.21769/BioProtoc.2899.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > Protein
Plant Science > Plant biochemistry > Protein
Molecular Biology > Protein > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
29 | https://bio-protocol.org/exchange/protocoldetail?id=29&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Site-directed Mutagenesis Using Dpn1
LJ Lili Jing
Published: Feb 5, 2011
DOI: 10.21769/BioProtoc.29 Views: 22681
Download PDF
Ask a question
Favorite
Cited by
Abstract
Site-directed mutagenesis is an important and widely used tool in molecular biology to generate specific changes in the DNA sequence of a given gene/genome. The protocol described here is for making nucleotide changes at specific loci in a large vector (>= 10 kb), and is based on the QuikChange II XL Site-Directed Mutagenesis Kit.
Materials and Reagents
Dpn1 restriction enzyme
XL10-Gold Ultracompetent Cells
QuikChange II XL Site-Directed Mutagenesis Kit (Guidechem)
LB agar (Sigma-Aldrich)
Antibiotics (Sigma-Aldrich)
NZ amine (casein hydrolysate)
Yeast extract
NaCl
NaOH
MgCl2
MgSO4
Glucose
NZY+ broth (see Recipes)
Equipment
Thermal cyclers (Bio-Rad Laboratories)
Bench-top centrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > Mutagenesis
Molecular Biology > DNA > Genotyping
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
290 | https://bio-protocol.org/exchange/protocoldetail?id=290&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Cytokines
RG Renaud Grépin
GP Gilles Pagès
Published: Vol 2, Iss 22, Nov 20, 2012
DOI: 10.21769/BioProtoc.290 Views: 15906
Original Research Article:
The authors used this protocol in Mar 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2012
Abstract
This protocol allows to measure the levels cytokines - such as VEGFs, CXCLs cytokines, PDGF or FGF - from fresh samples but also frozen tumors. The advantage of this method is to use very few micrograms of biological material and the protocol is carried out quickly.
Keywords: Cytokines ELISA Frozen tumors Fresh samples
Materials and Reagents
Fresh or frozen tumor tissues stored at - 80 °C
Extraction buffer (Life Technologies, catalog number: FNN0011 )
Antifoam Y-30 Emulsion (Sigma-Aldrich, catalog number: A5758 )
BCA protein quantification kit (Interchim, catalog number: MP2920 )
ELISA kits (Peprotech or R&D System)
Tween-20 (Sigma-Aldrich, catalog number: P-7949 )
BSA (Sigma-Aldrich, catalog number: A-7030 )
Avidin-HRP conjugate solution (Sigma-Aldrich, catalog number: A-7419 )
10x Dulbecco’s PBS (Life Technologies, Gibco®, catalog number: 14200-075 )
ABTS Liquid substrate solution (Sigma-Aldrich, catalog number: A3219 )
Equipment
Homogenizer such as Precellys (Ozyme BER1011S, France) or ultraturax
Centrifuge
96 wells plates (DUTSCHER SCIENTIFIC, catalog number: 047632 )
ELISA microplates (Nunc MaxiSorp, catalog number: 439454 )
Luminoskan (Thermo Fisher Scientific, catalog number: 5210470 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Grépin, R. and Pagès, G. (2012). Measurement of Cytokines. Bio-protocol 2(22): e290. DOI: 10.21769/BioProtoc.290.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Cancer Biology > Inflammation > Biochemical assays
Biochemistry > Protein > Quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,900 | https://bio-protocol.org/exchange/protocoldetail?id=2900&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
γ-Secretase Epsilon-cleavage Assay
Ting-Hai Xu
Yan Yan
KH Kaleeckal G. Harikumar
LM Laurence J. Miller
KM Karsten Melcher
HX H. Eric Xu
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2900 Views: 7531
Edited by: Yanjie Li
Reviewed by: Pia Giovannelli
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
γ-Secretase epsilon-cleavage assay is derived from the cell-based Tango assay (Kang et al., 2015), and is a fast and sensitive method to determine the initial cleavage of C99 by γ-secretase. In this protocol, we use HTL cells, which are HEK293 cells with a stably integrated luciferase reporter under the control of the bacterial tetO operator element, in which C99 C terminally fused to a reversed tetracyclin-inducible activator (rTA) transcriptional activator is expressed. Endogenous or transfected γ-secretase cleaves a C terminally fused rTA transcriptional activator from C99, allowing rTA to move to the nucleus to activate a luciferase reporter gene as a measurement for γ-secretase cleavage activity.
Keywords: γ-Secretase Cleavage Activity Epsilon-cleavage assay C99
Background
Alzheimer’s disease (AD) is the most prevalent chronic neurodegenerative disease. AD is closely associated with the formation of amyloid plaques. These plaques mainly consist of aggregated amyloid β, which is generated by the cleavage of the C terminal 99 amino acids fragment (C99) of the amyloid precursor protein by γ-secretase. In spite of extensive efforts, it remains unknown how γ-secretase recognizes its substrates. The conventional Tango assay was designed to monitor the activation of GPCRs (Barnea et al., 2008) by engineering a TEV cleavage site and a transcription activator to the cytoplasmic C terminus to of GPCRs and a TEV protease linked to human β-arrestin2. Here we used endogenous or transfected γ-secretase to cleave the transmembrane portion of its substrates, i.e., the C terminus of C99 is fused with rTA to establish the γ-secretase Epsilon-cleavage assay (Figure 1). The assay was first established to investigate the initial cleavage of C99 by γ-secretase (Xu et al., 2016).
Figure 1. The principle of the γ-secretase epsilon-cleavage assay. Upon cleavage of the C99 (or other γ-secretase substrates) hybrid protein by γ-secretase, the rTA is released from the membrane and enters nucleus to bind tetO DNA-binding site to stimulate luciferase reporter gene activity as measurement for total cleavage, both by endogenous and by transfected γ-secretase variants. (Xu et al., 2016)
Here we use the Dual-luciferase reporter assay kit. The stably integrated luciferase-Firefly reads represent the γ-secretase cleavage activity, while the transfected Renilla luciferase reads serve as a normalization standard.
Materials and Reagents
Pipette tips (VWR)
24-well plate (Corning, Costar®, catalog number: 3524 )
96-well plate (Corning, catalog number: 3595 )
Loading pipette tips
Cell culture flask (Corning, catalog number: 430639 )
96-well OptiPlate (PerkinElmer, catalog number: 6005290 )
HTL cells (a gift from G Barnea and R Axel, Brown University and Columbia University, resp.)
Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 26140079 )
Trypsin 0.25%-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Opti-MEM (Thermo Fisher Scientific, GibcoTM, catalog number: 31985062 )
X-tremeGENE 9 Reagent (Roche Diagnostics, catalog number: 06365787001 )
Sodium phosphate dibasic (Na2HPO4) (Fisher Scientific, catalog number: S374-1 )
Potassium phosphate monobasic (KH2PO4) (EMD Millipore, catalog number: PX1565-1 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: SX0420-5 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: BP366-500 )
Dual-luciferase reporter assay kit (Promega, catalog number: E1960 )
10x phosphate buffered saline (PBS buffer) (see Recipes)
1x passive lysis buffer (PLB) (see Recipes)
LAR2 substrate (see Recipes)
Stop & Glo® Reagent (see Recipes)
Equipment
Micro pipette (Eppendorf)
Eppendorf® Research® Pro electronic single channel pipette (20-1,000 µl)
37 °C, 5% CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Series II 3110 Water-Jacketed)
Cell culture microscope (Nikon Instruments, model: Eclipse TS100 )
Shaker (ARMA LAB, model: Orbital Shaker 100 )
Biosafety cabinet (The Baker, model: SterilGARD® e3 )
EnVision Multilabel Plate Reader (PerkinElmer, model: EnVision Multilabel )
Software
GraphPad Prism 5 (https://www.graphpad.com/scientific-software/prism/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Xu, T., Yan, Y., Harikumar, K. G., Miller, L. J., Melcher, K. and Xu, H. E. (2017). γ-Secretase Epsilon-cleavage Assay. Bio-protocol 7(22): e2900. DOI: 10.21769/BioProtoc.2900.
Yan, Y., Xu, T. H., Harikumar, K. G., Miller, L. J., Melcher, K. and Xu, H. E. (2017a). Dimerization of the transmembrane domain of amyloid precursor protein is determined by residues around the gamma-secretase cleavage sites. J Biol Chem, 292: 15826-15837.
Download Citation in RIS Format
Category
Biochemistry > Protein > Activity
Molecular Biology > Protein > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,901 | https://bio-protocol.org/exchange/protocoldetail?id=2901&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Streptavidin Bead Pulldown Assay to Determine Protein Homooligomerization
Ting-Hai Xu
Yan Yan
KH Kaleeckal G. Harikumar
LM Laurence J. Miller
KM Karsten Melcher
HX H. Eric Xu
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2901 Views: 20513
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
Pulldown assay is a conventional method to determine protein-protein interactions in vitro. Expressing a protein of interest with two different tags allows testing whether both versions can be captured via one of the two tags as homooligomeric complex. This protocol is based on streptavidin bead capture of a biotinylated protein and co-associated Flag-tagged protein using Streptavidin MagBeads.
Keywords: Pulldown assay Protein-protein interactions Streptavidin bead Biotinylated protein Homooligomeric complex
Background
The amyloid precursor protein (APP) can form a homodimer through its large extracellular domain as well as its transmembrane domain, which plays an important role in biological function. The current protocol has been used in characterizing homo-dimerization of the APP transmembrane C-terminal 99 amino acid fragment (C99) (Yan et al., 2017). The basic principle of this assay is shown in Figure 1: The streptavidin-coated MagBeads can trap the biotinylated protein, which can pull down the interaction protein and detected by anti-FLAG antibody.
Figure 1. The principle of MagBeads-based pull-down assay. In this particular protocol, biotinylated Avi-tagged C99 proteins and associated C99-TEV site-rTA-Flag protein were used.
Materials and Reagents
Pipette tips (VWR)
6-well plate (Corning, Costar®, catalog number: 3506 )
1.5 ml Eppendorf tube
96-well plate (Corning, catalog number: 3595 )
Cell culture flask (Corning, catalog number: 430639 )
96-well OptiPlate (PerkinElmer, catalog number: 6005290 )
Gel loading pipette tips
InvitrolonTM PVDF/Filter Paper Sandwich (Thermo Fisher Scientific, InvitrogenTM, catalog number: LC2005 )
PS1/PS2-deleted HTL cells (PS1/PS2 gene were deleted by CRISPR/Cas9 from HTL cells [Xu et al., 2016])
Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 26140079 )
Trypsin 0.25%-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Opti-MEM (Thermo Fisher Scientific, GibcoTM, catalog number: 31985062 )
Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11668019 )
Streptavidin MagBeads (GenScript, catalog number: L00424 )
CelLyticTM M (Sigma-Aldrich, catalog number: C2978 )
Protease inhibitor cocktail (Roche Diagnostics, catalog number: 11836153001 )
2x SDS loading buffer (Bio-Rad Laboratories, catalog number: 1610737 )
β-Mercaptoethanol (Bio-Rad Laboratories, catalog number: 1610710 )
BoltTM 4-12% Bis-Tris Plus Gels, 15-well (Thermo Fisher Scientific, catalog number: NW04125BOX )
NovexTM Tris-Glycine Transfer Buffer (25x) (Thermo Fisher Scientific, InvitrogenTM, catalog number: LC3675 )
Precision plus Protein prestained standard (Bio-Rad Laboratories, catalog number: 1610374 )
Methanol (EMD Millipore, catalog number: MX0485-5 )
Seppro® stripping buffer (Sigma-Aldrich, catalog number: S4324 )
Biotin (Sigma-Aldrich, catalog number: B4501 )
Sodium hydroxide (NaOH) solution (Fisher Scientific, catalog number: SS255 )
Sodium phosphate dibasic (Na2HPO4) (Fisher Scientific, catalog number: S374-1 )
Potassium phosphate monobasic (KH2PO4) (EMD Millipore, catalog number: PX1565-1 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: SX0420-5 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: BP366-500 )
Tris base (Fisher Scientific, catalog number: BP152-5 )
Glycine (Fisher Scientific, catalog number: BP381-5 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Hydrochloric acid (HCl) (EMD Millipore, catalog number: HX0603-75 )
Tween 20 (EMD Millipore, catalog number: 9480-OP )
Milk powder (Bio-Rad Laboratories, catalog number: 1706404 )
Anti-FLAG-peroxidase antibody (Sigma-Aldrich, catalog number: A8592 )
Anti-beta actin antibody (Abcam, catalog number: ab6276 )
Anti-mouse IgG, HRP-linked antibody (Cell Signaling Technology, catalog number: 7076S )
SuperSignal West Pico substrate (Thermo Fisher Scientific, catalog number: 34080 )
Note: This product has been discontinued.
Highly pure water (ddH2O) (produced by PURELAB Ultra system)
Biotin solution (see Recipes)
Phosphate buffered saline (PBS buffer) 10x (see Recipes)
Electrophoresis buffer (see Recipes)
Tris-buffered saline (TBS buffer) 10x (see Recipes)
TBST buffer (see Recipes)
Blocking solution (see Recipes)
Anti-FLAG antibody solution (see Recipes)
Anti-beta actin primary antibody solution (see Recipes)
Anti-mouse IgG secondary antibody solution (see Recipes)
Substrate solution (see Recipes)
Equipment
Pipettes
37 °C, 5% CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Series II 3110 Water-Jacketed)
Cell culture microscope (Nikon Instruments, model: Eclipse TS100 )
Biosafety cabinet (The Baker, model: SterilGARD® e3 )
Standard tabletop centrifuge (Eppendorf, model: 5417 R )
Invitrogen SDS-PAGE running cassette (Thermo Fisher Scientific, catalog number: A25977 )
Tank blot device (Bio-Rad Laboratories, model: Mini Trans-Blot® Module, catalog number: 1658029FC )
ChemiDocTM XRS+ Imager System (Bio-Rad Laboratories, model: ChemiDocTM XRS+ )
Shaker (Fisher Scientific, model: Chemistry Mixer 346 )
Rocking platform (ARMA LAB, model: Orbital Shaker 100 )
Magnetic separation rack (Thermo Fisher Scientific, catalog number: 12321D )
Software
Image Lab 5.2.1 software (http://www.bio-rad.com/en-ch/product/image-lab-software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Xu, T., Yan, Y., Harikumar, K. G., Miller, L. J., Melcher, K. and Xu, H. E. (2017). Streptavidin Bead Pulldown Assay to Determine Protein Homooligomerization. Bio-protocol 7(22): e2901. DOI: 10.21769/BioProtoc.2901.
Yan, Y., Xu, T. H., Harikumar, K. G., Miller, L. J., Melcher, K. and Xu, H. E. (2017a). Dimerization of the transmembrane domain of amyloid precursor protein is determined by residues around the gamma-secretase cleavage sites. J Biol Chem, 292: 15826-15837.
Download Citation in RIS Format
Category
Biochemistry > Protein > Isolation and purification
Molecular Biology > Protein > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,903 | https://bio-protocol.org/exchange/protocoldetail?id=2903&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Membrane Protein Interactions by Cell-based Tango Assays
Yan Yan
Ting-Hai Xu
KH Kaleeckal G. Harikumar
LM Laurence J. Miller
KM Karsten Melcher
HX H. Eric Xu
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2903 Views: 9733
Reviewed by: Alexandros AlexandratosLokesh Kalekar
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
The Tango assay is a protein-protein interaction assay, in which a transcription factor (rTA) is fused to a membrane-bound protein via a linker that contains a cleavage site for TEV protease, whereas a soluble interaction partner is fused to TEV protease (Barnea et al., 2008). Association between the two interaction partners leads to an efficient cleavage of the transcription factor, allowing it to translocate to the nucleus and activate a luciferase reporter gene as measurement of the interactions. In this modified assay, we fused one copy of the membrane-spanning amyloid precursor protein (APP) C99 region to TEV site-rTA (C99-TEV site-rTA) and a second copy to TEV protease (C99-TEV) to analyze intramembrane C99-C99 interaction in live cells.
Keywords: Tango assay γ-Secretase Cleavage Activity Interaction C99
Background
The amyloid precursor protein (APP) has three dimerization domains in its N-terminal extracellular domain. In addition, APP can also form dimers through the membrane-bound C99 (C-terminal 99 amino acid fragment) region. Importantly, C99 dimerization has been linked to Aβ production in Alzheimer’s disease (AD) pathology. The Tango assay described here and schematically shown as cartoon in Figure 1 is a fast and sensitive method for investigating homodimerization of C99 and other membrane proteins (Yan et al., 2017).
Figure 1. Cartoon illustration of the Tango interaction assay. Upon membrane cleavage of the C99 hybrid protein by TEV protease, the rTA transactivator protein is released from the membrane into the cytoplasm. This allows rTA to enter the nucleus and bind the tetO DNA-binding site upstream of an integrated luciferase reporter gene to stimulate luciferase reporter gene activity as measured by luminescence. (Yan et al., 2017).
Here we use the Dual-luciferase reporter assay kit. The stably integrated luciferase-Firefly reads represent the γ-secretase cleavage activity, while the transfected Renilla luciferase reads serve as normalization standard.
Materials and Reagents
Pipette tips (VWR)
24-well plate (Corning, Costar®, catalog number: 3524 )
96-well plate (Corning, catalog number: 3595 )
Cell culture flask (Corning, catalog number: 430639 )
96-well OptiPlate (PerkinElmer, catalog number: 6005290 )
Gel loading pipette tip
PS1/PS2-deleted HTL cells (PS1/PS2 gene were deleted by CRISPR/Cas9 from HTL cells [Xu et al., 2016])
Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 26140079 )
Trypsin 0.25%-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Opti-MEM (Thermo Fisher Scientific, GibcoTM, catalog number: 31985062 )
Dual-luciferase reporter assay kit (Promega, catalog number: E1960 )
X-tremeGENE 9 Reagent (Roche Diagnostics, catalog number: 06365787001 )
Sodium phosphate dibasic (Na2HPO4) (Fisher Scientific, catalog number: S374-1 )
Potassium phosphate monobasic (KH2PO4) (EMD Millipore, catalog number: PX1565-1 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: SX0420-5 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: BP366-500 )
10x phosphate buffered saline (PBS buffer) (see Recipes)
1x passive lysis buffer (PLB) (see Recipes)
LAR2 substrate (see Recipes)
Stop & Glo® Reagent (see Recipes)
Equipment
Micro pipette (Eppendorf)
Vacuum pump
37 °C, 5% CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Series II 3110 Water-Jacketed)
Cell culture microscope (Nikon Instruments, model: Eclipse TS100 )
Shaker (ARMA LAB, model: Orbital Shaker 100 )
Biosafety cabinet (The Baker, model: SterilGARD® e3 )
EnVision Multilabel Plate Reader (PerkinElmer, model: EnVision Multilabel )
Software
GraphPad Prism 5 (https://www.graphpad.com/scientific-software/prism/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Yan, Y., Xu, T., Harikumar, K. G., Miller, L. J., Melcher, K. and Xu, H. E. (2017). Detection of Membrane Protein Interactions by Cell-based Tango Assays. Bio-protocol 7(22): e2903. DOI: 10.21769/BioProtoc.2903.
Yan, Y., Xu, T. H., Harikumar, K. G., Miller, L. J., Melcher, K. and Xu, H. E. (2017a). Dimerization of the transmembrane domain of amyloid precursor protein is determined by residues around the gamma-secretase cleavage sites. J Biol Chem, 292: 15826-15837.
Download Citation in RIS Format
Category
Molecular Biology > Protein > Protein-protein interaction
Biochemistry > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,904 | https://bio-protocol.org/exchange/protocoldetail?id=2904&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bioluminescence Resonance Energy Transfer (BRET) Assay for Determination of Molecular Interactions in Living Cells
KH Kaleeckal G. Harikumar
Yan Yan
Ting-Hai Xu
KM Karsten Melcher
HX H. Eric Xu
LM Laurence J. Miller
Published: Vol 7, Iss 22, Nov 20, 2017
DOI: 10.21769/BioProtoc.2904 Views: 20804
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
The bioluminescence resonance energy transfer (BRET) assay can be used as an indicator of molecular approximation and/or interaction. A significant resonance energy transfer signal is generated when the acceptor, having the appropriate spectral overlap with the donor emission, is approximated with the donor. In the example provided, proteins tagged with bioluminescent Renilla luciferase (Rlu) as donor and yellow fluorescent protein (YFP) as acceptor were co-expressed in cells. This pair of donor and acceptor have an approximate Förster distance of 4.4 nm, providing the optimal working distance (Dacres et al., 2010). This technique can be used to explore the time-course of specific molecular interactions that occur in living cells.
Keywords: BRET assay Molecular approximation/interaction Renilla luciferase Yellow fluorescent protein Coelenterazine h
Background
Bioluminescence resonance energy transfer (BRET) studies, using a bioluminescence donor and a fluorescence acceptor, can monitor molecular interactions (such as between labeled proteins, peptides, or small molecules) occurring in real time in living cells. This approach is dependent on spatial approximation between the donor and acceptor, as well as appropriate spectral overlap to yield a meaningful signal (Figure 1). The example currently provided utilizes a Rlu-tagged protein as the donor and a YFP-tagged protein as acceptor (Harikumar et al., 2007). This has been very successfully applied to establish the presence of physiologically-relevant protein-protein interactions in the plasma membrane of living cells. It is important, however, to include controls for levels of expression that could cause non-specific protein-protein approximation and energy transfer (bystander effect), such as the use of similar levels of expression of a known non-associated protein. Also, competition with an unlabeled protein can help to establish the saturability of the interaction and the specificity of the signal.
Figure 1. Illustration of relevant events in a BRET experiment in a living cell. The energy transfer reaction is initiated by adding the luciferase substrate, coelenterazine-h, to cells expressing both molecules tagged with Rlu (donor) and with yellow fluorescent protein (acceptor). The Rlu emits light with a wavelength of approximately 475 nm that then excites the YFP to emit light at approximately 525 nm that can be quantified to represent the BRET signal. The approximate Fӧrster distance for this pair of donor-acceptor is approximately 4.4 nm.
Materials and Reagents
Pipette tips (USA Scientific, catalog number: 1111-1700 )
100-mm tissue culture grade plastic plates (SARSTEDT, catalog number: 83.3902 )
5 ml tissue culture tubes (Corning, Falcon®, catalog number: 352052 )
Cell culture flasks (Corning, catalog number: 3056 )
96-well OptiPlates (PerkinElmer, catalog number: 6005290 )
15 ml conical tube (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339650 )
Pasteur pipette (Fisher Scientific, catalog number: 13-678-20B )
Rapid flow bottle-top filter unit with polyethersulfone (PES) membrane (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 595-3320 )
PS1/PS2-deleted HTL cells
Note: This cell line was derived by Xu et al., 2016, utilizing CRISPR/Cas9 to delete PS1/PS2 from HTL cells, representing a cell line derived from HEK293 cells by Barnea and Axel who stably integrated a luciferase reporter under the control of the bacterial operator element tetO. These cells were used in this case to correlate with specific functional assays requiring a specialized cell type. In a general protocol, any transfectable cell type is fine.
Dulbecco’s modified Eagle’s medium powder (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 12100-038 ) (see Recipe 6 for media preparation)
Fetal Clone II supplement, a bovine serum product (GE Healthcare, HycloneTM, catalog number: SH30066.03 )
Trypsin 0.25%-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 ) diluted to 0.05% with 1x Dulbecco’s phosphate buffered saline, pH 6.80
DEAE-dextran hydrochloride (Sigma-Aldrich, catalog number: D9885 )
Dimethyl sulfoxide (DMSO) (Fisher Biotech, catalog number: BP231-1 )
Chloroquine diphosphate salt (Sigma-Aldrich, catalog number: C6628 )
Enzyme-free cell dissociation solution (EMD Millipore, catalog number: S-014-C )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S0876 )
Potassium phosphate monobasic (KH2PO4) (Fisher Scientific, catalog number: P285 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-500 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
HEPES (Research Products International, catalog number: H75030-1000 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: M1880 )
Calcium chloride dihydrate (CaCl2·2H2O) (Fisher Scientific, catalog number: C79-500 )
Sodium hydroxide (NaOH) (VWR, catalog number: BDH7247-1 )
Coelenterazine-h (AAT Bioquest, catalog number: 21165 ) (see Recipe 5 for preparation of stock solution)
Methanol (Honeywell International, catalog number: 24229 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Sodium bicarbonate (Fisher Scientific, catalog number: BP328-500 )
Hydrochloric acid (HCl) (Fisher Scientific, catalog number: A144-212 )
10x phosphate-buffered saline (PBS buffer) (see Recipes)
10x Kreb’s-Ringers-HEPES stock solution (10x KRH) (see Recipes)
50x CaCl2 stock solution (see Recipes)
1x KRH working solution (see Recipes)
Coelenterazine-h solution (see Recipes)
1x DMEM tissue culture medium (see Recipes)
Equipment
37 °C, 5% CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Series II 3110 Water-Jacketed)
Cell culture microscope (Fisher Scientific)
Micropipettes (Gilson)
2103 EnVision Plate Reader (PerkinElmer, model: 2103 EnVisionTM )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM LegendTM XT/XF centrifuge , catalog number : 75216362)
500 ml screw-cap autoclaved glass bottles (WHEATON, catalog number: 219759 )
Software
GraphPad Prism 6 (GraphPad Software, Inc. USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Harikumar, K. G., Yan, Y., Xu, T., Melcher, K., Xu, H. E. and Miller, L. J. (2017). Bioluminescence Resonance Energy Transfer (BRET) Assay for Determination of Molecular Interactions in Living Cells. Bio-protocol 7(22): e2904. DOI: 10.21769/BioProtoc.2904.
Yan, Y., Xu, T. H., Harikumar, K. G., Miller, L. J., Melcher, K. and Xu, H. E. (2017a). Dimerization of the transmembrane domain of amyloid precursor protein is determined by residues around the gamma-secretase cleavage sites. J Biol Chem, 292: 15826-15837.
Download Citation in RIS Format
Category
Biochemistry > Protein > Interaction
Molecular Biology > Protein > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,905 | https://bio-protocol.org/exchange/protocoldetail?id=2905&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Improved Method for Measuring Chromatin-binding Dynamics Using Time-dependent Formaldehyde Crosslinking
EH Elizabeth A. Hoffman
HZ Hussain Zaidi
SS Savera J. Shetty
SB Stefan Bekiranov
DA David T. Auble
Published: Vol 8, Iss 4, Feb 20, 2018
DOI: 10.21769/BioProtoc.2905 Views: 8022
Edited by: Gal Haimovich
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Formaldehyde crosslinking is widely used in combination with chromatin immunoprecipitation (ChIP) to measure the locations along DNA and relative levels of transcription factor (TF)-DNA interactions in vivo. However, the measurements that are typically made do not provide unambiguous information about the dynamic properties of these interactions. We have developed a method to estimate binding kinetic parameters from time-dependent formaldehyde crosslinking data, called crosslinking kinetics (CLK) analysis. Cultures of yeast cells are crosslinked with formaldehyde for various periods of time, yielding the relative ChIP signal at particular loci. We fit the data using the mass-action CLK model to extract kinetic parameters of the TF-chromatin interaction, including the on- and off-rates and crosslinking rate. From the on- and off-rate we obtain the occupancy and residence time. The following protocol is the second iteration of this method, CLKv2, updated with improved crosslinking and quenching conditions, more information about crosslinking rates, and systematic procedures for modeling the observed kinetic regimes. CLKv2 analysis has been applied to investigate the binding behavior of the TATA-binding protein (TBP), and a selected subset of other TFs. The protocol was developed using yeast cells, but may be applicable to cells from other organisms as well.
Keywords: Chromatin immunoprecipitation (ChIP) Protein dynamic Protein cross-linking Transcription factor Nucleic acid chemistry Chromatin structure Formaldehyde chemistry
Background
Transcription initiation is a complicated process that involves the cooperation and coordinated interaction of dozens of proteins on a chromatinized promoter (Kim et al., 2005; Encode Consortium, 2012; Rhee et al., 2012; Dowen et al., 2014). Many studies have investigated the assembly and regulation of the core transcriptional machinery in vitro (Zawel and Reinberg, 1992; Conaway and Conaway, 1993; Roeder, 1996; Hager et al., 2009; He et al., 2013; Cramer, 2014; Luse, 2014; Horn et al., 2016), but it has been more challenging to examine the stochastic nature of these processes in vivo. There are two general approaches used to measure chromatin-binding dynamics in vivo: microscopy and ChIP-based techniques (Coulon et al., 2013; Mueller et al., 2013). Microscopic techniques, such as fluorescence recovery after photobleaching (FRAP) or single molecule tracking (SMT), have high temporal resolution and have provided fundamental insight into chromatin binding dynamics, including results obtained by tracking individual molecules (Larson et al., 2009; Mueller et al., 2013; Morisaki et al., 2014). However, these approaches can be limited by photophysical effects such as photobleaching, and in addition, in the great majority of cases it is not possible to determine the identity of particular single copy loci where the measured interactions occur (Mueller et al., 2013). Alternatively, ChIP-based approaches provide precise chromatin location information. In Competition ChIP (CC), expression of a differentially tagged isoform of the TF of interest is induced and the relative levels of the constitutive and induced forms of the TF are monitored over time, yielding binding kinetic information through measurements of TF turnover at the sites of interest (van Werven et al., 2009; Lickwar et al., 2013). With advancements in modeling of CC data, residence times as short as 1.3 min have been measured (Zaidi et al., 2017). Relative dynamic measurements have also been made by conditional depletion of TFs from the nucleus using the Anchor Away technique (Haruki et al., 2008; Grimaldi et al., 2014), although specific mathematical models of the process have not yet been reported. The CLK method is complementary to these other ChIP-based approaches, exploiting the time dependence of formaldehyde crosslinking to derive binding kinetic parameters as well as fractional occupancy (Poorey et al., 2013). The first iteration of the CLK assay used ‘standard’ crosslinking and quenching conditions (1% formaldehyde and 250 mM glycine, respectively). Additional work has recently yielded experimental conditions that increase the crosslinking rate and improve quenching of the crosslinking reaction (Zaidi et al., 2017). These new conditions have resulted in a more robust method and the ability to model and analyze crosslinking kinetic data with more reliability and confidence.
Materials and Reagents
Pipette tips
Reusable cotton-plug top serological (glass) pipettes (can also use single-use plastic pipettes)
10 ml pipettes (Fisher Scientific, catalog number: 13-675M )
25 ml pipettes (Fisher Scientific, catalog number: 13-675N )
Pipette sterilizing boxes (Fisher Scientific, catalog number: 03-465 )
Nalgene PPCO centrifuge bottles with sealing closure (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3141-0500 )
50 ml conical tubes 30 x 115 mm (Corning, Falcon®, catalog number: 352070 )
2.0 ml microcentrifuge conical screw cap tubes (FastPrep tubes, Fisher Scientific, catalog number: 02-681-344 )
Microcentrifuge tube screw caps with O-Rings (for FastPrep tubes, Fisher Scientific, catalog number: 02-681-366 )
Acid washed 425-600 μm glass beads (Sigma-Aldrich, catalog number: G8772 )
18 gauge needle (PrecisionGlide, BD, catalog number: 305195 )
Disposable culture tubes, glass 13 x 100 mm (Fisher Scientific, catalog number: 14-961-27 )
1.5 ml microcentrifuge tubes graduated (Fisher Scientific, catalog number: 05-408-129 )
Whatman filter paper (GE Healthcare, catalog number: 1003-917 )
Autoradiography film (Genesee Scientific, catalog number: 30-101 )
1.5-1.7 ml polypropylene graduated tube with locking lid (Fisher Scientific, catalog number: 02-681-285 )
Hard-Shell High-Profile 96-well semi-skirted PCR plates (Bio-Rad Laboratories, catalog number: HSS9641 )
Tubular roll stock (to seal membrane in plastic before developing; Ampac, catalog number: TRS-95125-3 )
Immobilon-P membrane (PVDF; Merck, catalog number: IPVH00010 )
Microseal ‘B’ seal seals (Bio-Rad Laboratories, catalog number: MSB1001 )
Stericup sterile vacuum filter units, 500 ml (Merck, catalog number: SCGPU05RE )
Yeast strains, wild type (WT) and overexpression (OE) for each TF of interest (see Poorey et al., 2013 and Zaidi et al., 2017 for strain lists)
Plasmids for TF overexpression and vector control for WT strain (see Poorey et al., 2013 and Zaidi et al., 2017 for plasmid lists)
Locus specific primers (Invitrogen)
In-Fusion HD cloning kit (Takara Bio, Clontech, catalog number: 639649 )
Ice bucket
37% formaldehyde (Fisher Scientific, catalog number: F79 )
Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, catalog number: 500-0006 )
nProtein A Sepharose 4 Fast Flow beads (GE Healthcare, catalog number: 17-5280-01 )
Note: Ab-conjugated beads can be used instead, such as IgG Sepharose 6 Fast Flow (GE Healthcare, catalog number: 17-0969-01 ) and Sepharose 6 Fast Flow beads (GE Healthcare, catalog number: 17-0159-99 ).
QIAQuick PCR purification kit (QIAGEN, catalog number: 28106 )
iQ SYBR Green Supermix, 500 x 50 μl rxns (Bio-Rad Laboratories, catalog number: 1708882 )
Instant non-fat dry milk (Carnation)
Antibody (i.e., α-TBP, monoclonal, Abcam, catalog number: ab61411 )
Secondary ECL-conjugated antibody (we use Amersham ECL mouse or rabbit IgG HRP-linked whole Ab, GE Healthcare, catalog numbers: NXA931 or NA934V )
Amersham ECL Prime Western blotting detecting reagent (GE Healthcare, catalog number: RPN2232 )
Yeast extract (BD, BactoTM, catalog number: 212750 )
Bacto peptone (BD, BactoTM, catalog number: 211677 )
Sugar source, i.e.,:
D-(+)-Glucose (Sigma-Aldrich, catalog number: G7021 )
D-(+)-Galactose (Sigma-Aldrich, catalog number: G5388 )
D-(+)-Raffinose (MP Biomedicals, catalog number: 02102797 )
Difco yeast nitrogen base without amino acids and ammonium sulfate (BD, DifcoTM, catalog number: 233520 )
Note: Yeast nitrogen base without amino acids (with or without sugar source) can be used as an alternative and doesn’t require the addition of ammonium sulfate (i.e., Sigma-Aldrich, catalog number: Y0626 ).
Amino acids:
Adenine hemisulfate dihydrate (MP Biomedicals, catalog number: 02100195 )
L-Histidine hydrochloride monohydrate (Acros Organics, catalog number: 411731000 )
L-Lysine (Fisher Scientific, catalog number: BP386 )
L-Tyrosine (Acros Organics, catalog number: 140641000 )
L-Tryptophan (Fisher Scientific, catalog number: BP395 )
Uracil (Affymetrix, catalog number: 23020 )
L-Leucine (Acros Organics, catalog number: 125121000 )
L-Methionine (Fisher Scientific, catalog number: BP388 )
L-Arginine hydrochloride (Fisher Scientific, catalog number: BP372 )
L-Serine (Fisher Scientific, catalog number: BP393 )
Valine (Fisher Scientific, catalog number: BP397 )
L-Threonine (MP Biomedicals, catalog number: 02103053 )
L-Isoleucine (Fisher Scientific, catalog number: BP384 )
L-Phenylalanine (Fisher Scientific, catalog number: BP391 )
L-Cysteine hydrochloride monohydrate (Fisher Scientific, catalog number: BP376 )
L-Aspartic Acid (Acros Organics, catalog number: 105041000 )
L-Proline (Fisher Scientific, catalog number: BP392 )
Note: Commercially available yeast synthetic drop-out medium supplements (Sigma-Aldrich) can be used instead of a home-made dropout mix.
Bacto agar (BD, catalog number: 214010 )
Glycine, 2 kg (Bio-Rad Laboratories, catalog number: 1610724 )
Hydrochloric acid (Fisher Scientific, catalog number: A144SI-212 )
Tris base (Sigma-Aldrich, catalog number: T1503 )
Ammonium sulfate (Sigma-Aldrich, catalog number: A4418 )
Magnesium chloride hexahydrate (Sigma-Aldrich, catalog number: M9272 )
EDTA (Fisher Scientific, catalog number: BP120 )
Glycerol (Fisher Scientific, catalog number: BP229 )
β-Mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Protease inhibitors
cOmplete protease inhibitor tablet EDTA-free (Roche Diagnostics, catalog number: 04693132001 )
OR:
Phenylmethylsulfonyl fluoride (Sigma-Aldrich, catalog number: P7626 )
Benzamidine hydrochloride hydrate (Acros Organics, catalog number: 105241000 )
Pepstatin A (Sigma-Aldrich, catalog number: P4265 )
Leupeptin hemisulfate salt (Sigma-Aldrich, catalog number: L8511 )
Chymostatin (Sigma-Aldrich, catalog number: C7268 )
SDS (Sigma-Aldrich, catalog number: L3771 )
DTT (Roche Diagnostics, catalog number: 03117006001 )
Bromophenol blue (Bio-Rad Laboratories, catalog number: 1610404 )
Coomassie blue
Methanol (Fisher Scientific, catalog number: A452 )
Acetic acid
Sodium chloride (Fisher Scientific, catalog number: S640 )
Tween 20 (Sigma-Aldrich, catalog number: P5927 )
Note: This product has been discontinued.
HEPES (Fisher Scientific, catalog number: BP310 )
Triton X-100 (AMRESCO, catalog number: 0694 )
Sodium deoxycholate (Sigma-Aldrich, catalog number: D6750 )
Lithium chloride (Sigma-Aldrich, catalog number: L4408 )
Nonidet P40 (Spectrum, catalog number: N1156 )
Note: This product has been discontinued.
Diethyl pyrocarbonate (DEPC), 97% pure (Acros Organics, catalog number: 170250250 )
Acrylamide (Bio-Rad Laboratories, catalog number: 1610101 )
Bis-acrylamide (Fisher Scientific, catalog number: BP171 )
Ammonium persulfate (APS, Bio-Rad Laboratories, catalog number: 1610700 )
TEMED (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 17919 )
YPD media (see Recipes)
30% raffinose or galactose (see Recipes)
SC media (Yeast synthetic media, see Recipes)
Amino acid mix (see Recipes)
3 M glycine quench solution (see Recipes)
Benoit’s buffer (see Recipes)
Laemmli buffer (4x sample buffer, see Recipes)
Coomassie stain (see Recipes)
TBS (see Recipes)
TBST (see Recipes)
140 mM ChIP lysis buffer (see Recipes)
500 mM ChIP lysis buffer (see Recipes)
LiCl wash buffer (see Recipes)
1x TE (see Recipes)
ChIP elution buffer (see Recipes)
DEPC H2O (see Recipes)
30%/0.8% Bis-acrylamide solution (see Recipes)
SDS-PAGE running buffer (see Recipes)
Transfer buffer (see Recipes)
Equipment
Glass culture tubes and caps, 18 x 150 mm (i.e., disposable borosilicate glass tubes with plain end, Fisher Scientific, catalog number: 14-961-32 and Diamond culture tube caps, 18 mm, Globe Scientific, catalog number: 118154 )
Flasks (1 L, 250 ml; i.e., Pyrex narrow-neck heavy-duty glass Erlenmeyer flasks, Corning, PYREX®, catalog numbers: 4980-1L (1L) and 4980-250 (250 ml))
Pipettes (P2, P2, P200, P1000)
Pipet-Aid (Drummond Scientific, catalog number: 4-000-100 )
Incubator, 30 °C (i.e., Isotemp CO2 incubator, Fisher Scientific, Fisherbrand, catalog number: 11-676-603 )
Magnetic stir bars (Fisher Scientific, catalog number: 14-513-52 )
Stirring hot plate (Fisher Scientific, catalog numbers: 11-510-49SH or SP88850200 )
Timer
Sorvall RC 5B centrifuge (GMI, model: Sorvall RC-5B )
SLA-3000 rotor (Thermo Fisher Scientific, Thermo ScientificTM, model: SLA-3000 , catalog number: 07149)
Eppendorf 5810 R benchtop centrifuge with plate buckets and 15 ml/50 ml adapters (Eppendorf, model: 5810R , catalog number: 5811000827)
MP FastPrep-24 Bead beater (MP Biomedicals, model: FastPrep®-24 Classic, catalog number: 116004500 )
Bunsen burner
Branson Sonifier 250 with 1/8” microtip probe (Fisher Scientific, catalog numbers: 22-309782 and 22-309796 )
Eppendorf 5415C or D benchtop centrifuge (Eppendorf, similar is catalog number: 022620304 )
Shaker, 30 °C (i.e., Eppendorf, New Brunswick Scientific, model: Excella® E25 , catalog number: M1353-0002)
4 °C refrigerator
-20 °C freezer
-80 °C freezer
Autoclave
AutoMixer magnetic stir plate (Fisher Scientific, catalog number: 14-505-21 )
Ultrospec 2100pro UV/Visible spectrophotometer (Biochrom, model: ULTROSPEC 2100® , catalog number: 80-2112-21)
PowerPac Basic power supply (Bio-Rad Laboratories, catalog number: 1645050 )
Mini-PROTEAN tetra cell with casting stand and frames, combs, short plates, and spacer plates (Bio-Rad Laboratories, catalog number: 1658006FC )
Mini trans-blot electrophoretic transfer cell with holder cassettes, foam pads, and blue cooling unit (Bio-Rad Laboratories, catalog number: 1703930 )
Shaker (Reliable Scientific, model: 55S )
Autoradiography cassette (Fisher Biotech, catalog number: FBXC 810 )
Labquake shaker rotisserie, 32 x 10 to 19 mm with clip bar (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 415110Q )
Water baths (55 °C and 65 °C)
MyiQ real-time instrument (Bio-Rad Laboratories, catalog number: 170-9770 )
Software
ImageJ (NIH)
Mathematica
R or R-Studio
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Hoffman, E. A., Zaidi, H., Shetty, S. J., Bekiranov, S. and Auble, D. T. (2018). An Improved Method for Measuring Chromatin-binding Dynamics Using Time-dependent Formaldehyde Crosslinking. Bio-protocol 8(4): e2905. DOI: 10.21769/BioProtoc.2905.
Zaidi, H., Hoffman, E. A., Shetty, S. J., Bekiranov, S. and Auble, D. T. (2017). Second-generation method for analysis of chromatin binding with formaldehyde-cross-linking kinetics. J Biol Chem 292(47): 19338-19355.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA-protein interaction
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,906 | https://bio-protocol.org/exchange/protocoldetail?id=2906&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Optimized CTAB Method for Genomic DNA Extraction from Freshly-picked Pinnae of Fern, Adiantum capillus-veneris L.
YS Yi Shu
JW Jin Wan-Ting
YY Yuan Ya-Ning
FY Fang Yu-Han
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2906 Views: 16589
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
As the sister clade of seed plants, ferns are significant materials for plant phylogeny research. However, the genomic DNA extraction protocol for fern samples like modified CTAB method still lacks robustness. Here, we found that the amount and condition of the pinnae samples are critical for gDNA extraction in fern, Adiantum capillus-veneris L. In 500 μl CTAB solution, the recommended amount of pinnae is about 10-20 mg (2-3 pieces). The condition of the pinnae must be instantly-picked from a plant cultivated in a suitable environment. With these factors under control, it is highly reproducible to get the high-quality gDNA with low degradation rate
Keywords: Fern DNA extraction Adiantum capillus-veneris L. CTAB method Fern pinnae
Background
The CTAB method has been applied to gDNA extraction from Adiantum capillus-veneris L. (Han et al., 2012; Li et al., 2017). However, the protocol still shows instability and high degradation rate in our experiment. The pinnae of ferns accumulate large quantities of secondary metabolites, such as polysaccharides and polyphenols, which is adverse to DNA extraction (Ponnusamy et al., 2015).
To increase the robustness of gDNA extraction, we optimized the protocol basically from two aspects: 1) Reduce the amount of material and use only 2-3 pinnae (about 10-20 mg). 2) The pinnae must be freshly picked from a plant cultured in suitable cultivation environment (temperature: 25 °C, humidity: 65%, 16-h white light/8-h dark treatment) and instantly used for DNA extraction. Compared with the classical method, we can get gDNA of higher quality and lower degradation rate from ferns with this optimized protocol.
Materials and Reagents
1.5 ml Eppendorf tubes (Eppendorf®)
Steel beads (Diameter: 3.175 mm)
Nutrient soil
Vermiculite
Pipette tips (Corning, Axygen®, catalog number: T-1000-B ; T-200-Y ; T-300 )
Freshly-picked pinnae of Adiantum capillus-veneris
Note: The plant is cultured in the cultivation room of PKU for several years and generations, which makes it domesticated.
Liquid nitrogen
β-mercapto-ethanol (BME) (Thermo Fisher Scientific, Gibco®, catalog number: 21985023 )
PVP-40 (AMRESCO, catalog number: 0507-500G )
Phenol:Chloroform:Isoamyl alcohol (25:24:1) (Coolaber, catalog number: SL2040-100ML ) (purity: AR)
Chloroform, purity: AR
Isopropanol, purity: AR
75% ethanol, purity: AR
Ultrapure water
CTAB (AMRESCO, catalog number: 0833-1KG )
Sodium chloride, purity: GR
EDTA (AMRESCO, catalog number: 0322 )
Tris (AMRESCO, catalog number: 0497-5KG )
RNase I
HCl, purity: AR
M3 (Marker III) (TIANGEN Biotech, catalog number: MD103 )
2% CTAB (see Recipes)
10% RNaseI (TaKaRa, catalog number: 2158-1 ) (see Recipes)
Equipment
Pipettes (Eppendorf®)
Stainless steel spoon
Mortar (diameter: 100 mm) and pestle (size: 117 mm)
Tissue grinder (Retsch®, TissueLyser II)
Water bath (65 °C)
High-speed centrifuges (Refrigeration is not necessary)
Refrigerator (-20 °C)
Oven (37 °C)
Magnetic stirrer
Electrophoresis equipment
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yi, S., Jin, W., Yuan, Y. and Fang, Y. (2018). An Optimized CTAB Method for Genomic DNA Extraction from Freshly-picked Pinnae of Fern, Adiantum capillus-veneris L.. Bio-protocol 8(13): e2906. DOI: 10.21769/BioProtoc.2906.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > DNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,907 | https://bio-protocol.org/exchange/protocoldetail?id=2907&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An in vitro Co-culture System for the Activation of CD40 by Membrane-presented CD40 Ligand versus Soluble Agonist
KI Khalidah Ibraheem
CD Christopher J. Dunnill
MI Myria Ioannou
AM Albashir Mohamed
BA Balid Albarbar
Nikolaos T. Georgopoulos
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2907 Views: 7788
Edited by: HongLok Lung
Reviewed by: Tomas AparicioPornima Phatak
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
One fundamental property of the TNR receptor (TNFR) family relates to how ‘signal quality’ (the extent of receptor ligation or cross-linking) influences the outcome of receptor ligation, for instance the induction of death in tumour cells. It is unequivocal that membrane-presented ligand (delivered to target cells via cell-surface presentation by co-culture with ligand-expressing third-party cells) induces a greater extent of carcinoma cell death in vitro in comparison to non-cross-linked agonists (agonistic antibodies and/or recombinant ligands). The CD40 receptor epitomises this fundamental property of TNF receptor-ligand interactions, as the extent of CD40 cross-linking dictates cell fate. Membrane-presented CD40 ligand (mCD40L), but not soluble agonists (e.g., agonistic anti-CD40 antibody), induces high level of pro-inflammatory cytokine secretion and causes extensive cell death (apoptosis) in malignant (but not normal) epithelial cells. In this article, we describe a co-culture system for the activation of CD40 by mCD40L and subsequent detection of various features of apoptosis (including cell membrane permeabilisation, DNA fragmentation, caspase activation) as well as detection of intracellular mediators of cell death (including adaptor proteins, pro-apoptotic kinases and reactive oxygen species, ROS).
Keywords: TNF receptors (TNFRs) CD40 Receptor ligation Membrane-presented ligand Soluble agonist Co-culture In vitro Cell death Apoptosis Caspase activation DNA fragmentation Immunoblotting
Background
The role of the TNFRs and their ligands in regulating cell proliferation or death in lymphoid tissues as well as in epithelial (and particularly carcinoma) cells has been under extensive research, as their ability to induce cell death (mainly via apoptosis) represents a promising target for cancer therapy. Importantly, however, there is a clear difference in the ability of TNFR agonists to trigger cell death when presented in soluble versus membrane-bound form. Soluble agonists often demonstrate relatively low cytotoxic potency when administrated as a sole treatment, whereas membrane-presented ligands appear to be superior (Albarbar et al., 2015).
In this context, CD40 represents the most prominent TNFR family member. The receptor is expressed on a variety of epithelial cells and the effect of CD40 activation is exquisitely contextual (Young and Eliopoulos, 2004). Most importantly, the ability of CD40 to induce cytostasis or cell death (apoptosis) is highly dependent on the ‘quality’ of receptor engagement (degree of receptor cross-linking). Soluble CD40 agonists (recombinant soluble CD40L or agonistic antibody) are only cytostatic or weakly pro-apoptotic and only rendered pro-apoptotic by pharmacological intervention (Bugajska et al., 2002). By contrast, membrane-presented CD40L (mCD40L) is highly pro-apoptotic and induces extensive apoptosis in carcinoma cells, when presented to target carcinoma cells on the surface of third-party cells (Georgopoulos et al., 2006 and 2007) or by mCD40L-expressing, naturally-activated immunocytes (Hill et al., 2008).
The ability of mCD40L (but not soluble agonists) to efficiently kill malignant cells, and in a tumour cell-specific fashion, reflects the two most remarkable properties of the CD40-mCD40L dyad and our recent studies have deciphered these two fundamental properties of CD40. We utilised a co-culture system that involved culture of target, carcinoma (or normal) cells with growth-arrested, third-party, effector cells engineered to express the CD40L on their surface, in order to achieve presentation of mCD40L. This allowed us to study the ability of mCD40L to induce a number of different morphological and biochemical features of apoptosis, as well as define the intracellular mediators of cell death (Dunnill et al., 2017). Here, we provide a detailed protocol for the preparation of the co-culture system for mCD40L delivery to epithelial target cells (in comparison to soluble agonist, i.e., agonistic anti-CD40 antibody) and methodologies to assess mCD40L-induced apoptosis and detection of its intracellular mediators.
Materials and Reagents
Materials
T75 tissue culture flasks with vent (SARSTEDT, catalog number: 83.1813.002 )
T25 tissue culture flasks with vent (SARSTEDT, catalog number: 83.1810.002 )
96 well Nunc, white, flat bottom tissue culture multi-well plates (Thermo Fisher Scientific, catalog number: 136101 )
96 well, flat bottom, Costar transparent tissue culture plates (Corning, catalog number: 3595 )
96 well ELISA microplates (Greiner Bio One International, catalog number: 655101 )
24 well plates (Corning, catalog number: 3526)
6 well plates (Corning, catalog number: 3516)
Tissue culture dishes, 10 cm diameter, Nunclon with lid (Thermo Fisher Scientific, catalog number: 150350 )
Bijou tubes 5 ml sterile (x2,000) (SARSTEDT, catalog number: 60.9921.532 )
Cryopure tubes, 2.0 ml white cap (SARSTEDT, catalog number: 72.380 )
5 ml serological pipettes (SARSTEDT, catalog number: 86.1253.001 )
10 ml serological pipette (SARSTEDT, catalog number: 86.1254.001 )
25 ml serological pipettes (SARSTEDT, catalog number: 86.1685.001 )
120 ml sterile container graduated (x250) (SARSTEDT, catalog number: 75.9922.420 )
250 ml SterilinTM containers (Thermo Fisher Scientific, catalog number: 190A )
30 ml SterilinTM universals (Thermo Fisher Scientific, catalog number: 128AFS )
2 ml aspiration pipette individually wrapped sterile Non Pyrogenic (SARSTEDT, catalog number: 86.1252.011 )
5.0 ml TipOne® Repeat Dispenser Tip (Sterile) (STARLAB, catalog number: S4761-0500 )
1.25 ml TipOne Repeat Dispenser Tip (Sterile), Ind. Wrapped (STARLAB, catalog number: S4786-0125 )
Cell scrapers (Fisher Scientific, catalog number: FB55199 )
20 ml disposable sterile syringe (BD, catalog number: 300296 )
10 ml disposable sterile syringe (BD, catalog number: 302188 )
1.5 ml tubes (SARSTEDT, catalog number: 72.690.001 )
0.5 ml tubes (5,000) (SARSTEDT, catalog number: 72.699 )
0.2 µm syringe filter sterile (SARSTEDT, catalog number: 83.1826.102 )
Syringe filter 0.4 μm (x50) (GE Healthcare, Whatman, catalog number: 6896-2504 )
Haemocytometer (Fisher Scientific, catalog number: MNK-420-010N )
Haemocytometer cover slips (Fisher Scientific, catalog number: MNK-504-030M )
X2500 Countess Chamber Slides (2,500) (Thermo Fisher Scientific, catalog number: C10314 )
Blue loose pipette tips (1,000 µl) (SARTEDT, catalog number: 70.762 )
200 µl yellow pipette tips (SARTEDT, catalog number: 70.760.002 )
Neutral pipette tips (10 µl) (SARTEDT, catalog number: 70.1130 )
Cells
Human bladder carcinoma-derived EJ cells and colorectal carcinoma-derived HCT116 cells (obtained from the ATCC)
Note: They were cultured in a 1:1 (v/v) mixture of DMEM and RPMI 1640 containing 5% FBS, referred to as ‘DR/5%’ medium.
Normal human urothelial (NHU) cells
Note: They were established and cultured in complete KSFM as described (Bugajska et al., 2002).
3T3neo and 3T3CD40L fibroblasts – stably transfected NIH3T3 derivatives generated as previously described (Bugajska et al., 2002)
Note: They were cultured in DMEM supplemented with 10% FBS and containing 0.5 mg/ml G418, with omission of antibiotic in co-culture experiments (Georgopoulos et al., 2006).
Reagents
Purified water (double distilled ddH2O)
D-PBS, 10x, no calcium, no magnesium (Thermo Fisher Scientific, catalog number: 14200067 )
Mikrozid AF liquid, 10 L canister (LAVABIS, catalog number: SF000301 )
G418, 100 mg/ml solution (InvivoGen, supplied by Source BioScience LifeSciences, catalog number: ant-gn-1 )
Keratinocyte Serum Free Medium (KSFM) and supplements (Thermo Fisher Scientific, GibcoTM, catalog number: 17005075 )
RPMI-1640 Medium, with sodium bicarbonate, without L-glutamine (Sigma-Aldrich, catalog number: R0883-6X500ML )
Dulbecco’s Modified Eagle’s Medium (DMEM) (high glucose) with sodium bicarbonate, without L-glutamine (Sigma-Aldrich, catalog number: D6546-6X500ML )
Hanks' Balanced Salt Solution (HBSS) (Sigma-Aldrich, catalog number: H9394-6X500ML )
L-Glutamine solution (Sigma-Aldrich, catalog number: G7513-100ML )
Fetal bovine serum (FBS) (qualified fetal bovine serum, 500 ml) (Sigma-Aldrich, catalog number: F7524-500ML )
Ethylenediaminetetraacetic acid (EDTA) (Santa Cruz Biotechnology, catalog number: sc-29092 )
Trypsin-EDTA (Sigma-Aldrich, catalog number: T4174 )
Dimethyl Sulphoxide (DMSO) (Sigma-Aldrich, catalog number: D2650-100ML )
Mr. FrostyTM Freezing Container (Thermo Fisher Scientific, catalog number: 5100-0001 )
Isopropanol (Fisher Scientific, catalog number: A415-4 )
MycoProbeTM Mycoplasma detection assay (R&D Systems, catalog number: CUL001B )
Mitomycin C (10 mg) (Santa Cruz Biotechnology, catalog number: sc-3514B )
CK18 (cytokeratin 18) monoclonal antibody clone CY-90 (Sigma-Aldrich, catalog number: C8541-.2ML )
Goat anti Rabbit IgG IRDYE800 secondary antibody (tebu-bio, catalog number: 039611-132-122 )
Goat anti-Mouse IgG Alexa Fluor® 680 secondary antibody (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-21057 )
TRAF-3 antibody (Santa Cruz Biotechnology, catalog number: sc-949 )
Phospho-ASK1 (Thr845) antibody (Cell Signalling Technology, catalog number: 3765 )
Agonistic anti-CD40 mAb G28-5 (used at 10 µg/ml), purified from culture supernatants of the HB-9110 hybridoma line (purchased from the ATCC)
Affinity-purified human serum protein-adsorbed goat anti-mouse IgG (X-linker) (used at 5 µg/ml) (Sigma-Aldrich, catalog number: M8645 )
Staurosporine from Streptomyces sp. (Sigma-Aldrich, catalog number: S4400-.1MG )
Docetaxel (Sigma-Aldrich, catalog number: 01885-5MG-F )
CellTiter 96® AQueous One Solution Assay (5,000 assays) (Promega, catalog number: G3581 )
Cellular DNA Fragmentation ELISA kit (for up to 500 tests) (Roche Diagnostics, catalog number: 11585045001 )
Cytotox-GloTM cytotoxicity assay (5 x 10 ml) (Promega, catalog number: G9291 )
Sensolyte® Homogeneous AFC Caspase-3/7 Assay kit (Cambridge Bioscience, catalog number: ANA71114 )
CM-H2DCFDA (chloromethyl derivative of 5-(and-6)-chloromethyl-2',7'-dichlorodihydrofluorescein diacetate) (Thermo Fisher Scientific, catalog number: C6827 )
Glycerol (Fisher Scientific, catalog number: 10795711 )
Sodium dodecyl sulphate (SDS) (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0002 )
Tris-HCl, powder, 1 KG (Melford, catalog number: T1513 )
Sodium fluoride (Acros Organics, catalog number: 424325000 )
Sodium pyrophosphate tetrabasic (Sigma-Aldrich, catalog number: P8010-500G )
Sodium orthovanadate (Sigma-Aldrich, catalog number: S6508-10G )
Protease inhibitor (PI) cocktail (Merck, catalog number: 535140-1 )
PI cocktail (New England Biolabs, catalog number: 5872S )
AQUAGUARD-1 solution for disinfection of water baths and CO2 incubators (Biological Industries, catalog number: 01-867-1B ) (see Recipes)
1x PBS (see Recipes)
PBS/EDTA solution (see Recipes)
Freezing medium (see Recipes)
FACS buffer (see Recipes)
70% ethanol (see Recipes)–Ethanol, Absolute (Fisher Scientific, catalogue number: E/0650DF/P17 )
DR medium (see Recipes)
SSB buffer (see Recipes)
Lysis buffer (see Recipes)
Equipment
Gilson Pipettes
P1000 (200-1,000 μl)
P200 (50-200 μl)
P20 (2-20 μl)
P10 (1-10 μl)
Gilson REPETMAN electronic pipette 0.1-50 ml (Gilson, catalog number: F164503 )
Water bath (Memmert)
Boiling water bath (Grant)
-80 °C freezer
Sparkfree Refrigerator and Freezer (Labcold)
Electrophoresis Power Supply
Refrigerated centrifuge (PRISM R)
Universal 320 benchtop centrifuge (Hettich Zentrifugen)
Vortex mixer
Ultrasonic Homogenizer Sonicator
NuAire CellGard ES Biological Safety Cabinet (TripleRed)
Iso Class 5 Nuaire Autoflow IR direct heat CO2 incubator with a HEPA filtration system at 37 °C and 5% CO2 (TripleRed)
OdysseyTM Infra-red Imaging system (Li-Cor)
Guava EasyCyteTM Flow Cytometer (Millipore)
Countess II Automated Cell Counter (Thermo Fisher Scientific, catalog number: AMQAX1000 )
EVOSTM XL Core Imaging System (Fisher Scientific)
FLUOstar OPTIMA (BMG Labtech)
Software
MARS software (BMG Labtech), Version 2.0
Guava EasyCyte flow cytometry software (Millipore), Guavasoft Version 2.6
Image Studio Life, Version 4.0
Adobe Photoshop CS, Version 8.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ibraheem, K., Dunnill, C. J., Ioannou, M., Mohamed, A., Albarbar, B. and Georgopoulos, N. T. (2018). An in vitro Co-culture System for the Activation of CD40 by Membrane-presented CD40 Ligand versus Soluble Agonist. Bio-protocol 8(13): e2907. DOI: 10.21769/BioProtoc.2907.
Download Citation in RIS Format
Category
Cancer Biology > Cell death > Cell biology assays
Cell Biology > Cell isolation and culture > Co-culture
Cell Biology > Cell signaling > Intracellular Signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,908 | https://bio-protocol.org/exchange/protocoldetail?id=2908&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sleeping Beauty Transposon-based System for Rapid Generation of HBV-replicating Stable Cell Lines
JZ Jin-Wei Zheng
JC Jia-Li Cao
Quan Yuan
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2908 Views: 7971
Edited by: Yannick Debing
Reviewed by: Vasudevan Achuthan
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
The stable HBV-transfected cell lines, which based on stable integration of replication-competent HBV genome into hepatic cells, are widely used in basic research and antiviral drug evaluation against HBV. However, previous reported strategies to generate HBV-replicating cell lines, which primarily rely on random integration of exogenous DNA by plasmid transfection, are inefficient and time-consuming. We newly developed an all-in-one Sleeping Beauty transposon system (denoted pTSMP-HBV vector) for robust generation of stable HBV-replicating cell lines of different genotype. The pTSMP-HBV vector contains HBV 1.3-copy genome and dual selection markers (mCherry and puromycin resistance gene), allowing rapid enrichment of stably-transfected cells via red fluorescence-activated cell sorting and puromycin antibiotic selection. In this protocol, we described the detailed procedure for constructing the HBV-replicating stable cells and systematically evaluating HBV replication and viral protein expression profiles of these cells.
Keywords: HBV HBV-replicating cell lines Sleeping Beauty transposon system HBV 1.3-copy genome HepG2
Background
Chronic hepatitis B virus (HBV) infection is currently a major public health burden, affecting over 240 million individuals globally (Witt-Kehati et al., 2016). Patients with chronic HBV have an elevated risk of chronic active hepatitis, cirrhosis, or primary hepatocellular carcinoma (HCC) (Schweitzer et al., 2015). Current treatments with interferon-α or nucleoside analogs do not eradicate the virus, and their effects on clearing hepatitis B surface antigen (HBsAg) are limited (Lucifora and Protzer, 2016; Soriano et al., 2017). Therefore, there is an urgent need for the development of novel antiviral inhibitors (Nassal, 2015).
A cell culture model for evaluating the activity of new agents against HBV is an important tool for new drug development. The stable HBV-replicating cell lines, which carry replication-competent HBV genome stably integrated into the genome of human hepatoma cell lines (Huh7 and/or HepG2), are widely used to evaluate the effects of antiviral agents (Witt-Kehati et al., 2016). The stable HBV-producing human hepatoma cell lines (HepG2.2.15 and HepaAD38) integrated the D-genotype HBV genome, which are widely used in antiviral research (Chang et al., 1987; Ladner et al., 1997). However, stable HBV-producing cell lines of genotypes A, B, and C are not commonly used in the research field. Therefore, there is a need to develop cell lines of HBV genotypes A-C for drug development.
The Sleeping Beauty (SB) transposon system, derived from teleost fish sequences, is extremely effective at delivering DNA to vertebrate genomes, including those of humans (Structure of SB can be seen in Figure 1A). Sleeping Beauty transposition is a cut-and-paste process, during which the element ‘jumps’ from one DNA molecule to another (Figure 1B) (Ivics and Izsvak, 2011). Since its reconstruction in 1997 from the salmonid fish genome (Ivics et al., 1997), the SB system has been undergoing several modifications to improve its efficacy (Geurts et al., 2003; Baus et al., 2005; Score et al., 2006). The development of the hyperactive transposase SB100X has increased approximately 100-fold of efficiency compared with the first-generation transposase (Mátés et al., 2009), which is expected to facilitate widespread applications in functional genomics and gene therapy (Izsvak and Ivics, 2004).
Figure 1. The Sleeping Beauty transposable element and its transposition. A. The Sleeping Beauty (SB) system. The transposase gene (yellow rectangle) is flanked by terminal inverted repeats (IR/DRs, blue arrows), each containing two binding sites for the transposase (small green arrows). The transposase consists of an N-terminal, DNA-binding domain (PAI and RED), a nuclear localization signal (NLS), a C-terminal and catalytic domain (DDE). B. Transposition. The transposase gene within the element can be replaced by a therapeutic gene, and the resultant transposon can be maintained in a simple plasmid vector. The transposase is supplied in trans. The transposase binds to its binding sites within the IR/DR repeats and, together with host factors such as HMGB1, forms a synaptic complex, in which the ends of the transposon are paired. The transposon is excised from the donor molecule and integrates into a new location.
Materials and Reagents
Pipette tips, 10 μl (Haimen plastic, 20111088)
Pipette tips, 200 μl (Corning, Axygen®, catalog number: T-200-Y-R )
Pipette tips, 1 ml (Haimen plastic, 20111011)
Cell culture plate (100 mm) (Corning, catalog number: 430167 )
Cell culture plate (60 mm) (Thermo Fisher Scientific, catalog number: 150288 )
15 ml tube (Thermo Fisher Scientific, catalog number: 339651 )
70 μm cell strainer (Fisher Scientific, Fisherbrand, catalog number: 22-363-548 )
Cell culture plate (6 well) (Corning, catalog number: 3516 )
Cell culture plate (24 well) (Corning, catalog number: 3524 )
Cell Imaging Plate, 24 well, glass bottom (Eppendorf, catalog number: 0030741021 )
Nylon membranes (Roche Diagnostics, catalog number: 11417240001 )
Human hepatoma HepG2 cells (Originally from the China Centre for Type Culture Collection, Wuhan, China)
Minimum essential medium (MEM, powder) (Thermo Fisher Scientific, GibcoTM, catalog number: 41500-083 )
Fetal bovine serum, Qualified, Australia Origin (Thermo Fisher Scientific, catalog number: 10099141 )
X-tremeGENE HP DNA Transfection Reagent (Roche Diagnostics, catalog number: 06366236001 )
Opti-MEM (Thermo Fisher Scientific, GibcoTM, catalog number: 31985070 )
0.25% Trypsin-EDTA (1x), Phenol Red (Thermo Fisher Scientific, GibcoTM, catalog number: 25200-114 )
Puromycin (Thermo Fisher Scientific, InvitrogenTM, catalog number: A1113803 )
Mouse anti-HBcAg (Innodx Biotechnology, catalog number: 2A7-21 [it's new anti-HBc mAb, available on request])
Alexa Fluor® 488 Donkey Anti-Mouse IgG (H+L) (Thermo Fisher Scientific, catalog number: A-21202 )
DAPI (Thermo Fisher Scientific, InvitrogenTM, catalog number: D1306 )
Micrococcal nuclease (Takara Bio, catalog number: D2910 )
Proteinase K (Takara Bio, catalog number: D9033 )
Ethanol, C2H6O, AR (Xilong Scientific, catalog number: 1030029AR )
Oligonucleotides
dNTP Mixture 2.5 μM (Takara Bio, catalog number: D4030A )
DIG Easy Hyb Granules (Roche Diagnostics, catalog number: 11796895001 )
PrimeSTAR GXL DNA Polymerase (Takara Bio, catalog number: DR050A )
Premix Ex TaqTM (Probe qPCR) (Takara Bio, catalog number: RR390A )
Casein 10x blocking buffer (Sigma-Aldrich, catalog number: B6429-500ML )
Anti-DIG (AP) antibody (Roche Diagnostics, catalog number: 11093274910 )
CDP-Star AP substrate (Roche Diagnostics, catalog number: 12041677001 )
Universal DNA Purification Kit (TIANGEN Biotech, catalog number: DP214-03 )
Diagnostic kit for Hepatitis B surface antigen (CLEIA) (Wantai Biological Pharmacy, catalog number: HBV-1396 )
Diagnostic kit for Hepatitis B e-antigen (ELISA) (Wantai Biological Pharmacy, catalog number: HBV-0396 )
ED-11 (Innovax Biotechnology)
Virus DNA/RNA Extraction kit (GenMag Biotechnology, catalog number: NA007 )
Mycoplasma-free neonatal bovine serum (Tianhang Biotechnology, catalog number: 11011-8615 )
Sodium chloride (NaCl, AR) (Xilong Scientific, catalog number: 1001012AR )
Potassium chloride (KCl, cell culture) (Sigma-Aldrich, catalog number: P5405 )
Hydrochloric acid (HCl, AR) (Xilong Scientific, catalog number: 1029013AR )
Sodium hydroxide (NaOH, AR) (Xilong Scientific, catalog number: 1001037AR )
Disodium hydrogen phosphate (Na2HPO4·12H2O, AR) (Xilong Scientific, catalog number: 1001067AR )
Potassium dihydrogen phosphate (KH2PO4, AR) (Xilong Scientific, catalog number: 1002048AR500 )
Sodium bicarbonate (NaHCO3, AR) (Xilong Scientific, catalog number: 44558 )
Paraformaldehyde (Sigma-Aldrich, catalog number: 16005-1KG-R )
Triton X-100 (AMRESCO, catalog number: 0694 )
Bovine albumin (Low endotoxin) (ICPbio International, catalog number: ABRE-1KG )
Tris base (SEEBIO BIOTECH, catalog number: 183995 )
Tris-saturated phenol (Solarbio, catalog number: T0250 )
Ethylenediaminetetraacetic acid (EDTA, AR) (Xilong Scientific)
NONIDET® P-40 Substitute (AMRESCO, catalog number: M158-500ML )
Calcium chloride (CaCl2, AR) (Xilong Scientific, catalog number: U1000566-500g )
Sodium dodecyl sulfate (SDS) (Merck, catalog number: 428015 )
Chloroform (AR) (Xilong Scientific, catalog number: 1039013AR500 )
Isoamyl alcohol (AR) (Xilong Scientific, catalog number: U1001975-500ml )
Maleic acid (Sigma-Aldrich, catalog number: M0375 )
Tween-20 (BBI Solutions, catalog number: TB0560-500ml )
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA-Na2·2H2O, AR) (Xilong Scientific, catalog number: 100186 )
Acetate (CH3COOH, AR) (Xilong Scientific, catalog number: 1029047AR )
Sodium citrate (C6H5Na3O7, AR) (Xilong Scientific, catalog number: 1001059AR )
Verson buffer (see Recipes)
PBS buffer (see Recipes)
4% paraformaldehyde (see Recipes)
0.2% Triton X-100 (see Recipes)
3% BSA (see Recipes)
NET buffer (see Recipes)
1.2 M CaCl2 (see Recipes)
0.5 M EDTA (see Recipes)
10% SDS (see Recipes)
Phenol/chloroform/isoamyl alcohol (25:24:1) (see Recipes)
Maleic acid buffer (see Recipes)
Washing buffer (see Recipes)
Detection buffer (see Recipes)
50x TAE buffer (see Recipes)
Depurination buffer (see Recipes)
Denaturation buffer (see Recipes)
Neutralization buffer (see Recipes)
10x SSC (see Recipes)
2x SSC/0.1% SDS (see Recipes)
0.5x SSC/0.1% SDS (see Recipes)
Equipment
Pipettes (Mettler-Toledo International, RAININ, model: Pipet-Lite )
CO2 Incubator (Thermo Fisher Scientific, catalog number: 3111 )
Centrifuge (Thermo Fisher Scientific, model: HeraeusTM PicoTM 17 )
Sorvall refrigeration Centrifuge (Thermo Fisher Scientific, model: SorvallTM ST 16R )
BD FACS Aria III (BD, model: FACSAriaTM III )
High Content Screening System (PerkinElmer, model: Opera PhenixTM )
Water bath (Grant Instruments, model: GD100 )
UV cross-linking instrument (Shanghai SIGMA High-tech, model: SH4 )
Bio-Rad vacuum blotter (Bio-Rad Laboratories, model: Model 785 )
Multifunctional molecular hybridization oven (UVP, model: HM-4000 )
ImageQuant LAS4000 mini (GE Healthcare, model: ImageQuant LAS 4000 mini )
Plastic film sealing machine (Shanghai Mingwei, model: F-400 )
Biomek NXP (Beckman Coulter, model: Biomek NXP )
Microplate reader (Autobio, model: PHOmo )
Orion II Microplate Lumimometer (Titertek-Berthold, model: Orion II )
Electrophoresis apparatus (Bio-Rad Laboratories, catalog number: 1645050 )
LightCycler® 96 (Roche Molecular Systems, model: LightCycler® 96 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zheng, J., Cao, J. and Yuan, Q. (2018). Sleeping Beauty Transposon-based System for Rapid Generation of HBV-replicating Stable Cell Lines. Bio-protocol 8(13): e2908. DOI: 10.21769/BioProtoc.2908.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vitro model
Microbiology > Microbe-host interactions > Virus
Cell Biology > Cell structure > Chromosome
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,909 | https://bio-protocol.org/exchange/protocoldetail?id=2909&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA Immunoprecipitation (RIP) Sequencing of Pri-miRNAs Associated with the Dicing Complex in Arabidopsis
ZL Ziwei Li
SZ Songxiao Zhong
WW Wenye Wu
BZ Binglian Zheng
Published: Jul 5, 2018
DOI: 10.21769/BioProtoc.2909 Views: 6783
Edited by: Amey Redkar
Reviewed by: Marisa Rosa
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
RNA immunoprecipitation (RIP) is an antibody-based technique used to map in vivo RNA-protein interactions. DBR1, an RNA debranching enzyme, is responsible for the debranching of lariat RNA, for the degradation and turnover of lariat RNAs. It is well known that primary miRNA (Pri-miRNA) is recognized and further processed into mature miRNA by the Dicing complex mainly composed of DCL1 and HYL1. Due to the low abundance of pri-miRNAs, RIP followed qRT-PCR has been widely used to evaluate the binding efficiency of the Dicing complex with pri-miRNAs in previous studies. Therefore, the genome-wide evaluation of the Dicing complex with pri-miRNAs is lacking. With the improvement of high-throughput sequencing technologies, we successfully used RIP-seq to compare the binding efficiency of the Dicing complex with pri-miRNAs between wild-type and the dbr1-2 mutant in our recent study. In this protocol, we provide a detailed description of RIP-seq using GFP-trap beads in HYL1-YFP and DCL1-YFP transgenic plants between two different genotypes. This method can be used to assess the binding of pri-miRNAs with the Dicing complex in Arabidopsis, and it can be applied to other RNA binding proteins in plants.
Keywords: DBR1 RIP Pri-miRNA The Dicing complex
Materials and Reagents
RNase-free pipette tips
RNase-free Eppendorf tubes (Safe-Lock Tubes, Eppendorf, catalog number: 0030120086 )
50 ml and 15 ml RNase-free Falcon tubes (Corning Company)
Miracloth (Merck, catalog number: 475855-1R )
Paper towels
Fresh inflorescences including all buds and open flowers together (see Figure 1) of proHYL1::YFP-HYL1/Col-0, proHYL1::YFP-HYL1/dbr1-2, proDCL1::DCL1-YFP/Col-0, proDCL1::DCL1-YFP/dbr1-2 plants grown in 16 h/8 h light/dark condition, 22 °C
Figure 1. A mature plant with the position of the tissue used in this method indicated by a red rectangle. Inflorescences were collected freshly. In general, it is better to use the inflorescences from primary shoot for this experiment.
Liquid nitrogen
Ice
37% formaldehyde (Sinopharm Chemical Regent, catalog number: 10010018 , store in the dark)
Diethy pyrocarbonate (DEPC) (Sigma-Aldrich, catalog number: D5758 )
GFP-Trap agarose beads (Chromotek, catalog number: gta-20 )
Protein A agarose/Salmon Sperm DNA (Merck, Upstate, catalog number: 16-157 )
RNase inhibitor (Promega, catalog number: N2611 )
RQ1 DNase I (Promega, catalog number: M6101 )
Glycogen (Thermo Fisher Scientific, catalog number: R0551 )
Proteinase K (Thermo Fisher Scientific, catalog number: EO0491 )
SuperScript IV (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18090200 )
Taq DNA polymerase (Takara Bio, catalog number: R500Z )
dNTP (Thermo Fisher Scientific, catalog number: R0181 )
Oligo dT (Thermo Fisher Scientific, catalog number: SO132 )
DTT (Thermo Fisher Scientific, catalog number: R0861 )
Acidic Phenol:Chloroform
Chloroform (Acros Organics, catalog number: 423555000 )
Acidic Phenol (Sangon Biotech, catalog number: A504195 )
Ethanol (Acros Organics, catalog number: 397690010 )
Agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500100 )
PMSF (Sigma-Aldrich, catalog number: P7626 )
Protease Inhibitor Cocktail (Roche Diagnostics, catalog number: 11873580001 )
Illumina TruSeq Stranded Total RNA HT Sample Prep Kit (P/N15031048)
MgCl2 (Sangon Biotech, catalog number: MB0331 )
CaCl2 (Sangon Biotech, catalog number: CT1330 )
Glycine (Sangon Biotech, catalog number: A610235 )
EDTA (Sangon Biotech, catalog number: A100105 )
NaAc (Sangon Biotech, catalog number: ST0827 )
Sucrose (Sangon Biotech, catalog number: SB0498 )
HEPES (Sangon Biotech, catalog number: H0511 )
Tris (Sangon Biotech, catalog number: A600194 )
SDS (Sigma-Aldrich, catalog number: L5750 )
NaCl (Sangon Biotech, catalog number: A501218 )
Ficoll (Sigma-Aldrich, catalog number: F2637 )
Dextran T40 (Sangon Biotech, catalog number: DB0374 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Primers used in Figure 3:
Pri-miR156a-F: CAAGAGAAACGCAAAGAAACTGACAG
Pri-miR156a-R: AAAGAGATCAGCACCGGAATCTGACAG
Pri-miR158a-F: GTGATGACGCCATTGCTCTTT
Pri-miR158a-R: TGTGACTTTAGATGCCCTTGTTCA
Pri-miR159a-F: GGAGCTCTACTTCCATCGTCA
Pri-miR159a-R: CCACGTTCTCATCAAAACTTTC
Pri-miR166a-F: GACTCTGGCTCGCTCTATTCA
Pri-miR166a-R: TGGTCCGAAGACGCTAAAAC
Pri-miR167a-F: GAAGCTGCCAGCATGATCTA
Pri-miR167a-R: GGGTTTATAGAAGGGTGCGA
Pri-miR168aF: GCCTTGCATCAACTGAAT
Pri-miR168aR: CAAACAAAAGGAGACTAAAGA
Pri-miR169aF: TGGGTATAGCTAGTGAAACGCG
Pri-miR169aR: CCTTAGCTTGAGTTCTTGCGA
Pri-miR171aF: CCGCGCCAATATCTCAGTA
Pri-miR171aR: TGTCTCCATTTCAACACACACA
Pri-miR172aF: ATCTGTTGATGGACGGTGGT
Pri-miR172aR: AATAGTCGTTGATTGCCGATG
Pri-miR319aF: GAGATAGAGAGTTGAACAAATTCTTC
Pri-miR319aR: GTATCCATGATAGTTGAGAAATTTGC
Honda Buffer (see Recipes)
Nuclei Lysis Buffer(see Recipes)
ChIP Dilution Buffer (see Recipes)
Binding/Washing Buffer (see Recipes)
RIP Elution Buffer (see Recipes)
Equipment
Pipettes (Gilson Company)
Fume hood
Vacuum Pump (Shanghai SENCO Company, model: SHB-3 )
Microcentrifuge (Thermo)
Vortexer (VWR Company)
Mortar and Pestle (Fisher)
-80 °C Freezer (Thermo)
Rotator (Haimen Kylin-Bell Lab Instruments, catalog number: KB-3-D )
Mini Gel Electrophoresis Systems (Tanon Company)
ChIP-grade Sonifier (Diagenode Bioruptor)
Illumina HiSeq 2000 (Shanghai Genegy Company)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Li, Z., Zhong, S., Wu, W. and Zheng, B. (2018). RNA Immunoprecipitation (RIP) Sequencing of Pri-miRNAs Associated with the Dicing Complex in Arabidopsis. Bio-101: e2909. DOI: 10.21769/BioProtoc.2909.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA > RNA-protein interaction
Molecular Biology > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
291 | https://bio-protocol.org/exchange/protocoldetail?id=291&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Hemoglobin
RG Renaud Grépin
GP Gilles Pagès
Published: Vol 2, Iss 22, Nov 20, 2012
DOI: 10.21769/BioProtoc.291 Views: 18712
Original Research Article:
The authors used this protocol in Mar 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2012
Abstract
This protocol allows to measure the levels of intratumoral hemoglobin from human or rodent fresh samples but also frozen tumors. The advantage of this method is to use very few microliters of biological material for hemoglobin and the protocol is carried out quickly.
Keywords: Cancer Angiogenesis Resistance to treatment
Materials and Reagents
Fresh or frozen tumor tissues
Extraction buffer (Life Technologies, catalog number: FNN0011 )
Human hemoglobin (Sigma-Aldrich, catalog number: H7379 )
Drabkin's reagent (Sigma-Aldrich, catalog number: D5941 )
Brij 35 Solution 30% (Sigma-Aldrich, catalog number: B4184 )
Antifoam Y-30 Emulsion (Sigma-Aldrich, catalog number: A5758 )
BCA protein quantification kit (Interchim, catalog number: MP2920 )
Extaction buffer
Equipment
Homogenizer such as Precellys (Ozyme BER1011S, France) or ultraturax
96 wells plates (DUTSCHER SCIENTIFIC, catalog number: 047632 )
Luminoskan (Thermo Fisher Scientific, catalog number: 5210470 )
Centrifuges
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Grépin, R. and Pagès, G. (2012). Measurement of Hemoglobin. Bio-protocol 2(22): e291. DOI: 10.21769/BioProtoc.291.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,910 | https://bio-protocol.org/exchange/protocoldetail?id=2910&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phenol-based Extraction of RNA from Chlamydomonas reinhardtii
Emanuel Sanz-Luque
AM Amaury de Montaigu
Published: Jul 5, 2018
DOI: 10.21769/BioProtoc.2910 Views: 5930
Edited by: Adam Idoine
Reviewed by: Antoine Danon
Download PDF
Ask a question
Favorite
Cited by
Abstract
RNA extraction is a basic procedure in molecular biology and a wide variety of commercial kits are available. Some of these kits have been successfully used in Chlamydomonas. However, in some cases RNA quality and quantity may be dramatically reduced depending on the strains and/or the conditions where cells were grown or treated. Phenol-based protocols are the most robust methods to obtain both high quantity and quality RNA from any strain of this alga grown in any condition. Here, we describe an easy and cheap protocol using phenol but avoiding the acute toxicity of guanidine isothiocyanate present in the commercial phenol-based mixtures.
Keywords: RNA DNase treatment Phenol extraction Chlamydomonas
Materials and Reagents
Gloves
Pipette tips
2 ml microcentrifuge tubes
Liquid nitrogen (N2)
SDS 20%
Water-saturated Phenol (pH 4.5) (Amresco, catalog number: 0981-400ML )
Chloroform:Isoamyl Alcohol (24:1) (Amresco, catalog number: X205-450ML )
Chloroform (Sigma-Aldrich, catalog number: 372978 ) (store at 4 °C)
8 M Lithium Chloride (LiCl, store at 4 °C)
70% and 100% ethanol (store at 4 °C)
Nuclease-free water
TURBOTM DNase (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM2238 )
3 M Sodium Acetate
Agarose
Extraction Buffer (see Recipes)
Phenol (pH 4.5):Chloroform:Isoamyl Alcohol (see Recipes) (store at 4 °C)
Equipment
Pipettes
Autoclave
Centrifuge
Nanodrop (Thermo Fisher Scientific, model: NanoDropTM 1000 , catalog number: ND-1000)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant molecular biology > RNA
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,911 | https://bio-protocol.org/exchange/protocoldetail?id=2911&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bacterial Microcolonies in Gel Beads for High-throughput Screening
Yolanda Schaerli
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2911 Views: 8387
Edited by: Elizabeth Libby
Reviewed by: Pierre-Yves ColinBeatrice Li
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
High-throughput screening of a DNA library expressed in a bacterial population for identifying potentially rare members displaying a property of interest is a crucial step for success in many experiments such as directed evolution of proteins and synthetic circuits and deep mutational scanning to identify gain- or loss-of-function mutants.
Here, I describe a protocol for high-throughput screening of bacterial (E. coli) microcolonies in gel beads. Single cells are encapsulated into monodisperse water-in-oil emulsion droplets produced with a microfluidic device. The aqueous solution also contains agarose that gelates upon cooling on ice, so that solid gel beads form inside the droplets. During incubation of the emulsion, the cells grow into monoclonal microcolonies inside the beads. After isolation of the gel beads from the emulsion and their sorting by fluorescence activated cell sorting (FACS), the bacteria are recovered from the gel beads and are then ready for a further round of sorting, mutagenesis or analysis. In order to sort by FACS, this protocol requires a fluorescent readout, such as the expression of a fluorescent reporter protein. Measuring the average fluorescent signals of microcolonies reduces the influence of high phenotypic cell-to-cell variability and increases the sensitivity compared to the sorting of single cells. We applied this method to sort a pBAD promoter library at ON and OFF states (Duarte et al., 2017).
Keywords: High-throughput screening Microcolonies Microdroplets Gel beads Directed evolution Combinatorial libraries Synthetic biology
Background
Fluorescence activated cell sorting (FACS) has an unmatched screening throughput of > 107 events/h (Davies, 2012). However, sorting of single cells according to their fluorescence by FACS to screen libraries of synthetic circuits (Schaerli and Isalan, 2013) is often hampered by high phenotypic cell-to-cell variability. Alternatively, it is possible to sort small cell colonies (microcolonies) contained in hydrogel beads (Weaver et al., 1991; Sahar et al., 1994; Zengler et al., 2002; Meyer et al., 2015). Beads with a diameter of approximately up to 50 μm can be sorted by FACS (Weaver et al., 1991; Sahar et al., 1994; Zengler et al., 2002; Fischlechner et al., 2014; Duarte et al., 2017). The microcolonies in the beads are monoclonal, if just a single cell per bead is initially encapsulated, and that cell then grows to a microcolony inside the bead. Highly monodisperse gel beads can be produced in water-in-oil emulsion droplets generated on a microfluidic device (Theberge et al., 2010).
This protocol describes the generation of 1% agarose gel beads (diameter ~50 µm) harboring bacterial microcolonies using microfluidics and their sorting by FACS to isolate the variants with the desired properties (Duarte et al., 2017). It is possible to sort for variants that take on different states (e.g., ON and OFF) under different conditions (e.g., different inducer concentrations) by performing multiple sequential rounds of this protocol. With this method, we sorted cells expressing a fluorescent reporter protein, while it could also be amended to screen for other readouts. If combined with a strategy to maintain fluorescent reaction products in the bead (Fischlechner et al., 2014), it can be used to screen for enzyme or pathway activities. Another option is to co-encapsulate sensor cells that fluoresce upon the production of a compound of interest (Meyer et al., 2015). It is also possible to assay cell growth by relying on the light scatter of the microcolonies or by staining them with a fluorescent biomass indicator dye (e.g., staining nucleic acids or proteins) (Weaver et al., 1991). When encapsulating multiple cells per bead, cell-cell interactions could also be screened for. Thus, the described protocol is broadly applicable in biology.
Materials and Reagents
PTFE tubing with inner diameter of 0.8 mm and outer diameter of 1.6 mm (Cole-Parmer Instrument, catalog number: EW-06407-41 )
Stainless steel catheter couplers, 20 ga x 15 mm, non-sterile (Instech laboratories, catalog number: SC20/15 )
CellTrics filters, 50 µm yellow (Sysmex, catalog number: 04-0042-2317 )
1.5 ml micro tubes (for example SARSTEDT, catalog number: 72.706.400 )
Falcon 5 ml round-bottom tubes, disposable, polystyrene (Corning, Falcon®, catalog number: 352054 )
1.4 ml Non coded Screw Cap tubes U-bottom Bulk (Micronic, catalog number: MP32062 )
Adhesive tape
Aluminium foil
Kimwipes (KCWW, Kimberly-Clark, catalog number: 34120 )
Optional: microscope slides for droplets analysis (for example Kova Glasstic Slide 10 With Counting Grids, Kova International, catalog number: 87144E )
Gloves
Small resealable plastic bag
2 SGE Gas Tight Syringes, Fixed Luer Lock, volume 100 µl (Trajan Scientific, SGE Analytical Science, catalog number: 005229 )
SGE Gas Tight Syringe, Fixed Luer Lock, volume 5 ml (Trajan Scientific, SGE Analytical Science, catalog number: 008762 )
Hamilton needles 20 gauge, Kel-F Hub NDL, 2 in, point style 3 (Hamilton, catalog number: 90520 )
E. coli (or other bacterial) cells harboring the library to be screened
Ice
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Mineral oil (Sigma-Aldrich, catalog number: M5904 )
3M Novec 7500 Engineered Fluid (known as HFE-7500 oil) (3M, catalog number: Novec 7500 )
5% (w/w) 008-FluoroSurfactant in HFE7500 (Ran Biotechnologies, catalog number: 008-FluoroSurfactant-5wtH-20G ) (Protect from light)
Ultra-low Gelling Temperature agarose, type IX-A (Sigma-Aldrich, catalog number: A2576 )
1H,1H,2H,2H-Perfluoro-1-octanol (PFO), 97% (Sigma-Aldrich, catalog number: 370533 )
Petri dishes (14 cm) (Thermo Fisher Scientific, NuncTM, catalog number: 249964 )
Glass beads (2 mm) (Sigma-Aldrich, catalog number: Z273627 )
Syringe Filters 0.22 µm pore size, 25 mm diameter (Corning, catalog number: 431219 )
SYTO 9 Green Fluorescent Nucleic Acid Stain (Thermo Fisher scientific, catalog number: S34854 )
Ammonium sulfate ((NH4)2SO4) (Sigma-Aldrich, catalog number: 09978 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: 60356 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5379 )
Iron (II) sulfate heptahydrate (FeSO4·7H2O) (Sigma-Aldrich, catalog number: 215422 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 221473 )
Thiamine hydrochloride (Sigma-Aldrich, catalog number: T1270 )
Casamino acids (BD, BactoTM, catalog number: 223050 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M2643 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 258148 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S8045 )
Tryptone (BD, BactoTM, catalog number: 211705 )
Yeast extract (BD, BactoTM, catalog number: 212750 )
Kanamycin sulfate (Sigma-Aldrich, catalog number: K4000 )
Medium for the bacteria (in our case M63 medium, see Recipes) containing the appropriate antibiotic and inducer concentrations
1x phosphate-buffered saline (PBS) (see Recipes)
LB medium (see Recipes)
LB-Agar plates containing the appropriate antibiotic (see Recipes)
Equipment
Microfluidic devices to produce water-in-oil droplets (diameter 20-50 µm)
Note: For example, PDMS devices purchased from Wunderlichips GmbH (As we do. The design of the device is chosen by the customer. If you would like to purchase devices with our design, please refer to this publication when contacting Wunderlichips.). Alternatively, the devices can be prepared as previously described in detail, including the surface modification required to render them hydrophobic (Devenish et al., 2013). The design file of the device used in this study (40 µm flow-focusing channel) is available from the author’s website: (Figure 1).
Figure 1. Design of the microfluidic device used for droplet generation. The device contains an inlet for the oil phase, an inlet for the aqueous phase (bacteria, agarose, medium) and an exit outlet. The droplets are formed at the flow-focusing geometry (picture inset). For this protocol, the channel width at the flow focusing part is 40 µm and the height of the channels is also 40 µm. Using this device, droplets with a diameter of 40-50 µm can be produced. Scale bar = 40 µm.
Syringe pumps (for example Aladdin infusion pump, World Precision Instruments, catalog number: AL300-220 )
Inverted light microscope (for example Leica Microsystems, model: Leica DM IL LED ) (A conventional microscope is also possible, but the tubing of the microfluidic device might interfere with the optics.)
Fluorescence activated cell sorter (for example BD, model: FACSAriaTM III )
High-speed camera (for example Teledyne DALSA, model: Genie Nano M640 Mono, catalog number: G3-GM10-M0640 )
Note: Standard cameras are not fast enough to observe/record continuous droplet formation. However, if the exposure time can be adjusted to ~50 µsec, droplet formation can be monitored with single pictures.
Tubing cutter (Cole-Parmer, catalog number: EW-06438-10 )
2 Hot/cold compresses (from the pharmacy or grocery store)
Lab jack (Bochem Instrumente, catalog number: 11020 )
Note: Alternatively some box of the correct height to place the pump with the aqueous syringe at the height of the microscope stage.
-80 °C freezer
4 °C fridge
Set of pipettes covering 0.5-1,000 µl (for example from Gilson)
Pliers
Tweezers
Scissors
37 °C incubator
Autoclave
Benchtop centrifuge for 1.5 ml tubes
Spectrophotometer, nanodrop or plate reader to measure the absorbance of bacterial cultures
Thermoblock for 1.5 ml tubes
Software
Software to control the high-speed camera (for example Labview or Common vision blox, Stemmer imaging)
Image processing program, such as ImageJ or Photoshop
Software to control the FACS (for example BD FACSDIVA)
Flow cytometry analysis software such as FlowJo (LLC)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Schaerli, Y. (2018). Bacterial Microcolonies in Gel Beads for High-throughput Screening. Bio-protocol 8(13): e2911. DOI: 10.21769/BioProtoc.2911.
Download Citation in RIS Format
Category
Microbiology > Heterologous expression system > Escherichia coli
Molecular Biology > DNA > Mutagenesis
Systems Biology > Genomics > Screening
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,912 | https://bio-protocol.org/exchange/protocoldetail?id=2912&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Intact Vacuoles from Petunia Petals and Extraction of Sequestered Glycosylated Phenylpropanoid Compounds
Oded Skaliter *
JR Jasmin Ravid*
AC Alon Cna'ani*
GD Gony Dvir
RK Rafael Knafo
AV Alexander Vainstein
*Contributed equally to this work
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2912 Views: 6644
Edited by: Amey Redkar
Reviewed by: Ben SpitzerGongjun Shi
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Plant vacuoles are the largest compartment in plant cells, occupying more than 80% of the cell volume. A variety of proteins, sugars, pigments and other metabolites are stored in these organelles (Paris et al., 1996; Olbrich et al., 2007). Flowers produce a variety of specialized metabolites, some of which are unique to this organ, such as components of pollination syndromes, i.e., scent volatiles and flavonoids (Hoballah et al., 2007; Cna'ani et al., 2015). To study the compounds stored in floral vacuoles, this compartment must be separated from the rest of the cell. To enable isolation of vacuoles, protoplasts were first generated by incubating pierced corollas with cellulase and macrozyme enzymes. After filtering and several centrifugation steps, protoplasts were separated from the debris and damaged/burst protoplasts, as revealed by microscopic observation. Concentrated protoplasts were lysed, and vacuoles were extracted by Ficoll-gradient centrifugation. Vacuoles were used for quantitative GC-MS analyses of sequestered metabolites. This method allowed us to identify vacuoles as the subcellular accumulation site of glycosylated volatile phenylpropanoids and to hypothesize that conjugated scent compounds are sequestered in the vacuoles en route to the headspace (Cna'ani et al., 2017).
Keywords: Vacuole Protoplast Phenylpropanoid volatile Glycoside Petal Petunia
Background
Plant vacuoles occupy up to 80% of the cellular volume in plant cells. These organelles are essential for plant growth and development, with varied functions throughout the plant's life. Vacuoles compartmentalize different components, such as proteins, sugars, ions and specialized metabolites, and are involved in the plant's response to different developmental and environmental signals, e.g., stomatal opening, adaptation to cold, defense against herbivores and floral pigmentation (Shitan and Yazaki, 2013). Specific transporters are employed by vacuoles to allow penetration of inorganic ions and hydrophilic metabolites through the lipid bilayer membrane of the tonoplast (Schneider et al., 2012; Liu et al., 2015).
Specialized metabolites, including floral scent volatiles, are often produced and/or accumulated in sink organs, such as flower petals, glandular trichomes, root bark, etc. (Hanhineva et al., 2008; Kortbeek et al., 2016; Lashbrooke et al., 2016). Volatile phenylpropanoids and other specialized metabolites, e.g., flavonoids, monoterpenes, betalains, alkaloids and brassinosteroids, undergo various postproduction modifications, such as glycosylation, methylation and acylation. These modifications increase their stability, enable transport, lower their toxicity by blocking reactive groups and enhance their water solubility, thus enabling storage in subcellular compartments (Bowles et al., 2005; Dean et al., 2005). Glycosylated scent compounds are generally regarded as storage forms or precursors for the emission of aglycones at the appropriate time or stage of plant or organ development (Rambla et al., 2014). Floral scent has been studied extensively in the model plant Petunia. However, little is known about the intracellular fate of scent compounds. To this end, based on several previously described protocols from different plants/tissues (Robert et al., 2007; Fontes et al., 2010; Faraco et al., 2011 and 2014; Pérez-Díaz et al., 2014; Shen et al., 2014; Cna'ani et al., 2017), we generated a procedure for vacuolar isolation from petunia petals. Using a GC-MS–based protocol for isolating glycosylated volatiles from petal vacuoles, we were able to reveal a mechanism used by flowers to sequester volatile phenylpropanoids in vacuoles prior to their developmentally regulated emission to the environment.
Materials and Reagents
Aluminum foil
Cell strainer 100 μm nylon (Corning, catalog number: 431752 )
Centrifuge tube 15 ml (Corning, catalog number: 430790 )
Centrifuge tube 50 ml (Corning, catalog number: 430828 )
Corning® bottle-top vacuum filter system (Corning, catalog number: 430796 )
Cover slides 24 x 50 mm (Knittel Glass, catalog number: VD1 2450 Y100A )
Cap for 4ml vial (J.G. Finneran, catalog number: 5360-13 )
Finnpipette® pipette tips 5 ml (Sigma-Aldrich, Thermo Fisher, catalog number: P2924 )
Glass insert (J.G Finneran, catalog number: 401BS-530 )
Microscope slides 3 x 1 inch (Knittel Glass, catalog number: VA31100 001FKB )
Non-sterile scalpel blades (Bar Naor, catalog number: BN10011-00 )
Paper sheets (Romical, catalog number: 322-05004040 )
PARAFILM® M sealing film (BRAND, catalog number: 701605 )
Pasteur pipettes open tip 150 mm (Hilgenberg, catalog number: 3150101 )
Petri dishes 90 x 15 mm (MINIPLAST, catalog number: 820-090-01-017 )
Safe-Lock Tubes, 1.5 ml, Eppendorf QualityTM, colorless (Eppendorf, catalog number: 0030120086 )
Safe-Lock Tubes, 2.0 ml, Eppendorf QualityTM, colorless (Eppendorf, catalog number: 0030120094 )
Cap for 2 ml Vial (CHROMSERVIS, catalog number: 1076-8002-C )
Silicone tubing 8 x 12 mm (Chen Samuel, catalog number: 054080120 )
Sterile pipette 1 ml (Alexred, catalog number: ALP ON1E1 )
Vial 2 ml (J.G Finneran, catalog number: 32008-1232 )
Vial 4 ml (J.G. Finneran, catalog number: 34013-1545 )
Ammonium nitrate (Sigma-Aldrich, catalog number: 256064 )
Calcium chloride dihydrate (Merck, catalog number: 102382 )
Cellulase R10 (Duchefa Biochemie, catalog number: C8001 )
D-Mannitol (Sigma-Aldrich, catalog number: M4125 )
Ethylenediaminetetraacetic acid disodium salt dihydrate (Sigma-Aldrich, catalog number: E6635 )
Ficoll® PM 400 (Sigma-Aldrich, catalog number: F4375 )
Fluorescein diacetate solution (Sigma-Aldrich, catalog number: F7378 )
Gamborg’s B-5 Basal Salt Mixture (Sigma-Aldrich, catalog number: G5768 )
HEPES (Sigma-Aldrich, catalog number: H7006 )
Hydrochloric acid 37% (w/w) (Bio Basic, catalog number: HC6025 )
Isobutyl benzene (Sigma-Aldrich, catalog number: 113166 )
KCl (Sigma-Aldrich, catalog number: P4504 )
Macrozyme R10 (Duchefa Biochemie, catalog number: M8002 )
MES sodium salt (Sigma-Aldrich, catalog number: M3885 )
Methyl alcohol (Sigma-Aldrich, catalog number: 322415 )
n-Hexane HPLC (Biosolve, catalog number: 082906 )
Sodium citrate tribasic dihydrate (Sigma-Aldrich, catalog number: C8532 )
Sodium hydroxide (Sigma-Aldrich, catalog number: 221465 )
Sodium hypochlorite 5% (Romical, catalog number: 73-7586-1400 )
Sodium phosphate dibasic (Sigma-Aldrich, catalog number: 255793
Sodium phosphate dibasic heptahydrate (Sigma-Aldrich, catalog number: S2429 )
Sodium phosphate monobasic monohydrate (Sigma-Aldrich, catalog number: S3522 )
Sterile double-distilled water (DDW)
Sucrose (DAEJUNG CHMICAL & METALS, catalog number: 7501-4400 )
Viscozyme (cellulolytic enzyme mixture) (Sigma-Aldrich, catalog number: V2010 )
TEX buffer (see Recipes)
Enzyme solution (see Recipes)
Suspension buffer (see Recipes)
0.5 M EDTA, pH 8 (see Recipes)
30% Ficoll (see Recipes)
5% Ficoll (see Recipes)
0.2 M Sodium phosphate, pH 8 (see Recipes)
Lysis buffer (see Recipes)
1 M Mannitol (see Recipes)
0.2 M Sodium phosphate, pH 7.5 (see Recipes)
Vacuole buffer (0% Ficoll) (see Recipes)
80% Methyl alcohol (see Recipes)
0.1 M Citrate (see Recipes)
0.2 M Sodium phosphate dibasic (see Recipes)
Citrate phosphate buffer, pH 5.4 (see Recipes)
Isobutyl benzene 80 µg/ml (see Recipes)
Hexane-standard solution (see Recipes)
Equipment
Scalpel handle #3 (Bar Naor, catalog number: BN400-3-WH )
Beaker 400 ml (Isolab Laborgeräte, catalog number: 025.01.400 )
Beaker 600 ml (Isolab Laborgeräte, catalog number: 025.01.600 )
FinnpipetteTM F3 variable volume single-channel pipettes 100-1,000 µl (Thermo Fisher Scientific, catalog number: 4640060 )
FinnpipetteTM F3 variable volume single-channel pipettes 20-200 µl (Thermo Fisher Scientific, catalog number: 4640050 )
FinnpipetteTM F3 variable volume single-channel pipettes 2-20 µl (Thermo Fisher Scientific, catalog number: 4640030 )
FisherbrandTM one-hole rubber stopper number 13 (Fisher Scientific, catalog number: 14-135S )
Centrifuge 5430 R (Eppendorf, model: 5430 R , catalog number: 022620603)
Centrifuge 5810 R (Eppendorf, model: 5810 R , catalog number: 5811000320)
Flow hood
Hemocytometer XB.K25 0.10 mm 1/400 mm2 (QIUJING, catalog number: 02270113 )
Incubator at 37 °C
Kenzan flower arrangement needle point holder 1.5 inch
Light microscope (Olympus, model: BH-2 )
Orbital shaker (Thermo Fisher Scientific, model: FormaTM 3250 )
SpeedVac (Thermo Fisher Scientific, Savant, model: SVC-100H )
Standard scissors curved 12 cm (Bar Naor, catalog number: BN11-011-12 )
Stopcock, straight PP & HDPE, OD 8 mm (KARTELL, catalog number: 374 )
Tissulyzer II (QIAGEN, catalog number: 85300 )
TransferPette® S, variable 500-5,000 µl (BRAND, catalog number: 704782 )
Tweezers curved #7 (Bar Naor, catalog number: BN-7-W )
Tweezers extra fine #5 (Bar Naor, catalog number: BN78320-5 )
Ultrasonic cleaner (Cole-Parmer, model: 8845-6 )
Vacuum filter flask 2 L (Corning, catalog number: 5340-2L )
Vacuum pump (KNF, catalog number: N 840.3 FT.18 )
Vortex-genie 2 (Scientific industries, model: Vortex-Genie 2 , catalog number: G 560E)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Skaliter, O., Ravid, J., Cna'ani, A., Dvir, G., Knafo, R. and Vainstein, A. (2018). Isolation of Intact Vacuoles from Petunia Petals and Extraction of Sequestered Glycosylated Phenylpropanoid Compounds. Bio-protocol 8(13): e2912. DOI: 10.21769/BioProtoc.2912.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Metabolite profiling
Cell Biology > Organelle isolation > Vacuole
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,913 | https://bio-protocol.org/exchange/protocoldetail?id=2913&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
FRAP: A Powerful Method to Evaluate Membrane Fluidity in Caenorhabditis elegans
RD Ranjan Devkota
Marc Pilon
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2913 Views: 9293
Reviewed by: Tugsan TezilKelly H. Oh
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
FRAP (Fluorescence Recovery After Photobleaching) is probably the most direct method to investigate the dynamics of molecules in living cells. Here, we describe FRAP to quantify membrane fluidity in C. elegans. Using FRAP, we have shown that cold, glucose and exogenous saturated fatty acids can decrease the fluidity of cellular membranes in certain mutants.
Keywords: FRAP Membrane fluidity Prenylated GFP C. elegans Fatty acid PAQR-2
Background
Biological membranes, defining features of all cells, are primarily composed of phospholipids (Van Meer et al., 2008). The fatty acid species present in the phospholipid bilayer greatly influence its properties. For example, a high saturated fatty acid content increases membrane rigidity while a high unsaturated fatty acid content promotes fluidity (Pilon, 2016). The fatty acid composition of cellular membranes often shows clear correlations with the composition of dietary fats, which can be incorporated directly into phospholipids (Abbott et al., 2012; Dancy et al., 2015). However, considering that wide variations in diets exist, cells must have regulatory mechanisms that monitor and adjust membrane composition and achieve the desired membrane properties, such as fluidity, curvature, thickness, etc. Using FRAP on worms that express a prenylated GFP in intestinal cells, we have previously shown that mutants lacking PAQR-2, a homolog of the mammalian adiponectin receptors, have reduced membrane fluidity upon cultivation in the presence of glucose or on diets rich in saturated fatty acids (Svensk et al., 2016; Devkota et al., 2017). During FRAP, fluorescent molecules in a specified region are photobleached using a high-power laser and subsequent recovery of the bleached region is recorded and quantified (Reits and Neefjes, 2001). Here we describe a detailed FRAP protocol to study the fluidity of membranes in C. elegans.
Materials and Reagents
Petri dish (60 x 15 mm) with cams (SARSTEDT, catalog number: 82.1194.500 )
Microscope frosted slides 25 x 75 x 1 mm (Thermo Fisher Scientific, catalog number: 2951-001T )
Microscope cover glass 22 x 22 mm (VWR, catalog number: 631-1570 )
0.2 μm filter (polyethylenesulfone membrane, VWR, catalog number: 28145-501 )
C. elegans strains QC114 {etEx2 [(pQC09.6) glo-1p::GFP::ras-2 CAAX + (pRF4) rol-6(su1006)]} and QC129 (paqr-2[tm3410]) (Caenorhabditis Genetics Center/CGC, University of Minnesota, USA)
E. coli OP50 strain (CGC, University of Minnesota, USA)
Levamisole (Sigma-Aldrich, catalog number: L9756 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: 795488 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P2222 )
Sodium Chloride (NaCl) (Sigma-Aldrich, catalog number: 31434 )
Bacto Peptone (BD, catalog number: 211677 )
Agar Powder (VWR, catalog number: 20767.298 )
Cholesterol (Sigma-Aldrich, catalog number: C8667 )
Magnesium Sulfate (Sigma-Aldrich, catalog number: M2643 )
Calcium Chloride (Sigma-Aldrich, catalog number: C8106 )
Agarose (Sigma-Aldrich, catalog number: A9539 )
α-D-glucose (Sigma-Aldrich, catalog number: 158968-500G )
Ethanol (95%, Solveco, catalog number: 1000 )
Phosphate buffer (see Recipes)
M9 buffer (see Recipes)
Nematode Growth Media (NGM) (see Recipes)
Agarose pads (see Recipes)
Levamisole solution (see Recipes)
Equipment
Standard incubators for worm maintenance (cooled incubator by Panasonic/Sanyo, model: MIR 254 )
40x water immersion objective
Stereomicroscope (Leica Microsystems, model: Leica MZ75 )
Laser Scanning Confocal Microscope (ZEISS, model: LSM 700 )
Software
Zen 2012 SP5 software (ZEISS)
Microsoft Excel for Mac 2011
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Devkota, R. and Pilon, M. (2018). FRAP: A Powerful Method to Evaluate Membrane Fluidity in Caenorhabditis elegans. Bio-protocol 8(13): e2913. DOI: 10.21769/BioProtoc.2913.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,914 | https://bio-protocol.org/exchange/protocoldetail?id=2914&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Modified Approach for Axenic Cultivation of Spores of Fern Adiantum capillus-veneris L. with High Germination Rate
YY Yuan Ya-Ning
YS Yi Shu
JW Jin Wan-Ting
FY Fang Yu-Han
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2914 Views: 4454
Reviewed by: Shweta PanchalShankar Pant
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Spores are the primary way of spread and reproduction for ferns, a clade of seed-free vascular plants. However, no detailed protocol for ferns spore cultivation has been reported yet. Here we provide a modified approach for axenic cultivation of fern Adiantum capillus-veneris L., based on Cao’s and Li’s method (Cao, et al., 2010; Li, et al., 2013).
Our approach can be briefly divided into four steps: 1) collect spores; 2) sterilize the spores with 5% sodium hypochlorite solution and wash twice; 3) incubate the spores in liquid Knop’s medium in the dark for five days; 4) cultivate the spores on Knop's plate medium. To increase the germination rate, we constrain the sterilization time under 25 min and add dark treatment step after spore sterilization. After these modifications, the germination rate raises from 2% to 25%.
Keywords: Fern Spores cultivation Adiantum capillus-veneris L. Germination rate Axenic cultivation
Background
In the phylogenetic tree of plants, ferns are a critical clade of land plants, as they are the sister lineage of seed plants. Ferns are characteristic by their unique life cycle. Compared with seed plants, the sporophyte of ferns bear spores for spreading instead of seeds. Under favorable conditions, spores germinate to form gametophytes, in which cells on certain areas (rib) specialize into reproductive organs to produce gametes. After water-dependent fertilization, the newborn sporophyte emerge and an entire life cycle of fern completes (Li et al., 2013). Hence, to study the sexual reproduction processes and life history of ferns, spore cultivation under experimental conditions is necessary.
However, protocols available for ferns spores cultivation are insufficient. Here, we choose Adiantum capillus-veneris L. as experimental material to optimize the spore cultivation protocol, as Adiantum is a representative fern with isospory, and the cultivation system of Adiantum under lab condition has been developed by Li et al. (2013).
This protocol is also instructive for spore cultivation in other members of homosporous ferns.
Materials and Reagents
Pipette tips (Corning, AXYGEN®, catalog number: T-1000-B )
Sieve (with pore size no less than 0.20 mm, any brand)
Sterile 1.5 ml microcentrifuge tubes (Eppendorf®)
Petri dishes (NEST Biotechnology, catalog number: 715001 )
Laboratory film (Parafilm® M)
Adiantum spores
Sterilized water
NaClO (ALADDIN, catalog number: S101636-5kg )
Ca(NO3)2 (ALADDIN, catalog number: C100076-100g )
KNO3 (ALADDIN, catalog number: P111635-500g )
MgSO4 (Sigma-Aldrich, VETECTM, catalog number: V900066-500G )
KH2PO4 (Sigma-Aldrich, VETECTM, catalog number: V900041-500G )
FeCl3·6H2O (Sigma-Aldrich, catalog number: 31232-250G )
Gellan Gum (GelzanTMCM, PhytoTechnology Laboratories, catalog number: G3251 )
Knop’s medium liquid (see Recipes)
Knop’s medium solid (see Recipes)
Equipment
1 L flask (any brand)
Sterile tweezers (any brand)
Pipettes (Eppendorf®)
Autoclave (Panasonic, model: MLS-3781L-PC )
Super clean bench (Esco Micro, model: SVE-4A1 )
Centrifuge (Thermo Fisher Scientific, model: HeraeusTM PicoTM 21 )
Constant temperature and illumination intensity incubator (Beijing Luxi, model: GZX-400PY )
Stereoscopic microscope (Leica Microsystems, model: Leica DFC450 C )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yuan, Y., Yi, S., Jin, W. and Fang, Y. (2018). A Modified Approach for Axenic Cultivation of Spores of Fern Adiantum capillus-veneris L. with High Germination Rate. Bio-protocol 8(13): e2914. DOI: 10.21769/BioProtoc.2914.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > Morphogenesis
Plant Science > Plant physiology > Axenic cultivation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,915 | https://bio-protocol.org/exchange/protocoldetail?id=2915&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Mammary Gland Whole Mount Preparation and Analysis
CT Cornelia Tolg
MC Mary Cowman
ET Eva A. Turley
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2915 Views: 15162
Edited by: Vivien Jane Coulson-Thomas
Reviewed by: Sudan PuriMindy Call
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
The mammary gland undergoes extensive remodeling during pregnancy and is also subject to neoplastic processes both of which result in histological changes of the gland epithelial structure. Since the mammary tree is a complex three-dimensional structure a method is needed that provides an overview of the entire gland. Whole mounts provide this information, are inexpensive and do not require specialized equipment. This protocol describes mammary gland isolation, whole mount preparation and analysis. Mammary gland tissue, which is removed postmortem, is stained with Carmine Alum, a nuclear stain, allowing detection of epithelial structures embedded in the adipose tissue of the mammary fat pad. Stained mammary glands are imaged by light microscopy or embedded and sectioned for histological examination. Image analysis software such as Image J can be used to quantify extensity of branching complexity, epithelial structure remodeling or hyperplastic changes.
Keywords: Mammary gland Whole mount Branching morphogenesis Mammary epithelial cell Mammary tree
Background
Although development of the mammary gland begins during embryonic development and a rudimentary epithelial structure is present at birth, the epithelial mammary tree undergoes extensive expansion postnatally. In response to hormonal changes, mammary epithelial cells proliferate and invade the mammary fat pad. During pregnancy, the mammary gland epithelium undergoes further differentiation and remodeling to prepare for milk production. Subsequently, these epithelial structures involute in response to weaning. These remodeling processes are driven by hormones, growth factors, cytokines and the extracellular matrix. In addition to remodeling in response to physiological processes, the mammary gland is subject to pathological processes such as neoplastic transformation. This complex biology together with the relatively ease of isolation make the mammary gland a useful experimental model. Experimental studies analyzing mammary gland biology or neoplastic transformation often employ mouse models to quantify the effect of gene deletion or overexpression on mammary gland development, remodeling and neoplastic transformation. Mammary gland whole mounts allow routine examination of these normal and disease processes on the entire 3D epithelial structure of the mammary gland (Plante et al., 2011; Inman et al., 2015; Tucker et al., 2016 and 2017; Kolla et al., 2017; Tolg et al., 2017). Furthermore, injection of mice with potential therapeutic compounds combined with whole mount analysis allows in vivo testing of future cancer treatment strategies. This protocol provides details of the procedure starting with removal of the mammary gland and ending with image analysis. A video of mammary gland isolation, photos, figures and referenced literature make it more complete compared to existing whole mount protocol.
Materials and Reagents
Glass slide (Micro Slides Superfrost Plus) (VWR, catalog number: 48311-703 )
Micro cover glass (VWR, catalog number: 48393-081 )
Glass Pasteur pipette (VWR, catalog number: 14672-380 )
Glass Slide Staining Dish (DWK Life Sciences, WheatonTM, catalog number: 900200 )
Coplin Staining Dish (Variety Glass, catalog number: 674EMD )
50 ml Crew Cap tubes (SARSTEDT, catalog number: 62.547.254 )
Mice
100% ethanol (Greenfield Global, Commercial Alcohols, catalog number: P016EAAN )
Glacial acetic acid (Merck, catalog number: AX0073-9 )
Carmine dye: Carmin Alum (Fisher Scientific, catalog number: C579-25 )
Aluminum potassium dodecahydrate (Merck, catalog number: 101042 )
Hydrochloric acid (HCl, Sigma-Aldrich, catalog number: H1758 )
Xylene (LabChem, catalog number: LC269704 )
Permount SP15 (Fisher Scientific, catalog number: SP15-100 )
Carnoy’s solution (see Recipes)
Carmine alum solution (see Recipes)
Destaining solution (see Recipes)
Equipment
Small scissors (Delicate dissecting scissors, Fisher Scientific, FisherbrandTM, catalog number: 08-951-5 ; Sharp-pointed dissecting scissors, Fisher Scientific, FisherbrandTM, catalog number: 08-940 )
Forceps (Fisherbrand curved medium point general purpose forceps)
Chemical hood (Fisher Scientific)
Dissecting microscope with digital camera (Q color 3 camera, OLYMPUS, model: SZX 12 )
Stirring Hotplate (Fisher Scientific)
Weighing scale (Denver Instrument, model: XS-310D, catalog number: 8531.1 )
pH meter (Fisher Scientific, Accumet Research, model: AR15 , catalog number: 13-636-AR15)
Software
ImageJ: free download available at https://imagej.nih.gov/ij
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tolg, C., Cowman, M. and Turley, E. A. (2018). Mouse Mammary Gland Whole Mount Preparation and Analysis. Bio-protocol 8(13): e2915. DOI: 10.21769/BioProtoc.2915.
Download Citation in RIS Format
Category
Developmental Biology > Morphogenesis > Organogenesis
Cancer Biology > General technique > Tumor formation
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,916 | https://bio-protocol.org/exchange/protocoldetail?id=2916&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessment of Uptake and Biodistribution of Radiolabeled Cholesterol in Mice Using Gavaged Recombinant Triglyceride-rich Lipoprotein Particles (rTRL)
Anna Worthmann
CJ Clara John
JH Joerg Heeren
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2916 Views: 5194
Edited by: Andrea Puhar
Reviewed by: Nelma Pértega-GomesTim Andrew Davies Smith
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
The here described method can be used to estimate the uptake of orally provided cholesterol in mice. Briefly, mice are gavaged with radiolabeled cholesterol and 4 h later, organ distribution of the radiolabel is determined by liquid scintillation counting. The method has been applied successfully to determine dietary cholesterol handling of mice housed at different ambient temperatures
Keywords: Lipid metabolism Oral fat tolerance Cholesterol Lipid/Cholesterol biodistribution Radioactive tracer study Organ uptake
Background
Cholesterol facilitates membrane fluidity and is a precursor for steroid hormones, bile acids and vitamin D. Animals are provided with cholesterol either from the diet or by de novo synthesis. Surplus of cholesterol may be harmful as its accumulation in blood vessel walls can cause atherosclerosis. It has been shown that the activation of brown adipose tissue (BAT) by cold reduces hypercholesterolemia (Berbee et al., 2015). It was, however, unclear whether BAT activity alters acute peripheral dietary cholesterol handling. To address this question, we orally administered mice with recombinant triglyceride-rich lipoprotein particles (rTRL) labeled with [4-14C]-Cholesterol and measured the organ distribution of the radiolabel 4 h after gavage. The biodistribution of radiolabeled cholesterol in vivo has been measured before (Szigeti et al., 1972; Townsend et al., 2001). However, in these studies, the radioactive cholesterol was either supplied by the diet or injected intravenously. Furthermore, other studies have assessed the fractional cholesterol absorption rate over a longer period of time (48 and 72 h) (Zilversmit and Hughes, 1974; Turley et al., 1994), As we were especially interested in the plasma clearance and the cholesterol uptake into the BAT after cold exposure, we chose to analyze the organs after a rather short period of time (4 h). Instead of applying an oil gavage, we used rTRL since the oil gavage resembles a rather unphysiologic condition (very high amount of lipids) but not a postprandial situation. Additionally, supplying the tracer with the diet is not suitable in cold-treated mice as they eat twice as much as when kept at warm ambient temperatures (30 °C).
Materials and Reagents
Pipette tips
Glass Vials 50 x 14 mm with plastic srew cap 5 ml (schuett-biotec, catalog number: 3563143 )
Eppendorf Safe-Lock Tubes (Eppendorf, catalog number: 022363352 )
15 ml Tube PP (SARSTEDT, catalog number: 62.554.502 )
Pico Prias Vial 6 ml (PerkinElmer, catalog number: 6000193 )
Parafilm (IDL, catalog number: 2801310131 )
Omnifix-F Syringes 1 ml (B. Braun Medical, catalog number: 9161406V )
Animal Feeding needles (Fine Science Tools, catalog number: 18061-20 )
100 Sterican Hypodermic needle (B. Braun Medical, catalog number: 4657519 )
C57BL/6 Mice (Charles River)
Intralipid® 20% (Baxter, catalog number: 2B6064 )
Methanol (Carl Roth, ROTISOLV®, catalog number: 7583.1 )
Chloroform (Carl Roth, ROTISOLV®, catalog number: 4432.1 )
NaCl 0.9% (B. Braun Medical, catalog number: 817403 )
Cholesterol, [4-14C]-, 50 µCi (1.85 MBq) (PerkinElmer, catalog number: NEC018050UC )
EDTA solution (Sigma-Aldrich, catalog number: E7889-100ml )
Solvable (PerkinElmer, catalog number: 6NE9100 )
Ketamin 10% (WDT, catalog number: 793-319 )
Rompun® 2% (Bayer)
Lipid solution (see Recipes)
Anesthesia (see Recipes)
Equipment
Aquasafe 500 Plus (Gardner Denver Medical, ZINSSER ANALYTIC, model: Aquasafe 500 Plus, catalog number: 1008500 )
Balance (Sartorius, catalog number: BP 410 S )
Pipette (Eppendorf, model: Research® plus, catalog number: 3123000063 ) with tips
HeraeusTM FrescoTM 21 Microcentrifuge, Max. RCF: 21,100 x g (Thermo Fisher Scientific, model: HeraeusTM FrescoTM 21 , catalog number: 75002555)
Nitrogen-Stream from Nitrogen bottle (Flow rate 1.5 L/min)
Sonifier (Branson, model: Digital Sonifier® 450 )
Sonifier Horn Double Step 1/8'' Microtip (Branson, catalog number: 101-063-212 )
Vortexer (IKA, model: MS 1 )
Climate chamber (Memmert, model: HPP750life )
Beta-Counter (PerkinElmer, model: Tri-Carb® 2810TR )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Worthmann, A., John, C. and Heeren, J. (2018). Assessment of Uptake and Biodistribution of Radiolabeled Cholesterol in Mice Using Gavaged Recombinant Triglyceride-rich Lipoprotein Particles (rTRL). Bio-protocol 8(13): e2916. DOI: 10.21769/BioProtoc.2916.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Lipid transport
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,917 | https://bio-protocol.org/exchange/protocoldetail?id=2917&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Brain Tissue Culture of Per2::Luciferase Transgenic Mice for ex vivo Bioluminescence
Nora L. Salaberry
JM Jorge Mendoza
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2917 Views: 6090
Edited by: Oneil G. Bhalala
Reviewed by: Karthik Krishnamurthy
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
In circadian research, it is essential to be able to track a biological rhythm for several days with the minimum perturbation for the organisms or tissues. The use of transgenic mice lines, in which the luciferase reporter is coupled to a molecular clock protein (here PERIOD2), gives us the opportunity to follow the circadian activity in different tissues or even single clock cells for days without manipulation. This method creates sections using a mouse brain matrix, which allows us to obtain several brain samples quickly at a single time point.
Keywords: Bioluminescence Per2::Luciferase Brain Mouse matrix Tissue culture Rhythm Circadian
Background
Circadian rhythms are behavioral or molecular changes that follow roughly 24 h-cycles and are sustained without any external cue. In mammals, locomotor activity, body temperature and hormone release are examples of circadian rhythms which are under the control of the suprachiasmatic nucleus (SCN) clock located in the hypothalamus. The ability of the SCN cells to keep an endogenous rhythm is due to a molecular machinery composed by the positive and negative loops of the expression of clock genes: firstly, CLOCK and BMAL1 proteins heterodimerize to activate the transcription of different genes through E-box sites on the promoter which is on genes like period (Per1-3) and cryptochrome (Cry1-2; Takahashi et al., 2008). Then, the proteins of PERIOD and CRYPTOCHROME heterodimerize and enter back to the nucleus to prevent BMAL1 binding to the E-Box. Hence, PERIOD and CRYPTOCHROME inhibit their own transcription (Takahashi et al., 2008). A second loop is made by retinoid-related orphan receptors (ROR) and Rev-Erb: the ROR proteins activate Bmal1 gene while REV-ERB proteins inhibit it via ROR-response element in the Bmal1 promoter. All this mechanism oscillates within a 24 h-period (Takahashi et al., 2008).
In circadian research, it is important to follow rhythmic activity in the whole organism or tissues around the 24 h. For that, it is necessary to get tissues or samples at different time points to model the oscillations of gene, protein expression or hormonal release. However, these methods require more than one animal per time point, and therefore it requires a lot of animals to get a complete and significant circadian oscillation.
In 2000, Yamazaki et al., created a transgenic rat line to solve this problem. They inserted a vector containing the luciferase gene from the firefly under the control of Per1 promoter. Since the 80’s, the luciferase has been used as ATP, gene or protein reporter. This 61-kDa enzyme has the particularity to release photon by oxidation of its substrate and in the presence of ATP, Mg2+ and oxygen (Gould and Subramani, 1988). The beetle luciferase has the advantage to be a single protein with no post-translational modification; its catalytic area is ready-to-use after its translation and minimal auto-fluorescence throughout recording (Bioluminescent Reporters [Reference #1]).
Although Per1-luciferase rat is an advance in circadian field, it does not allow us to follow the endogenous clock gene expression, but rather the endogenous activity of the heterodimer CLOCK-BMAL1. In 2004, Takahashi lab created the transgenic mouse line in which the open reading frame (ORF) of the luciferase is fused to the end of the Per2 gene (Yoo et al., 2004). All cells expressing the PER2 protein are also able to produce yellow-green light (~560 nm) in the absence of external light source if they have access to the luciferin: the consumable substrate. The bioluminescence produced by these cells permits to follow the circadian clock activity of the same individual for several days, and even weeks.
The principal aim of this technique is to dissect the brain region of interest of several animals at a single time point. For that, we used a mouse brain matrix that requires less tissue preparation and slices faster than a vibratome. However, the disadvantage of this technique is the loss of thickness precision (~500 µm). The vibratome cuts thinner and more precise tissue slices, but all the related procedure requires time. The advantage of the use of the matrix is to have few steps to work rapidly on the area of interest.
Materials and Reagents
Gloves
Carbon steel scalpel No. 24 (Swann-Morton, catalog number: 0211 )
Double edge stainless steel razor blade (Electron Microscopy Sciences, catalog number: 72000 )
NuncTM cell culture/Petri dishes (35 mm, Thermo Fisher Scientific, catalog number: 150318 )
10 ml syringe (Terumo Medical, catalog number: SS-10ES )
Corning® vacuum filter system 500 ml, sterile, pore size: 0.22 µm (Corning, catalog number: 431097 )
Sterile sampling pot: aseptic 40 ml polypropylene straight container with screw cap (Dominique DUTSCHER, Corning GOSSELINTM, catalog number: 688252 )
Falcon Corning® 15 ml PP Centrifuge Tubes (Corning, catalog number: 430791 )
Falcon Corning® 50 ml PP Centrifuge Tubes (Corning, catalog number: 430829 )
FisherbrandTM SureOneTM 0.1-10 µl aerosol barrier pipette tips (Fisher Scientific, catalog number: 11903466 )
FisherbrandTM SureOneTM 20-200 µl aerosol barrier pipette tips (Fisher Scientific, catalog number: 11963466 )
FisherbrandTM SureOneTM 100-1,000 µl aerosol barrier pipette tips (Fisher Scientific, catalog number: 11973466 )
Costar® 5 ml Stripette® serological pipets, sterile (Corning, catalog number: 4487 )
Costar® 10 ml Stripette® serological pipets, sterile (Corning, catalog number: 4488 )
Costar® 25 ml Stripette® serological pipets, sterile (Corning, catalog number: 4489 )
Axygen® 0.2 ml Thin Wall PCR Tubes with Flat Cap (Corning, catalog number: PCR-02-C )
Axygen® 0.6 ml Maxy Clear SnaplockMicrocentrifuge Tube (Corning, catalog number: MCT-060-C )
Millicell® cell culture insert (Merck, catalog number: PICMORG50 )
Per2::Luciferase homozygote knock-in (KI) Musmusculus (Per2tm1Jt)
Note: Mice were initially from Jackson Laboratories. Generally, we used young-adult (2-6 months old) mice, males as well as females, from our own breeding colony (Chronobiotron platform, UMS-3415 in Strasbourg). Aside from specific protocols, mice were housed in groups–of 3 or 4 individuals with food and water available ad libitum– in light-proof ventilated rooms, under 12 h white light and 12 h dim red light (< 5 lux at cage level) cycle (LD12:12; lights on at 7:00 A.M.).
Antibiotic (penicillin-streptomycin 10,000 U/ml; 10,000 mg/ml, Sigma-Aldrich, catalog number: P4333 ), stored at -20 °C
B27 (Thermo Fisher Scientific, catalog number: 17504044 ), stored at -20 °C
Hank’s balanced salt solution with red phenol (HBSS; 10x, Sigma-Aldrich, catalog number: H1641 ) stored at room temperature
HEPES (Sigma-Aldrich, catalog number: H0887 ), stored at 4 °C
Sodium bicarbonate (Sigma-Aldrich, catalog number: S8761 ), stored at 4 °C
Bactericide/fungicide: ANIOSYME DD1 (Laboratoires ANIOS, Lille-Hellemmes, France)
Commercial chlorine in tablets to make 10x bleach
Dulbecco's modified Eagle's medium 10x (DMEM) with low glucose without red phenol (Sigma-Aldrich, catalog number: D2902 ), stored at 4 °C
D (+) Glucose (Sigma-Aldrich, catalog number: G7021 ), stored at room temperature
Beetle luciferin (Promega, catalog number: E1602 ), stored at -80 °C
High vacuum grease (Dow corning®, Wiesbaden, Germany), stored at room temperature
MilliQ Water
EtOH 70%
0.1 M luciferin (see Recipes), stored at -20 °C
HBSS 1x (see Recipes), stored at 4 °C
DMEM 1x (see Recipes), stored at 4 °C
Cleaning solution for tools (see Recipes)
Equipment
Note: All items without reference can be ordered from any qualified company.
Stainless steel mouse brain matrix (Adult Mouse Brain Slicer Matrix, Zivic Instruments, catalog number: BSMAS005-1 )
Note: Other brain matrixes (for hamsters or rats) exist.
Stainless steel tweezers, fine tips, straight
Note: To have a better sight of the dissection tools, see Figure 1.
Figure 1. Surgery instruments used during the protocol. 1) Carbon steel scalpel No. 24; 2) Double edge stainless steel razor blade; 3) Stainless steel mouse brain matrix; 4-5) Stainless steel tweezers, fine tips, straight; 6) Friedman bone rongeur; 7) Curved Scissors, fine tips; 8) Stainless steel operating scissors, straight.
Stainless steel operating scissors, straight
Curved Scissors, fine tips
Friedman bone rongeur
Vacuum pump (KNF, catalog number: N86KN.18 )
Red light lamp (around 620-650 nm)
Fiber optic light source (SCHOTT, catalog number: KL 1500LCD )
Stereo Microscope (Nikon, catalog number: 536087 )
Sterilized BRAND® Petri dish, glass, size 100 mm x 15 mm (BRAND, catalog number: 455742 )
1 L sterilized bottle
500 ml sterilized bottle
100 ml sterilized measuring cylinder
1 L sterilized measuring cylinder
1 L sterilized beaker
Magnet
Magnetic plate (size: big enough for 1 L beaker; strength: enough to dissolve powder into a liquid)
P10 pipetman® classic (Gilson, catalog number: F144802 )
P20 pipetman® classic (Gilson, catalog number: F123600 )
P200 pipetman® classic (Gilson, catalog number: F123601 )
P1000 pipetman® classic (Gilson, catalog number: F123602 )
Pipetboy acu 2 (INTEGRA Biosciences, catalog number: 155019 )
Milli-Q® water system
Ice maker
Fridge (4 °C)
Fume hood (horizontal flow)
Fume hood (vertical flow)
Autoclave
Photo-counting apparatus as LumiCycle 32 (Actimetrics, Wilmette, IL, USA) inside 36.5 °C incubator
37 °C incubator
Note: Petri dishes will be sealed. We do not need 5% CO2; an incubator that keeps only medium or dishes at 37 °C is enough.
Software
LumiCycle Analysis for data extraction
Table software like Microsoft Office Excel for data extraction
SigmaPlot for statistics
GraphPad for graphs
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Salaberry, N. L. and Mendoza, J. (2018). Brain Tissue Culture of Per2::Luciferase Transgenic Mice for ex vivo Bioluminescence. Bio-protocol 8(13): e2917. DOI: 10.21769/BioProtoc.2917.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Tissue isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,918 | https://bio-protocol.org/exchange/protocoldetail?id=2918&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Cerebellum Granule Neurons from Mouse or Rat Pups and Evaluation of Clostridial Neurotoxin Activity and Their Inhibitors by Western Blot and Immunohistochemistry
Domenico Azarnia Tehran
Marco Pirazzini
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2918 Views: 9928
Edited by: Andrea Puhar
Reviewed by: Xuecai Ge
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Cerebellar Granule Neurons (CGN) from post-natal rodents have been widely used as a model to study neuronal development, physiology and pathology. CGN cultured in vitro maintain the same features displayed in vivo by mature cerebellar granule cells, including the development of a dense neuritic network, neuronal activity, neurotransmitter release and the expression of neuronal protein markers. Moreover, CGN represent a convenient model for the study of Clostridial Neurotoxins (CNT), most notably known as Tetanus and Botulinum neurotoxins, as they abundantly express both CNT receptors and intraneuronal substrates, i.e., Soluble N-ethylmaleimide-sensitive factor activating protein receptors (SNARE proteins). Here, we describe a protocol for obtaining a highly pure culture of CGN from postnatal rats/mice and an easy procedure for their intoxication with CNT. We also illustrate handy methods to evaluate CNT activity and their inhibition.
Keywords: Cerebellar granule neurons Clostridial neurotoxins Tetanus Botulinum SNARE proteins Inhibitors Cell-based assay
Background
The large family of Clostridial Neurotoxins (CNT) is formed by Tetanus Neurotoxin (TeNT) and the many variants of Botulinum Neurotoxins (BoNT) which are the neuroparalytic toxins responsible for tetanus and botulism, respectively (Schiavo et al., 2000; Johnson and Montecucco, 2008; Rossetto et al., 2014). TeNT, the seven BoNT serotypes (BoNT/A to /G) and their many subtypes are metalloproteases that cause neuroparalysis by blocking neurotransmitter release via the cleavage of SNARE proteins (Soluble N-ethylmaleimide-sensitive factor activating protein receptors), the three essential proteins governing the fusion of synaptic vesicle with the presynaptic plasma membrane (Rossetto et al., 2014; Montecucco and Rasotto, 2015; Pirazzini et al., 2017). In addition, some putative novel serotypes (BoNT/X and BoNT/En aka eBoNT/J) (Zhang et al., 2017; Brunt et al., 2018; Zhang et al., 2018) and a BoNT-like toxin (BoNT/Wo) (Zornetta et al., 2016) displaying metalloprotease activity against SNARE proteins have been recently identified (Azarnia Tehran and Pirazzini, 2018). Yet, whether they are naturally produced and can be considered true BoNT still requires validation. Each toxin has a selective action against one specific protein that is cleaved at a distinct peptide bond (Binz, 2013; Pantano and Montecucco, 2014; Zornetta et al., 2016; Zhang et al., 2017; Zhang et al., 2018): BoNT/B, /D, /F /G, /Wo and /X hydrolyze VAMP-1/2 (vesicle-associated membrane protein) while BoNT/A and BoNT/E cleave the membrane protein SNAP-25 (synaptosomal-associated protein of 25 kDa). BoNT/C and BoNT/En are unique as they cleave more than one SNARE type: BoNT/C cleaves SNAP-25 and many isoforms of syntaxin (Pirazzini et al., 2017; Zanetti et al., 2017); instead BoNT/En cleaves different members of VAMP family and SNAP-25/23 (Zhang et al., 2018). To reach their intraneuronal substrates, CNT carry out a very sophisticated mechanism of intoxication aimed at delivering the catalytic part of the toxin within the cytosol of nerve terminals (reviewed in [Montal, 2010; Rossetto et al., 2014; Pirazzini et al., 2017]).
This process relies on cardinal functions of neuron physiology which are exploited by BoNT to enter the neuron: the expression of appropriate glycolipid and protein receptors for binding (Binz and Rummel, 2009; Rummel, 2017), the recycling of synaptic vesicles for internalization (Matteoli et al., 1996; Harper et al., 2011; Colasante et al., 2013), the generation of an electrochemical gradient across synaptic vesicle membrane to translocate the catalytic domain in the cytosol (Montal, 2010; Pirazzini et al., 2016) and the presence of a redox-chaperone system to enable SNARE proteins’ cleavage (Pirazzini et al., 2018). These features are fully preserved by cultured Cerebellar Granule Neurons (CGN), a primary culture of cerebellar granule cells from post-natal rodent cerebellum. The cerebellar cortex is composed of a few neuronal types like Purkinje cells, inhibitory interneurons and granule cells that form a highly organized tissue with well-characterized neuronal circuitries (Bilimoria and Bonni, 2008). Cerebellar granule cells constitute the most numerous and homogeneous neuronal population and can be easily isolated (Messer, 1977). Cultured CGN recapitulate many characteristics of development and maturation observed in vivo and have been extensively used as a useful model to study basic molecular and biological processes of neuron physiology like apoptosis, migration and differentiation (Contestabile, 2002).
Many neuronal models, including spinal cord neurons, hiPSC derived neurons, mES derived neurons, hippocampal neurons, cortical neurons and several methods have been developed to study BoNT activity in vitro (Pellett, 2013).In our laboratory, we choose CGN as their preparation is relatively simple, rapid and very reliable and it provides a highly pure (more than 95%) and homogeneous (mostly granule cells) neuronal culture model to conveniently evaluate CNT activity by monitoring the cleavage of SNARE proteins via Western blotting or immunocytochemistry (Pirazzini et al., 2011; Eleopra et al., 2013; Pirazzini et al., 2013b and 2013c). Moreover, CGN can be adapted to the investigation of putative inhibitors and can be used as a solid platform for screening anti-BoNT antitoxins (Pirazzini et al., 2013a and 2014; Azarnia Tehran, et al., 2015; Zanetti et al., 2015; Pirazzini and Rossetto, 2017). Here, we describe a simple protocol for fast isolation of CGN, an easy procedure for their intoxication with CNT, and two methods (Western blot and immunocytochemistry) to evaluate their toxicity and inhibition.
Materials and Reagents
0.22 µm filters (33 mm – Merck, Millex, catalog number: SLGP033RS )
Culture plates
6 wells (Corning, Falcon®, catalog number: 353046 )
24 wells (Corning, Falcon®, catalog number: 353047 )
96 wells (Corning, Falcon®, catalog number: 353072 )
35 mm Petri dishes (Corning, Falcon®, catalog number: 353001 )
50 ml sterile conical plastic tubes (Corning, Falcon®, catalog number: 352070 )
Coverslips 13 mm #1 (Thermo Fisher Scientific, catalog number: 1014355113NR1 )
Micropipette tips
1,000 µl tips (SARSTEDT, catalog number: 70.762.211 )
200 µl tips (SARSTEDT, catalog number: 70.760.211 )
10 µl tips (SARSTEDT, catalog number: 70.1130.210 )
Nitrocellulose membranes (Sartorius, Stedim Biotech, catalog number: 11306-41BL )
Plastic Pasteur pipettes (LP ITALIANA, catalog number: 133030 )
Serological plastic pipettes:
5 ml plastic pipettes (Corning, Falcon®, catalog number: 357543 )
10 ml plastic pipettes (Corning, Falcon®, catalog number: 357551 )
25 ml plastic pipettes (Corning, Falcon®, catalog number: 357525 )
Single-use stericups 0.22 µm filters ExpressTM Plus (Merck, catalog number: SCGPU0SRE )
Sterile scalpel (CHEMIL, catalog number: 11230028 )
Mice or rats (any gender) postnatal day 4-6
Distilled H2O
Ethanol (Sigma-Aldrich, catalog number: 46139 )
Poly-L-lysine hydrobromide solution (Sigma-Aldrich, catalog number: P8920 )
Phenol red (Sigma-Aldrich, catalog number: P3532 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P5405 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
D-(+)-Glucose (Sigma-Aldrich, catalog number: G7528 )
Sodium phosphate monobasic monohydrate (NaH2PO4) (Sigma-Aldrich, catalog number: S3522 )
KH2PO4 (Sigma-Aldrich, catalog number: P5655 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C3306 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: 63138 )
Fatty acid free bovine serum albumin (Sigma-Aldrich, catalog number: A7030 )
Trypsin from porcine pancreas (Sigma-Aldrich, catalog number: T4799 )
Trypsin inhibitor from soybean (Sigma-Aldrich, catalog number: T9003 )
CompleteTM Mini, EDTA-free Protease Inhibitor Cocktail (Sigma-Aldrich, Roche Diagnostics, catalog number: 04693159001 )
Trypan blue solution, 0.4% (Thermo Fisher Scientific, catalog number: 15250061 )
Deoxyribonuclease I from bovine pancreas (Sigma-Aldrich, catalog number: D5025 )
Basal Medium Eagle (BME) (Thermo Fischer Scientific, GibcoTM, catalog number: 21010046 )
GlutamaxTM Supplement (Thermo Fischer Scientific, GibcoTM, catalog number: 35050061 )
Gentamicin solution (Sigma-Aldrich, catalog number: G1272 )
Cytosine β-D-arabinofuranoside (AraC) (Sigma-Aldrich, catalog number: C1768 )
Fetal Bovine Serum (FBS) (EUROCLONE, catalog number: EUS 028877 )
Note: Comparative testing for culture optimization is needed when changing serum lot or supplier.
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
Trizma® hydrochloride (Sigma-Aldrich, catalog number: T3253 )
Glycine (Sigma-Aldrich, catalog number: G8898 )
Sodium dodecyl sulfate (SDS, Sigma-Aldrich, catalog number: L3771 )
Bromophenol Blue (Sigma-Aldrich, catalog number: B0126 )
Glycerol (Sigma-Aldrich, catalog number: G9012 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
NuPAGETM 12% Bis-Tris Gels (Thermo Fisher Scientific, catalog number: NP0341BOX )
NuPAGETM 4-12% Bis-Tris Gels (Thermo Fisher Scientific, catalog number: NP0321BOX )
NuPAGETM MES SDS Running Buffer (20x) (Thermo Fisher Scientific, catalog number: NP0002 )
NuPAGETM MOPS SDS Running Buffer (20x) (Thermo Fisher Scientific, catalog number: NP0001 )
Methanol (Sigma-Aldrich, catalog number: 322415 )
Ponceau S (Sigma-Aldrich, catalog number: P3504 )
Acetic acid (Sigma-Aldrich, catalog number: 45726 )
Tween 20® (Sigma-Aldrich, catalog number: P9416 )
Anti Syntaxin-1A/1B antibody (homemade)
Anti-BoNT/A-cleaved SNAP-25 antibody (homemade)
Anti-BoNT/B-TeNT-cleaved VAMP2 antibody (homemade)
Anti-BoNT/E-cleaved SNAP-25 antibody (homemade)
Anti-SNAP-25 antibody (SMI81, Abcam, catalog number: ab24737 )
Anti-Syntaxin1 antibody (Synaptic System, catalog number: 110 011 )
Anti-VAMP-2 antibody (Synaptic System, catalog number: 104 211 )
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
Ammonium chloride (Sigma-Aldrich, catalog number: A9434 )
Fluorescence mounting medium (Agilent Technologies, Dako, catalog number: S3023 )
HRP-conjugated or fluorescent-conjugated secondary antibodies (any supplier)
Sodium dodecyl sulfate (Sigma-Aldrich, catalog number: 74255 )
Tetanus neurotoxin and botulinum neurotoxins. The neurotoxins used in our laboratory are purified as previously described (Schiavo and Montecucco, 1995; Shone and Tranter, 1995) or produced recombinantly (Bade et al., 2004; Zanetti et al., 2017)
Krebs solution (10x) (see Recipes)
155 mM MgSO4 stock solution (see Recipes)
12.2 mM CaCl2 stock solution (see Recipes)
Solution A (see Recipes)
Solution B (see Recipes)
Solution C (see Recipes)
Solution D (see Recipes)
Solution E (see Recipes)
Poly-L-lysine solution (see Recipes)
BME complete medium, CGN culture medium (see Recipes)
Cytosine β-D-arabinofuranoside (AraC) stock solution (see Recipes)
PBS (see Recipes)
PBST (see Recipes)
SDS-PAGE Sample loading buffer (4x) (see Recipes)
Transfer buffer (see Recipes)
Ponceau S solution (see Recipes)
Blocking buffer (see Recipes)
4% Paraformaldehyde solution (see Recipes)
Quenching solution (see Recipes)
Permeabilization solution (see Recipes)
Blocking solution (see Recipes)
Equipment
Micropipettes (any supplier)
Pipette controller (any supplier)
Centrifuge for conical tubes (Eppendorf, model: 5804 R )
Dissecting hood (any supplier)
Dissecting stereomicroscope (OPTIKA Microscopes, model: SZM-LED2 )
Sterile laminar flow hood (any supplier)
Hemacytometer (any supplier)
Humidified incubator (5% CO2 at 37 °C) (any supplier)
Ice bucket and ice
Scissors #1 (Rudolf Medical GmbH, catalog number: RU 2675-18 )
Forceps #2 (Rudolf Medical GmbH, catalog number: RU 7584-16 )
Scissors #3 (Rudolf Medical GmbH, catalog number: RU 2246-09 )
Tweezers #4 (Rudolf Medical GmbH, catalog number: RU 4240-05 )
Mini gel tank (Thermo Fisher Scientific catalog number: A25977 )
Mini Trans-Blot® Cell (Bio-Rad Laboratories, catalog number: 1703930 )
Thermoblock (any supplier)
Thermosettable water-bath (37 °C) (any supplier)
Vortex mixer (any supplier)
Epifluorescence or confocal microscope: Leica CTR6000 equipped with X5 N PL AN (Leica Microsystems, model: Leica CTR6000 )
0.12, x20 N PL AN 0.40 objectives or Leica SP5 equipped with 100x HCX PL APO NA 1.4 objective, respectively (Leica Microsystems, Wetzlar, Germany)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Azarnia Tehran, D. and Pirazzini, M. (2018). Preparation of Cerebellum Granule Neurons from Mouse or Rat Pups and Evaluation of Clostridial Neurotoxin Activity and Their Inhibitors by Western Blot and Immunohistochemistry. Bio-protocol 8(13): e2918. DOI: 10.21769/BioProtoc.2918.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,919 | https://bio-protocol.org/exchange/protocoldetail?id=2919&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Fluorescent Labeling of Rat-tail Collagen for 3D Fluorescence Imaging
Andrew D. Doyle
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2919 Views: 8392
Edited by: Ralph Thomas Boettcher
Reviewed by: Michela PeregoMasashi Asai
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
Rat tail collagen solutions have been used as polymerizable in vitro three-dimensional (3D) extracellular matrix (ECM) gels for single and collective cell migration assays as well as spheroid formation. These 3D hydrogels are a relatively inexpensive, simple to use model system that can mimic the in vivo physical characteristics of numerous tissues within the body, namely the skin. While confocal imaging techniques such as fluorescence reflection and two-photon microscopy are able to visualize collagen fibrils during 3D imaging without fluorescence, other imaging modalities require direct conjugation of fluorescent dyes to collagen. Here we detail how to generate 3D collagen gels labeled with a fluorescent dye. Furthermore, we go through the steps required to reproducibly generate bright collagen hydrogels that are suitable for live cell 3D imaging techniques.
Keywords: Rat-tail collagen Fibrils Hydrogel Fluorescent dye 3D imaging
Background
The study of cell migration and cell interaction with its surrounding microenvironment has been started since the 1950’s when Paul Weiss and Beatrice Garber originally observed the effect of increasing plasma concentration (fibrin) on mesenchymal cell morphology (Weiss and Garber, 1952). In subsequent years and decades, biochemists started to delve into purifying extracts from rat tail collagen and started their use as a highly polymerizable 3D matrix (Fitch et al., 1955; Gross et al., 1955; Chandrakasan et al., 1976). It wasn’t until the 1990’s that 3D matrices truly became useful to the cell biology community, especially for studying cell migration (Friedl et al., 1995). Recently, a transition from simplified two-dimensional (2D) studies on ECMs to 3D has begun. This evolution has followed shortly behind the recent advances in fluorescence microscopy, especially super-resolution microscopy. While standard laser scanning confocal microscopes can utilize reflection microscopy or two-photon-based second harmonic generation to visualize collagen fibers in the absence of a fluorescent tag, both techniques do not always properly depict the ECM architecture due either to polarity issues or lack of a significant fibril thickness. A fluorescently-tagged ECM allows imaging of the smallest individual fibrils even with super-resolution techniques.
Unlike most proteins collagen cannot be simply tagged with a fluorophore when in solution because the numerous lysine residues are required for alpha helix formation with other monomers during polymerization (Chandrakasan et al., 1976). For this reason, the labeling must be accomplished on preformed gels. This protocol describes how to label a polymerized gel, bring the collagen back into solution with acetic acid, and properly mix a minimal amount (2-4% of total protein) of labeled collagen with an unlabeled fraction to generate a bright, fluorescent collagen gel capable of sustaining cell viability while allowing observation of ECM architecture over multiple hours of fluorescence imaging.
Materials and Reagents
MatTek Dishes (35 mm, #1.5 coverslip, 20 mm opening: MATTEK, catalog number: P35G-1.5-20-C )
ColorpHast pH-indicator-strips with pH range 6.5-10 (Merck, catalog number: 109543 )
10-100 and 1,000 μl Gilson MICROMAN® positive displacement pipette tips (Gilson, catalog numbers: FD10004 , FD10006 )
10 cm tissue culture dish (Thermo Fisher Scientific, catalog number: 150350 )
Cell lifters (Corning, catalog number: 3008 )
Aluminum foil
Plastic wrap
Scintillation vial (Sigma-Aldrich, catalog number: Z190527 )
1.5 ml microfuge tubes (Thermo Fisher Scientific, catalog number: AM12400 )
Dubecco’s Minimal Essential Medium (DMEM) powder, Phenol red (Sigma-Aldrich, catalog number: D2429 )
NaOH pellets (Sigma-Aldrich, catalog number: S8045 )
Phosphate Buffered Saline with Calcium and Magnesium (PBS++) chilled to 4 °C and at room temperature (GE Healthcare, HycloneTM, catalog number: SH30264.02 )
Rat tail collagen solution (dissolved in 20 mM acetic acid, commercial brands are fine, but in-house preparations are usually cleaner and polymerize faster) at a concentration greater than 5 mg/ml (6 mg/ml used here)
Sodium bicarbonate (Sigma-Aldrich, catalog number: S5761 )
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma-Aldrich, catalog number: H4034 )
Boric acid (powder 99.5%, Sigma-Aldrich, catalog number: B6768 )
Acetic acid (Sigma-Aldrich, catalog number: 27221-1L ) (chilled to 4 °C, less than 50 ml of 16.65 M is required)
Atto-488 NHS-ester 1 mg (Sigma-Aldrich, catalog number: 41698 )
DMSO (Sigma-Aldrich, catalog number: D2650 )
Sircol Collagen Assay kit (available from Accurate Chemical & Scientific, catalog number: CLRS1000 )
Slide-A-Lyzer Dialysis cassette (G2) with 20,000 MW cutoff (Thermo Fisher Scientific, catalog number: 87735 )
1 M Tris (pH 7.4, KD Medical, catalog number: RGF-3340 )
NaCl (Sigma-Aldrich, catalog number: S7653 )
HCl (37%, Sigma-Aldrich, catalog number: H1758-500ML )
10x DMEM (see Recipes)
10x reconstitution buffer (10x RB; see Recipes)
1 N NaOH (500 μl in a microfuge tube; see Recipes)
1 N HCl (500 μl in a microfuge tube; see Recipes)
50 mM Borate buffer pH 9.0 (see Recipes)
5 mg/ml Atto-488 NHS-ester dye in DMSO (see Recipes)
Sodium Chloride (NaCl), 8% solution (see Recipes)
50 mM Tris buffer (see Recipes)
Equipment
10-100 and 1,000 μl Gilson MICROMAN® positive displacement pipette (Gilson, catalog numbers: F148314 , F148180 )
Lab timer
2-4 L beaker
Ultra-clear 8 x 20 mm centrifuge tubes (Optional: Beckman Coulter, catalog number: 345843 )
Rectangular ice bucket packed with ice
Water bath
Large Magnetic stir bar to large beaker (Sigma-Aldrich, SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: Z284491 )
Small Magnetic stir bar for scintillation vial (Sigma-Aldrich, SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: Z126942 )
Stir plate
Mini centrifuge (i.e., VWR, model: Galaxy Mini )
Biological hood (any brand)
Brightfield microscope with 10 and 20x phase contrast objectives
Cooled centrifuge capable of 20,000 x g and 4 °C (i.e., TOMY, model: MX-307 )
Lab Rocker (i.e., Denville Scientific, model: 110, catalog number: S2110 )
Airfuge ultra centrifuge (optional: Beckman Coulter, catalog number: 340400 )
Laser scanning or spinning disk confocal microscope (i.e., Nikon Instruments, model: A1R or Yokogawa, model: CSU-X1 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Doyle, A. D. (2018). Fluorescent Labeling of Rat-tail Collagen for 3D Fluorescence Imaging. Bio-protocol 8(13): e2919. DOI: 10.21769/BioProtoc.2919.
Download Citation in RIS Format
Category
Biochemistry > Protein > Labeling
Cell Biology > Cell movement > Cell migration
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
292 | https://bio-protocol.org/exchange/protocoldetail?id=292&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Epithelial Cells from Mouse Gastrointestinal Tract for Western Blot or RNA Analysis
MZ Maged Zeineldin
KN Kristi Neufeld
Published: Vol 2, Iss 22, Nov 20, 2012
DOI: 10.21769/BioProtoc.292 Views: 21202
Original Research Article:
The authors used this protocol in May 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2012
Abstract
The gastrointestinal (GI) tract is lined by a single layer of epithelial cells which function in secretion, absorption, and digestion. In addition, most GI tract tumors develop from epithelial cells (carcinomas). This protocol describes isolation of the surface epithelium from the underlying stroma, muscular layer and submucosa in the GI tract. In this protocol, epithelial cell adhesions are weekend by chelating Ca +2 ions followed by mechanical separation of the cells by vortexing. Analysis of protein levels and gene expression patterns in isolated epithelial cells versus whole GI tissue minimizes the potential for confounding contributions from contaminating stromal cells.
Keywords: Intestine tissue Colon tissue Cell isolation Protein Mouse
Materials and Reagents
4% sodium hypochlorite (Sigma-Aldrich, catalog number: 239305 )
Phosphate buffered saline (PBS) (Mediatech, Cellgro®, catalog number: 21-031 )
KCl
NaCl
KH2PO4
Na2HPO4
EDTA
DTT
Aprotinin (USB, catalog number: 9087-70-1 )
Leupeptin (MP, catalog number: 195623 )
Pepstatin (MP, catalog number: 195368 )
PMSF (Sigma-Aldrich, catalog number: 329-98-5 )
Ethanol
0.04% sodium hypochlorite (see Recipes)
100x protease inhibitor (store at -20 °C) (see Recipes)
Solution B (see Recipes)
1x lysis buffer (see Recipes)
Equipment
CO2 chamber for mice
Dissecting scissors (one medium size and one small size for dissecting mice)
Forceps (2)
15-ml conical tubes
1.5-ml eppendorf tubes
3ml Insulin syringe
Vortex
Centrifuge compatible with 15-ml conical
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > RNA > Transcription
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,920 | https://bio-protocol.org/exchange/protocoldetail?id=2920&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Starch in Guard Cells of Arabidopsis thaliana
SF Sabrina Flütsch
LD Luca Distefano
Diana Santelia
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2920 Views: 9337
Reviewed by: María Victoria Martin
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
In this protocol, we describe how to quantify starch in guard cells of Arabidopsis thaliana using the fluorophore propidium iodide and confocal laser scanning microscopy. This simple method enables monitoring, with unprecedented resolution, the dynamics of starch in guard cells.
Keywords: Starch Guard cells Arabidopsis Stomatal opening Propidium iodide
Background
Starch is a complex polymer of glucose and represents the most abundant form in which plants store carbohydrate. Starch serves different functions, according to the cell types from which it is derived, and the external environmental conditions. In guard cells, which border the stomatal pores that control water and carbon dioxide exchange with the environment, starch can be mobilized within minutes upon transition to light, helping to generate organic acids and sugars to increase guard cell turgor and promote stomatal opening. In mesophyll cells, starch typically accumulates gradually during the day and is degraded at night to support metabolism (Santelia and Lunn, 2017).
Because guard cells comprise only a minor fraction of the total leaf, it is difficult to measure starch quantitatively using conventional methods. Up until now, starch accumulation in guard cells has been mostly visualized by iodine staining. This technique can determine the presence/absence of starch but does not provide accurate, quantitative information.
Here, we describe a fluorescence-based imaging method to quantify starch in guard cells of Arabidopsis thaliana. This technique is based on the covalent labeling of cell wall material and other glucan substrates, including starch, with the fluorescent pseudo-Schiff reagent propidium iodide (PS-PI). Isolated epidermal peels are treated with periodic acid to oxidize the hydroxyl groups of the glucose units to aldehyde and ketone groups. The aldehyde groups (-CHO) can then react covalently with propidium iodide, resulting in samples with highly fluorescent glucans that are well suited for confocal laser scanning microscopy. The area of single starch granules within guard cell chloroplasts can be determined using digital imaging. We applied this method to assess the dynamics of starch content in guard cells of intact Arabidopsis leaves over the diurnal cycle, and to determine the impact of fusicoccin (a chemical activator of the proton pump) on starch amounts in guard cells of isolated epidermal peels fragments floating in stomatal opening buffer (Horrer et al., 2016).
Our protocol is an adaptation of a previous mPS-PI staining technique (Truernit et al., 2008). The original method was developed to image entire plant organs for three-dimensional reconstruction of their cellular organization. The main difference between the two methods is the incubation time with the propidium iodide solution, which is 1-2 h for entire plant organs, and only about 20-40 min for epidermal peels.
The technique described here is simple, accurate and highly reproducible. By facilitating the detailed quantification of starch amounts in guard cells, this method will increase the number of questions we will be able to answer about any aspect of guard cell starch metabolism.
Materials and Reagents
Pipette tips (SARSTEDT)
12-well plate (Greiner Bio One International, catalog number: 665180 )
Falcon tubes
Parafilm M (Bemis, catalog number: PM996 )
Microscope slides (Thermo Fisher Scientific, Menzel-Gläser)
Coverslips (Thermo Fisher Scientific, Menzel-Gläser)
Kimtech Science precision wipes (KCWW, Kimberly-Clark, catalog number: 75512 )
Square Petri dish (Greiner Bio One International, catalog number: 688102 )
Arabidopsis thaliana ecotype Col-0
Methanol (Carl Roth, catalog number: 8388.4 )
Ethanol (Reuss Chemie, catalog number: RC-A15-A )
Acetic acid
Periodic acid (Sigma-Aldrich, catalog number: P7875 )
Sodium metabisulfite (Sigma-Aldrich, catalog number: S9000 )
Hydrochloric acid (Carl Roth, catalog number: 4625.1 )
Propidium iodide (Sigma-Aldrich, catalog number: 81845 )
Chloral hydrate (Sigma-Aldrich, catalog number: 15307-R )
Glycerol (Carl Roth, catalog number: 3783.1 )
Gum arabic (Carl Roth, catalog number: 4159.3 )
Fixative solution (see Recipes)
Schiff Reagent (see Recipes)
Chloral hydrate solution (see Recipes)
Hoyer’s solution (see Recipes)
Equipment
Glass beaker
Precision tweezers (RubisTech, catalog number: 5-SA RT )
Pipettes (Gilson)
Fume hood (Renggli AG)
Refrigerator (Liebherr)
Oven (Ehret)
Green light LED lamp (In-house built)
Confocal laser scanning microscope (Leica Microsystems, model: Leica TCS SP5 )
Note: This product has been discontinued. Any confocal laser scanning microscope can be used.
Computer
Software
ImageJ (NIH USA, version 1.8, https://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Flütsch, S., Distefano, L. and Santelia, D. (2018). Quantification of Starch in Guard Cells of Arabidopsis thaliana. Bio-protocol 8(13): e2920. DOI: 10.21769/BioProtoc.2920.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Carbohydrate
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,921 | https://bio-protocol.org/exchange/protocoldetail?id=2921&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Phages Infecting Marinomonas mediterranea by an Enrichment Protocol
Patricia Lucas-Elío
Sukrit Silas
AS Antonio Sanchez-Amat
Published: Jul 5, 2018
DOI: 10.21769/BioProtoc.2921 Views: 6729
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
This protocol describes the isolation of lytic phages infecting the marine bacterium Marinomonas mediterranea from samples of seawater, sand, and seagrass from Posidonia oceanica meadows. It includes the collection of samples, the enrichment method and the isolation and purification of the phages using double layer agar plates. Although the method has been optimized for M. mediterranea, it might be used in the isolation of phages infecting other Marinomonas species and marine bacteria.
Keywords: Marinomonas mediterranea Isolation of phages from natural samples Purification of phages Double layer assay Phage storage
Background
CRISPR-Cas systems provide adaptive immunity against genetic infection in prokaryotes by acquiring short segments of nucleic acids of the invasive element (spacers). These “molecular memories of infection” are used to produce guide RNAs that target Cas nucleases to the pathogen when a new infection occurs. The spacers are stored directly in the genome of the host, interspersed between directed repeats of the CRISPR arrays. The analysis of the repertoire of spacer sequences in prokaryotic genomes as well as in metagenomic datasets has highlighted a vast diversity of undiscovered genetic pathogens that are the targets of CRISPR-Cas systems (Shmakov et al., 2017). The isolation of phages infecting microorganisms of interest can provide important insights into the mechanism of action of the CRISPR-Cas systems in a natural context.
In this work, we provide an easy and inexpensive method for isolating phages infecting the model bacterium Marinomonas mediterranea, from the natural environment of this microorganism. This bacterium has two different CRISPR-Cas systems: a canonical type I-F system, and also one type III-B system capable of acquiring spacers not only from DNA but also from RNA (Silas et al., 2016). This protocol could be easily adapted for the isolation of other phages from marine environments, which contain an enormous diversity of uncharacterized viruses.
Materials and Reagents
Cotton gauze swabs 20 x 20 cm (Gaspunt®, catalog number: PI132001 )
Cellulose esters filters 0.45 µm, 47 mm diameter (Merck, MF-MilliporeTM, catalog number: HAWP04700 )
90 mm Petri Dishes (Thermo Fisher Scientific, Thermo ScientificTM, SterilinTM, catalog number: 101VR20 )
96-Well Microplates (Thermo Fisher Scientific, Thermo ScientificTM, NuncTM MicroWellTM, catalog number: 269620 ) for OD measurements in the spectrophotometer
Disposable culture borosilicate glass tubes 16 x 100 mm (Corning, PYREX®, catalog number: 99445-16 )
Syringe Luer-LokTM 10 ml (BD, catalog number: 309604 )
Syringe filters, PES, 0.2 µm, 33 mm diameter, sterile (Fisher Scientific, FisherbrandTM, catalog number: 15206869 )
Sea Salts (Sigma-Aldrich, catalog number: S9883 )
Marine Agar (Conda, catalog number: 1059 )
Glycerol (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP229-1 )
Sodium Chloride (NaCl) (Scharlab, catalog number: SO02271000 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Scharlab, catalog number: MA00851000 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Merck, EMSURE®, catalog number: 1.05833.1000 )
Potassium chloride (KCl) (Merck, EMSURE®, catalog number: 1.04936.0500 )
Calcium chloride 2-hydrate (CaCl2·2H2O) (ITW Reagents Division, PanReac AppliChem, catalog number: 131232.1211 )
Sodium hydroxide (NaOH) (ITW Reagents Division, PanReac AppliChem, catalog number: 141687 )
European bacteriological agar (Conda, catalog number: 1800 )
Glucose (VWR, NORMAPUR®, catalog number: 24370.294 )
Iron (III) citrate hydrate (Merck, catalog number: 1.03862 )
Tri-sodium citrate 2-hydrate (ITW Reagents Division, PanReac AppliChem, catalog number: 141655 )
Di-potassium hydrogen phosphate (VWR, RECTAPUR®, catalog number: 26930.293 )
Bacteriological peptone (Conda, catalog number: 1616 )
Yeast extract (Conda, catalog number: 1702 )
MMC2G medium (see Recipes)
Equipment
NalgeneTM 250 ml Polycarbonate Centrifuge Bottles with Sealing Closure (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3140-0250 )
47 mm Glass filtration set with funnel, fritted membrane support, clamp, silicone rubber stopper and receiver kitasato flask
Pipettes (P1000, P100, P10)
100 ml, 1 L and 2 L glass flasks
Flask shaker (GFL-Gesellschaft für Labortechnik, model: 3005 )
Centrifuge for high volume samples (Thermo Fisher Scientific, model: SorvallTM RC 5B plus with GSA rotor)
Centrifuge for low volume samples (Eppendorf, model: 5430R )
Vacuum pump (KNF, model: N 86 KN.18 )
25 °C incubator (Kgroup, Koxka, model: API-6/1 MIL )
Microplate SpectroPhotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: Multiskan® Spectrum )
Water bath (LAUDA-Brinkmann, model: Aqualine AL25, catalog number: L000612 )
pH meter (HACH, Crison, model: Basic 20 )
Dri-block® Dry Thermoblock (Cole-Parmer, Techne, model: DB-2D )
Procedure
Sample collection
Marinomonas mediterranea forms part of the microbiota associated with the seagrass Posidonia oceanica (Espinosa et al., 2010). Take samples of seawater and sand from the surroundings of this seagrass, as well as samples from different parts of the Posidonia oceanica plant itself in glass bottles. Keep plant and sand samples in seawater. Keep the samples at 4 °C until processed. We typically processed the samples within 24-48 h.
Note: In various attempts to isolate phages infecting Marinomonas mediterranea, we have obtained plaques only when using the sand and seawater samples, never from the plant samples.
Processing of the samples for the enrichment protocol
The processing protocol is dependent on the type of sample.
For seawater samples
Filter the water samples through 7-8 layers of unfolded cotton gauze swabs placed on a glass funnel under non-sterile conditions.
Centrifuge the filtrate at 5,000 x g, 10 min, 4 °C.
Filter the supernatant through 0.45 µm Millipore HA filters placed on a fritted glass base using a 47 mm glass filtration set connected to a vacuum pump.
Keep the filtrate in glass flasks at 4 °C until the enrichment protocol is performed (Procedure C below). We have obtained plaques from filtrates that had been stored up to 11 days at 4 °C.
For plant samples, suspend the plant tissue at 20% (w/v) in seawater (or sterile SeaSalts solution), mash it with a hand-held kitchen blender, filter the samples through cotton gauze swabs, and follow the rest of steps as with the water samples.
For sand samples, add wet sand to untreated seawater at 20% in a flask just before beginning the enrichment (Procedure C). No further filtration is necessary for this sample.
Note: The sand concentration is approximate, as it is not dried before weighing.
Enrichment of phages infecting M. mediterranea
Use M. mediterranea strains that might enhance the probabilities of phage propagation as hosts for the phage enrichments. We have succeeded using either a mutant with a deletion of the III-B CRISPR-Cas system (∆III-B mutant strain) or a regulatory mutant, T103, which shows defects in CRISPR-Cas expression (Silas et al., 2017).
Day 1
Streak the M. mediterranea host strain on a marine agar plate from a -80 °C frozen glycerol stock and incubate for 48 h at 25 °C. We keep the plate inside a cardboard box for the first overnight incubation, but place it inside a plastic bag until the second day so that the medium does not get very dry. After they are grown, the plates are kept at 15 °C. Do not keep the plates at 4 °C since this adversely affects cell viability.
Day 3
Pick 2-3 isolated colonies and inoculate into 10 ml MMC2G broth in a 100 ml flask at 25 °C overnight at 130 rpm.
Note: We never fill in excess of 1/5th of the total volume of the flask to ensure good aeration of the culture as M. mediterranea is a strict aerobe.
Day 4
Measure the OD600 of the overnight culture in a microplate spectrophotometer using a 10-1 dilution of the culture added to a 96-well microplate. This culture is used to inoculate a new 100 ml MMC2G culture in a 1 L flask such that the initial OD600 is 0.05. Grow at 25 °C (130 rpm) until the culture reaches late exponential phase (OD600 of 0.6, approximately 4.5 h of incubation).
Add 20 ml of the late exponential phase culture to every 180 ml of the processed environmental sample (from Procedure B: seawater, seagrass or sand) supplemented with 0.5% peptone and 0.1% yeast extract (we add 9 ml peptone and 1.8 ml yeast extract from sterile-filtered 10% stocks). Incubate this enrichment culture in a 1 L volume glass flask at 75 rpm, 25 °C, 16 h (Figure 1).
Prepare another 100 ml flask (labeled control 1) with 18 ml of the processed environmental sample (from Procedure B) containing 0.5% peptone and 0.1% yeast extract, and add 2 ml of MMC2G (but no bacteria). Incubate it under the same conditions, 75 rpm, 25 °C, 16 h, as the enrichment assay (Figure 1).
Pick 2-3 isolated colonies of the host strain from the plate from Day 1 and inoculate 10 ml MMC2G broth in a 100 ml flask at 25 °C overnight at 130 rpm.
Day 5
Measure the OD600 of the overnight culture of the host strain and use this to inoculate a new 100 ml MMC2G culture in a 1 L flask such that the initial OD600 is 0.05. Grow at 25 °C (130 rpm) until the culture reaches late exponential phase (OD600 of 0.6).
Prepare 5 replicate borosilicate glass tubes for each enrichment (Step C3b) and 3 replicates for the control 1 flask (Step C3c), containing 3.6 ml of fresh MMC2G medium and 0.4 ml of the late exponential M. mediterranea culture from Step C4a (Figure 1).
Add 1 ml of each enrichment or control 1 culture, filtered through 0.2 µm polystyrene sulfonate (PSS) sterile filters, into each of corresponding replicate tubes (Figure 1).
Set another 3 replicate tubes named control 2 that won’t have any 1 ml enrichment filtrate from Day 4, but 1 ml additional fresh MMC2G medium instead (Figure 1).
Incubate all the tubes without shaking at 25 °C overnight.
Figure 1. Schematics of the procedure for the days 4 and 5 of the enrichment protocol (Step C). The enrichment and control 1 are set up on Day 4 from the processed environmental samples and an exponential phase culture of the host. The enrichment continues on the Day 5 by inoculating tubes with the overnight enrichment and control 1 cultures. Control 2 is set up on Day 5 using only the exponential phase host culture, but no processed environmental samples.
Day 6
Follow the OD600 of the replicate tubes making a measurement approximately every 12 h. It may take more than one day of incubation to observe a decrease in the optical density of some of the enrichment tubes compared to the control 2 tubes. We consider an enrichment tube as positive if it has a decrease in the OD600 ≥ 50% compared to control 2.
A decrease in the OD600 of any of the tubes from control 1 may be due to growth inhibitors such as toxic compounds or lytic microorganisms (such as bdellovibrios), which may be interfering in the enrichment cultures as well.
In the case of a positive result in the enrichment tubes, keep 1 ml at 4 °C and filter the rest of that sample through 0.2 µm PSS sterile filters. Use this filtrate to test for the presence of phages in the samples by the plaque assay (Procedure D, below). Some phages could be retained by the filters, so in case no plaques are obtained, it is possible to go back and test the 1 ml unfiltered aliquot stored at 4 °C.
Check for the presence of phages in the enrichments by double layer assays
To perform a double layer plaque assay, a phage aliquot is incubated with susceptible cells to allow phages to attach to cells. Next, this mixture is poured together with melted agar medium (the upper layer) on plates already containing a layer of solid sterile medium (the bottom layer). When the plates are incubated, the infected cells release phage progeny. The spread of the new phages is restricted to neighboring cells by diffusion through the solid medium. Therefore, each infectious particle produces a clear circular zone of lysed cells called a plaque, visible to the naked eye.
Place the plates for the double layer plaque assay (containing the bottom layer of MMC2G medium) at room temperature.
Dilute an overnight culture of the strain to be tested (for example, M. mediterranea MMB-1 with the CRISPR-Cas loci deleted) with fresh medium to an OD600 of 0.12. In our hands an overnight culture inoculated the previous afternoon works well, as does an exponential phase culture prepared that morning.
Mix 0.9 ml of the diluted culture with 0.1 ml of the phage filtrate from Step C5c in an Eppendorf tube. Depending on the phage concentration, it may be necessary to use 10-fold dilutions of the phage suspension to get plaques instead of a fully lysed plate. In this case, use the MMCbase (see Recipes) to make the phage dilutions.
Incubate the mixture of phages and bacteria without shaking at room temperature for about 30 min and then add it to a tube containing the melted top agar kept at 45 °C in a dry thermoblock. Mix rapidly (but avoiding the formation of bubbles by placing the tube vertically between the palm of both hands and rolling forward and backward about 5 times) and distribute it evenly on top of the bottom layer. Let the plates sit until the top agar solidifies (30 min-1 h). Invert the plates and incubate them at 25 °C overnight.
The presence of phages is revealed by the appearance of plaques in the lawn of host cells (Figure 2).
Figure 2. Double layer assay with the appearance of phage plaques. Phage CPG1g plaques on a lawn of M. mediterranea MMB-1 ∆III-B mutant strain (right) compared to a control lawn without any phage addition (left).
Isolation of the virus by plaque purification
Choose a plate with only a few well-separated plaques and retrieve a sample from a single plaque by picking a bit of the top agar layer using a 200 µl sterilized pipette tip held perpendicularly to the surface of the plate. Choose a plaque far from others so that the sample is not contaminated with other phages diffusing through the agar. Avoid touching the bacteria surrounding the plaque.
Place the tip in 1 ml of MMC2G broth and gently pipette up and down a few times to release the phage. Discard the tip. Use this broth for another dilution series and plaque assay using an exponential phase culture of the host. Once plaques are obtained, repeat the isolation procedure from a single plaque to be sure that only a single clone of the virus has been selected.
Preparation of a virus working solution and storage of the isolated virus
Day 1
To store a phage that was isolated from a plaque, add 4.35 ml of fresh MMC2G or Marine broth, 400 μl of a culture of the host at exponential phase of growth and 10 μl of the suspension with phages from the plaque to a glass tube. Incubate the tube in static conditions at 25 °C overnight. Also set up a control tube without the plaque suspension to compare optical densities the next day.
Day 2
The tube containing the phage and bacteria should be lysed and should have lower turbidity than the control.
Filter the contents of that tube through 0.2 µm syringe filters in order to eliminate any remaining bacteria in the sample.
Mix 800 μl of the filtrate with 200 μl of sterile glycerol, mix by pipetting and immediately store the stock at -80 °C.
To recover phage from the stock, scrape off a bit of the frozen mass with a sterile tip and introduce the whole tip in a tube containing fresh medium and an exponential phase growth of the host (as described in Step F1).
Recipes
MMC2G medium
Note: This is a complex medium prepared with MMCbase supplemented with citrate, phosphate and glucose solutions after autoclaving.
Prepare the MMCbase by dissolving in 800 ml of distilled water (in a 2 L flask) the following salts:
NaCl 20.00 g
MgSO4·7H2O 7.00 g
MgCl2·6H2O 5.30 g
KCl 0.70 g
CaCl2·2H2O 1.25 g
Peptone 5.00 g
Yeast Extract 1.00 g
Adjust the pH to 7.4 using a NaOH solution
Bring the total volume to 1 L with distilled water
As a stock for MMC2G liquid medium, add the MMCbase to a bottle that will be stored, after autoclaving, at room temperature. For solid medium, add 15 g of European Bacteriological Agar (this yields 1.5% agar plates). For the double layer assays, add 0.8% agar for the bottom layer, which will be poured onto plates. For the top layer prepare the medium with 0.6% agar in small bottles
Autoclave the MMCbase
Finalization of the medium for its usage
When we want to prepare MMC2G liquid medium, we have the MMCbase liquid in a bottle at room temperature and we add the following citrate, phosphate and glucose solutions from the stocks immediately before the inoculation. These components must be autoclaved separately, and the stocks are kept at room temperature in the lab and can be used every time new media are prepared:
1)
Hydrated ferric citrate (III) at 1% plus sodium citrate at 9%. This solution is added at a 1/1,000 dilution (10 μl/10 ml of medium)
2)
K2HPO4 1 M: Add 4 μl/10 ml of medium to get a final 0.4 mM concentration
3)
Glucose 20%: 100 μl/10 ml of medium to get a final 0.2% concentration
To prepare MMC2G plates, after sterilization keep the MMCbase agar at 50 °C in a water bath and add the citrate solution, phosphate and glucose just before pouring the plates. Once the plates are solid, keep the medium at 15 °C until it is going to be used
To prepare the top layer, on the day that you are making the double layers, melt the top agar that was prepared in a small bottle, by placing it in boiling water. After it is melted, put in a water bath at 50 °C. Add the citrate, phosphate and glucose from the stock solutions and distribute it in tubes with 3.5 ml of media. Keep it melted at 45 °C until you make the double layers
Acknowledgments
This work has been supported by the grant BFU2017-85464-P (Ministerio de Economía, Industria y Competitividad, Spain). This protocol has been adapted from an “Amplification method” previously described by Suttle (1993). We are thankful to JA García Charton for continuously providing us with the marine samples from the Mediterranean Sea. The authors declare that there are no conflicts of interest.
References
Espinosa, E., Marco-Noales, E., Gomez, D., Lucas-Elio, P., Ordax, M., Garcias-Bonet, N., Duarte, C. M. and Sanchez-Amat, A. (2010). Taxonomic study of Marinomonas strains isolated from the seagrass Posidonia oceanica, with descriptions of Marinomonas balearica sp. nov. and Marinomonas pollencensis sp. nov. Int J Syst Evol Microbiol 60(Pt 1): 93-98.
Shmakov, S. A., Sitnik, V., Makarova, K. S., Wolf, Y. I., Severinov, K. V. and Koonin, E. V. (2017). The CRISPR spacer space is dominated by sequences from species-specific mobilomes. MBio 8(5): e01397-17.
Silas, S., Lucas-Elio, P., Jackson, S. A., Aroca-Crevillen, A., Hansen, L. L., Fineran, P. C., Fire, A. Z. and Sanchez-Amat, A. (2017). Type III CRISPR-Cas systems can provide redundancy to counteract viral escape from type I systems. Elife 6: e27601.
Silas, S., Mohr, G., Sidote, D. J., Markham, L. M., Sanchez-Amat, A., Bhaya, D., Lambowitz, A. M. and Fire, A. Z. (2016). Direct CRISPR spacer acquisition from RNA by a natural reverse transcriptase-Cas1 fusion protein. Science 351(6276): aad4234.
Suttle, C. A. (1993). Chap 15: Enumeration and isolation of viruses. In: Kemp, P. F., Sherr, B. F., Sherr, E. B. and Cole, J. J. (Eds). Handbook of Methods in Aquatic Microbial Ecology. Lewis Publ pp: 121-134.
Copyright: Lucas-Elio et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
Category
Microbiology > Microbial physiology > Interspecific competition
Cell Biology > Cell isolation and culture > Virus isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,922 | https://bio-protocol.org/exchange/protocoldetail?id=2922&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Induction of Natural Competence in Genetically-modified Lactococcus lactis
Joyce Mulder
MW Michiel Wels
OK Oscar P. Kuipers
MK Michiel Kleerebezem
PB Peter A. Bron
Published: Vol 8, Iss 13, Jul 5, 2018
DOI: 10.21769/BioProtoc.2922 Views: 6571
Edited by: Modesto Redrejo-Rodriguez
Reviewed by: Adison WongAlba Blesa
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Natural competence can be activated in Lactoccocus lactis subsp lactis and cremoris upon overexpression of ComX, a master regulator of bacterial competence. Herein, we demonstrate a method to activate bacterial competence by regulating the expression of the comX gene by using a nisin-inducible promoter in an L. lactis strain harboring either a chromosomal or plasmid-encoded copy of nisRK. Addition of moderate concentrations of the inducer nisin resulted in concomitant moderate levels of ComX, which led to an optimal transformation rate (1.0 x 10-6 transformants/total cell number/g plasmid DNA). Here, a detailed description of the optimized protocol for competence induction is presented.
Keywords: Natural competence Transformation Lactococcus lactis ComX overexpression NICE system
Background
Natural competence is the process in which a bacterium acquires exogenous DNA via a specialized uptake machinery after which the internalized DNA is either integrated into its genome or maintained as plasmid DNA. Several bacteria enter a state of competence upon specific environmental triggers such as genotoxic stress or starvation (Seitz and Blokesch, 2013; Blokesch, 2016). Quorum sensing systems such as comCDE or comRS control the activation of natural competence in Gram positive bacteria (Håvarstein et al., 1995; Pestova et al., 1996; Kleerebezem et al., 1997b; Fontaine et al., 2015). More specifically, comC and comS encode pheromones, whereas comD encodes a histidine kinase and comE and comR encode response regulators (Håvarstein et al., 1995; Pestova et al., 1996; Fontaine et al., 2010; Fontaine et al., 2015). In streptococci, the activated regulator drives transcription of the alternative sigma factor ComX, which in turn, activates transcription of competence genes that encode the proteins encompassing the DNA uptake machinery (Johnston et al., 2014). Previously, strategies employing overexpression of ComX led to the successful introduction of exogenous DNA in Streptococcus thermophilus (Blomqvist et al., 2006) and L. lactis (David et al., 2017; Mulder et al., 2017), even though different approaches were employed to achieve its overexpression. These studies also showed that different expression levels of comX critically impact on transformation rates. For example, in our work we used L. lactis subsp. lactis KF147, a strain that allows Nisin-Controlled gene Expression system (NICE) (Mierau and Kleerebezem, 2005) and harbors chromosomal nisRK (essential to allow nisin induction) but does not produce nisin. In this strain, we introduced pNZ6200, a vector containing comX under the control of the nisin-inducible nisA promotor, by electro-transformation, and the resulting strain was not transformable upon full comX induction (2 ng/ml nisin), whereas optimal transformation rates (1.0 x 10-6 transformants/total cell number/g plasmid DNA) were observed upon moderate levels of induction (0.03 ng/ml nisin) (Mulder et al., 2017). Moreover, we also demonstrated that applying the same strategy worked for a nisRK derivative of L. lactis subsp. lactis IL1403, whereas competence induction in L. lactis subsp. cremoris KW2 required prior transformation of the strain with pNZ9531 that expresses nisRK (Kleerebezem et al., 1997a) to allow nisin induced expression of comX. In order to assess whether other L. lactis strains can become naturally competent, we hereby provide a method containing all details of the competence protocol as described previously (Mulder et al., 2017) that can assist other scientists to unleash competence in the L. lactis strain of their interest and might prevent experimental issues concerning nisin induced expression of ComX. This newly developed protocol is expected to allow genetic access in a broad panel of L. lactis strains with an efficiency that enables rapid-one-step construction of gene replacement mutants via integration of linear DNA fragments harboring an antibiotic resistance marker flanked by chromosomal homologous DNA regions.
Materials and Reagents
Pipette tips
15 ml and 50 ml CELLSTAR® Polypropylene Tube (conical) (Greiner Bio One International, CELLSTAR®, catalog numbers: 188271 and 227261 respectively)
Plastic Petri dish 94 x 16 with vents light version (Greiner Bio One International, catalog number: 633181 )
12 ml Cell Culture Tubes (Greiner Bio One International, CELLSTAR®, catalog number: 163160 )
Inoculation loops
Eppendorf Tubes® Safe-Lock Tubes 1.5 ml (Eppendorf, catalog number: 0030120086 )
Electroporation cuvettes, 2 mm gap (Bio-Rad Laboratories, catalog number: 1652086 )
Semi-micro cuvettes for 1 ml (for optical density measurements)
Bacterial strains: L. lactis strain of interest with a complete set of competence genes, L. lactis harboring pNZ6200 (Mulder et al., 2017), pNZ6202 (Mulder et al., 2017), and pNZ9531 (Kleerebezem et al., 1997a)
M17 broth (M17) and M17 agar (M17A) (Tritium, catalog numbers: M086.76.0200 and M085.76.0200 respectively)
Glucose solution (20%, Tritium, catalog number: G209.65.0080 )
Distilled water (Thermo Fisher Scientific, GibcoTM, catalog number: 15230089 )
Stock solutions of antibiotics:
20 mg/ml chloramphenicol (Sigma-Aldrich, catalog number: C0378-100G )
20 mg/ml erythromycin (Fisher Scientific, catalog number: BP920-25 )
12.5 mg/ml Tetracycline hydrochloride (Sigma-Aldrich, catalog number: T7660-25G )
NisinA® P Ultrapure Nisin A (Handary, Brussels, Belgium, prepare a 2 mg/ml stock solution in distilled water containing 0.05 glacial acetic acid)
Alternatively: nisin from Lactococcus lactis 2.5% (Sigma-Aldrich, catalog number: N5764 )
JETSTAR 2.0 Maxiprep Kit (GENPRICE, catalog number: 220 020 ) or PureLinkTM HiPure Plasmid Maxiprep Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: K210007 )
QubitTM dsDNA BR Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32850 )
Phenol BioUltra, for molecular biology, TE-saturated, ~73% (T) (Sigma-Aldrich, catalog number: 77607 )
Chloroform HPLC grade, ≥ 99.9% (Sigma-Aldrich, catalog number: 528730 )
Ethidium bromide (Sigma-Aldrich, catalog number: E1510-10ML )
Agarose tablets (U.S. Biotech Sources, catalog number: G01PD-500 )
Glacial acetic acid (Scharlab, catalog number: AC03522500 )
β-glycerophosphate (Disodium salt) (Sigma-Aldrich, catalog number: 50020-500G )
Potassium phosphate dibasic (K2HPO4) (Merck, catalog number: 1.05104.1000 )
Potassium phosphate monobasic (KH2PO4) (Merck, catalog number: 1.04873.1000 )
Na-acetate (Merck, catalog number: 1.06268.1000 )
(NH4)3-citrate (Sigma-Aldrich, catalog number: A1332-500G )
Ascorbic acid (VWR, AnalaR NORMPAPUR®, catalog number: 20150.231 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (Sigma-Aldrich, catalog number: M8054-100G )
Adenine (Sigma-Aldrich, Fluka, catalog number: 01830 )
Guanine (Sigma-Aldrich, catalog number: G11950-100G )
Uracil (Sigma-Aldrich, Fluka, catalog number: 94220 )
Xanthine (Sigma-Aldrich, catalog number: X7375-10G )
Alanine (Sigma-Aldrich, catalog number: A7627-100G )
Arginine (Sigma-Aldrich, catalog number: A5006-500G )
Aspartic acid (Sigma-Aldrich, catalog number: A9256-100G )
Cysteine-HCl (Sigma-Aldrich, catalog number: C1276-250G )
Glutamic acid (Sigma-Aldrich, catalog number: G1251-500G )
Glycine (Merck, catalog number: 1.04201.0250 )
Histidine (Sigma-Aldrich, catalog number: H8000-100G )
Leucine (Sigma-Aldrich, catalog number: L8000-100G )
Lysine (Sigma-Aldrich, catalog number: L5626-100G )
Methionine (Sigma-Aldrich, catalog number: M9625-100G )
Phenylalanine (Sigma-Aldrich, catalog number: P2126-100G )
Proline (Sigma-Aldrich, catalog number: P0380-100G )
Serine (Sigma-Aldrich, catalog number: S4500-100G )
Threonine (Sigma-Aldrich, catalog number: T8625-100G )
Tryptophane (Sigma-Aldrich, catalog number: T0254-100G )
Valine (Sigma-Aldrich, catalog number: V0500-100G )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670-100G )
Calcium chloride dihydrate (CaCl2·2H2O) (Merck, catalog number: 1.02382.0500 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: Z0251-100G )
Cobalt(II) sulfate heptahydrate (CoSO4·7H2O) (Sigma-Aldrich, catalog number: C6768-100G )
Copper (II) sulfate pentahydrate (CuSO4·5H2O) (Scharlab, catalog number: CO01010500 )
Ammonium molybdate tetrahydrate ((NH4)6Mo7O24·4H2O) (Sigma-Aldrich, Fluka, catalog number: 09878 )
Iron(II) chloride tetrahydrate (FeCl2·4H2O) (Sigma-Aldrich, catalog number: 44939-50G )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 30721-1L )
Iron(III) chloride hexahydrate (FeCl3·6H2O) (Sigma-Aldrich, catalog number: F2877-100G )
p-aminobenzoëic acid (Sigma-Aldrich, catalog number: A9879-100G )
Inosine (Sigma-Aldrich, catalog number: I4125-25G )
Orotic acid (Sigma-Aldrich, catalog number: O2750-100G )
Pyridoxamine-HCl (Sigma-Aldrich, catalog number: P9380-5G )
Thymidine (Sigma-Aldrich, catalog number: T9250-10G )
D-biotin (Sigma-Aldrich, catalog number: B4501-5G )
6,8-thioctic acid (Sigma-Aldrich, catalog number: T5625-5G )
Pyridoxine-HCl (Sigma-Aldrich, catalog number: P9755-25G )
Folic acid (Sigma-Aldrich, catalog number: F7876-25G )
Nicotinic acid (Sigma-Aldrich, catalog number: N4126-5G )
Ca-(D+)pantothenate (Sigma-Aldrich, catalog number: P5155-100G )
Riboflavin (Sigma-Aldrich, catalog number: R4500-25G )
Thiamin-HCl (Sigma-Aldrich, catalog number: T4625-100G )
Vitamin B12 (Sigma-Aldrich, catalog number: V2876-5G )
Alternatively, PCR product (obtained with KOD hot start DNA polymerase)
Note: Containing an antibiotic resistance marker flanked by chromosomal fragments for integration obtained by using overlap PCR (Horton et al., 1990) if preferred over plasmid transformation, e.g., for the construction of gene replacement mutants.
Optional: KOD hot start DNA polymerase Master Mix (Merck, Novagen, catalog number: 71842-4 )
GSGM17 (see Recipes)
Washing solution 1 (see Recipes)
Washing solution 2 (see Recipes)
Recovery medium (see Recipes)
CDM (see Recipes)
GCDM (chemically defined medium supplemented with glucose) (see Recipes)
Stock solutions for CDM (see Recipes)
Nucleotide solution
MnCl2·4H2O solution
Amino acid solution
Metal solution
Iron solution
Vitamin solution
Equipment
General pipettes
200 ml bottle
Water bath (for 30 °C and 55 °C)
Incubation stove at 30 °C
Vortex
Autoclave
Microcentrifuge (Eppendorf® Refrigerated Microcentrifuge) (Eppendorf, model: 5417R )
Centrifuge for 15 and 50 ml tubes (Heraeus Megafuge 1.0R)
Qubit® 2.0 Fluorometer (Thermo Fisher Scientific, InvitrogenTM, mode: Qubit® 2.0 )
Electroporator (Bio-Rad Laboratories, model: GenePulserXcellTM )
Spectrophotometer (Genesys 10 UV Spectrophotometer)
Nanodrop ND1000 spectrophotometer (NanoDrop Technologies) (Thermo Fisher Scientific, model: NanoDropTM 1000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mulder, J., Wels, M., Kuipers, O. P., Kleerebezem, M. and Bron, P. A. (2018). Induction of Natural Competence in Genetically-modified Lactococcus lactis. Bio-protocol 8(13): e2922. DOI: 10.21769/BioProtoc.2922.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Transformation
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,923 | https://bio-protocol.org/exchange/protocoldetail?id=2923&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Micropropagation of Prickly Pear by Axillary Shoot Proliferation
LG Luisa Gutiérrez-Quintana
CZ Carlos Zúñiga-Rizo
AB Asdrúbal Burgos
LP Liberato Portillo
Published: Jul 5, 2018
DOI: 10.21769/BioProtoc.2923 Views: 5626
Edited by: Adam Idoine
Reviewed by: Jinping Zhao
Download PDF
Ask a question
Favorite
Cited by
Abstract
A protocol for the axillary bud proliferation of prickly pear (Opuntia; Cactaceae) is presented. This genus is widely used as a crop in the arid and semi-arid areas of the globe worldwide, providing numerous benefits for human and animal consumption. In vitro culture for axillary bud proliferation is of great use to obtain a large quantity of plants in a short period of time, with potential uses in production and for the preservation of endangered species of the Opuntia genus.
The optimal medium for Opuntia in vitro culture consists of Murashige and Skoog medium (MS) and L2 vitamins. To increase the yield of the axillary bud proliferation, we recommend the addition of plant growth regulators (PGRs). This work suggests a 15 d incubation in the medium with 2.2 mg/L of benzyl aminopurine (BA) after which the explants are transferred to the medium without PGRs. We explain as well how to adapt the plant to ex vitro conditions.
Keywords: Prickly pear In vitro culture Axillary bud proliferation Ex vitro adaptation
Background
The genus Opuntia (prickly pear) is one of the members of the Cactaceae family (Bravo-Hollis, 1978). Although it is native to the Americas, it currently grows in the wild and commercial plantations of the South of Europe, North of Africa, Australia, Middle East, West Asia and other regions of the world (Ochoa and Barbera, 1995; Kiesling and Metzing, 2017). Prickly pear has profound effects on the arid and semi-arid environments as well as the human communities that live in those areas because of its high biomass yields despite growing in drylands (Acevedo et al., 1983). In many of such areas, the genus Opuntia is exploited for a number of things. The young cladodes of Opuntia can be consumed as a vegetable; the fruit is eaten directly or processed into jelly, juice or sweets (Barba et al., 2017). The whole plant can be used for animal forage, living fence (Las Casas et al., 2017) and recently it started to be used commercially to produce biofuel (Aké Madera, 2014). In addition, the Opuntia genus has a number of bioactive and nutritionally valuable compounds (Betancourt et al., 2017; Melgar et al., 2017).
The advantages of in vitro culture include high proliferation rates and the production of pathogen-free plants (Shedbalkar et al., 2010). In their native environments, some Opuntia species are suffering losses in their populations, due to exploitation without replacement that has been carried out traditionally (Rocha-Flores et al., 2017). In vitro culture thus brings the possibility of recovering the populations of endangered plants (Torres-Silva et al., 2018), as well as a large scale production for agriculture. Here we present a protocol for plant in vitro culture of the Opuntia genus that includes the cytokinin benzyl aminopurine (BA).
Materials and Reagents
1,000 glass culture containers (100 ml) (Sigma-Aldrich, catalog number: B8648 )
Parafilm
Scapel
Petri dish
Nursery trays (International GreenHouse, catalog number: CN-PLG )
Humidity dome (International GreenHouse, catalog number: PR-DOME7 )
An Opuntia sp. young tender cladode
Dishwashing liquid
Deionized water
96% alcohol
60% sodium hypochlorite (NaClO) (household bleach)
1 N NaOH
1 N HCl
Tween 20 detergent
Benzyl aminopurine (6-benzyl aminopurine) (Sigma-Aldrich, catalog number: B3408 )
Activated charcoal (Sigma-Aldrich, catalog number: C9157 )
Agar-agar (Sigma-Aldrich, catalog number: A1296 )
Sucrose (C12H22O11) (Sigma-Aldrich, catalog number: S5391 )
Ammonium nitrate (NH4NO3) (Sigma-Aldrich, catalog number: A3795 )
Potassium nitrate (KNO3) (Sigma-Aldrich, catalog number: NIST193 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: 223506 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: 1374361 )
Potassium dihydrogen phosphate (KH2PO4) (Sigma-Aldrich, catalog number: PHR1330 )
EDTA (Na2EDTA) (Sigma-Aldrich, catalog number: PHR1068 )
Ferrous sulfate heptahydrate (FeSO4·7H2O) (Sigma-Aldrich, catalog number: 1270355 )
Manganese sulfate tetrahydrate (MnSO4·4H2O) (Sigma-Aldrich, catalog number: 229784 )
Zinc sulfate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: Z0251 )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: B6768 )
Potassium iodide (KI) (Sigma-Aldrich, catalog number: 746428 )
Sodium molybdate dihydrate (Na2MoO4·2H2O) (Sigma-Aldrich, catalog number: M1003 )
Cupric sulfate pentahydrate (CuSO4·5H2O) (Sigma-Aldrich, catalog number: C3036 )
Cobalt chloride hexahydrate (CoCl2·6H2O) (Sigma-Aldrich, catalog number: C2911 )
Myo-inositol (C6H12O6) (Sigma-Aldrich, catalog number: I7508 )
Thiamine hydrochloride (C12H17ClN4OS·HCl) (Sigma-Aldrich, catalog number: T1270 )
Pyridoxine (C8H11NO3) (Sigma-Aldrich, catalog number: P5669 )
MS + L2 vitamins salts (see Recipes)
Disinfection solution (see Recipes)
Maintenance medium (see Recipes)
Stimulation medium (see Recipes)
Rooting medium (see Recipes)
Substrate for ex vitro adaptation (see Recipes)
Note: All reagents are stored at room temperature and have a long shelf life (~10 years). Maintenance, stimulation and rooting media can be stored up to 15 d at 4 °C. Disinfection solution should be prepared and used the same day.
Equipment
Tweezers
Microwave oven
pH meter
Weighing balance
Autoclave
Laminar flow hood
Greenhouse
Growth chamber
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Tissue isolation and culture
Plant Science > Plant breeding > Micropropagation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,924 | https://bio-protocol.org/exchange/protocoldetail?id=2924&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Enzymatic Assays of Histone Decrotonylation on Recombinant Histones
Rachel Fellows
Patrick Varga-Weisz
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2924 Views: 6116
Edited by: David Cisneros
Reviewed by: Damián Lobato-Márquez
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
Class I histone deacetylases (HDACs) are efficient histone decrotonylases, broadening the enzymatic spectrum of these important (epi-)genome regulators and drug targets. Here, we describe an in vitro approach to assaying class I HDACs with different acyl-histone substrates, including crotonylated histones and expand this to examine the effect of inhibitors and estimate kinetic constants.
Keywords: Crotonylation Acetylation Butyrylation Histone deacetylase Enzyme Kinetic Chromatin
Background
Posttranslational modifications of histones are an important facet of genome regulation, including gene expression (for example see Pengelly et al., 2013; reviewed in Castillo et al., 2017). Histone modifications alter chromatin structure and/or regulate the binding of proteins, such as nucleosome remodeling factors (reviewed in Bannister and Kouzarides, 2011). Most histone modifications are reversible and can be removed enzymatically. For example, histone acetylation is removed by histone deacetylases (HDACs), of which there exist several classes. In recent years new histone lysine acylations, including succinylation, propionylation, butyrylation, hydroxybutyrylation and crotonylation have emerged as new alternative acylations to the canonical histone acetylation and the functional relevance of many of these newly discovered histone modifications have been demonstrated (reviewed in Sabari et al., 2017). In particular, histone crotonylation is associated with active gene expression and is thought to be influenced by the metabolic state of the cell (Sabari et al., 2015; Fellows et al., 2018). Class I histone deacetylases have recently been shown to also efficiently decrotonylate histones (Wei et al., 2017; Fellows et al., 2018).
Histone deacetylation assays are often performed using fluorescent acetyl substrates, such as BOC-lys(acetyl)-AMC, because this allows high-throughput in vitro approaches, suitable for drug discovery (Wegener et al., 2003a; 2003b and 2003c). However, we found that the analogous fluorescent crotonyl substrate BOC-lys(crotonyl)-AMC was inhibitory to histone deacetylases (Fellows et al., 2018). In this protocol, we describe a method for analysis of the activity of histone deacetylases with in vitro crotonylated histone H3, and we investigate the effect of an inhibitor and estimate kinetic parameters using an in vitro approach. This method does not require the use of radioisotopes. It also does not rely on fluorescent peptide mimics, and thus, the kinetic constants determined may be more representative of those found in vivo. The approach depends on the recognition of histone acylations, such as crotonylation, by specific antibodies. It is a versatile approach, which could be applied to study a variety of other histone modifications, enzymes, and inhibitors.
Materials and Reagents
8-strip 0.2 ml non-flex flat cap PCR tubes with individual lids (STARLAB INTERNATIONAL, catalog number: I1402-3700 )
250 ml and 1 L cylinders (Corning, catalog number: 3022P-250 , 3022P-1L )
Pre-cut extra thick blot paper, 7 x 8.4 cm (Bio-Rad Laboratories, catalog number: 1703966 )
Amersham Protran 0.45 µm nitrocellulose membrane, 300 mm x 4 m (GE Healthcare, catalog number: 10600002 )
5, 10 and 25 ml Costar® Stripette® serological pipettes (Corning, catalog numbers: 4487 , 4488 , 4489 )
50 ml Falcon® tubes, polypropylene (Corning, catalog number: 352070 )
Eppendorf® tubes 5.0 ml, Eppendorf QualityTM (Eppendorf, catalog number: 0030119401 )
X-ray film 18 x 24 cm double sided (Scientific Laboratory Supplies, catalog number: MOL7016 )
Transparent acetate sheet, e.g., colour copier transparency film (Interaction-Connect, Q-CONNECT®, catalog number: KF00533 )
Milli-Q® water
Recombinant human histone H3.1 protein, 1 mg/ml (New England Biolabs, catalog number: M2503S )
Note: Prepare aliquots (e.g., 10 µl aliquots) and store at -80 °C.
Recombinant catalytic domain of human p300 protein (Enzo Life Sciences, catalog number: BML-SE451-0100 ), 100 µg, 15.18 µM (exact concentration may vary by batch, check the tube)
Note: Prepare aliquots (e.g., 10 µl aliquots) and store at -80 °C.
Crotonyl-coenzyme A trilithium salt ~90% pure as per HPLC (Sigma-Aldrich, catalog number: 28007 )
Note: For acetylation we used: Acetyl-coenzyme A (Sigma-Aldrich, catalog number: ACOA-RO ROCHE). Prepare 5 mM stock solution in water, aliquot and store at -80 °C.
Manufacturer: Roche Diagnostics, catalog number: 10101893001 .
Trizma®-hydrochloride, ≥ 99.0% (Sigma-Aldrich, catalog number: T3253 )
Potassium chloride, 99.5-101.0% AnalaR NORMAPUR® (VWR, catalog number: 26764.298 )
UltraPureTM 0.5 M EDTA, pH 8.0 (Thermo Fisher Scientific, catalog number: 15575020 )
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
Glycerol, ≥ 99% (Sigma-Aldrich, catalog number: G5516 )
Dithiothreitol (DTT) (Thermo Fisher Scientific, catalog number: R0861 )
Magnesium chloride hexahydrate, ≥ 99.0% (Sigma-Aldrich, catalog number: M2670 )
Zinc sulfate heptahydrate (Sigma-Aldrich, catalog number: Z0251 )
Recombinant human HDAC1 protein (Active Motif, catalog number: 31908 ) 50 µg, 0.1 mg/ml, 1.78 µM (exact concentration may vary by batch, check tube)
Note: Prepare aliquots (e.g., 10 µl aliquots) and store at -80 °C.
2x Laemmli sample buffer (Bio-Rad Laboratories, catalog number: 1610737 )
Note: Add 2-mercaptoethanol to 5% v/v as described by supplier.
2-mercaptoethanol, ≥ 99.0% (Sigma-Aldrich, catalog number: M6250 )
Sodium Butyrate, 98% (Sigma-Aldrich, catalog number: 303410 )
Note: Prepare a 1 M solution in water, adjust to pH 7 and aliquot.
Precast RunBlue 4-12% Bis-Tris (Expedeon, catalog number: NBT41227 )
20x RunBlue MES run buffer (Expedeon, catalog number: NXB70500 )
PageRulerTM Prestained protein ladder, 10 to 180 kDa (Thermo Fisher Scientific, catalog number: 26616 )
10x Tris/glycine/SDS electrophoresis buffer (Bio-Rad Laboratories, catalog number: 1610732EDU )
UltraPureTM Tris buffer (Thermo Fisher Scientific, catalog number: 15504020 )
Glycine, ≥ 99.7% AnalaR NORMAPUR® (VWR, catalog number: 101196X )
Methanol, ≥ 99.8% AnalaR NORMAPUR® (VWR, catalog number: 20847.307 )
Sodium chloride, 99.5-100.5% AnalaR NORMAPUR® (VWR, catalog number: 27810.295 )
Bovine serum albumin, heat shock fraction pH 7 ≥ 98% (Sigma-Aldrich, catalog number: A9647 )
Anti-crotonyl-histone H3 lys18 (H3K18cr) rabbit polyclonal antibody (PTM Biolabs, catalog number: PTM-517)
Anti-rabbit IgG HRP linked whole antibody (GE Healthcare, catalog number: NA934-1ML )
Enhanced chemiluminescence (ECL) Western blotting reagents (GE Healthcare, catalog number: RPN2106 )
Synthetic crotonylated H3K18cr peptide 95% pure, lyophilized (TGGKAPR-Lys(Crotonyl)-QLATKAA-EDA-Biotin, BioGenes, Peptide 60556.1) (EDA is a spacer amino acid sequence)
Histone acylation buffer (see Recipe 1)
HDAC assay buffer (see Recipe 2)
MES Run buffer (see Recipe 3)
Tris glycine SDS (TGS) buffer (see Recipe 4)
Transfer buffer (see Recipe 5)
Tris-buffered saline, pH 7.5 (TBS) (see Recipe 6)
TBS with tween 20 (TBS-T) (see Recipe 7)
TBS-T with 3% (w/v) bovine serum albumin (TBS-T BSA) (see Recipe 8)
Equipment
Pipettes (Gilson, catalog numbers: F123602 , F123601 , F123600 , F144801 , model: P1000, P200, P20, P2)
Pipette controller PIPETBOY acu2 (VWR, INTEGRA Biosciences, catalog number: 612-2964 )
Fume hood (e.g., Protector Xstream Laboratory Hood, Labconco)
Milli-Q Water Purification System (Merck, catalog number: ZRXQ003WW )
GE Healthcare AmershamTM HypercasetteTM Autoradiography Cassette (GE Healthcare, catalog number: RPN11643 )
Vortex-genie 2 (Scientific Industries, model: Vortex-Genie 2 , catalog number: SI-0236)
Microcentrifuge (STARLAB INTERNATIONAL, model: Mini Fuge, catalog number: N2631-0007 )
Two T100TM Thermal Cyclers (Bio-Rad Laboratories, catalog number: 1861096 )
Amersham electrophoresis power supply EPS 301 (GE Healthcare, catalog number: 18113001 )
XCell SureLockTM Mini-Cell Electrophoresis System (Thermo Fisher Scientific, catalog number: EI0001 )
Transblot® SD semi-dry electrophoretic transfer cell (Bio-Rad Laboratories, catalog number: 1703940 )
MI-5 x-ray film processor (Jet X-Ray, model: Mi5 )
Epson expression 1680 scanner (Seiko Epson, model: Epson Expression 1680 )
Note: Equivalent models of equipment specified here may also be used.
Software
ImageJ version 1.50 b
Windows Excel 2016
Adobe Illustrator CC 2015.3
Graphpad Prism version 7.0
Epson Scan Software in professional mode
Note: Other versions of this software or similar software may be used but the instructions specified in the data analysis section may then differ.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fellows, R. and Varga-Weisz, P. (2018). In vitro Enzymatic Assays of Histone Decrotonylation on Recombinant Histones. Bio-protocol 8(14): e2924. DOI: 10.21769/BioProtoc.2924.
Download Citation in RIS Format
Category
Biochemistry > Protein > Posttranslational modification
Molecular Biology > Protein > Deacylation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,925 | https://bio-protocol.org/exchange/protocoldetail?id=2925&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction of RNA from Recalcitrant Tree Species Paulownia elongata
NR Niveditha Ramadoss
Chhandak Basu
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2925 Views: 6082
Edited by: Samik Bhattacharya
Reviewed by: Laia Armengot
Original Research Article:
The authors used this protocol in Jul 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2018
Abstract
Isolation of pure RNA is the basic requisite for most molecular biology work. Plants contain polyphenols and polysaccharides, which can interfere with isolation of pure RNA from them. Especially hardwood tree species like Paulownia elongata have surplus amount of RNA-binding alkaloids, proteins and secondary metabolites that can further complicate the process of RNA extraction. Paulownia elongata is a fast-growing tree species which is known for its role in environmental adaptability and biofuel research. Here we describe an economical, efficient and time-saving method (2 h) to extract RNA from leaf tissues of the tree Paulownia elongata. Lack of DNA contamination and good RNA integrity were confirmed using RNA Gel electrophoresis. The purity of RNA was confirmed using Nanodrop spectrophotometer that revealed an A260:A280 ratio of about 2.0. The purified RNA was successfully used in the downstream applications such as RT-PCR (Reverse Transcription PCR) and qPCR (quantitative PCR). This method could be used for RNA extraction from several other recalcitrant tree species.
Keywords: RNA Recalcitrant plant species RNA extraction Paulownia elongata TrizolTM
Background
Paulownia elongata is a widely distributed tree that belongs to the family of Paulowniaceae (Zhu et al., 1986). It is known for its high adaptability and rapid growth rate (Chaires et al., 2017). Paulownia woods are gaining demands from all over the world due to their high stability, low thermal conductivity, decay and rot resistance etc. (Ayrilmis and Kaymakci, 2013). Apart from this, P. elongata is also known to show tolerance to a variety of biotic and abiotic stresses (Chaires et al., 2017). However not many studies are done on understanding its stress tolerance mechanism, which requires extraction of high-quality RNA.
High-quality RNA refers to RNA that is devoid of any genomic DNA, phenols, polysaccharides, secondary metabolites, etc. that interfere with molecular biology techniques (Ouyang et al., 2014). Genomic DNA contamination will affect the detection and quantification of gene expression analysis such as RT-PCR, qPCR, northern blotting and RNA sequencing (Añez-Lingerfelt et al., 2009). This is because the reaction cannot differentiate between cDNA (complementary DNA) and genomic DNA, which will lead to overestimation of gene expression present (Añez-Lingerfelt et al., 2009). Phenols in RNA can oxidize to form quinones that will bind to nucleic acids irreversibly (Ouyang et al., 2014). Polysaccharides and secondary metabolites can co-precipitate and degrade the RNA in the sample thereby affecting the yield, quality and downstream applications of RNA (Ouyang et al., 2014; Ghawana et al., 2011). Since P. elongata leaves are known to have a high content of alkaloids and proteins (Kirov et al., 2014), isolation of pure RNA from them poses a challenge. Methods using spin columns did not yield a good amount of RNA (data not shown) from P. elongata leaves, and this could be due to the fact that spin columns efficiency decreases in the presence of alkaloids (Ouyang et al., 2014). CTAB (cetyltrimethyl ammonium bromide) based methods are spin-column free but are time-consuming (Ouyang et al., 2014). Thus, we combined the Trizol (InvitrogenTM) extraction method and spin-column based purification method in our protocol.
In our study we extracted high quantity RNA using a modified Trizol (InvitrogenTM) method. The quality of RNA was improved by using RNA Clean and Concentrator Kit (ZYMO RESEARCH, USA) with modifications. The RNA yield was measured using Nanodrop spectrophotometer (Figure 1). The Nanodrop measurement peaks can also analyze the presence of phenols or polysaccharides in the sample. In our study, the peak indicated that the RNA was free from phenol or polysaccharide contamination (Figure 1). The integrity of the RNA was further affirmed by running an RNA gel (Formaldehyde free RNA gel kit, Amresco, USA). The gel revealed that the RNA extracted using our method was free from genomic DNA contamination. Clear 28S and 18S rRNA bands were observed (Figure 2). The RNA was then successfully used in downstream applications like RT-PCR and qPCR which amplified the ubiquitin gene (Figures 3 and 4). In RT-PCR, we used cDNA synthesized from our P. elongata RNA as the template. The cDNA was amplified using ubiquitin qPCR primers. The ubiquitin primers used in the study are as follows:
Forward Primer- 5’ GTC AGG AGG AAC ACC TTC TTT 3’
Reverse Primer- 5’ CCT TGA CTG GGA AGA CCA TTAC 3’
Thus bands of about 250 bp were observed as a result of successful amplification of ubiquitin (Figure 3). Our method of RNA isolation not only has high and pure yield but is also time-saving. The entire procedure takes about 2 h.
Materials and Reagents
Nuclease-free microfuge tubes
Nuclease-free micropipette tips
Nitrile powder free gloves
Liquid nitrogen
RNase (ribonuclease) Away (Thermo Fisher Scientific, catalog number: 7000TS1 )
Trizol (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15596026 )
24:1 Chloroform:Isoamyl alcohol (Acros Organics, catalog number: 327155000 )
75% and 100% ethanol
Nuclease-free water (Not DEPC-treated) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 4387936 )
Turbo DNase (deoxyribonuclease) (Thermo Fisher Scientific, AmbionTM, catalog number: AM2238 )
RNA Clean and Concentrator kit (ZYMO RESEARCH, catalog number: R1015 )
Chilled isopropanol
Equipment
Pipettes (BioExpress, GeneMate, catalog number: P-3960-20 )
Mortar and pestle (Harold Import, HIC, catalog number: 43717 )
Vortexer (BioExpress, GeneMate, catalog number: S-3200-1 )
Refrigerated microcentrifuge (Labnet International, catalog number: C2500-R )
Water bath
-80 °C freezer
Fume hood (KEWAUNEE, model: H05_5460-00 )
Nanodrop Spectrophotometer (Thermo Fisher Scientific, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ramadoss, N. and Basu, C. (2018). Extraction of RNA from Recalcitrant Tree Species Paulownia elongata. Bio-protocol 8(14): e2925. DOI: 10.21769/BioProtoc.2925.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,926 | https://bio-protocol.org/exchange/protocoldetail?id=2926&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of TLR4 and CD14 Receptor Endocytosis Using Flow Cytometry
MS Michael S. Schappe
BD Bimal N. Desai
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2926 Views: 9076
Edited by: Ivan Zanoni
Reviewed by: Meenal SinhaBenoit Stijlemans
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
After recognizing extracellular bacterial lipopolysaccharide (LPS), the toll-like receptor 4 (TLR4)-CD14 signaling complex initiates two distinct signaling pathways–one from the plasma membrane and the other from the signaling endosomes (Kagan et al., 2008). Understanding the early stages of TLR4 signal transduction therefore requires a robust and quantitative method to measure LPS-triggered TLR4 and CD14 receptor endocytosis, one of the earliest events of LPS detection. Here, we describe a flow cytometry-based method that we used recently to study the role of the ion channel TRPM7 in TLR4 endocytosis (Schappe et al., 2018). The assay relies on stimulating the cells with LPS and measuring the cell surface levels of TLR4 (or CD14) at various time points using flow cytometry. Although we detail the method specifically for TLR4 and CD14 from murine bone marrow-derived macrophages, it can be readily adapted to evaluate receptor endocytosis in a variety of other signaling contexts.
Keywords: Toll-like receptor TLR TLR4 CD14 Endocytosis Macrophage BMDM Innate immunity LPS
Background
Innate immune cells, including macrophages and dendritic cells, employ a variety of pattern recognition receptors (PRRs) to survey their environments for danger- and pathogen-associated molecular patterns. Trafficking and signaling of PRRs from various subcellular compartments enables wider immune surveillance and has emerged as an important design principle of innate immunity (Brubaker et al., 2015). The detection of the bacterial endotoxin LPS is highly dependent on TLR4 and its co-receptor CD14. The endocytosis of the TLR4 complex requires CD14 and is essential for LPS-induced macrophage activation (Zanoni et al., 2011; Tan et al., 2015). Endocytosis of TLR4 is essential to activate secondary signaling complexes at the newly-formed ‘signaling endosome,’ which promotes interferon regulatory factor 3-dependent transcription through the signaling adaptor TIR-domain containing adapter-inducing interferon-β (TRIF) (Kagan et al., 2008). TLR4 endocytosis has been observed in macrophages, dendritic cells, and epithelial cells (Roy et al., 2014). Understanding the underlying mechanisms of this critical step in macrophage activation requires a robust and quantitative method to measure LPS-triggered TLR4 endocytosis. Here, we describe a version of a flow cytometry-based method that was initially reported by Kagan and colleagues (Kagan et al., 2008), and used by others, to monitor TLR4 endocytosis. We have used the method recently to study the role of transient receptor potential melastatin-like 7 (TRPM7), an ion channel, in TLR4 endocytosis (Schappe et al., 2018). The experimental logic of this method relies on measuring the loss of TLR4 and CD14 staining at the cell surface after LPS treatment. We stain LPS-treated cells with an anti-TLR4 (or anti-CD14) fluorophore-conjugated antibody without permeabilization. The fluorescence intensity acquired using flow cytometry reports the relative quantity of receptor resident in the plasma membrane (Figure 1). Although specific for TLR4 and CD14, the assay can be readily adapted to evaluate receptor endocytosis in a variety of other signaling contexts.
Figure 1. Schematic of TLR4 and CD14 endocytosis protocol. Experimental workflow described in protocol “Procedure”.
Materials and Reagents
Materials
Pipette tips
5 ml round, disposable round-bottom tube (FACS Tube) (Corning, Falcon®, catalog number: 352052 )
Aluminum foil (Genesee Scientific, catalog number: 88-101 )
0.2 μm bottle filter (Thermo Fisher Scientific, NalgeneTM, catalog number: 566-0020 )
6-well non-treated culture plates (Corning, catalog number: 3736 )
Sterile cell scrapers (Fisher Scientific, FisherbrandTM, catalog number: 08-100-240 )
Sterile individually packaged serological pipette (10 ml) (Greiner Bio One International, catalog number: 607160 )
Sterile individually packaged serological pipette (5 ml) (Greiner Bio One International, catalog number: 606160 )
1.7 ml microfuge Eppendorf tubes (Genesee Scientific, Olympus Plastics, catalog number: 24-281 )
NuncTM TripleFlaskTM Treated Cell Culture Flasks (Thermo Fisher Scientific, catalog number: 132867 )
Falcon® 50 ml Conical Centrifuge Tube (Corning, catalog number: 352098 )
Cell line
L-929 cells (ATCC, catalog number: CCL-1 )
Reagents
LPS EB-Ultrapure (lipopolysaccharide from E. coli O111:B4, InvivoGen, catalog number: tlrl-3pelps )
PBS (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Mouse TruStain fcXTM (anti-CD16/32) (BioLegend, catalog number: 101320 )
TLR4 [anti-mouse CD284] (PE) (clone: SA15-21; isotype: Rat IgG2a, κ) (BioLegend, catalog number: 145404 )
CD14 [anti-mouse] (APC) (clone: Sa2-8; isotype: Rat IgG2a, κ) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 17-0141-81 )
RPMI 1640 (Thermo Fisher Scientific, GibcoTM, catalog number: 11875093 )
Fetal bovine serum (heat-inactivated), certified, USA origin (Thermo Fisher Scientific, GibcoTM, catalog number: 10082147 )
Trypan blue (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
HBSS, no calcium, no magnesium (Thermo Fisher Scientific, GibcoTM, catalog number: 14170112 )
BSA (Bovine serum albumin) (Roche Molecular Systems, catalog number: 3116956001 )
DMEM, high glucose (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
BMDM Media (see Recipes)
Culture Media (see Recipes)
Treatment Media (see Recipes)
FACS Buffer (see Recipes)
L929-conditioned media (see Recipes)
Equipment
TC20 Automated cell counter (Bio-Rad Laboratories, catalog number: 1450102 )
Pipet-aid Pipette Controller (Drummond Scientific, catalog number: 4-000-101 )
4 °C Cold Room
4 °C Benchtop centrifuge
37 °C Cell Culture Incubator with CO2 control
Sterile cell culture hood
Flow Cytometer (BD, model: FACSCantoTM II , or equivalent)
Software
GraphPad Prism 7 (Graph Pad Software; La Jolla, CA USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Schappe, M. S. and Desai, B. N. (2018). Measurement of TLR4 and CD14 Receptor Endocytosis Using Flow Cytometry. Bio-protocol 8(14): e2926. DOI: 10.21769/BioProtoc.2926.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Macrophage
Cell Biology > Cell-based analysis > Cytosis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,927 | https://bio-protocol.org/exchange/protocoldetail?id=2927&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Root Colonizing Bacteria
Maged M. Saad
AZ Axel de Zélicourt
E Eleonora Rolli
L Lukas Synek
Heribert Hirt
Published: Jul 20, 2018
DOI: 10.21769/BioProtoc.2927 Views: 5157
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
Here we describe a simple method to quantify the number of viable bacteria (e.g., Enterobacter sp. SA187) that colonize the root system of Arabidopsis thaliana.
Keywords: Arabidopsis thaliana Colony forming unit Endophytes
Background
Colonization of roots by inoculated bacteria is an important step in the interaction between beneficial bacteria and the host plant. Enterobacter sp. SA187 is an endophytic bacterium that has been isolated from root nodules of the indigenous desert plant Indigofera argentea (Andrés-Barrao et al., 2017; Lafi et al., 2017). SA187 promotes the growth of the model plant Arabidopsis thaliana under diverse abiotic stresses such as salinity, drought or high temperature, demonstrating an important potential for application as Plant Growth Promoting Bacteria (PGPR) to improve abiotic resistance and yield of crops in arid lands. SA187 can colonize both roots and shoots of A. thaliana on ½ MS agar plates or in soil (de Zélicourt et al., 2018). To follow the fate of inoculant strain SA187 on the non-host plant A. thaliana, we applied a routinely cultivation-dependent method. This protocol has been successfully used to mounter the bacterial number colonized both root and shoot of the A. thaliana plant under different abiotic stresses (de Zélicourt et al., 2018).
Materials and Reagents
Mechanical pipette tips
1.5, 2 ml Eppendorf tube
Razor Blades (LabSupplyOutlaws, catalog number: 12-640 )
NuncTM 96 Microtiter Plates (Thermo Fisher Scientific, Thermo FisherTM, catalog number: 262162 )
Disposable Tissue Grinder Pestle (Corning, Axygen®, catalog number: PES-15-B-SI )
TissueLyser II .Gentech Biosciences (GENTECH BIOSCIENCES, catalog number: 85300 )
Lab Parafilm M (Labdirect, catalog number: PM992 )
100 mm Petri dish (Corning, Falcon®, catalog number: 351029 )
Square Petri Dish with Grid (SIMPORT, catalog number: D210-16 )
Stainless Steel Beads, 2.3 mm diameter (Bio Spec Products, catalog number: 11079123ss )
Seeds of Arabidopsis (Arabidopsis thaliana)
Murashige and Skoog Basal Salt Mixture (MS) (Sigma-Aldrich, catalog number: M5524 )
LB Broth with agar (Lennox) (Sigma-Aldrich, catalog number: L2897 )
Magnesium chloride anhydrous, ≥ 98% (Sigma-Aldrich, catalog number: M8266 )
Sodium chloride BioXtra, ≥ 99.5% (Sigma-Aldrich, catalog number: S7653 )
Potassium hydroxide (Sigma-Aldrich, catalog number: 484016 )
Silwet® L-77 (PhytoTechnology Laboratories, catalog number: S7777 )
Equipment
Tweezers with Sharp Tip (Labdirect, catalog number: 560.002.115 )
Top centrifuge (Eppendorf)
Vortex (VWR digital Vortex Mixer)
28 °C shaker-incubator
Growth chamber (Percival Scientific or similar types. Set the growth conditions to 22 °C, 16 h light/8 h dark cycles)
TissueLyser II© (QIAGEN)
Autoclave (TOMY SEIKO, model: LSX-500 or similar types)
Mechanical pipettes (Gilson, catalog numbers: F123601 (P200) and F123602 (P1000)
Analytical balance (0.1 mg resolution)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > Bacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,928 | https://bio-protocol.org/exchange/protocoldetail?id=2928&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Single and Multiplexed Gene Editing in Ustilago maydis Using CRISPR-Cas9
Mariana Schuster
CT Christine Trippel
PH Petra Happel
DL Daniel Lanver
SR Stefanie Reißmann
RK Regine Kahmann
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2928 Views: 8297
Reviewed by: Aksiniya AsenovaShahin S. Ali
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
The smut fungus Ustilago maydis is an established model organism for elucidating how biotrophic pathogens colonize plants and how gene families contribute to virulence. Here we describe a step by step protocol for the generation of CRISPR plasmids for single and multiplexed gene editing in U. maydis. Furthermore, we describe the necessary steps required for generating edited clonal populations, losing the Cas9 containing plasmid, and for selecting the desired clones.
Keywords: CRISPR-Cas9 Multiplexing Gene editing Ustilago maydis Smut fungi
Background
The basidiomycete fungus U. maydis is a model organism that has enabled important discoveries in topics like DNA repair and homologous recombination, mating, sexual development, secondary metabolism, filamentous growth, RNA transport and virulence (Holliday, 2004; Steinberg, 2007; Bakkeren et al., 2008; Holloman et al., 2008; Lanver et al., 2017; Niessing et al., 2018). U. maydis is a biotrophic plant pathogen that causes smut disease on maize. As a typical member of the large group of smut fungi its sexual development is intimately coupled with its ability to colonize plants. The popularity of U. maydis as a model organism resides in its short pathogenic life cycle that is completed in less than two weeks, its accessibility for forward and reverse genetics that includes the establishment of self-replicating plasmids (Tsukuda et al., 1988), the development of solopathogenic strains able to cause disease without mating and an available well-annotated genome (Kämper et al., 2006). In U. maydis, homologous recombination-based genome manipulations are very efficient, but become tedious when several genes have to be modified because the number of selectable markers is limited (Schuster et al., 2016). The most recent addition to the technical toolboxes for this organism has been the adaptation of the CRISPR-Cas9 genome editing technology (Schuster et al., 2016) and its development for multiplexed editing (Schuster et al., 2018). The CRISPR-Cas9 genome editing technology, developed from research in bacterial immune systems (Barrangou et al., 2007), has revolutionized molecular biology. The system allows efficient modification of almost any given sequence (Jinek et al., 2012) and has been established for a large number of organisms including filamentous fungi (Deng et al., 2017; Shi et al., 2017).
The CRISPR-Cas9 technology established for U. maydis is based on an all-in-one plasmid approach. A self-replicating plasmid (Tsukuda et al., 1988) is used as a backbone to provide the U. maydis codon-optimized Cas9 gene and the U6 promoter for sgRNA expression. This plasmid is unstable without selection and is rapidly lost (Figure 1 and Schuster et al. [2016]). The system proved very efficient for disruption of single genes reaching on average 70% of edited cells in progeny of one transformant (Schuster et al., 2016). A multiplexing version of the system was generated by using tRNA promoter-based expression cassettes that enabled the expression of several sgRNAs from the same plasmid (Schuster et al., 2018). This modification combined with elevated and longer expression of the Cas9 protein was used for the simultaneous disruption of five effector genes with 70% efficiency (Schuster et al., 2018). The multiplexed version of CRISPR-Cas9 has also been successfully applied for elucidating the contribution of oligopeptide transporters to virulence (Lanver et al., 2018).
Materials and Reagents
Consumables
Sterile pipette tip
Toothpick
60 mm x 15 mm round Petri dishes
Competent cells
E. coli competent cells e.g., One Shot TOP10 Chemically Competent E. coli (Thermo Fisher Scientific, catalog number: C404010 )
Plasmids and double-stranded DNA
pCas9_sgRNA_0 (Addgene, catalog number: 70763 or available on request) (Figure 1A)
pMS73 (Addgene, catalog number: 110629 or available on request) (Figure 1B)
Double-stranded DNA fragments can be purchased e.g., gBlocks (Integrated DNA Technologies) or GeneStrands (Eurofins Genomics)
Oligonucleotides 10 pmol/µl
oMS59: 5’ ATTCGTGATTTACACCAAACACGC 3’
oMS49: 5’ CCCCTCGTCTCGCGCCTCATTGGTCGAATTG 3’
oSR224: 5’ CTACACTCAGCACACGATGT 3’
Enzymes and buffers
Acc65I restriction endonuclease (New England Biolabs, catalog number: R0599S )
Gibson Assembly® master mix (New England Biolabs, catalog number: E2611S )
Phusion High-Fidelity DNA Polymerase (New England Biolabs, catalog number: M0530S ) or BioMix Red (Bioline, catalog number: BIO-25006 )
Kits
QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27104 )
Wizard SV Gel and PCR Clean-Up system (Promega, catalog number: A9281 )
Optional: Plate Seq Kit PCR (Eurofins genomics)
Antibiotics
Ampicillin 10 mg/ml stock in Milli-Q water (Carl Roth, catalog number: HP62.1 )
Carboxin 5 mg/ml stock in methanol (Sigma-Aldrich, catalog number: 45371 )
Reagents
Tryptone (BD Biosciences)
Yeast extract (BD Biosciences)
Sodium chloride (NaCl)
Peptone (BD Biosciences)
Sucrose (BD Biosciences)
Sorbitol (Sigma-Aldrich, catalog number: S1876 )
Bacto agar (BD Biosciences)
Potato Dextrose Broth (BD Biosciences)
Media (see Recipes)
Yeast extract tryptone (dYT) liquid medium + 100 µg/ml ampicillin
YT agar plates + 100 µg/ml ampicillin
YEPS light liquid medium +/- 2 µg/ml carboxin
Two layered regeneration agar light (RegAgar) plates (Bottom layer (10 ml) with 4 µg/ml carboxin and top layer (10 ml) without carboxin (Prepare fresh))
Potato dextrose (PD) agar plates +/- 2 µg/ml carboxin
Note: All media need to be autoclaved. For plates, 20 ml of media should be used per Petri dish.
Equipment
Note: No equipment from specific manufacturers is required. Any equivalent device can be used.
Pipettes
Computer with internet access
Plate incubators (28 °C, 37 °C)
Shakers (28 °C, 37 °C)
ThermoMixer (e.g., Eppendorf, model: ThermoMixer® C , catalog number: 5382000015)
Thermocycler (e.g., Analytik, Jena, Biometra, catalog number: 846-2-070-301 )
Tabletop centrifuge (e.g., Thermo Fisher Scientific, catalog number: 75008801 )
Software
No specific software is required. Any appropriate alignment program like CloneManager 9 Professional Edition (Scientific & Educational Software) or CLC Main Workbench (QIAGEN) can be used.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Schuster, M., Trippel, C., Happel, P., Lanver, D., Reißmann, S. and Kahmann, R. (2018). Single and Multiplexed Gene Editing in Ustilago maydis Using CRISPR-Cas9. Bio-protocol 8(14): e2928. DOI: 10.21769/BioProtoc.2928.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Genome editing
Molecular Biology > DNA > DNA modification
Microbiology > Microbial genetics > CRISPR-Cas9
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,929 | https://bio-protocol.org/exchange/protocoldetail?id=2929&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Embryonic Intravitreous Injection in Mouse
LC Liyuan Cui
YD Yupu Diao
JZ Jiayi Zhang
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2929 Views: 4799
Edited by: Miao He
Reviewed by: Ehsan Kheradpezhouh
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Axons of retinal ganglion cells (RGCs) relay visual information from the retina to lateral geniculate nucleus (LGN) and superior colliculus (SC), which are two major image-forming visual nuclei. Wiring of these retinal projections completes before vision begins. However, there are few studies on retinal axons at embryonic stage due to technical difficulty. We developed a method of embryonic intravitreous injection of dyes in mice to visualize retinal projections to LGN and SC. This study opens up the possibility of understanding early visual circuit wiring in mice embryos.
Keywords: Embryo Intravitreous injection Retinal projection Retinal axons Uterus
Background
Retinal axons begin to project to LGN and SC as early as embryonic day 14.5 (E14.5) in mice. To investigate axon projections in embryos, dyes need to be injected intravitreally while keeping the embryos alive for at least 10 h prior to injection surgery. Previous studies showed embryos can be cultured in vitro using mouse serum with oxygen. However, issues such as nutrition diversity, oxygen saturation and temperature regulation impinge the physiological condition of the embryo. In our research, we conducted intravitreous injection through uterine wall and eyelids in embryos and kept them in uterine after injection. Retinal axon projections to LGN and SC were nicely labeled from E15.5 to E18.5.
Materials and Reagents
50 ml centrifuge tube (Corning, catalog number: 430828 )
Cotton ball (Winner Medical Group, catalog number: 50401050 )
Sterile gauze (Winner Medical Group, catalog number: 016935 )
Suture needle (Ningbo Medical Needle Co., LTD, 7/0)
Microscope slides (Fisher Scientific, catalog number: 12-550-15 )
Microscope cover glass (Fisher Scientific, catalog number: 12-544-18 )
Dropper (Shanghai Baiqian Biotechnology, catalog number: J00082 )
Mouse (Shanghai SLAC, strain: C57BL/6J)
Redistilled water (ddH2O)
75% alcohol (Sinopharm Chemical Reagent, catalog number: 80176960 )
Mineral oil (Sigma-Aldrich, catalog number: M8410 )
Cholera toxin B (CTB), Alexa FluorTM 555 conjugate (Thermo Fisher Scientific, InvitrogenTM, catalog number: C22843 )
Isoflurane (RWD Life Science, catalog number: R510-22 )
Iodophor (Shanghai Likang Disinfectant Hi-Tech, catalog number: 310100 )
Lidocaine (MP Biomedicals, catalog number: 190111 )
Sucrose (AMRESCO, catalog number: M117 )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: 16005 )
Optimal cutting temperature compound (O.C.T) (Sakura, Tissue-Tek®, catalog number: 4583 )
Diamidino-phenyl-indole (DAPI) (Sigma-Aldrich, catalog number: D9542 )
AQUA-MountTM Mounting medium (Thermo Fisher Scientific, catalog number: 13800 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Sodium phosphate dibasic dihydrate (Na2HPO4·2H2O) (Sigma-Aldrich, Fluka, catalog number: 71645 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S5886 )
Ampicillin (INALCO, catalog number: 1758-9314 )
Trichloroacetaldehyde hydrate (Sinopharm Chemical Reagent, catalog number: 30037517 )
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S5011 )
Tris (Sangon Biotech, catalog number: A100826 )
Tris hydrochloride (Tris-HCl) (AMRESCO, catalog number: T0234 )
Triton X-100 (AMRESCO, catalog number: 0694 )
DAPI (Sigma-Aldrich, catalog number: D9542 )
0.1 M Phosphate buffer saline solution(PBS) (see Recipes)
Ampicillin solution (see Recipes)
0.9% Sodium chloride solution (see Recipes)
1% lidocaine solution (see Recipes)
10% Chloral hydrate solution (see Recipes)
0.2 M Phosphate buffer (PB) (see Recipes)
0.05 M Tris buffered saline (TBS) (see Recipes)
0.5%/0.05% Triton solution (see Recipes)
CTB solution (see Recipes)
4% paraformaldehyde solution (see Recipes)
30% sucrose solution (see Recipes)
DAPI solution (see Recipes)
Equipment
Glass Capillaries for Nanoliter 2010 (referred to as pipette in this manuscript) (World Precision Instruments, catalog number: 504949 )
Scissors (RWD Life Science, catalog number: S12003-09 )
Tweezers (VETUS, catalog number: ST-10 )
Ophthalmic scissors (World Precision Instruments, catalog number: 14003-G )
Water bath (Jinghong Experimental Equipment, model: XMID-8222 )
Nanoject II Auto-Nanoliter Injector (Drummond Scientific, model: Nanoject II , catalog number: 6584)
DC temperature controller (FHC, model: 40-90-8D )
Anesthesia machine (RWD Life Science, catalog number: R610 )
Flaming/brown micropipette puller (Sutter Instrument, model: P-97 )
Shaver (Codos, catalog number: KP-3000 )
Fluorescence microscope (Nikon Instruments, model: Eclipse Ni-U )
-80 °C freezer (Thermo Fisher Scientific, catalog number: ULT 1386-3-V42 )
Freezing microtome (Leica Biosystems, model: Leica CM1950 )
Software
ImageJ (NIH, USA)
Matlab (Mathworks Inc, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cui, L., Diao, Y. and Zhang, J. (2018). Embryonic Intravitreous Injection in Mouse. Bio-protocol 8(14): e2929. DOI: 10.21769/BioProtoc.2929.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Optic nerve
Neuroscience > Sensory and motor systems > Visual system
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
293 | https://bio-protocol.org/exchange/protocoldetail?id=293&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
GPCRs Interaction Measurement by Fluorescence Resonance Energy Transfer (FRET)
Manuel D. Gahete
RL Raúl M. Luque
JC Justo P. Castaño
Published: Vol 2, Iss 22, Nov 20, 2012
DOI: 10.21769/BioProtoc.293 Views: 9221
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
This is a protocol to determine the physical interaction of a G-protein coupled receptor (GPCR) with itself (homodimerization) or with other GPCR (heterodimerazation) using fluorescence resonance energy transfer (FRET). FRET is a distance-dependent interaction between the electronic excited states of two dye molecules (in this case, CFP and YFP) in which excitation is transferred from a donor molecule (CFP) to an acceptor (YFP) molecule without emission of a photon that can be used to determine interaction among YFP- and CFP-tagged GPCRs. Nowadays, FRET microscopy technique can be used to determine interaction between any proteins that retain biological function when expressed as a fusion to the fluorescent protein.
Keywords: Fluorescent microscopy Hormonal receptors Protein interaction Somatostatin High-resolution
Materials and Reagents
A cell line lacking the expression of the GPCR of interest
Expression plasmid containing E-CFP
Expression plasmid containing E-YFP
Expression plasmid containing E-YFP and E-GFP coupled in frame (CFP-YFP or Positive control)
Expression plasmid containing the first GPCR of interest tagged with E-CFP (GPCR1-CFP)
Expression plasmid containing the second GPCR of interest tagged with E-YFP (GPCR2-YFP)
Lipofectamine 2000
4% paraformaldehyde
PBS
Fluoromount
Poly-l-lysine
Equipment
Round coverslips coated with poly-l-lysine
Nikon Eclipse TE2000 E scope equipped with a 400 DCLP dichroic filter (Chroma)
ORCA II BT digital camera
Software
MetaMorph software (Imaging Corporation)
Image J software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gahete, M. D., Luque, R. M. and Castaño, J. P. (2012). GPCRs Interaction Measurement by Fluorescence Resonance Energy Transfer (FRET). Bio-protocol 2(22): e293. DOI: 10.21769/BioProtoc.293.
Download Citation in RIS Format
Category
Molecular Biology > Protein > Protein-protein interaction
Biochemistry > Protein > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,930 | https://bio-protocol.org/exchange/protocoldetail?id=2930&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Evaluating Working Memory on a T-maze in Male Rats
AH Ahmed M. Hussein
MB Mekite Bezu
VK Volker Korz
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2930 Views: 9098
Edited by: Edgar Soria-Gomez
Reviewed by: Arnau Busquets-GarciaShauna Parkes
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Working memory is short-term memory, so temporal improvement does not reflect the consolidation of a memory trace, rather the functionality of the underlying neuronal circuits and molecular signaling cascades. The administration of drugs–either one-time or through daily injection–can elucidate the underlying mechanisms. The T-maze is especially suitable for studying dopamine-dependent working memory, since it is less stressful than other tests, for example, water maze-based paradigms (Bezu et al., 2016 and 2017). Here, we present a training protocol for evaluating the underlying mechanisms that lead to the development of spatial working memory in rats. Our approach uses a T-maze, and it can be used to get high temporal resolution.
Keywords: Learning Behavior Rats Dopamine Working memory T-maze Cognition
Background
Spatial working memory is a short-time process where spatial information is encoded (Dudchenko, 2004) to influence subsequent behavior. Until now, only a few behavioral paradigms have been developed to test spatial working memory (Wenk, 2001). One of the most commonly used paradigms is the T-maze, which consists of a start arm and two arms arranged in a T-shape. In this paradigm, rats intrinsically tend to switch arm visits during consecutive trials, which suggests the rats remember the first arm that was visited, which is called “spontaneous alternation” (Lalonde, 2002). This tendency can be reinforced by baiting the arms with food when animals are mildly food deprived. Usually, protocols aim to train animals to reach a certain criterion of correct choices before pharmacological treatment starts or to accumulate the results over (Crawley and Goodwin, 1980; Deacon and Rawlins, 2006). We are interested in the role of the dopaminergic system in spatial learning and memory. For this reason, we treat animals with dopamine transporter (DAT) inhibitors, which block the reuptake of dopamine into the synapse and results in an increased concentration of extracellular dopamine. Further, the role of different dopamine receptors, like D1- and D2-like receptors, was elucidated through experiments that used receptor-specific agonists and antagonists. In this protocol, we use the T-maze for studying working memory, because this task is particularly sensitive to changes in the dopaminergic system compared with other working memory tests like water maze-based tasks (Bezu et al., 2017). Our overall goal is to synthesize of new compounds with high specificity to the target molecules and low side effects (Aher et al., 2016; Saroja et al., 2016; Sase et al., 2016; Hussein et al., 2017; Kristofova et al., 2018). Thus, we analyze a variety of brain structures involved in working memory processing, like the hippocampus, septum, basal forebrain, and prefrontal cortex (Chudasama and Robbins, 2004; Gruber et al., 2006) for regulation and modification of molecular signaling molecules and receptor complexes involved in memory processes (Baddeley, 1992). Rats were trained over a three day period, and we did not notice differences between pharmacologically treated rats and control rats that received additional training (up to six days) (Bezu et al., 2017).
Materials and Reagents
Custom made T-maze, made of Acrylic glass GS black (Bilek + Schüll, Vienna, Austria)
Male Sprague-Dawley rats (12-13 weeks old)
Note: They were bred and maintained in the Core Unit of Biomedical Research, Division of Laboratory Animal Science and Genetics, Medical University of Vienna.
Pharmacological agents
Note: They were applied in the experimental room since taking the animals to a different location causes novelty stress, that may potentiate the brief stress of intraperitoneal injection that we conducted.
Standard maintenance food (ssniff, R/M-H, Soest, Germany)
Food reward: e.g., food pellets were provided (Dustless Precision Pellets®, Rodent purified diet, 45 mg; Bio-Serv, catalog number: F0021 )
Incidin® Extra N (Ecolab, catalog number: 30 125 30 , PZN 002 357 95)
1% incidin (see Recipes)
Equipment
Three lamps (LED chip, 20 W) for indirect illumination (mounted on a stand placed 1.3-1.5 m above the floor directed to the ceiling); Illumination within arms: 40-50 lux
Recording camera (video camera, ABUS AUGUST BREMICKER SÖHNE KG, model: EyseoEcoLine, catalog number: TV7003 )
T-maze
For the apparatus see Figure 1. Reward food pellets were placed outside the T-maze scattered over the table to mask olfactory cues during training. Visual cues (equipment, walls and doors, Figure 1B) were identifiable around the maze. Additional cues like paper printouts of black and white figures were placed on room walls two meters above the floor (Sánchez-Santed et al., 1997). The maze was cleaned with 1% Incidin after the training of each animal to remove olfactory cues. Indirect illumination (from floor to ceiling) provides equal light intensities (40-50 lux) in each arm. Trials were monitored with a camera (mounted on the ceiling directly above the maze- and videos stored on a PC. A freely available video capture program (Debut Video Capture) was used to store the videos on a computer. Paper printouts of figures (210 mm x 279 mm) placed at room walls and equipment served as visual cues.
Figure 1. T-maze placed on a desk (A) and printouts of external cues placed on experimental room walls (B). Two-goal arms (50 cm long, 10 cm in width, with walls of 25 cm height) and the starting arm (70 cm) could be separated by a guillotine door (A). The maze was placed on a table with a height of 80 cm. The start arm was equipped with a starting box (20 cm in length) separated from the maze by a guillotine door. At the end of each goal arm, reward food pellets were provided in a small plastic cup (30 mm in diameter and 12 mm in height) to mask the food pellet.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hussein, A. M., Bezu, M. and Korz, V. (2018). Evaluating Working Memory on a T-maze in Male Rats. Bio-protocol 8(14): e2930. DOI: 10.21769/BioProtoc.2930.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,931 | https://bio-protocol.org/exchange/protocoldetail?id=2931&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Plasmid Extract from Budding Yeast (Saccharomyces cerevisiae)
Gal Haimovich
Published: Jul 20, 2018
DOI: 10.21769/BioProtoc.2931 Views: 10095
Edited by: Chao Jiang
Reviewed by: Samantha E. R. Dundon
Download PDF
Ask a question
Favorite
Cited by
Abstract
Plasmids are widely used tools in yeast research. In many cases, plasmid libraries are used in genetic screens or in yeast two hybrid screens. In such cases, it is necessary to extract plasmids carrying unknown genetic elements from positive clones that were isolated in the screen.
This is a simple protocol to extract plasmid DNA from budding yeast cultures (Robzyk and Kassir, 1992). The amount produced is small, but it is sufficient for PCR or for transformation into bacteria, where the plasmid can be amplified to provide sufficient amounts for downstream uses (e.g., restriction enzyme analysis, sequencing).
Keywords: Budding yeast Plasmid extraction Miniprep
Materials and Reagents
Pipette tips (1,000 μl, 200 μl, 20 μl)
15 ml test-tube or equivalent
1.7 ml tubes
0.5 ml PCR tubes
Kimwipes (e.g., KCWW, Kimberly-Clark, catalog number: 34120 )
Isolated yeast clone carrying the required plasmid
Difco Yeast nitrogen base without amino acid (e.g., BD, catalog number: 291940 )
Yeast Synthetic Drop-out medium supplements (Sigma-Aldrich)
Note: Choose drop-out supplement based on the required plasmid selection in yeast (e.g., Sigma-Aldrich, catalog number: Y1501 for drop-out without Uracil).
D-Glucose (e.g., Sigma-Aldrich)
Sucrose (e.g., Sigma-Aldrich)
Tris base (e.g., Sigma-Aldrich)
12.EDTA (e.g., Sigma-Aldrich)
Triton X-100
100% ethanol
70% ethanol
Ammonium acetate
HCl 1 N
NaOH 10 N
Nuclease-free water
Double distilled water
Ice
0.5 mm glass beads (e.g., MP Biomedicals, catalog number: 116540449-1kg )
Synthetic selective medium (see Recipes)
STET buffer (see Recipes)
7.5 M ammonium acetate (see Recipes)
Equipment
1,000 μl, 200 μl, 20 μl pipettes
Yeast incubator/shaker suitable for 15 ml tubes or equivalent
Refrigerated centrifuge suitable for 1.7 ml tubes
Vacuum aspirator (optional)
Heating block set to 100 °C
Vortex mixer (optional: with multi-tube head ) (e.g., VWR, catalog number: 10153-836 )
Oven (> 160 °C)
-20 °C freezer
Glass beaker (use appropriate size to amount of glass beads; a 1 L beaker is sufficient for 1 kg beads)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > DNA
Molecular Biology > DNA > DNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,932 | https://bio-protocol.org/exchange/protocoldetail?id=2932&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessing Experience-dependent Tuning of Song Preference in Fruit Flies (Drosophila melanogaster)
XL Xiaodong Li
HI Hiroshi Ishimoto
AK Azusa Kamikouchi
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2932 Views: 6179
Edited by: Zinan Zhou
Reviewed by: Xiaoliang Zhao
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
In songbirds and higher mammals, early auditory experience during childhood is critical to detect and discriminate sound patterns in adulthood. However, the neural and molecular nature of this acquired ability remains elusive. Here, we describe a new behavioral paradigm with Drosophila melanogaster to investigate how the auditory experience shapes sound perception. This behavioral paradigm consists of two parts: training session and test session. In the training session, we keep the flies singly in a training capsule and expose them to training sound for 6 days after eclosion. After the training session, flies are subjected to the test session, in which the mating behaviors of flies are monitored upon sound playback. As the training and test sounds, we use two types of artificial sound, which correspond to the pattern of conspecific and heterospecific courtship songs of fruit flies. By applying this method, we can measure how the acoustic experience with the conspecific song as a young adult sharpens the song preference and mate selection as a breeding adult in the fruit fly.
Keywords: Courtship song Preference Acoustic experience Sound perception Drosophila
Background
For successful mating, animals actively evaluate candidate partners for mating by detecting and preferring species-specific sensory signals. In higher animals, both innate instinct and social experience acquired after birth contribute to the mating preference. Indeed, in species such as birds, fishes, sheep and goats, innate preference is dominant, while later social interactions with parents or siblings fine-tune the phenotypic discrimination and mating preference (Owens et al., 1999; Ten Cate and Vos, 1999; Kozak et al., 2011).
The fruit fly, Drosophila melanogaster, has been an invaluable model to study the neural mechanism underlying mating behaviors at the level of genes, cells, and circuits (Kazama, 2015). A male fly courts a female with a stereotyped ritual before he succeeds in copulation (Yamamoto and Koganezawa, 2013). Both male and female flies have the innate ability to evaluate species-specific sensory signals emitted during this courtship ritual, such as visual cues and pheromones, as well as courtship songs, and choose a conspecific mating partner (Zhou et al., 2014; Clowney et al., 2015; Kallman et al., 2015). Although it is traditionally believed that the courtship behavior of flies is innate (Hall, 1994; Baker et al., 2001; Auer and Benton, 2016), the programmed courtship circuitry is susceptible to variables in development such as sleep deprivation (Kayser et al., 2014), social isolation (Kim and Ehrman, 1998; Pan and Baker, 2014), and auditory experience (Li et al., 2018). The courtship behavior of flies is also affected by previous courtship outcomes, which has been used as a courtship conditioning assay to evaluate learning and memory in male flies (Keleman et al., 2012; Koemans et al., 2017). Moreover, researchers developed a sensitive system to record and analyze the courtship songs (Arthur et al., 2013). By combining this system with computational modeling, Coen et al. (2014) found that males courtship song can be modulated by dynamic sensory experience acutely. However, to what extent social experience and developmental plasticity contribute to the perception of the courtship song is not well understood.
Here we report a behavioral paradigm to assess how an experience of hearing the conspecific song as a young adult sharpens the song preference and mate selection as a breeding adult in the fruit fly. This paradigm consists of training session and test session. At the training session, we expose single males or females to an artificial courtship song. At the test session, we use the male-female courtship behavior and male-male chaining behavior to measure the response in females and males, respectively. By combining this brand-new behavioral paradigm with sophisticated genetic tools established in flies, such as the GAL4/UAS binary expression system to manipulate individual genes and neurons, this novel approach gives the potential to clarify the neural mechanism on how experience-dependent tuning of the mating preference is built upon both innate and experience-dependent auditory systems.
Materials and Reagents
Pipette tips, with volumes of 1 ml (FUKAEKASEI and WATSON, catalog number: 110-706C )
Pasteur pipette (Borosilicate Glass Pasteur Pipette, Corning, catalog number: 7095D-5X , 6.5 mm in outer diameter, 146 mm in length)
Stocking mesh made of nylon and polyurethane (Small pieces of stocking mesh)
Plastic insect screen mesh (Mesh size 24: 0.84 mm)
Rubber sheet (10 mm thick)
Mending tape
Empty plastic vials (Chiyoda Science, catalog number: KFB-1M ) for cold anesthesia
Drosophila melanogaster, fly strains to be tested of both sexes
Ice for anesthesia
Artificial pulse song (Figure 1) (Supplemental audio file 1, Supplemental audio file 2)
A sound file comprised of the repetition of 1-sec pulse burst and a subsequent 2-sec pause, in which the inter-pulse interval (IPI) is 35 msec (“conspecific song”, Supplemental audio file 1) or 75 msec (“heterospecific song” Supplemental audio file 2). Intra-pulse frequency of both songs is 167 Hz. Use Audacity to make the artificial pulse songs.
Fly food (Standard yeast-based media) (see Recipes)
Figure 1. Artificial pulse song. A. A scheme of a sound file. Inter-pulse interval (IPI) is set to be 35 msec or 75 msec. B. Preparation of a sound file with Audacity. A series of magnified views are shown.
Equipment
Loudspeakers (8 ohm, Ø 185 mm, Fostex, Foster Electric, catalog number: FF225WK )
Daito Voice AR-10N, 8 ohm, Ø 100 mm, Tokyo Cone Paper MFG. Co. Ltd., Saitama, Japan
Stereo zoom microscope (Leica Microsystems, model: Leica S6 E )
Two pairs of forceps (Roboz Surgical Instrument, Dumont, model: Dumostar No. 5, catalog number: RS-4976 ) for ablating wings from flies
Aspirator
A custom-made flexible aspirator to pick up flies gently. Assembled from a mouthpiece (Pipette tips, with volumes of 1 ml), latex tube (about 50 cm), mesh, and a glass tube (about 5 cm) to keep flies (Pellegrino et al., 2010).
Sound nest (Figure 2A)
A custom-made latticework of a container to hold the training capsules during the training session. We used cardboard dividers of a freezer box (AS ONE, catalog number: 1-1473-01 ). Each well of the cardboard dividers holds a training capsule.
Training capsule (Figure 2B)
A custom-made capsule made of a glass tube cut out from a Pasteur pipette, two pipette tips, a piece of stocking mesh and pieces of mending tape. Cut pipette tips (1 ml) to make their larger ends about 20 mm long. Hook two of these 20 mm pieces to a glass tube at its both ends. The size of a glass tube is about 27 mm long, with the internal diameter of 5.2 mm and the external diameter of 6.5 mm. Seal both exits of the glass tube with a piece of stocking mesh (made of nylon and polyurethane), which allowed free passage of air but not the fly. A thin layer of fly food, standard Drosophila yeast-based medium, is paved at the bottom of the glass tube.
Digital power amplifier (20 W, Lepai, model: LP-2020A+NFJ Edition )
Note: A simple and inexpensive power amplifier. Other amplifier can also be used.
Soundproof box (Sonora Technology Co. Ltd, Aichi, Japan) (Figure 2C)
Note: A custom-made steel soundproof box with a ventilating hole.
Figure 2. Training setup. A. Sound nest to hold training capsules. B. Training capsule. Two pipette tips sealed with stocking mesh cover both open ends of a glass tube (upper). A schematic of a training capsule during the training session (lower). C. Soundproof boxes for the training (left), each of which contains a loudspeaker and sound nest (right).
Tablet PC (DOSPARA, Windows 8.1, model: Diginnos DG-D08IWB )
Note: A simple and inexpensive Tablet PC. Other device to playback a sound file can also be used.
Female copulation plate (Figure 3A)
A custom-made apparatus made of Plexiglas, which consists of eight circular chambers (15 mm in diameter, 3 mm in depth) with their bottom covered with a circular sheet of insect screen mesh for sound penetration. It is made from a pair of transparent Plexiglas panels with eight holes (chamber and base) sandwiching the insect screen mesh and a circular shaped cover Plexiglas (70 mm in diameter, 1 mm in depth). The cover plate has a loading hole at the rim (3 mm in diameter) in order to load the flies in rotation. A screw fixes all the elements through the center hole (4 mm in diameter).
Rubber support
A custom-made apparatus to support the female copulation plate. Make a hole (70 mm in diameter) in the middle of a rubber sheet to hold the female copulation plate.
Male-male chaining chamber (Figure 3B)
Note: This is a custom-made apparatus made of Plexiglas. See Inagaki et al., 2010 for detailed structure and size of the apparatus.
Web camera (Logitech, Logicool®, model: HD Webcam C270 )
Small LED light array to illuminate female copulation chambers (Figure 5B)
LED light box (ComicMaster Tracer, Too Marker Products, Japan)
Behavior assay room with controlled temperature (25 ± 1 °C) and humidity (50 ± 10%)
Thermometer for monitoring the temperature at the point of the experiment
Ultrasonic washing machine for washing the acoustic behavior chambers (AS ONE, model: ASU-6 )
Figure 3. Apparatus for behavioral assays. A. Copulation plate for the female copulation assay. B. Apparatus for the male-male chaining assay.
Software
Audacity (The Audacity Team) (https://www.audacityteam.org)
Free open source, cross-platform audio software
Windows Media Player (Microsoft)
Other media player can also be used.
Logitech Webcam Software
Provided with the web camera
ChaIN (http://www.bio.nagoya-u.ac.jp/~NC_home/chain_E.html)
Custom-made software (Yoon et al., 2013)
R (https://www.r-project.org)
Free open source, cross-platform for statistical computing and graphics
Procedure
Preparing flies
Trainee
Culture flies at 25 ± 1 °C and 50 ± 10% relative humidity in a 12-h light/dark cycle.
Collect virgin females and virgin males within 8 h after eclosion under ice anesthesia.
Clip the male wings with forceps (Figure 4). Keep the female wings intact.
Subject these flies immediately to the training session after recovering from the anesthesia.
Figure 4. Operation for clipping fly wings. Flies are anesthetized on an ice-cold aluminum plate. Wings of male flies are clipped at their bases (dotted line).
Partner male
Use wild-type male flies for the female copulation assay as partner males. Clip the wings of these males right after eclosion.
Keep them singly in a plastic vial with fly food at 25 °C in a 12-h light/dark cycle until experiments. Transfer each fly to a new plastic vial with fly food every 2 to 3 days, but not on the day of experiment. Use 7-day old males for the female copulation assay.
Training session
Keep the room temperature at 25 ± 1 °C and relative humidity 50 ± 10%.
Introduce each fly gently to a training capsule on the day of eclosion.
Set training capsules in the sound nest.
Place the sound nest in front of a loudspeaker ( FF225WK ). One of the mesh-ends of each training capsule faces the loudspeaker, so that sound is delivered to each chamber with minimal disturbance. The distance between the loudspeaker and the near end of the training capsules is 24 mm.
Start an artificial pulse song (conspecific song or heterospecific song) playback for experienced flies. For Naïve flies, no sound is played. The mean baseline-to-peak amplitude of sound particle velocity is 8.6 mm/sec when measured at the near end of the training capsules, and 6.6 mm/sec at the far end of the training capsule. The sound particle velocity is identical for all training sounds.
The artificial pulse song, 3-min long, is stored in a WAV format audio file (monaural, 44,100 Hz, 32-bit float). Play the audio file repeatedly with Windows media player for 6 days. Renew food in each training capsule every 36 h.
After the 6-day training, collect male flies into a vial containing fly food in a group of seven without anesthesia until male-male chaining assay. Keep the female flies in the training capsules singly without sound playback until the female copulation assay.
Test session
Notes:
Keep the room temperature at 25 ± 1°C and relative humidity 50 ± 10%.
Perform behavioral tests within 4 h after light onset on the 7th day.
In female copulation assay, the intactness of female wings is critical for copulation success. Ruffled or crippled wings will lower the copulation success rate. Load flies (one pair into each chamber) rapidly. To avoid early copulation and to give all the fly pairs a universal start in interaction, shake the chamber after each action of puffing.
Female copulation assay (Figure 5)
Use trained females and partner males in this assay.
Transfer a pair of female and male flies gently with an aspirator through the loading hole into one of the eight chambers in the copulation plate rapidly without anesthesia. For each recording, load up to 8 pairs of flies (Figure 5A).
Immediately after the transfer of the flies, insert the apparatus to a rubber support and place it over a loudspeaker (Daito Voice AR-10N). The loudspeaker is placed 39 mm under the chambers. Two small LED light arrays are placed at both sides of the loudspeaker to illuminate the female copulation chambers (Figure 5B).
Figure 5. Female copulation assay. A. Loading flies into a chamber. A fly pair is loaded into one of eight copulation chambers by using an aspirator. Each chamber has a test female and a partner male. The copulation plate is inserted into a hole of the rubber support. B. Assay setup. Rubber support holding the copulation plate is placed over a loudspeaker with appropriate distance. C. Example graph of song response of female flies. Cumulative copulation rate in the heterospecific song test after training is plotted. Naïve group (no sound during training) and experienced groups (trained with conspecific song or heterospecific song) are shown. N, Naïve; E, experienced. N.S., not significant, P > 0.05; ***P < 0.001; Kruskal–Wallis test versus Naïve group.
Start the sound playback and video recording simultaneously. The particle velocity received at the apparatus is adjusted as 9.2 mm/sec.
Record the behaviors of flies for 30 min with a web camera (Logitech, Logicool®) with a video capture software (Logitech Webcam Software) (Video 1).
Video 1. A video clip showing female copulation assay. Copulation started in a pair out of eight pairs.
Male-male chaining assay (Figure 6)
Use trained males in this assay. See Inagaki et al., 2010 for a protocol.
Data analysis
Statistical analysis is performed with R (version 3.0.3). All data related to this study are already published in Li et al., 2018.
Female copulation assay
Evaluate behavioral response of females to the artificial pulse songs by observing the copulation latency (time to mating from the test started) of a female paired with a partner male in the chamber. Here, copulation is defined by observing the specific features as follows: (1) females permit a male to mount them for more than 1 min, (2) females reduce their locomotor activity with the mounting partner, and (3) females part her wings during the mounting (Manning, 1967; Yamada et al., 2018).
This copulation latency is analyzed manually from the video playback.
Figure 6. Male-male chaining assay. A. Six males are loaded into a chamber by using an aspirator. Put the chamber in front of a loudspeaker. B. Illustration depicts the male-male chaining assay setup (left). An actual image of male-male chaining behavior (right). C. Example graph of song response of male flies. The time-courses of the chain index in response to playback of heterospecific song are shown (Left). Sound playback starts at 5 min. The bold line and ribbon represent the average value and standard error, respectively. The box plot shows the summed chain index between 5-min and 11.5-min (right). N, Naïve group with no sound training (blue); E, experienced group with conspecific song training (red) or heterospecific song training (orange). N.S., not significant, P > 0.05; ***P < 0.001; Mann-Whitney U test versus Naïve group.
Male-male chaining assay
Measure the number of the follower flies in chains as the chain index using the custom-made software: ChaIN version 3 (Ishikawa et al., 2017).
Recipes
Standard fly food
Use the following ingredients for 1 L of standard fly food:
Ingredient
Quantity
Agar
8 g
Cornmeal
40 g
Yeast
45 g
Glucose
100 g
Propionic acid
4 ml
10% Methyl p-Hydroxybenzoate in 70% EtOH
3 ml
Acknowledgments
This work was supported by MEXT KAKENHI Grant-in-Aid for Scientific Research (B) (Grant 16H04655 to AK), the Grants-in-Aid for Scientific Research on Innovate Areas "Evolinguistics" (Grant 18H05069 to AK), Challenging Research (Exploratory) (Grant 17K19450 to AK), Grant-in-Aid for Scientific research (C) (15K07147 to HI), JSPS KAKENHI Grant-in-Aid for JSPS Fellows (18J15228 to XL), and Inamori Foundation Research Grant, Japan (HI). This protocol was adapted from procedures published in Li et al. (2018). Figures 2, 3, 5, and 6 were modified and reproduced with permission from Li et al. (2018).
Competing financial interests: The authors declare no competing financial interests.
References
Arthur, B. J., Sunayama-Morita, T., Coen, P., Murthy, M. and Stern, D. L. (2013). Multi-channel acoustic recording and automated analysis of Drosophila courtship songs. BMC Biol 11: 11.
Auer, T. O. and Benton, R. (2016). Sexual circuitry in Drosophila. Curr Opin Neurobiol 38: 18-26.
Baker, B. S., Taylor, B. J. and Hall, J. C. (2001). Are complex behaviors specified by dedicated regulatory genes? Reasoning from Drosophila. Cell 105(1): 13-24.
Clowney, E. J., Iguchi, S., Bussell, J. J., Scheer, E. and Ruta, V. (2015). Multimodal chemosensory circuits controlling male courtship in Drosophila. Neuron 87(5): 1036-1049.
Coen, P., Clemens, J., Weinstein, A. J., Pacheco, D. A., Deng, Y. and Murthy, M. (2014). Dynamic sensory cues shape song structure in Drosophila. Nature 507(7491): 233-237.
Hall, J. C. (1994). The mating of a fly. Science 264(5166): 1702-1714.
Inagaki, H. K., Kamikouchi, A. and Ito, K. (2010). Protocol for quantifying sound-sensing ability of Drosophila melanogaster. Nat Protoc 5(1): 26-30.
Ishikawa, Y., Okamoto, N., Nakamura, M., Kim, H. and Kamikouchi, A. (2017). Anatomic and physiologic heterogeneity of subgroup-A auditory sensory neurons in fruit flies. Front Neural Circuits 11: 46.
Kallman, B. R., Kim, H. and Scott, K. (2015). Excitation and inhibition onto central courtship neurons biases Drosophila mate choice. Elife 4: e11188.
Kayser, M. S., Yue, Z. and Sehgal, A. (2014). A critical period of sleep for development of courtship circuitry and behavior in Drosophila. Science 344(6181): 269-274.
Kazama, H. (2015). Systems neuroscience in Drosophila: Conceptual and technical advantages. Neuroscience 296: 3-14.
Keleman, K., Vrontou, E., Krüttner, S., Yu, J. Y., Kurtovic-Kozaric, A. and Dickson, B. J. (2012). Dopamine neurons modulate pheromone responses in Drosophila courtship learning. Nature 489(7414): 145-149.
Kim, Y. K. and Ehrman, L. (1998). Developmental isolation and subsequent adult behavior of Drosophila paulistorum. IV. Courtship. Behav Genet 28(1): 57-65.
Koemans, T. S., Oppitz, C., Donders, R. A. T., van Bokhoven, H., Schenck, A., Keleman, K. and Kramer, J. M. (2017). Drosophila courtship conditioning as a measure of learning and memory. J Vis Exp (124).
Kozak, G. M., Head, M. L. and Boughman, J. W. (2011). Sexual imprinting on ecologically divergent traits leads to sexual isolation in sticklebacks. Proc Biol Sci 278(1718): 2604-2610.
Li, X., Ishimoto, H. and Kamikouchi, A. (2018). Auditory experience controls the maturation of song discrimination and sexual response in Drosophila. Elife 7: e34348.
Manning, A. (1967). The control of sexual receptivity in female Drosophila. Anim Behav 15(2): 239-250.
Owens, I. P., Rowe, C. and Thomas, A. L. (1999). Sexual selection, speciation and imprinting: separating the sheep from the goats. Trends Ecol Evol 14(4): 131-132.
Pan, Y. and Baker, B. S. (2014). Genetic identification and separation of innate and experience-dependent courtship behaviors in Drosophila. Cell 156(1-2): 236-248.
Pellegrino, M., Nakagawa, T. and Vosshall, L. B. (2010). Single sensillum recordings in the insects Drosophila melanogaster and Anopheles gambiae. J Vis Exp (36): 1-5.
Ten Cate, C. and Vos, D.R. (1999). Sexual imprinting and evolutionary processes in birds: a reassessment. Adv Study Behav 28: 1-31.
Yamada, D., Ishimoto, H., Li, X., Kohashi, T., Ishikawa, Y. and Kamikouchi, A. (2018). GABAergic local interneurons shape female fruit fly response to mating songs. J Neurosci 38(18): 4329-4347.
Yamamoto, D. and Koganezawa, M. (2013). Genes and circuits of courtship behaviour in Drosophila males. Nat Rev Neurosci 14(10): 681-692.
Yoon, J., Matsuo, E., Yamada, D., Mizuno, H., Morimoto, T., Miyakawa, H., Kinoshita, S., Ishimoto, H. and Kamikouchi, A. (2013). Selectivity and plasticity in a sound-evoked male-male interaction in Drosophila. PLoS One 8(9): e74289.
Zhou, C., Pan, Y., Robinett, C. C., Meissner, G. W. and Baker, B. S. (2014). Central brain neurons expressing doublesex regulate female receptivity in Drosophila. Neuron 83(1): 149-163.
Copyright: Li et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Li, X., Ishimoto, H. and Kamikouchi, A. (2018). Assessing Experience-dependent Tuning of Song Preference in Fruit Flies (Drosophila melanogaster). Bio-protocol 8(14): e2932. DOI: 10.21769/BioProtoc.2932.
Li, X., Ishimoto, H. and Kamikouchi, A. (2018). Auditory experience controls the maturation of song discrimination and sexual response in Drosophila. Elife 7: e34348.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,933 | https://bio-protocol.org/exchange/protocoldetail?id=2933&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Muscle Function Assessment Using a Drosophila Larvae Crawling Assay
YP Yanina Post
AP Achim Paululat
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2933 Views: 6185
Edited by: Vivien Jane Coulson-Thomas
Reviewed by: tarsis ferreira
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
Here we describe a simple method to measure larval muscle contraction and locomotion behavior. The method enables the user to acquire data, without the necessity of using expensive equipment (Rotstein et al., 2018). To measure contraction and locomotion behaviour, single larvae are positioned at the center of a humidified Petri dish. Larval movement is recorded over time using the movie function of a consumer digital camera. Subsequently, videos are analyzed using ImageJ (Rueden et al., 2017) for distance measurements and counting of contractions. Data are represented as box or scatter plots using GraphPad Prism (©GraphPad Software).
Keywords: Locomotion Video analysis Drosophila melanogaster Crawling Muscle contraction
Background
It is well known that despite other factors, the composition of the surrounding extracellular matrix (ECM) is of great relevance for proper organ functionality. Changes in its composition can ultimately lead to organ malfunction or failure. Using the muscles of third instar wandering larvae as a model, we can assess the influence of the concentration of single ECM proteins on meshwork flexibility or strength with larval locomotion behavior as a readout. In general, this is also possible for first or second instar larvae, but we decided to use wandering third instar larvae due to their large body size. For precise aging of Drosophila larvae, we refer to the descriptions given by Demerec (1950).
A wide range of methods for measuring Drosophila melanogaster larvae crawling has arisen in recent years. Techniques such as FIM2c (Risse et al., 2017) enable the user to study locomotion in a detailed manner; however, they require a specialized set of equipment. The simple test described herein allows the recording of differences in crawling speed and muscle contractibility with tools that can most likely be found in every laboratory or students classroom. The method is based on a protocol published by Nichols et al. (2012). However, instead of using agar-filled plates, we conducted our experiments in humidified, empty Petri dishes. Thereby, we eliminate the problem of larvae digging into the agar, which can negatively influence the measurement of Z-direction crawling, leading to a loss of information.
Materials and Reagents
Polystyrene Petri dish 92 x 16 mm with ventilation cams (SARSTEDT, catalog number: 82.1473.001 )
Paintbrush, Marabu Universal round No. 1 or comparable (Marabu, catalog number: 4007751346186 )
Graph paper (0.2 cm2 grids) (LANDRÉ, catalog number: 100050441 or comparable)
Third instar wandering larvae of respective strains (e.g., w1118, BL3605)
Tap water
Equipment
QuickMistTM Spray bottle (Dynamo, catalog number: 605144 )
Stereomicroscope (ZEISS, model: Stemi 2000-C ) with an attached light source (SCHOTT, model: KL 200 LED )
Canon EOS 1000D (Canon, model: EOS 1000D ) (or similar camera with attachable microscope tube and video function. Alternatively, any digital camera with capability to focus objects in the distance range of 5-10 cm and video function is suitable. A tripod or reproduction stand should be at hand)
Software
FIJI 2.0.0 (Schindelin et al., 2012) or ImageJ 2.0.0 (Rueden et al., 2017)
GraphPad Prism 5 (©GraphPad Software) or comparable software with a scatter plot or box plot tool (The R Project for Statistical Computing, R Core Team (2013))
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Post, Y. and Paululat, A. (2018). Muscle Function Assessment Using a Drosophila Larvae Crawling Assay. Bio-protocol 8(14): e2933. DOI: 10.21769/BioProtoc.2933.
Rotstein, B., Post, Y., Reinhardt, M., Lammers, K., Buhr, A., Heinisch, J. J., Meyer, H. and Paululat, A. (2018). Distinct domains in the matricellular protein Lonely heart are crucial for cardiac extracellular matrix formation and heart function in Drosophila. J Biol Chem 293(20): 7864-7879.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Myofiber
Developmental Biology > Morphogenesis > Motility
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,934 | https://bio-protocol.org/exchange/protocoldetail?id=2934&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorophore-Based Mitochondrial Ca2+ Uptake Assay
CP Charles B. Phillips
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2934 Views: 6465
Edited by: Gal Haimovich
Reviewed by: José M. DiasPia Giovannelli
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
The physiological importance of mitochondrial calcium uptake, observed in processes such as ATP production, intracellular calcium signaling, and apoptosis, makes desirable a simple, straightforward way of investigating this event with unambiguous results. The following protocol uses a calcium-sensitive, membrane-impermeable fluorophore to monitor extra-mitochondrial calcium levels in the presence of permeabilized mammalian cells harboring activated mitochondria.
Keywords: Mitochondrial Calcium Flux MCU Uniporter HEK
Background
Mitochondrial Calcium Uniporter (MCU)-mediated calcium flux is the primary way in which calcium enters the mitochondria. Mitochondrial calcium is important for several reasons, three of which are cited often in the literature. One, calcium in the mitochondria activates key dehydrogenases in the Krebs cycle which leads to increased ATP production. A more recent study indicates that mitochondrial calcium has a direct effect on both F1FO-ATPase and cytochrome chain activity (Glancy and Balaban, 2012), further enhancing its role as pivotal in cellular energy production. Two, because of the low, micromolar affinity of MCU and the large amount of cytosolic calcium mitochondria can sequester, MCU-mediated calcium uptake also plays a critical role in clearing transient increases in cytoplasmic calcium and in turn, shapes cellular signaling pathways that use calcium as a secondary messenger (Wheeler et al., 2012). Three, modulations of mitochondrial calcium play an important role in the regulation of apoptosis (Zoratti and Szabo, 1995). Steep increases in mitochondrial calcium levels initiate cell death by inducing the opening of the mitochondrial permeability transition pore in the inner membrane, an event that dissipates the inner mitochondrial membrane potential and releases cytochrome C, Diablo/Smac, and Caspase enzymes from the intermembrane space (Zoratti and Szabo, 1995; Pacher and Hajnoczky, 2001). While these phenomena have been well-characterized, the genetic identity of MCU has only recently been observed, and with that discovery has come the demand for a speedy and reliable way of observing mitochondrial calcium flux.
Our fluorophore-based mitochondrial calcium uptake assay is easy to set up and provides several advantages over other popular methods. HEK-293 cells with activated mitochondria are suspended in a recording buffer along with a membrane-impermeable calcium-sensitive fluorophore. The plasma membrane is permeated with a detergent while leaving the mitochondrial inner membrane in-tact, bringing the mitochondria in direct contact with the buffer. Following this, calcium is added to the cell-suspension and MCU-mediated calcium flux can be followed by observing the changing fluorescence of the fluorophore, which cannot follow calcium into the mitochondria. The highly specific MCU inhibitor, Ru360, is finally added to the cell-suspension to show that the observed change in fluorescence (i.e., calcium flux) is mediated by MCU. One of the most attractive features of the protocol is the speed of set-up and acquisition of flux data. Once cells are ready to harvest, calcium-flux data can be obtained in less than ten minutes. Another important quality of the protocol lies in its simplicity, specifically, in the straight-forward way in which the assay reports calcium flux and identifies MCU as the pathway. Implicating MCU as the sole calcium uptake pathway in this protocol is the observation that no calcium uptake of any kind is observed in cells lacking MCU. One drawback to the protocol is the inability of it to carefully quantify calcium flux, and for this, a calcium-45 uptake protocol is much preferable. In fact, limited quantification of mitochondrial calcium flux using this protocol is possible if one reports only the relative calcium flux, for example, by comparing two fluxes as a ratio of one over the other.
One of the opaquer yet more popular methods of observing MCU activity aims to follow the changes in mitochondrial calcium levels in intact cells whose mitochondria have been pre-loaded with a membrane-permeable calcium sensitive fluorophore. Because the plasma membranes of these cells are intact, intracellular calcium modulation depends on the release of calcium from the other major intracellular calcium sink, the endoplasmic reticulum (ER), which can be triggered by the addition of histamine to the extracellular buffer. Histamine achieves this by activating the phospholipase C/IP3 pathway, which results in the production of IP3 and concomitant activation of the IP3-receptor in the ER membrane, thereby releasing calcium stores from the ER into to cytoplasm. Because of the spatial proximity of the ER to the mitochondria, activation of the IP3 receptor transiently bathes mitochondria with a high dose of free calcium, which is in turn sequestered by the mitochondrial matrix. In this system, intra-mitochondrial calcium levels are monitored by observing changes in fluorescence of the pre-loaded, membrane-permeable, calcium sensitive probes which have presumably migrated to the mitochondrial matrix. Because MCU is the primary way through which calcium traverses the inner-mitochondrial membrane, it is taken for granted that the observed changes in fluorescence are due to the activation of MCU by these local increases in free calcium. It has even been suggested that the degree to which the fluorescence signal changes upon histamine stimulation is directly proportionate to the degree of MCU functionality. The complexity of this experimental design naturally raises doubts about what’s being inferred, namely, that the fluorescence changes upon histamine stimulation are a function of MCU functionality alone and not of, for example, the successful localization of the probe to mitochondria, or of the potential changes to any part of the phospholipase C/IP3 pathway, or of changes in proximity of the ER to mitochondria, or of the amount of calcium stored and/or released by the ER in various cell types under various experimental conditions, any of which may explain the observed fluoresce differences between the conditions tested and which may actually have little to do with MCU functionality. The experimental design described in detail below aims to reduce these sorts of ambiguities and to clearly report mitochondrial calcium flux mediated by MCU.
Materials and Reagents
Pipette tips
Cell culture dishes (Corning, catalog number: 430293 )
Pasteur pipette
15 ml tube
HEK 293 cells (Incubation: 37 °C, 5.0% CO2) (ATCC, catalog number: CRL-1573 )
DMEM (high glucose, no glutamine) (store at 4 °C) (Thermo Fisher Scientific, GibcoTM, catalog number: 11960051 )
Trypsin
Premium fetal bovine serum (store at -20 °C) (Atlanta Biologicals, catalog number: S11150 )
L-glutamine (store at -20 °C) (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
HEPES (store at RT) (Sigma-Aldrich, catalog number: H3375-1KG )
Potassium chloride (KCl) (store at RT) (Fisher Scientific, catalog number: P217-500 )
Potassium phosphate dibasic (K2HPO4) (store at RT) (Fisher Scientific, catalog number: P290-500 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (store at RT) (Fisher Scientific, catalog number: M33-500 )
Potassium hydroxide (KOH) (store at RT) (for pH to 7.4) (Fisher Scientific, catalog number: P250-500 )
Succinate (store at RT) (Sigma-Aldrich, catalog number: S3674-100G )
Calcium Green 5N - hexapotassium salt (CG-5N) (Thermo Fisher Scientific, InvitrogenTM, catalog number: C3737 )
Note: Store at -20 °C as powder; 4 °C dissolved in ddH2O. Recommended: dissolve to a concentration of 0.5 μM for stock solution.
Digitonin (Sigma-Aldrich, catalog number: D141 )
Note: Store at -20 °C as powder. Dissolve in ddH2O immediately before use. Recommended: dissolve to a concentration of 30 mM for stock solution.
Ruthedium 360 (Ru360) (Santa Cruz Biotechnology, catalog number: sc-222265 )
Note: Store at -20 °C as powder; 4 °C dissolved in ddH2O.
Calcium Chloride Dihydrate (Fisher Scientific, catalog number: C79-500 )
Recommended: Dissolve in water to a concentration of 10 mM for stock solution.
Growth media (see Recipes)
Wash buffer (WB) (see Recipes)
Recording buffer (RB) (see Recipes)
Equipment
Pipettes
Incubator (Fisher Scientific, IsotempTM, catalog number: 13-255-26 )
Centrifuge (Thermo Fisher Scientific, model: HeraeusTM LabofugeTM 400 , catalog number: 75008164)
Quartz cuvette (Fisher Scientific, Fisherbrand, catalog number: 14-958-128 )
Small stir bar (Hach, catalog number: 2095349 )
Thermo Cell Holder with Stirrer (Hitatchi, model: 251-0148 )
F-2500 Fluorescence spectrophotometer (Hitachi, model: 251-0090 )
Software
IGOR Pro
Microsoft Excel
Procedure
Cell (HEK-293) preparation
Carefully remove growth media from a confluent 10-cm dish (i.e., with a Pasteur pipette. See Note 3 for more on cell density). Add 10 ml WB (Wash Buffer) warmed to 37 °C to the plate with 10 ml pipet, pipetting up and down to gently lift cells from the bottom of the plate, and transfer WB-cell slurry to a 15 ml tube. These preparations are to be carried out on the bench at room temperature. If cells are strongly adherent and not easily dislodged by gentle up-and-down pipetting, add 0.7 ml of Trypsin (or just enough to evenly cover cells) warmed to 37 °C after washing cells once with 10 ml WB and let stand in a 37 °C incubator for 2-3 min. Remove cells from the incubator. Cells should now be easily displaced by gentle up-and-down pipetting with 10 ml WB. Transfer WB-cell slurry to a 15 ml tube.
Gently pellet cells by centrifugation at room temperature at 1,000 x g for 5 min. Discard supernatant.
Wash pellet by re-suspending cells in 10 ml WB, spin for 5 min at 1,000 x g, and discard supernatant.
Resuspend cells in 2.5 ml recording buffer (RB), also warmed to 37 °C. Transfer 2.0 ml of this slurry to the quartz cuvette with a small stir bar. (The remaining 0.5 ml can be used separately to analyze protein content via Western Blot analysis. See Note 5 for more on Western Blots)
Note: Gently flick cuvette to remove bubbles before the start of the experiment, as these can create unwanted noise in the data.
Flux experiment
Place cuvette with RB-cell slurry into the cell-holder/stirrer affixed to the spectrophotometer. Turn on a stirrer and stir cells slowly (see Note 1).
Set spectrophotometer to these parameters:
Excitation wavelength: 506 nm
Emission wavelength: 531 nm
Em/Ex slit width: 2.5/2.5 nm
Time scan
600 sec (or longer)
0 sec delay
PMT Voltage: 700 Volts
Response: 0.04 sec
Data Mode: Fluorescence
Start recording time scan. See Figure 1 below.
Figure 1. Starting the Recording. Left: cartoon of quartz cuvette with 2 ml recording buffer suspending wild-type (WT) HEK cells, loaded into the stirrer on the fluorescence spectrophotometer (small stir bar not shown). Right: spectrophotometric trace about 45 sec after starting the recording.
Add CG-5N to a final concentration of 0.25 nM (i.e., 1 μl of 0.5 μM stock). CG-5N is a membrane impermeable calcium-sensitive fluorophore (Kd = 14 μM). The fluorescence signal will go up with the addition of the fluorophore as trace amounts of calcium are present in the RB. See Figure 2 below.
Figure 2. Adding CG-5N. Adding CG-5N to a concentration of 0.25 nM (left) will increase the fluorescence signal in the trace profile (right).
Add digitonin to a final concentration of 30 μM (i.e., 2 μl of 30 mM stock). Digitonin permeabilizes the plasma membrane by extracting cholesterol, leaving those intracellular membranes lacking cholesterol (e.g., the mitochondrial inner membrane) intact. This brings mitochondria in direct contact with the buffer solution and susceptible to influence by experimental reagents (the outer mitochondrial membrane is already in a steady-state with the cytoplasm with regards to small molecules like the reagents used in this protocol). CG-5N (membrane-impermeable) is afterward reporting ‘extra-mitochondrial’ calcium levels. A typical dip in fluorescence is almost always observed upon the addition of digitonin, as can be seen in Figure 3 below.
Figure 3. Adding digitonin. Adding digitonin to a concentration of 30 μM (left) will cause the spectrophotometric trace profile to drop (right).
Add CaCl2 to a final concentration of 10 μM (i.e., 2 μl of 10mM stock). The fluorescence signal will go up as calcium binds to CG-5N. If the cells are harboring activated mitochondria containing functional MCU (i.e., WT-HEK cells), a precipitous declination in fluorescence will immediately follow, signifying MCU-mediated calcium uptake (see Figure 4).
Note: If cells lack MCU, the fluorescence signal in the trace profile will increase but then will immediately flatten out, showing that the observed declination in the trace profile of WT cells after the addition of calcium is due to MCU-mediated calcium uptake AND NOT by other intra-cellular calcium uptake pathways such as SERCA (Sarco/Endoplasmic Calcium-ATPase) (Note 6).
Figure 4. Adding calcium. Adding calcium to a final concentration of 10 μM (left) will produce a sharp increase in the trace profile (right). The following drop in fluorescence signal is indicative of MCU-mediated calcium flux.
After some time has passed, typically between 30 sec to 1 min, add Ru360 to a final concentration of 0.5 μM. Ru360 (i.e., 0.5 μl of 2 mM stock) is a potent inhibitor of MCU (Kd = 340 pM) and will cause the spectrophotometric trace to flatten as the steady-state exchange between the CG-5N-calcium-bound and CG-5N-calcium unbound species returns due to the lack of calcium mobility away from CG-5N. This step testifies to the dependence of MCU on the removal of calcium from the buffer solution observed in the previous step. See Figure 5 below; here, Ru360 is added to the cuvette after a second shot of 10 μM calcium.
Figure 5. Ru360. Adding Ru360 to a final concentration of 0.5 μM (left) will cause the spectrophotometric trace profile to flatten (right).
Data analysis
For reference data, please refer to Figure 4–figure supplement 2C, and Figure 4–figure supplement 3A in our paper ‘Dual functions of a small regulatory subunit in the mitochondrial calcium uniporter complex’ by following the link provided below:
http://cdn.elifesciences.org/elife-articles/15545/figures-pdf/elife15545-figures.pdf?_ga=1.67863441.1487892113.1470405893
Raw data from the spectrophotometric traces were uploaded into IGOR Pro and the slope of the a.u./time trace, starting immediately following the addition of calcium and for the following 10 sec, was calculated from each graph. The average of 3 slopes from cells expressing WT-hMCU and WT-hEMRE was calculated in Microsoft Excel along with the concomitant standard error. These values were used to normalize all following experimental data sets against.
Notes
Stir bar speed
The speed of the stir bar can be an important but overlooked factor in determining the quality of the fluorescence trace profile. Spinning too fast can result in cell damage (cells will clump together in the cuvette), while spinning too slowly may limit the speed of reagent mixing within the cuvette, which can be seen in the spectrophotometric data primarily as enhanced noise and hyperbolic-like transitions from one steady-state to another upon the addition of a new reagent to the cuvette. In general, we’ve found that starting the stir bar in its slowest setting first and then slowly ramping up speed is the best way to find the optimal speed leading to intact cells and quick rates of reagent mixing. In our hands, this ideal speed is, qualitatively, on the slow end within the range of possible stir-bar speeds.
Digitonin
We have found that digitonin from Sigma-Aldrich works particularly well for this experiment. Also, make digitonin stock fresh before each experiment, as this reagent tends to crash out of solution between experiments (within an hour).
Cell density
While the number of HEK cells used in an experiment is completely up to the experimenter, we have found the ideal number to be 2.0 x 107, or 1 fully confluent 10 cm dish.
Cell types
We have performed this experiment exclusively with HEK 293 cells, and cannot say how it might work using other cell types.
Western Blot Analysis
Recording Buffer (RB) does not interfere Western Blot analysis. Simply spin the remaining 0.5 ml of cell slurry down, discard sup (RB), and lyse cells with ice cold lysis buffer (we found RIPA buffer works well for this). Lysing cells with about 50 μl RIPA buffer yields protein concentrations in a range appropriate for the comfortable loading of between 10 μg and 50 μg of protein in a 15 μl or 50 μl per well gel. A high-speed spin step at Step A4 is also required after lysis to pellet cell derbies and to keep the lysate from becoming ‘goopy’ and unmanageable during loading; keep the supernatant. Follow instructions for your lysis buffer of choice (add protease inhibitors, work on ice, etc.) and carefully quantify protein concentration after the high-speed spin with your method of choice. We always run a loading control gel on which we detect Actin (we load 10 μg protein for this blot). Other gels should be run on which to look for the protein of interest (typically MCU or one of its regulatory partners, but this obviously depends on the experiment and what’s desirable to detect). In general, expect to spend time optimizing western blots to see high-quality (high signal to noise) data.
A clear difference between the trace profiles of wild-type cells and MCU-knock out cells (cells in which MCU has been deleted from the genome) is that in the latter, the slope, after the addition of calcium, is nearly zero, while in the former, the slope is clearly negative. The profile’s negative slope after calcium addition is therefore indicative of MCU-mediated calcium uptake.
Figure 6. Spectrophotometric Profile of MCU-knockout Cells. Trace profile is flat after the addition of Ca2+ when MCU has been deleted from the genome.
Recipes
Growth media
90% (v/v) DMEM
4.5 g/L D-glucose, L-glutamate, sodium pyruvate
10% (v/v) premium fetal bovine serum
2 mM L-glutamine
Store at 4 °C
Notes:
Prepare media under sterile conditions, i.e., in a laminar flow hood.
Filter media through a 0.22 μm filter after preparation.
Wash buffer (WB)
20 mM HEPES
125 mM KCl
2 mM K2HPO4
1 mM MgCl2
Adjust pH to 7.4 with KOH
Store at 4 °C
Recording buffer (RB)
WB (see above)
5 mM succinate
Store at 4 °C
Acknowledgments
This work was carried out in Dr. Christopher Miller’s lab (HHMI; Brandeis University) and was supervised by Dr. Ming-Feng Tsai.
The above protocol is a classic protocol which has been used for decades in the field of mitochondrial calcium handling. Our thanks to those original thinkers who gave it life and to those who have refined it over the years. The author declares that there are no conflicts of interest or competing interests.
References
Glancy, B. and Balaban, R. S. (2012). Role of mitochondrial Ca2+ in the regulation of cellular energetics. Biochemistry 51(14): 2959-2973.
Pacher, P. and Hajnoczky, G. (2001). Propagation of the apoptotic signal by mitochondrial waves. EMBO J 20(15): 4107-4121.
Wheeler, D., Groth, R., Ma, H., Barrett, C., Owen, S., Safa, P., and Tsien, R. (2012). CaV1 and CaV2 channels engage distinct modes of Ca2+ signaling to control CREB-dependent gene expression. Cell 149(5): 1112-1124.
Zoratti, M. and Szabo, I. (1995). The mitochondrial permeability transition. Biochim Biophys Acta 1241(2): 139-176.
Copyright: Phillips. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Phillips, C. (2018). Fluorophore-Based Mitochondrial Ca2+ Uptake Assay. Bio-protocol 8(14): e2934. DOI: 10.21769/BioProtoc.2934.
Tsai, M. F., Phillips, C. B., Ranaghan, M., Tsai, C. W., Wu, Y., Willliams, C. and Miller, C. (2016). Dual functions of a small regulatory subunit in the mitochondrial calcium uniporter complex. Elife 5: e15545.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fluorescence
Cell Biology > Cell-based analysis > Ca2+ homeostasis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,935 | https://bio-protocol.org/exchange/protocoldetail?id=2935&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
BMV Propagation, Extraction and Purification Using Chromatographic Methods
AS Aleksander Strugała
PB Paulina Bierwagen
JR Jakub Dalibor Rybka
MG Michał Giersig
MF Marek Figlerowicz
Anna Urbanowicz
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2935 Views: 5843
Edited by: Vamseedhar Rayaprolu
Reviewed by: Joanna Sztuba-SolinskaJolene Ramsey
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Brome mosaic virus (BMV) is a well-known plant virus representing single-stranded RNA (ssRNA) positive-sense viruses. It has been widely used as a model in multiple studies concerning plant virus biology, epidemiology and the application of viral capsids in nanotechnology. Herein, we describe a method for BMV purification based on ion-exchange and size-exclusion chromatography. The presented method is of similar efficiency to previously described protocols relying on differential centrifugation and can easily be scaled up. The resulting BMV capsids are stable and monodisperse and can be used for further applications.
Keywords: Brome mosaic virus BMV Plant virus purification Virion Capsid Virus-like particles (VLP)
Background
One of the key challenges for nanotechnology to overcome is elaboration of effective and tissue-specific drug delivery methods. Plant viruses and virus-like particles (VLPs) are biocompatible and biodegradable and do not contain pathogens hazardous to human or animal health, and are a safe alternative to the synthetic drug carriers which often activate an undesirable response of the immune system or accumulate in the body to toxic levels. Finally, the production of the viral capsids is relatively cheap and fast (Ren et al., 2007; Arcangeli et al., 2014).
Brome mosaic virus (BMV) of the Bromoviridae family is a good candidate for use as a nanoparticle carrier since it shows all of the abovementioned features and is one of the best-studied plant viruses (Figlerowicz, 2000; Alejska et al., 2005; Urbanowicz et al., 2005; Wierzchoslawski et al., 2006; Kao et al., 2011). It is a positive-sense RNA virus with a genome composed of three different RNA segments. Each genomic RNA is packed into a separate capsid. The capsids are morphologically indistinguishable although they differ with their biophysical and biological properties. The molecular weight of the BMV virion is 4.6 MDa, and its diameter is approximately 28 nm. The BMV capsid has a T = 3 icosahedral construction and is comprised of 180 19.4-kDa CP monomers (Ni et al., 2014; Vaughan et al., 2014).
Although a commercial usage of VLPs as drug carriers is a distant future goal, BMV-based VLPs have already been loaded with various nanoparticles. The most effective VLP formation was obtained when gold nanoparticles were coated with polyanions, such as carboxylated polyethylene glycol. However other nanoparticles, such as spherical and cubic iron oxide were also encapsidated in BMV-based VLPs (Dragnea et al., 2003; Chen et al., 2006; Huang et al., 2011; Guerrero et al., 2017). BMV capsids carrying quantum dots might find an application as luminescent bioprobes (Dixit et al., 2006). In addition, the encapsulation of a chromophore, indocyanine green, into empty BMV capsids has also been archived (Jung et al., 2011). All previous reports described BMV preparations that were purified by differential ultracentrifugation using sucrose or cesium chloride gradients. These methods, although generate excellent quality viral preparations, have quantitative limitations. In this protocol we describe an efficient (up to 0.2 mg of virus from 1 g of plant tissue), chromatography-based method of obtaining BMV of high purity and quality; this method is an easy alternative to existing methods. The produced BMV capsids show high monodispersity and structure-environment dependency, features that are crucial for the formation of functional VLPs (Strugala et al., 2017) (Figure 2). Similarly to previously described methods, our procedure can be applicable to the purification of other plant viruses of similar capsid size. For example, it was highly efficient for the purification of the red clover necrotic virus (RCNMV) and resulted with monodisperse viral preparations. Finally, our protocol might be easily adapted for larger-scale purification.
Materials and Reagents
Notes:
Regarding the materials, reagents and equipment, a proper and comparable setup may be used.
All prepared buffers should be filtered through a 0.45 μm filter. Additionally, buffers for Size Exclusion Chromatography should be degassed (Degassing process takes 1 h for 1 L buffer. Store degassed buffers at 4 °C, for 1 month).
BMV propagation
Pots (Floser, catalog number: BTS 10,5 ), H 80 mm, Ø 105 mm, vol. 0.46 L
Garden trays, 60 cm Square Tray Black (Garland Products, catalog number: G191B )
Soil (PPHU Socha, all-purpose garden soil pH 5.5-6.5), quartz sand (PPHU Socha, 1mm diameter)
Gloves (Mercator medical, Nitrylex PF classic)
Tips
5,000 μl (PZ HTL, catalog number: 35001 )
1,000 μl (OMNITIP, catalog number: 85710 )
200 μl (OMNITIP, catalog number: 83710 )
10 μl (OMNITIP, catalog number: 81710 )
Barley (Hordeum vulgare) seeds
BMV-infected plants (barley or Chenopodium quinoa)
Carborundum F400 (KREMER POLSKA, catalog number: 58750 )
Liquid nitrogen (Air Products, CryoEase)
Sodium phosphate monobasic (Sigma-Aldrich, catalog number: S3139 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670 )
Inoculation buffer (see Recipes)
BMV isolation from plants
NalgeneTM Oak Ridge High-Speed PPCO centrifuge tube (Thermo Fisher Scientific, catalog number: 3119-0050 )
Tips (see Materials and Reagents A5)
NalgeneTM Polysulfone reusable bottle top filter, 500 ml, collar 45 mm (Thermo Fisher Scientific, catalog number: DS0320-5045 )
Filters 0.45 μm, 47 mm (Merck, catalog number: HAWG047S6 )
Liquid nitrogen or dry ice
Sodium acetate (CH3COONa) (Sigma-Aldrich, catalog number: S2889 )
Boric acid (H3BO3) (MP Biomedicals, catalog number: 194810 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670 )
Chloroform (Firma Chempur, catalog number: CHEM*112344305 )
30% polyethylene glycol 8000 (PEG 8000) (BioShop, catalog number: PEG800 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
BMV extraction buffer (see Recipes)
10x L buffer (phosphate buffer) (see Recipes)
BMV purification
Discardit IITM 5 ml syringe (BD, catalog number: 309050 )
50 ml conical tubes (SARSTEDT, catalog number: 62.548.004 )
Tips (see Materials and Reagents A5)
Micro tubes 1.5 ml (SARSTEDT, catalog number: 72.690.001 )
Amicon Ultra-15 Filters (Merck, catalog number: UFC910024 )
Filters 0.45 μm, 47 mm (Merck, catalog number: HAWG047S6 )
PP centrifuge tubes 12 x 75 mm (Bionovo, catalog number: E-1649 )
Millex-HV Syringe Driven Filter Unit (Merck, Millex Filter, catalog number: SLHV013NL )
DEAE-cellulose (Sigma-Aldrich, catalog number: D3764 )
Sodium chloride (NaCl) (BioShop, catalog number: SOD001 )
Trizma base (Sigma-Aldrich, catalog number: T1503 )
Glycerol (Carl Roth, Rotipuran, catalog number: 3783 )
Phosphate-buffered saline (PBS) (Thermo Fisher Scientific, catalog number: 18912014 )
BMV analysis
Micro tubes 1.5 ml (SARSTEDT, catalog number: 72.690.001 )
Tips (see Materials and Reagents A5)
Quartz cuvette (Hellma, catalog numbers: 105.201-QS , 105.231-QS )
4-20% Mini-PROTEAN® TGXTM Precast Protein Gels, 10-well, 30 μl (optional, Bio-Rad Laboratories, catalog number: 4561093 )
Rotiphorese NF-acrylamid/bis 19:1 (Carl Roth, catalog number: A516.1 )
Sodium dodecyl sulfate (SDS) (Carl Roth, catalog number: 0183.2 )
Ammonium persulfate (APS) (Sigma-Aldrich, catalog number: A3678 )
TEMED (BioShop, catalog number: TEM001.50 )
Perfect Tricolor Protein Ladder (EURx, catalog number: E3210-01 )
SDS-PAGE sample loading buffer: NovexTM Tris-Glycine SDS Sample Buffer (2x) (Thermo Fisher Scientific, catalog number: LC2676 )
PageBlueTM Protein Staining Solution (Thermo Fisher Scientific, catalog number: 24620 )
Equipment
Preparing Buffers–all the steps:
Bottles
1 L (Kavalierglass, Simax, catalog number: 1632414321940 )
500 ml (Kavalierglass, Simax, catalog number: 1632414321500 )
250 ml (Kavalierglass, Simax, catalog number: 1632414321250 )
Cylinders
500 ml (Kavalierglass, Simax, catalog number: 1632432111343 )
250 ml (Kavalierglass, Simax, catalog number: 1632432111238 )
100 ml (Kavalierglass, Simax, catalog number: 1632432111130 )
BMV propagation
Beakers
1 L (Kavalierglass, Simax, catalog number: 1632417010940 )
800 ml (Kavalierglass, Simax, catalog number: 1632417010800 )
600 ml (Kavalierglass, Simax, catalog number: 1632417010600 )
400 ml (Kavalierglass, Simax, catalog number: 1632417010400 )
250 ml (Kavalierglass, Simax, catalog number: 1632417010250 )
100 ml (Kavalierglass, Simax, catalog number: 1632417010100 )
Ice bucket (Round Ice Bucket with Lid, 4 L) (Corning, catalog number: 432122 )
Porcelain unglazed mortar (Conbest, catalog number: 891-03-220 ) and porcelain unglazed pestle (Conbest, catalog number: 892-03-135 )
Pipettes
Eppendorf Research® plus 0.5-5 ml (Eppendorf, model: Research® plus , catalog number: 3123000071)
Discovery comfort DV1000 (PZ HTL, catalog number: 4046-DV )
Discovery comfort DV100 (PZ HTL, catalog number: 4044-DV )
Discovery comfort DV10 (PZ HTL, catalog number: 4042-DV )
Discovery comfort DV2 (PZ HTL, catalog number: 4041-DV )
Fitotron® plant growth chamber (Percival Scientific, model: E41-L2 )
BMV extraction from plants
Pipettes (see Equipment B4)
Porcelain unglazed mortar (Conbest, catalog number: 891-03-220 ) and porcelain unglazed pestle (Conbest, catalog number: 892-03-135 )
Vortex (Reax control) (Heidolph Instruments, catalog number: 541-11000-00 )
Centrifuge (Eppendorf, models: 5415 R , 5810 R )
Laboratory scale (RADWAG Balances and Scales, model: PS 1000.R2 )
IKA MS 3 digital shaker (IKA, model: MS 3 )
BMV purification
Barnstead GenPure LifeScience UV/UF (TKA Wasseraufbereitungssysteme, catalog number: 08.2204 )
Versatile laboratory pump (PL 2/1) (AGA LABOR, model: Basic 36 )
Ion Exchange Chromatography
Peristaltic pump (Masterflex L/S, Easy Load II Head, Cole-Parmer, catalog number: EW-77200-50 )
CrystalCruz® chromatography column 2.5 x 10 cm (Santa Cruz Biotechnology, catalog number: sc-205558 )
Pipettes (see Equipment B4)
Size-Exclusion Chromatography (SEC)
HiPrep 16/60 Sephacryl S-500 HR (GE Healthcare, catalog number: 28-9356-06 )
ÄKTAprime plus (GE Healthcare)
BMV analysis
Concentration measurement
Pipettes (see Equipment B4)
Apparatus for SDS Polyacrylamide gel electrophoresis (PAGE) (Mini-PROTEAN® Tetra Vertical Electrophoresis Cell) (Bio-Rad Laboratories, catalog number: 1658004 )
Mini-PROTEAN® Tetra Cell Casting Module (Bio-Rad Laboratories, catalog number: 1658013 )
Power supply (Wealtec, model: ELITE 300 Plus )
Multi Bio 3D (Biosan, catalog number: BS-010125 )
Thermoblock (Biosan, model: Bio TDB-100 )
BioPhotometer (Eppendorf, catalog number: 550507804 )
DLS analysis
Pipettes (see Equipment B4)
Malvern Zetasizer μV (Malvern Instruments)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Strugała, A., Bierwagen, P., Rybka, J. D., Giersig, M., Figlerowicz, M. and Urbanowicz, A. (2018). BMV Propagation, Extraction and Purification Using Chromatographic Methods. Bio-protocol 8(14): e2935. DOI: 10.21769/BioProtoc.2935.
Download Citation in RIS Format
Category
Biochemistry > Protein > Isolation and purification
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,936 | https://bio-protocol.org/exchange/protocoldetail?id=2936&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Lentiviral Pseudotype ELLA for the Measurement of Antibodies Against Influenza Neuraminidase
Fabrizio Biuso
GC George Carnell
EM Emanuele Montomoli
Nigel Temperton
Published: Jul 20, 2018
DOI: 10.21769/BioProtoc.2936 Views: 6155
Edited by: Longping Victor Tse
Reviewed by: Masfique Mehedi
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
This protocol describes the rapid and safe production of lentiviral pseudotypes characterized by a lentiviral core containing a reporter, in conjunction with avian influenza haemagglutinin (HA) and human neuraminidase (NA) glycoproteins on the surface. Production is optimized with Endofectin LentiTM transfection reagent in 6-well plate format. These pseudotyped viruses can be employed for serological assays of surface glycoproteins HA and NA. They can be efficiently used to perform the ELLA (Enzyme-linked lectin assay) to measure NA inhibiting antibodies in lieu of using reassortant virus or Triton X-100 inactivated wild-type virus as source of antigen, which may require higher biosafety levels.
Keywords: ELLA PV OD Assay Neuraminidase Antibody Neutralisation
Background
The production of influenza virus pseudotypes has been extensively described previously (Nefkens et al., 2007; Temperton et al., 2007; Carnell et al., 2015). The need for a safe and rapid system to evaluate antibodies targeting the NA via the ELLA assay, avoiding the employment of reassortant mismatched virus or wild-type virus, has been met by producing influenza NA bearing pseudotypes (Prevato et al., 2015). A recent study (Biuso et al., 2017) confirmed that the co-expression of HA with NA improves the release of newly formed pseudotyped lentiviruses. Here we report a simple, widely applicable and optimized protocol for PV production by using the Endofectin LentiTM transfection reagent in 6-well plate format, and the methodology to perform an ELLA assay with the resulting influenza pseudotypes. While PV production for HA-based assays has made use of the lentiviral genome containing a reporter gene, the ELLA assay utilizes solely the surface NA glycoprotein, rendering a PV-incorporated reporter irrelevant to this protocol. The original ELLA assay from 1990 was recently improved (Couzens et al., 2014). This assay enables the detection of exposed galactose residues resulting from the enzymatic action of NA on sialic acids present on the fetuin substrate. This assay allows the measurement of NA inhibiting antibodies, through detection of a drop in enzymatic NA activity. The ELLA overcomes the limits of the cumbersome thiobarbituric acid assay (TBA) that employs hazardous materials, allowing for large-scale screening of serum samples. The basis of the assay is simple, 96-well plates are coated in the carbohydrate fetuin, which is then exposed to NA through NA bearing PV. The NA enzyme cleaves terminal sialic acid residues from the fetuin, exposing galactose that is then bound by the peanut agglutinin from Arachis hypogeal, conjugated to horseradish peroxidase (PNA-HRPO). This reagent then forms the basis for colorimetric reading of NA activity by a spectrophotometer. This activity can then be knocked down using an inhibitor (such as antibodies found in human sera) in subsequent assays. The described protocol combines the ability to screen a large number of sera through the ELLA assay, with a simple and safe lentiviral pseudotype production protocol. NA targeting antibodies are typically neglected in current influenza vaccines (compared to HA targeting antibodies), despite being shown to limit influenza symptoms and transmission (Marcelin et al., 2011 and 2012; Wohlbold and Krammer, 2014).
Materials and Reagents
Multi Guard Barrier pipette tips 1-20 and 1-200 μl (Sorenson BioScience, catalog number: 30550T )
NuncTM Cell-Culture Treated Multi dishes (6-well) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 140675 )
Microcentrifuge tube 1.5 ml
Sterile syringes (10 ml), generic
Millex-HA 0.45 μm filters (Merck, catalog number: SLHAM33SS )
96-well microtiter plates Maxi Sorp surface (Thermo Fisher Scientific, NuncTM, catalog number: 439454 )
96-well microtiter plates round-bottom, for dilutions (Thermo Fisher Scientific, NuncTM, catalog number: 267245 )
Reservoirs (Fisher Scientific, catalog number: 11543412 )
Aluminum foil (Household item)
Falcon tube (15 ml, any supplier)
HEK 293T/17 cells (ATCC, catalog number: CRL-11268 )
Plasmids
Glycoprotein expression plasmids: phCMV-H11 and pI.18-NA
Lentiviral vector expressing firefly luciferase: pCSFLW
Second-generation lentiviral packaging construct plasmid: p8.91 (expresses gag, pol and rev)
Note: Information on the plasmids above can be found in Temperton et al. (2007), Carnell et al. (2015) and Biuso et al. (2017). Plasmids available from Viral Pseudotype Unit, University of Kent: [email protected].
Dulbecco’s modified Eagle medium (DMEM) (PAN-Biotech, catalog number: P04-04510 ) supplemented with 10% foetal bovine serum (FBS) (PAN-Biotech, catalog number: P40-37500 ) and 1% penicillin/streptomycin (P/S) (PAN-Biotech, catalog number: P06-07100 )
Gibco Reduced Serum media Opti-MEM® (Thermo Fisher Scientific, catalog number: 31985047 )
Endofectin LentiTM (Tebu-bio, catalog number: EFL1001-01 , EFL1001-02 )
Phosphate-buffered saline (DPBS) for cell culture (Thermo Fisher Scientific, catalog number: 14040133 )
Trypsin-EDTA (0.05%), phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 25300054 )
Internal negative and positive serum controls [e.g., from the U.S Food and Drug Administration (FDA), the National Institute for Biological Standards and Control (NIBSC) or Consortium for the standardization of influenza seroepidemiology (CONSISE)]
Coating buffer (KPL, catalog number: 50-84-01 )
Fetuin (Sigma-Aldrich, catalog number: F3385 )
BSA (Sigma-Aldrich, catalog number: A8327 )
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
Lectin from Arachis hypogaea (peanut)-Peroxidase (PNA-HRPO) (Sigma-Aldrich, catalog number: L7759-1MG )
DPBS-T (Sigma-Aldrich, catalog number: P3563-10PAK )
o-Phenylenediamine dihydrochloride (OPD) (Sigma-Aldrich, catalog number: P8287 )
1 N Sulfuric acid (e.g., Fisher Scientific, Fisher ChemicalTM, catalog number: VL3171000 )
Citrate Buffer (Sigma-Aldrich, catalog number: P4922 )
Equipment
Class II biosafety cabinet (Thermo Fisher Scientific, Thermo ScientificTM, model: MSC-AdvantageTM Class II )
Chemical hood
Cell culture Incubator
Water bath or heat block
Plate sealer
-80 °C freezer (e.g., Thermo Fisher Scientific, model: TSX ULT )
Electronic serological pipette (e.g., Gilson, model: MACROMAN® )
Pipettes (Gilson, models: PIPETMAN® Classic P2, P20, P200 and P1000, catalog numbers: F144801 , F123600 , F123601 and F123602 )
Multichannel pipettes (e.g., Gilson, model: PIPETMAN® L Multichanel, 8 or 12 channels)
Plate centrifuge (ELMI, model: SkySpinTM CM-6MT )
Spectrophotometer for ELISA plate reading (e.g., Tecan Trading, model: SunriseTM )
Inverted microscope (e.g., OLYMPUS, model: IX53 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Antibody analysis > Antibody function
Immunology > Antibody analysis > Antibody-antigen interaction
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,937 | https://bio-protocol.org/exchange/protocoldetail?id=2937&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Two Different Methods of Quantification of Oxidized Nicotinamide Adenine Dinucleotide (NAD+) and Reduced Nicotinamide Adenine Dinucleotide (NADH) Intracellular Levels: Enzymatic Coupled Cycling Assay and Ultra-performance Liquid Chromatography (UPLC)-Mass Spectrometry
Karina S. Kanamori*
Guilherme C. de Oliveira*
Maria Auxiliadora-Martins
RS Renee A. Schoon
JR Joel M. Reid
EC Eduardo N. Chini
*Contributed equally to this work
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2937 Views: 7096
Edited by: Andrea Puhar
Reviewed by: Neelanjan Bose
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Current studies on the age-related development of metabolic dysfunction and frailty are each day in more evidence. It is known, as aging progresses, nicotinamide adenine dinucleotide (NAD+) levels decrease in an expected physiological process. Recent studies have shown that a reduction in NAD+ is a key factor for the development of age-associated metabolic decline. Increased NAD+ levels in vivo results in activation of pro-longevity and health span-related factors. Also, it improves several physiological and metabolic parameters of aging, including muscle function, exercise capacity, glucose tolerance, and cardiac function in mouse models of natural and accelerated aging.
Given the importance of monitoring cellular NAD+ and NADH levels, it is crucial to have a trustful method to do so. This protocol has the purpose of describing the NAD+ and NADH extraction from tissues and cells in an efficient and widely applicable assay as well as its graphic and quantitative analysis.
Keywords: NAD+ levels NADH Cycling assay NAD+ degradation Fluorescence Mass spectroscopy Aging Metabolism UPLC
Background
Oxidized Nicotinamide adenine dinucleotide and reduced nicotinamide adenine dinucleotide (NAD+ and NADH) are important biological cofactors that donate and accept electrons in several anabolic and catabolic functions. They participate in reactions such as glycolysis, the tricarboxylic acid cycle, and oxidative phosphorylation. In addition, it serves as a substrate for several enzymes involved in DNA damage repair, such as the sirtuins and poly (ADP-ribose) polymerases (PARPs) (Imai and Guarente, 2014; Verdin, 2015; Yoshino et al., 2018).
NAD+ levels decrease during aging and are involved in age-related metabolic decline. It has been shown that the cellular NAD pool is determined by a balance between the activity of NAD-synthesizing and NAD-consuming enzymes (Aksoy et al., 2006; Barbosa et al., 2007; Yang et al., 2007; Nahimana et al., 2009; Bai et al., 2011; Yoshino et al., 2011). In previous publications, our laboratory has demonstrated that expression and activity of the NADase CD38 increases with age and that CD38 is required for the age-related NAD decline and mitochondrial dysfunction via a pathway mediated at least in part by regulation of SIRT3 activity (Camacho-Pereira et al., 2016). We also identified CD38 as the main enzyme involved in the degradation of the NAD precursor nicotinamide mononucleotide (NMN) in vivo. That indicates that CD38 has a key role in the modulation of NAD-replacement therapy for aging and metabolic diseases (Camacho-Pereira et al., 2016). CD38 was originally identified as a cell-surface enzyme that plays a key role in several physiological processes such as immune response, inflammation, cancer, and metabolic disease (Frasca et al., 2006; Barbosa et al., 2007; Guedes et al., 2008; Malavasi et al., 2008).
Several different assays and methods have been described due to the great importance of monitoring NAD+ and NADH cellular levels under various physiological conditions. Specifically two of them, ultra-performance liquid chromatography (UPLC)-mass spectroscopy assay and cycling assay have finality and both are equally sensitive and specific (Camacho-Pereira et al., 2016).
Our laboratory also further optimized and validated the cycling assay. We determined NAD+ and NADH specific and does not detect any of the other nucleotides or NAD derivatives tested, including nicotinamide adenine dinucleotide phosphate (NADP), nicotinic acid adenine dinucleotide (NAAD), nicotinic acid adenine dinucleotide phosphate (NAADP), cyclic-adenine diphosphate ribose (cADPR), adenine triphosphate (ATP), ADP, and others. The results obtained with both methods confirm that there is indeed a decrease in levels of both NAD+ and NADH in murine tissues during chronological aging (Camacho-Pereira et al., 2016). Furthermore, both techniques correlated well for both nucleotides (correlation coefficient of r = 0.95 for NAD+ and 0.97 for NADH) (Camacho-Pereira et al., 2016).
In regards to the cycling assay (pathway in which the main reaction happens), it takes NAD+ and NADH present in the samples and they are coupled to both enzymes alcohol dehydrogenase (ADH) and diaphorase in a cycling assay. Every time NAD+ or NADH cycles, it produces a molecule of resorufin, which is highly fluorescent. This fluorescence is directly captured by the multi-well fluorescence plate reader therefore indirectly the NAD+ levels can be measured. Most studies have relied on separated extractions for NAD+ and reduced nicotinamide adenine dinucleotide (NADH) determination: a basic extraction for the reduced species and a separate acidic extraction for the oxidized species (Ashrafi et al., 2000; Smith et al., 2000; Lin et al., 2001; Anderson et al., 2002; Lin et al., 2004). The extraction conditions are specific for the stabilization of either oxidized compounds, which are more stable in acid or reduced compounds, which are more stable in base.
Conversely, the ultra-performance liquid chromatography (UPLC)-mass spectrometry is an analytical chemistry technique that combines the physical separation capabilities of liquid chromatography with the mass analysis capabilities of mass spectrometry (MS). MS systems are popular in chemical analysis because the individual capabilities of each technique are enhanced synergistically. While liquid chromatography separates mixtures with multiple components, mass spectrometry provides identity of the individual components with high molecular specificity and detection sensitivity. This tandem technique can be used to analyze very accurate components such as NAD+ and NADH (Dass, 2007).
Part I: Cycling assay
Materials and Reagents
Plastic tips 10 (Thermo Fisher Scientific, Molecular Bioproducts, catalog number: 3511-05 )
Plastic tips 1,000 (Thermo Fisher Scientific, Molecular Bioproducts, catalog number: 3101 )
Plastic tips 200 (Thermo Fisher Scientific, Molecular Bioproducts, catalog number: 3551 )
1.5 ml Microcentrifuge tubes (USA Scientific, catalog number: 1415-2508 )
2.0 ml MCT Graduated tubes (Fisher Scientific, Fisherbrand, catalog number: 05-408-146 )
96-well Microfluor 1White flat-bottom plate (Thermo Fisher Scientific, catalog number: 7705 )
Combitips Advanced 10 ml (Eppendorf, catalog number: 0030089464 )
Disposable cell lifter (Fisher Scientific, Fisherbrand, catalog number: 08-100-240 )
Cells of interest: any cell can be used to measure NAD+/NADH levels
Tissues of interest: any tissue can be used to measure NAD+/NADH levels
Trichloroacetic Acid (TCA) (Sigma-Aldrich, catalog number: T4885-500G )
Sodium hydroxide (NaOH) 10 N (Fisher Scientific, Fisher Chemical, catalog number: SS267 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E5134 )
Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, catalog number: 5000006 )
1,2,2-Trichlorotrifluoroethane (TCTFE) (Fisher Scientific, Fisher Chemical, catalog number: T1781 )
Trioctylamine (Sigma-Aldrich, catalog number: T81000-500G )
Tris base, Trizma base (Sigma-Aldrich, catalog number: T6066 )
Diaphorase (Sigma-Aldrich, catalog number: D5540-500UN )
Alcohol dehydrogenase (ADH) (Sigma-Aldrich, catalog number: A3263-75KU )
Activated charcoal (Sigma-Aldrich, catalog number: C7606-125G )
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S0751-500G )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S0876-500G )
Absolute Ethanol (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP2818-500 )
Bovine Serum Albumin (Sigma-Aldrich, catalog number: A7906 )
β-NAD sodium salt (Sigma-Aldrich, catalog number: N0632-1G )
Riboflavin 5’-monophosphate sodium salt hydrate (FMN) (Sigma-Aldrich, catalog number: F8399 )
Resazurin sodium salt (Sigma-Aldrich, catalog number: 199303-5G )
Phosphate-buffered saline (PBS – pH 7.4) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Organic solvent (see Recipes)
Sodium Phosphate Buffer (pH 8.0) (see Recipes)
20 mM Sodium Phosphate Buffer (pH 7.0) (see Recipes)
4% charcoal suspension (in 20 mM sodium phosphate, pH 7.0) (see Recipes)
Bradford Dye (see Recipes)
Tris Buffer (1 M, pH 8.0) (see Recipes)
Equipment
Note: The brands and models indicated are the ones used by our group, similar equipment can be used as well.
1 L volumetric flask
Pipettes (10, 200, 1,000 µl)
Repeat Pipette (Eppendorf, model: Repeater® M4 )
Scissors
Homogenizer, Tissue Tearor (Bio Spec Products, catalog number: 780CL-04 )
Microcentrifuge (Eppendorf, model: 5424 )
Scale (Mettler-Toledo International, model: AG104 )
Sonic Dismembrator (Fisher Scientific, model: Model 100 )
Vortex (Scientific Industries, model: Vortex-Genie 2 , catalog number: G560)
-80 °C freezer
Plate reader (Molecular Devices, model: SpectraMax® GeminiTM XPS )
Spectrophotometer (BioTek Instruments, model: Epoch 2 )
Software
Gen5 Microplate Reader and Imager Software (BioTek Instruments)
Microsoft Excel (Microsoft Corporation)
SoftMax Pro 6 (Molecular Devices, LLC)
GraphPad Prism 7 (GraphPad Software, Inc)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kanamori, K. S., de Oliveira, G. C., Auxiliadora-Martins, M., Schoon, R. A., Reid, J. M. and Chini, E. N. (2018). Two Different Methods of Quantification of Oxidized Nicotinamide Adenine Dinucleotide (NAD+) and Reduced Nicotinamide Adenine Dinucleotide (NADH) Intracellular Levels: Enzymatic Coupled Cycling Assay and Ultra-performance Liquid Chromatography (UPLC)-Mass Spectrometry. Bio-protocol 8(14): e2937. DOI: 10.21769/BioProtoc.2937.
Download Citation in RIS Format
Category
Biochemistry > Other compound > NAD+/NADH
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,938 | https://bio-protocol.org/exchange/protocoldetail?id=2938&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Measuring CD38 Hydrolase and Cyclase Activities: 1,N6-Ethenonicotinamide Adenine Dinucleotide (ε-NAD) and Nicotinamide Guanine Dinucleotide (NGD) Fluorescence-based Methods
Guilherme C. de Oliveira*
Karina S. Kanamori*
Maria Auxiliadora-Martins
CC Claudia C. S. Chini
EC Eduardo N. Chini
*Contributed equally to this work
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2938 Views: 7844
Edited by: Andrea Puhar
Reviewed by: YONG TENGAnca Savulescu
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
CD38 is a multifunctional enzyme involved in calcium signaling and Nicotinamide Adenine Dinucleotide (NAD+) metabolism. Through its major activity, the hydrolysis of NAD+, CD38 helps maintain the appropriate levels of this molecule for all NAD+-dependent metabolic processes to occur. Due to current advances and studies relating NAD+ decline and the development of multiple age-related conditions and diseases, CD38 gained importance in both basic science and clinical settings. The discovery and development of strategies to modulate its function and, possibly, treat diseases and improve health span put CD38 under the spotlights. Therefore, a consistent and reliable method to measure its activity and explore its use in medicine is required. We describe here the methods how our group measures both the hydrolase and cyclase activity of CD38, utilizing a fluorescence-based enzymatic assay performed in a plate reader using 1,N6-Ethenonicotinamide Adenine Dinucleotide (ε-NAD) and Nicotinamide Guanine Dinucleotide (NGD) as substrates, respectively.
Keywords: CD38 NAD+ NADase Cyclase Hydrolase NGD ε-NAD Aging
Background
Current studies on age-related development of metabolic dysfunction and frailty are each day in more evidence. It is known that, as the aging progresses, the NAD+ levels decrease in an expected process. Recent studies have shown that a reduction in nicotinamide adenine dinucleotide (NAD+) is implicated in the development of age-associated metabolic decline (Massudi et al., 2012). Increased NAD+ levels in vivo, results in activation of pro-longevity and health span-related factors and improves several physiological and metabolic parameters of aging (Camacho-Pereira et al., 2016), including muscle function, exercise capacity, glucose tolerance, and cardiac function in mouse models of natural and accelerated aging.
Due to its role in NAD+ metabolism, the study of CD38 and its functions has been of great importance. CD38 was first identified in 1980 as a structural cell surface marker for the characterization of immune cells (Malavasi et al., 2008; van de Donk et al., 2016), and its first association as a NAD hydrolase enzyme was in the following decade (Kontani et al., 1993). However, during the past years, its enzymatic activities were more clearly elucidated. Initially, CD38 has been implicated to be responsible for the synthesis of the second messengers, cyclic ADP-ribose (cADPR), ADPR and nicotinic acid–adenine dinucleotide phosphate (NAADP) (Chini et al., 2002). These products are involved in calcium signaling and control many biological processes including lymphocyte proliferation and insulin secretion (Kato et al., 1999). However, its major enzymatic activity is the NAD+ hydrolysis, placing CD38 as the major NADase in several mammalian tissues and as an important regulator of NAD+-dependent processes (Aksoy et al., 2006).
The primary catalytic reaction of CD38 involves the cleavage of the high energy β-glycosidic bond between nicotinamide and ribose. During catalysis, the removal of the nicotinamide from β-NAD is coupled with the formation of intermediates that are stabilized through H-bonds between their ribosyl groups and the catalytic residue Glu226, a residue required for the NADase and cyclase activity of the enzyme (Sauve et al., 2000; Liu et al., 2009). These intermediates are released from the catalytic site forming ADPR or cADPR (Figure 1). In general, the majority of the CD38 NADase catalytic activity will generate nicotinamide, but also ADPR and cADPR which have been shown to have second messenger signaling roles through the activation of ryanodine receptor (RYR2). The full description of these pathways and Ca2+ signaling can be found in the remarkable works of Galione (1994) and Chini and Dousa (1996). The roles of CD38 as a cyclase and of NAD-derived calcium messengers in physiology and pathology have been extensively reviewed (Sauve et al., 2000; Chini, 2009).
Physiologically, CD38 has been implicated in the regulation of metabolism and the pathogenesis of the aging process, and of multiple conditions, such as obesity, diabetes, heart disease, asthma and inflammation. Therefore, the study of CD38, its activities, and possible modulators are of great interest. Our protocol presents a method of measuring its hydrolase and cyclase activities, utilizing ε-NAD and NGD techniques (Graeff et al., 1994) with a fluorescence-based enzymatic assay performed in a plate reader, in a consistent and reproducible manner (Figure 2).
Figure 1. Schematic illustrating the reactions catalyzed by CD38 under physiological conditions
Figure 2. CD38 and substrate schematics. A. CD38 hydrolase activity (ε-NAD as substrate); B. Cyclase activity (NGD as substrate); Strong arrow indicates which product is preferentially formed in each reaction. C. Molecular structure of ε-NAD and NGD. *Nic = Nicotinamide, ε-I = enzyme-intermediate complex, (c)ADPR = (cyclic) ADP-ribose, (c)GDPR = (cyclic) GDP-ribose, Ex = excitation wavelength, Em = emission wavelength.
Materials and Reagents
Plastic tips 1,000 (Thermo Scientific®, Molecular Bioproducts, catalog number: 3101 )
Plastic tips 200 (Thermo Fisher Scientific, Molecular Bioproducts, catalog number: 3551 )
96-well plate (Microfluor 1 White flat-bottom plate) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 7705 )
1.5 ml tubes
60 mm culture dishes (Fisher Scientific, FisherbrandTM, catalog number: FB012921 )
Tissues of interest: any tissue can be used to measure NAD+/NADH levels
Cells of interest: we usually use A549, JURKAT, Patu 9888T to measure NAD+/NADH levels
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
Sucrose (Sigma-Aldrich, catalog number: S0389-1KG )
Tris Base (Trizma® base, Sigma-Aldrich, catalog number: T6066 )
Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, catalog number: 5000006 )
CD38 human recombinant enzyme (R&D Systems, catalog number: 2404-AC-010 )
CD38 inhibitor (Merck, Calbiochem, catalog number: 538763 )
Anti-CD38 antibody–Isatuximab (Creative-Biolabs, catalog number: TAB-432CQ )
Nicotinamide guanine dinucleotide sodium salt (NGD) (Sigma-Aldrich, catalog number: N5131 )
Nicotinamide 1, N6-ethenoadenine dinucleotide (ε-NAD) (Santa Cruz Biotechnology, catalog number: sc-215559 )
MES (Sigma-Aldrich, catalog number: M3671 )
Sodium chloride (Sigma-Aldrich, catalog number: S7653 )
Nanopure water
HCl
Sucrose Buffer (see Recipes)
rhCD38 enzyme buffer (see Recipes)
Materials necessary to collect cells:
Scraper–Corning cell lifter (Corning, catalog number: 3008 )
Trypsin-EDTA 0.25% (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Phosphate Buffered Saline (PBS) 1x (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
Equipment
Note: The brands and models indicated are the ones used by our group, similar equipment can be used as well.
Pipettes (10, 200, 1,000 μl)
Scissors
Graduated cylinder
Repeat pipette (Eppendorf, model: Repeater® M4 )
Scale (Mettler-Toledo International, model: AG104 )
Microcentrifuge (Eppendorf, model: 5424 )
Homogenizer (Tissue Tearor, Bio Spec Products, catalog number: 780CL-04 )
Sonic Dismembrator (Fisher Scientific, model: Model 100 Sonic Dismembrator)
Spectrophotometer (BioTek Instruments, model: Epoch 2 )
Vortex (Scientific Industries, model: Vortex-Genie 2 , catalog number: G560)
Plate reader (Molecular Devices, model: SpectraMax Gemini XPS )
Software
Gen5 Microplate Reader and Imager Software (BioTek Instruments)
Microsoft Excel (Microsoft Corporation)
SoftMax Pro 6 (Molecular Devices, LLC)
GraphPad Prism 7 (GraphPad Software, Inc)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：de Oliveira, G. C., Kanamori, K. S., Auxiliadora-Martins, M., Chini, C. C. S. and Chini, E. N. (2018). Measuring CD38 Hydrolase and Cyclase Activities: 1,N6-Ethenonicotinamide Adenine Dinucleotide (ε-NAD) and Nicotinamide Guanine Dinucleotide (NGD) Fluorescence-based Methods. Bio-protocol 8(14): e2938. DOI: 10.21769/BioProtoc.2938.
Download Citation in RIS Format
Category
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,939 | https://bio-protocol.org/exchange/protocoldetail?id=2939&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol to Test the Effect of Sorbitol in vitro on Hybrid Larch (Larix x eurolepis Henry) Emblings
BJ Bettina Johst
MR María del Carmen Dacasa Rüdinger
Published: Jul 20, 2018
DOI: 10.21769/BioProtoc.2939 Views: 4302
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol presents a method to test the effect of sorbitol in vitro on hybrid larch plants derived from somatic embryogenesis. We have tested four different media variants, one control variant without sorbitol and three variants of decreasing water potential corresponding to sorbitol concentrations in the culture medium of 4%, 10%, and 20%. We cultured two hybrid larch clones on these media during 35 days and assessed their vitality and weight growth after this time.
Keywords: In vitro stress test Larch Tree breeding Sorbitol
Background
Forest tree breeding can benefit from methods that permit a high-throughput screening of plant lines in early stages of its development. Such methods help to delimitate the number of genotypes to be tested later in the field, an issue that in case of forest tree species requires considerable amounts of space. One possibility is to test young plantlets in vitro, a procedure that has the additional advantage of facilitating homogeneous and well-controlled experimental conditions. Aspects of tolerance against biotic and abiotic stress factors can be for instance screened in vitro. Among them, drought stress is receiving special attention in improvement programs. A common way to mimic water deficit is to add an osmoticum to the root supporting medium which reduces water availability. The osmoticum can be ionic like NaCl or non-ionic like mannitol, sorbitol or PEG (polyethylene glycol) (Singh and Singh, 2015). We have developed a protocol that allows testing the effect of sorbitol in vitro on hybrid larch emblings derived from somatic embryogenesis.
Materials and Reagents
Filter paper (90 x 90 mm) (sterile)
Aluminum foil
Weighing pan
Disposable syringe (20 ml DiscarditTM II) (BD, catalog number: 300330 )
Syringe filters (0.2 μm, cellulose acetate membrane, VWR, catalog number: 514-0061 )
Glass pipettes (sterile)
2x Scalpel (sterile)
Permanent marker
Steri Vent Container HIGH (sterile) (107 x 94 x 96 mm) with lid (sterile) (Duchefa Biochemie, catalog numbers: S1686 and S1681 respectively)
Plant material
Note: Produced via somatic embryogenesis (larch emblings) and delivered into sterile culture medium. We used two different clones of hybrid larch and 12 ramets per medium variant. The experiment was repeated twice. A total of 192 emblings were needed.
Potassium hydroxide (KOH)
Hydrochloric acid (HCl)
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Duchefa Biochemie, catalog number: M0513 )
Potassium dihydrogenphosphate (KH2PO4) (Duchefa Biochemie, catalog number: P0574 )
Calcium chloride dihydrate (CaCl2·2H2O) (Duchefa Biochemie, catalog number: C0504 )
MS micro salt mixture (Duchefa Biochemie, catalog number: M0301 )
MS vitamin mixture (Duchefa Biochemie, catalog number: M0409 )
Calcium nitrate tetrahydrate (Ca(NO3)2·4H2O) (Duchefa Biochemie, catalog number: C0505 )
Casein-Hydrolysate (Duchefa Biochemie, catalog number: C1301 )
Thiamine hydrochloride (C12H17ClN4OS·HCl) (Duchefa Biochemie, catalog number: T0614 )
Sucrose (C12H22O11) (Duchefa Biochemie, catalog number: S0809 )
GelriteTM (Duchefa Biochemie, catalog number: G1101 )
L-Glutamine (C5H10N2O3) (Duchefa Biochemie, catalog number: G0708 )
D-Sorbitol (C6H14O6) (Duchefa Biochemie, catalog number: S0807 )
Sterile 0.2 M L-Glutamine stock solution (see Recipes)
BM5-medium (Medium composition) (see Recipes)
Sorbitol medium (see Recipes)
Equipment
5x Duran glass bottle 1 L (sterile)
3x Tweezers (sterile)
Instrument stand (sterile)
4x Erlenmeyer flask 1 L
Volumetric flask 50 ml
Ruler (sterile)
pH meter
Magnetic stirrer
4x Stir bars
Precision balance
Rapid sterilizer for laboratory instruments (Simon Keller, model: Steri 250, catalog number: 31100 )
Autoclave (steam sterilizer, Tuttnauer, model: 3150 EL )
Osmometer (Wescor, model: 5500 Vapor Pressure Osmometer )
Laminar flow bench (EUROCLONE, model: AURA HZ 48 )
Plant culture room (Equipped with Philips lamps, Philips, model: Master TL-D 58W/840, catalog number: 927922084023 )
Software
IBM® SPSS® Statistics
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant physiology > Abiotic stress
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
294 | https://bio-protocol.org/exchange/protocoldetail?id=294&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Free Cytosolic Calcium Concentration ([Ca2+]i) in Single CHO-K1 Cells
Manuel D. Gahete
RL Raúl M. Luque
JC Justo P. Castaño
Published: Vol 2, Iss 22, Nov 20, 2012
DOI: 10.21769/BioProtoc.294 Views: 12829
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
This is a protocol to analyze the functional response of single CHO-K1 cells to a given treatment in terms of changes in free cytosolic calcium concentration ([Ca2+]i). This is possible by using the Ca2+ indicator dye Fura-2 AM, a polyamino carboxylic acid that binds to free intracellular calcium and is excited at 340 nm and 380 nm. The ratio of the emissions at 505 nm after excitation with those wavelengths is directly correlated to the amount of intracellular calcium. This protocol can be applied to other cell types (cell lines or primary cell cultures) by changing the culture conditions accordingly to the cell type.
Keywords: Intracellular pathway Microscopy Single cell Cytosolic calcium Treatment response
Materials and Reagents
Ca2+ indicator dye Fura-2-acetoxymethyl ester (Fura-2 AM) (Molecular Probes)
Phenol red-free DMEM
NaHCO3
Equipment
25 mm round glass coverslips
Nikon Eclipse TE200-E microscope with attached back thinned-CCD cooled digital camera (ORCAII BT; Hamamatsu Photonics)
Software
MetaFluor Software (Imaging Corp)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gahete, M. D., Luque, R. M. and Castaño, J. P. (2012). Measurement of Free Cytosolic Calcium Concentration ([Ca2+]i) in Single CHO-K1 Cells. Bio-protocol 2(22): e294. DOI: 10.21769/BioProtoc.294.
Download Citation in RIS Format
Category
Cell Biology > Cell-based analysis > Ion analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,940 | https://bio-protocol.org/exchange/protocoldetail?id=2940&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Overcoming Autofluorescence to Assess GFP Expression During Normal Physiology and Aging in Caenorhabditis elegans
Alina C. Teuscher
Collin Y. Ewald
Published: Jul 20, 2018
DOI: 10.21769/BioProtoc.2940 Views: 11354
Download PDF
Ask a question
Favorite
Cited by
Abstract
Green fluorescent protein (GFP) is widely used as a molecular tool to assess protein expression and localization. In C. elegans, the signal from weakly expressed GFP fusion proteins is masked by autofluorescence emitted from the intestinal lysosome-related gut granules. For instance, the GFP fluorescence from SKN-1 transcription factor fused to GFP is barely visible with common GFP (FITC) filter setups. Furthermore, this intestinal autofluorescence increases upon heat stress, oxidative stress (sodium azide), and during aging, thereby masking GFP expression even from proximal tissues. Here, we describe a triple band GFP filter setup that separates the GFP signal from autofluorescence, displaying GFP in green and autofluorescence in yellow. In addition, yellow fluorescent protein (YFP) remains distinguishable from both the yellowish autofluorescence and GFP with this triple band filter setup. Although some GFP intensity might be lost with the triple band GFP filter setup, the advantage is that no modification of currently used transgenic GFP lines is needed and these GFP filters are easy to install. Hence, by using this triple band GFP filter setup, the investigators can easily distinguish autofluorescence from GFP and YFP in their favorite transgenic C. elegans lines.
Keywords: Microscopy Filter set Fluorescent protein GFP YFP Autofluorescence Gut granules Lysosome-related organelles Age-pigments Lipofuscin Aging Transcription factor SKN-1 HSF-1 C. elegans
Background
Major sources of autofluorescence include intracellular lysosome-derived granules, mitochondria (i.e., autofluorescent molecules such as NAD(P)H and flavins), or extracellular collagen (Hermann et al., 2005; Monici, 2005). During aging, autofluorescent materials such as lipofuscin and advanced glycation end-products (AGE) accumulate. In the nematode C. elegans, the autofluorescence of gut granules starts already during embryogenesis, reflecting the biogenesis of lysosome-related organelles (Hermann et al., 2005). This prominent autofluorescence of these lysosome-related gut granules in the intestine continues throughout development and adulthood. The source of the autofluorescence, whether it is lipofuscin, AGE, tryptophan metabolites, or something else, is still unclear. However, this autofluorescence increases during aging and the two main tissues that show the highest autofluorescence are the intestine and the uterus in C. elegans (Pincus et al., 2016). With current fluorescent filter sets (TRITC, DAPI, FITC), three different autofluorescent wavelengths have been characterized in C. elegans. The red autofluorescence (visualized by TRITC) progressively increases with age, the blue autofluorescence (visualized by DAPI) peaks right before death, and the green autofluorescence (visualized by FITC) is a mixture from the red and blue autofluorescence (Pincus et al., 2016).
The multicellular model organism C. elegans is transparent, allowing GFP fluorescence to be assessed in vivo non-invasively (Chalfie et al., 1994). With commonly used GFP filter sets, for instance, FITC with an excitation center wavelength of 470 nm and a full bandwidth of 40 nm (470/40 nm), and emission range of 525/50 nm, the intestinal autofluorescence overlaps with the GFP signal. Previously, knockdowns by RNA interference (RNAi; e.g., tdo-2 RNAi) or gut granule-loss (glo) mutations (Hermann et al., 2005; Coburn et al., 2013), which either diminish or eliminate the intestinal autofluorescence, have been applied to the desired GFP transgenic C. elegans lines to overcome this problem. However, RNAi knockdowns or mutations that help to diminish autofluorescence alter gene function and might cause artifacts. In addition, there are transgenic GFP fusions of several stress response-regulating transcription factors (DAF-16::GFP, HSF-1::GFP, HLH-30::GFP, SKN-1::GFP) that are routinely used to assess cytoplasmic to nuclear translocation in intestinal cells as a proxy for their activation (Henderson and Johnson, 2001; Libina et al., 2003; Kwon et al., 2010; Lapierre et al., 2013; Morton and Lamitina, 2013; Ewald et al., 2015 and 2017b). Particularly, the transgenic SKN-1::GFP fusion is barely visible and is masked by intestinal autofluorescence even in larval C. elegans (Havermann et al., 2014; Wang et al., 2016; Hu et al., 2017).
To overcome the problem of autofluorescence masking intestinal GFP, Oliver Hobert (http://www.bio.net/mm/celegans/1998-November/001769.html) and several other investigators in the C. elegans community had proposed the principle of this combination of GFP filter sets. Optimization of these GFP filter sets by the Blackwell lab made it possible to assess the subcellular localization of SKN-1 and other proteins that were difficult to visualize (An and Blackwell, 2003). Unfortunately, these previous filter sets are not on sale anymore. Here, we describe the currently and commercially available filters that can be used to rebuild these GFP-filter settings. In contrast to the single band FITC GFP filter set, the proposed triple band GFP filter set has a very narrow excitation bandwidth of 10 nm, which is right by the maximum peak for the S65C mutant GFP excitation (488 nm) that is commonly used in C. elegans (Boulin et al., 2006; Heppert et al., 2016). More importantly, the emission filter used here has a first pass-through (520/20 nm) for the light emitted close to the GFP emission peak (509 nm) and a second pass-through (595/40 nm) from the light around the autofluorescence emission, allowing the separation of GFP (visible in green) and autofluorescence (visible in yellow).
Materials and Reagents
250 ml glass Erlenmeyer flask
1.5 ml centrifuge tubes
Microscope slides (size: 76 mm x 26 mm, 1 mm thick; VWR, Thermo Fisher Scientific, catalog number: 631-1303 )
Cover slip (size: 18 mm x 18 mm; VWR, catalog number: 631-1567 )
Tape (MILIAN, catalog numbers: 140255B , BA-5419-07 )
C. elegans strains (available at Caenorhabditis Genetics Center [CGC] https://cbs.umn.edu/cgc/home) or if not available at CGC, can be requested directly from the research labs that generated them: N2 C. elegans wild-type Bristol, LD1 Is007 [Pskn-1::skn-1b/c::gfp; pRF4 rol-6 (su1006)], LSD2022 spe-9(hc88); jgIs5 [Prol-6::rol-6::gfp, Pttx-3::gfp], EQ87 iqIs28 [pAH71 Phsf-1::hsf-1::gfp; pRF4 rol-6 (su1006)], BT24 rhIs23 [gfp::him-4] III, NL5901 pkIs2386 [Punc-54::alpha-synuclein::YFP + unc-119(+)])
Note: For culturing and handling C. elegans, please see Stiernagle (2006).
Agarose (Conda, catalog number: 8010 )
KH2PO4 (Merck, catalog number: 1048731000 )
Na2HPO4 (Sigma-Aldrich, catalog number: S5136 )
NaCl (Sigma-Aldrich, catalog number: S3014 )
MgSO4 (Fisher Scientific, catalog number: 10316240 )
Levamisole hydrochloride (Sigma-Aldrich, catalog number: L0380000 ) (2 mM) solved in M9 buffer
Note: Used here to paralyze worms; it is not recommended to use sodium azide (NaN3) (Sigma-Aldrich, catalog number: S2002-100G ) (20 mM, solved in M9 buffer).
Agarose pads (see Recipes)
M9 buffer (see Recipes) (Stiernagle, 2006; He, 2011)
Equipment
Autoclave
Microwave to heat up agarose
Heated water bath or heat block to keep agarose molten
For loading C. elegans onto agarose pads:
Stereomicroscope, worm pick, pipettes (Figure 1A) (Ewald et al., 2017a)
Upright bright field fluorescence microscope (Tritech Research, model: BX-51-F , Figure 1B)
Camera (The Imaging Source, model: DFK 23UX236 , with IC Capture 2.4 software)
It is important to use a color camera, since a monochrome camera is unable to distinguish between colors, so the filter set would be ineffective.
Triple band filter sets
Note: The triple band filter sets used here are from Chroma Technology Corp., but similar filter sets can be acquired from other manufacturers.
The triple band filter sets consist of the 69000 ET-DAPI/FITC/TRITC (69000x, 69000m, 69000bs, EX/EM 25 mm, ringed, DC 25.5 x 36 x 1 mm) (Chroma Technology, catalog number: 69000 ). However, the excitation filter 69000x is exchanged with an ET485/10x narrow band excitation filter (25 mm, ringed; Chroma Technology, catalog number: ET485/10x). The interpretation of the filter nomenclature for example for ET485/10x is: “ET” stands for magnetron sputtered exciter, “485” indicates the center wavelength of 485 nm and the “/10” indicates the full bandwidth of 10 nm (i.e., +/- 5 nm from the center), and the “x” stands for excitation. Hence, the triple band filter set consists of the ET485/10x excitation filter, the 69000bs dichroic beam splitter, and the 69000m emission filter. The triple band filters are then assembled in a microscope filter cube. A schematic of this setup is shown in Figures 1C and 1D. A comparison between the filter set properties and the resulting images are shown in Figure 2. In brief, the 69000m emission filter allows light coming through from 520/20 nm (green) and from 595/40 (yellow to orange/red) but blocks the greenish to yellow light (535-572 nm), which is the key feature of the triple band filter set that allows distinguishing GFP from autofluorescence (Figure 2). This is in contrast to a GFP long-pass emission filter (ET500lp, > 500 nm), which allows all the light from green to red to pass through.
Figure 1. Equipment and experimental setup. A. Equipment and utilities for mounting C. elegans on microscope slides. Shown from the top left: a stereoscope, M9 buffer in a falcon tube, levamisole in a 1.5 ml centrifuge tube, a pipette with tips, a worm-pick to mount C. elegans in the liquid droplet, microscope slides with 2% agarose pad, and C. elegans on culturing plate. B. Upright bright field fluorescence microscope setup; C. The filter cube and its position in the microscope; D. A schematic representation of the filter cube. The dashed lines indicate the pathway of the light through the filter cube, while the arrows indicate the filters and the mirror. E. Preparation of the 2% agarose pad slides for microscopy. On the left side is a slide with a drop of 2% agarose dropped between two blue taped slides, while on the right side the agarose drop was already covered by another slide perpendicular to the green taped slides.
Figure 2. Applying the triple band filter set to distinguish between GFP signal and C. elegans autofluorescence. A-B. The LSD2022 C. elegans strain expresses an integrated collagen::GFP transgene (ROL-6::GFP), which is visible in the cuticle (white arrow). In addition, the strain LSD2022 expresses GFP driven by the ttx-3 promoter in the AIY interneuron pair (white arrowhead) (Kim et al., 2010). A C. elegans worm (LSD2022) imaged with a commonly used single band filter set (A). The same animal imaged with the triple band filter set. Green is GFP and yellow is autofluorescence (B). C. Transmission graph of the single band filter set we used in (A) [49002-ET-EGFP (FITC/Cy2) by Chroma]; D. Transmission graph of the triple band filter setup used for (B). The triple band filter setup consists of a narrow band ET485/10x excitation filter, a 69000bs dichroic mirror filter, and a 69000m emission filter, which allows light coming through from 520/20 nm (green) and from 595/40 (yellow to orange/red). However, the 69000m emission filter blocks the greenish to yellow light (535-572 nm), which is the key feature that helps to distinguish GFP from autofluorescence. (C and D) The graphs are both adapted from www.chroma.com.
Software
IC Capture 2.4 software (https://www.theimagingsource.com/support/downloads-for-windows/end-user-software/iccapture/)
ImageJ (https://imagej.net/Image_Stitching)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Developmental Biology > Cell signaling > Stress response
Cell Biology > Cell imaging > Fluorescence
Molecular Biology > Protein > Detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,941 | https://bio-protocol.org/exchange/protocoldetail?id=2941&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
α-Synuclein Aggregation Monitored by Thioflavin T Fluorescence Assay
Michael M. Wördehoff
Wolfgang Hoyer
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2941 Views: 12813
Edited by: Ralph Thomas Boettcher
Reviewed by: Aditya Iyer
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Studying the aggregation of amyloid proteins like α-synuclein in vitro is a convenient and popular tool to gain kinetic insights into aggregation as well as to study factors (e.g., aggregation inhibitors) that influence it. These aggregation assays typically make use of the fluorescence dye Thioflavin T as a sensitive fluorescence reporter of amyloid fibril formation and are conducted in a plate-reader-based format, permitting the simultaneous screening of multiple samples and conditions. However, aggregation assays are generally prone to poor reproducibility due to the stochastic nature of fibril nucleation and the multiplicity of modulating factors. Here we present a simple and reproducible protocol to study the aggregation of α-synuclein in a plate-reader based assay.
Keywords: Amyloid Aggregation α-Synuclein Thioflavin T assay Parkinson’s disease
Background
Aggregation of endogenous proteins to amyloid fibrils is a pathogenic process that is associated with several disorders, e.g., neurodegenerative diseases like Alzheimer’s disease (AD) or Parkinson’s disease (PD) as well as systemic diseases like AL amyloidosis (Knowles et al., 2014). This process can be recapitulated in vitro in a plate-reader-based setup by aggregation assays based on Thioflavin T fluorescence, allowing the aggregation kinetics of amyloid proteins to be studied in dependence of various influencing factors.
Thioflavin T (ThT) is a fluorescence dye that has first been used for staining amyloid fibrils in histological samples by Vassar and Culling in 1959 (Vassar and Culling, 1959), its application for detecting and quantifying amyloid fibrils in vitro has first been described by Naiki et al. in 1989 (Naiki et al., 1989). Upon binding within the cross-β-architecture of amyloid fibrils, ThT changes its spectral characteristics (bathochromic wavelength shift to λex: 450 nm and λem: 482 nm) and exhibits a strong increase in fluorescence emission (Biancalana and Koide, 2010). It is therefore a very sensitive indicator of amyloid fibril formation and has been adapted to aggregation assays with synthetically and recombinantly produced amyloidogenic proteins, like the AD-associated protein amyloid-β (LeVine, 1993) as well as the PD-associated protein α-synuclein (Hashimoto et al., 1998).
Aggregation assays with Thioflavin T are nowadays mainly performed in fluorescence plate readers, where e.g., 96 conditions can be tested simultaneously. These assays suffer from poor reproducibility resulting from the stochastic nature of fibril nucleation and the multiplicity of factors affecting protein aggregation. Therefore, strategies to increase the reproducibility of ThT assays have been employed, such as the use of orbital shaking of the well plate during the measurement as well as the addition of glass beads to the wells to improve mixing (Giehm and Otzen, 2010).
Here, we describe a simple protocol for α-synuclein aggregation assays using ThT that comprises the following strategies to improve reproducibility and convenience:
The use of N-terminally acetylated α-synuclein, which is the native state of the protein (Anderson et al., 2006). N-terminal acetylation of α-synuclein also increases reproducibility of aggregation half times in ThT assays (Iyer et al., 2016).
Thirty seconds of shaking prior to the ThT fluorescence measurement leads to more reproducible fluorescence readings due to a more homogenous distribution of fibrils within the sample, including aggregation nuclei that preferentially form at the air-water-interface (Campioni et al., 2014).
Glass beads (Ø 2.85-3.45 mm) are added to each well to improve mixing and homogeneity of the sample as described (Giehm and Otzen, 2010).
We use half-area 96-well-plates (Corning, USA) that have a non-binding surface. Half-area wells save sample volume, as only 100-120 μl is needed per well. The non-binding surface e.g., prevents adsorption of amyloid fibrils to the well surface, a process that can cause aberrant readings in ThT assays (Murray et al., 2013).
Materials and Reagents
50 ml Falcon centrifuge tubes (TPP Techno Plastic Products, catalog number: 91050 )
Sterile syringe filter, Filtropur S, 0.2 μm (SARSTEDT, catalog number: 83.1826.001 )
Slide-A-LyzerTM dialysis cassettes 10 kDA MW cutoff, 3-12 ml (Thermo Fisher Scientific, catalog number: 66810 )
HiTrap Q HP IEC column, 5 ml (GE Healthcare, catalog number: 17115401 )
Superdex 75 16/60 SEC column, ~120 ml volume (GE Healthcare, catalog number: 28989333 )
Protein LoBind Tubes 1.5 ml (Eppendorf, catalog number: 0030108116 )
96-well plates (Corning half-area, black and clear flat bottom, non-binding surface) (Corning, catalog number: 3881 )
Sealing tape, clear polyolefin (Thermo Fisher Scientific, catalog number: 232701 )
E. coli BL21DE3 competent cells (e.g., available from Merck, catalog number: 69450 )
α-Synuclein in pT7-7 vector (e.g., Addgene, catalog number: 36046 )
We use a version of this plasmid that is codon-optimized for E. coli
NatB in pACYCduet vector (e.g., Addgene, catalog number: 53613 )
Isopropyl β-D-1-thiogalactopyranoside (IPTG), > 99% (Ubiquitin-Proteasome Biotechnologies, catalog number: P1010-100 )
Ampicillin sodium salt (Sigma-Aldrich, catalog number: A9518 )
Chloramphenicol (Sigma-Aldrich, catalog number: C0378 )
YT medium (2x) premixed powder (AppliChem, catalog number: A0981 )
Magnesium sulfate heptahydrate p.a. (Merck, catalog number: 1058860500 )
Glycerol bidistilled, ≥ 99.5% (VWR, catalog number: 24388 )
Tris(hydroxymethyl)aminomethane, Trizma base p.a. (Sigma-Aldrich, catalog number: 93350 )
Sodium chloride, p.a. (Carl Roth, catalog number: 3957 )
Sodium dihydrogen phosphate monohydrate, p.a. (AppliChem, catalog number: 131965.1211 )
α-Synuclein, N-terminally acetylated (from recombinant expression in E. coli [Johnson et al., 2010] and purified as described [Wördehoff et al., 2017])
Note: We verify N-terminal acetylation by HPLC and mass spectrometry. Alternatively, acetic acid gel electrophoresis can be performed (Iyer et al., 2016). We have included a short description of our α-synuclein purification protocol in the procedure section of this protocol.
Thioflavin T, ultrapure grade (AnaSpec, catalog number: AS-88306 )
Sodium azide (purum p.a., Sigma-Aldrich, catalog number: 71290 )
H2O (Milli-Q ≥ 18.2 MΩ resistivity)
Glass beads, Ø 2.85-3.45 mm (Carl Roth, catalog number: A557.1 ), stored in 70% ethanol to ensure sterility
Potassium dihydrogen phosphate (p.a., AppliChem, catalog number: A1043 )
Dipotassium hydrogen phosphate, trihydrate (p.a., Merck, catalog number: 105099 )
Potassium chloride (p.a., Carl Roth, catalog number: 6781.1 )
Hydrochloric acid, p.a. ≥ 37% (Sigma-Aldrich, catalog number: 30721-M )
Ammonium sulfate, puriss. p.a. ≥ 99% (Merck, catalog number: 31119-M )
Modified 2YT medium (see Recipes)
10x Medium buffer, pH 7.2 (see Recipes)
IEC buffer A (see Recipes)
IEC buffer B (see Recipes)
Saturated ammonium sulfate solution (see Recipes)
SEC buffer (see Recipes)
Equipment
Pipettes (e.g., Eppendorf, model: Research® Plus , catalog numbers: 3123000039, 3123000055, 3123000063)
Sterile tweezers
-80 °C freezer
Fluorescence plate reader (e.g., BMG LABTECH, model: FLUOstar Omega ), equipped with monochromators or appropriate filters for the fluorophore Thioflavin T (e.g., BMG excitation filter: 448(nm)-10, BMG emission filter: 482(nm)-10)
Note: The plate reader should be heatable to 37 °C.
UV/VIS spectrophotometer (e.g., JASCO, model: V-650 )
Heating Block (e.g., Grant Instruments, model: UBD2 )
Magnetic stirrer (e.g., Cole-Parmer Instrument, Stuart, model: CB161 )
Centrifuge for 50 ml Falcons (e.g., Eppendorf, model: 5804 R )
ÄKTA Purifier (GE Healthcare)
Software
Microsoft Excel
AmyloFit (http://www.amylofit.ch.cam.ac.uk/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wördehoff, M. M. and Hoyer, W. (2018). α-Synuclein Aggregation Monitored by Thioflavin T Fluorescence Assay. Bio-protocol 8(14): e2941. DOI: 10.21769/BioProtoc.2941.
Download Citation in RIS Format
Category
Molecular Biology > Protein > Protein-protein interaction
Neuroscience > Nervous system disorders > Parkinson's disease
Biochemistry > Protein > Self-assembly
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,942 | https://bio-protocol.org/exchange/protocoldetail?id=2942&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Visualization of Growth and Morphology of Fungal Hyphae in planta Using WGA-AF488 and Propidium Iodide Co-staining
Amey Redkar
Elaine Jaeger
Gunther Doehlemann
Published: Jul 20, 2018
DOI: 10.21769/BioProtoc.2942 Views: 10257
Download PDF
Ask a question
Favorite
Cited by
Abstract
Fungal pathogens colonizing plants show a varying degree of symptoms. Microscopy techniques have been used to study the infection and proliferation of fungal hyphae inside the host. One of the best optimized and commonly used method is the co-staining with Wheat Germ Agglutinin- Alexa Fluor 488 conjugate (WGA-AF488) and propidium iodide (PI), which stains fungal hyphae and the plant cell wall in contrasting shades. This technique is widely used to characterize the various behaviors of fungal hyphae, e.g., in fungal knockout mutants being attenuated during differential stages of host colonization. We describe the protocol for sample preparation of WGA-AF488– PI staining of infected plant tissue. Here, we have used an infected sample with the basidiomycetous smut fungus Ustilago maydis that infects its host plant maize (Zea mays L.) and Ustilago hordei that infects barley (Hordeum vulgare L.). This protocol helps to understand growth, biomass and morphology of fungus in planta by confocal laser scanning microscopy (Doehlemann et al., 2011; Redkar et al., 2015).
Keywords: Microscopy Fungus Propodium iodide Confocal Maize
Materials and Reagents
2.0 ml microcentrifuge tubes
100% ethanol
Double distilled water
Potassium hydroxide 10% (KOH)
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
Wheat Germ Agglutinin (WGA) Alexa Fluor 488 (Thermo Fisher Scientific, catalog number: W11261 )
Propidium iodide (PI) (Sigma-Aldrich, catalog number: P4170 )
Potassium phosphate monobasic (KH2PO4)
Sodium phosphate dibasic (Na2HPO4)
Potassium chloride (KCl)
Sodium chloride (NaCl)
WGA-AF488-Stock Solution (see Recipes)
Phosphate buffer saline (PBS, pH 7.4, self-made) (see Recipes)
Propidium iodide-Stock Solution (see Recipes)
Staining Solution (see Recipes)
Equipment
Vacuum Infiltrator
Confocal microscope (e.g., Leica Microsystems, model: Leica TCS SP8 )
Software
Leica Image Analysis Software in the SP8 confocal microscopy or with the freely available ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > Fungus
Plant Science > Plant cell biology > Intercellular communication
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
is this protocol compatible for oomycete hyphae growth and morphology visualization?
0 Answer
4 Views
Mar 12, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,943 | https://bio-protocol.org/exchange/protocoldetail?id=2943&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
High-throughput YO-PRO-1 Uptake Assay for P2X7 Receptors Expressed in HEK Cells
Akira Karasawa
TK Toshimitsu Kawate
Published: Jul 20, 2018
DOI: 10.21769/BioProtoc.2943 Views: 7515
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
P2X7 receptors are extracellular ATP-gated ion channels that play broad physiological and pathological roles in animals (Sluyter, 2017). Activation of P2X7 receptors lead to the opening of membrane channels permeable for small cations like Na+ and Ca2+ as well as fluorescent dyes such as YO-PRO-1 (Alves et al., 2014). Taking advantage of this dye-permeability, YO-PRO-1 uptake assays have been widely used to probe P2X7 receptor activity (Surprenant et al., 1996; Rassendren et al., 1997; Karasawa et al., 2017). Here we describe a step by step protocol for a high-throughput YO-PRO-1 uptake assay using HEK293 cells expressing P2X7 receptors. This 3-day protocol is particularly suited for examining effects of small molecules and mutations on P2X7 receptor function. This protocol was adapted from our previously published paper (Karasawa and Kawate, 2016).
Keywords: P2X7 HEK293 cells Microplate reader Drug screening
Background
The P2X7 receptor opens a membrane channel permeable to cations (Surprenant et al., 1996; Sluyter, 2017). While electrophysiology remains the gold standard for quantifying P2X7 receptor activity, this specialized technique may not be readily available. In addition, electrophysiology is not suited for high-throughput screening, as it requires a substantial amount of time and manipulation for each recording. Uptake of a fluorescent molecule, therefore, has been a widely used alternative, especially for screening multiple conditions/mutants (Cankurtaran-Sayar et al., 2009; Qu et al., 2011). One of the most commonly used fluorescent molecules is a monomeric cyanine nucleic acid stain, YO-PRO-1. This fluorescent molecule increases its green fluorescence upon binding to nucleic acids in the cell. Because YO-PRO-1 directly permeates the P2X7 membrane pore, activity of this receptor can be studied by following the changes in green fluorescence (Karasawa et al., 2017). Typically, YO-PRO-1 uptake is studied using a fluorescent microscope, which allows time-dependent quantification of regions-of-interest (Surprenant et al., 1996; Rassendren et al., 1997). A major challenge, however, is to retain information about the activation kinetics while maintaining a higher throughput. To overcome this issue, we have developed a YO-PRO-1 uptake method using a fluorescent plate reader. By quickly measuring the total fluorescence from each well, our method enables data collection every 70-80 sec/well. While this is not near the sampling frequency of a low-throughput single cell measurement (e.g., electrophysiology or fluorescent microscopy), it is sufficient for quantifying the initial rate of YO-PRO-1 uptake. Our newly developed method described in this protocol, therefore, is an efficient approach for screening hundreds of conditions based on P2X7 activation kinetics.
Materials and Reagents
Note: Materials and Reagents are stored at room temperature unless otherwise noted.
Generic pipette tips (VWR, catalog numbers: 613-0741 , 613-2133 , 613-0746 )
Cryogenic Storage Vials 2 ml, Sterile (Fisher Scientific, catalog number: 10-500-26 )
CELLSTAR serological pipettes 2, 5, 10 ml (Greiner Bio One International, catalog numbers: 710107 , 606107 , 607107 )
Neptune Microcentrifuge Tubes with Attached Flat Caps 1.5 ml (Biotix, catalog number: 4445.X )
Falcon® Tissue Culture Dishes (Corning, catalog number: 353003 )
CELLSTAR 6-Well Multiwell Culture Plates (Greiner Bio One International, catalog number: 657160 )
Corning® BioCoatTM 96-Well Multiwell Plates with Poly-D-Lysine (Corning, catalog number: 356640 )
Multiwell Cell Culture 96-Well Plates (VWR, catalog number: 10062-900 )
HEK-293 cells (ATCC, catalog number: CRL-1573 ) (stored in liquid nitrogen)
pIM2 vector (developed in the Kawate lab; Figure 1) harboring a P2X7 receptor gene (stored in -20 °C freezer)
Note: In this protocol, panda P2X7 gene (NCBI Reference Sequence: XP_002913164.2) is used.
MAX EfficiencyTM DH5αTM competent cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18258012 ) (Stored in -80 °C freezer)
E.Z.N.A. Plasmid Mini Kit (Omega Bio-tek, catalog number: D6942-02 )
Liquid nitrogen (Airgas, catalog number: NI 180LT230 )
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 11995065 ) (stored in 4 °C fridge)
FBS (Atlanta Biologicals, catalog number: S11150H ) (Stored in -80 °C freezer)
Ultra Pure Grade Carbon Dioxide (Airgas, catalog number: CD UP200 )
100% Pure Ethanol (Decon Labs, catalog number: V1016TP )
2-Propanol (Avantor Performance Materials, catalog number: 9095-33 )
DPBS/Modified (GE Healthcare, catalog number: SH30028.02 )
HycloneTM Trypsin 0.25% (1x) (GE Healthcare, catalog number: SH30042.02 ) (stored in 4 °C fridge)
YO-PROTM-1 Iodide (491/509) (Thermo Fisher Scientific, catalog number: Y3603 ) (stored in -20 °C freezer)
jetPRIME (Polyplus-transfection, catalog number: 114-15 ) (stored in 4 °C fridge)
Sodium Chloride (NaCl) (Fisher Scientific, catalog number: S641-212 )
Gentamicin (Thermo Fisher Scientific, GibcoTM, catalog number: 15710064 )
Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-4 )
Adenosine 5’-triphosphate disodium salt hydrate (Sigma-Aldrich, catalog number: A7699 ) (stored in a -20 °C freezer)
HEPES (Fisher Scientific, Fisher BioreagentsTM, catalog number: BP310-1 )
D-(+)-Glucose (Sigma-Aldrich, catalog number: G5767 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Calcium Chloride Dihydrate (CaCl2·2H2O) (Fisher Scientific, catalog number: C79-500 )
JNJ 47965567 (Tocris Bioscience, catalog number: 5299 ) (stored in 4 °C fridge)
DMEM-FBS (see Recipes)
Assay buffer (see Recipes)
YO-PRO-1 Solution (see Recipes)
100 mM ATP stock (see Recipes)
100 mM Inhibitor stock (JNJ) (see Recipes)
Equipment
500 ml beaker
Original Pipet-Aid pipette controller (Drummond Scientific, catalog number: 4-000-110 )
GilsonTM PIPETMANTM M Multichannel Pipettes (Gilson, catalog number: F81027 )
ErgoOne 30-300 μl 12-Channel (USA Scientific, catalog number: 7112-3300 )
Mettler Toledo-XP204-Analytical Balance (Mettler-Toledo International, model: XP204S/M , catalog number: 11130054)
Magnetic stir bars
Baker SterilGARDR® II Biological safety Cabinet SG-600 (The Baker Company, model: SterilGARDR II SG600 )
NanoDrop2000 (Thermo Fisher Scientific, ThermoScientific, model: NanoDropTM 2000 , catalog number: ND-2000)
VWR® Ultra Low Temperature Upright Freezers and Freezer (VWR, model: 5656 )
IsotempTM digital-control water baths (Fisher Scientific, model: Model 202 )
Shel Lab 2350-T CO2 Water Jacketed Incubator (Sheldon Manufacturing, catalog number: 9150933 )
MALGENECryo 1 °C Freezing Container (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 5100-0001 )
Hemocytometer (Daigger Scientific, catalog number: EF16034F )
Milli-Q® Reference Water Purification System (EMD Millipore, catalog number: Z00QSV0WW )
SevenEasy pH meter (Mettler-Toledo International, catalog number: 51302819 )
Gravity and vacamatic sterilizers (Amscope, model: EAGLE® SERIES 3000 , catalog number: 213415)
Refrigerator (PHC, model: MPR-1411 )
SANYO Biomedical freezer (SANYO, model: MDF-U333 )
Steadystir digital S56 (Fisher Scientific, catalog number: 14-359-756 )
Ice maker (Hoshizaki America, model: F-500BAF )
Ice Bucket with Lid (Globe Scientific, catalog number: IBB003P )
EVOSTM FL Imaging System (Thermo Fisher Scientific, catalog number: AMF4300 )
EVOSTM Light Cube, GFP (Thermo Fisher Scientific, catalog number: AMEP4651 )
EVOSTM Light Cube, Texas Red (Thermo Fisher Scientific, catalog number: AMEP4655 )
Biotek SynergyTM 2 Multi-mode Detection Microplate/Plate Reader (BioTek Instruments, catalog number: 7160204 )
Software
Vector NTI software 11.5 (Thermo Fisher Scientific)
Gen5 1.10 (BioTek Instruments)
Excel 14.0 (Microsoft)
Origin 6.0 (OriginLab)
Procedure
Preparation of plasmid
The pIM2 vector harbors a multiple cloning site (MCS) and mCherry flanking an internal ribosome binding site (IRES; Figure 1). This enables one to check transfection efficiency by following mCherry fluorescence (Figure 2). A P2X7 receptor gene (XP_002913164.2) is subcloned in MCS using BamHI and XhoI. (Figure 1)
Figure 1. Vector map of pIM2-P2X7. This figure is created using Vector NTI software (Thermo Fisher Scientific).
Amplify the plasmid using an E.Z.N.A. miniprep kit.
Measure the concentration of plasmid using Nanodrop (normally around 0.5 μg/μl).
Store the plasmid in a -20 °C freezer.
HEK293 cell preparation (perform in a biosafety cabinet)
Store aliquots of low passage HEK293 cells in liquid nitrogen.
Thaw an aliquot of HEK293 cells in a 37 °C water bath and transfer into 10 ml DMEM-FBS medium in a 10 cm dish. Incubate the cells in a CO2 incubator at 37 °C.
When the cell density reaches 90-100% confluency, aspirate the medium, rinse with 5 ml DPBS, and dissociate with 1 ml trypsin. Split the cells at 1/10 cell density with DMEM-FBS in a new 10 cm dish. Repeat Steps B2 and B3 for maintaining HEK293 until sued in the YO-PRO-1 uptake assay.
One day before transfection, split 90-100% confluent HEK cells in a 10 cm dish into a 6-well plate by performing Steps B5-B8.
Rinse the cells with DPBS and detach them with 1 ml trypsin.
Resuspend the cells by gently pipetting with 12 ml DMEM-FBS.
Plate 2 ml of resuspended cells into each well of a 6-well plate.
Incubate the HEK cells overnight in a CO2 incubator.
Transfection (perform in a biosafety cabinet)
For each well of the 6-well plate, prepare DNA/transfection reagent mixture in the following procedure.
Add 2 μg of pIM2 plasmid, 5 μl jetPRIME transfection reagent, and 200 μl jetPRIME buffer in a 1.5 ml Eppendorf tube.
Mix well by vortexing and incubate for 15 min at room temperature (RT).
Add the DNA/transfection-reagent mixture into a well of the HEK cells on a 6-well plate.
Incubate the cells for 3 h at 37 °C in a CO2 incubator (No shaking).
Aspirate the medium and rinse the cells with 2 ml of DPBS.
Incubate the cells with 0.5 ml trypsin at RT.
Mix the cells with 3 ml DMEM-PBS by gently pipetting up and down 3 times.
Split 100 μl of resuspended cells into each well of a poly-L-lysine coated 96-well plate.
Incubate the cells overnight at 37 °C in a CO2 incubator.
YO-PRO-1 uptake assay
Check the transfection efficiency by mCherry fluorescence using a fluorescent microscope (Figure 2). More than 70% of the cells should show red fluorescence.
Figure 2. mCherry fluorescence from HEK cells expressing P2X7. Image was obtained using an Evosf1 microscope (10x objective; 10% gain; Ex: 585/29 Em: 624/40). Scale bar = 400 μm. Typically more than 70% of the cells are fluorescent.
Prewarm Assay buffer and YO-PRO-1 solution (10 ml/plate each) at 37 °C in a water bath.
Replace the DMEM-FBS medium in the 96-well plate with 100 μl/well Assay buffer.
Aspirate Assay buffer and gently add 100 μl YO-PRO-1 solution in each well. When drugs are tested, include the desired concentration of compounds in the YO-PRO-1 solution.
Incubate the plate for 15 min at 37 °C in a CO2 incubator.
Prewarm the plate reader at 37 °C.
Prepare 11 mM ATP in Assay buffer from 100 mM stock and dispense 100 μl/well in a 96-well plate (no poly-L-lysine coating plastic plate).
Open Gen5 software on Biotek Synergy 2 Multi-mode Detection Microplate/Plate Reader.
Click the procedure and create the program as shown in Figure 3.
Figure 3. Screenshots of the YO-PRO-1 uptake assay program on Gen5 software. A. Program used in this protocol; B. Input setup for fluorescence measurements.
Select the wells that include samples by clicking the upper right button in Figure 3B.
Hit "Read" bottom and the tray will come out automatically.
Insert the 96-well plate on the tray and start the program.
After measuring the background fluorescence for 5 min, the tray will come out.
Immediately add 10 μl of 11 mM ATP into each well using a multichannel pipette.
Push the tray back into the machine and the program continues to measure fluorescence.
Once the program is finished, click the well in the matrix and export the data (time and fluorescence values) as a Microsoft Excel file.
Check the YO-PRO-1 fluorescence from the cells under an Evosf1 microscope. If P2X7 was activated by ATP, green fluorescence should be observed (Figure 4B).
Figure 4. YO-PRO-1 fluorescence from HEK cells. Images were obtained using an Evosf1 microscope (10x objective; 10% gain; Ex: 470/22 Em: 525/50). Scale bars = 400 μm. A. HEK cells transfected with Empty pIM2 vector; B. HEK cells transfected with pIM2-P2X7.
Data analysis
Export the raw data as a Microsoft Excel file.
Normalized the fluorescence by subtracting the background fluorescence.
Plot the fluorescence value against the time (Figure 5A).
Obtain the initial rates of YO-PRO-1 uptake by linear regression analysis on Excel (Figure 5B). Normally, the first 4-6 points are within the linear range.
Figure 5. YO-PRO-1 uptake by P2X7 activation. A. P2X7-mediated YO-PRO-1 uptake triggered by 1 mM ATP (black). Vector control (red) shows little accumulation of YO-PRO-1. B. Zoomed in window highlighting the initial linear range of Yo-Pro-1 uptake activity. Slope of this equation (69.10) represents the initial rate for this assay. Graphs were made by Origin software for representation purpose in this figure.
For the measurement of the efficacy of a drug, carry out the YO-PRO-1 uptake assay in the presence of different concentrations of the drug (Figure 6A).
Plot the initial rates against drug concentrations (Figure 6B).
Calculate the IC50 value by fitting a Hill equation.
Figure 6. Efficacy of P2X7 specific inhibitor JNJ. A. P2X7-mediated YO-PRO-1 uptake triggered by 1 mM ATP in the absence (Black) or in the presence of JNJ at different concentrations (Color). B. Initial rates of YO-PRO-1 uptake at different concentrations were plotted against JNJ concentrations. These points were fit to a Hill equation using Origin software.
Repeat the assay with HEK cells transfected on different days. Normally 5 different assays are used for quantifying P2X7 activity.
Calculate the IC50 values from each assay and obtain the average values.
Notes
Overgrown or unhealthy HEK cells present substantially lower transfection efficiency. In addition, unhealthy cells tend to give higher background of YO-PRO-1 fluorescence as this dye can get into these cells without P2X7 activation.
Poly-L-lysine coated plate is essential as HEK cells easily come off from the non-coated plate during the washing step.
YO-PRO-1 is light sensitive. We found fluorescence intensity of YO-PRO-1 significantly went down after a few hours. YO-PRO-1 solution should be prepared just before the fluorescence measurement.
Recipes
Note: Prepare Recipe 1 DMEM-FBS in a tissue culture hood. Other solutions do not need to be sterilized.
DMEM-FBS
For 500 ml DMEM-FBS, replace 50 ml of DMEM with 50 ml FBS and 500 μl of Gentamicin
Assay buffer
Weigh out the following chemicals in a 500 ml beaker:
NaCl
4.3 g
HEPES
1.2 g
Glucose
1.17 g
KCl
74.6 mg
CaCl2
7.35 mg
Dissolve in Milli-Q water by mixing with stir bar
Adjust the pH to 7.4 with NaOH
Make up the volume to 500 ml with Milli-Q water
Store the solution in a 4 °C fridge
YO-PRO-1 Solution (prepare freshly just before the assay)
Thaw 1 mM YO-PRO-1 stock (provided in DMSO) at RT (stored in a -20 °C freezer)
Take 55 μl of YO-PRO-1 stock solution into a 15 ml tube and add 11 ml of Assay buffer to make 5 μM YO-PRO-1 solution
100 mM ATP stock
Weigh out 1.1 g of ATP in a 50 ml tube
Dissolve the ATP in Assay buffer
Adjust the pH to 7.4
Make up the volume to 20 ml with Milli-Q water
Aliquot it into a 1.5 ml tube and store in a -20 °C freezer
100 mM Inhibitor stock (JNJ)
Weigh out 9.77 mg JNJ 47965567 in a 1.5 ml tube
Dissolve it with 200 μl DMSO
Aliquot it into 1.5 ml tube and store in a -20 °C freezer
Acknowledgments
This protocol was adapted from our previous work (Karasawa and Kawate, 2016). This work was supported by the National Institutes of Health (GM114379 and NS072869). The authors declare no conflicts of interest.
References
Alves, L. A., de Melo Reis, R. A., de Souza, C. A., de Freitas, M. S., Teixeira, P. C., Neto Moreira Ferreira, D. and Xavier, R. F. (2014). The P2X7 receptor: shifting from a low- to a high-conductance channel - an enigmatic phenomenon? Biochim Biophys Acta 1838(10): 2578-2587.
Cankurtaran-Sayar, S., Sayar, K. and Ugur, M. (2009). P2X7 receptor activates multiple selective dye-permeation pathways in RAW 264.7 and human embryonic kidney 293 cells. Mol Pharmacol 76(6): 1323-1332.
Karasawa, A. and Kawate, T. (2016). Structural basis for subtype-specific inhibition of the P2X7 receptor. Elife 5: e22153.
Karasawa, A., Michalski, K., Mikhelzon, P. and Kawate, T. (2017). The P2X7 receptor forms a dye-permeable pore independent of its intracellular domain but dependent on membrane lipid composition. Elife 6: e31186.
Qu, Y., Misaghi, S., Newton, K., Gilmour, L. L., Louie, S., Cupp, J. E., Dubyak, G. R., Hackos, D. and Dixit, V. M. (2011). Pannexin-1 is required for ATP release during apoptosis but not for inflammasome activation. J Immunol 186(11): 6553-6561.
Rassendren, F., Buell, G. N., Virginio, C., Collo, G., North, R. A. and Surprenant, A. (1997). The permeabilizing ATP receptor, P2X7. Cloning and expression of a human cDNA. J Biol Chem 272(9): 5482-5486.
Sluyter, R. (2017). The P2X7 Receptor. Adv Exp Med Biol 1051: 17-53.
Surprenant, A., Rassendren, F., Kawashima, E., North, R. A. and Buell, G. (1996). The cytolytic P2Z receptor for extracellular ATP identified as a P2X receptor (P2X7). Science 272(5262): 735-738.
Copyright: Karasawa and Kawate. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
Category
Cell Biology > Cell-based analysis > Transport
Molecular Biology > Protein > Ion channel signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,944 | https://bio-protocol.org/exchange/protocoldetail?id=2944&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
High Resolution Melting Temperature Analysis to Identify CRISPR/Cas9 Mutants from Arabidopsis
CD Cynthia Denbow
SE Sonia Carole Ehivet
SO Sakiko Okumoto
Published: Vol 8, Iss 14, Jul 20, 2018
DOI: 10.21769/BioProtoc.2944 Views: 7953
Edited by: Rainer Melzer
Reviewed by: Runlai HangMarta Bjornson
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
CRISPR/Cas9 made targeted mutagenesis and genome editing possible for many plant species. One of the ways that the endonuclease is used for plant genetics is the creation of loss-of-function mutants, which typically result from erroneous DNA repair through non-homologous end joining (NHEJ) pathway. The majority of erroneous repair events results in single-bp insertion or deletion. While single-bp insertions or deletions (indels) effectively destroy the function of protein-coding genes through frameshift, detection is difficult due to the small size shift. High-resolution melting temperature analysis allows quick detection, and it does not require any additional pipetting steps after the PCR amplification of the region of interest. In this protocol, we will describe the steps required for the analysis of potential homozygous mutants.
Keywords: CRISPR/Cas9 High-resolution melting analysis Indel detection Arabidopsis Targeted mutagenesis
Background
CRISPR/Cas9 nuclease is a ribonucleoprotein that is capable of cleaving a DNA double strand at a specific 22 nucleotide sequence. The major advantage of the CRISPR/Cas9 system compared to other nucleases such as zinc-finger nucleases and Transcription Activator-Like Effector Nucleases (TALENs) is that the sequence specificity is conferred by the RNA and does not require separate proteins for each target sequence. This reduces the cost dramatically, and a single construct can target as many as 32 targets. Due to this low cost and efficiency, the CRISPR/Cas9 system is now widely used in many plant species (Baltes and Voytas, 2015; Belhaj et al., 2015).
When a double-stranded DNA break induced by CRISPR/Cas9 is erroneously repaired by the NHEJ pathway, the repaired sequence most frequently results in small indels, among which one bp indels are the most common (Ma et al., 2015; Pan et al., 2016; Ren et al., 2016). One bp indel is too small for a polyacrylamide gel electrophoresis-based method to detect, therefore alternative methods capable of detecting one-bp indels are needed (Zhu et al., 2014).
Currently, the most commonly used method for small indel detection takes advantage of enzymes such as T7 endonuclease (T7E1) and CEL nuclease that cleave mismatches (Yeung et al., 2005; Vouillot et al., 2015). In these methods, the region including the target sequence is amplified by PCR, followed by the melting-annealing cycle to generate heteroduplexes and digestion by the mismatch detecting enzymes. While these methods are very effective in detecting large indels, they are not very effective in detecting a one-bp deletion. Even with T7E1 nuclease, which is better suited for the detection of small indels compared to the CEL nuclease, the efficiency decreases as the indel size decreases (Gohlke et al., 1994).
An alternative method, high-resolution melting (HRM), offers multiple advantages. HRM detects a small shift in the melting temperature (e.g., caused by heteroduplexing) using a dsDNA-binding dye. Firstly, it does not require additional pipetting steps after the PCR amplification step of the target region. Secondly, the method reliably detects single bp indels at a low (5%) concentration. In this protocol, we describe the procedure to analyze the HRM curves of PCR fragments containing CRISPR-generated small indels (Denbow et al., 2017). Four steps required for the detection of CRISPR-induced indels in Arabidopsis include: i) genomic DNA extraction, ii) optimizing the PCR condition, iii) PCR step for analyzing either T1 plants or putative homozygous plants carrying a single bp deletion, and iv) data analysis.
Materials and Reagents
Tissue disruption
2 ml microfuge tubes
Glass beads, 4 mm diameter (Walter Stern, catalog number: 100E )
Arabidopsis
Liquid nitrogen
DNA isolation
1.5 ml microfuge tubes
Chloroform/IAA mixture (24:1)
Isopropanol (CAS number 67-63-0)
Ethanol (200 proof) (CAS number 64-17-5)
70% ethanol
Tris-HCl (pH 7.5)
Tris base (CAS number 77-86-1)
EDTA free acid (CAS number 60-00-4)
NaCl (CAS number 7647-14-5)
CTAB (CAS number 57-09-0)
RNase A (Sigma-Aldrich, catalog number: R6513 )
Cesium Chloride (CsCl) (CAS number 7647-17-8)
2% CTAB solution (see Recipes)
TE buffer (see Recipes)
RNase A stock solution (see Recipes)
1 M CsCl solution (see Recipes)
PCR
Optical film (Bio-Rad Laboratories, catalog number: 2239444 )
96 well hard-shell black and white plate (Bio-Rad Laboratories, catalog number: hsp9665 )
LC Green Plus (BioFire Defense, catalog number: BCHM-ASY-0006 )
Phire Hot Start II DNA polymerase and buffer (Thermo Fisher Scientific, catalog number: F122 )
dNTP, 100 mM each (Thermo Fisher Scientific, catalog number: 10297018 )
Mineral oil (Fisher Scientific, catalog number: O121-1 )
Agarose (CAS number 9012-36-6)
PCR primers
Glacial acetic acid (CAS number 64-19-7)
TAE buffer (see Recipes)
Equipment
LightScanner system (BioFire Defense, USA)
PCR machine (Bio-Rad C1000) (Bio-Rad Laboratories, model: C1000 )
Tissue grinder (Mini-Beadbeater-96, Biospec, OK, USA) (Bio Spec Products, model: Mini-Beadbeater-96 )
Tabletop centrifuge (Eppendorf, model: 5427 R )
Vortex mixer (Fisher Scientific, catalog number: 02-215-365 )
Software
LightScanner software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Denbow, C., Ehivet, S. C. and Okumoto, S. (2018). High Resolution Melting Temperature Analysis to Identify CRISPR/Cas9 Mutants from Arabidopsis. Bio-protocol 8(14): e2944. DOI: 10.21769/BioProtoc.2944.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,945 | https://bio-protocol.org/exchange/protocoldetail?id=2945&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is a correction notice. See the corrected protocol.
Peer-reviewed
Correction Notice: Obtaining Acute Brain Slices
Thomas Papouin
PH Philip G. Haydon
Published: Jul 5, 2018
DOI: 10.21769/BioProtoc.2945 Views: 2788
Ask a question
How to cite
Favorite
Cited by
I was recently alerted that there are some typos and errors in the protocol "Obtaining acute brain slices (https://bio-protocol.org/e2699)" we published last year.
The recipe of: "1- Stock artificial cerebrospinal fluid (ACSF) solution (1 L, store at 4 °C)" has numerical errors and units typos. Please replace it with the following:
Recipes
Stock artificial cerebrospinal fluid (ACSF) solution (1 L, store at 4 °C)
Glucose 10 mM (1.8 g for 1 L)
Potassium chloride 3.2 mM (0.23 g for 1 L)
Sodium chloride 120 mM (7 g for 1 L)
Sodium phosphate monobasic anhydrous 1 mM (0.119 g for 1 L)
Sodium bicarbonate 26 mM (2.18 g for 1 L)
Make up to 1 L with ddH2O
Verify and adjust pH to 7.3 and osmolarity to 290-300 mOsm.L-1
References
Papouin, T. and Haydon, P. G. (2018). Obtaining Acute Brain Slices. Bio-protocol 8(2): e2699.
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Papouin, T. and Haydon, P. G. (2018). Correction Notice: Obtaining Acute Brain Slices. Bio-protocol 8(13): e2945. DOI: 10.21769/BioProtoc.2945.
Download Citation in RIS Format
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,946 | https://bio-protocol.org/exchange/protocoldetail?id=2946&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Electron Microscopic Assay Using Random Sampling from Single Sections to Test Plastic Synaptic Changes in Hippocampus
GM G. Mark Marcello*
LS Lilla E. Szabó*
PS Peter Sotonyi
Bence Rácz
*Contributed equally to this work
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2946 Views: 5428
Edited by: Geoffrey C. Y. Lau
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Studies over several decades on the organization of the CA1 hippocampus–a particularly favorable model for learning, memory and certain forms of cognition–have shown that the synaptic network in this brain region is plastic (Fortin et al., 2012). Recent evidence suggests that a number of environmental and endogenous stimuli may have a substantial effect on hippocampus-dependent cognitive function, implying enhanced synaptic plasticity in this brain region. Stimuli (e.g., food restriction, enriched environment, social interaction, gene-loss [knock-out animals], etc.) can trigger structural and functional plasticity (e.g., spine formation, increased expression of neurotrophic factors, synaptic function and neurogenesis) in the hippocampus (Stewart et al., 1989; Andrade et al., 2002; Babits et al., 2016). Using quantitative electron microscopy, we can study the synaptic neuropil of CA1 hippocampus in rodents during short- or long-term treatments and/or stimuli. Within the scope of this electron microscopic methodological construct, the density of various synaptic connections, the morphology and internal structure of excitatory spine synapses (e.g., the mean length and width of postsynaptic densities) can be quantified. Such quantitative ultrastructural measurement using high-resolution electron-microscopy may be applied to observe structural manifestations of synaptic plasticity in rodent brain tissue. The presented ultrastructural protocol may empower researchers to reveal details and synaptic changes which may not be obvious using only light microscopy. Ultrastructural data may provide substantial advances in our understanding of the changes in hippocampal synaptic architecture under different conditions.
Keywords: Brain Synapse Neuropil Quantitative electron microscopy Random sampling
Background
We performed electron microscopy using random sampling from single sections to optimize sample size (over ~100 images per sample) and to detect changes in synaptic features in control and treated animals. The errors introduced by this approach are relatively modest (e.g., we found a numerical density of perforated spines in control animals similar to that of earlier studies also using single-section analysis (Calverley and Jones, 1987 and 1990). Our aim is not to make stereologically-rigorous estimates of the absolute values; instead, we want to determine whether there are significant differences between normal and treated animals. Since we use the same sampling method for all experimental groups, we should be able to detect any substantial changes induced by an appropriate treatment protocol. However, such random sampling has a potential to underestimate differences; other methods should also be used to confirm the impact of a given treatment on the hippocampus.
Materials and Reagents
Pipette tips
Aluminum foil
Glass slides
ACLAR® Fluoropolymer Films (Electron Microscopy Sciences, catalog number: 50425-10 )
Glass engraving pen
Sterile Scalpel Blades #11 (Electron Microscopy Sciences, catalog number: 72044-11 )
Copper Grids (e.g., 300 mesh) (Sigma-Aldrich, catalog number: G4901 )
Grid Storage Box, 100 Capacity (Electron Microscopy Sciences, catalog number: 71140 )
Parafilm two-way stretch 100 mm x 38 m long (TAAB, catalog number: P069 )
Glass vials with PE stoppers (Fisher Scientific, catalog number: 03-339-26C)
Manufacturer: DWK Life Sciences, catalog number: KFS60965D2 .
Glass beakers
Whatman® qualitative filter paper, Grade 1 (Sigma-Aldrich, catalog number: WHA1001150 )
Cyanoacrylate superglue
Paraformaldehyde (4% in PB) (powder) (Sigma-Aldrich, catalog number: 158127 )
Glutaraldehyde (Electron Microscopy Sciences, catalog number: 16310 )
NaH2PO4·H2O (Sigma-Aldrich, catalog number: S9638 )
Na2HPO4·7H2O (Sigma-Aldrich, catalog number: S2429 )
HCl (Sigma-Aldrich, catalog number: 30721 )
NaOH (Sigma-Aldrich, catalog number: S2770 )
Osmium tetroxide solution (2% in H2O) (Sigma-Aldrich, catalog number: 75633 )
Notes:
This stock solution can be diluted with 0.2 M PB to reach the final 1% working concentration used for contrasting.
Extremely toxic, handle only under an approved fume hood, wear proper protective clothing, handle with care; do not dispose of in sinks; follow local regulation for toxic waste disposal.
Ethanol, absolute (diluted with distilled water as requested by Procedure) (Merck, catalog number: 1009831011 )
Uranyl acetate (Electron Microscopy Sciences, catalog number: 22400 )
Propylene oxide (Sigma-Aldrich, catalog number: 82320 )
Note: Extremely toxic, handle only under an approved fume hood, wear proper protective clothing, handle with care; do not dispose of in sinks; follow local regulations for toxic waste disposal.
DurcupanTM Resin set (Sigma-Aldrich, catalog number: 44610 )
Lead citrate solution (Leica Ultrostain II, TAAB, Leica Microsystems, catalog number: T534/2 )
Notes:
The 3% lead citrate solution is pre-packed in vacuum tight bags under helium atmosphere.
Toxic, handle with care and collect after use; follow local regulation for toxic waste disposal.
0.1 M Phosphate buffer (PB, pH 7.4) (see Recipes)
4% of formaldehyde solution with 0.2% of glutaraldehyde (see Recipes)
DurcupanTM ACM resin (See Recipes)
Equipment
Stereo (dissecting) microscope (Leica Microsystems, model: Leica S6D )
Vibratome (e.g., Leica Biosystems, model: Leica VT 1000S )
LSETM Incubator digital shaker (Corning, catalog number: 6781-4 )
Refrigerator
Fume hood
Thermostat
Ultramicrotome (Leica Microsystems, Reichert, model: Reichert Ultracut S )
Diamond knife (Diatome ultra 45°, at least 1.5 mm wide)
Perfect loop for section pick-up (Electron Microscopy Sciences, catalog number: 70944 )
Transmission electron microscope, operating at 80 kV (e.g., JEOL, model: JEM-1011 )
Circular-top Analog Hotplate Stirrer (DLAB MS-H-S, DLAB Instruments Ltd.)
Forceps suitable for grid-handling
Freezer
Software
NIH ImageJ (https://imagej.nih.gov/ij/)
Kaleidagraph (Synergy Software http://www.synergy.com/wordpress_650164087/kaleidagraph/)
AnalySIS from Soft Imaging System (Münster, Germany)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Marcello, G. M., Szabó, L. E., Sotonyi, P. T. and Rácz, B. (2018). Quantitative Electron Microscopic Assay Using Random Sampling from Single Sections to Test Plastic Synaptic Changes in Hippocampus. Bio-protocol 8(15): e2946. DOI: 10.21769/BioProtoc.2946.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Cortex
Neuroscience > Cellular mechanisms > Synaptic physiology
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,947 | https://bio-protocol.org/exchange/protocoldetail?id=2947&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Long-term in vitro Culture of Cryptosporidium parvum
NY Nigel Yarlett
MM Mary Morada
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2947 Views: 7514
Edited by: Adler R. Dillman
Reviewed by: Michael ArrowoodSmita Nair
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Continuous in vitro growth of Cryptosporidium parvum has proved difficult and conventional in vitro culture techniques result in short-term (2-5 days) growth of the parasite resulting in thin-walled oocysts that fail to propagate using in vitro cultures, and do not produce an active infection using immunosuppressed or immunodeficient mouse models (Arrowood, 2002). Here we describe the use of hollow fiber bioreactors (HFB) that simulate in vivo conditions by providing oxygen and nutrients to host intestinal cells from the basal surface and permit the establishment of a low redox, high nutrient environment on the apical surface. When inoculated with 105 C. parvum (Iowa isolate) oocysts the bioreactor produced 108 oocysts per ml (20 ml extra-capillary volume) after 14 days, and was maintained for over 2 years. In vivo infectivity studies using a TCR-α-immune deficient mouse model showed that oocysts produced from the bioreactor at 6, 12 and 18 months were indistinguishable from the parent Iowa isolate used to initiate the culture. HFB produced oocysts had similar percent excystation profiles to the parent Iowa isolate.
Keywords: Parasitology Cell culture Protozoans Cryptosporidia Cryptosporidium parvum Hollow fiber bioreactor
Background
Cryptosporidium parvum is an intracellular obligate parasite of the intestinal tract of man and other mammals resulting in an acute diarrhea. The disease is self-limiting in immunocompetent individuals, however, in immunocompromised adults and young children, the disease can be life-threatening (Kotloff, 2017). It is amongst the top three diagnosed enteric diseases of children in economically low resource countries (Kotloff et al., 2013; Sow et al., 2016), and is estimated to account for 9% of child deaths globally (Bhutta and Black, 2013; Checkley et al., 2015). In countries with a high burden of pediatric diarrheal disease, it has been shown that there is a correspondingly high incidence of malnutrition, stunting, and impaired cognitive functions (Lang and MA-LED Network Investigators, 2015). Despite the significant health risks and global distribution of this disease, there is no consistently effective therapy for the most-at-risk population. Recent advances in manipulating the parasite genome (Vinayak et al., 2015) and chemotherapeutic profiling (Arnold et al., 2017; Love et al., 2017; Manjunatha et al., 2017) are an encouraging sign that this bleak situation will change. Culture of the parasite has concentrated on developing a 3D culture system using adult murine colon cells (Baydoun et al., 2017) or novel bioengineered human intestinal cells (DeCicco RePass et al., 2017) which has produced novel insights into parasite invasion and significantly extended the length of culture time compared to the 2D culture method. However, these techniques are limited in terms of parasite numbers obtained. The 3D models overcome the major obstacle associated with conventional 2D culture methods where host cells receive nutrients and oxygen from the apical surface (except for those systems that use porous membrane inserts like the Costar Transwell system); this is contrary to the in vivo situation where the enterocytes receive nutrients and oxygen from the basal surface and the apical surface faces the lumen of the gut. However, current intestinal implant models fail to provide the low oxygen environment present inside the gut lumen which restricts the long-term growth of the parasite. The use of hollow fiber technology allows the creation of the biphasic environment present in the gut and overcomes many problems associated with the long-term culture of C. parvum (Morada et al., 2016). This protocol describes the establishment of hollow fiber bioreactors that can be used to simulate in vivo conditions by providing oxygen and nutrients to the basal surface of host intestinal cells that are attached to the outside of the hollow fibers (Figure 1). The environment inside the reactor is adjusted to mimic the lumen of the gut hence the apical surface of the intestinal cells are established in a low redox, high nutrient environment, that favors high growth rates and long-term maintenance of C. parvum. The use of this method provides 108-109 oocysts which can be used for molecular and biochemical studies and has the advantage of avoiding the use of harsh chemicals such as K-dichromate, which is used as a long-term storage medium at (4 °C) and has the advantage of sanitizing the oocysts; and chlorine currently used as both a sanitizer and to enhance excystation of oocysts obtained from animal sources (Arrowood, 2008).
Figure 1. Hollow Fiber Bioreactor. A. Schematic representation of the HFB; B. HFB setup.
Materials and Reagents
BrandTechTM BRANDTM reagent reservoirs (BrandTech Scientific, catalog number: 703459 )
Aluminum foil 18 in x 500 ft (Sigma-Aldrich, catalog number: Z185159-1EA )
BD syringe with various tips, 60 ml (BD, catalog number: 309653 )
BD Diagnostic Systems SYR only Luer-LokTM 10 ml 200PK RX (Thermo Fisher Scientific, catalog number: B302995)
Manufacturer: BD, catalog number: 302995 .
BD Disposable syringes with Luer-LokTM Tips, 3 ml (BD, catalog number: 309657 )
FisherbrandTM sterile alcohol prep pads (Fisher Scientific, catalog number: 22-363-750 )
BD VacutainerTM general use syringe needles (BD, catalog number: 305180 )
FisherbrandTM borosilicate glass disposable serological pipets with regular tip, standard length, 5 ml (Fisher Scientific, catalog number: 13-678-27E )
FisherbrandTM borosilicate glass disposable serological pipets with regular tip, standard length, 10 ml (Fisher Scientific, catalog number: 13-678-27F )
FisherbrandTM borosilicate glass disposable serological pipets with regular tip, short length, 25 ml (Fisher Scientific, catalog number: 13-678-36D )
EMD MilliporeTM MillexTM-GP sterile syringe filters with PES membrane (Fisher Scientific, catalog number: SLGP033RS)
Manufacturer: Merck, catalog number: SLGP033RS .
CorningTM polyethylene terephthalate (PET) centrifuge tubes, 15 ml (Corning, catalog number: 430055 )
CELLSTARTM Greiner Bio-OneTM TC treated cell culture flasks, 250 ml (Greiner Bio One International, catalog number: 658175 )
FisherbrandTM premium microcentrifuge tubes, 1.5 ml (Fisher Scientific, catalog number: 05-408-129 )
FisherbrandTM low-retention pipet tips–filtered, 10 μl (Fisher Scientific, catalog number: 02-717-158 )
FisherbrandTM low-retention pipet tips–filtered, 20 μl (Fisher Scientific, catalog number: 02-717-161 )
FisherbrandTM low-retention pipet tips–filtered, 200 μl (Fisher Scientific, catalog number: 02-717-165 )
QuibitTM assay tubes (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32856 )
MicroAmpTM optical 96-well reaction plate with barcode (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4306737 )
MicroAmpTM optical adhesive film (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4311971 )
Filters, bottle top 1 L (Thermo Fisher Scientific, catalog number: 597-4520 )
DynabeadsTM MPCTM-S magnetic particle concentrator (Thermo Fisher Scientific, catalog number: A13346 )
DynabeadsTM MPCTM-6 magnetic particle concentrator (Thermo Fisher Scientific, catalog number: 12002D )
DynabeadsTM L10 tubes (Thermo Fisher Scientific, catalog number: 74003 )
VWR® 8-425 screw thread vials (VWR, Avantor, catalog number: 66020-950 )
Cap screw top black, with PTFE/silicone pre-slit septa, 10 mm, packed in a clean environment (PerkinElmer, catalog number: N9306052 )
C. parvum 18S-rRNA primers: Cp18S-995F: 5’-TAGAGATTGGAGGTTCCT-3’ and Cp18S-1206R: 5’-CTCCACCAACTAAGAACGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA)
Human 18S-rRNA primers: Hs18S-F1373: 5’-CCGATAACGAACGAGACACTCTGG-3’ and Hs18S-R1561: 5’-TAGGGTAGGCACACGCTGAGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA)
Quant-iTTM Qubit RNA BR assay kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q10211 )
RNeasy mini kit, 250 (QIAGEN, catalog number: 74106 )
RNase-free DNase set, 50 (QIAGEN, catalog number: 79254 )
iScriptTM RT-qPCR sample preparation reagent (Bio-Rad Laboratories, catalog number: 1708898 )
Luna® Universal one step RT-qPCR kit protocol (New England BioLabs, catalog number: E3005 )
Sterile phosphate buffered saline (Thermo Fisher Scientific, GibcoTM, catalog number: 10010049 )
Minimum Essential Medium (MEM) with L-glutamine and phenol red, without HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 11095-114 )
Horse Serum, New Zealand origin (Thermo Fisher Scientific, GibcoTM, catalog number: 16050122 )
UltraPureTM DNase/RNase-free distilled water (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977015 )
Ethanol, 70% (Sigma-Aldrich, catalog number: 1009744000)
Manufacturer: Merck, catalog number: 100974 .
Roche DiagnosticsTM glucose test strips for Accutrend® Plus meters (Fisher Scientific, catalog number: 22-045-871)
Manufacturer: Roche Diagnostics, catalog number: 11447475160
Crypt-a-GloTM reagent only kit (Waterborne, catalog number: A400FLR-20 )
Sporo-GloTM (Waterborne, catalog number: A600FLR-20X )
Trypsin-EDTA (0.25%), phenol red (Thermo Fisher-Scientific, GibcoTM, catalog number: 25200056 )
L-glutamine (Sigma-Aldrich, catalog number: G3126 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
D-glucose (Sigma-Aldrich, catalog number: G8270 )
Ascorbic acid (Sigma-Aldrich, catalog number: A0278 )
P-Aminobenzoic acid (Sigma-Aldrich, catalog number: A9878 )
Calcium pantothenate (Sigma-Aldrich, catalog number: C8731 )
Folic acid (Sigma-Aldrich, catalog number: F7876 )
Heparin (Sigma-Aldrich, catalog number: H3393 )
Antibiotic/antimycotic 100x (Thermo Fisher Scientific, catalog number: 15240062 )
Taurodeoxycholate (Sigma-Aldrich, catalog number: T0557 )
Thioglycolic acid (MP Biomedicals, catalog number: 102933 )
Mannitol (Sigma-Aldrich, catalog number: M4125 )
Glutathione (Sigma-Aldrich, catalog number: G6013 )
Taurine (Sigma-Aldrich, catalog number: T8691 )
Betaine hydrochloride (Sigma-Aldrich, catalog number: B3501 )
Cysteine (Sigma-Aldrich, catalog number: C7352 )
Oleic acid (Sigma-Aldrich, catalog number: O1257-10MG )
Cholesterol (Sigma-Aldrich, catalog number: C4951-30MG )
DynabeadsTM anti-Cryptosporidium (Thermo Fisher Scientific, catalog number: 73011 )
Nitrogen Medical Grade 99.998% purity (TW Smith, Brooklyn, NY)
Carbon dioxide, Bone Dry, 99.998% (TW Smith, Brooklyn, NY)
ECS medium mix (see Recipes)
ICS medium mix (see Recipes)
Equipment
1 L Bottles, 33 mm cap (Fisher Scientific, catalog number: 0642114)
Manufacturer: DWK Life Sciences, catalog number: 61111T1000 .
125 ml Bottles, 33 mm cap (DWK Life Sciences, catalog number: 219755 )
Roche DiagnosticsTM glucose controls for Accutrend® Plus meters (Fisher Scientific, catalog number: 22-045-733)
Manufacturer: Roche Diagnostics, catalog number: 05213231160 .
HausserTM LevyTM hemacytometer chamber set (Hausser Scientific, catalog number: 3520 )
FiberCellTM Systems Duet Pump (FiberCell Systems, catalog number: P3202 )
Hollow Fiber Medium Cartridge (FiberCell Systems, catalog number: C2011 )
UVP UV2 Sterilizing PCR Workstation (VWR, Avantor, Bridgeport, NJ 08014, USA)
Class II, Type A, Biohazard Cabinet, model number 10276 (Envirco Cedar Grove, NJ 07009, USA)
Beckman Coulter Microfuge® 16 centrifuge (Beckman Coulter, model: Microfuge® 16 )
EppendorfTM centrifuge 5810R (Eppendorf, model: 5810 R )
Quant Studio 6 Flex 44 (Applied Biosystems, Life Technology, Thermo Fisher Scientific, Waltham, MA, USA)
Thermo Scientific Revco Ultima CO2 incubator (Thermo Fisher Scientific, Waltham, MA, USA)
DynabeadsTM MX mixer base (Thermo Fisher Scientific, catalog number: 15902 )
QubitTM 3.0 fluorometer (Thermo Fisher Scientific, catalog number: Q33216 )
NikonTM Optiphot fluorescence microscope (Nikon, Westbury, NY)
Fisher Scientific Accumet® AR10 pH benchtop meter (Fisher Scientific, catalog number: 13-636-AB150 )
Fisher Scientific dry bath incubator (Fisher Scientific, catalog number: 11-718-2 )
Autoclave (LBR Scientific, Rutherford, NJ)
Software
Quant Studio RT-PCR software v1.0 (Applied Biosystems, Life Technology, Thermo Fisher Scientific, Waltham, MA, USA)
Sigma Plot v2001 (Systat Software, Inc, San Jose, CA, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yarlett, N. and Morada, M. (2018). Long-term in vitro Culture of Cryptosporidium parvum. Bio-protocol 8(15): e2947. DOI: 10.21769/BioProtoc.2947.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Cell Biology > Cell isolation and culture > 3D cell culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,948 | https://bio-protocol.org/exchange/protocoldetail?id=2948&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Apoptosis-like Cell Death in Ustilago maydis by Annexin V-FITC Staining
Dibya Mukherjee
Aroni Mitra
Anupama Ghosh
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2948 Views: 6337
Original Research Article:
The authors used this protocol in Dec 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2017
Abstract
Programmed cell death (PCD) guides the transition between key developmental stages in many organisms. PCD also remains an important fate for many organisms upon exposure to different stress conditions. Therefore, an insight into the progression of PCD during the execution of a biological phenomenon can yield significant details of the underlying mechanism. Apoptosis, as well as apoptosis-like programmed cell death, constitutes one of the forms of PCD in higher and lower eukaryotes respectively. Flipping of phosphatidylserine (PS) from the inner leaflet of the plasma membrane to the outer leaflet is among the different hallmarks of apoptosis/apoptosis-like PCD that marks the initiation of the said cell death event. This flipping can be detected through staining of the target cells using annexin V-FITC that binds specifically to PS. In Ustilago maydis the staining of the externally exposed PS by annexin V-FITC is difficult due to the presence of cell wall. The key to such staining, therefore, relies on the gentle removal of the cell wall without significantly altering the underlying plasma membrane architecture/topology. This protocol highlights the dependence of the PS staining on the extent of protoplastation of the stressed cells in Ustilago maydis.
Keywords: Apoptosis Ustilago maydis Phosphatidylserine externalization Annexin V-FITC staining Protoplast Plasma membrane
Background
PS externalization constitutes one of the hallmarks of apoptosis-like PCD that can be detected very early (Martin et al., 1995). Hence the appearance of PS on the outer leaflet of the plasma membrane marks the onset of an apoptotic cell death phenomenon. Ustilago maydis is a biotrophic plant pathogen and infects host plant Zea mays. The lifecycle of U. maydis has been demonstrated to comprise of primarily two morphological forms namely the non-pathogenic haploid sporidial form and the pathogenic diploid filamentous form. The transition from the haploid to the diploid takes place through the mating of the compatible haploid strains on plant surfaces (Kahmann and Kamper, 2004). This leads to the generation of an infectious structure called appressoria that further penetrates the host plant as the filamentous form of the pathogen. Within the plant cells, the filamentous form of U. maydis again undergoes several transitions between morphologically distinct phases leading to sporulation. PCD has been demonstrated to play a significant role in the morphological transformations of different cell types primarily in higher eukaryotes (Buss et al., 2006; Suzanne and Steller, 2013). Also in some phytopathogenic fungi, PCD has been evidenced to be absolutely essential for the generation of appressoria (Veneault-Fourrey et al., 2006). Besides aiding in the switching between distinct morphological forms, PCD is also an end result of a harsh environmental stress response (Phillips et al., 2003). During penetration of the host plant the pathogens are exposed to a number of host defense response derived stress conditions. Among them, exposure to an increasingly oxidative environment is the most common. The primary reason behind this is the increased production of reactive oxygen species by the host in response to pathogen invasion (Torres et al., 2006). Assaying PCD in the fungal pathogen under each of these conditions mentioned can give significant insights into the pathogenic development as well as stress response of U. maydis. This protocol described the steps in detail to stain U. maydis sporidia under axenic culture conditions with annexinV-FITC to detect onset of any apoptosis-like cell death event upon exposure to adverse environmental conditions. However, it doesn’t include the staining of filamentous hyphae of U. maydis during its growth in-planta. Therefore this protocol is only applicable to the U. maydis sporidial cell suspension.
Materials and Reagents
Plastic Petri-dishes (Tarsons, catalog number: 460020-90MM )
50 ml centrifuge tubes (Tarsons, catalog number: 546041 )
15 ml centrifuge tubes (Tarsons, catalog number: 546021 )
250 ml conical flasks (Fisher Scientific, FisherbrandTM, catalog number: 15429103 )
Culture tubes (BOROSIL, catalog number: 9800U08 , 25 x 150 mm, 55 ml) with plastic caps (Tarsons, catalog number: 020070 )
10 ml disposable syringe (Dispo Van, Hindustan Syringes and Medical Devices Limited)
0.22 μm syringe filter (Sartorius, catalog number: 16532-K )
Microscope slides (Polar Industrial, Blue Star, catalog number: PIC-1 , 75 x 25 mm)
Cover slips (Blue Star, 22 mm square, 0.13-0.16 mm thick)
Pipette tips (Tarsons, 0.2-10 μl, catalog number: 521000 ; 2-200 μl, catalog number: 521010 ; 200-1,000 μl, catalog number: 521020 )
Inoculation loop
Kimwipes (Tarsons, catalog number: 370080 , 11.17 x 21.3 cm)
Sterile scalpel blades
Organisms: Ustilago maydis solopathogenic strain SG200 (Kamper et al.,2006)
Yeast extract powder (HiMedia Laboratories, catalog number: RM027 )
Peptone, bacteriological (HiMedia Laboratories, catalog number: RM001 )
Sucrose, A.R. (HiMedia Laboratories, catalog number: RM3063 )
Potato Dextrose Broth (HiMedia Laboratories, catalog number: M403 )
D-Sorbitol (Sigma-Aldrich, catalog number: S1876 )
Tri-sodium citrate dihydrate (Merck, catalog number: 1.93619.0521 )
Citric acid monohydrate (Merck, catalog number: 1.93011.0521 )
Calcium chloride dihydrate (SRL Sisco Research Laboratories, catalog number: 0344317 )
Tris (hydroxymethyl) aminomethane (Merck, Calbiochem, catalog number: 9210-OP )
Hydrochloric acid about 37% (Merck, catalog number: 1.93001.0521 )
Hydrogen peroxide 30% (Merck, catalog number: 1.93007.0521 )
Lysing Enzymes from Trichoderma harzianum (Sigma-Aldrich, catalog number: L1412 )
Annexin V-FITC apoptosis detection kit (Sigma-Aldrich, catalog number: APOAF )
YEPSL media (see Recipes)
Potato Dextrose Agar (PD agar) media (see Recipes)
SCS buffer (see Recipes)
Lysing enzymes in SCS (see Recipes)
STC buffer (see Recipes)
10x binding buffer (see Recipes)
Equipment
Pipette (0.5-10 μl, 2-20 μl, 20-200 μl, 100-1,000 μl)
Weighing balance (Shimadzu, model: BL220H )
Shaking incubator
Double beam spectrophotometer (Hitachi High-Technologies, model: U-2910 )
Light Microscope (ZEISS, model: Axioskop 40 )
Confocal microscope (Leica Microsystems, model: Leica TCS-SP7 )
Cold centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: Sorvall RC 6 Plus , catalog number: 36-101-0816)
Laminar air flow
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mukherjee, D., Mitra, A. and Ghosh, A. (2018). Detection of Apoptosis-like Cell Death in Ustilago maydis by Annexin V-FITC Staining. Bio-protocol 8(15): e2948. DOI: 10.21769/BioProtoc.2948.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell staining
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,949 | https://bio-protocol.org/exchange/protocoldetail?id=2949&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
HCV Reporter System (Viral Infection-Activated Split-Intein-Mediated Reporter System) for Testing Virus Cell-to-cell Transmission ex-vivo
FZ Fanfan Zhao
TZ Ting Zhao
LD Libin Deng
DL Dawei Lv
XZ Xiaolong Zhang
XP Xiaoyu Pan
JX Jun Xu
GL Gang Long
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2949 Views: 5123
Edited by: David Paul
Reviewed by: Jose Antonio Reyes-Darias
Original Research Article:
The authors used this protocol in Jan 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2017
Abstract
Hepatitis C virus (HCV) spread involves two distinct entry pathways: cell-free transmission and cell-to-cell transmission. Cell-to-cell transmission is not only an efficient way for viruses to spread but also an effective method for escaping neutralizing antibodies. We adapted the viral infection-activated split-intein-mediated reporter system (VISI) and developed a straightforward model for Live-cell monitoring of HCV cell-to-cell transmission ex-vivo: co-culture of HCV infected donor cells (red signal) with uninfected recipient cells (green signal) and elimination of the cell-free transmission by adding potent neutralizing antibody AR3A in the supernatant. With this model, the efficiency of cell-to-cell transmission can be evaluated by counting the number of foci designated by the green signal of recipient cells.
Keywords: HCV Reporter system Fluorescence signal Virus spread Cell-to-cell transmission
Background
Accumulating evidence support that viruses can use different routes of spread in infected tissues (Sattentau, 2008; Zhong et al., 2013). For HCV transmission, both cell-free transmission and cell-to-cell transmission can mediate virus transfer between hepatocytes. While cell-free transmission initiates HCV infection, cell-cell transmission is thought to transfer HCV to adjacent hepatocytes directly. It provides an excellent way to resist the neutralizing antibodies and contribute to the viral persistence (Brimacombe et al., 2011; Xiao et al., 2014). Previous articles also proved some host factors which contributed to cell-cell transmission, such as scavenger receptor BI (SR-BI), CD81, tight junction proteins claudin-1 (CLDN1), Occludin (OCLN), epidermal growth factor receptor (EGFR) (Witteveldt et al., 2009; Catanese et al., 2013; Zona et al., 2013). But the exact mechanisms of this process still need to explore. We optimized a viral infection-activated split-intein-mediated reporter system (VISI) for live-cell visualization of HCV infection (Zhao et al., 2017). Based on the study in Huh7.5.1 cell line using a technique of split GFP/RFP reconstitution by intein protein splicing (Figure 1A), it showed that VISI system is a very sensitive and low background system. With this system, we can clearly visualize the HCV infected cell by its nuclear fluorescence signal. In addition, combining VISI-GFP and VISI-mCherry cells, we can further monitor HCV cell-to-cell transmission in the presence of potent neutralizing antibody AR3A.
Materials and Reagents
For cell culture materials
Sterile 100 mm polystyrene Petri dish (Thermo Fisher Scientific, catalog number: 172931 )
Sterile flat-bottom 96-well plate (Thermo Fisher Scientific, catalog number: 167008 )
Sterile 60 mm polystyrene Petri dish (Thermo Fisher Scientific, catalog number: 150288 )
Sterile 6-well plate (Thermo Fisher Scientific, catalog number: 140675 )
Sterile 50 ml Conical Centrifuge Tube (Thermo Fisher Scientific, catalog number: 339652 )
Plasmids and Cell lines
Lentiviral vector:
pWPI-blasticidin-NLS-GFPn-INTEINn (Genbank: KY067203)
pWPI-puromycin-INTEINc-GFPc-NLS-IPS (Genbank: KY067204) (for construction of Huh7.5.1-VISI-GFP cell line)
pWPI-blasticidin-NLS-mCherry(n)-INTEINn (Genbank: KY067205)
pWPI-puromycin-INTEINc-mCherry(c)-NLS-IPS (Genbank: KY067206) (for construction of Huh7.5.1-VISI-mCherry cell line)
Two auxiliary plasmids:
psPAX2 (the HIV-1 packaging plasmid)
pMD2.G (a vesicular stomatitis virus glycoprotein [SV-G] expression vector)
Note: Lentiviral vector and two auxiliary plasmids were kindly provided by professor R. Bartenschlager.
293T cell (ATCC, catalog number: CRL-3216 )
Huh7.5.1 cell (Human hepatocyte-derived cell line Huh7.5.1 is kindly provided by professor F. Chisari)
HCV virus strains
HCV JC1 (GenBank: JF343782.1)
Subgenomic JFH1 (sgJFH1) (GenBank: AB114136.1)
Note: They were kindly provided by professor T. Wakita, professor C. M. Rice, professor J. Bukh, and professor R. Bartenschlager.
For cell culture medium
1x phosphate-buffered saline (PBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010049 )
0.25% Trypsin (Thermo Fisher Scientific, GibcoTM, catalog number: 25200072 )
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: C11965500CP )
Fetal bovine serum (Thermo Fisher Scientific, GibcoTM, catalog number: 10099141 )
100x Nonessential amino acids (Thermo Fisher Scientific, GibcoTM, catalog number: 11140050 )
100x Penicillin/streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Complete DMEM (see Recipes)
For transcription in vitro
MEGAscript® T7 Transcription Kit (Thermo Fisher Scientific, catalog number: AM1333 )
For electroporation buffer
ATP (Thermo Fisher Scientific, catalog number: R0441 )
L-Glutathione (Sigma-Aldrich, catalog number: V900456-25G )
Potassium chloride (KCl) (Sinopharm Chemical Reagent, catalog number: 10016318 )
Calcium chloride (CaCl2) (Shanghai Experiment Reagent, catalog number: 117600 )
Dipotassium hydrogen phosphate (K2HPO4) (Shanghai Experiment Reagent, catalog number: 168120 )
Potassium phosphate monobasic (KH2PO4) (Shanghai Experiment Reagent, catalog number: 175650 )
HEPES (Sigma-Aldrich, catalog number: H4034-25G )
EGTA (Sangon Biotech, catalog number: E0732-50G )
Magnesium chloride (MgCl2) (Sinopharm Chemical Reagent, catalog number: 10012818 )
Cytomix buffer (see Recipes)
For Calcium Phosphate (CaPO4) transfection buffer
HEPES (Sigma-Aldrich, catalog number: H4034-25G )
Sodium chloride (NaCl) (Sinopharm Chemical Reagent, catalog number: 10019318 )
Disodium hydrogen phosphate (Na2HPO4·12H2O) (Shanghai Experiment Reagent, catalog number: 174710 )
Calcium chloride (CaCl2) (Shanghai Experiment Reagent, catalog number: 117600 )
Calcium Phosphate (CaPO4) transfection buffer (see Recipes)
HCV-neutralizing antibody
Antibody AR3A
Note: AR3A is kindly provided by professor M. Law.
For cell line selecting
Puromycin (Sigma-Aldrich, catalog number: P8833-25MG )
Blasticidin (Thermo Fisher Scientific, GibcoTM, catalog number: R21001 )
Equipment
Electroporator (Bio-Rad Laboratories, model: Gene Pulser XcellTM )
Electroporation cuvette (Bio-Rad Laboratories, Gene Pulser cuvette, 0.4 cm)
Fluorescence microscope (Olympus, model: IX53 )
Software
GraphPad Prism (GraphPad Software, https://www.graphpad.com/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhao, F., Zhao, T., Deng, L., Lv, D., Zhang, X., Pan, X., Xu, J. and Long, G. (2018). HCV Reporter System (Viral Infection-Activated Split-Intein-Mediated Reporter System) for Testing Virus Cell-to-cell Transmission ex-vivo. Bio-protocol 8(15): e2949. DOI: 10.21769/BioProtoc.2949.
Download Citation in RIS Format
Category
Microbiology > in vivo model > Viruses
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
295 | https://bio-protocol.org/exchange/protocoldetail?id=295&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse ESC Differentiation to Nkx2.1+ Lung and Thyroid Progenitors
TL Tyler A. Longmire
LI Laertis Ikonomou
Darrell N. Kotton
Published: Vol 2, Iss 22, Nov 20, 2012
DOI: 10.21769/BioProtoc.295 Views: 11185
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
The de novo derivation of lung progenitors from pluripotent stem cells provides the opportunity to model early lung development in vitro and allows easy access to cells for tissue engineering or basic cell biology studies. This detailed protocol allows the generation of lung and thyroid progenitors from mouse embryonic stem cell (ESC) or induced pluripotent stem cell (iPSC) lines. When used together with a published Nkx2.1-GFP knock-in ESC line, the protocol allows tracking and purification of lung and thyroid progenitors by sorting on the GFP reporter based on the induction of the earliest known marker of lung and thyroid cell fate, Nkx2.1. After sorting, a pure population of Nkx2.1+ cells can then be replated for further expansion, differentiation, and maturation in culture in serum-free conditions.
Keywords: Embryonic Stem Cells Directed Differentiation Lung Progenitors Thyroid Progenitors Nkx2-1
Materials and Reagents
Mouse ESCs or iPSCs carrying a GFP reporter knocked in to the Nkx2.1 locus (Nkx2.1-GFP ESCs) (Longmire et al., 2012)
1x 0.05% Trypsin-EDTA (Life Technologies, Gibco®, catalog number: 25300-054 )
Defined Fetal Bovine Serum (Hyclone, catalog number: SH30070.03 )
IMDM powder (Life Technologies, Invitrogen™, catalog number: 12200-036 )
NaHCO3 (Sigma-Aldrich, catalog number: S-5761 )
Pen/Strep (Life Technologies, Invitrogen™, catalog number: 15140-148 ) (10,000 U Penicillin and 10 mg Streptomycin per ml)
Cellgro water (VWR, catalog number: 45000-672 )
Ham’s F-12 (Cellgro, catalog number: 10-080-CV )
B-27 supplement with RA (Life Technologies, Invitrogen™, catalog number: 17504-044 )
N-2 supplement (Life Technologies, Invitrogen™, catalog number: 17502-048 )
BSA Fraction V 7.5% in PBS (Life Technologies, Invitrogen™, catalog number: 15260-037 )
1-thioglycerol (MTG) (Sigma, M6145-25ml )
200 mM L-Glutamine (Life Technologies, Invitrogen™, catalog number: 25030-081 )
Ascorbic Acid (Sigma-Aldrich, catalog number: A4544-25G )
1M HEPES (Gibco, 15630-080 )
CaCl2 (Sigma-Aldrich, catalog number: C4901 )
BSA (Sigma-Aldrich, catalog number: A9418-10G )
100x ITS supplement (BD Biosciences, catalog number: 354352 )
mNoggin (R&D Systems, catalog number: 1967-NG-025 )
SB431542 (Sigma-Aldrich, catalog number: S4317 )
mWnt3a (R&D Systems, catalog number: 1324-WN-010 )
hBMP4 (R&D Systems, catalog number: 314-BP-050 )
hEGF (R&D Systems, catalog number: 236-EG-01M )
mFGF2 (R&D Systems, catalog number: catalog number: 3139-FB-025 )
mFGF7 (R&D Systems, catalog number: 5028-KG-025 )
hFGF10 (R&D Systems, catalog number: 345-FG-025 )
Heparin sodium salt (Sigma-Aldrich, catalog number: H4784-250mg )
Dexamethasone (Sigma-Aldrich, catalog number: D4902 )
8‐Br‐cAMP (Sigma-Aldrich, catalog number: B7880 )
IBMX (Sigma-Aldrich, catalog number: I5879 )
DMSO, Hybri-Max (Sigma-Aldrich, catalog number: D2650 )
Ethanol (Sigma-Aldrich, catalog number: E7023 )
Activin A (R&D Systems, catalog number: 338-AC )
PBS (Life Technologies, Gibco®, catalog number: 14190-250 )
0.1% Gelatin in ultrapure water (EMD Millipore, catalog number: ES-006-B )
Cxcr4 Antibody: APC Rat anti-mouse CD184 (Cxcr4) (BD-Pharmigen, catalog number: 558644 )
cKit Antibody: PE Rat anti-mouse CD117 (cKit) (BD-Pharmigen, catalog number: 553355 )
APC Isotype: APC Rat IgG2b, κ (BD-Pharmigen, catalog number: 553991 )
PE Isotype: PE Rat IgG2b, κ (BD-Pharmigen, catalog number: 553989 )
IMDM (see Recipes)
Serum free differentiation medium (SFD) (see Recipes)
Complete serum free differentiation medium (cSFDM) (see Recipes)
BASE medium for DCI+K (see Recipes)
Anteriorization medium (see Recipes)
Ventralization medium (see Recipes)
DCI+K medium (see Recipes)
Preparation of 10x cAMP+IBMX stock (see Recipes)
Equipment
P100 Petri dish (100 mm x 15 mm Bacteriological Petri Dish, nontreated polystyrene, BD Falcon™, catalog number: 351029 )
P150 Petri dish (150 mm x 15 mm Bacteriological Petri Dish, nontreated polystyrene, BD Falcon™, catalog number: 351058 )
12 x 75 mm, 5 ml polystyrene round bottom test tube with a cell strainer cap (BD, 352235 )
1.5-ml Eppendorf Snap-Cap microcentrifuge tubes (Thermo Fisher Scientific, catalog number: 05-402-25 )
Centrifuges
LSRII flow cytometer
0.22μm filter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Embryonic stem cell > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,950 | https://bio-protocol.org/exchange/protocoldetail?id=2950&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Arabidopsis-Green Peach Aphid Interaction: Rearing the Insect, No-choice and Fecundity Assays, and Electrical Penetration Graph Technique to Study Insect Feeding Behavior
Vamsi Nalam
JL Joe Louis
MP Monika Patel
Jyoti Shah
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2950 Views: 9050
Edited by: Renate Weizbauer
Reviewed by: Zhao Zhang
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
Aphids constitute a large group of Hemipterans that use their slender stylets to tap into the sieve elements of plants from which they consume copious amounts of phloem sap, thus depriving the plant of photoassimilates. Some aphids also transmit viral diseases of plants. Myzus persicae Sülzer, commonly known as the green peach aphid (GPA), which is a polyphagous insect with a host range that covers 50 plant families, is considered amongst the top 3 insect pest of plants. The interaction between Arabidopsis thaliana and the GPA is utilized as a model pathosystem to study plant-aphid interaction. Here we describe the protocol used in our laboratories for rearing the GPA, and no-choice and fecundity bioassays to study GPA performance on Arabidopsis. In addition, we describe the procedure for the electrical penetration graph (EPG) technique to monitor feeding behavior of the GPA on Arabidopsis.
Keywords: Myzus persicae EPG Aphid feeding behavior Plant-aphid interaction Sieve element phase
Background
Aphids are important pests of plants that utilize their mouthparts, which are modified into stylets, to remove phloem sap from the sieve elements. As part of their feeding process, aphids deposit saliva into the plant tissue. While some salivary components elicit plant defenses, others manipulate host physiology to benefit the insect, including suppressing plant defenses (Nalam et al., 2018). Plants utilize a variety of defenses to control aphid infestation. These include antibiosis, which adversely impacts aphid growth, development and fecundity, and antixenosis, which affects insect behavior, including feeding behavior. These defenses are exerted at various steps, including at the cell surface, during the intercellular penetration of leaf tissue by the insect stylet, when the stylet tip is inside plant cells, and when the stylet tip is in the sieve elements (Nalam et al., 2018). The green peach aphid (GPA), Myzus persicae Sülzer, is an important pest of plants in numerous families, including the Brassicaceae, Solanaceae, Cucurbitaceae, Rosaceae, Asteraceae, Malvaceae, Amaranthaceae (Blackman and Eastop, 2000). In addition, the GPA transmits several viral diseases (Kennedy et al., 1963; Matthews, 1991). During the last decade, the interaction between Arabidopsis thaliana, which belongs to the Brassicaceae family, and the GPA has been increasingly utilized to study plant-aphid interaction (Louis et al., 2012; Louis and Shah, 2013). This pathosystem has facilitated understanding of the physiological and molecular processes that determine the outcome of plant-aphid interaction, including plant defense mechanisms and their impact on insect population growth, fecundity and behavior (Louis et al. 2012; Louis and Shah, 2013).
The direct current (DC)-electrical penetration graph (EPG) system, which measures the electromotive force (EMF) signal and fluctuations in electrical resistance resulting from aphid stylet penetrations, provides a sensitive method to monitor aphid feeding behavior on plants (Tjallingii, 1985; Salvador-Recatalà and Tjallingii, 2015). When the aphid stylet is inserted intercellularly, the voltage is positive and when inserted intracellularly, the voltage is negative (Tjallingii, 2006). The different EPG waveform patterns are indicative of the different activities in which the insect is engaged. Moreover, the duration of each type of waveform provides a quantitative measure of the effect of plant genotype and/or treatment on insect feeding behavior, including the time spent by the insect feeding from the sieve elements. However, despite the success of the Arabidopsis-GPA pathosystem, the protocols utilized to study aphid population growth, fecundity and feeding behavior have not been described in detail. Here, we detail the protocols for rearing a Brassicaceae-adapted colony of the GPA, no-choice assays for monitoring GPA population growth, fecundity assays to monitor insect reproductive rate, and the EPG analysis to monitor GPA feeding behavior on Arabidopsis.
Part I: Rearing the green peach aphid
The green peach aphid (Myzus persicae) colony is maintained on a mix of radish (Raphanus sativus ‘Early Scarlet Globe’) and mustard (Brassica juncea ‘Florida Broadleaf’) plants, which like Arabidopsis belong to the Brassicaceae family. On Brassicaceae, GPA reproduces asexually by releasing live apterous (wingless) nymphs.
Materials and Reagents
T.O. Plastics Standard Flats 1020 tray with bottom holes (Hummert International, model: STE-1020-OPEN - WITH HOLES, catalog number: 11-3000-1 )
T.O. Plastics Standard Flats 1020 tray without holes (Hummert International, model: STE-1020-NH - NO HOLES, catalog number: 11-3050-1 )
Square injection molded plastic pots (4.5” [11.43 cm] width x 3.75” [9.53 cm] height) with holes at the bottom (International Greenhouse, catalog number: CN-SQK )
Twist ties
Biohazard autoclave bags (Fisher Scientific, catalog number: 01-830D )
NalgeneTM polypropylene heavy duty sterilizing tray (Thermo Fisher Scientific, catalog number: 6900-0020 )
Soil Mix (Sunshine® Mix #8, Sun Gro Horticulture, model: Fafard®-2 )
Radish seeds (Radish Early Scarlet Globe) (Main Street Seed & Supply, catalog number: 13307-13 )
Mustard seeds (Florida Mustard Broad Leaf) (Main Street Seed & Supply, catalog number: 12501-13 )
Green peach aphid colony (Specimen number 194 deposited with Kansas State University Museum of Entomological and Prairie Arthropod Research)
Equipment
Plant growth chamber (Percival Scientific, model: AR-66L2 )
Note: Programmed for a 14/10 h day (80-100 μE m-2 sec-1)/night photoperiod at 22 °C.
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nalam, V., Louis, J., Patel, M. and Shah, J. (2018). Arabidopsis-Green Peach Aphid Interaction: Rearing the Insect, No-choice and Fecundity Assays, and Electrical Penetration Graph Technique to Study Insect Feeding Behavior. Bio-protocol 8(15): e2950. DOI: 10.21769/BioProtoc.2950.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Plant-insect interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,951 | https://bio-protocol.org/exchange/protocoldetail?id=2951&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Hypoxia Reporter Element Assay
Daelynn R Buelow
Sharyn D. D Baker
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2951 Views: 5772
Edited by: Jia Li
Reviewed by: Liku B TezeraPhilipp Wörsdörfer
Original Research Article:
The authors used this protocol in Dec 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2017
Abstract
Hypoxia is a condition in which there is a decrease in oxygen supply to the cellular environment. Changes to cellular oxygen levels can lead to transcriptional changes of oxygen-regulated genes. Reporter assays are used to study gene expression alteration and modifications in response to environmental changes. Dual-reporter assays allow the simultaneous measurement of two different genes within a single cell, thus improving experimental accuracy. Within this protocol, we describe the utilization of the LightSwitch Dual Assay System to measure BMX expression in response to hypoxic conditions.
Keywords: Luciferase Reporter assay Hypoxia Regulation Transcription
Background
In our recent publication (van Oosterwijk et al., 2018), we sought to examine the regulation of BMX, a nonreceptor tyrosine kinase, in response to sorafenib treatment. BMX, a Tec kinase family member, is known bind to tyrosine-phosphorylated proteins and mediate membrane targeting by binding to phosphatidylinositol 3,4,5-triphosphate (PIP3; Chen et al., 2013). We showed that direct treatment of sorafenib in acute myeloid leukemia (AML) cells lines with or without stromal cell support did not contribute to the upregulation of BMX. Previous studies have shown that BMX expression can be induced by ischemia and that sorafenib has antiangiogenic activity (He et al., 2006; Davis et al., 2011). Therefore, we hypothesized that the antiangiogenic activity of sorafenib causes a hypoxic environment within the bone marrow, thus contributing to a hypoxia-dependent BMX upregulation in AML. Under hypoxic conditions, we were able to show a significant increase in BMX expression in a number of different cell lines. Further analysis of the BMX promoter identified a putative hypoxia-responsive element (HRE; 5’-ACGTG-3’) at -5005. To test whether this HRE was involved in the hypoxia-induced promoter activation of BMX, we developed a hypoxia element reporter assay.
Reporter assays are extensively used throughout the scientific community to study alterations and modifications to gene expression in response to environmental changes. One type of reporter assay that is gaining in acceptance are the dual-reporter assays. This type of reporter assay allows the simultaneous expression and measurement of two different reporters within a single cell and had been widely proven to improve experimental accuracy by reducing extraneous influences. One such dual assay system is the LightSwitch Dual Assay System. This system utilizes the RenSP luciferase reporter gene, a novel luciferase developed by SwitchGear Genomics and the Cypridina luciferase reporter gene. RenSP and Cypridina employ different substrates, thus eliminating cross-reaction between proteins and their substrates. RenSP is used with your favorite gene as the reporter signal, and Cypridina is utilized with a constitutively active promoter as the control signal.
Here, we used the LightSwitch Dual Assay System to evaluate the involvement of the BMX HRE to its upregulation in response to hypoxic conditions.
Materials and Reagents
Pipette tips
White 96 well plates (CELLSTAR® Tissue Culture Plates, Greiner Bio One International, catalog number: 655083 )
HEK293 (293[HEK-293]; ATCC, catalog number: CRL-1573 )
pLightswitch_Prom_BMX (BMX promoter construct; SwitchGear Genomics, catalog number: S701154 )
pLightswitch_Prom control vector (SwitchGear Genomics, catalog number: S790005 )
pTK-Cluc (Cypridina TK control construct; SwitchGear Genomics, catalog number: SN0322S )
FuGENE® HD (Promega, catalog number: E2311 )
DMEM, high glucose, pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11995065 )
QuikChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, catalog number: 200516 )
Terrific Broth Powder (BD, DifcoTM, catalog number: 243820 )
Glycerol (Sigma-Aldrich, catalog number: G9012 )
Poly-D-Lysine (Sigma-Aldrich, catalog number: P6407-5MG )
Opti-MEM (Thermo Fisher Scientific, GibcoTM, catalog number: 31985070 )
Fetal Bovine Serum (Thermo Fisher Scientific, GibcoTM, catalog number: 10437028 )
LightSwitch Dual Assay System (SwitchGear Genomics, catalog number: DA010 )
Poly-D-Lysine hydrobromide (MP Biomedicals, catalog number: 02150175 )
Terrific Broth (see Recipes)
5x Poly-D-lysine Solution (see Recipes)
1x Poly-D-lysine Solution (sterile) (see Recipes)
Growth media (see Recipes)
Equipment
Pipettes
Thermocycler (Eppendorf, model: Mastercycler® pro S , catalog number: 950030020)
Table-top centrifuge (Eppendorf, model: 5810 R , catalog number: 022625101)
Swinging bucket rotor (Eppendorf, model: S-4-104 , catalog number: 5820755008)
High-performance centrifuge (Thermo Fisher Scientific, model: SorvallTM RC 6 Plus , catalog number: 36-101-0816)
Laminar flow hood (Thermo Fisher Scientific, model: 1300 Series Class II , Type A2, catalog number: 1323TS)
37 °C, 5% CO2 water-jacketed incubator (Thermo Fisher Scientific, model: Heracell VIOS 160i , catalog number: 51030285)
37 °C non-humidified incubator (Labnet International, model: 311DS , catalog number: I5311-DS)
Hypoxia chamber (Coy Lab, model: O2 Control InVitro Glove Box with no upgrades)
Standardfeatures include:
Humidified incubation box
Temperature control
Control of O2 and CO2 in 0.1% increments
Plate luminometer (Molecular Devices, model: SpectraMax i3x , with no upgrades)
Standard features include:
Read modes: Absorbance, Fluorescence, Luminescence
Wavelength ranges include: Abs: 230-1,000 nm, Fl Ex: 250-830 nm, Fl EM 270-850 nm, Lumi: 300-850 nm
Software
GraphPad Prism (GraphPad Software, Version 6)
QuikChange Primer Design (https://www.genomics.agilent.com/primerDesignProgram.jsp)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Buelow, D. R. and Baker, S. D. D. (2018). Hypoxia Reporter Element Assay. Bio-protocol 8(15): e2951. DOI: 10.21769/BioProtoc.2951.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Molecular biology technique
Molecular Biology > DNA > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,952 | https://bio-protocol.org/exchange/protocoldetail?id=2952&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for the Isolation and Super-resolution dSTORM Imaging of RyR2 in Cardiac Myocytes
YH Yufeng Hou
CL Christopher Le
CS Christian Soeller
WL William E. Louch
Published: Aug 5, 2018
DOI: 10.21769/BioProtoc.2952 Views: 5366
Edited by: Joe Zhang
Reviewed by: Anca Savulescu
Download PDF
Ask a question
Favorite
Cited by
Abstract
Since its inception, super-resolution microscopy has played an increasingly important role in the discovery and characterization of nanoscale biological structure. dSTORM, which is one of the most commonly applied methods, relies on stochastic photoswitching of fluorophores to recreate a super-resolution image. The cardiac field has particularly benefitted from the application of this technique, as it has enabled sub-diffraction-limit visualization of calcium release units (CRUs) and the fundamental structures that trigger contraction. Acquisition of such images requires careful, reproducible sample preparation, and consistent imaging conditions maintained for the duration of the experiment. Here we present standardized methods for the production of dSTORM images of the Ca2+ release channel Ryanodine Receptor type-2 (RyR2) in cardiac myocytes. The presented protocols specifically focus on steps involved in primary cardiac myocyte isolation, sample preparation, and imaging with details provided for experimental solutions and microscope settings. This discussion is followed by an overview of various analysis techniques to discern RyR2 organization within clusters and CRUs.
Keywords: Super-resolution dSTORM Langendorff Cell Isolation Image processing
Background
In recent years, super-resolution microscopy has seen a rapid rise in popularity. A variety of super-resolution techniques have been described which enable optical resolution well below the diffraction limit of light, in some cases approaching that obtainable by electron microscopy. Together, the advent of these techniques has led to an explosion of new research into nanoscale biological structure, domains, and protein interactions. One popular super-resolution technique is direct Stochastic Optical Microscopy (dSTORM), which pairs the benefits of relatively simple sample handling with an ~10x improvement in resolution in comparison with standard confocal microscopy (van de Linde et al., 2011). The trade-off, however, is an increased acquisition time as well as complexity of analysis which can seem daunting to those starting in the field. While recent commercial systems from the major imaging companies such as Zeiss, Nikon, and Olympus have made dSTORM more accessible to biologists, the technique still requires careful planning of experiments and accurate, reproducible protocols to ensure the production of high-quality images.
The Ryanodine Receptor type 2 (RyR2) protein is a homo-tetrameric Ca2+ release channel localized within the sarcoplasmic reticulum of cardiac myocytes, which is an important target for super-resolution structural studies (Jayasinghe et al., 2012; Soeller and Baddeley, 2013; Asghari et al., 2014; Hiess et al., 2015; Hou et al., 2015; Munro et al., 2016). Indeed, the RyR is well-suited to such studies, owing to its large size and its tendency to agglomerate into functionally important ‘clusters’. Most of these clusters have sizes that are just below the resolution of conventional microscopes. Because of these desirable features, the RyR can also serve as a useful example protein for introducing methods in sample preparation and imaging in a more general context. Here we present standardized methods to produce high-quality dSTORM images using the Carl Zeiss Elyra P1 dSTORM setup, with the RyR2 as a model target. The outlined protocols include methods for primary cardiac myocyte isolation, sample preparation, and imaging. Further discussion is provided regarding the analysis of RyR2 organization, including techniques for discernment of RyR clusters and, in turn, Ca2+ Release Units (CRUs) which are functional groupings of RyR clusters thought to underlie Ca2+ sparks (Inui et al., 1987).
Materials and Reagents
Consumables
18 gauge disposable needle (BD, catalog number: 301900 )
Weigh boat
Falcon tubes 50 ml, 15 ml (Corning, catalog numbers: 430829 , 430791 )
Pasture pipette (VWR, catalog number: VWRI612-1684 )
1.5 Coverslips on dish (MATTEK, catalog number: P35G-0.170-14-C )
Coverslip preparation: Coverslips for the experiment also require prior preparation. To obtain very clean coverslips, we wash coverslips first with EtOH and allow them to dry. Apply 200 μl of prepared Poly-L-Lysine (0.01%) solution to the coverslip and incubate overnight at 4 °C or 2 h at 37 °C. The Poly-L Lysine coating allows cell adhesion when plated.
Animals
Mice (Breed: C57BL/6J)
Reagents
EtOH (VWR, catalog number: 20824.296 )
NaCl (Sigma-Aldrich, catalog number: 71376 )
KCl (Sigma-Aldrich, catalog number: P9541 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
MgCl2·6H2O (Sigma-Aldrich, catalog number: M2393 )
NaH2PO4 (Sigma-Aldrich, catalog number: S5011 )
D-Glucose (Sigma-Aldrich, catalog number: 49159 )
Isoflurane (Abbott, catalog number: B506 )
Bovine serum albumin (BSA) (Stock dilution: 2 g/100 ml)
DNase, Batch Number: 57B17285 (Worthington Biochemical, catalog number: LS002006 )
Phosphate buffered saline (PBS) (Lonza, BioWhittakerTM, catalog number: BE17-512F )
Collagenase 2, Activity 265 units, Batch number: 45A15450 (Worthington Biochemical, catalog number: LS004176 )
Bovine Serum Albumin (powder) (Sigma-Aldrich, catalog number: A2153 )
CaCl2 (Sigma-Aldrich, catalog number: 449709 )
PFA (Electron Microscopy Sciences, catalog number: 19208 )
Glycine (Sigma-Aldrich, catalog number: G7126 )
Note: Prepare Glycine 100 mM in PBS.
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Note: Prepare 0.03% Triton X-100 (v/v) in PBS.
Image iT FX signal Enhancer (Thermo Fisher Scientific, catalog number: I36933 )
Poly-L-lysine solution 0.01% w/v (Sigma-Aldrich, catalog number: P4707 )
Low Blocking Buffer (Thermo Fisher Scientific, catalog number: 00-4953-54 )
NaOH (Sigma-Aldrich, catalog number: S5881 )
Immersion oil 30 degrees (Carl Zeiss, catalog number: Immersol-518F , 30 °C)
Cell isolation buffer (CIV) (see Recipes for composition)
Collagenase solution (see Recipes for composition)
4% Paraformaldehyde (PFA) solution (see Recipes for composition)
Antibodies
Mouse Anti-RyR1 Primary antibody (Thermo Fisher Scientific, catalog number: MA3-916 )
Donkey Anti-mouse Alexa 647 Secondary (Abcam, catalog number: ab181292 )
Mounting media
Vecta Shield (Vector Laboratories, catalog number: H-1000 )
Glycerol solution 86-89% (Sigma-Aldrich, catalog number: 49781 )
Equipment
Mechanical apparatus
Peristaltic perfusion pump (Watson-Marlow Fluid Technology Group, model: 101U )
Standard gauge infusion tubes x3 with added three-way valve
Water bath (37 °C) with pump to water jacket
Microdissection kit
Scissors
Fine tip forceps
Curved scissors
Curved tip forceps
Heating plate
Measuring cylinder 500 ml
Schott Bottle 500 ml
Pipettes–10 μl, 200 μl, 1,000 μl (Thermo Fisher Scientific, Finnpipette)
Scales (Sartorius, models: BL310 and CP224S )
pH meter (Radiometer Copenhagen, model: pHM 92 )
Imaging
Carl Zeiss LSM 710 inverted confocal microscope (Carl Zeiss, model: LSM 710 )
Carl Zeiss ELYRA P1 dSTORM attachment for LSM 710 (Carl Zeiss, model: ELYRA P.1 ) Supplied with:
PLAN Apocromat 63x NA 1.41 Oil Immersion objective
PLAN Apocromat 100x NA 1.46 Oil Immersion objective
ANDOR Ixon EMCCD
Halogen lamp
TIRF filter set (SIM, TIRF, TIRF-HP, TIRF-uHP)
200 mW 642 nm Laser and associated filters
Software
Zen Black software (Carl Zeiss)
ImageJ Software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell isolation and culture > Cell isolation
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,953 | https://bio-protocol.org/exchange/protocoldetail?id=2953&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Structural Analysis of Bordetella pertussis Biofilms by Confocal Laser Scanning Microscopy
NC Natalia Cattelan
OY Osvaldo Miguel Yantorno
RD Rajendar Deora
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2953 Views: 5753
Edited by: Emily Cope
Reviewed by: Juan Facundo Rodriguez AyalaSofiane El-Kirat-Chatel
Original Research Article:
The authors used this protocol in Dec 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2017
Abstract
Biofilms are sessile communities of microbial cells embedded in a self-produced or host-derived exopolymeric matrix. Biofilms can both be beneficial or detrimental depending on the surface. Compared to their planktonic counterparts, biofilm cells display enhanced resistance to killing by environmental threats, chemicals, antimicrobials and host immune defenses. When in biofilms, the microbial cells interact with each other and with the surface to develop architecturally complex multi-dimensional structures. Numerous imaging techniques and tools are currently available for architectural analyses of biofilm communities. This allows examination of biofilm development through acquisition of three-dimensional images that can render structural features of the sessile community. A frequently utilized tool is Confocal Laser Scanning Microscopy. We present a detailed protocol to grow, observe and analyze biofilms of the respiratory human pathogen, Bordetella pertussis in space and time.
Keywords: Biofilm Confocal microscopy Bordetella pertussis Whooping cough Biofilm-structure
Background
Bordetella pertussis is an obligate human pathogen of the upper respiratory tract that causes whooping cough or pertussis (Mooi, 2010; Dorji et al., 2018). Biofilms of B. pertussis form on a variety of artificial surfaces and under static, shaking, and fluid flow conditions (Mishra et al., 2005; Sloan et al., 2007; Serra et al., 2011). Microscopic evaluation of these biofilms shows that this bacterium produces irregularly shaped microcolonies separated by fluid channels, embedded in an exopolymeric matrix composed by extracellular DNA (eDNA), proteins and polysaccharides (Parise et al., 2007; Sloan et al., 2007; Serra et al., 2008; Conover et al., 2011; Nicholson et al., 2012; Ganguly et al., 2014; Cattelan et al., 2017). In addition to forming biofilms in the laboratory setting, B. pertussis forms multi-dimensional organ-adherent biofilms on the nose and trachea during experimental infections of mice. Development of these mammalian biofilms is characterized by an extracellular polymeric matrix composed of eDNA, the Filamentous hemagglutinin protein and the Bps polysaccharide (Conover et al., 2010 and 2011; Serra et al., 2011; Dorji et al., 2018). Based on these results, biofilm formation has been proposed by us and others as a possible strategy adopted by B. pertussis to infect, persist and continually circulate in the community (Cattelan et al., 2016). Consistent with this hypothesis, we found that currently circulating strains from Argentina and USA produce significantly higher levels of biofilms when compared to a laboratory reference strain and colonize the mouse nose and trachea at higher numbers than the prototype laboratory strain (Cattelan et al., 2017). These results also provide evidence that hyperbiofilm growth is a strategy employed by circulating organisms to infect and survive inside their host.
In order to study the mechanisms involved in biofilm development, microscopic evaluation is a key technique that allows differentiation of the steps of the process, from adhesion to maturation and dispersion. In particular, confocal laser scanning microscopy (CLSM) is frequently used because it allows visualization of architectural complexities of intact and hydrated biofilms. In this protocol, we describe how to grow and process samples of B. pertussis biofilms, as demonstrated in our recent publication (Cattelan et al., 2017).
Materials and Reagents
0.2 μm filter
Bacteriological Petri plates (Fisher Scientific, catalog number: FB0875712 )
Sterile test tubes (17 x 100 mm, RPI, Research Products International, catalog number: 168599 )
Serological pipettes:
5 ml pipette (SARSTEDT, catalog number: 86.1253.001 )
25 ml pipette (SARSTEDT, catalog number: 86.1685.001 )
NalgeneTM 2 ml cryogenic tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number 5000-0020 )
Coverglasses, 22 x 22 mm (Fisher Scientific, FisherbrandTM, catalog number: 12-542B )
NuncTM 6-wells plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 150239 )
Aluminum foil
Microscope slides (Fisher Scientific, FisherbrandTM, catalog number: 12-552-3 )
Sterile disposable plastic material:
Posi-Click tubes (Denville Scientific, catalog number: C2170 )
P200 and P1000 tips (USA Scientific, catalog numbers: 1111-0706 and 1112-1720 )
B. pertussis strain harboring a pGB5P1-GFP plasmid
Defibrinated sheep’s blood (Hemostat Laboratories, catalog number: DSB100 )
50% glycerol solution (Fisher Scientific, catalog number: G33-1 )
Kanamycin (Sigma-Aldrich, catalog number: K1377 )
Neutralized buffered formalin (Fisher Scientific, catalog number: SF100-4 )
Stainer-Scholte medium (Stainer et al., 1970; Nicholson et al., 2012)
Sterile PBS (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 )
ProLongTM Gold Antifade Mountant (Thermo Fisher Scientific, InvitrogenTM, catalog number: P36934 )
DifcoTM Bordet-Gengou agar plates (BD, BD Biosciences, catalog number: 248200 )
L-Proline (Sigma-Aldrich, catalog number: 131547 )
KH2PO4 (Sigma-Aldrich, catalog number: V000225 )
KCl (Sigma-Aldrich, catalog number: P3911 )
MgCl2·6H2O (Sigma-Aldrich, catalog number: M2393 )
CaCl2 (Sigma-Aldrich, catalog number: C1016 )
Tris base (Sigma-Aldrich, catalog number: T1378 )
NaCl (Sigma-Aldrich, catalog number: S7653 )
FeSO4·7H2O (Sigma-Aldrich, catalog number: F8633 )
L-cystine (Sigma-Aldrich, catalog number: C8755 )
L-ascorbic acid (Sigma-Aldrich, catalog number: A5960 )
Nicotinic acid (Sigma-Aldrich, catalog number: PHR1276 )
Reduced L-glutathione (Sigma-Aldrich, catalog number: G4251 )
SS medium (see Recipes)
SS supplement (filter-sterilized) (see Recipes)
Bordet-Gengou (BG) medium (see Recipes)
Equipment
Kimax® Erlenmeyer flasks (125 ml) (DWK Life Sciences, KIMBLE®, catalog number: 26500 )
Sterile forceps
PIPETMAN® Classic (Gilson, models: P20, P200, P1000, catalog numbers: F123600 , F123601 , F123602 )
Humid chamber (an appropriately sized Tupperware container with either a weigh boat containing water or paper towels soaked with water)
Chemical fume hood (Hamilton Laboratory Solutions, model: PL-822 )
Eclipse Ti-E inverted Confocal Microscope (Nikon, model: D-Eclipse C1si )
Vortex (Fisher Scientific, catalog number: 02-215-365 )
pH meter (Denver Instrument, model: UB-10 )
Incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Steri-CycleTM )
Benchtop centrifuge (Eppendorf, model: 5418 )
Refrigerator (4 °C) (Whirlpool, model: WRR56X18FW02 )
-20 °C freezer (Kenmore, model: 253-26722103 )
SPECTRONIC TM Spectrophotometer (Thermo Fisher Scientific, model: GENESYS 20 )
Weigh Balance (Ohaus, model: Scout Pro SP202 and VWR, model: VWR-164AC )
Roller Drum (Eppendorf, New BrunswickTM, model: TC-2 )
Software
ImageJ (Schneider et al., 2012)
COMSTAT2 plugin (Heydorn et al., 2000)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cattelan, N., Yantorno, O. M. and Deora, R. (2018). Structural Analysis of Bordetella pertussis Biofilms by Confocal Laser Scanning Microscopy. Bio-protocol 8(15): e2953. DOI: 10.21769/BioProtoc.2953.
Download Citation in RIS Format
Category
Microbiology > Microbial biofilm > Biofilm culture
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,954 | https://bio-protocol.org/exchange/protocoldetail?id=2954&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Secretion of Capsidiol in Leaf Tissues of Nicotiana benthamiana
TK Teruhiko Kuroyanagi
MC Maurizio Camagna
Daigo Takemoto
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2954 Views: 4892
Edited by: Arsalan Daudi
Reviewed by: Michael EnosKangquan Yin
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Plant species produce a wide variety of antimicrobial metabolites to protect themselves against potential pathogens in natural environments. Phytoalexins are low molecular weight compounds produced by plants in response to attempted attacks of pathogens. Accumulation of phytoalexins in attacked plant tissues can inhibit the growth of penetrating pathogens. Thus phytoalexins play a major role in post-invasion defense against pathogens. Major phytoalexins produced by Solanaceous plants are sesquiterpenoids such as capsidiol produced by Nicotiana and Capsicum species, and rishitin produced by Solanum species, which are synthesized in the cytosol and secreted into the intercellular space of plant tissues. We previously reported that deficiency in capsidiol secretion causes enhanced susceptibility of Nicotiana benthamiana to potato late blight pathogen, Phytophthora infestans. Here, we describe a practical protocol to measure the secreted capsidiol in N. benthamiana.
Keywords: Capsidiol Nicotiana benthamiana Phytoalexins Secretion Transporter
Background
This protocol provides a quick and simple method to quantify the secretion of capsidiol as performed in Shibata et al. (2016). Because cyclohexane is commonly used as the solvent to wash off pollen coat layers but keeps pollen viable (Doughty et al., 1993), we developed this method to wash off secreted metabolites from the leaf surface to quantify extracellular capsidiol. The function of plasma-membrane localized transporters can be analyzed using this method, while also allowing it to be used in conjunction with other methods, such as biochemical transport analysis using plasma membrane vesicles (e.g., Sugiyama et al., 2007), in order to determine the substrate of the examined transporter.
Materials and Reagents
Pipette tips (e.g., PIPETMAN Diamond Tips, Gilson)
Needleless syringe (e.g., TerumoTM Tuberculin Syringes 1 ml, Terumo Medical, catalog number: SS-01T )
50 ml tubes (e.g., 50 ml Falcon centrifuge tube)
200 ml round-bottom flask
2 ml tubes (e.g., microcentrifuge tube, 2 ml with lid, BRAND, catalog number: 780550 )
Leaves of 4-5 weeks old wild-type or gene-silenced Nicotiana benthamiana
Notes:
For Virus-induced gene silencing (VIGS) of N. benthamiana, see Zhang and Liu, (2014).
Similar method can be applied for other plant species (e.g., see Khare et al., 2017).
INF1 elicitor produced by P. infestans or in E. coli
Notes:
For the method of INF1 preparation, see Takemoto et al. (2005) or Shibata et al. (2010).
Other elicitors may be used as well.
Capsidiol
Note: Capsidiol is not commercially available. For the method of capsidiol purification, see Matsukawa et al. (2013).
99.5% Cyclohexane (Wako Pure Chemical Industries, catalog number: 034-05006 )
99.5% Cyclohexane/Ethyl acetate (1:1, v/v) (Ethyl acetate, Wako Pure Chemical Industries, catalog number: 051-00351 )
99.5% acetonitrile (Wako Pure Chemical Industries, catalog number: 019-08631 )
Liquid nitrogen
Methanol (Wako Pure Chemical Industries, catalog number: 131-01826 )
Equipment
Pipettes (e.g., PIPETMAN P, Gilson)
Electronic scale (e.g., Mettler-Toledo International, model: AG245 Analytical balance)
Freezer
Rotary evaporator with water bath (e.g., Yamato Scientific, model: RE-301-BW )
Centrifugal concentrator (e.g., TOMY DIGITAL BIOLOGY, model: CC-105 with Vacuum Pump)
Microtube mixer (e.g., TAITEC, model: E-36 )
Sonicator Bath (e.g., SND, model: US-101 )
Mortar and pestle
Microcentrifuge (e.g., KUBOTA, model: 3740 )
High-performance liquid chromatography (HPLC) system (e.g., Prominence Modular HPLC system, Shimadzu, Japan)
ODS column (e.g., Nomura Chemical, model: Develosil ODS-UG-3 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kuroyanagi, T., Camagna, M. and Takemoto, D. (2018). Measuring Secretion of Capsidiol in Leaf Tissues of Nicotiana benthamiana. Bio-protocol 8(15): e2954. DOI: 10.21769/BioProtoc.2954.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Host-microbe interactions
Cell Biology > Cell isolation and culture > Cell isolation
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,955 | https://bio-protocol.org/exchange/protocoldetail?id=2955&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Tethered Chromosome Conformation Capture Sequencing in Triticeae: A Valuable Tool for Genome Assembly
Axel Himmelbach
IW Ines Walde
MM Martin Mascher
NS Nils Stein
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2955 Views: 8166
Edited by: Rainer Melzer
Reviewed by: Pooja VermaVinay Panwar
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Chromosome conformation capture sequencing (Hi-C) is a powerful method to comprehensively interrogate the three-dimensional positioning of chromatin in the nucleus. The development of Hi-C can be traced back to successive increases in the resolution and throughput of chromosome conformation capture (3C) (Dekker et al., 2002). The basic workflow of 3C consists of (i) fixation of intact chromatin, usually by formaldehyde, (ii) cutting the fixed chromatin with a restriction enzyme, (iii) religation of sticky ends under diluted conditions to favor ligations between cross-linked fragments or those between random fragments and (iv) quantifying the number of ligations events between pairs of genomic loci (de Wit and de Laat, 2012). In the original 3C protocol, ligation frequency was measured by amplification of selected ligation junctions corresponding to a small number of genomic loci (‘one versus one’) through semi-quantitative PCR (Dekker et al., 2002). The chromosome conformation capture-on-chip (4C) and chromosome conformation capture carbon copy (5C) technologies then extended 3C to count ligation events in a ‘one versus many’ or ‘many versus many’ manner, respectively. Hi-C (Lieberman-Aiden et al., 2009) finally combined 3C with next-generation sequencing (Metzker, 2010). Here, before religation sticky ends are filled in with biotin-labeled nucleotide analogs to enrich for fragments with a ligation junction in a later step. The Hi-C libraries are then subjected to high-throughput sequencing and the resultant reads mapped to a reference genome, allowing the determination of contact probabilities in a ‘many versus many’ way with a resolution that is limited only by the distribution of restriction sites and the read depth. The first application of Hi-C was the elucidation of global chromatin folding principles in the human genome (Lieberman-Aiden et al., 2009). Similar efforts have since been carried out in other eukaryotic model species such as yeast (Duan et al., 2010), Drosophila (Sexton et al., 2012) and Arabidopsis (Grob et al., 2014; Wang et al., 2015; Liu et al., 2016). Other uses of Hi-C include the study of chromatin looping at high-resolution (Rao et al., 2014; Liu et al., 2016), of chromatin reorganization along the cell cycle (Naumova et al., 2013) and of differences in chromatin organization in mutant individuals (Feng et al., 2014). The tethered conformation capture protocol (TCC) (Kalhor et al., 2011) described here is a variant of the original Hi-C method (Lieberman-Aiden et al., 2009) and was adapted to Triticeae.
Keywords: Tethered conformation capture Hi-C Physical mapping Chromatin interaction Triticeae Sequencing Genome assembly Scaffolding
Background
Any successful Hi-C experiment should reveal the distance-dependent decay of contact probabilities: the frequency by which two loci juxtapose in three-dimensional space is predominantly determined by their distance in the linear genome (Lieberman-Aiden et al., 2009). This observation motivated the application of Hi-C for physical mapping: the number of Hi-C links between pairs of contigs of a whole-genome shotgun assembly can serve as a proxy of the linear distance between them. This distance information can then be fed into graph algorithms to reconstruct the linear order of scaffolds along the chromosomes (Burton et al., 2013; Kaplan and Dekker, 2013). The three-dimensional proximity information obtained from our TCC approach was employed to order and orient BAC-based super scaffolds in the high-quality barley reference genome (Beier et al., 2017; Mascher et al., 2017). For the Emmer genome assembly, the TCC information was used in a similar manner to validate the scaffolds leading to chromosome-scale assemblies (pseudomolecules) (Avni et al., 2017).
TCC is a modified Hi-C approach in which key reactions (marking of the DNA ends and circularization) are performed on a solid phase rather than in solution (Kalhor et al., 2011). In fact, in human cells the tethering approach yielded improved signal-to-noise ratios, thus leading to a better mapping of low-frequency interactions (Kalhor et al., 2011). This observation prompted us to develop a similar protocol for Triticeae, which is based on the isolation of crosslinked nuclei from young leaves (Hövel et al., 2012) followed by TCC (Kalhor et al., 2011) (Figure 1). Briefly, the chromosome conformation is captured in native leaves by chemical crosslinking using formaldehyde (Hövel et al., 2012), which covalently connects proteins to DNA, as well as proteins to each other. Nuclei are purified, and cysteine residues of proteins contained in the chromatin are biotinylated (Kalhor et al., 2011). The DNA is digested with a restriction enzyme (HindIII) followed by immobilization at low density on streptavidin-coated beads via the crosslinked biotinylated proteins (Kalhor et al., 2011). DNA ends are filled-in, marked with biotin and circularized while tethered to the beads (Kalhor et al., 2011). The crosslinks are reversed, ligation junctions are affinity-purified and provided with adapters for Illumina sequencing to discover genuine pairs of intrachromosomal interaction sites, which were initially captured (Kalhor et al., 2011).
Chromosome conformation capture sequence data is analyzed in the context of genome sequence assemblies. If a chromosome-scale reference genome is available, Hi-C (or TCC) reads can be aligned to it and assigned to restriction fragment predicted in silico from the genome sequence. Subsequently, the number of Hi-C reads linking pairs of restriction pairs can be quantified and the counts be aggregated in larger genome windows (e.g., 1 Mb bins) to obtain estimates of the contact probabilities between pairs of genomic loci (Lieberman-Aiden et al., 2009). These contact probabilities can be used to investigate chromatin organization and its interaction with various biological parameters such as stage of the cell cycle (Naumova et al., 2013) or the epigenomic landscape (Zhou et al., 2013). Chromosome conformation capture sequencing can also be used to reconstruct contiguous, chromosome-scale genomic reference sequences from fragmented sequence assembly. The Hi-C/TCC reads are mapped to a sequence assembly composed of unordered scaffolds, and links between scaffolds are counted and used as a measure of genomic distance. The closer two sequence scaffolds are to each other in the linear genome, the higher the number of Hi-C read pairs linking them. This distance information can then be used to derive a linear order of sequence scaffolds and orient adjacent scaffolds relative to each other (Burton et al., 2013; Kaplan and Dekker, 2013). These approaches have been applied in the sequence assembly of insect (Dudchenko et al., 2017) and Triticeae genomes (Avni et al., 2017; Mascher et al., 2017).
Figure 1. Schematic overview of TCC for Triticeae. Leaves of seven days old plants (I) are harvested for chemical crosslinking of the chromatin (II). The chromatin structure is captured by the formation of covalent bonds between proteins (grey ovals) and between proteins and DNA (line). The orange and light blue segments exemplify two HindIII fragments located on a chromosome. Nuclei are purified (III), and proteins are biotinylated (IV, green pentagon) for subsequent tethering of the complexes to a solid phase. DNA is digested (scissors) using the restriction enzyme HindIII (V) and tethered at low density to streptavidin-coated beads (VI, purple). Ends are marked and filled-in using biotin-14-dCTP (VII, red star). By including dGTPαS in the fill-in reaction, a phosphorothioate bond is introduced. Thereby DNA is guarded against Exonuclease III digestion, which is used at a later step to remove biotinylated nucleotides from non-ligated ends (not shown). Filled-in HindIII sites are ligated ‘on-bead’ (VIII), thereby newly creating NheI restriction sites, which are indicating TCC ligation events. The crosslinking is reversed. DNA is purified (IX) and treated with Exonuclease III (not shown) prior to fragmentation (X). The position of primers (grey triangles) used for controlling the marking and ligation of ends (3C control) is indicated (IX). Ends of the fragmented DNA are repaired and tailed with ‘A’ (not shown). DNA fragments with genuine ligation junctions are affinity-purified based on the incorporated biotin (XI) and provided with Illumina adapters (XII, grey lines) for paired-end sequencing. Ligation products are PCR-amplified (XII; arrowheads: position of primer), size-selected (XIII) and quality controlled (QC). The junctions are revealed by paired-end (PE) sequencing using an Illumina HiSeq2500 device (XIV) followed by bioinformatic analysis (XV). The estimated hands-on time is indicated in days (d). The operating period of the Illumina HiSeq2500 instrument is given for 2x 100 cycles sequencing and depends on the chemistry and type of flowcell (days in brackets). The flowchart is adapted from (Kalhor et al., 2011).
Materials and Reagents
Notes:
We tested all components in independent experiments. However, this list does not imply that alternative products from other manufacturers cannot perform just as well.
The use of the published equipment and chemistry is not indicating any competing interest.
Compost soil (multiple vendors)
Pots (16 cm diameter) (multiple vendors)
Aluminum foil (multiple vendors)
10 µl Sapphire Low Retention Filtertips (Greiner Bio One International, catalog number: 771265 )
200 µl Sapphire Low Retention Filtertips (Greiner Bio One International, catalog number: 737265 )
1,000 µl Sapphire Low Retention Filtertips (Greiner Bio One International, catalog number: 750265 )
0.2 µm filter, Millex GP (Merck, catalog number: SLGP033RS )
10 ml and 50 ml syringes (multiple vendors)
50 ml Falcon tubes (Corning, catalog number: 352070 )
Racks for 50 ml Falcon tubes fitting into the desiccator (multiple vendors)
Disposable 10 ml and 25 ml plastic pipettes (multiple vendors)
Pipette fillers (BRAND, catalog number: 25315 )
Paper towels (multiple vendors)
Appropriate protective gear for working with liquid nitrogen (multiple vendors)
Dewar vessel for transport and storage of liquid nitrogen (multiple vendors)
Miracloth (Merck, catalog number: 475855-1R )
Sefar Nitex 03-55/32 (55 µm mesh opening, 32% open area) (Stefan Kastenmüller GmbH)
Tubes (1.5 ml and 2.0 ml; SARSTEDT, catalog numbers: 72.690.001 and 72.695.500 )
Microscopic slides (76 x 26 x 1 mm) (multiple vendors)
Cover slips (multiple vendors)
Cell counting chamber (Neubauer chamber) and glass cover (Celeromics)
Needle (0.9 x 40 mm, HSW FINE-JECT) (Henke-Sass, Wolf, catalog number: 8300025263 )
Slide-A-LyzerTM Dialysis cassette (0.5-3 ml, cutoff 20 kDa) with float buoys (Thermo Fisher Scientific, catalog number: 66003 )
Parafilm (BRAND, catalog number: 701605 )
Magnetic Particle Concentrator (MPC) for 1.5 ml tubes (DynaMag-2 Magnet) (Thermo Fisher Scientific, catalog number: 12321D )
15 ml conical tubes (Corning, catalog number: 352196 )
Rubber strap or tape
DynaMag-96 Side Skirted Magnetic Particle Concentrator (MPC96) (Thermo Fisher Scientific, catalog number: 12027 )
PCR-tubes, Sapphire (Greiner Bio One International, catalog number: 652250 )
Snap-cap microTUBEs (with AFA-fiber and pre-split septum) (Covaris, catalog number: 520045 )
Disposable scalpels (multiple vendors)
Polystyrene plugs (self-made) of 0.5 to 1.0 cm thickness fitting snugly into the 50 ml plastic tubes
Seeds (provided by the experimenter)
HEPES sodium salt (4-(2-Hydroxyethyl) piperazine-1-ethanesulfonic acid sodium salt) (Carl Roth, catalog number: 7020.2 )
Concentrated HCl (Carl Roth, catalog number: 4625.1 )
Sucrose (Carl Roth, catalog number: 9097.1 )
MgCl2•6H2O (Sigma-Aldrich, catalog number: M2670 )
KCl (Honeywell, Fluka, catalog number: 60130 )
Triton X-100 (Carl Roth, catalog number: 3051.3 )
100% glycerol (Carl Roth, catalog number: 3783.1 )
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: 93482 )
2-mercaptoethanol (14.3 M) (Carl Roth, catalog number: 4227.1 )
37% (w/v) formaldehyde solution (containing 10-15% methanol as stabilizer) (Sigma-Aldrich, catalog number: 252549 )
Glycine (Carl Roth, catalog number: 3790.1 )
Liquid nitrogen
Aprotinin (Sigma-Aldrich, catalog number: 10820 )
Leupeptin (Sigma-Aldrich, catalog number: L2884 )
Pepstatin (Sigma-Aldrich, catalog number: P5318 )
VECTASHIELD mounting medium with DAPI (VECTOR Laboratories, catalog number: H-1200 )
SDS (Sodium Dodecyl Sulfate) (Serva, catalog number: 20765 )
Tris (hydroxymethyl) aminomethane (Tris base) (Carl Roth, catalog number: 5429.3 )
NaCl (Carl Roth, catalog number: 9265.2 )
EZlink Iodoacetyl-PEG2-Biotin (IPB) (Thermo Fisher Scientific, catalog number: 21334 )
1,4-Dithiothreitol (DTT) (Carl Roth, catalog number: 6908.1 )
HindIII (100 U/µl) (New England BioLabs, catalog number: R0104T )
NheI (10 U/µl) (Thermo Fisher Scientific, catalog number: ER0971 )
MyOne Streptavidin T1 beads (Thermo Fisher Scientific, catalog number: 65601 )
Na2HPO4 (Carl Roth, catalog number: P030.2 )
KH2PO4 (Carl Roth, catalog number: 3904.1 )
100 mM dATP (Thermo Fisher Scientific, catalog number: R0142 )
100 mM dTTP (Thermo Fisher Scientific, catalog number: R0172 )
2'-Deoxyguanosine-5'-(α-thio)-triphosphate, Sodium salt (dGTPαS), 1:1 Mixture of Rp and Sp isomers (Jena Bioscience, catalog number: NU-424S )
Biotin-14-dCTP (Thermo Fisher Scientific, catalog number: 19518018 )
Klenow DNA polymerase, large fragment (10 U/µl) (Thermo Fisher Scientific, catalog number: EP0052 )
UltraPure BSA (50 mg/ml) (Thermo Fisher Scientific, catalog number: AM2616 )
T4 DNA ligase (5 U/µl) with 10x T4 DNA Ligation buffer and 50% PEG 4000 (Thermo Fisher Scientific, catalog number: EL0011 )
RNase A (DNase-free) (MACHEREY-NAGEL, catalog number: 740505 )
Proteinase K (Thermo Fisher Scientific, catalog number: 25530015 )
Phenol:CHCl3:isoamyl alcohol (25:24:1) (Carl Roth, catalog number: A156.2 )
8-Hydroxyquinoline (Sigma-Aldrich, catalog number: H6878 )
Isoamyl alcohol (Carl Roth, catalog number: 8930.1 )
CHCl3 (Carl Roth, catalog number: 3313.2 )
Glycogen (Thermo Fisher Scientific, catalog number: R0561 )
100% ethanol (Carl Roth, catalog number: 9065.4 )
Q5 Hot Start High-Fidelity DNA Polymerase (2 U/µl) and 5x Q5 Hot Start buffer (New England BioLabs, catalog number: M0493S )
Primer for biotin incorporation control (barley):
Primer 1 (5'- ATCTTCATGCGAGGCAGAGT-3')
Primer 2 (5'- ACCGTTGAACCATCTTCAGG-3')
Note: The primers are HPLC purified, 0.2 μmol synthesis scale, dissolved in H2O to 100 µM; contact e.g., Sigma-Aldrich for synthesis.
dNTP Set (100 mM solutions) (Thermo Fisher Scientific, catalog number: R0181 )
dNTP Mix (25 mM each) (Thermo Fisher Scientific, catalog number: R1121 )
MinElute Gel Extraction Kit (QIAGEN, catalog number: 28606 )
Bromophenol Blue (Carl Roth, catalog number: A512.2 )
10x NEBuffer 1 buffer (New England BioLabs, catalog number: B7001S )
UltraPure Agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500500 )
Exonuclease III (100 U/µl) from E. coli (New England BioLabs, catalog number: M0206S )
AMPure XP beads (Beckman Coulter, catalog number: A63881 )
10x Tango (Thermo Fisher Scientific, catalog number: BY5 )
100 mM ATP (Thermo Fisher Scientific, catalog number: R0441 )
T4 DNA polymerase (5 U/µl) (Thermo Fisher Scientific, catalog number: EP0062 )
T4 polynucleotide kinase (10 U/µl) (Thermo Fisher Scientific, catalog number: EK0031 )
Klenow DNA polymerase, large fragment (10U/µl) (Thermo Fisher Scientific, catalog number: EP0052 )
Klenow fragment, 3'→5' exo- (5 U/µl) (New England BioLabs, catalog number: M0212L )
Dynabeads MyOne Streptavidin C1 (Thermo Fisher Scientific, catalog number: 65001 )
DNA LoBind tubes (1.5 ml) (Eppendorf, catalog number: 0030108051 )
TruSeq DNA Single Indexes Set A (Illumina, catalog number: 20015960 )
Library amplification primer:
Primer 3 (5'-AATGATACGGCGACCACCGAGAT-3')
Primer 4 (5'-CAAGCAGAAGACGGCATACGA -3')
Note: The primers are HPLC purified, 0.2 μmol synthesis scale, dissolved in H2O to 100 µM; contact e.g., Sigma-Aldrich for synthesis.
SYBR-Gold (Thermo Fisher Scientific, catalog number: S11494 )
GeneRuler 50 bp DNA ladder (Thermo Fisher Scientific, catalog number: SM0373 )
Glacial acetic acid (Carl Roth, catalog number: 3738.5 )
QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106 )
100% isopropanol (Carl Roth, catalog number: 6752.4 )
Note: Prepare the following solutions (#100-#107) as described in Green and Sambrook (2012).
1 M Tris-HCl, pH 8.0 (100 ml)
1 M Tris-HCl, pH 7.4 (100 ml)
1 M Tris-HCl, pH 7.5 (100 ml)
0.5 M EDTA, pH 8.0 (100 ml)
1 M DTT (20 ml)
Phenol:CHCl3:isoamyl alcohol (25:24:1) with 0.1% 8-Hydroxyquinoline
CHCl3:isoamyl alcohol (24:1)
1 M MgCl2
1 M HEPES, pH 8.0 (see Recipes)
2 M sucrose (see Recipes)
1 M KCl (see Recipes)
10% (v/v) Triton X-100 (see Recipes)
Nuclei Isolation Buffer (NIBF) with formaldehyde (see Recipes)
2 M glycine (see Recipes)
1 mg/ml Aprotinin (see Recipes)
1 mg/ml Leupeptin (see Recipes)
1 mg/ml Pepstatin (see Recipes)
Nuclei Isolation Buffer with protease inhibitors (NIBP) (see Recipes)
Sucrose cushion (see Recipes)
Nuclei Isolation Buffer with 1.5 M sucrose (NIBS) (see Recipes)
2% (w/v) SDS (see Recipes)
4 M NaCl (see Recipes)
Wash buffer 1 (see Recipes)
25 mM IPB (see Recipes)
10x NEBuffer 2 (see Recipes)
1x NEBuffer 2 (see Recipes)
HindIII (10 U/ µl) (see Recipes)
Dialysis buffer (TE buffer) (see Recipes)
Phosphate Buffered Saline with Tween 20, pH 7.4 (PBST) (see Recipes)
25 mM neutralized IPB (see Recipes)
10 mM dATP (see Recipes)
10 mM dTTP (see Recipes)
Wash buffer 2 (see Recipes)
Wash buffer 3 (see Recipes)
10x ligation buffer TCC (see Recipes)
10 mg/ml BSA (see Recipes)
Extraction buffer (see Recipes)
25 mg/ml RNase A (see Recipes)
20 mg/ml Proteinase K (see Recipes)
5 mg/ml glycogen (see Recipes)
80% ethanol (see Recipes)
70% ethanol (see Recipes)
3 M sodium acetate, pH 5.2 (see Recipes)
EB (see Recipes)
EBT (see Recipes)
Primer 1 + 2 (10 µM each) (see Recipes)
10 mM dNTP mix (see Recipes)
2.5 mM dNTP mix (see Recipes)
TLE (see Recipes)
Tween Wash Buffer (TWB) (see Recipes)
2x Binding Buffer (2x BB) (see Recipes)
1x Binding Buffer (1x BB) (see Recipes)
1x ligation buffer (see Recipes)
Primer 3 + 4 (10 µM each) (see Recipes)
6x loading dye (see Recipes)
50x TAE (see Recipes)
Equipment
Scissors (multiple vendors)
Ice bucket (multiple vendors)
Borosilicate glass bottles (100 ml) (Laborbedarfshop, catalog number: GT00205 )
Borosilicate glass bottles (250 ml) (Laborbedarfshop, catalog number: GT00206 )
Borosilicate glass bottles (500 ml) (Laborbedarfshop, catalog number: GT00207 )
Borosilicate glass bottles (1,000 ml) (Laborbedarfshop, catalog number: GT00208 )
Borosilicate Erlenmeyer flasks (500 ml) (Laborbedarfshop, catalog number: GT00153 )
P1, 10 µl Finnpipette (Thermo Fisher Scientific, catalog number: 4641040N )
P10, 100 µl Finnpipette (Thermo Fisher Scientific, catalog number: 4641070N )
P20, 200 µl Finnpipette (Thermo Fisher Scientific, catalog number: 4641080N )
P100, 1000 µl Finnpipette (Thermo Fisher Scientific, catalog number: 4641100N )
Mortar with pestle with a rough surface for grinding (about 10 cm diameter) (multiple vendors)
Metal spoon (multiple vendors)
Funnels fitting into 50 ml tubes (multiple vendors)
Sieve or tea strainer (about 8 cm diameter) (multiple vendors)
Greenhouse equipped with automatic shading and supplementary light (sodium halogen lamps)
pH meter (multiple vendors)
Water bath (65 °C) (multiple vendors)
-20 °C freezer (multiple vendors)
-80 °C freezer (multiple vendors)
Vortex (multiple vendors)
Measuring cylinder 100 ml, 1 L (multiple vendors)
Autoclave (multiple vendors)
Analytical laboratory balance 'Quintix' (0,1 mg to 120 g) (Sartorius, catalog number: Quintix® 124-1S )
Precision laboratory balance 'Cubis' (10 mg to 2.2 kg) (Sartorius, catalog number: MSE2203P-000-DR )
Ice machine (multiple vendors)
Desiccator (multiple vendors)
Vacuum pump with manometer, condensation trap and tubing to connect desiccator to vacuum pump (multiple vendors)
Fume hood
Note: All manipulations involving the NIBF buffer must be performed inside a fume hood. Follow the safety regulations of your laboratory during the manipulations and for the waste disposal.
Heraeus Multifuge 4KR centrifuge for 50 ml tubes (3,000 x g required) (Thermo Fisher Scientific, model: HeraeusTM Multifuge 4KR , catalog number: 75004461)
Heraeus Fresco 21 centrifuge for Eppendorf tubes (16,000 x g required) (Thermo Fisher Scientific, model: HeraeusTM FrescoTM 21 , catalog number: 75002426)
Epifluorescence microscope BX61 (Olympus) equipped with a cooled CCD camera (Hamamatsu Orca ER) (see Note 1) (Olympus, model: BX61 )
Incubator cabinet (37 °C) (Memmert, model: Model 600 , catalog number: D06062)
Rocking platform (Heidolph Instruments, model: Titramax 1000, catalog number: 544-12200-00 )
Eppendorf ThermoMixer C (Eppendorf, model: ThermoMixer® C , catalog number: 5382000015) with a Smartblock for 1.5 ml tubes (Eppendorf, catalog number: 5360000038 )
1 L beaker glass (multiple vendors)
Magnetic stir bar and magnetic stirrer (multiple vendors)
Tube rotator (NeoLab, catalog number: 7-0045 )
Incubator cabinet (16 °C) (GFL-Gesellschaft für Labortechnik, catalog number: 3032 ) placed in a cold room at 4 °C
Qubit 2.0 (or Qubit 4) fluorometer with assay tubes, dsDNA HS Assay and dsDNA BR Assay (Thermo Fisher Scientific, model: Qubit 4, catalog number: Q33227 )
Thermocycler (multiple vendors)
Microwave (multiple vendors)
Agarose gel electrophoresis equipment and accessories [microwave, tray (15 x 15 cm), combs, power supply, electrophoresis buffer, agarose, etc.] (multiple vendors)
Covaris S220 AFA Ultrasonicator (Covaris) and associated equipment [snap-cap microTUBEs (with AFA-fiber and pre-split septum), chiller, software, computer (see Note 1)]
Dark Reader blue light transilluminator (Clare Chemical Research, catalog number: DR46B )
Agilent 2100 Electrophoresis Bioanalyzer or Agilent 4200 TapeStation System (Agilent Technologies, model: Agilent 2100 ) including accessories and consumables (see Note 1)
GenPure Pro UV/UF (Thermo Fisher Scientific, catalog number: 50131950 )
Software
Software and computer hardware:
To analyze Hi-C/TCC sequence data, a computer server running a Unix operating system (e.g., Linux, Solaris, MacOS; see Note 1) or access to a cloud-computing system (e.g., CyVerse, http://www.cyverse.org) is required. Common UNIX command line tools (such as) need to be available. To accelerate CPU-intensive steps such as read alignment, access to a multi-core machine (> 16 CPU cores) is recommended. Depending on the number of samples to be analyzed, hard disk storage space needs to be allocated.
The following bioinformatics software need to be installed to carry out the primary data analysis described below:
Casava, http://support.illumina.com/sequencing/sequencing_software/casava.html
Cutadapt, http://cutadapt.readthedocs.io
BWA-MEM, https://github.com/lh3/bwa
SAMtools, http://www.htslib.org/download/
BEDtools, http://bedtools.readthedocs.io
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Himmelbach, A., Walde, I., Mascher, M. and Stein, N. (2018). Tethered Chromosome Conformation Capture Sequencing in Triticeae: A Valuable Tool for Genome Assembly. Bio-protocol 8(15): e2955. DOI: 10.21769/BioProtoc.2955.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > DNA structure
Systems Biology > Epigenomics > Chromatin architecture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,956 | https://bio-protocol.org/exchange/protocoldetail?id=2956&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Microscopic Observation of Subcellular GFP-tagged Protein Localization in Rice Anthers
Seijiro Ono
Ken-Ichi Nonomura
Published: Aug 5, 2018
DOI: 10.21769/BioProtoc.2956 Views: 4870
Original Research Article:
The authors used this protocol in Feb 2018
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2018
Abstract
This protocol demonstrates a simple method to determine the subcellular localization of fluorescence-tagged proteins on the vibratome sections of rice developing anthers. If a cell type-specific promoter is used to drive the tagged protein-encoding gene, the method enables to clearly distinguish the cells retaining fluorescent signals from other anther cells. It is applicable to both live and fixed samples, and presumably to other plant tissues.
Keywords: Green fluorescent protein (GFP) Rice Anther
Materials and Reagents
Micropipette tips
Razor blade (FEATHER Safety Razor, catalog number: 99027 )
2 ml Safe-Lock microtube (Eppendorf, catalog number: 0030120094 )
Microscope slide glass (Matsunami Glass, catalog number: SMAS-01 )
Coverslip (Matsunami Glass, catalog number: C218181 )
CRYO DISH No2 (SHOEI WORK’S, catalog number: 1101-2 )
(Optional) 15 ml centrifuge tubes (TPP Techno Plastic Products, catalog number: 91015 )
(Optional) Nylon filter mesh sheet
Young panicles at a preferred developmental stage from transgenic rice plants expressing fluorescent proteins (if you target meiotic stages in japonica rice varieties, use 4-8 cm long panicles containing flowers with 0.5-0.9 mm long anthers)
Low melting temperature agarose (SeaPlaqueTM Agarose) (Lonza, catalog number: 50101 )
ddH2O
Krazy Glue® (Krazy Glue, catalog number: KG585 )
VECTASHIELD mounting medium with DAPI (Vector Laboratories, catalog number: H-1200 , store at 4 °C in the dark condition)
Nail polish
(Optional) Paraformaldehyde (Wako Pure Chemical Industries, catalog number: 162-16065 )
(Optional) 5 N NaOH solution
(Optional) Ice
(Optional) PIPES (Wako Pure Chemical Industries, catalog number: 345-02225 )
(Optional) EGTA (Wako Pure Chemical Industries, catalog number: 342-01314 )
(Optional) MgSO4•7H2O (Wako Pure Chemical Industries, catalog number: 138-00415 )
(Optional) KOH solid (60 g or more, Wako Pure Chemical Industries, catalog number: 168-21815 )
(Optional) Glycerol (Wako Pure Chemical Industries, catalog number: 075-00616 )
(Optional) DMSO (Wako Pure Chemical Industries, catalog number: 048-21985 )
(Optional) 5x PMEG stock buffer (see Recipes, store at 4 °C. It is available for 6 months)
Equipment
Micropipettes
(Optional) Measuring cylinder
100 ml polypropylene beaker
(Optional) 200 ml or 300 ml flask
Standard microwave oven
Block incubator (ASTEC, model: BI-525A )
Stereo microscope (Nikon, model: SMZ445 )
Fine forceps (Fine Science Tools, DUMONT, model: #5 )
Vibrating microtome (MicroSlicer) (DOSAKA EM, model: ZERO-1 )
Confocal Laser Scanning Microscope (CLSM, Olympus, model: FV300 ) or fluorescent microscope
(Optional) Autoclave
(Optional) Vacuum Pressure pump (e.g., Merck, model: WP6122050 )
(Optional) Vacuum desiccator (e.g., SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F42400-2041 )
(Optional) Sample Shaker
(Optional) Water bath
Software
ImageJ (or Fiji)
Photoshop CC (Adobe)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Tissue analysis
Developmental Biology > Morphogenesis > Cell structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,957 | https://bio-protocol.org/exchange/protocoldetail?id=2957&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isothermal Titration Calorimetry: A Biophysical Method to Characterize the Interaction between Label-free Biomolecules in Solution
Andrea Saponaro
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2957 Views: 21699
Reviewed by: Shyam SolankiTimothy S. Artlip
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
This protocol can be applied to analyze the direct interaction between a soluble protein and a target ligand molecule using Isothermal Titration Calorimetry (ITC, Malvern). ITC allows the biophysical characterization of binding between label-free, non-immobilized and in-solution biomolecules by providing the stoichiometry of the interaction, the equilibrium binding constants and the thermodynamic parameters. ITC monitors heat changes (released and/or absorbed) caused by macromolecular interactions with no restrictions of buffer and molecular weight of the macromolecules.
Keywords: ITC Calorimetr Macromolecular interaction Binding affinity KAT1 channels 14-3-3 proteins
Background
Macromolecular interactions are critical cellular events as they form the basis for signal transduction pathways. Thus, macromolecular interactions are an essential field of research, as they allow a deeper understanding of the molecular mechanisms which underlie both physiological and pathophysiological processes, and the rational design of drugs able to modulate disease-causing macromolecular binding events.
In this context, Isothermal Titration Calorimetry (ITC) is a powerful technique for the characterization of macromolecular interactions. ITC determines the heat change that occurs upon the binding of two molecules. Heat can be absorbed (endothermic reaction) or released (exothermic reaction). ITC monitors such heat changes by determining the differential power, provided by heaters of the instrument to both the reference and the sample cells, needed for counteracting any temperature difference between the two cells during the binding reaction such that no difference in temperature arises between the reference and sample cells (Figure 1).
Figure 1. Principle of Isothermal Titration Calorimetry (ITC). A. Cartoon representation of an isothermal titration calorimetry instrument composed of: a reference cell filled with MilliQ water; a sample cell containing a biomolecule; and an automated injection syringe containing the other binding molecule (ligand) used to titrate the ligand into the sample cell. The sample and reference cells are surrounded by an adiabatic jacket. The system is able to detect temperature differences between the reference and sample cells and to maintain an absence of temperature difference between them (ΔT = 0) by supplying power to both the reference and the sample cell via two heaters. The output of the instrument is the power (μcal/sec) required to maintain ΔT = 0 between the reference and sample cells. B-D. The temperature difference between the reference and the sample cell, induced by the ligand–biomolecule binding, is converted into the power needed to bring the two cells back to the same temperature during the binding reaction. As the titration proceeds, the biomolecule in the sample cell becomes saturated with the ligand, so that less interactions occur and consequently the heat change decreases (C) until the biomolecule is fully saturated and the instrument detects only heat change due to the dilution of the ligand (D).
ITC provides important information about the nature of the macromolecular interaction: the binding stoichiometry (N); the thermodynamic parameters of the binding reaction (enthalpy, ∆H, entropy, ∆S, and Gibbs free energy, ∆G); the strength of the interaction (the equilibrium association constant KA, from which the more commonly used equilibrium dissociation constant KD can be derived).
Among the methods used to characterize macromolecular interactions, ITC has two major advantages: i) the biomolecules are free to move in solution and are not labelled, which insures a direct characterization of the binding event, unbiased by labelling and/or by limitation on molecule motions due to their immobilization on a surface; ii) ITC is the only method that allows a detailed characterization of the binding event by providing not only the binding affinity, but also other critical information, i.e., the binding stoichiometry and the thermodynamic parameters. This information can help significantly in the understanding of the molecular mechanism of the binding reaction, even when no structural data are yet available. Furthermore, they can be used as complementary data to validate structural results.
Recently, I presented crystallographic and functional data showing that the K+ inward rectifier KAT1 (K+ Arabidopsis thaliana 1) channel is regulated by the direct binding of 14-3-3 proteins (Saponaro et al., 2017). In particular, I identified a 14-3-3 mode III binding site at the very C-terminus of KAT1 and co-crystallized it with tobacco 14-3-3 proteins (14-3-3c) to describe the protein complex in atomic detail. The structural results were complemented/supported by measuring, through ITC, the interaction between a synthetic KAT1 C-terminal phosphopeptide (CPP) and 14-3-3c. ITC was employed to quantify the stoichiometry, the equilibrium binding affinity and the thermodynamic parameters of the 14-3-3c-CPP binding reaction.
The aim of this protocol is to provide a detailed description of the setting procedure of an ITC experiment, highlighting the crucial steps and related concerns, and providing, at the same time, a well-established strategy to overcome such problems. Moreover, the present protocol describes the analysis of an ITC measurement of the single binding event in a 14-3-3c/CPP interaction.
Materials and Reagents
Pipette tips (20 μl, 200 μl and 1,000 μl)*
Glass syringe 2.5 ml, 18GA, 8.5IN, PT3 (Malvern Panalytical, catalog number: SYN161714 )
Disposable borosilicate glass tubes, 0.7 ml, 6 x 50 mm (O.D. x Height) (DWK Life Sciences, Kimble Chase, catalog number: 73500-650 )
0.22 μm vacuum filter*
Purified Nicotiana tabacum 14-3-3c protein recombinantly expressed in E. coli. Protein stock concentration is 100 μM
Note: The protein was expressed and purified as described in Saponaro et al. (2017).
Synthetic phosphopeptide* (corresponding to the last 5 residues of Arabidopsis thaliana KAT1 channel (hereafter CPP) dissolved in MilliQ Water. Peptide stock concentration is 15 mM) (Peptide was purchased from CASLO ApS as a lyophilized powder, purity ≥ 98%)
NaCl*, stock concentration 5 M (Sigma-Aldrich, catalog number: 746398 )
HEPES*, stock concentration 1 M, pH 7.4 (Sigma-Aldrich, catalog number: RDD002 )
NaOH*, stock concentration 10 M (Sigma-Aldrich, catalog number: S8045 )
MgCl2*, stock concentration 2 M (Sigma-Aldrich, catalog number: M8266 )
β-mercaptoethanol*, stock concentration 100 mM (Sigma-Aldrich, catalog number: M6250 )
MilliQ Water*
Sample buffer (see Recipes)
*Note: These items can be purchased from any suitable vendor.
Equipment
Pipettors (P10, P20, P200, P1000)*
Microcalorimeter (Malvern Panalytical, model: MicroCal VP-ITC )
Vacuum pump (provided together with MicroCal VP-ITC, Malvern Panalytical, model: ThermoVac, catalog number: 29013182 )
Filling syringe (provided together with MicroCal VP-ITC, Malvern Panalytical)
Plastic tubes, 3 ml (provided together with MicroCal VP-ITC, Malvern Panalytical)
Benchtop refrigerated centrifuge with rotor FA-45-48-1 (Eppendorf, model: 5427 R , catalog number: 5409000210)
Stir bars 7 mm for mixing the solutions within the vacuum pump (ThermoVac) (Malvern Panalytical, catalog number: BAR150020-005 )
UV spectrometer (Eppendorf, BioSpectrometer® basic supplied with Eppendorf μCuvette® G1.0, that is suitable for volumes of 1.5-10 μl, catalog number: 6135000904 )
pH meter*
*Note: These items can be purchased from any suitable vendor.
Software
Origin software (version7, MicroCal, Malvern Instruments Ltd, RRID: SCR_014212)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Saponaro, A. (2018). Isothermal Titration Calorimetry: A Biophysical Method to Characterize the Interaction between Label-free Biomolecules in Solution. Bio-protocol 8(15): e2957. DOI: 10.21769/BioProtoc.2957.
Saponaro, A., Porro, A., Chaves-Sanjuan, A., Nardini, M., Rauh, O., Thiel, G. and Moroni, A. (2017). Fusicoccin activates KAT1 channels by stabilizing their interaction with 14-3-3 proteins. Plant Cell 29(10): 2570-2580.
Download Citation in RIS Format
Category
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,958 | https://bio-protocol.org/exchange/protocoldetail?id=2958&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Direct Visualization of the Multicopy Chromosomes in Cyanobacterium Synechococcus elongatus PCC 7942
RO Ryudo Ohbayashi
Hirofumi Yoshikawa
Satoru Watanabe
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2958 Views: 5852
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
Cyanobacteria are prokaryotic organisms that carry out oxygenic photosynthesis. The fresh water cyanobacterium Synechococcus elongatus PCC 7942 is a model organism for the study of photosynthesis and gene regulation, and for biotechnological applications. Besides several freshwater cyanobacteria, S. elongatus 7942 also contains multiple chromosomal copies per cell at all stages of its cell cycle. Here, we describe a method for the direct visualization of multicopy chromosomes in S. elongatus 7942 by fluorescence in situ hybridization (FISH).
Keywords: Cyanobacteria Polyploidy Chromosome distribution In situ hybridization Replication origin
Background
Cyanobacteria are prokaryotic microorganisms that utilize an oxygen-producing photosynthetic system similar to that of chloroplasts in higher plants. Whereas bacteria such as Escherichia coli and Bacillus subtilis harbor a single circular chromosome, several species of freshwater cyanobacteria have multiple circular chromosomes per cell (Mann and Carr, 1974; Labarre et al., 1989; Binder and Chisholm, 1995). The freshwater cyanobacterium Synechococcus elongatus PCC 7942 (hereafter referred to as S. elongatus 7942) carries 3-8 chromosomal copies per cell (Griese et al., 2011; Watanabe et al., 2012; Watanabe et al., 2015). A fluorescence reporter-operator system has been established to acquire images of the multicopy chromosome of S. elongatus 7942 (Chen et al., 2012; Jain et al., 2012). Although this system enables live-cell imaging, it requires complex genetic constructs for labeling individual chromosomes, and, overall, this type of system is unstable over an extended period of cultivation. Thus, it is necessary to examine the chromosomal distribution in S. elongatus 7942 cells that have a simple genetic background. We recently established a fluorescence in situ hybridization (FISH) method for visualizing the oriC region and putative terC region of the multicopy chromosome in S. elongatus 7942 (Watanabe et al., 2018). A DNA probe, which covers the oriC or terC region, was synthesized and used for the FISH analysis. Labeled chromosomes in S. elongatus 7942 cells can be observed by fluorescence microscopy. Here, we describe a step-by-step protocol for the FISH method.
Materials and Reagents
Pipette tips
200 μl (FUKAEKASEI and WATSON, catalog number: 110-705C )
1,000 μl (FUKAEKASEI and WATSON, catalog number: 110-706C )
PCR-tubes and strips
Tube (FUKAEKASEI and WATSON, catalog number: 137-333C )
Cap (FUKAEKASEI and WATSON, catalog number: 137-432C )
Disposable plastic dish (for BG-11 plate) (KANTO KAGAKU, model: CSPD90-15, catalog number: 96930-01 )
93 ml test tubes (for culturing) (MonotaRO, IWAKI, catalog number: 09184061)
Manufacturer: IWAKI, catalog number: TEST30NP .
Poly-lysine coated glass slides (Matsunami Glass, catalog number: S7441 )
Cover glass (MonotaRO, catalog number: CT18189 )
Tube for sonication (microtube AFA Fiber Pre-Slit Snap-Cap) (Covaris, catalog number: 520077 )
Aluminum foil
Synechococcus elongatus PCC 7942 strain (Pasteur culture collection)
Genomic DNA of S. elongatus 7942 (10-50 ng for each PCR reaction)
ExTaq PCR Kit (TaKaRa Bio, catalog number: RR001A )
Fluorescence-12-dUTP (Roche Diagnostics, catalog number: 11427857910 )
Random primed DNA labeling kit (Roche Diagnostics, catalog number: 11004760001 )
99.5% ethanol (KANTO KAGAKU, catalog number: 14032-08 )
3 M NaOAc solution (pH 5.2) (KANTO KAGAKU, catalog number: 37092-00 )
Glycogen (20 ng/ml) (Roche Diagnostics, catalog number: 10901393001 )
Triton X-100 (NACALAI TESQUE, catalog number: 35501-02 )
Formamide (KANTO KAGAKU, catalog number: 16062-00 )
Paraformaldehyde (KANTO KAGAKU, catalog number: 32034-12 )
Dimethyl sulfoxide (KANTO KAGAKU, catalog number: 10378-00 )
Sodium hydroxide (KANTO KAGAKU, catalog number: 37184-00 )
Methanol (KANTO KAGAKU, catalog number: 25183-00 )
PBS powder (Sigma-Aldrich, catalog number: P3813 )
Lysozyme (Wako Pure Chemical Industries, catalog number: 122-02673 )
Tris-HCl (pH 7.5) (Sigma-Aldrich, catalog number: T3253-250G )
EDTA (NACALAI TESQUE, catalog number: 15111-45 )
Sodium chloride (KANTO KAGAKU, catalog number: 37144-00 )
Trisodium citrate dihydrate (KANTO KAGAKU, catalog number: 37150-00 )
Glycerol (KANTO KAGAKU, catalog number: 17029-00 )
DAPI (Sigma-Aldrich, catalog number: D9564-10MG )
Salmon sperm DNA (Roche Diagnostics, catalog number: 11467140001 )
Three sets of PCR primers for visualizing oriC or terC (Eurofins Genomics, Table 1)
Table 1. List of primers used for the preparation of FISH probes
BG-11 liquid medium (pH 8.2) (Castenholz, 1988)
BG-11 plates (pH 8.2) (Castenholz, 1988)
Hybridization solution (see Recipes)
Fixation solution (see Recipes)
PBS buffer (see Recipes)
Lysozyme solution (see Recipes)
20x Standard Saline Citrate (SSC) (see Recipes)
Mounting solution (see Recipes)
Equipment
Pipettes
P20 (Gilson, catalog number: F123600 )
P200 (Gilson, catalog number: F123601 )
P1000 (Gilson, catalog number: F123602 )
Thermal cycler (Thermo Fisher Scientific, Applied Biosystems, model: Veriti )
Microtube centrifuge (TOMY SEIKO, model: MX-107 )
Covaris S-2 sonicator (Covaris, Woburn, MA, USA)
Plant growth chamber (TOMY SEIKO, model: CLE-405 )
UV/Vis spectrophotometer (Shimadzu, model: UV-1800 )
Pharmaceutical refrigerator (Panasonic, model: MPR-3120CN-PJ )
Glass vat for staining (AS ONE, models: 1-4398-01 and 1-4398-11 )
Forma direct heat CO2 Incubator (Thermo Fisher Scientific, model: FormaTM 310 , catalog number: 320)
Fluorescence microscope (Olympus, models: BX53 and DP71 ; filters: U-FUW for DAPI and U-FGW for chlorophyll, objective: UPLSAPO 100XOPH)
All-in-one fluorescence microscope (Olympus, model: FSX100 , filters: U-MNUA2 for DAPI, U-MWIBA3 for FISH signal, and U-MWIG3 for chlorophyll, objective: UPLSAPO , super apochromat)
Note: This system is necessary to obtain clear FISH images.
Software
Camera software for DP71 (Olympus)
Software for FSX 100 (Olympus, FSX-BSW)
Adobe Photoshop Elements 11 (Adobe Photoshop, CC)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ohbayashi, R., Yoshikawa, H. and Watanabe, S. (2018). Direct Visualization of the Multicopy Chromosomes in Cyanobacterium Synechococcus elongatus PCC 7942. Bio-protocol 8(15): e2958. DOI: 10.21769/BioProtoc.2958.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell staining
Molecular Biology > DNA > DNA labeling
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,959 | https://bio-protocol.org/exchange/protocoldetail?id=2959&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Inositol Phosphates Purification Using Titanium Dioxide Beads
Miranda SC Wilson
AS Adolfo Saiardi
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2959 Views: 5046
Edited by: Alessandro Didonna
Reviewed by: Pooja TeotiaDoyel Sen
Original Research Article:
The authors used this protocol in Mar 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2015
Abstract
Inositol phosphates (IPs) comprise a family of ubiquitous eukaryotic signaling molecules. They have been linked to the regulation of a pleiotropy of important cellular activities, but low abundance and detection difficulties have hampered our understanding. Here we present a method to purify and enrich IPs or other phosphate-rich metabolites from mammalian cells or other sample types. Acid-extracted IPs from cells bind selectively via their phosphate groups to titanium dioxide beads. After washing, the IPs are easily eluted from the beads by increasing the pH. This technique, in combination with downstream analytical methods such as PAGE or SAX-HPLC, opens unprecedented investigative possibilities, allowing appropriate analysis of IPs from virtually any biological or non-biological source.
Keywords: Inositol polyphosphate Inositol pyrophosphate IP6 IP7 Metabolism Metabolites Signaling
Background
Inositol phosphates (IPs) are a family of conserved signaling molecules, ubiquitous in eukaryotes (Irvine and Schell, 2001; Tsui and York, 2010). They have been implicated in the regulation of a broad range of cellular activities, including calcium signaling, trafficking, and phosphate homeostasis (Wilson et al., 2013; Thota and Bhandari, 2015; Azevedo and Saiardi, 2017). However, our understanding of IPs signaling has been hampered by the fact that they can be difficult to study.
Unlike other phosphate-rich molecules such as nucleotides, IPs do not absorb in the UV/Vis range, and are often present at relatively low abundance in cells. The traditional methodology for IP detection and analysis is to radioactively metabolically label cells with 3H-inositol that is taken up and incorporated into IPs over 1-5 days (Wilson and Saiardi, 2017). After labeling, IPs are extracted with perchloric acid; these extracts are neutralised before separation by strong anion exchange (SAX) HPLC and scintillation counting of each fraction (Azevedo and Saiardi, 2006). The use of 3H-labelled IPs and chromatography has also been required for in vitro biochemical studies. The requirement for radioactive IPs or metabolic labeling limits the possible lines of investigation. These are time-consuming, technically demanding and expensive experiments.
We previously developed a polyacrylamide gel electrophoresis (PAGE) method for resolving and visualizing IPs (Losito et al., 2009; Loss et al., 2011). This technique was immediately useful in following in vitro reactions, as well as analyzing in vivo high abundance IPs such as IP6, IP7 and IP8 from Dictyostelium discoideum (Pisani et al., 2014), or IP6 from plant seeds (Desai et al., 2014; Kolozsvari et al., 2014). However, in the majority of cell types or model organisms, low IP concentrations make it impossible to run a PAGE gel of enough neutralized extract to visualize IPs while maintaining correct gel migration. In mammalian cells, the most abundant IP is IP6 at 40-100 µM (measured in cell lines such as HL60, C1866 and BAF3; French et al., 1991; Bunce et al., 1993), while the inositol pyrophosphate IP7 is thought to be present at sub-µM levels. We were therefore inspired to develop the present method that uses titanium dioxide beads to purify cold or radioactive IPs regardless of their abundance (Wilson et al., 2015). Titanium dioxide binds the phosphate groups of the IPs. The concentrated IPs can be analyzed by PAGE, SAX-HPLC, or other techniques.
The use of titanium dioxide beads now enables analysis of total unlabeled IPs from any cell type (Pavlovic et al., 2015; Wilson et al., 2015; Gu et al., 2016; Pavlovic et al., 2016). It also allows the study of IPs extracted from previously impossible sample types, including large volumes of liquid media, biofluids, or animal tissues. For biochemical work, the method can be used to remove salt and proteins from IPs preparations. Here we present the method as used for purifying IPs from cultured adherent mammalian cells.
Materials and Reagents
Pipette tips (Starlab, catalog number: S1112-1830 )
1.5 ml Eppendorf-style microcentrifuge tubes (Starlab, catalog number: S1615-5500 )
50 ml Falcon centrifuge tubes (Corning, catalog number: 352070 )
15 cm tissue culture dishes (Thermo Fisher Scientific, catalog number: 168381 )
pH test strips (Sigma-Aldrich, catalog number: P4536-100EA )
Titansphere TiO2 beads, 5 µm (Hichrom, catalog number: 5020-75000 )
PBS (Thermo Fisher Scientific, catalog number: 20012019 )
0.25% Trypsin-EDTA (Thermo Fisher Scientific, catalog number: 25200056 )
Double distilled water (ddH2O) or Milli-Q water (Millipore)
Perchloric acid, 70% (Sigma-Aldrich, catalog number: 244252-1L )
Ammonium hydroxide, 28-30% (Sigma-Aldrich, catalog number: 221228-1L )
1 M perchloric acid (see Recipes)
~2.8% ammonium hydroxide (see Recipes)
Equipment
Pipettes (Gilson, models: P1000 and P200, catalog numbers: F123602 , F123601 )
Ice box
Balance (Acculab, model: ALC-80.4 )
Humidified incubator (Eppendorf, model: Galaxy® 170 R , catalog number: CO17311002)
Benchtop centrifuge (Eppendorf, catalog number: 5702000365 )
Benchtop centrifuge with cooling (LaboGene, model: ScanSpeed 1730R )
Rotator (Cole-Parmer, Stuart, model: SB3 )
Note: This should be placed in a fridge or cold room.
Vortex mixer (Scientific Industries, model: Vortex Genie 2 , catalog number: SI-0266)
Centrifugal evaporator (Martin Christ Gefriertrocknungsanlagen, catalog number: RVC 2-18 )
Tilt table (Cole-Parmer, Stuart, catalog number: SSM4 )
Cell scrapers (Greiner Bio One International, catalog number: 541070 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wilson, M. S. C. and Saiardi, A. (2018). Inositol Phosphates Purification Using Titanium Dioxide Beads. Bio-protocol 8(15): e2959. DOI: 10.21769/BioProtoc.2959.
Download Citation in RIS Format
Category
Biochemistry > Other compound > Inositol phosphates
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
296 | https://bio-protocol.org/exchange/protocoldetail?id=296&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Plastic Embedding and Sectioning of Plant Tissues
Tie Liu
Published: Vol 2, Iss 23, Dec 5, 2012
DOI: 10.21769/BioProtoc.296 Views: 16630
Original Research Article:
The authors used this protocol in Feb 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2011
Abstract
Plastic (resin) embedding provides exclusively improvements to cellular definition compared to paraffin embedding. The combination of strongly cross-linking paraformaldehyde with glutaraldehyde and post fixed with OsO4 is the fixative of choice for high-resolution light microscopy and electron microscopy. For this reason, this method is an ideal tool for visualizing plant cellular morphology and phenotype.
Materials and Reagents
Ethanol
Acetone
Na2HPO4
Gelatin capsules (Electron Microscopy Sciences, catalog number: 71012 )
Glutaraldehyde (Fluka, catalog number: 49627 )
Paraformaldehyde
OsO4
Catalyst
Osmium (Fluka, catalog number: 75633 )
Fixative solution (see Recipes)
Post-fixative solution (see Recipes)
NaPO4 buffer (see Recipes)
Resin (LR white) (Fluka, catalog number: 62662 ) (see Recipes)
Equipment
Shaker
Incubator with temperature control
Light or electron microscopy
Vacuum
Glass blade or jeweler saw (Electron Microscopy Sciences, catalog number: 71012 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, T. (2012). Plastic Embedding and Sectioning of Plant Tissues. Bio-protocol 2(23): e296. DOI: 10.21769/BioProtoc.296.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Tissue analysis
Cell Biology > Tissue analysis > Tissue staining
Plant Science > Plant cell biology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,960 | https://bio-protocol.org/exchange/protocoldetail?id=2960&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Perithecium Formation and Ascospore Discharge in Fusarium graminearum
YG Yan Guo
WW Wan-Qian Wei
Dong Zhang
Wei-Hua Tang
Published: Aug 5, 2018
DOI: 10.21769/BioProtoc.2960 Views: 4847
Download PDF
Ask a question
Favorite
Cited by
Abstract
The filamentous ascomycete Fusarium graminearum (previously also known as Gibberella zeae) is a phytopathogen of grain cereals, reducing crop yield and grain quality. The abilities of sexual reproduction organ-perithecium formation, ascospore formation and discharge are all essential characteristics relevant to F. graminearum disease cycle. Here, we present the details of the protocol to study perithecium formation and ascospore discharge in F. graminearum.
Keywords: Fusarium graminearum Sexual reproduction Perithecium formation Ascospore discharge
Background
The ascomycete fungus Fusarium graminearum is the major causal agent of wheat Fusarium head blight and maize Gibberella stalk rot. This fungus can produce sexual fruiting bodies–perithecia on the surface of colonized host plants, the perithecia overwinters on crop debris and discharge ascospore for next year epidemic (Goswami and Kistler, 2004). Favored by moist and warm conditions, ascospores are forcibly discharged from perithecia and become airborne in air currents as the primary inoculum.
This fungus is homothallic; most strains can produce perithecia on carrot agar easily in vitro (Trail and Common, 2000). The microscopic study and a thorough description of perithecia development have been reported with temporal transcriptomic analysis during sexual development of F. graminearum (Trail and Common, 2000; Hallen et al., 2007). After induction of haploid hyphae at 0 h in vitro, dikaryotic cells formed and perithecium initiated at 24 h, young perithecia with central ascogenous cells and developing walls appeared at 48 h. The central ascospore matured at 144 h (Hallen et al., 2007). Studies have been conducted on factors that affect ascospore discharge and have concluded that relative humidity and temperature significantly affect the discharge process, while the light is not essential but it can help (Trail et al., 2002).
In this protocol, we outline the method of studying perithecium formation and ascospore discharge in F. graminearum, facilitating the identification of genes that have specific roles in sexual development and disease cycle.
Materials and Reagents
60 mm x 15 mm diameter dish (Sigma-Aldrich, catalog number: P5481-500EA)
Manufacturer: Excel Scientific, catalog number: D-901 .
2 ml microcentrifuge tube (BRAND, catalog number: 780546 )
Glass spreading rod (CHEMGLASS, catalog number: CLS-1350-01 )
Scalpel (Fisher Scientific, FisherbrandTM, catalog number: 08-920B )
Cork borer (Adelab Scientific, catalog number: LV-CRKBOR8 )
Microscope slides (China Sail Brand, catalog number: 7105 )
Sterile gauzes (Shanghai HongLong Medical Material Company)
Pipette tip box
Parafilm (Bemis, catalog number: 52858-000 )
Fungal strain: F. graminearum PH-1 (NRRL 31084)
Sterile distilled H2O
Ampicillin sodium salt (YEASEN, catalog number: 60203ES60 )
TWEEN 60 (Sigma-Aldrich, catalog number: P1629 )
Fresh carrot agar (see Recipes, store at 4 °C)
2.5% TWEEN 60 (see Recipes, store at RT)
Equipment
1 L Erlenmeyer Flask (Fisher Scientific, catalog number: S63274)
Manufacturer: Corning, Pyrex®, model: 49801L/EMD .
500 ml Erlenmeyer Flask (Fisher Scientific, catalog number: S63273)
Manufacturer: Corning, Pyrex®, model: 4980500/EMD .
Autoclave (Zealway Instrument, model: GI54DWS )
Homogenizer (Ronghua Instrument Manufacturing, model: JJ-2B )
Mold incubator (Yiheng Instrument, model: MJ-150-I )
UV light (PHILIPS lighting, model: TL-D 15W BLB 1SL/25, catalog number: 928024810803 )
Biological safety cabinet (Esco Micro, model: FHC1200A )
Induction chamber (JIANGNAN INSTRUMENT, model: GXZ-300 )
Camera (Canon, model: EOS 7D )
Microscope (Olympus, model: BX51 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial physiology > Sporulation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,961 | https://bio-protocol.org/exchange/protocoldetail?id=2961&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fusarium graminearum Double (Triple) Mutants Generation Using Sexual Crosses
YG Yan Guo
Dong Zhang
Wei-Hua Tang
Published: Aug 5, 2018
DOI: 10.21769/BioProtoc.2961 Views: 3939
Download PDF
Ask a question
Favorite
Cited by
Abstract
Fusarium graminearum is a destructive phytopathogen that infects major cereal crops such as wheat, maize and barley. Double or triple mutants are often very useful in the phenotypic and genetic analysis of genes that function redundantly or within similar pathways. When single gene mutants are available, double or triple mutants can be generated by crossing heterothallic strains or multiple rounds of protoplast transformation. When individual mutants carry different antibiotic resistance, it is convenient to use the sexual crossing to generate desired recombinant strains. Here, we present a protocol for generating double or triple mutants by sexual crossing in one homothallic strain with further antibiotic resistance and genomic DNA PCR screening of recombinant progenies.
Keywords: Fusarium graminearum Sexual crossing Double mutants Triple mutants
Background
The ascomycete fungus Fusarium graminearum is a devastating phytopathogen that causes head blight, ear rot, stalk rot and crown in cereals. It can produce perithecia on carrot agar in vitro. This assay can be used for studying perithecia development, ascospore discharge and sexual recombination (Nicholson, 2007).
F. graminearum is homothallic and has both MAT1-1 and MAT1-2-1 locus; each of these locus deletion mutants is sterile in self-crosses (Zheng et al., 2013). To generate double gene mutants, one single gene mutant has traditionally been outcrossed with MAT deletion mutants and further outcrossed with another single mutant (Bowden and Leslie, 1999; Lee et al., 2011; Son et al., 2012). Another strategy of double or triple mutants construct is deleting a gene in the other mutant strain with protoplast transformation (Oide et al., 2007 and 2014).
Here, we adapt and simplify this method, and present the details of the protocol to generate double and triple mutants using sexual crosses in one homothallic strain with further antibiotic resistance screening.
Materials and Reagents
60 mm x 15 mm diameter plates (Sigma-Aldrich, catalog number: P5481-500EA)
Manufacturer: Excel Scientific, catalog number: D-901 .
Sterile glass spreading rod (CHEMGLASS, catalog number: CLS-1350-01 )
1.5 ml sterile centrifuge tube (Corning, Axygen®, catalog number: MCT-150-C )
Sterile toothpicks (Purchased from Carrefour Supermarket)
90 mm diameter plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 263991 )
Fungal strain: F. graminearum PH-1 (NRRL 31084)
Sterile ddH2O
Fresh carrot (Purchased from Carrefour Supermarket)
TWEEN 60 (Sigma-Aldrich, catalog number: P1629 )
Ampicillin sodium Salt (YEASEN, catalog number: 60203ES60 )
Yeast extract (Oxoid, catalog number: LP0021 )
Casamino acids (Sigma-Aldrich, catalog number: 22090 )
Sucrose (Sinopharm Chemical Reagent, catalog number: 10021418 )
Hygromycin B (Sigma-Aldrich, Roche Diagnostics, catalog number: 10843555001 )
G418 sulfate (Santa Cruz Biotechnology, catalog number: sc-29065 )
V8 juice (Campbell Soup, 051000000675)
CaCO3 (Sigma-Aldrich, catalog number: C4830 )
Nourseothricin sulfate (Goldbio, catalog number: N-500-100 )
Fresh carrot agar (see Recipes, store at 4 °C)
2.5% TWEEN 60 (see Recipes, store at RT)
TB3 plate (see Recipes, store at 4 °C)
V8 juice agar (see Recipes, store at 4 °C)
Equipment
1 L Erlenmeyer Flask (Fisher Scientific, catalog number: S63274)
Manufacturer: Corning, Pyrex®, model: 49801L/EMD .
500 ml Erlenmeyer Flask (Fisher Scientific, catalog number: S63273)
Manufacturer: Corning, Pyrex®, model: 4980500/EMD .
Hemocytometer (0.10 mm, 1/400 mm2) (QIUJING, model: XB-K-25 )
Biological safety cabinet (ESCO Micro, model: FHC1200A )
Autoclave (Zealway Instrument, model: GI54DWS )
Homogenizer (Ronghua Instrument Manufacturing, model: JJ-2B )
UV light (Philips Lighting, model: TL-D 15W/BLB 1SL/25, catalog number: 928024810803 )
Induction chamber (JIANGNAN INSTRUMENT, model: GXZ-300 )
Vortexer (Bio-Rad Laboratories, model: BR-2000 Vortexer )
Mold incubator (Yiheng, model: MJ-150I )
Microscope (Olympus, model: BX51 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,962 | https://bio-protocol.org/exchange/protocoldetail?id=2962&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of LYVE-1+ Endothelial Cells from Mouse Embryos
PC Patrick Crosswhite
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2962 Views: 5141
Edited by: Jia Li
Reviewed by: Jijun Cheng
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Lymphatic vessel endothelial hyaluronan receptor 1, or LYVE-1, is a type 1 integral membrane glycoprotein expressed by lymphatic endothelial cells (LECs). LYVE-1 is commonly used as a biological marker to visually distinguish developing lymphatic vessels from blood endothelial cells (arteries or veins). As our understanding of lymphatic biology is still lacking today, the need to isolate LECs apart from other endothelial cells has taken on greater importance. The following procedure describes a magnetic bead separation procedure for isolating LEC-rich populations of cells from developing mouse embryos.
Keywords: LYVE-1 Endothelial cells Lymphatic Liver Mouse embryo
Background
The lymphatic vasculature forms a secondary circulatory system that functions in draining extracellular fluid from tissue, allows for the transport of lipids, and provides immune cell trafficking and transport function. While our understanding of the lymphatic system has rapidly expanded in the last couple of decades, it is still lacking compared to our knowledge of arterial and venous biology. The identification of LYVE-1 receptor expression by LECs provided a useful tool to distinguish lymphatic tissue but LYVE-1 is known to be expressed in other tissues including liver and spleen sinusoidal cells and pancreatic exocrine and islet of Langerhans cells (Banerji et al., 1999). Encoded by the LYVE1 gene, the biological function of the LYVE-1 receptor has yet to be determined but it has been suggested to participate in tumor metastasis in addition to HA transport across endothelial cells (Jackson, 2003). Despite it being expressed in a variety of tissues, LYVE-1 is still a commonly used marker today to distinguish LECs from other endothelial cells. The goal of this procedure was to isolate LECs from developing mouse embryos with a positive selection approach using dynabeads conjugated to LYVE-1 antibody.
Materials and Reagents
Pipettes tips (Eppendorf, catalog numbers: 022491105 , 022491113 , 022491121 , 022491164 )
Microcentrifuge tube (Fisher Scientific, catalog number: 05-408-130 )
12-well cell culture plate (Greiner Bio One International, catalog number: 665102 )
40 μm strainer (Corning, Falcon® , catalog number: 352340 )
Microcentrifuge tube magnet (New England Biolabs, catalog number: S1509S )
Dynabeads: Sheep anti-rat IgG (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11035 )
LYVE-1 antibody, 0.5 mg/ml (R&D Systems, catalog number: AF2125 )
Trizol solution (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15596018 )
RNA Prep Kit (QIAGEN, catalog number: 74106 )
Bovine serum albumin (Rockland Immunochemicals, catalog number: BSA-50 )
PBS w/o Ca2+ and Mg2+ (Merck, Omnipur®, catalog number: 6505-OP )
Collagenase (Sigma-Aldrich, catalog number: 10103578001 )
Dispase (Sigma-Aldrich, catalog number: D4693-1G )
DNase (Thermo Fisher Scientific, AmbionTM, catalog number: AM2224 )
HBSS (Thermo Fisher Scientific, GibcoTM, catalog number: 14175095 )
Ammonium Chloride (NH4Cl) (Merck, Calbiochem, catalog number: 168320 )
Sodium Bicarbonate (NaHCO3) (Merck, catalog number: SX0320-1 )
Na2EDTA (EDTA disodium) (VWR, catalog number: 97061-022 )
Molecular grade water (Sigma-Aldrich, catalog number: W4502-1L )
PBS/BSA Solution (see Recipes)
Enzyme Solution (see Recipes)
RBC Lysis Buffer Solution (see Recipes)
Equipment
Incubator (Fisher Scientific)
Centrifuge (Eppendorf, model: 5415 R )
NanoDropTM 2000 Spectrophotometers (Thermo Fisher Scientific, model: NanoDropTM 2000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Crosswhite, P. (2018). Isolation of LYVE-1+ Endothelial Cells from Mouse Embryos. Bio-protocol 8(15): e2962. DOI: 10.21769/BioProtoc.2962.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Lymphangiogenesis
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,963 | https://bio-protocol.org/exchange/protocoldetail?id=2963&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Combinations of Patch-Clamp and Confocal Calcium Imaging in Acutely Isolated Adult Mouse Amygdala Brain Slices
Erin E. Koffman
Jianyang Du
Published: Aug 5, 2018
DOI: 10.21769/BioProtoc.2963 Views: 6961
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
Calcium imaging is a powerful technique in the study of neuronal physiology, as it avoids the enzyme treatment on neurons and is able to study the neuronal activities in vivo. Using calcium-imaging techniques, we are able to monitor the elevation of calcium in the neuron. Furthermore, we can combine calcium imaging with other methods, like whole-cell patch clamp recordings, to detect a single cell calcium signal in brain slices. In this protocol, we describe a detailed confocal imaging method that is combined with whole-cell patch clamp configuration using brain slices (Du et al., 2017).
Keywords: Confocal Calcium imaging Brain slices Whole-cell patch-clamp Amygdala
Background
Brain slices have been used successfully to study synapses, neurons, and neural circuits for decades. Many experimental manipulations have been applied to the brain slice model, such as drug applications, intracellular recordings, and optical imaging. Compared to cultured neurons, brain slices preserve many of the essential functional properties of neuronal circuits. Calcium imaging is a widely used technique designed to indicate the intracellular calcium (Ca2+) status of isolated cells and tissues. Studying intracellular calcium in brain tissue gives insight to a variety of physiological processes such as cell proliferation, signal transduction, synaptic plasticity, and cell death as calcium concentration plays a key role in each of these functions (Cameron et al., 2016). A calcium indicator is a fluorescent molecule that binds to Ca2+ ions to change their fluorescence light spectrum. Two classic types of calcium indicators are widely used: chemical indicators (calcium dyes) and genetically encoded calcium indicators (GECIs). In this study, we use the typical calcium dyes to measure the calcium signal of a single neuron in brain slices. This technique has allowed our lab to study neuronal activity as well as calcium signaling in a wide variety of cell types. We describe techniques of live brain-slice calcium imaging used in our laboratory, and detail experimental protocols and know-how acquired over the years for preparing brain slices, loading neurons with dyes through patch-clamp, confocal imaging, and image processing and analysis (Du et al., 2017). The implementation of these techniques has been a powerful tool for our studies, and has allowed us to add to the vast amount of research surrounding neuronal calcium signaling.
Materials and Reagents
Pipette tips (USA Scientific, catalog numbers: 1112-1820 ; 1110-1800 ; 1111-3840 )
Single edge razor blade (Fisher Scientific, catalog number: 12-640 )
Patch-clamp grass pipette (Sutter Instrument, catalog number: BF100-58-10 )
C57BL/6J male mice, age 9-12 weeks (THE JACKSON LABORATORY, catalog number: 000664 )
Note: Mice are group housed before and during the experiment.
Oregon GreenTM 488 BAPTA-6F, Hexapotassium Salt, cell impermeant (Thermo Fisher Scientific, catalog number: O23990 )
Note: Aliquots should be stored at -20 °C.
Isoflurane (Henry Schein Animal Health, catalog number: 029404 )
95% Oxygen and 5% CO2 cylinder (Airgas, catalog number: X02OX95C2003102 )
Sucrose (Fisher Scientific, catalog number: BP220-1 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: P217-500 )
Sodium phosphate monobasic (NaH2PO4) (Acros Organics, catalog number: 447760010 )
Magnesium sulfate (MgSO4) (Acros Organics, catalog number: 124900010 )
Sodium bicarbonate (NaHCO3) (Fisher Scientific, catalog number: S233-500 )
Calcium chloride (CaCl2) (Fisher Scientific, catalog number: C79-500 )
Glucose (Fisher Scientific, catalog number: BP350-1 )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S271-1 )
Magnesium chloride (MgCl2) (Fisher Scientific, catalog number: M33-500 )
Potassium methanesulfonate (KSO3CH3) (Sigma-Aldrich, catalog number: 83000 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Adenosine 5'-triphosphate magnesium salt (MgATP) (Sigma-Aldrich, catalog number: A9187 )
Guanosine 5'-triphosphate sodium salt hydrate (Na3GTP) (Sigma-Aldrich, catalog number: G8877 )
Phosphocreatine (Sigma-Aldrich, catalog number: P1937 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 417661 )
High sucrose dissection solution (see Recipes)
Normal artificial cerebrospinal fluid (ACSF) (see Recipes)
Patch-clamp pipette solution (see Recipes)
Equipment
Blunt-ended scissors (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 78702 )
Blunt-ended forceps (Fisher Scientific, catalog number: 13-812-39 )
Iridectomy scissors (Sklar Surgical Instruments, catalog number: 64-2035 )
Point-ended scissors (Fisher Scientific, catalog number: 13-808-2 )
Hemostats Rankin forceps (Fisher Scientific, catalog number: 13-812-45 )
Metal spatula (Fisher Scientific, catalog number: 14-374 )
Vibrating blade microtome (Leica Biosystems, model: Leica VT1000 S )
Pipettes, single channel, 0.2 µl-1 ml (Gilson, model: PIPETMAN® Classic )
Confocal microscope (Nikon Instruments, model: Eclipse FN1 )
4 °C refrigerator (Whirlpool, model: WRR56X18FW )
MultiClamp 700B Amplifier (Molecular Devices, model: MultiClampTM 700B )
Digidata 1550B plus HumSilencer (Molecular devices, model: Digidata® 1550B )
P-97 Micropipette Puller (Sutter Instrument, model: P-97 )
Software
pCLAMP 10 Software Suite (Molecular devices)
NIS-Elements Confocal (Nikon instruments)
Procedure
Note: Animal care and procedures met National Institutes of Health standards. Local animal care ethical standards must be adhered to. The University of Iowa Animal Care and Use Committee (ACURF #4041016) and the University of Toledo Institutional Animal Care and Use Committee (Protocol #108791) approved all procedures.
C57BL/6J mouse
The 4 weeks old C57BL/6J mice are originally ordered from Jackson laboratory (Stock No. 000664). The mice are housed and bred in the animal facilities at the University of Toledo. Mice are maintained on a standard 12-h light-dark cycle and received standard chow and water ad libitum. Animal care and procedures met National Institutes of Health standards. The University of Iowa Animal Care and Use Committee (ACURF #4041016) and University of Toledo Institutional Animal Care and Use Committee (Protocol #108791) approved all procedures. Experimental groups are male mice matched for age (ranging from 9 to 12 weeks) and assigned randomly to experimental groups.
Whole-cell patch clamp and confocal calcium imaging
Anesthetize a 9-12 weeks old mouse with over-dose isoflurane. Pour 5 ml isoflurane into a sealed glass desiccator followed by putting in a mouse. Decapitate after the mouse lacks eyelash and limb reflections.
Dissect the brain and rinse in the pre-oxygenated (5% CO2 and 95% O2) ice-cold high sucrose dissection solution (see Recipes) for 5 min. Then glue the brain on the plate of the sample chamber of the Leica Vibrating blade microtome (Figure 1). One brain is sufficient for one-day experiment.
Figure 1. Schematic of the procedure of the brain slicing using vibratome. A. The brain is dissected and rinsed in the pre-oxygenated (5% CO2 and 95% O2) ice-cold high sucrose dissection solution. B. The cerebellum is removed and the cerebrum will be glued to the vibratome. C. Vibratome slice the brain coronally into 300 µm sections. D. Slices are incubated in normal pre-oxygenated ACSF.
Vibratome slice brains coronally into 300 µm sections in the pre-oxygenated (5% CO2 and 95% O2) ice-cold high sucrose dissection solution.
Incubate slices in normal artificial cerebrospinal fluid (ACSF) at room temperature (22-25 °C) for at least 1 h before recording (see Recipes).
For experiments, transfer individual slices to a submersion-recording chamber and continuously perfuse with the 5% CO2/95% O2 ACSF (~3.0 ml/min) at 22-25 °C (Figure 2).
Figure 2. Schematic of the Ca2+ imaging perfusion and recording system
Observe the slices under an upright confocal microscope (Nikon Eclipse FN1). The slices containing the amygdala is identified according to The Mouse Brain in Stereotaxic Coordinates: second edition (Paxinos and Franklin, 2003).
Dissolve Oregon Green 488 BAPTA-6F (100 μM) in the patch-clamp pipette solution (see Recipes).
Use the Sutter P-97 micropipette puller to make the patch-clamp pipette. The pipette resistance (measured in the bath solution) is 3-5 MΩ. Before moving into the brain slice, a holding positive pressure (~0.1 ml suction through a 1 ml syringe) is given to the pipette. Once the pipette tip attaches to the cell membrane, the positive pressure is released followed by a transient negative suction through the pipette. High-resistance (> 1 GΩ) seals are formed in voltage-clamp mode.
Then hold the membrane potential at -80 mV. With the high-resistance seals, an additional transient negative suction is given to break the cell membrane. Whole-cell patch-clamp configuration is made from pyramidal neurons in the lateral amygdala.
After obtaining the whole-cell configuration, wait 15-20 min for the intracellular diffusion of the Oregon Green.
Cells are then switched from voltage-clamp mode to current-clamp mode for Ca2+ imaging.
Perform imaging using a high-speed confocal laser scanning microscope NIKON Eclipse FN1 with a long-working distance water-immersion objective (25x; NA 1.1). NIS-Elements Confocal software is used to capture signals and data analysis.
Intracellular calcium signals in dendrites near the soma of pyramidal neurons in the lateral amygdala are evoked by electrical stimulation at cortical inputs with a series of frequencies (20 Hz, 50 Hz and 100 Hz for 1 sec) (Figure 3).
Figure 3. Postsynaptic [Ca2+]i recording in the amygdala slices. A-B. Schematic for measuring changes in postsynaptic [Ca2+]i. Brain slices are prepared, cortical input stimulation is identified, and lateral amygdala pyramidal neurons are loaded with the fluorescent Ca2+ indicator Oregon Green 488 BAPTA-6F (100 µM) via a patch pipet. Changes in postsynaptic [Ca2+]i induced by presynaptic stimulation at 20, 50, and 100 Hz are assayed when the ACSF is saturated with 5% CO2 (pH 7.35). C. Example of loading of Oregon Green 488 BAPTA-6F via a patch pipet in the amygdala neurons. D. Representatives of changes in [Ca2+]i signal with stimulation of lateral amygdala neurons.
Detect fluorescence signals at one frame/10-50 msec.
Analyze the real-time calcium imaging data using NIS-Elements Confocal software (Figure 3).
Data analysis
Relative changes in fluorescence are calculated and normalized to baseline measurements as ∆F/F0, where F0 is the fluorescence intensity before stimulation and ∆F is the change in fluorescence during presynaptic stimulation.
Recipes
High sucrose dissection solution (pH 7.30 at 22-25 °C)
205 mM sucrose
5 mM KCl
1.25 mM NaH2PO4
5 mM MgSO4
26 mM NaHCO3
1 mM CaCl2
25 mM glucose bubbled with 95% O2/5% CO2
Normal artificial cerebrospinal fluid (ACSF) (pH 7.35 at 22-25 °C )
115 mM NaCl
2.5 mM KCl
2 mM CaCl2
1 mM MgCl2
1.25 mM NaH2PO4
11 mM glucose
25 mM NaHCO3 bubbled with 95% O2/5% CO2
Patch-clamp pipette solution
135 mM KSO3CH3
5 mM KCl
10 mM HEPES
4 mM MgATP
0.3 mM Na3GTP
10 mM phosphocreatine (mOsm = 290)
Adjust pH to 7.25 with KOH
Acknowledgments
We thank Thomas Moninger, Theresa Mayhew, and Sarah Horgen for assistance. JD is supported by the American Heart Association (15SDG25700054) and the National Institutes of Mental Health (R01MH113986). The authors declare that there are no conflicts of interest or competing interests.
References
Cameron, M., Kekesi, O., Morley, J. W., Tapson, J., Breen, P. P., van Schaik, A. and Buskila, Y. (2016). Calcium imaging of AM dyes following prolonged incubation in acute neuronal tissue. PLoS One 11(5): e0155468.
Du, J., Price, M. P., Taugher, R. J., Grigsby, D., Ash, J. J., Stark, A. C., Hossain Saad, M. Z., Singh, K., Mandal, J., Wemmie, J. A. and Welsh, M. J. (2017). Transient acidosis while retrieving a fear-related memory enhances its lability. Elife 6: e22564.
Paxinos, G. and Franklin, K. B. J. (2003). The mouse brain in stereotaxic coordinates. 2nd edition. Academic Press.
Copyright: Koffman and Du. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
Category
Cell Biology > Cell imaging > Confocal microscopy
Neuroscience > Cellular mechanisms > Intracellular signalling
Cell Biology > Cell signaling > Second messenger
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,964 | https://bio-protocol.org/exchange/protocoldetail?id=2964&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fusarium graminearum Inoculation on Wheat Head
CF Chanjing Feng
HL Huiquan Liu
ZT Zhe Tang
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2964 Views: 7542
Edited by: Feng Li
Reviewed by: Rosario Gomez-Garcia
Original Research Article:
The authors used this protocol in Jun 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2015
Abstract
Fusarium graminearum, the major causal agent of Fusarium head blight (FHB), causes serious wheat yield losses and a threat to human and animal health. The main efforts to combat the disease are the research of pathogenesis mechanisms and breeding for disease resistance plants. The efficiency of these actions could be evaluated by reliable inoculation assay, which is performed by accurate and repeatable inoculation methods. Hence, a standard procedure of effective wheat inoculation should improve the accuracy of pathogenicity evaluation. Here, we present a protocol for wheat spike inoculation with fungal conidial suspensions or fungus agar discs. These methods show highly reproducibility and accuracy on wheat infection experiment in laboratory conditions.
Keywords: Fusarium graminearum Wheat Inoculation method Pathogenesis Resistance
Background
Fusarium graminearum is a destructing fungal pathogen which causes globally serious Fusarium head blight (FHB) disease on cereal crops. In recent years, the incidence of FHB increased with the global climate change and changes in farming practices. Additionally, F. graminearum produces several mycotoxins including trichothecene mycotoxin deoxynivalenol (DON), which threatens the health of humans and animals (Tanaka et al., 1988; Windels, 2000; Su et al., 2018). Up to date, the most effective tools to control FHB are derived from the studies on pathogenic mechanisms and breeding for disease resistant plant (Steiner et al., 2009; Son et al., 2013).
Because lack of the pathogen-specialized patterns that typically induce gene-for-gene-mediated resistance in the host (van Eeuwijk et al., 1995), the infection and spreading of F. graminearum are easily influenced by the environment. The study of pathogenesis mechanisms could be accelerated by analyzing of the F. graminearum pathogenicity. It is necessary to make a standard and an effective protocol of inoculation which is repeatable and accurate. One of the most important method to prevent FHB is breeding for resistant plants. Numerous studies have shown that inheritance of resistance of wheat to FHB is of a quantitative nature. Therefore, the major task of research FHB resistance is to map the quantitative trait loci (QTLs) region, and a large number of QTLs were described by genetic mapping in diverse wheat germplasm (Buerstmayr et al., 2009; Dhariwal et al., 2018). To verify the functions in QTLs region, an effective inoculation protocol is indispensable. However, the traditional wheat inoculation method for resistance identification is using the conidial suspension to widely sprinkle on the wheat surface instead of inoculation in the specific position of wheat in the field. This inoculation method is constrained by many factors, such as lower accuracy or stability, and sensitivity to environment (Fernando et al., 1997; Francl et al., 1999). The objectives of this protocol are to introduce a method of F. graminearum inoculation, which is standard, effective and repeatable on wheat in a growth chamber. It could help to improve the analysis accuracy and reduce the costs to some extent. In brief, the method can lay a foundation for the research of FHB pathogenesis and resistant breeding.
Materials and Reagents
20 μl pipette tips
Centrifuge tube, 50 ml
Petri dish, round (60 mm x 15 mm)
Pots (25 cm in diameter)
Grey cinnamon soil (obtained from wheat field of Yangling)
20 cm x 30 cm Plastic bag (Tuopu Daily Chemicals Company, Miaojie, catalog number: MBRL-A )
Hole puncher (diameter: 2 mm)
Miracloth (Merck, catalog number: 475855-1R )
Round toothpick (yekee, catalog number: Y-9892 )
Flowering stage Wheat (Triticum aestivum) cultivar of the Xiaoyan 22 (available upon request)
F. graminearum wildtype strain PH-1 (NRRL 31084) (available upon request, Cuomo et al., 2007)
Pathogenicity defective mutant Fgkin1 (Luo et al., 2014)
Urea (GB 2004-2001) (Shaanxi Coal Chemical Corporation, Huashan)
Carboxymethylcellulose sodium salt (Sigma-Aldrich, catalog number: C5678-500G )
Ammonium nitrate (NH4NO3) (Spectrum Chemical Manufacturing, catalog number: YY975 )
Mono potassium phosphate (KH2PO4) (Guangdong Guanghua Sci-Tech, catalog number: 1.01863.020 )
Magnesium sulfate heptahydrate (MgSO4•7H2O) (Guangdong Guanghua Sci-Tech, catalog number: 1.03107.010 )
Yeast Extract (Oxoid, catalog number: LP0021 )
Potato dextrose agar medium (Beijing Aoboxing Bio-tech, Aobox®, catalog number: 02-023 )
Carboxymethylcellulose liquid medium (CMC) (see Recipes; Cappellini and Peterson, 1965)
PDA liquid medium (see Recipes; Booth, 1971)
Equipment
Pipettes (Gilson, 20 μl)
Hemocytometer (0.1 mm, 1/400 mm2) (QIUJING, model: XB-K-25 )
Artificial climate growth chamber (Controlling temperature and humidity) (Percival Scientific, model: E-36HO )
Centrifuge (Bench-top high speed centrifuge, Xiangyi, model: L530 )
Shaker (Shaker-for flasks, Peiying, model: THC-C-1 )
Microscope (Olympus, model: CX41RF )
Camera (Nikon, model: D3000 )
Software
SAS (Statistics Analysis System, ver. 9.2) or R (ver. R-3.5.0)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Feng, C., Liu, H. and Tang, Z. (2018). Fusarium graminearum Inoculation on Wheat Head. Bio-protocol 8(15): e2964. DOI: 10.21769/BioProtoc.2964.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Fungus
Plant Science > Plant immunity > Disease bioassay
Molecular Biology > DNA > DNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,965 | https://bio-protocol.org/exchange/protocoldetail?id=2965&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is a correction notice. See the corrected protocol.
Peer-reviewed
Correction Notice: Cytology and Microscopy: Immunolocalization of Covalently Modified Histone Marks on Barley Mitotic Chromosomes
Isabelle Colas
Katie Baker
Andrew J. Flavell
Published: Jul 20, 2018
DOI: 10.21769/BioProtoc.2965 Views: 2917
Reviewed by: Marisa Rosa
Ask a question
How to cite
Favorite
Cited by
I published the following article in 2016 (https://bio-protocol.org/e1841) and I submitted it as an output for our ERC grant which had just only started when we publish this work.
Unfortunately, they pointed out that I forgot to add the project in the acknowledgment and they had requested that we amend this part as follow:
We gratefully acknowledge the financial support from the grant BBSRC BB/I1022899/1 “The diversity and evolution of the gene component of the barley pericentromeric heterochromatin”, the European Community Grant FP7 MeioSys (222883), ERC project 669182 ‘SHUFFLE’ and the Scottish Government through RESAS work programme (WP5.2).
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Colas, I., Baker, K. and Flavell, A. J. (2018). Correction Notice: Cytology and Microscopy: Immunolocalization of Covalently Modified Histone Marks on Barley Mitotic Chromosomes. Bio-protocol 8(14): e2965. DOI: 10.21769/BioProtoc.2965.
Download Citation in RIS Format
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,966 | https://bio-protocol.org/exchange/protocoldetail?id=2966&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Storage (Starch/Glycogen) and Total Saccharides Content in Algae and Cyanobacteria by a Phenol-Sulfuric Acid Method
Tomáš Zavřel
PO Petra Očenášová
Maria A. Sinetova
Jan Červený
Published: Vol 8, Iss 15, Aug 5, 2018
DOI: 10.21769/BioProtoc.2966 Views: 10627
Edited by: Renate Weizbauer
Reviewed by: Manish Kumar PatelDušan Veličković
Original Research Article:
The authors used this protocol in Dec 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2017
Abstract
This is a protocol for quantitative determination of storage and total carbohydrates in algae and cyanobacteria. The protocol is simple, fast and sensitive and it requires only few standard chemicals. Great advantage of this protocol is that both storage and total saccharides can be determined in the cellular pellets that were already used for chlorophyll and carotenoids quantification. Since it is recommended to perform the pigments measurement in triplicates, each pigment analysis can generate samples for both total saccharide and glycogen/starch content quantification.
The protocol was applied for quantification of both storage and total carbohydrates in cyanobacteria Synechocystis sp. PCC 6803, Cyanothece sp. ATCC 51142 and Cyanobacterium sp. IPPAS B-1200. It was also applied for estimation of storage polysaccharides in Galdieria (IPPAS P-500, IPPAS P-507, IPPAS P-508, IPPAS P-513), Cyanidium caldarium IPPAS P-510, in green algae Chlorella sp. IPPAS C-1 and C-1210, Parachlorella kessleri IPPAS C-9, Nannochloris sp. C-1509, Coelastrella sp. IPPAS H-626, Haematococcus sp. IPPAS H-629 and H-239, and in Eustigmatos sp. IPPAS H-242 and IPPAS C-70.
Keywords: Sugars Carbohydrates Polysaccharides Colorimetry Spectrophotometry Synechocystis Chlorella Haematococcus
Background
Carbohydrates play a number of roles in the metabolism of algae and cyanobacteria. As nicely summarized by Raven and Beardall (Raven and Beardall, 2003), carbohydrates represent major sink of intermediates in carbon reduction/oxidation pathways (photosynthesis and photorespiration), they provide skeletons required for growth (e.g., for amino-acid or cell wall biosynthesis), they represent sources of ATP and reducing equivalents (through respiration pathways), they serve as compatible solutes, they are essential for maintaining cellular turgor (by securing rigid structure of the cell wall) and they can scavenge free radicals. Storage polysaccharides (of which the main forms in algae and cyanobacteria are starch and glycogen) that serve as both energy and carbon source, buffer the disproportion between the carbohydrates production and consumption rates, and allow for active metabolism (e.g., nitrogen fixation) in the dark periods.
Carbohydrates are routinely analyzed in many life science laboratories. The saccharides content can be quantified by a wide range of chemical (e.g., chromatographic), biochemical (e.g. gravimetric, colorimetric, enzymatic) or physical (e.g., polarimetry) methods. The estimation of storage carbohydrates as described in this protocol represents a combination of starch/glycogen purification according to the previous studies (Schneegurt et al., 1994; Bandyopadhyay et al., 2010; Sinetova et al., 2012), starch/glycogen decomposition in acidic environment and free glucose determination by the classical phenol-sulfuric acid method (Dubois et al., 1956; Masuko et al., 2005). Total carbohydrates estimation consists of simple resuspension of the cellular pellet (after extraction of chlorophyll and carotenoids) in phenol solution and hydrolyzation of cellular saccharides by sulfuric acid.
The advantages of this protocol are simplicity, sensitivity and quickness. The carbohydrates/glycogen/starch estimation requires only several standard reagents, which makes this protocol much simpler and cheaper when compared to protocols that include enzymatic cleavage of glycogen (De Porcellinis et al., 2017; Khan et al., 2018), enzymatic determination of free glucose (Bandyopadhyay et al., 2010; Sinetova et al., 2012; Khan et al., 2018) or extensive amounts of chemicals (Khan et al., 2018). Another advantage of this protocol is that only 1 ml of diluted culture suspension is needed for the analysis (for further details see Note 1) which is significantly lower amount than required in other protocols (De Porcellinis et al., 2017). Additionally, saccharides/glycogen/starch measurement can be performed on the same samples that were originally used for determination of chlorophyll and carotenoids content (Sinetova et al., 2012).
On the other hand, this protocol is not as specific for determination of storage polysaccharides as the enzymatic assays (De Porcellinis et al., 2017) since glycogen or starch are distinguished only partially from other cellular polysaccharides (e.g., from polysaccharides of the cell wall). Another limitation is using D-glucose as a calibration standard since various carbohydrates that are present in the cells differ in the absorption spectra (Dubois et al., 1956; Masuko et al., 2005). Nevertheless, even with these limitations, this cheap, simple and fast protocol is suitable for rough estimation of carbohydrates content in algae and cyanobacteria.
Materials and Reagents
Safe-lock tubes 1.5 ml SafeSeal (SARSTEDT, catalog number: 72.706.400 )
Rotilabo® Sealing clips for the safe-lock tubes tubes (Carl Roth, catalog number: N217.1 )
Holders for the safe-lock tubes (VWR, catalog number: 30128-282 )
96-well microplates (type P) with the original lids (Cole-Parmer, catalog numbers: EW-07903-80 and EW-07903-86 )
Pipette tips
Standard tips: 20-200 μl, 100-1,000 μl (Mettler-Toledo International, catalog numbers: 17001118 and 17001129 )
Tips with filters: 20-200 μl (Mettler-Toledo International, catalog number: 17014963 )
Reservoir for a multichannel pipette 60 ml (BrandTech Scientific, catalog number: 703459 )
Aluminum foil (optional)
Cyanobacterial/algae culture
Methanol ≥ 99.9% (Alfa Aesar, catalog number: 41467.K7 )
Phenol (Sigma-Aldrich, catalog number: P1037 )
Potassium hydroxide p.a. (Ing. Petr Švec - PENTA, catalog number: 15520-31000 )
Ethanol 96% (Merck, catalog number: 1590102500 )
Sulfuric acid 96% (Ing. Petr Švec - PENTA, catalog number: 20370-11000 )
D-glucose (Sigma-Aldrich, catalog number: G8270 )
Distilled/double deionized water
Sodium hydroxide (Ing. Petr Švec - PENTA, catalog number: 15760-31000 )
Hydrochloric acid (Ing. Petr Švec - PENTA, catalog number: 19360-11000 )
Glucose calibration series (see Recipes)
Equipment
Pipettes
20-200 μl (Mettler-Toledo International, catalog number: 17014391 )
100-1,000 μl (Mettler-Toledo International, catalog number: 17014382 )
Multichannel pipette 20-200 μl (Mettler-Toledo International, catalog number: 17013805 )
Fridge 4 °C, freezer -20 °C (LIEBHERR, model: LCexv 4010 , catalog number: 9005382197172), optionally -80 °C (RevcoTM ExF -86 °C Upright Ultra-Low Temperature Freezer, Thermo Fisher Scientific, catalog number: EXF24086V )
Fume hood (MERCI, model: M 1500 , catalog number: 2D100110200001)
Refrigerated centrifuge (Sigma Laborzentrifugen, model: Sigma 1-16K , catalog number: 10030)
Vacuum Concentrator (Eppendorf, model: Concentrator plus , catalog number: 5305000100)
Analytical balances with an accuracy of 10 μg (Sartorius, catalog number: SECURA225D-1OBR )
Microplate spectrophotometer (Thermo Fisher Scientific, model: MultiskanTM GO , catalog number: 51119300)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zavřel, T., Očenášová, P., Sinetova, M. A. and Červený, J. (2018). Determination of Storage (Starch/Glycogen) and Total Saccharides Content in Algae and Cyanobacteria by a Phenol-Sulfuric Acid Method. Bio-protocol 8(15): e2966. DOI: 10.21769/BioProtoc.2966.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Carbohydrate
Plant Science > Phycology > Cell analysis
Biochemistry > Carbohydrate > Glycogen
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
This protocol works for plant cell walls?
1 Answer
18 Views
Feb 7, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,967 | https://bio-protocol.org/exchange/protocoldetail?id=2967&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Inexpensive and Comprehensive Method to Examine and Quantify Field Insect Community Influenced by Host Plant Olfactory Cues
Rupesh Kariyat
JC Jesus Chavana
JK Jasleen Kaur
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2967 Views: 5234
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
Insect pollinators, herbivores and their natural enemies use olfactory cues emitted by their host plants to locate them. In insect-plant ecology, understanding the mechanisms underlying these interactions are of critical importance, as this bio-communication has both ecological and agricultural applications. However, the first step in such research is to identify and quantify the insect community associated with the plant/s species of interest. Traditionally, this has been accomplished by a variety of insect trapping methods, either using pitfall traps, or sticky traps, or sweep nets in field. The data collected from these traps tend to be incomplete, and also damage the specimens, making them unusable for any taxonomic purposes. This protocol derives ideas from these traditional traps and use a combination of three easily made inexpensive modified traps that conceals the host plant, but allows the plant volatiles to pass through as olfactory cues. These traps are economical, can be made to fit with most plant sizes, and are also reusable. Collectively, these traps will provide a solid estimate (quantifiable) of all associated community of arthropods that can also be stored for future studies.
Keywords: Herbivores Plant volatiles Traps Insect community Olfaction
Background
To defend against the wide range of herbivorous insects that feed on them, plants have evolved a wide range of defenses that include direct and indirect defenses (Howe and Jander, 2008; Kariyat et al., 2012 and 2013). Among these, plant volatiles are a major group that falls under indirect defenses. Plant volatiles are low molecular weight high vapor pressure organic secondary metabolites emitted by plants as part of their normal metabolic activities (Pare and Tumlinson, 1999). However, when herbivores feed on them, they alter their volatile emission by varying it both qualitatively (number of compounds emitted) and quantitatively (amount and ratio of each compound in the blend) (Pare and Tumlinson, 1999; Kariyat et al., 2012). This altered volatile bouquet is also known as herbivore-induced plant volatiles (HIPV). HIPV are the major olfactory cues that the natural enemies (predators and parasitoids) of these herbivores use as signals to find their host–the herbivores (Kariyat et al., 2012), thereby indirectly improving host plant fitness. In addition, undamaged plants also emit volatile organic compounds that are used as cues by herbivores to locate their host plant for both feeding and oviposition (Kariyat et al., 2013 and 2014). A critical component of such insect-plant interaction studies involving plant volatiles is to examine and quantify the community of insects (herbivores, predators, pollinators, and other natural enemies) that gets attracted to their hosts under field conditions (Kariyat et al., 2012). Traditionally, such studies have employed one or a combination of insect traps such as commercial sticky traps, pheromone traps, and light traps to name a few. However, most of these traps have visual aid that interferes with olfactory cues. This can affect understanding the role of olfactory cues, and in many cases, the traps only collect only a subset of the actual insect community associated with the host.
This protocol provides detailed instructions to use inexpensive and easily available materials to build a combination of three traps-which when combined will carry out comprehensive trapping of the majority of insects associated with the hosts (Kariyat et al., 2012). These traps can easily be assembled and disassembled, and are also reusable. The basic methodology involves building a cage from hardwire cloth which encloses the host plant/s of interest, two pitfall traps made of plastic cups, and a pan trap made of aluminum that fits on top of the cage. Combined, these traps will collect insects flying above and at the canopy level, and insects that either crawl or are soil dwellers.
Materials and Reagents
Hardwire cloth, 0.635 cm mesh size, 0.61 x 3.05 m (Lowe’s, Blue Hawk, catalog number: 492388 , model: 840147)
Zip ties, 28 cm, White,100 Ct (Lowe’s, UtilitechTM, catalog number: 76025 , model: SGY-CT18)
Aluminum pie pans, 22.2 cm dia. x 2.9 cm (Handi-Foil, catalog number: 20305E-3 )
Plastic cups, 9 oz, Clear (Solo, Walmart, 554949033)
Woodenskewers/dowels, 4.76 mm dia., length 30.5 cm (Walmart, 554544726)
White Bridal veil fabric, 0.22 m x 0.18 m, mesh size: 1 mm2 (Hobby Lobby, catalog number: 852640 )
A4 size white paper (Staples, catalog number: 135855 , model: 135855 / 135855 WH)
A4 size acetate sheets (Staples, catalog number: APOCG7031S , model: CG7031S)
Glass vials 40.7ml (Fisher Scientific, catalog number: 03-338L )
Distilled water
Odorless tangle foot sticky glue (Tangle-Trap® Sticky Coating) (TANGLEFOOT, catalog number: 300000676 , Part No. LB8249)
Micro 90 odorless detergent (Micro-90) (Cole-Parmer, catalog number: SK-18100-05 )
80% ethanol (Sigma-Aldrich, catalog number: 793191-4X1GA-PB )
Equipment
Scissors
Hardwire cloth wire cutter, Fatmax 5.08 cm 60 CrV snips (Stanley Black & Decker, catalog number: FMHT73563 )
4 °C refrigerator
Microscope
Software
Minitab v. 14
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kariyat, R., Chavana, J. and Kaur, J. (2018). An Inexpensive and Comprehensive Method to Examine and Quantify Field Insect Community Influenced by Host Plant Olfactory Cues. Bio-protocol 8(16): e2967. DOI: 10.21769/BioProtoc.2967.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Environmental science > Plant > Plant-insect interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,968 | https://bio-protocol.org/exchange/protocoldetail?id=2968&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Human Mesenchymal Stem Cell 3D Spheroids Using Low-binding Plates
Elena Redondo-Castro
Catriona J Cunningham
Jonjo Miller
Stuart A Cain
SA Stuart M Allan
Emmanuel Pinteaux
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2968 Views: 8400
Edited by: Giusy Tornillo
Reviewed by: Alak MannaSurabhi Sonam
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
The 3D culture of human mesenchymal stem cells (hMSCs) represents a more physiological environment than classical 2D culture and has been used to enhance the MSC secretome or extend cell survival after transplantation. Here we describe a simple and affordable method to generate 3D spheroids of hMSCs by seeding them at high density in a low-binding 96-well plate.
Spheroids of hMSCs cultured in low-binding 96-well plates can be used to study the basic biology of the cells and to generate conditioned media or spheroids to be used in transplantation therapeutic approaches. These MSCs or their secretome can be used as a regenerative therapy and for tissue repair across multiple disease areas, including neurodegeneration.
In comparison to other methods (hanging drop, use of gels or biomaterials, magnetic levitation, etc.), the method described here is simple and affordable with no need to use specialized equipment, expensive materials or complex reagents.
Keywords: Low-binding plate Spheroid 3D culture Human mesenchymal stem cells High density
Background
Mesenchymal stem cells (MSCs) are an attractive candidate for the development of novel regenerative therapies for diseases such as stroke or amyotrophic lateral sclerosis (Chen et al., 2001; Bang et al., 2005; Boido et al., 2014). Their versatility makes the optimization and standardization of techniques essential to ensure MSC therapies can provide as much benefit as possible. One possible way to maximize the therapeutic potential (e.g., enhanced secretion of anti-inflammatory mediators) of MSCs is to culture them in 3D (Bartosh et al., 2010). Cells do not normally grow in monolayers in physiological conditions, therefore culturing them in 3D provides a more realistic environment, and increases secretion of certain factors such as vascular endothelial growth factor (VEGF) or granulocyte-colony stimulating factor (GCSF), amongst others (Caplan and Correa, 2011; Redondo-Castro et al., 2018). Some of these factors exert beneficial actions leading to an enhanced repair response (Torres-Espín et al., 2013; Kalladka and Muir, 2014) and by modulating the inflammatory component (Bernardo and Fibbe, 2013; Mathew et al., 2017).
Several methods have been developed to generate spheroids including magnetic levitation (Haisler et al., 2013); nanoparticles (Daquinag et al., 2013), hanging drop techniques (Bartosh et al., 2010; Murphy et al., 2014), suspension methods (Carpenedo et al., 2007) and hydrogels (Laschke et al., 2013; Tseng et al., 2017). Some of these methods, despite being effective, are time consuming or expensive as they require complex reagents or equipment (Cha et al., 2017). For this reason, we have been culturing spheroids using a very simple method (Redondo-Castro et al., 2018) that only requires a low-binding 96-well plate combined with a high-density suspension of cells.
With this method, we are able to obtain mature spheroids in a few days, with a very high rate of efficiency and reproducibility. Moreover, phenotypic characterization of spheroids shows that this method could be really useful for researchers developing cell therapies (either cell suspensions for transplants or generating cell-derived products such as conditioned media), as well as in other research fields.
Materials and Reagents
Cell culture plasticware
T75 and/or T25 flasks (Corning, catalog numbers: 430641U for T75 and 3056 for T25)
Plates low cell binding, 96 wells, round bottom (Thermo Fisher Scientific, NuncTM, catalog number: 145399 )
Centrifuge tubes (15 ml; 50 ml, Corning, catalog numbers: 430790 ; 430828 )
Cryovials (STARLAB, catalog number: E3110-6122 )
Plastic stripettes (5 ml; 10 ml; 25 ml, Corning, Costar®, catalog numbers: 4487 ; 4488 ; 4489 )
Pipette tips (TipOne, STARLAB, catalog numbers: S1111-3700 ; S1111-1706 ; S1111-6701 )
Non-adherent microfuge tubes (Eppendorf, catalog number: 0030108116 )
Reagents
DMEM low glucose (Sigma-Aldrich, catalog number: D6046 )
Fetal bovine serum (FBS, Thermo Fisher Scientific, GibcoTM, catalog number: 10500064 )
Gelatin, Analar (BDH, catalog number: 440454B )
L-Glutamine, 200 mM (Sigma-Aldrich, catalog number: G7513 )
MesenPRO RSTM Medium (Thermo Fisher Scientific, GibcoTM, catalog number: 12746012 )
PBS, without calcium and magnesium (Sigma-Aldrich, catalog number: D8537 )
Penicillin-streptomycin (P/S), 10,000 units penicillin and 10 mg streptomycin per ml (Sigma-Aldrich, catalog number: P0781 )
Trypsin/EDTA 10x (Sigma-Aldrich, catalog number: T4174 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Trypan blue solution (Sigma-Aldrich, catalog number: T8154 , 0.4% [w/v] solution)
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
Methanol (Fisher Scientific, CAS: 67-56-1)
Fish skin gelatin (Sigma-Aldrich, catalog number: G7041 )
Antibodies:
Mouse anti-fibrillin (used at 1/200, Merck, catalog number: MAB1919 )
Rabbit anti-fibronectin (used at 1/200, Sigma-Aldrich, catalog number: F3648 )
Donkey anti-mouse 680 nm (used at 1/400, LI-COR, catalog number: 926-68072 )
Donkey anti-rabbit 488 nM (used at 1/500, Thermo Fisher Scientific, InvitrogenTM, catalog number: R37118 )
DAPI (used at 1/100,000,Thermo Fisher Scientific, InvitrogenTM, catalog number: D1306 )
Gelatin solution (see Recipes)
MesenPRO RSTM Medium (see Recipes)
DMEM low glucose (see Recipes)
Trypsin (see Recipes)
Equipment
Water bath, 37 °C (Grant JB Nova)
CO2 Incubator (Eppendorf, New BrunswickTM, model: Galaxy® 170 S )
Glass hemocytometer (Brand)
Laminar flow hood (ENVAIR, model: Envair Eco Safe Basic Plus )
Inverted microscope (Olympus, model: CKX31 )
Moticam 2300 camera coupled to Motic Images Plus 2.0 ML software (Motic, model: Moticam 2300 )
Cell culture centrifuge (Sigma Laborzentrifugen, model: 3-16KL )
Aspirator (dry vacuum pump/compressor, Welch Vacuum - Gardner Denver, model: 2511 )
Autoclave (Prestige Medical, model: Classic 2100 Extended, catalog number: 210004UK )
Software
Motic Images Plus 2.0 ML software, Motic®
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Redondo-Castro, E., Cunningham, C. J., Miller, J., Cain, S. A., Allan, S. M. and Pinteaux, E. (2018). Generation of Human Mesenchymal Stem Cell 3D Spheroids Using Low-binding Plates. Bio-protocol 8(16): e2968. DOI: 10.21769/BioProtoc.2968.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Mesenchymal stem cell
Cell Biology > Cell isolation and culture > 3D cell culture
Cell Biology > Cell-based analysis > Non-adherent culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,969 | https://bio-protocol.org/exchange/protocoldetail?id=2969&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Modifying Styrene-maleic Acid Co-polymer for Studying Lipid Nanodiscs by Direct Fluorescent Labeling
VS Victoria Schmidt
JS James N. Sturgis
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2969 Views: 5860
Edited by: David Paul
Reviewed by: Tim Andrew Davies SmithMahmoud Nasr
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
This protocol was developed to functionalize styrene maleic acid (SMA) by direct fluorescent labeling in an easy way, accessible to biochemistry laboratories. This novel method is based on the coupling of carboxylic acids to primary amines using a carbodiimide, a reaction commonly used for protein chemistry. The procedure uses the hydrolyzed styrene-maleic acid copolymer and occurs entirely in aqueous solution with mild conditions compatible with many biomolecules.
Keywords: SMALPs Membrane solubilization Nanodiscs Fluorescent labeling Nanodiscs modification
Background
Characterization of membrane proteins in-vitro can be very challenging (Grisshammer and Tate, 1995). In addition to difficulties with over-expression and membrane isolation, membrane proteins need to be extracted from their native environment. The necessary solubilization step commonly requires the use of detergent to replace the native lipid environment, this can often lead to the loss of structure and/or activity of the membrane protein (Duquesne et al., 2016). For this reason, several alternative options such as amphipols (Popot, 2010) have been developed to avoid some of the difficulties associated with detergents and maintain the solubility of membrane protein. A few years ago Styrene Maleic Acid (SMA) copolymer became more frequently used as an alternative to low molecular weight detergent strategies (Dorr et al., 2014; Jamshad et al., 2015; Prabudiansyah et al., 2015). SMA has been shown to be able to spontaneously solubilize biological membranes and give disc-shape particles with an average size of 10 nm. These nanodiscs (called SMALPs) contain a mixture of protein embedded in lipids from membrane and SMA copolymer maintaining the particle in solution (Knowles et al., 2009). SMALPs are compatible with most common biochemical approaches such as affinity purification or size exclusion chromatography. One important advantage of using SMA is the “almost native” environment they provide to membrane proteins, allowing preservation of key lipids often involved in maintaining membrane protein structure or function. Protein characterization sometimes requires labeled material, but fluorescent tags can also alter protein structure. Chemically modified SMA allows labeling of nanodiscs without protein modification and so could be of interest for various types of analysis. Previous studies have used labeled amphipols with different chemistries such as poly-histidine (Giusti et al., 2015); biotin (Charvolin et al., 2009); and DNA oligonucleotides tags (Le Bon et al., 2014) to immobilize membrane proteins. Fluorescent-labeled SMA can be employed in a similar way with lipid environment being preserved allowing for the study of membrane proteins in a native-like environment using fluorescence correlation spectroscopy or energy transfer measurements.
This protocol aims to chemically modify SMA in solution based on the reaction coupling of carboxylic acids to primary amines using a carbodiimide, a reaction commonly used for protein cross-linking (Carraway and Koshland, 1972). This experiment was previously done with a 2:1 styrene-maleic anhydride form as the starting point (Lindhoud et al., 2016). Our protocol maintains mild conditions compatible with many biomolecules throughout the procedure. This makes the chemistry easily accessible to biological laboratories, and will allow a wide range of molecules to be attached to the SMA.
Materials and Reagents
50 ml sterile Falcon tubes (SARSTEDT, catalog number: 62.657.254 )
Disposable pipet tips 10-200 µl (Ultratip, Greiner Bio One International, catalog number: 739290 )
Disposable pipet tips 100-1,000 µl (Ultratip, Greiner Bio One International, catalog number: 686290 )
8,000 MW cut-off membrane (Spectra/Por membrane, Spectrum Laboratories)
1.5 ml sterile Eppendorf tubes (Eppendorf, catalog number: 0030125150 )
0.5 ml sterile Eppendorf PCR tubes (Eppendorf, catalog number: 0030124537 )
0.2 ml sterile Eppendorf PCR tubes (Eppendorf, catalog number: 0030124332 )
MicroBioSpin chromatography columns (Bio-Rad Laboratories, catalog number: 7326221 )
E. coli total lipid extract (Avanti Polar Lipids, catalog number: 100500P )
Ethanol 96% (VWR, catalog number: VWRC20823.362 )
dH2O in lab wash bottle
NaCl (Sigma-Aldrich, catalog number: S3014-5KG )
Tris base (Roche Diagnostics, catalog number: 10708976001 )
SMA 3:1 solution at 25% w/v (Polyscope Polymers, XIRAN®, catalog number: SL25010 S25 )
MES dry powder (Sigma-Aldrich, catalog number: M2933 )
Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Sigma-Aldrich, catalog number: E7750 )
N-hydroxysulfosuccinimide (Sulfo-NHS) (Sigma-Aldrich, catalog number: 56485 )
Cystamine dihydrochloride (Sigma-Aldrich, catalog number: 30050 )
1,4-Dithiothreitol (DTT) (Sigma-Aldrich, Fluka BioChemika, catalog number: 43817 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418-250ML )
Atto488 maleimide (Atto-TEC, catalog number: AD 488-41 )
Atto532 maleimide (Atto-TEC, catalog number: AD 532-41 )
100 mM MES buffer pH 7.0 (see Recipes)
25 mM MES buffer pH 7.0 (see Recipes)
75 mM MES buffer pH 5.8, EtOH 25% (see Recipes)
Tris-HCl 20 mM pH 8.0 (see Recipes)
Tris-HCl 20 mM pH 8.0, NaCl 200 mM (see Recipes)
Equipment
P10, P20, P200 and P1000 Pipetman pipettes (Gilson, catalog number: F167300 )
Centrifuge for 1.5 and 2.0 ml Eppendorf tubes (Eppendorf, model: 5424 R )
Magnetic stirrer hot plate
10 mm stir bar
pH meter (Fisher Scientific)
Thermomixer comfort (Eppendorf, model: ThermoMixer® comfort , catalog number: 5355 000.011)
Precision cell quartz cuvettes (Hellma, catalog number: 105.202-QS )
UV Spectrophotometer (Shimadzu)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Schmidt, V. and Sturgis, J. N. (2018). Modifying Styrene-maleic Acid Co-polymer for Studying Lipid Nanodiscs by Direct Fluorescent Labeling. Bio-protocol 8(16): e2969. DOI: 10.21769/BioProtoc.2969.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Membrane lipid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
297 | https://bio-protocol.org/exchange/protocoldetail?id=297&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Viral Immunofluorescence with Rift Valley Fever Virus Infected MEFs in a 96 Well Plate
TM Theresa S. Moser
SC Sara Cherry
Published: Vol 2, Iss 23, Dec 5, 2012
DOI: 10.21769/BioProtoc.297 Views: 10838
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
Immunofluorescence is a method to detect viral infection in multiple types of host cells. This procedure can be adapted for both high-throughput and low-throughput assays for any virus for which there are antibodies available. Time of infection and virus multiplicity of infection (MOI) vary and should be optimized for each virus and host cell type. Here we give an example of viral immunofluorescence in a 96 well plate with a Rift Valley fever virus (RVFV, strain MP12) infection in mouse embryonic fibroblasts (MEF).
Materials and Reagents
Mouse embryonic fibroblasts (or other host cell)
Rift Valley fever virus MP12 (or other virus)
Dulbecco’s modified eagle medium (DMEM) (Life Technologies, Gibco®, catalog number: 11965-084 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F2442 )
Penicillin-Streptomycin (Life Technologies, Gibco®, catalog number: 15140-122 )
L-Glutamine (Life Technologies, Gibco®, catalog number: 35050-061 )
Dulbecco’s phosphate-buffered saline (DPBS) (Life Technologies, Gibco®, catalog number: 14190-136 )
0.05% Trypsin (Life Technologies, Gibco®, catalog number: 25300-054 )
Ethanol (Sigma-Aldrich, catalog number: 459844 )
Phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: P5368 )
Formaldehyde solution (Sigma-Aldrich, catalog number: 252549 )
TritonX-100 (Sigma-Aldrich, catalog number: 78787 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2158 )
Primary antibody: Mouse anti-RVFV ID8 (obtained privately from C. Schmaljohn USAMRIID)
Secondary antibody: AlexaFluor goat anti-mouse 488 (Life Technologies, Invitrogen™, catalog number: A11029 )
Hoechst 33342 (Sigma-Aldrich, catalog number: B2261 )
Plate sealing film (Denville Scientific, catalog number: B1212-4 )
Complete DMEM (see Recipes)
Fixative (see Recipes)
PBST (see Recipes)
Block (see Recipes)
Equipment
Black, clear-bottomed 96 well plates (Corning Incorporated, catalog number: 3712 )
T75 flask for cell maintenance (Corning Incorporated, catalog number: 430725 )
Type II Laminar Flow Hood (ESCO Corporation)
Thermo Forma Series II 37 °C Incubator with 5% CO2 (Thermo Fisher Scientific, Forma, catalog number: 3110 )
Hemocytometer (Hausser Scientific Brightline)
Multichannel pipette (Fisherbrand, catalog number: FJ19506 )
Matrix Well Mate (optional) (Thermo Fisher Scientific)
Plate shaker (Barnstead International, catalog number: 4625 )
Centrifuge (Eppendorf, catalog number: 5810R )
Multichannel Manifold Aspirator (Drummond, catalog number: 3-000-096 )
Sterile basins (Thermo Fisher Scientific, catalog number: 13681500 )
Quatracide (Thermo Fisher Scientific, catalog number: 50200423 )
Automated inverted microscope (Molecular Devices Image Express Micro)
Software
Image Analysis software (MetaXpress: Molecular Devices Version 2.0.0.13)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Moser, T. S. and Cherry, S. (2012). Viral Immunofluorescence with Rift Valley Fever Virus Infected MEFs in a 96 Well Plate. Bio-protocol 2(23): e297. DOI: 10.21769/BioProtoc.297.
Moser, T. S., Schieffer, D. and Cherry, S. (2012). AMP-activated kinase restricts Rift Valley fever virus infection by inhibiting fatty acid synthesis. PLoS Pathog 8(4): e1002661.
Download Citation in RIS Format
Category
Immunology > Immune cell staining > Immunodetection
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,970 | https://bio-protocol.org/exchange/protocoldetail?id=2970&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Microfluidics-Based Analysis of Contact-dependent Bacterial Interactions
RC Robert Cooper
LT Lev Tsimring
JH Jeff Hasty
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2970 Views: 6569
Edited by: Modesto Redrejo-Rodriguez
Reviewed by: Aurelio Hidalgo
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Bacteria in nature live in complex communities with multiple cell types and spatially-dependent interactions. Studying cells in well-mixed environments such as shaking culture tubes or flasks cannot capture these spatial dynamics, but cells growing in full-fledged biofilms are difficult to observe in real time. We present here a protocol for observing time-resolved, multi-species interactions at single-cell resolution. The protocol involves growing bacterial cells in a near monolayer in a microfluidic device. As a demonstration, we describe in particular observing the dynamic interactions between E. coli and Acinetobacter baylyi. In this case, the protocol is capable of observing both contact-dependent lysis of E. coli by A. baylyi via the Type VI Secretion System (T6SS) and subsequent functional horizontal gene transfer (HGT) of genes from E. coli to A. baylyi.
Keywords: Microfluidics Horizontal gene transfer (HGT) Type VI secretion system (T6SS) Natural competence Antibiotic resistance Acinetobacter Biofilm Microbial ecology
Background
Spatially-dependent interactions between different species of bacteria likely occur ubiquitously in nature, but they can be difficult to observe. One example is enhancement of horizontal gene transfer (HGT) by contact-dependent, in situ lysis of a prey cell, which serves as DNA donor, by a naturally competent, predatory, DNA recipient cell. This was only recently observed in Gram-negative bacteria, but it has already been seen in multiple species, and it is thought to be a relatively widespread phenomenon (Borgeaud et al., 2015; Cooper et al., 2017; Veening and Blokesch, 2017; Ringel et al., 2017). Killing-enhanced HGT cannot easily be observed at single-cell resolution in shaking culture tubes, both because single cells cannot be observed over time, and the well-mixed environment prevents spatial structure. These interactions occur in biofilms, but it is difficult to observe and track cells in their interior. Cells pressed between a glass slide and an agar pad are constrained to a two-dimensional spatial structure and can be observed during contact-dependent lysis (LeRoux et al., 2012; Basler et al., 2013). However, this method allows only a limited duration of observation before either nutrients are depleted, stopping cell growth, or growing colonies push up the agar and develop three-dimensional structure. Microfluidics is an ideal solution to these problems, as it continually provides fresh media while washing away excess, growing cells. The commonly used polydimethylsiloxane (PDMS) and glass substrates are rigid enough to maintain cells in an easily visualized monolayer, while still allowing complex dynamics that can approximate biofilm growth (Liu et al., 2015; Humphries et al., 2017). While we specifically describe contact-dependent killing and HGT between A. baylyli and E. coli, this method should also be generalizable to other species and spatially-structured interactions.
Materials and Reagents
Glass coverslips, #1.5 (Fisher Scientific, catalog number: 12-530F )
Plastic weighing boat, hexagonal (Fisher Scientific, catalog number: 02-202B )
Razor blade (Fisher Scientific, catalog number: 12-640 )
0.5 mm biopsy punch (World Precision Instruments, catalog number: 504528 )
Cutting mat (Harris, GE Healthcare, Whatman, catalog number: WB100020 )
Clear removable tape (e.g., Scotch Magic Tape, catalog number: B0000DH8HQ )
Aluminum foil (e.g., Reynolds Recycled, catalog number: B0028LZ86A )
Squirt bottles containing 70% ethanol, water, methanol, and heptane, respectively (Fisher Scientific, catalog number: 03-409-34 )
Parafilm (optional) (Bemis, catalog number: PM996 )
15 ml conical tubes (Genesee Scientific, catalog number: 21-103 )
1.5 ml microcentrifuge tubes (Fisher Scientific, catalog number: 05-408-129 )
Microfluidic mold or chip
Our layout is shown in Figure 1, and a mask design for photolithography is provided as supplementary information (see Co-culture chip.zip. Design files for a microfluidic chip for co-culturing different species of bacteria. The chip includes several different trap designs and geometries to facilitate experiment optimization). The specific design of a microfluidic chip is not critical, but some key considerations are as follows:
Trapping regions should be large enough to contain enough cells to make interesting dynamics likely, but they should also be small enough to allow sufficient diffusion of nutrients throughout the trap. We used several trap geometries with areas on the order of 104 μm2.
Trap heights should maintain a cell monolayer. We used approximately 0.8-1 μm.
The fluid channels should avoid right angles and dead spaces, which contribute to clogging.
Note: Our chip was based on the design developed in Danino et al. (2010), with parallel main media channels that have trapping chambers on their sides. We included multiple trap geometries, including some with one edge open to media channels, some with two edges open, some with additional, low-flow wings, and some with media feeder channels at the back, so we could test them all in parallel (Figure 2). The chip also includes a Dial-A-Wave design that allows precise control of the ratios of two different media sources. For single-media experiments as described here, it is sufficient to only use one inlet port, leaving the others un-punched. For further design considerations and details on media switching, see Ferry et al. (2011). If you have a pre-fabricated chip, you do not need items 1-16, and items 18-21 may need to be adjusted as appropriate for use with your chip.
Figure 1. A microfluidic chip with four rows of traps and 3 media ports to allow dynamic media switching. Channels shown in blue are 20 μm tall, traps shown in green are 0.8-1 μm tall, and an optional layer of feeder channels shown in red are 0.2 μm tall. The three inlets allow precise concentrations of a dynamically varying chemical of choice, via the Dial-A-Wave mechanism. Note that the feeding channel layer and use of more than one inlet are optional.
Figure 2. A closer view of the four rows of trapping regions. A. The top row contains 100 μm wide traps that alternate between 100 and 200 μm long, open to channels on two sides. B. The second row contains the same trap design with additional wings on the side that experience lower flow. C. The third row of traps is the same as the first, but open on only one side. D. The fourth row of traps is the same as the third, but the back is connected to another media channel by an optional third 0.2 μm tall layer to allow media exchange without allowing cells through. Note that this very low-height layer is technically difficult both to fabricate on a wafer (mold) and to prevent from collapsing on an assembled PDMS chip.
BD 60 ml Luer-Lok syringes (BD, catalog number: 309053 )
Tubing, 0.02" ID, 0.06" OD (Tygon, Murdock Industrial, catalog number: AAD04103 )
Straight luer stubs, 23 ga x 0.50 in (Instech Laboratories, catalog number: LS23S )
Bent luer stubs, 23 ga x 0.50 in, bent 90° (OK International, Metcal, catalog number: 923050-90BTE )
E. coli carrying a plasmid that can transfer from E. coli to A. baylyi
Note: We used pBAV1k-GFP (Addgene, catalog number: 26702 ), a plasmid with kanamycin resistance and a broad host range origin of replication that can propagate in both species (Bryksin and Matsumura, 2010). Another option would be to use a plasmid with the ColE1 origin of replication, which cannot propagate in A. baylyi, but to insert a GFP gene (and optionally the antibiotic resistance marker) between two flanking regions of A. baylyi genomic homology. This would encourage homologous recombination into the A. baylyi genome, which occurs at higher frequency than transfer of a self-replicating plasmid (Palmen et al., 1993). A good strain of E. coli for use in microfluidics is MG1655 (Coli Genetic Stock Center, catalog number: 6300 ), although other strains will work as well. Common cloning strains with mutations in recA, including dh5-alpha, are not ideal because they grow more slowly.
A. baylyi strain ADP1 (ATCC, catalog number: 33305 ), see also Notes
Note: Either A. baylyi or E. coli or both should contain a fluorescent marker such as mCherry to visually distinguish between the two in movies. We inserted mCherry into a neutral region of the A. baylyi genome using a modified version of pp2.1-PT5-lacI-gusA-specR-pp2.2-IMBB (Murin et al., 2011; Addgene, catalog number: 30505 ) with the lacI-gusA insert replaced by mCherry.
Tween 20, aka, polysorbate 20 (Sigma-Aldrich, catalog number: P9416-50ML )
Dehydrated LB (Luria-Bertani) broth, Miller (BD, catalog number: 244610 )
70% ethanol (Fisher Scientific, catalog number: BP8201500 ).
Distilled water
Methanol (Fisher Scientific, catalog number: A412-500 )
Heptane (Fisher Scientific, catalog number: H350-1 )
Antibiotics as appropriate to maintain your cell strains
For E. coli carrying pBAV1k, use kanamycin at 50 μg/ml.
For A. baylyi with a marker inserted using a variant of pp2.1-PT5-lacI-gusA-specR-pp2.2-IMBB, use spectinomycin at 17 μg/ml.
Sylgard 184 silicone elastomer kit (i.e., polydimethylsiloxane or PDMS) including both base and curing agent (Ellsworth Adhesives, catalog number: 184 SIL ELAST KIT 0.5KG) (For Recipe 1)
Manufacturer: Dow Corning, catalog number: 4019862 .
PDMS (see Recipe 1)
LB + Tween 20 media (see Recipe 2)
Equipment
Tweezers (e.g., Sports Medica, catalog number: B075VSFWSV )
Glass stirring rod for PDMS (e.g., United Scientific Supplies, catalog number: GSR008 )
Vacuum desiccator for degassing PDMS (e.g., Thermo Fisher Scientific, Nalgene polypropylene desiccator with stopcock, catalog number: 5310-0250 )
Note: We attach this to an in-house vacuum line, but a vacuum pump would also work.
Oven set to 80 °C (e.g., Isotemp 500, Fisher Scientific, catalog number: 13246516GAQ )
UVO cleaner attached to an oxygen tank, used to bond chips to the cover glass (e.g., Jelight, model: 42 )
Dissecting microscope for punching holes in the PDMS (e.g., Amscope, model: SM-4B )
Goose-neck illuminator for use with the microscope (e.g., Amscope, model: LED-6W )
Fume hood
Appropriate personal protective equipment
Note: Appropriate personal protective equipment should be worn throughout, including a lab coat, nitrile gloves, and safety glasses.
Inverted, fluorescent microscope (We used Nikon TE and TI models)
Note: An inverted, fluorescent microscope capable of automated imaging, including a CCD camera, a fluorescent light source, and appropriate filters.
Computer
Note: A computer connected to the microscope and camera that is running software capable of controlling and receiving data from them, such as Micro-Manager (free and open source) or NIS-Elements, and ImageJ (free) to process image files.
Software
ImageJ (https://imagej.nih.gov/ij/) or its packaged version FIJI (https://fiji.sc/)
Procedure
Fabricate a microfluidic chip
Note: This section can be skipped if you have a pre-fabricated microfluidic chip.
Prepare PDMS
Mix PDMS base and curing agent in a weigh boat at a ratio of 10:1; i.e., 36.4 g PDMS base and 3.6 g curing agent. Mix thoroughly with a glass stirring rod.
Place the boat in the vacuum desiccator to degas the PDMS. When air bubbles are nearly overflowing the weigh boat, break the vacuum momentarily to pop and deflate the bubbles. Continue until there are no more bubbles.
Prepare wafer
Tear off a piece of aluminum foil and wrap it around the wafer containing your trap molds. Carefully press down, avoiding the mold features, to remove air bubbles (see Figure 3).
Figure 3. A wafer with molds of microfluidic chips ready for PDMS to be poured on
Pour and cure PDMS
Pour the degassed PDMS onto the wafer, and place it back into the vacuum desiccator to degas the PDMS as before. When the PDMS is thoroughly degassed, cure it in an 80 °C oven for an hour or overnight. Allow the cured PDMS to cool before proceeding, to avoid damaging your wafer.
Cut and punch chips
Carefully peel the cured and cooled PDMS away from the wafer. Cut out individual chips with a razor blade on a cutting mat.
Turn the chips feature site up and place under the dissecting microscope. Carefully use the biopsy punch to remove a core all the way through the chip at each media port. Note that an experiment with no media switching only requires punching one inlet and one outlet.
Clean and bond chips
Clean the chips sequentially with 70% ethanol and water, and dry them with a stream of nitrogen gas. Be sure to clean out the ports either with high-velocity gas or by injecting 70% ethanol or water through them using a syringe and luer stub adapter. Immediately place tape over the features of each chip after drying to prevent dust from settling on it.
In a fume hood, clean the coverslips sequentially with heptane, methanol, and distilled water before drying under a stream of nitrogen gas. Immediately place tape over each coverslip after drying to prevent dust from settling on them.
Open the oxygen line to the UVO cleaner. Place the chips (feature side up) and coverslips inside the UVO cleaner, peel off the tape, and activate the surface for 3 min. Re-close the valve of the oxygen tank.
Quickly and carefully place each chip feature side down onto a coverslip, and then bake at 80 °C for an hour or overnight to bond them.
Note: If your chips have low height features (like the 1 μm traps on our chips), they can collapse if you press down on the chip. Placing the coverslip on top of the chip instead of the other way around can help protect low features.
Prepare chip and media
Note that our design includes an optional media switcher requiring 3 inlet ports. For an experiment with no media switches, it is sufficient to use only one inlet and one outlet, leaving the remaining inlets un-punched. For details on media switching, see Ferry et al. (2011). For each port, remove the metal part of a bent luer stub adapter. This can be done by soaking the adapter in acetone to dissolve the adhesive, and then pulling out the metal piece with tweezers. Discard the plastic and keep the metal piece.
For each port, attach a straight luer stub adapter to a 50 ml syringe. Attach a length of tubing to the adapter, and insert the metal piece from a bent luer stub adapter into the other end of the tubing.
Prime the tubing of all but one syringe by injecting 1 ml of LB + Tween 20 (Recipe 2) straight down into the bottom of the syringe (see Figure 4). Press the pipet tip against the very bottom of the syringe, and then maintain steady pressure on the plunger until you see LB begin to come out the other end of the tubing. Carefully add another 10 ml of LB into the syringe. Allow fluid to flow through the tubing until you are sure there are no more bubbles in the line, and then tape the end of the tubing to the syringe just above the liquid level to stop the flow. Cover the top of the syringe with tape or parafilm to prevent contamination (see also Figure 5). Note that chilled media will release dissolved gases as it warms, so to avoid bubbles, allow any chilled media to warm to at least room temperature before loading your syringes. See also Video 1, in which the syringe is loaded with food coloring to aid visualization.
Figure 4. Prime the tubing by injecting media directly into the luer stub, through the bottom of the syringe
Figure 5. An example of a primed syringe
Video 1. Loading a syringe. To aid visualization, this syringe was loaded with water dyed green with food coloring.
Prepare cells
Meanwhile, grow 10-15 ml of each strain separately in LB with appropriate antibiotics to mid-exponential phase. For E. coli carrying pBAV1k, use kanamycin at 50 μg/ml.
Harvest each strain by transferring to 15 ml conical tubes and centrifuging for 5 min at 2,000 x g. Room temperature is fine for centrifugation steps.
Resuspend each strain in 1 ml fresh LB, transfer to a 1.5 ml microcentrifuge tube, and harvest again for 3 min at 10,000 x g. This washing step is to remove any residual antibiotics.
Resuspend the two strains at high density – use about 1-3 volumes of LB with Tween 20 for each volume of cell pellet.
Mix the two strains at 3 volumes of E. coli for each volume of A. baylyi. The ratio can be adjusted in subsequent attempts, but E. coli MG1655 are less adhesive than A. baylyi and thus are more likely to be washed out of the traps during and immediately after loading. If using another E. coli strain that is more adhesive, a more equal ratio of the two species may work better. Note also that species ratio can affect the frequency of interactions such as horizontal gene transfer (Cooper et al., 2017).
Load the cell mixture into a prepared syringe and tubing in the same way as for the media syringes above.
Load the chip
For each media port, lower the luer stub below the fluid level in the syringe, hold it until fluid begins flowing out from the end, and insert it into the appropriate port in the chip, as in Figure 6. Do the same for the cell mixture in the waste port. Note that the loading speed can be increased by placing the chip in the vacuum desiccator for at least 20 min before loading.
Figure 6. A loaded PDMS chip with 2 ports
Place the chip onto the microscope stage, fix it in place, and raise the syringes a few feet above the chip. They can be taped to the wall, or for a more advanced setup see Ferry et al. (2011). Watch under the microscope as the channels fill with media. You want the fresh media and the cells to meet about midway into the trapping region. The extra buffer space is to prevent contaminating the media channel with cells in the next step. Adjust the syringe heights to ensure this. When the media does meet the cells, adjust the syringe heights so there is a slow forward flow from media to waste.
If cells have not loaded well into the traps, flick the waste media line (loaded with cells) with your fingers. Try gently at first, and then harder as needed (see also Video 2). The pressure waves should force cells into the traps, but be careful not to force cells into the upstream media channels.
Video 2. Flicking the microfluidics lines. A demonstration of how to flick the media lines, which helps initial loading of cells and can temporarily disrupt clogs.
Once sufficient cells of each species are loaded into the traps (see Figure 7 for a representative example of a loaded trap), immediately adjust the syringe heights to obtain a forward flow from media to waste. The flow velocity must be fast enough to avoid clogging, but not so fast as to wash the less sticky E. coli out of the traps. The flow rate can be adjusted up as the cells grow and fill the traps. Both syringes should be above the chip.
Figure 7. A microfluidic trap loaded with cells. The channel runs along the bottom of the image, A. baylyi cells are shown in red, and E. coli cells are shown in green.
Record data and babysit the experiment
Set your microscope to record one set of images every 3-5 min. You will need to determine the appropriate exposure power and duration to observe cellular fluorescence on your equipment. In general, use the lowest possible exposure that will give reliable data, to avoid damaging the cells. A longer exposure at lower intensity is preferable to a short exposure at high intensity. Imaging multiple stage positions using a motorized stage is ideal, because it increases the likelihood you will capture usable data.
Keep an eye on the experiment to be sure that cells are growing and the channels do not clog. If cells are washing out of the traps, reduce the flow rate by raising the waste syringe or lowering the fresh media syringe. If channels are beginning to clog, or if media is not flowing forward, increase the flow rate by adjusting the syringe heights in the opposite direction.
If channels begin clogging, this generally portends the beginning of the end. Sometimes, the experiment can be given a temporary reprieve by flicking the tubing connecting the syringes to the chip, as in Video 2. However, this can also rearrange the cells within the traps, which can compromise time course data. See also Notes.
Data analysis
Captured still images can be converted into movies using the free program ImageJ, which also comes in a package recursively called FIJI.
Import a folder of images with the command File > Import > Image Sequence. Be sure to select ‘Sort names numerically’. Using a virtual stack (opening with the computer’s virtual memory rather than loading into RAM) will load faster and can be useful for large folders on computers with limited RAM, but annotations often do not work on virtual stacks.
Convert to a hyperstack using the Images > Stacks > Stack to Hyperstack command. Specify the appropriate number of positions, channels, time points, and Z-slices. Select display as composite.
Adjust the color and contrast of each channel using the tools available at Image > Color > Channels Tool and Image > Adjust > Brightness And Contrast.
Optional: If you want to add any annotations, such as time stamps or scale bars, you must convert the multichannel hyperstack to an RGB stack using Image > Type > RGB Color. Be sure to adjust the contrast first, because it will be fixed once the stack has been converted to RGB.
Optional: Add any desired annotations. To add time stamps, use Image > Stacks > Label. To add a scale bar, use Analyze > Set Scale followed by Analyze > Tools > Scale Bar.
Optional: Crop all frames in the movie by selecting the rectangle tool and then Image > Crop. Select only a portion of the time series using Image > Stacks > Tools > Make Substack.
Save your processed movie as a TIFF stack at full quality and/or as a compressed movie using the options in File > Save As. You may need to download a plugin to save as a .avi or .mov file from https://imagej.nih.gov/ij/plugins/. Saving as an animated GIF is another option that is easily shared on social media.
Representative results can be seen in the attached movies for Cooper et al. (2017).
Notes
In our hands, A. baylyi was difficult to work with in microfluidics, because it adhered to both the PDMS and glass coverslips of our chips. We attempted several strategies to reduce cellular adhesion, including adding high levels of Tween 20, adding DNase (Das et al., 2010), adding PEG to the PDMS before curing, and deleting the thin pilus gene acuA (Gohl et al., 2006), but none helped significantly.
Interestingly, some of our experiments began well, but then there appeared to be a change in A. baylyi that caused them to become more adhesive to both the surfaces and each other. In a microfluidic device where non-adhesive cells are washed away, the adhesive phenotype is constantly selected for and rapidly dominates once it emerges. The adhesive phenotype may be related in part to recently described genomic instability caused by mobile genetic elements that cause genomic insertions and deletions at relatively high frequencies (Renda et al., 2015). When this instability disrupts production of bioemulsifier, the cells begin to aggregate. A strain of A. baylyi that lacks all insertion elements (Suárez et al., 2017) may work better in microfluidics, but we have not tested it. An alternative explanation may be a developmental switch between bacillar and coccoid phenotypes, with the coccoid phenotype being related to nutrient stress and adhesion (James et al., 1995).
Regardless, while cellular adhesion limited the duration of our experiments, we were able to run them for long enough to reproducibly observe T6SS-dependent killing and subsequent HGT before the channels fully clogged (Cooper et al., 2017).
Recipes
PDMS
36.4 g silicone elastomer
3.6 g curing agent
Weigh together in a plastic weigh boat and stir thoroughly with a glass stir bar immediately before proceeding to degas and pour onto the wafer
LB + Tween 20
25 g LB powder
Distilled water to 1 L
Tween 20
Dissolve the LB powder and Tween 20 into distilled water, then filter sterilize. Alternatively, add Tween 20 into pre-made LB liquid and filter sterilize
Acknowledgments
RMC was supported by a fellowship from The Hartwell Foundation. This work was supported in part by the National Institute of General Medical Sciences (NIGMS): San Diego Center For Systems Biology – P50 GM085764. This protocol was adapted from Cooper et al. (2017).
Competing interests
The authors declare no conflicts of interest.
References
Basler, M., Ho, B. T. and Mekalanos, J. J. (2013). Tit-for-tat: type VI secretion system counterattack during bacterial cell-cell interactions. Cell 152(4): 884-894.
Borgeaud, S., Metzger, L. C., Scrignari, T. and Blokesch, M. (2015). The type VI secretion system of Vibrio cholerae fosters horizontal gene transfer. Science 347(6217): 63-67.
Bryksin, A. V. and Matsumura, I. (2010). Rational design of a plasmid origin that replicates efficiently in both gram-positive and gram-negative bacteria. PLoS One 5(10): e13244.
Cooper, R. M., Tsimring, L. and Hasty, J. (2017). Inter-species population dynamics enhance microbial horizontal gene transfer and spread of antibiotic resistance. Elife 6.
Danino, T., Mondragon-Palomino, O., Tsimring, L. and Hasty, J. (2010). A synchronized quorum of genetic clocks. Nature 463(7279): 326-330.
Das, T., Sharma, P. K., Busscher, H. J., van der Mei, H. C. and Krom, B. P. (2010). Role of extracellular DNA in initial bacterial adhesion and surface aggregation. Appl Environ Microbiol 76(10): 3405-3408.
Ferry, M. S., Razinkov, I. A. and Hasty, J. (2011). Microfluidics for synthetic biology: from design to execution. Methods Enzymol 497: 295-372.
Gohl, O., Friedrich, A., Hoppert, M. and Averhoff, B. (2006). The thin pili of Acinetobacter sp. strain BD413 mediate adhesion to biotic and abiotic surfaces. Appl Environ Microbiol 72(2): 1394-1401.
Humphries, J., Xiong, L., Liu, J., Prindle, A., Yuan, F., Arjes, H. A., Tsimring, L. and Suel, G. M. (2017). Species-independent attraction to biofilms through electrical signaling. Cell 168(1-2): 200-209 e212.
James, G. A., Korber, D. R., Caldwell, D. E. and Costerton, J. W. (1995). Digital image analysis of growth and starvation responses of a surface-colonizing Acinetobacter sp. J Bacteriol 177(4): 907-915.
LeRoux, M., De Leon, J. A., Kuwada, N. J., Russell, A. B., Pinto-Santini, D., Hood, R. D., Agnello, D. M., Robertson, S. M., Wiggins, P. A. and Mougous, J. D. (2012). Quantitative single-cell characterization of bacterial interactions reveals type VI secretion is a double-edged sword. Proc Natl Acad Sci U S A 109(48): 19804-19809.
Liu, J., Prindle, A., Humphries, J., Gabalda-Sagarra, M., Asally, M., Lee, D. Y., Ly, S., Garcia-Ojalvo, J. and Suel, G. M. (2015). Metabolic co-dependence gives rise to collective oscillations within biofilms. Nature 523(7562): 550-554.
Murin, C. D., Segal, K., Bryksin, A. and Matsumura, I. (2011). Expression vectors for Acinetobacter baylyi ADP1. Appl Environ Microbiol 78(1): 280-283.
Palmen, R., Vosman, B., Buijsman, P., Breek, C. K. and Hellingwerf, K. J. (1993). Physiological characterization of natural transformation in Acinetobacter calcoaceticus. J Gen Microbiol 139(2): 295-305.
Renda, B. A., Dasgupta, A., Leon, D. and Barrick, J. E. (2015). Genome instability mediates the loss of key traits by Acinetobacter baylyi ADP1 during laboratory evolution. J Bacteriol 197(5): 872-881.
Ringel, P. D., Hu, D. and Basler, M. (2017). The role of type VI secretion system effectors in target cell lysis and subsequent horizontal gene transfer. Cell Rep 21(13): 3927-3940.
Suárez, G. A., Renda, B. A., Dasgupta, A. and Barrick, J. E. (2017). Reduced mutation rate and increased transformability of transposon-free Acinetobacter baylyi ADP1-ISx. Appl Environ Microbiol 83(17).
Veening, J. W. and Blokesch, M. (2017). Interbacterial predation as a strategy for DNA acquisition in naturally competent bacteria. Nat Rev Microbiol 15(10): 621-629.
Copyright: Cooper et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Cooper, R., Tsimring, L. and Hasty, J. (2018). Microfluidics-Based Analysis of Contact-dependent Bacterial Interactions. Bio-protocol 8(16): e2970. DOI: 10.21769/BioProtoc.2970.
Cooper, R., Tsimring, L. and Hasty, J. (2017). Inter-species population dynamics enhance microbial horizontal gene transfer and spread of antibiotic resistance. Elife 6: e25950.
Download Citation in RIS Format
Category
Microbiology > Community analysis > Spatial interaction
Microbiology > Microbial biofilm > Biofilm culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,971 | https://bio-protocol.org/exchange/protocoldetail?id=2971&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessment of Caenorhabditis elegans Competitive Fitness in the Presence of a Bacterial Parasite
MP McKenna. J. Penley
Levi T. Morran
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2971 Views: 5179
Reviewed by: Juan Facundo Rodriguez AyalaDURAI SELLEGOUNDER
Original Research Article:
The authors used this protocol in Aug 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2017
Abstract
Accurate measurements of an organism’s fitness are crucial for measuring evolutionary change. Methods of fitness measurement are most accurate when incorporating an individual’s survival and fecundity, as well as accounting for any ecological interactions or environmental effects experienced by the organism. Here, we describe a protocol for measuring the relative mean fitness of Caenorhabditis elegans populations, or strains, through an assay that accounts for individual survival, fecundity, and intraspecific competitive ability in the presence of a bacterial parasite. In this competitive fitness assay nematodes from a focal population or strain are mixed with a GFP-marked tester strain in equal proportions, the mixture of nematodes are then exposed to a parasite, and the relative competitive fitness of the focal strain is determined by measuring the change in the ratio of focal nematodes to GFP-marked nematodes after one generation. Specifically, this protocol can be implemented to measure changes in nematode host fitness after experimental evolution by determining the relative competitive fitness of evolved versus ancestral nematode populations.
Keywords: Fitness assay Experimental evolution C. elegans S. marcescens Competition
Background
Accurate measurements of fitness and changes in fitness over time are critical for determining a population’s response to natural selection. Nonetheless, fitness is notoriously difficult to measure because it incorporates an individual’s survival, fecundity, reproductive timing, and must account for ecological and environmental effects on individuals. Although no protocol for measuring fitness is optimal under all possible conditions, measures of fitness that account for survival and fecundity, while holding ecological and environmental effects constant, are likely to provide reliable overall estimates of fitness for a given scenario. Here we describe a protocol for measuring the relative fitness differences between C. elegans populations or strains and for determining the change in relative fitness over evolutionary time in the presence of a bacterial parasite. We utilized the gram-negative bacterium, Serratia marcescens, as a virulent parasite when consumed by C. elegans. Especially, S. marcescens strain SM2170 is capable of killing C. elegans hosts within 24 to 48 h of ingestion (Penley et al., 2017). This procedure makes use of Competitive Fitness Assays (CFAs) (Lenski et al., 1991; Wiser and Lenski, 2015), utilizing intraspecific competition to compare the relative fitness between different nematode populations or strains (Morran et al., 2009). Measurements of relative fitness, as determined via the CFA, incorporate survival and reproduction with intraspecific competition in a controlled environment to provide a comprehensive measure of fitness (Penley et al., 2017).
Relative fitness in the presence of the bacterial parasite is determined by competing a focal strain with an isogenic GFP-labeled tester strain over the course of one generation and measuring the reproductive success of the focal strain against the tester strain (Morran et al., 2009). Thus, this CFA accounts for survival against the parasite and host reproduction over the course of the nematode’s lifecycle. One single tester strain is used to measure the relative fitness of each focal nematode population or strain to facilitate comparisons of relative fitness between populations or strains. Importantly, the tester is marked with pharyngeal GFP to allow easy visualization of tester strain offspring versus focal population or strain offspring after one generation of competition. CFAs are initialized with a 50:50 mix of focal and tester strain individuals, and therefore, any deviation from 50:50 mix in the offspring indicates unequal competitive fitness between the focal and tester strains. An increase in the proportion of focal nematodes in the offspring indicates greater competitive fitness relative to the tester, while a decrease indicates reduced competitive fitness relative to the tester. The proportion of focal hosts in the offspring can be compared across multiple populations to measure the relative competitive fitness between focal strains or populations of interest. Importantly, competitive fitness measures are most effective when competing approximately equal numbers of individuals between two populations or strains with minor to moderate differences in competitive fitness. Uneven or variable starting ratios of strains or populations can confound measurements of relative fitness, while major differences in fitness between competing strains or populations are often difficult to accurately quantify (Wiser and Lenski, 2015).
This protocol is particularly useful for measuring evolutionary change after experimental evolution of C. elegans hosts in the presence of a bacterial parasite. First, the relative fitness of experimental host populations can be directly compared with the relative fitness of the ancestral population. Ancestral C. elegans populations can be stored at -80 °C during experimental evolution and then revived for CFAs to assess changes in the experimental population fitness over time (Gray and Cutter, 2014; Teotonio et al., 2017). Second, during experimental evolution, hosts may adapt to parasite exposure through altered life histories and/or increased levels of host defense. Therefore, measuring only survival in the presence of the parasite may not fully account for changes in host fitness. This CFA can account for changes in both life history and resistance that alter reproductive output in the presence of the parasite. Importantly, this procedure was originally developed to measure the change in C. elegans’ competitive fitness after multiple generations of evolution in presence of the bacterial parasite, Serratia marcescens (Morran et al., 2009; Morran et al., 2014; Parrish et al., 2016; Penley et al., 2017). Nonetheless, this protocol can be adapted to measure the relative competitive fitness of any two or more C. elegans populations or strains in the presence of any relevant bacterial parasite. Further, it can be used to measure the change in relative competitive fitness over the course of experimental evolution for any C. elegans populations evolved in the presence of a bacterial parasite.
Materials and Reagents
1.5 ml micro-centrifuge tube (MIDSCI, catalog number: MID15C )
1,000 μl pipette tips (MIDSCI, catalog number: AVR4 )
200 μl pipette tips (MIDSCI, catalog number: AVR1 )
1,000 μl wide bore pipette tips (Genesee Scientific, catalog number: 22-426 )
200 μl wide bore pipette tips (Genesee Scientific, catalog number: 22-423 )
Microscope slides (Fisher Scientific, catalog number: 12-550-19 )
Semimicro spatula (Fisher Scientific, catalog number: 14-374 )
Disposable inoculating loops, 10 μl (VWR, catalog number: 12000-810 )
100 x 15 mm Petri dishes (Tritech Research, catalog number: T3301 )
0.22 μm sterile syringe filter (Spectrum Chemical Manufacturing, catalog number: 882-66597 )
Disposable plastic syringe (Thermo Fisher Scientific, catalog number: S7510-10 )
Serratia marcescens strain SM2170, BSL2 (Sue Katz, Rogers State University)
Escherichia coli strain OP50, BSL1 (Caenorhabditis Genetics Center)
GFP-labeled C. elegans (strain JK2735) (Caenorhabditis Genetics Center)
Nematode Growth Media Lite powder (United States Biological, catalog number: N1005 )
LB granules (Fisher Scientific, catalog number: BP9723-500 )
Potassium Phosphate Monobasic (KH2PO4) (Fisher Scientific, catalog number: P288-100 )
Sodium Chloride (NaCl) (Fisher Scientific, catalog number: S671-500 )
Sodium Phosphate Dibasic Anhydrous (Na2HPO4) (Fisher Scientific, catalog number: S374-500 )
Magnesium Sulfate Anhydrous (MgSO4) (Fisher Scientific, catalog number: M65-500 )
Ampicillin Sodium Salt (Dot Scientific, catalog number: DSA40040-25 )
Household bleach
LB Broth (see Recipes)
NGM Lite plates (see Recipes)
Escherichia coli (OP50)-seeded NGM Lite plates (see Recipes)
M9 Buffer (see Recipes)
1 M MgSO4 Solution (see Recipes)
Ampicillin 200 mg/ml (see Recipes)
Equipment
Hand tally counters (United Scientific Supplies, catalog number: HTCP01 )
2 L flask (Corning, PYREX®, catalog number: 5320-2L )
P1000 μl pipetman (Eppendorf, model: Research® plus, catalog number: 3121000120 )
P100 μl pipetman (Eppendorf, model: Research® plus, catalog number: 3121000074 )
-80 °C freezer (Eppendorf, New BrunswickTM, model: Innova® U725 )
Tabletop centrifuge for 1.5 ml micro-centrifuge tubes (Eppendorf, model: 5424 )
20 °C controlled environment chamber (Percival Scientific, model: I36NLC8 )
28 °C shaker incubator (Eppendorf, New BrunswickTM, model: Innova® 42R , catalog number: M1335-0010)
Stereomicroscope (Olympus, model: SZX16 )
LED transmitted light illumination base (Olympus, model: SZX2-ILLT )
GFP filter for stereomicroscope (Olympus, model: SZX2-FGFP )
Stereomicroscope objective 7x-115x (Olympus, model: SDFPLAPO1XPF )
Fluorescence illumination lamp (Excelitas Technologies, model: X-Cite® 120Q )
X-Cite® Liquid Light Guide (Bulbtronics, Excelitas Technologies, model: 805-00038 )
Autoclave (STERIS, model: SG-120 )
Chemical fume hood (Kewaunee Scientific, model: H05 )
Software
JMP Pro 12.0.1 (SAS Institute Inc., Cary, NC)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Penley, M. J. and Morran, L. (2018). Assessment of Caenorhabditis elegans Competitive Fitness in the Presence of a Bacterial Parasite. Bio-protocol 8(16): e2971. DOI: 10.21769/BioProtoc.2971.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,972 | https://bio-protocol.org/exchange/protocoldetail?id=2972&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Deoxycholate Fractionation of Fibronectin (FN) and Biotinylation Assay to Measure Recycled FN Fibrils in Epithelial Cells
Archana Varadaraj
Carina Magdaleno
KM Karthikeyan Mythreye
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2972 Views: 5567
Edited by: Ralph Thomas Boettcher
Reviewed by: Piyali Saha
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
Fibronectin (FN) is an extracellular matrix protein that is secreted by many cell types and binds predominantly to the cell surface receptor Integrin α5β1. Integrin α5β1 binding initiates the step-wise assembly of FN into fibrils, a process called fibrillogenesis. We and several others have demonstrated critical effects of fibrillogenesis on cell migration and metastasis. While immunostaining and microscopy methods help visualize FN incorporation into fibrils, with each fibril being at least 3 μm in length, the first study that developed a method to biochemically fractionate FN to quantify fibril incorporated FN was published by Jean Schwarzbauer’s group in 1996. Our protocol was adapted from the original publication, and has been tested on multiple cell types including as shown here in MCF10A mammary epithelial and Caki-1 renal cancer epithelial cells. Using two detergent extractions, cellular FN is separated into detergent insoluble or fibril incorporated FN and soluble FN or unincorporated fractions. To determine whether fibrillogenesis utilizes a recycled pool of FN, we have used a Biotin labeled FN (FN-Biotin) recycling assay, that has been modified from a previous study. Using a combination of the recycling assay and deoxycholate fractionation methods, one can quantitatively demonstrate the extent of fibrillogenesis in cells under different experimental conditions and determine the source of FN for fibrillogenesis.
Keywords: Fibronectin (FN) Fibrillogenesis Extracellular matrix Recycling Endocytosis
Background
Fibronectin (FN) is a ubiquitously produced extra cellular matrix (ECM) component (Uitto et al., 1989; Mao and Schwarzbauer, 2005). Fibronectin pools are generated transcriptionally that can be increased by several growth factors such as TGF-β1 (Yokoi et al., 2002; Mimura et al., 2004; Tang et al., 2007). The step-wise process of fibrillogenesis involving cell surface receptor Integrin α5β1 engagement with dimeric FN, drives the process of fibrillogenesis in cells (Yang and Hynes, 1996). Integrin α5β1 regulation by receptor activation/inactivation cycles, receptor endocytosis and recycling influences fibrillogenesis (Gao et al., 2000; White et al., 2007; Caswell et al., 2008) with FN contributing to net endocytosis rates of integrins in active conformations (Arjonen et al., 2012). The relevance of FN fibrillogenesis to cellular outcome has been demonstrated by numerous studies investigating fibril-specific functions for the FN protein. For example, a polymeric form of fibronectin or ‘super-fibronectin’ shows anti-metastatic and anti-angiogenic properties against different tumor types (Pasqualini et al., 1996; Yi and Ruoslahti, 2001). In the absence of a FN matrix, as observed in Von Hippel Lindau syndrome, renal cancer characterized by the mutation or loss of the Von Hippel Lindau (VHL) protein (Ohh et al., 1998; Hoffman et al., 2001), introducing a VHL mutant unable to form a fibronectin matrix is insufficient to suppress formation of tumors in SCID mice (Stickle et al., 2004). All disease mutants of the VHL gene in renal cancer also fail to form a FN matrix (Hoffman et al., 2001). Thus, analyses of fibril versus soluble FN maybe of importance to investigations that explore the contribution of the FN matrix to cellular response. Endpoint and real-time assays have been successfully used to study fibrillogenesis (Pankov et al., 2000; Mao and Schwarzbauer, 2005). Both studies rely on microscopy-based approaches to determine fibrillogenesis in cells. Biochemical fractional of FN is a quantitative approach to complement microscopy-based methods to detect levels of fibril incorporated from soluble FN. Using a fractionation assay in combination with a recycling assay, allows us to determine whether FN that is incorporated in the matrix is recycled from an existing pool of FN in the cell or from cell autonomous sources. The FN-Biotin recycling assay is simpler than classical temperature-switching assays that investigate receptor recycling (Roberts et al., 2001). Additionally, the temperature-switching assays quantify protein recycling from a decrease in rate of protein endocytosis; requiring additional lysosomal or proteasomal inhibitors in the assay. Our recycling assay can be adapted to many different proteins that localize intracellularly and at the cell membrane. While performing our FN fractionation protocol we did detect integrin β1 in the soluble and insoluble fractions. It is possible to extend this observation to perform recycling of integrins using a Biotin-conjugated integrin or any protein of interest. Alternatively, it is also possible to perform immunoprecipitation experiments on the recycled protein fraction to determine whether specific proteins interact preferentially with the two FN fractions. This protocol can help answer several questions associated with protein trafficking kinetics, interacting partner proteins and new functional characteristics based on associating proteins in the different fractions.
Materials and Reagents
15 ml conical tube (Thermo Fisher Scientific, catalog number: 339650 )
Pipette tip
1,250 μl (USA Scientific, TipOne, catalog number: 1112-1720 )
200 μl (USA Scientific, TipOne, catalog number: 1110-1700 )
20 μl (USA Scientific, TipOne, catalog number: 1123-1710 )
10 μl (USA Scientific, TipOne, catalog number: 1111-3700 )
Aluminum foil (Walmart, 551605957)
Beaker (100 ml, WWR, catalog number: 890000-200 )
Filter paper (GE Healthcare, catalog number: 1001-929 )
T75 flask (Corning, catalog number: 353824 )
Six-well tissue culture plates (Corning, catalog number: 3506 )
Cell lifter (Fisher Scientific, FisherbrandTM, catalog number: 08-100-240 )
23 G needle (BD, Precision Glide, catalog number: 305193 )
Microcentrifuge tubes (Eppendorf, catalog number: 022600028 )
MCF10A breast cell lines (ATCC, catalog number: CRL-10317 )
Caki-1 renal cancer cell lines (ATCC, catalog number: HTB-46 )
Protein Ladder (Bio-Rad Laboratories, catalog number: 1610375 )
PVDF protein transfer membrane (Merck, catalog number: IPVH08100 )
Fibronectin antibody (Santa Cruz Biotechnology, catalog number: sc-59826 )
Actin antibody (Abcam, catalog number: ab8227 )
GAPDH antibody (Abcam, catalog number: ab9484 )
Biotin labeled fibronectin (CYTOSKELETON, catalog number: FNR03 )
Streptavidin conjugated IRDye® (LI-COR, catalog number: 926-32230 )
IRDye 800CW Secondary Antibody (LI-COR, catalog number: 925-32210 )
DMEM/F-12 HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 11330057 )
Insulin (Thermo Fisher Scientific, GibcoTM, catalog number: 12585014 )
EGF (Thermo Fisher Scientific, GibcoTM, catalog number: PHG0313 )
Hydrocortisone (Corning, catalog number: 354203 )
Horse Serum (Thermo Fisher Scientific, GibcoTM, catalog number: 16050122 )
Penicillin-Streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Cholera toxin (Sigma-Aldrich, catalog number: C8052-2MG )
Skimmed Milk powder (Thermo Fisher Scientific, catalog number: LP0031B )
BSA (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP9703100 )
McCoy's 5A (ATCC, catalog number: 30-2007 )
FBS (Corning, catalog number: 35-011-CV )
0.05% Trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25300062 )
SDS (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP166-100 )
Sodium deoxycholate (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP349-100 )
Tris Base (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP152-1 )
Tris-HCl (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP153-1 )
Glycine (Fisher Scientific, Fisher ChemicalTM, catalog number: G48-212 )
Tween 20 (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP337-500 )
Sodium Hydroxide pellets (Fisher Scientific, Fisher ChemicalTM, catalog number: S318-1 )
Ethanol, absolute (200 proof) (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP2818500 )
N-ethylmaleimide (Thermo Fisher Scientific, catalog number: 23030 )
Iodoacetic acid (Thermo Fisher Scientific, catalog number: 35603 )
DTT (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP172-25 )
Bromophenol blue (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP115-25 )
Nitrocellulose (GE Healthcare, catalog number: 10600012 )
NaCl (Fisher Scientific, Fisher BioReagentsTM, catalog number: BP358-1 )
KCl (Fisher Scientific, Fisher ChemicalTM, catalog number: P217-3 )
Na2HPO4 (MP Biomedicals, catalog number: 02191440.1 )
KH2PO4 (MP Biomedicals, catalog number: 02195453.1 )
100% Methanol (Fisher Scientific, Fisher ChemicalTM, catalog number: A935-4 )
Glacial acetic acid (Fisher Scientific, catalog number: A38-212 )
Phenylmethylsulphonyl fluoride (PMSF) (ACROS ORGANICS, catalog number: 215740050 )
Ethylenediaminetetraacetic acid (EDTA) (Fisher Scientific, catalog number: 5312-500 )
Growth media for MCF10A cells (see Recipes)
Growth media for Caki-1 cells (see Recipes)
10x PBS (see Recipes)
1x PBS (see Recipes)
10x TBS (see Recipes)
1x TBS (see Recipes)
1x TBS 0.2% Tween (see Recipes)
1x SDS Running Buffer (see Recipes)
1x Transfer Buffer (see Recipes)
2 M DTT (see Recipes)
5x Loading Dye (see Recipes)
Blocking Buffer (see Recipes)
Primary antibody buffer (see Recipes)
Secondary antibody buffer (see Recipes)
Acid wash (see Recipes)
1 M Tris-HCl pH 8.0 (see Recipes)
1 M Tris-HCl pH 8.8 (see Recipes)
100 mM Phenylmethylsulphonyl fluoride (PMSF) (see Recipes)
100 mM Iodoacetic acid (see Recipes)
100 mM N-Ethylmaleimide (NEM) (see Recipes)
0.5 M Ethylenediaminetetraacetic acid (EDTA) pH 8.0 (see Recipes)
Deoxycholate lysis buffer (see Recipes)
SDS lysis buffer (see Recipes)
Equipment
Magnetic stirrer (Corning, catalog number: 440936 )
Rotor wheel (Thermo Fisher Scientific, catalog number: 88881001 )
Heating block (Thermo Fisher Scientific, catalog number: 88870001 )
Orbital Shaker (Corning, catalog number: 6780-FP )
Microcentrifuge (Eppendorf, model: 5424 R , catalog number: 5404000138)
Centrifuge (Thermo Fisher Scientific, model: SorvallTM Legend T plus , catalog number: 75004367)
Incubator (PHC, Panasonic, model: MCO-170AICUVL-PA )
Pipettes (5 ml; 10 ml, Fisher Scientific, FisherBrandTM, catalog numbers: 13-676-10C ; 13-676-10F )
Tissue culture hood (Thermo Fisher Scientific, catalog number: 1333 )
Autoclave
Odyssey Fc Imaging System (LI-COR, model number: 2800 )
Light microscope (Zeiss, model: ID03 )
Ice bucket
-20 °C freezer (Fisher Scientific, catalog number: 13-986-148 )
SDS PAGE apparatus and Transfer tank (Bio-Rad Laboratories, catalog number: 1658029fc )
Tray to set up transfer (12 ½" x 17 ½")
Software
LI-COR Lite (https://www.licor.com/bio/products/software/image_studio_lite/download.html)
ImageJ (https://imagej.nih.gov/ij/download.html)
Microsoft excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Varadaraj, A., Magdaleno, C. and Mythreye, K. (2018). Deoxycholate Fractionation of Fibronectin (FN) and Biotinylation Assay to Measure Recycled FN Fibrils in Epithelial Cells. Bio-protocol 8(16): e2972. DOI: 10.21769/BioProtoc.2972.
Download Citation in RIS Format
Category
Biochemistry > Protein > Self-assembly
Biochemistry > Protein > Isolation and purification
Molecular Biology > Protein > Isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,973 | https://bio-protocol.org/exchange/protocoldetail?id=2973&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo and in vitro 31P-NMR Study of the Phosphate Transport and Polyphosphate Metabolism in Hebeloma cylindrosporum in Response to Plant Roots Signals
CG Christine Le Guernevé
AB Adeline Becquer
MT Margarita Torres-Aquino
LA Laurie K Amenc
CT Carlos Trives-Segura
SS Siobhan Staunton
Claude Plassard
Hervé Quiquampoix
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2973 Views: 4979
Edited by: Marc-Antoine Sani
Reviewed by: Mukesh MahajanNeelanjan Bose
Original Research Article:
The authors used this protocol in Feb 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2017
Abstract
We used in vivo and in vitro phosphorus-31 nuclear magnetic resonance (31P-NMR) spectroscopy to follow the change in transport, compartmentation and metabolism of phosphate in the ectomycorrhizal fungus Hebeloma cylindrosporum in response to root signals originating from host (Pinus pinaster) or non-host (Zea mays) plants. A device was developed for the in vivo studies allowing the circulation of a continuously oxygenated mineral solution in an NMR tube containing the mycelia. The in vitro studies were performed on fungal material after several consecutive treatment steps (freezing in liquid nitrogen; crushing with perchloric acid; elimination of perchloric acid; freeze-drying; dissolution in an appropriate liquid medium).
Keywords: 31P-NMR spectroscopy Phosphate compartmentation Polyphosphate metabolism Ectomycorrhizal fungi
Background
The association between mycorrhizal fungi and plants improves the P nutrition of the host-plant (Smith and Read, 2008; Plassard and Dell, 2010; Cairney, 2011; Smith et al., 2015). This positive effect has been attributed primarily to phosphate (Pi) uptake by the fungal hyphae exploring a large volume of soil beyond the depletion zone around actively absorbing roots (Smith and Read, 2008; Cairney, 2011; Smith et al., 2015) and to the secretion of extracellular phosphatases by the fungal cells (Quiquampoix and Mousain, 2005). Absorbed Pi is partly incorporated into phosphorylated metabolites, phospholipids and nucleic acids, and partly condensed into polyphosphates (PolyP) where they constitute a storage pool in the vacuoles (Ashford et al., 1994). This protocol details a device that allows the study of Pi transport in fungal cell compartments and metabolism of PolyP by 31P-NMR spectroscopy. Mycelia are incubated without plants, with host plants or with non-host plants (Torres-Aquino et al., 2017). For the in vivo studies, this perfusion system permits the circulation of an oxygenated nutrient solution in an NMR tube so that the risk of liquid leakage in the NMR spectrometer is prevented. The in vitro studies are based on the perchloric acid extraction of the fungal mycelia. This protocol could be used for other fungal or plant species.
Materials and Reagents
50 ml Falcon® tube (Corning, catalog number: 352098 )
Sterile plastic Petri dish, 90 mm (Dominique DUTSCHER, Gosselin, catalog number: 688302 )
Sterile plastic Petri dish, 35 mm (Corning, Falcon®, catalog number: 351008 )
Nichrome wire, stainless steel, round, 22 gauge, 0.64 mm diameter (suppliers for electronic cigarettes)
Aluminum screw cap, 40 mm with rubber liner (VWR, SPV, catalog number: 215-2690 )
Multi-Purpose Silicone for kitchen or bathroom, 280 ml (Castorama, Rubson)
60 ml Luer-lock syringes (B. Braun Melsungen, Omnifix®, catalog number: 4613503F )
TeflonTM PTFE microtube, 1.15 mm and 1.75 mm for internal (int) and external (ext) diameter (diam), respectively (Dominique DUTSCHER, PTFE, catalog number: 091932 )
Needles 18 G 0.9 x 40 mm (Dominique DUTSCHER, BD MicrolanceTM 3, catalog number: 301300 )
Tubing, int diam 1.14 mm (Dominique DUTSCHER, Silicone, catalog number: 4906591 )
Tubing, int diam 3.17 mm (Dominique DUTSCHER, Silicone, catalog number: 4906600 )
Tubing, int diam 2.79 mm (Gilson, PVC, catalog number: F117948 )
Microtubes, 1.5 ml (Dominique DUTSCHER, Eppendorf, catalog number: 033511 )
Straight barbed reducing connectors (Cole-Parmer, catalog number: EW-50621-95 )
Valve Luer polycarbonate one way (Cole-Parmer, catalog number: EW-30600-01 )
Sterile syringe filters for air, 0.2 µm, 6.4 cm diam (Labomoderne, Midisart, catalog number: RS3320 )
Autoclavable Polypropylene bag, 3 L, non-printed (Dominique DUTSCHER, Gosselin, catalog number: 140230 )
Tips 1,200 µl for pipet (Dominique DUTSCHER, Sartorius, catalog number: 077200B )
Home-made syringe holder
Home-made needle holder for aeration
Folding skirted caps, 14.9 mm diam (Dominique DUTSCHER, Saint Gobain, catalog number: 110602 )
Paper for sterilization (Dominique DUTSCHER, catalog number: 006950 )
Surgical blade sterile No 21 (Dominique DUTSCHER, catalog number: 132521 )
Borosilicate glass capillaries with filament for easy filling, 1.5 mm outer diameter, 0.86 mm internal diameter (Harvard Apparatus, catalog number: 30-0057 )
10 mm diameter NMR tubes for in vitro studies (Norell, catalog number: 1008-UP-8 )
Specially homemade NMR tube for in vivo studies (see Figure 1)
Silicone film
Hebeloma cylindrosporum (ectomycorrhizal basidiomycete) (laboratory’s own collection, available upon request)
Pinus pinaster
Zea mays
Concentrated (30%) hydrogen peroxide (H2O2) solution (Sigma-Aldrich, catalog number: 216763-500ML-M )
Liquid nitrogen (Air Liquide)
Calcium sulfate dihydrate (CaSO4•2H2O) (Merck, catalog number: 102161 )
Thiamine hydrochloride –HCl (Sigma-Aldrich, catalog number: T4625-10G )
Manganese (II) sulfate monohydrate (MnSO4•H2O) (Sigma-Aldrich, catalog number: M7899-500G )
Zinc sulfate heptahydrate (ZnSO4•7H2O) (Sigma-Aldrich, catalog number: Z0251-100G )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: B6768-500G )
Copper (II) sulfate pentahydrate (CuSO4•5H2O) (Sigma-Aldrich, catalog number: C8027-500G )
Sodium molybdate dihydrate (Na2MoO4•2H2O) (Sigma-Aldrich, catalog number: M1651-100G )
Potassium nitrate (KNO3) (Sigma-Aldrich, catalog number: P8291-1KG )
Sodium phosphate monobasic monohydrate (NaH2PO4•H2O) (Sigma-Aldrich, catalog number: 71504-250G-M )
Magnesium sulfate heptahydrate (MgSO4•7H2O) (Sigma-Aldrich, catalog number: 63138-250G )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333-500G )
Calcium chloride dihydrate (CaCl2•2H2O) (Sigma-Aldrich, catalog number: C5080-500G )
Ferric ammonium citrate (Sigma-Aldrich, catalog number: RES20400-A702X )
D-glucose (Sigma-Aldrich, catalog number: G8270-1KG )
Agar-agar (Sigma-Aldrich, catalog number: A7002-500G )
MES (2-N-morpholino-ethanesulfonic acid, 4-morpholineethanesulfonic acid monohydrate) (Sigma-Aldrich, catalog number: 69892-500G )
Tris(hydroxymethyl)aminomethane (TRIS) (Sigma-Aldrich, catalog number: T1378-500G )
Methylenediphosphonic acid (MDP) (Sigma-Aldrich, catalog number: M9508-5G )
1 N sulfuric acid solution (Merck, catalog number: 109072 )
Perchloric acid 70% (HClO4) (Sigma-Aldrich, catalog number: 311421-250ML )
Sodium metavanadate (NaVO3) (Sigma-Aldrich, catalog number: 590088-25G )
Potassium bicarbonate (KHCO3) (Sigma-Aldrich, catalog number: 60339-500G )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758-500G )
Potassium hydroxide 1 N (KOH) (Merck, catalog number: 105029 )
4-Morpholinepropanesulfonic acid (MOPS) (Sigma-Aldrich, catalog number: M1254-250G )
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: S2002-100G )
Deuterium oxide (D2O) (Sigma-Aldrich, catalog number: 151882-100G )
Trace elements (see Recipes)
Mineral salt base solutions (see Recipes)
Thiamine solution (see Recipes)
N6 complete liquid solution (see Recipes)
Solid N6 complete liquid solution (see Recipes)
Interaction medium (IM) (see Recipes)
Equipment
Sample bottles,120 ml (VWR, SPV, catalog number: SPVAGO2246 )
Glass bottles, 1,000 ml, ISO borosilicate, graduated (Dominique DUTSCHER, catalog number: 046415 )
Glass bottles, 2,000 ml, ISO borosilicate, graduated (Dominique DUTSCHER, catalog number: 046416 )
Glass cylinder (diameter 7 mm)
Graduated borosilicate glass beaker 1,000 ml (Dominique DUTSCHER, catalog number: 068942 )
Polypropylene economical beaker 3,000 with moulded graduations (Dominique DUTSCHER, catalog number: 391134 )
Two pairs of stainless steel straight tweezers Wironit, Brucelles type, 130 mm (Dominique DUTSCHER, catalog number: 491037 )
A scalpel handle for blade 20 to 25 (Dominique DUTSCHER, catalog number: 3740004 )
A standalone burner (Dominique DUTSCHER, catalog number: 071109 )
Butane gas cartridge for the burner (Dominique DUTSCHER, catalog number: 060415 )
A nail, a hammer, scissors and cutting pliers
Incubator with controlled temperature set at 25 °C
Autoclave
Laminar flow cabinet
Cork-borer, 7.5 mm diameter (Dominique DUTSCHER, catalog number: 942783 )
High pressure O2 gas cylinder (Air products)
Centrifuge 5804 R, refrigerated, without rotor (Eppendorf, model: 5804 R , catalog number: 5805000017)
Rotor F-34-6-38, for 6 × 85 ml tubes, incl. rotor lid (Eppendorf, catalog number: 5804727002 )
Adapter for 50 ml Falcon tubes (Dominique DUTSCHER, catalog number: 033252 )
Peristaltic pump (Gilson Minipuls3)
Varian UNITY INOVA 500 MHz NMR spectrometer equipped with a 10 mm broad band probe operating at 202.4 MHz for 31P
Software
Microsoft Excel for calculations
Statistica 7.1 (StatSoft Inc., Tulsa, OK, USA) for statistical analysis
VnmrJ and ACDlabs for processing the 31P-NMR spectra
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Le Guerneve, C., Becquer, A., Torres-Aquino, M., Amenc, L. K., Trives-Segura, C., Staunton, S., Plassard, C. and Quiquampoix, H. (2018). In vivo and in vitro 31P-NMR Study of the Phosphate Transport and Polyphosphate Metabolism in Hebeloma cylindrosporum in Response to Plant Roots Signals. Bio-protocol 8(16): e2973. DOI: 10.21769/BioProtoc.2973.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Fungus
Biophysics > NMR spectroscopy > in vivo NMR spectroscopy
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,974 | https://bio-protocol.org/exchange/protocoldetail?id=2974&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Delivery of the Cas9 or TevCas9 System into Phaeodactylum tricornutum via Conjugation of Plasmids from a Bacterial Donor
HW Helen Wang
SS Samuel S. Slattery
BK Bogumil J. Karas
DE David R. Edgell
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2974 Views: 7577
Edited by: David Cisneros
Reviewed by: Ran Chen
Original Research Article:
The authors used this protocol in Feb 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2018
Abstract
Diatoms are an ecologically important group of eukaryotic microalgae with properties that make them attractive for biotechnological applications such as biofuels, foods, cosmetics and pharmaceuticals. Phaeodactylum tricornutum is a model diatom with defined culture conditions, but routine genetic manipulations are hindered by a lack of simple and robust genetic tools. One obstacle to efficient engineering of P. tricornutum is that the current selection methods for P. tricornutum transformants depend on the use of a limited number of antibiotic resistance genes. An alternative and more cost-effective selection method would be to generate auxotrophic strains of P. tricornutum by knocking out key genes involved in amino acid biosynthesis, and using plasmid-based copies of the biosynthetic genes as selective markers. Previous work on gene knockouts in P. tricornutum used biolistic transformation to deliver CRISPR-Cas9 system into P. tricornutum. Biolistic transformation of non-replicating plasmids can cause undesired damage to P. tricornutum due to random integration of the transformed DNA into the genome. Subsequent curing of edited cells to prevent long-term overexpression of Cas9 is very difficult as there is currently no method to excise integrated plasmids. This protocol adapts a new method to deliver the Cas9 or TevCas9 system into P. tricornutum via conjugation of plasmids from a bacterial donor cell. The process involves: 1) design and insertion of a guideRNA targeting the P. tricornutum urease gene into a TevCas9 expression plasmid that also encodes a conjugative origin of transfer, 2) installation of this plasmid in Escherichia coli containing a plasmid (pTA-Mob) containing the conjugative machinery, 3) transfer of the TevCas9 expression plasmid into P. tricornutum by conjugation, 4) screening of ex-conjugants for urease knockouts using T7 Endonuclease I and phenotypic screening, and 5) curing of the plasmid from edited cells.
Keywords: CRISPR-Cas9 Conjugation Phaeodactylum tricornutum Auxotroph Genome editing Diatoms
Background
The CRISPR system is a bacterial immune system that recognizes foreign DNA and leads to the activation of a targeted endonuclease, such as Cas9, which will generate a double strand break (DSB) in the invading DNA (Jinek et al., 2012; Wright et al., 2016). This system has been co-opted for genome editing applications whereby a single chimeric guide RNA (gRNA) can program Cas9 to target genes in model organisms, including in P. tricornutum (Daboussi et al., 2014). However, Cas9 generates blunt end DSB and the length of indels generated upon DNA repair is difficult to predict. Thus, in this study we used a dual endonuclease, TevCas9 to target the urease gene. TevCas9 is a dual endonuclease that is generated through the fusion of the I-TevI nuclease domain to Cas9 via a linker region (Wolfs et al., 2016). TevCas9 creates 33-36 bp deletions with non-compatible DNA ends (Wolfs et al., 2016). A previous study used transcription activator-like effector nucleases (TALENs) delivered by biolistic transformation (Weyman et al., 2015) to generate knockouts of the urease gene in P. tricornutum. To create an efficient system for gene editing in P. tricornutum, we adapted and optimized a plasmid-based system to deliver Cas9 or TevCas9 into P. tricornutum via conjugation from a bacterial donor cell (Karas et al., 2015). The new conjugation-based method to deliver Cas9 or TevCas9 described here is simpler, more efficient, and does not require specialized equipment for biolistic transformation (Slattery et al., 2018).
Materials and Reagents
Pipette tips, 100-1,250 μl (VWR, catalog number: 89079-470 )
Pipette tips, 1-200 μl (VWR, catalog number: 89079-478 )
Pipette tips, 0.1-10 μl (VWR, catalog number: 89079-464 )
1.5 ml Eppendorf tubes (Corning, Axygen®, catalog number: MCT-150-C )
0.2 ml PCR tubes (VWR, catalog number: 20170-012 )
Parafilm (Bemis, catalog number: PM996 )
50 ml centrifuge tubes (Greiner Bio One, catalog number: 227261 )
NalgeneTM filters (Thermo Fisher Scientific, catalog number: 595-4520 )
Phaeodactylum tricornutum cells [Culture Collection of Algae and Protozoa (CCAP, UK), catalog number: 1055/1 ] grown in 50 ml Falcon tubes
TransforMaxTM EPI300TM Chemically competent E. coli cells (Lucigen, catalog number: C300C105 )
pKS diaCas9_sgRNA plasmid (Addgene, catalog number: 74923 )
BsaI-HF restriction endonuclease (New England Biolabs, catalog number: R0535S )
P1 buffer (QIAGEN, catalog number: 19051 )
β-mercaptoethanol (VWR, catalog number: 97064-588 )
Alkaline lysis (P2) buffer (QIAGEN, catalog number: 19052 )
Neutralization (P3) buffer (QIAGEN, catalog number: 19053 )
Isopropanol (Sigma-Aldrich, catalog number: 190764 )
95% (v/v) EtOH (Commercial Alcohols, catalog number: P016EA95 )
T4 DNA ligase with buffer (New England Biolabs, catalog number: M0202S )
2-Propanol-205 (Caledon Laboratories, catalog number: 8601-7-40 )
BSA (Sigma-Aldrich, catalog number: A2058 )
BsaI (New England Biolabs, catalog number: R0535S )
EZ-10 spin column Miniprep Kit (Bio Basic, catalog number: BS614 )
EZ-10 spin column PCR product purification kit (Bio Basic, catalog number: BS363 )
Bacto agar (BD, BactoTM, catalog number: 214030 )
Agar A (Bio Basic, catalog number: FB0010 )
Yeast extract (BioShop, catalog number: YEX401 )
Bacteriological tryptone (BioShop, catalog number: TRP402 )
Sodium chloride (NaCl) (Fisher Scientific, Fisher Chemical, catalog number: S271-500 )
AmpliTaq 360 DNA polymerase, 10x buffer, and 25 mM Magnesium Chloride (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4398828 )
ZeocinTM (InvivoGen, catalog number: ant-zn-5p )
Ampicillin (BioShop, catalog number: AMP201.100 )
Gentamicin sulfate (Bio Basic, catalog number: GB0217 )
D-Glucose (BioShop, catalog number: GLU501.1 )
Zymolyase 20 T (BioShop, catalog number: ZYM001.1 )
Tris (Fisher Scientific, Fisher BioReagents, catalog number: BP152-5 )
Glycerol (Fisher Scientific, Fisher Chemical, catalog number: G33-1 )
Sodium sulfate (Na2SO4) (Fisher Scientific, Fisher Chemical, catalog number: S421-300LB )
Potassium chloride (KCl) (Merck, EMD Millipore, catalog number: PX1405-1 )
Sodium bicarbonate (NaHCO3) (Merck, EMD Millipore, catalog number: SX0320-1 )
Potassium bromide (KBr) (The Science Company, catalog number: NC-2136 )
Boric acid (H3BO3) (BioShop, catalog number: BOR001.1 )
Sodium fluoride (NaF) (Sigma-Aldrich, catalog number: S7920 )
Magnesium chloride hexahydrate (MgCl2•6H2O) (BioShop, catalog number: MAG510.1 )
Calcium chloride dihydrate (CaCl2•2H2O) (Fisher Scientific, catalog number: C79-3 )
Strontium chloride hexahydrate (SrCl2•6H2O) (Sigma-Aldrich, catalog number: 255521 )
Sodium nitrate (NaNO3) (Fisher Scientific, catalog number: S343-500 )
Sodium phosphate monobasic monohydrate (NaH2PO4•H2O) (Sigma-Aldrich, catalog number: S9638 )
Iron(III) chloride hexahydrate (FeCl3•6H2O) (Sigma-Aldrich, catalog number: 236489 )
Na2EDTA•2H2O (Bio Basic, catalog number: EB0185 )
Copper (II) sulfate pentahydrate (CuSO4•5H2O) (Bio Basic, catalog number: CDB0063 )
Sodium molybdate dihydrate (Na2MoO4•2H2O) (Avantor Performance Materials, catalog number: 3764-01 )
Zinc sulfate heptahydrate (ZnSO4•7H2O) (Alfa Aesar, catalog number: A12915-36 )
Cobalt (II) chloride hexahydrate (CoCl2•6H2O) (Sigma-Aldrich, catalog number: C3169 )
Manganese(II) chloride tetrahydrate (MnCl2•4H2O) (BioShop, catalog number: MAN222 )
Selenous acid (H2SeO3) (Sigma-Aldrich, catalog number: 229857 )
Nickel(II) sulfate (NiSO4) (Sigma-Aldrich, catalog number: 656895 )
Sodium orthovanadate (Na3VO4) (BioShop, catalog number: SPP310 )
Potassium chromate (K2CrO4) (Sigma-Aldrich, catalog number: 216615 )
Thiamine-HCl (Sigma-Aldrich, catalog number: 47858 )
Biotin (Sigma-Aldrich, catalog number: B4639 )
Cyanocobalamin (Sigma-Aldrich, catalog number: C3607 )
Zymogen solution (see Recipes)
Lysis buffer for P. tricornutum cells (see Recipes)
LB medium (see Recipes)
SOC media (see Recipes)
LB agar plates (see Recipes) containing 100 μg ml-1 ampicillin or 100 μg ml-1 ampicillin with 40 μg ml-1 gentamicin
50% L1, 5% LB, 1% agar plate (1 L) (see Recipes)
L1 media (see Recipes)
L1 agar plates (see Recipes) containing 50 μg ml-1 ZeocinTM
2x Aquil salt (see Recipes)
NP stock (see Recipes)
1,000x L1 trace metals (see Recipes)
Vitamin solution (see Recipes)
Equipment
Qubit® 2.0 Fluorometer (Thermo Fisher Scientific, InvitrogenTM, model: Qubit® 2.0 , catalog number: Q32866)
Heat block (VWR, catalog number: 13259-030 )
Water bath (Fisher Scientific, model: IC 2100 )
Micropipettes (PIPETMAN, variable volume)
Binocular Microscope (Leitz Wetzlar, model: Labolux12 )
Hemocytometer
Table top centrifuge (Hettich Lab Technology, catalog number: 2004-01 )
Centrifuge (Beckman Coulter, model: Avanti® J-26 XPI , catalog number: 393127)
PCR thermal cycler (Bio-Rad Laboratories, model: T100TM, catalog number: 1861096 )
UV-visible spectrophotometer (Biochrom, model: ULTROSPEC 2100® , catalog number: 80-2112-21)
Incubator shaker (Thermo Fisher Scientific, model: Large Incubated and Refrigerated, catalog number: SHKE5000-7 )
Vortex
Autoclave
Refrigerator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, H., Slattery, S. S., Karas, B. J. and Edgell, D. R. (2018). Delivery of the Cas9 or TevCas9 System into Phaeodactylum tricornutum via Conjugation of Plasmids from a Bacterial Donor. Bio-protocol 8(16): e2974. DOI: 10.21769/BioProtoc.2974.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,975 | https://bio-protocol.org/exchange/protocoldetail?id=2975&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Random Insertional Mutagenesis of a Serotype 2 Dengue Virus Clone
Jeffrey W. Perry
AT Andrew W. Tai
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2975 Views: 4829
Edited by: Modesto Redrejo-Rodriguez
Reviewed by: Sesha Lakshmi Arathi Paluri
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
Protein tagging is a powerful method of investigating protein function. However, modifying positive-strand RNA virus proteins in the context of viral infection can be particularly difficult as their compact genomes and multifunctional proteins mean even small changes can inactivate or attenuate the virus. Although targeted approaches to functionally tag viral proteins have been successful, these approaches are time consuming and inefficient. A strategy that has been successfully applied to several RNA viruses is whole-genome transposon insertional mutagenesis. A library of viral genomes, each containing a single randomly placed small insertion, is selected by passaging in cell culture and the insertion sites can be identified using Next Generation Sequencing (NGS). Here we describe a protocol for transposon mutagenesis of the 16681 strain of dengue virus, serotype 2. Mutant dengue virus libraries containing short randomly placed insertions are passaged through mammalian cells and insertions are mapped by NGS of the viable progeny. The protocol is divided into four stages: transposon mutagenesis of a dengue cDNA clone, viral genome transfection into permissive cells, isolation of viral progeny genomes, and sequencing library preparation.
Keywords: Transposon Mutagenesis RNA virus Dengue Flavivirus
Background
A key aspect of understanding viral pathogenesis is elucidating the viral proteins’ functions during infection. However, viral proteins, particularly those encoded by compact viral genomes, are often multifunctional and therefore more challenging to study, in part because they are often difficult to tag (epitope tags, fluorescent proteins, etc.) in the context of an infectious virus genome without compromising viral infection. One workaround is to express individually tagged proteins in cells, which may result in an incomplete picture of the viral protein’s function as the other viral proteins are not present. It also does not directly determine if the functional tag interferes with the tagged protein’s function(s) in viral infection. Another approach is the empiric tagging of viral proteins in the context of an infectious virus genome, which ensures viral viability but is an inefficient process that is difficult to scale.
Transposon mutagenesis can help dissect the functions of proteins under various experimental conditions and has been used at a whole genome scale to elucidate the role of various proteins during microbial infections. This approach has been successfully applied to a number of positive-strand RNA viruses (Arumugaswami et al., 2008; Beitzel et al., 2010; Teterina et al., 2011; Thorne et al., 2012; Remenyi et al., 2014; Eyre et al., 2017; Fulton et al., 2017). By coupling the transposon mutagenesis approach to Next Generation Sequence, a map of sites in the viral genome that tolerate insertions can be determined with unprecedented resolution. Once these sites are identified, functional tags can be introduced into these sites through site-directed mutagenesis. This protocol describes whole-genome transposon insertion mapping applied to the 16681 strain of serotype 2 dengue virus.
Materials and Reagents
Pipette tips (Fisher Scientific, catalog numbers: 02-707-80 ; 02-707-167 )
6-well plate (Corning, catalog number: 3506 )
0.22 μm sterile filter (Corning, catalog number: 431219 )
Cell scraper (Corning, catalog number: 3010 )
10-beta chemically competent E. coli (New England Biolabs, catalog number: C3019H ) or equivalent–genotype used Δ(ara-leu) 7697 araD139 fhuA ΔlacX74 galK16 galE15 e14- ϕ80dlacZΔM15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 Δ(mrr-hsdRMS-mcrBC)
Primers
Fragment A (SacI/NarI) forward with T7 sequence
GAAATTAATACGACTCACTATAAGTTGTTAGTCTACGTG
Fragment A (SacI/NarI) reverse
GTCATAGTGGCGCCTACCATAACCATCACTCTTCCC
Fragment B (NarI/EcoRV) forward
GGTTATGGTAGGCGCCACTATGACGGATGAC
Fragment B (NarI/EcoRV) reverse
CTGCTTCCTGATATCTCTGCCTGGTCTTCCC
Fragment C (EcoRV/XbaI) forward
GACCAGGCAGAGATATCAGGAAGCAGTCCAATCC
Fragment C (EcoRV/XbaI) reverse
AGAACCTGTTGATTCAACAGCAC
Ion Torrent P1 adaptor top oligo
CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT
Ion Torrent P1 adaptor bottom oligo
<phos>ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT
Modified Ion Torrent A adaptor top oligo
<phos>GGCCGCCTGAGTCGGAGACACGCAGGGATGAGATGGTT
Modified Ion Torrent A adaptor bottom oligo
CGGACTCAGCCTCTGTGCGTCCCTACTCTACC
SacI (New England Biolabs, catalog number: R3156 )
NarI (New England Biolabs, catalog number: R0191 )
EcoRV (New England Biolabs, catalog number: R3195 )
XbaI (New England Biolabs, catalog number: R0145 )
NotI (New England Biolabs, catalog number: R0189 )
Mutation Generation System kit (Thermo Fisher Scientific, catalog number: F-701 )
Carbenicillin (Fisher Scientific, catalog number: BP26481 )
Kanamycin (Thermo Fisher Scientific, catalog number: 11815024 )
Promega Wizard Maxiprep kit (Promega, catalog number: A7270 )
Promega Gel Purification kit (Promega, catalog number: A9281 )
m7g(5')ppp(5')A RNA Cap Structure analog (New England Biolabs, catalog number: S1405S )
Agarose (Thermo Fisher Scientific, catalog number: 16500100 )
Q5 polymerase (New England Biolabs, catalog number: M0493 )
T7 MEGAscript in vitro RNA translation kit (Thermo Fisher Scientific, catalog number: AM1334 )
ZYMO Quick-RNA Viral kit (ZYMO RESEARCH, catalog number: R1034 )
Applied Biosciences High Capacity cDNA kit (Thermo Fisher Scientific, catalog number: 4368814 )
Ion Library Taqman Quantitation kit (Thermo Fisher Scientific, catalog number: 4468802 )
10x TBE (Fisher Scientific, catalog number: BP1333 )
T4 DNA ligase (New England Biolabs, catalog number: M0202 )
T4 PNK (New England Biolabs, catalog number: M0201 )
dNTPs (Thermo Fisher Scientific, catalog number: R1121 )
AMPure XP Beads (Beckman Coulter, catalog number: A63881 )
LB medium (Fisher Scientific, catalog number: BP1425-500 )
PEG 8000 (Thermo Fisher Scientific, catalog number: BP233-100 )
Vero cells (ATCC, catalog number: CCL-81 )
TransMessenger transfection reagent (QIAGEN, catalog number: 301525 )
Full-length dengue virus clone 16681 serotype 2 cDNA (in plasmid pD2/IC-30P-NBX, Huang et al., 2010).
Note: This cDNA was a generous gift of Dr. Huang from the Centers for Disease Control.
Equipment
Note: No specific equipment is necessary and any model of the following should suffice.
Balance
Pipettes
Heat block
Incubator
Thermal cycler
Water bath
Microcentrifuge
Magnet for Ampure XP bead purification
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Perry, J. W. and Tai, A. W. (2018). Random Insertional Mutagenesis of a Serotype 2 Dengue Virus Clone. Bio-protocol 8(16): e2975. DOI: 10.21769/BioProtoc.2975.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,976 | https://bio-protocol.org/exchange/protocoldetail?id=2976&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Fusarium graminearum Knockout Mutants by the Split-marker Recombination Approach
WW Wan-Qiu Wang
Wei-Hua Tang
Published: Aug 20, 2018
DOI: 10.21769/BioProtoc.2976 Views: 5673
Download PDF
Ask a question
Favorite
Cited by
Abstract
Fusarium graminearum is a destructive phytopathogen and shows an impressive metabolic diversity. Gene deletion is an important and useful approach for gene function study. Here we present a protocol for generating gene deletion mutant by applying “split-marker” deletion strategy (Catlett et al., 2003) with PEG-mediated protoplast transformation (Yuan et al., 2008; Martín, 2015).
Keywords: Fusarium graminearum Gene knock out Split-marker recombination
Materials and Reagents
Pipette tips (Corning, Axygen®, catalog number: T-300-R-S )
Sterile centrifuge tube (Corning, Axygen®, catalog number: MCT-150-C )
PCR tubes (Corning, Axygen®, catalog number: PCR-02-C )
50 ml volume centrifuged tubes (Corning, Axygen®, catalog number: SCT-50ML-25-S )
Scalpel (Fisher Scientific, catalog number: 08-920B )
15 ml volume centrifuge tube (Corning, Axygen®, catalog number: SCT-15ML-25-S )
Petri dish
Medical gauze (regular cotton yarn, Shanghai Honglong Medical Material Company)
Niex nylon membrane
Sterile toothpicks
Fungal strains: F. graminearum PH-1(NRRL 31084)
Primers (store at 4 °C for using within one month, store at -20 °C for using within six months)
Primer HY-F
Primer HY-R
Primer YG-F
Primer YG-R
Primer Up-F
Primer Up-R
Primer ID-F
Primer ID-R
Primer ID-2F
Primer ID-2R
Ampicillin sodium Salt (Yeasen, catalog number: 60203ES60 )
Hygromycin B (Sigma-Aldrich, Roche Diagnostics, catalog number: 10843555001 )
Chloroform (Sinopharm Chemical Reagent, catalog number: 10006818 )
Isopropyl alcohol (Sinopharm Chemical Reagent, catalog number: 80109218 )
75% ethanol (Sinopharm Chemical Reagent, catalog number: 80176961 )
Sterile ddH2O
AxyPrepTM DNA Gel Extraction kit (Corning, Axygen®, catalog number: AP-GX-250 )
KOD FX PCR kit (TOYOBO, catalog number: KOD-101 )
Agarose (Biowest, catalog number: 111860 )
TAE buffer (Thermo Fisher Scientific, catalog number: B49 )
Lysing enzymes (Sigma-Aldrich, catalog number: L1412 )
Driselase (Sigma-Aldrich, catalog number: D9515 )
Chitinase (Sigma-Aldrich, catalog number: C6137 )
KCl (Sinopharm Chemical Reagent, catalog number: 10016318 )
Ampicillin (Yeasen, catalog number: 60203ES10 )
Yeast extract (Thermo Fisher Scientific, OxoidTM, catalog number: LP0021B )
Casamino acids (Sigma-Aldrich, catalog number: 22090 )
Sucrose (Sinopharm Chemical Reagent, catalog number: 10021418 )
CaCO3 (Sinopharm Chemical Reagent, catalog number: 10005717 )
Tris (AMRESCO, catalog number: 0826 )
CaCl2 (Sinopharm Chemical Reagent, catalog number: 10005861 )
PEG4000 (Sinopharm Chemical Reagent, catalog number: 30151626 )
NaCl (Sinopharm Chemical Reagent, catalog number: 10019318 )
EDTA (Sinopharm Chemical Reagent, catalog number: 10009617 )
Peptone (Sinopharm Chemical Reagent, catalog number: 10014963 )
D-glucose (Sinopharm Chemical Reagent, catalog number: 10010518 )
V8 juice (Campbell Soup Company)
CTAB (Sinopharm Chemical Reagent, catalog number: 30037416 )
Plasmid pUCATPH (the sequence can be download from website: http://www.snapgene.com/resources/plasmid_files/yeast_plasmids/pUCATPH/)
Genomic DNA preparation of F. graminearum in ddH2O
0.22 μm PES membrane (Merck, catalog number: GPWP14250 )
YEPD liquid medium (see Recipes)
Mycelium enzymolysis mixture (see Recipes)
STC buffer (see Recipes)
PTC (see Recipes)
TB3 plate (see Recipes)
Low-melting-temperature TB3 (see Recipes)
V8 juice agar (see Recipes)
1.5x CTAB (see Recipes)
Mung bean liquid medium (see Recipes)
1.2 M KCl (see Recipes)
Equipment
Hemocytometer (0.10 mm, 1/400 mm2) (QIUJING, model: XB-K-25 )
Flask (SiQi, model: SP250SJ )
Electronic balance (OHAUS, model: AR1140 )
Mold incubator (Yiheng, model: MJ-150-I )
Micropipettes (Eppendorf)
Gel electrophoresis chamber (Tanon, model: EPS300 )
Gel apparatus (Helixx Mupid-exU) and image system (Tanon gel image system, model: 1600 )
Microcentrifuge (Eppendorf, model: 5418 , catalog number: 022620304)
Centrifuge (Beckman Coulter, model: Avanti® J-E )
PCR system (Bio-Rad Laboratories, model: S1000 )
Orbital shaker (Kylin-Bell Lab Instruments, model: TS-2 )
Shaker (Boyn Industria, model: THZ-C-1 )
Biological safety cabinet (ESCO Micro, model: FHC1200A )
Microscope (Olympus, model: BX51 )
Autoclave (SANYO, model: MLS-3781L-PC )
Ultra-low Temperature Freezer (Thermo Fisher Scientific, model: TSE400V )
Tube holder (LUOBENDE)
Tissuelyser II (QIAGEN, model: 85300 )
Growth chamber (JIANGNAN INSTRUMENT, model: RXZ-1000 )
DuoFlow pH Monitor (Bio-Rad Laboratories, model: 760-2040 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,977 | https://bio-protocol.org/exchange/protocoldetail?id=2977&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pollen Germination and Pollen Tube Growth of Arabidopsis thaliana: In vitro and Semi in vivo Methods
HD Hugh Dickinson
JR Josefina Rodriguez-Enriquez
R Robert Grant-Downton
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2977 Views: 14565
Reviewed by: Samik BhattacharyaIgor Cesarino
Original Research Article:
The authors used this protocol in Jan 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2013
Abstract
Studies of pollen germination and post-germination development are not only essential for understanding plant reproduction but also are an excellent model system for tip-based growth. Here we describe easy, reproducible methods for germination and growth of pollen from the model plant Arabidopsis thaliana in artificial conditions. Our growth system can be used both for pollen placed directly on this artificial substrate as well as for the so-called ‘semi in vivo’ method. This is where a pistil is cut shortly after hand-pollination and the pollen tubes grow through the plant tissue and emerge from the cut end onto the surface of the artificial medium.
Keywords: Arabidopsis thalian Pollen Germination Pollen tube In vitro Semi in vivo
Background
The pollen of flowering plants is widely used as a model system for rapid, tip-based growth. Naturally, studies of pollen biology are also essential for understanding plant fertility and reproductive development. However, a simple and reliable method for germinating pollen from the model plant Arabidopsis thaliana and sustaining rapid, morphologically normal pollen tube growth in vitro has been frustratingly elusive. Prior to developing our own method (Rodriguez-Enriquez et al., 2013), described here, we attempted to replicate several published methods, but after numerous attempts we failed to generate satisfactory results. For instance, replicating Boavida and McCormick’s method in the lab was difficult as it has a remarkably narrow temperature optimum (22 °C) and this is a situation that clearly does not reflect the reproductive biology of A. thaliana in vivo (Boavida and McCormick, 2007). Furthermore, there are issues with germination rate and local pollen density in this method that also do not entirely reflect natural events on the stigmatic surface. Our first clue that there were key ‘missing factors’ necessary for reliable pollen germination in vitro came from observations that placing stigmatic surfaces of A. thaliana on such artificial media stimulated high levels of pollen germination in the region around the stigmatic surface. This happened even when the pollen grains were not in any direct contact with this plant tissue. Subsequently, experimental work established that two factors were particularly important (Rodriguez-Enriquez et al., 2013). Firstly, the use of cellulosic membrane on the surface of the agarose-based medium–which likely acted to mimic the ‘dry stigma’ environment that A. thaliana pollen encounters in vivo. Secondly, we discovered that the polyamide spermidine is a potent stimulant of pollen germination. We also found several other factors that contribute to the success and reproducibility of the experiments (Rodriguez-Enriquez et al., 2013). Below, we describe in detail a step-by-step method for in vitro germination of pollen from A. thaliana Columbia (Col) and Landsberg erecta (Ler) ecotypes, the two commonly used lab ecotypes.
After our study was published, several groups have employed our method in experimental work on A. thaliana (Waterworth et al., 2015; MacAlister et al., 2016; Rottmann et al., 2016). Intriguingly, by using a modified version of our system, Rottmann et al. (2016) proved that our medium could support pollen tube growth emerging from the severed end of pollinated pistils where the style had been cut and the tissue laid on the medium. Previously, Qin et al. (2009) had achieved this “semi in vivo” growth technique using a different medium and demonstrated that pollen tube growth through the style elicited a novel transcriptome when compared with pollen grains grown in vitro at a comparable developmental stage. Here, we confirm that this technique works well with our novel medium first described in Rodriguez-Enriquez et al. (2013), and give a step-by-step protocol to permit its replication. This technical modification might be useful to study a number of processes. For example, it allows the evaluation of whether maternal factors on the stigmatic surface and style affect pollen germination and pollen tube growth rates, as the number of pollen tubes and the timing of their emergence can be visualized and quantified.
Materials and Reagents
Materials
Glass microscope slides
Falcon tubes
Glass pipettes
Cellophane membrane (Cellulose) (Innovia Films, catalog number: 325P )
pH indicator strips:
Paper DOSATEST, pH 0-14 (VWR, catalog number: 35309.606 )
DOSATEST, pH 7-14 (VWR, catalog number: BDH35312.607 )
Plant material: Arabidopsis thaliana
Notes:
We use Arabidopsis thaliana plants grown under standard environmental glasshouse conditions for this species, at 25 °C and where necessary with supplemental lighting (optimally, by high-pressure sodium grow light bulbs) to maintain conditions of 140 μmol•m-2•sec-1 with a 16 h day length. Inferior levels of illumination were associated with much poorer levels of pollen germination in our experience. Plants were grown in a 4:1 ratio of multipurpose peat-based compost to horticultural vermiculite. Plant quality is paramount for consistency in these experiments.
To maintain good plant growth, we were careful not to grow the seedlings at high or even medium densities in the pots (normally 3-5 plants in a 9 cm diameter pot). It is better to sow seeds in situ, if possible, and to thin out the seedlings to this small number as soon as they appear.
It is essential never to water overhead when flowering as irrigating in this way will increase the probability that pollen in opening flowers is rendered inviable due to rupturing of pollen grains. We ensure that plants are watered well by placing the pots in plastic seed trays without holes and keeping up to 2 cm of water in the bottom of the tray.
We like to add a small amount (c. 0.75 g) of slow release Osmocote fertilizer to the tray to guarantee the plants have a constant supply of nutrients.
It is very important to harvest the flowers for pollen germination in the correct developmental stage, for consistency. Only plants that had already progressed into flowering and just started to develop seed pods (siliques) on the main inflorescence axis should be used. It is also most important to avoid using the pollen from older plants that have started to exit the flower production process (i.e., those with fewer unopened flower buds than siliques and mature flowers), since they have a dramatically declining percentage of pollen germination.
Chemical reagents
Note: All of the following are stored at room temperature unless otherwise stated.
Agarose (e.g., Molecular Grade, Bioline, catalog number: BIO-41025 )
Boric acid (Sigma-Aldrich, catalog number: B9645 )
Calcium chloride (Sigma-Aldrich, catalog number: C1016 )
Calcium nitrate (Sigma-Aldrich, catalog number: C1396 )
Casein enzymatic hydrolysate (N-Z-Amine A) (Sigma-Aldrich, catalog number: C0626 ), stored at 4 °C
Distilled, autoclaved water
Ferric ammonium citrate (Sigma-Aldrich, catalog number: F5879 )
Note: Deliquescent and light sensitive, ensure storage in a tightly sealed light-proof container.
Gamma amino butyric acid (GABA) (Sigma-Aldrich, catalog number: A2129 )
Myo-inositol (Sigma-Aldrich, catalog number: I5125 ), stored at 4 °C
Potassium hydroxide
Spermidine (Sigma-Aldrich, catalog number: S0266 )
Note: Store at 4 °C; spermidine is highly hygroscopic and air-sensitive so always ensure that the lid is very well sealed.
Sucrose (Sigma-Aldrich, catalog number: S9378 )
Standard solution (see Recipes)
Sucrose stock solution
Boric acid stock solution
Calcium chloride stock solution
Calcium nitrate stock solution
Potassium chloride stock solution
Casein enzymatic hydrolysate stock solution
Ferric ammonium citrate stock solution
Myo-inositol stock
Spermidine stock
GABA stock
Equipment
PAP Pen (e.g., Liquid Block Super PAP pen; Daido Sangyo Saitama, Japan)
Microscope slide boxes
Water bath or dry heat block
Temperature controlled oven
Pipettes
Tweezers
Scalpel/razor blade
Fine scissors
Small glass beaker
Microwave
Photomicroscope, with multiple lenses and camera unit
Hand-held counter
Software
ImageJ software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Dickinson, H., Rodriguez-Enriquez, J. and Grant-Downton, R. (2018). Pollen Germination and Pollen Tube Growth of Arabidopsis thaliana: In vitro and Semi in vivo Methods. Bio-protocol 8(16): e2977. DOI: 10.21769/BioProtoc.2977.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > Morphogenesis
Developmental Biology > Cell growth and fate > Germination
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,978 | https://bio-protocol.org/exchange/protocoldetail?id=2978&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
CRISPR/Cas Gene Editing of a Large DNA Virus: African Swine Fever Virus
Manuel V. Borca
KB Keith A. Berggren
ER Elizabeth Ramirez-Medina
EV Elizabeth A. Vuono
Douglas P. Gladue
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2978 Views: 8677
Edited by: Modesto Redrejo-Rodriguez
Reviewed by: Covadonga Alonso
Original Research Article:
The authors used this protocol in Feb 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2018
Abstract
Gene editing of large DNA viruses, such as African swine fever virus (ASFV), has traditionally relied on homologous recombination of a donor plasmid consisting of a reporter cassette with surrounding homologous viral DNA. However, this homologous recombination resulting in the desired modified virus is a rare event. We recently reported the use of CRISPR/Cas9 to edit ASFV. The use of CRISPR/Cas9 to modify the African swine fever virus genome resulted in a fast and relatively easy way to introduce genetic changes. To accomplish this goal we first infect primary swine macrophages with a field isolate, ASFV-G, and transfect with the CRISPR/Cas9 donor plasmid along with a plasmid that will express a specific gRNA that targets our gene to be deleted. By inserting a reporter cassette, we are then able to purify our recombinant virus from the parental by limiting dilution and plaque purification. We previously reported comparing the traditional homologous recombination methodology with CRISPR/Cas9, which resulted in over a 4 log increase in recombination.
Keywords: ASFV African swine fever ASF CRISPR CRISPR/Cas9
Background
African Swine Fever (ASF) is a highly lethal contagious viral disease of swine caused by ASF virus (ASFV). The genome of ASFV consists of a double-stranded DNA genome of approximately 180-190 kilobase pairs. ASFV causes a spectrum of disease, from highly lethal to sub-clinical, depending on host characteristics and the virus strain (Tulman et al., 2009). There is no commercial vaccine for ASFV; experimentally, the only vaccines that have shown to protect against the current circulating strain from the outbreak in Georgia in 2007 (ASFV-G) are live attenuated vaccines that contain one or more deletions to the viral genome, for example: (O' Donnell et al., 2015). Traditionally, gene deletions for ASFV have been performed by homologous recombination where a donor plasmid containing homologous genomic sequences is used for gene deletion (O' Donnell et al., 2015), however this only occurs at a very low rate, making production of recombinant ASFV difficult (Borca et al., 2018).
Recently we reported the use of CRISPR/Cas9 as an alternative approach to introduce gene deletions in ASFV, with a 4 log increase over traditional methods (Borca et al., 2018). This increase, in recombination using CRISPR/Cas9, allows for easier production and purification of recombinant viruses from the parental wild-type. It is possible that using CRISPR/Cas9 will allow for viral protein mutations, expanding our abilities to dissect critical domains for virulence, possibly even in genes that have been previously determined to be essential. This approach has successfully been reported with other large DNA viruses including Orthopox (Okoli et al., 2018), Vaccinia virus (Yuan et al., 2015 and 2016), Herpes Simplex virus (Suenaga et al., 2014) and Pseudorabies (Tang et al., 2016).
Materials and Reagents
Pipette tips 10 μl, 200 μl, 1,000 μl (Thermo Fisher Scientific, Thermo ScientificTM, catalog numbers: 2140-05 , 2160P , 2079 )
PrimariaTM 6-well plates (Corning, catalog number: 353846 )
PrimariaTM Tissue culture flasks T-75 filtered flasks (Corning, Falcon®, catalog number: 353824 )
50 ml Conical tube (Corning, Falcon®, catalog number: 352098 )
Polypropylene microcentrifuge tubes
T-25 flask (Corning, catalog number: 3056 )
T-150 flask (Corning, catalog number: 3151 )
0.22 μm filter (Corning, catalog number: 430769 )
African swine fever virus field isolates such as ASFV-G (isolated from infected swine serum and adding serum to swine macrophages to propagate the virus. Titrations were done as described by Enjuanes et al., 1976).
Yorkshire pigs aged 3-12 months as blood donors
Cas9 donor plasmid (custom designed for target of interest by blue heron bio. See attached insertion cassette sequence (Supplemental file)
Fugene HD (Active Motif, catalog number: 32042 )
gRNA plasmids (custom designed for target of interest by blue heron bio.)
OptiMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 31985062 )
Phosphate Buffered Saline (PBS) 1x, pH 7.0-7.3 (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 )
0.5 M EDTA pH 8.0 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575020 )
Ficoll-Paque PLUS density gradient of 1.077 g/ml (GE Healthcare, catalog number: 17144002 )
RPMI 1640 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 11875093 )
Gamma Irradiated Fetal bovine serum (GE Healthcare, HycloneTM, catalog number: SH30071.03 )
Antibiotic-Antimycotic (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 15240096 )
Gentamycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15750060 )
HEPES 1 M (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
L-Glutamine, 200 nM (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
L929 media (L cell, L929, derivative of Strain L) (ATCC, catalog number: CCL-1 )
Heparin (Sagent Pharmaceuticals, catalog number: 400-10 )
L929 conditioned media (see Recipes)
Macrophage Wash Media (see Recipes)
Macrophage complete media (see Recipes)
PBS + EDTA (see Recipes)
Equipment
P1,000, P200, P20, P10 Pipettes (Gilson)
2 Liter roller bottles (Corning, catalog number: 431329 )
250 ml centrifuge bottles (Thermo Fisher Scientific, Thermo ScientificTM, NalgeneTM, catalog number: 3141-0250 )
Inverted Fluorescent Microscope (Carl-Zeiss)
Hematocytometer
Pipet aid (Drummond Scientific, catalog number: 4-000-101 )
Tabletop Centrifuge (Eppendorf, model: 5810 )
Floor Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: Sorvall® RC-4 )
Sorval SLA-1500 fixed angle rotor (Thermo Fisher Scientific, model: SLA-1500 )
Vortex mixer (Fisher Scientific, catalog number: 12-812 )
-70 °C freezer (Thermo Scientific, model: ULT2586-9-A40 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Borca, M. V., Berggren, K. A., Ramirez-Medina, E., Vuono, E. A. and Gladue, D. P. (2018). CRISPR/Cas Gene Editing of a Large DNA Virus: African Swine Fever Virus. Bio-protocol 8(16): e2978. DOI: 10.21769/BioProtoc.2978.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,979 | https://bio-protocol.org/exchange/protocoldetail?id=2979&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Studying the Role of Microglia in Neurodegeneration and Axonal Regeneration in the Murine Visual System
AH Alexander M Hilla
DF Dietmar Fischer
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2979 Views: 11335
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
Microglia reside in the central nervous system (CNS) and are involved in the maintenance of the physiologic state. They constantly survey their environment for pathologic alterations associated with injury or diseases. For decades, researchers have investigated the role of microglia under different pathologic conditions, using approaches aiming to inhibit or eliminate these phagocytic cells. However, until recently, methods have failed to achieve complete depletion. Moreover, treatments often affected other cells, making unequivocal conclusions from these studies difficult. Recently, we have shown that inhibition of colony stimulating factor 1 receptor (CSF1R) by oral treatment with PLX5622 containing chow enables complete depletion of retinal microglia and almost complete microglia depletion in the optic nerve without affecting peripheral macrophages or other cells. Using this approach, we investigated the role of microglia in neuroprotection in the retina and axon regeneration in the injured optic nerve under different conditions. Thus, this efficient, reliable and easy to use protocol presented here will enable researchers to unequivocally study the contribution of microglia on neurodegeneration and axon regeneration. This protocol can be also easily expanded to other paradigms of acute and chronic injury or diseases in the visual system.
Keywords: Axon regeneration Neurodegeneration Microglia Microglia depletion PLX5622 CSF1R
Background
Microglia are resident immune cells of the central nervous system (CNS), which continuously scan their environment for pathologic alterations (Nimmerjahn et al., 2005). Upon detection of such conditions, microglia transform into an activated state and migrate towards the source where they perform different tasks (Kreutzberg, 1996; Davalos et al., 2005). Pathologic alterations, such as neurodegenerative diseases or acute injuries, are associated with neuronal loss and phagocytosis of these dying cells by activated microglia. Therefore, the overall assumption is that microglia are involved in this process (Thanos, 1991; Davalos et al., 2005; Hanisch and Kettenmann, 2007). Besides a possible effect of microglia on dying neurons, microglia are also part of the glial scar, which is formed at the lesion site and impairs axon regeneration in the CNS (Silver, 2004; Kitayama et al., 2011). However, as a clear discrimination of infiltrated blood born macrophages and microglia in the injured nerve was not feasible, the specific role of microglia in glial scar formation and axonal regeneration remained elusive (Silver, 2004; Hanisch and Kettenmann, 2007; Prinz and Priller, 2014; Hilla et al., 2017).
A suitable model to address the role of microglia in CNS degeneration and axonal regeneration is the visual pathway with its retinal ganglion cells (RGCs), whose axons project through the optic nerve (Leibinger et al., 2009; Fischer and Leibinger, 2012). Upon axonal damage, axons normally fail to regenerate (Thanos, 1991; Fischer et al., 2000). The degenerative and regenerative processes, following acute injury, can be easily visualized in retinal wholemounts and optic nerves, respectively as presented in the current protocol. Furthermore, the visual system and particularly RGCs are a suitable model to study neurodegenerative processes in chronic diseases such as multiple sclerosis or glaucoma (Kerrison et al., 1994; Howell et al., 2007; Diekmann and Fischer, 2013; Dietrich et al., 2018). In addition, the optic nerve is widely used as a classical model to study general regenerative failure in the CNS and strategies to facilitate axon growth (Fischer and Leibinger, 2012).
Several studies have been published, suggesting detrimental effects of microglia on RGC survival and axon regeneration whereas other studies indicate a beneficial, neuroprotective role (Thanos et al., 1993; Levkovitch-Verbin et al., 2006; Bosco et al., 2008; Chen et al., 2012; Rice et al., 2015). However, due to a paucity of depletion methods, many studies initially analyzed the contribution of microglia by altering their activation state with pharmacologic approaches (Thanos et al., 1993; Levkovitch-Verbin et al., 2006; Bosco et al., 2008; Jiao et al., 2014). In recent years, genetic methods were developed to achieve microglia depletion (Heppner et al., 2005; Bruttger et al., 2015; Waisman et al., 2015). However, apart from the requirement of transgenic animals, these methods have potential drawbacks such as the development of astrogliosis, secretion of pro-inflammatory cytokines and blood-brain-barrier damage, which complicate data interpretation. Only recently, pharmacologic colony stimulating factor 1 receptor (CSF1R) inhibitors PLX3397 and PLX5622 have been developed, which allow near complete depletion of microglia in the CNS independent of the animals genetic background (Elmore et al., 2014; Spangenberg et al., 2016; Hilla et al., 2017). In fact, we have recently demonstrated that an oral PLX5622 treatment for 21 days leads to a complete depletion of microglia in the retina and almost a total elimination in the optic nerve (Hilla et al., 2017). In accordance with previous studies, this approach selectively induces apoptosis of microglia by CSF1R inhibition, while other phagocytic cells such as peripheral macrophages are not affected (Elmore et al., 2014; Hilla et al., 2017). Although some studies suggested that this treatment causes minor astrocyte activation in the brain, we did not find any in the optic nerve or retina (Elmore et al., 2014; Hilla et al., 2017). Furthermore, as the inhibitor is orally bioavailable and capable of passing the blood brain barrier, PLX5622 can be formulated in standard rodent chow preventing the necessity of regular injections. Thus, this approach allows scientists to unequivocally address the role of microglia for different pathologic CNS paradigms, such as injury or chronic diseases, not only in the visual system, but also in other prominent CNS tissues such as brain and spinal cord. Using this approach in the visual pathway, we found that microglia neither affect the degeneration process of RGCs nor their capability to regenerate injured axons into the optic nerve upon an acute injury (Hilla et al., 2017). The current protocol describes the method for depleting microglia in the visual system and how effects on acute degeneration of RGCs and axon regeneration in the optic nerve can be quantified to identify the contribution of microglia in this context. This protocol can be easily expanded to investigate the involvement of microglia in other paradigms of acute and chronic injury or diseases in the visual system.
Materials and Reagents
Glass capillary (World Precision Instruments, catalog number: 1B100F-6 )
Glass slide (VWR, catalog number: 631-0108 )
Surgical filament (Ethicon, catalog number: EH7790 )
Scalpel blades (B. Braun Melsungen, catalog number: BB511 )
Swabs (Lohmann & Rauscher, catalog number: 13356 )
Nitrocellulose membrane (GE Healthcare, catalog number: RPN303E )
Male and female mice aged between 6-10 weeks
CSF1R-inhibitor PLX5622 (PLX, Plexxikon, commercially not available)
AIN-76A standard rodent chow (Research Diets)
Ketamine (Grovet, Alfasan, Medistar, catalog number: 10002 )
Xylazine (Bayer, Rompun® 2% Injection 25 ml)
Cholera toxin subunit B, Alexa FluorTM 555 (CTB) (Thermo Fisher Scientific, InvitrogenTM, catalog number: C22843 )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, catalog number: 14190-094 )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: 252549 )
Sucrose (Sigma-Aldrich, catalog number: S9378 )
KP-CryoCompound (KLINIPATH, catalog number: 1620-C )
Double distilled H2O (Carl Roth, catalog number: 3478.2 )
Eye ointment (DR. WINZER, Gent-Ophtal®)
Methanol (Sigma-Aldrich, catalog number: 179957 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Iba1 antibody (Wako Pure Chemical Industries, catalog number: 019-19741 , RRID: AB_839504, LOT-specific concentration: 1 mg/ml)
βIII-tubulin antibody (BioLegend, catalog number: 801202 , RRID: AB_2313773, LOT-specific concentration: 1 mg/ml)
RNA-binding protein with multiple splicing (RBPMS) antibody (Abcam, catalog number: ab194213 , LOT-specific concentration: 0.25 mg/ml)
Secondary antibodies
Donkey anti mouse 488 (Thermo Fisher Scientific, catalog number: A-21202 , RRID: AB_141607, LOT-specific concentration: 2 mg/ml)
Donkey anti rabbit 594 (Thermo Fisher Scientific, catalog number: A-21207 , RRID: AB_141637, LOT-specific concentration: 2 mg/ml)
Donkey serum (Bio-Rad Laboratories, catalog number: C06SB )
Bovine serum albumin (Sigma-Aldrich, catalog number: A3294 )
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
Paraformaldehyde (PFA) solution (see Recipes)
Sucrose solution (see Recipes)
Blocking solution (sections) (see Recipes)
Blocking solution (wholemount) (see Recipes)
Equipment
Jeweler's forceps (Fine Science Tools, catalog number: 11254-20 )
Capsulotomy scissor (Hermle, catalog number: 564 )
Mouse head holder (KOPF INSTRUMENTS, catalog number: 921-E )
Cryostat (Leica Biosystems, model: CM3050 S )
Fluorescence microscope (ZEISS, model: Axio Observer.D1 )
Confocal laser scanning microscope (Leica Microsystems, model: Leica TCS SP8 )
Binocular (ZEISS, model: Stemi DV4 SPOT )
Cold light source (SCHOTT, model: KL 1600 LED )
Software
Excel 2016 (Microsoft)
SigmaStat 3.1 (Systat)
Photoshop CS6 (Adobe)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Hilla, A. M. and Fischer, D. (2018). Studying the Role of Microglia in Neurodegeneration and Axonal Regeneration in the Murine Visual System. Bio-protocol 8(16): e2979. DOI: 10.21769/BioProtoc.2979.
Hilla, A. M., Diekmann, H. and Fischer, D. (2017). Microglia are irrelevant for neuronal degeneration and axon regeneration after acute injury. J Neurosci 37(25): 6113-6124.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Neuroscience > Cellular mechanisms > Microglia
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
298 | https://bio-protocol.org/exchange/protocoldetail?id=298&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Adoptive Transfer of Isolated Bone Marrow Neutrophils
JB Jimena Tosello Boari
Eva Acosta Rodríguez
Published: Vol 2, Iss 23, Dec 5, 2012
DOI: 10.21769/BioProtoc.298 Views: 17914
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
Adoptive transfer experiments of specific cell populations are widely used methods to assess the role of the injected population on an ongoing process. In the last years, new and unprecedented roles in the regulation of immune responses have been reported for neutrophils. The following protocol is to be used to isolate neutrophils from bone marrow and to inject them in an appropriate host to test the role of neutrophils during infection, inflammation or other pathological conditions.
Materials and Reagents
Mice: Donor 8-12 week-old mice and sex-matched receptors. We always used C57BL/6 mice but it should work for any mice strain.
Red blood lysing buffer Hybri-Max (Sigma-Aldrich, catalog number: R7757 )
PBS (Life Technologies, Gibco®, catalog number: 10010-023 )
EDTA (Life Technologies, Gibco®, catalog number: 15575-020 )
Fetal Bovine Serum (FBS) (PAA Laboratories GmbH, catalog number: A15-201 )
Anti-Ly-6G Microbead kit (Miltenyi Biotec, catalog number: 130-092-332 )
0.4% Trypan blue solution (Sigma-Aldrich, catalog number: T8154 )
PE-Cy7 labeled anti mouse Ly-6G (eBioscience, catalog number: 25-5931 )
FITC labeled anti mouse CD11b (eBioscience, catalog number: 11-0112 )
Isoflurane
Flushing/washing buffer (see Recipes)
MACS buffer (modified) (see Recipes)
Equipment
LS column (Miltenyi Biotec, catalog number: 130-042-401 )
Laminar Flow Cabinet
MACS separators
Centrifuge Eppendorf 5810R (Eppendorf, model: 5811000.010 )
Centrifuge rotor for plates A-4-62 (Eppendorf, model: 5810709.008 )
Optic microscope
Counting Neubauer chamber
Flow cytometer BD FACS Canto II
Automatic pipettes (full range volumes)
Sterile forceps and scissors
Tips (full range volumes)
Microtubes (1.5 ml)
Tubes (15 and 50 ml)
Culture dishes (45 mm)
Conventional Insulin 1 ml syringes with detachable needle (25G) (BD Biosciences, catalog number: 329651 )
Low-dead volume insulin 1 ml syringes (29G) (BD Biosciences, catalog number: 329410 )
Cell strainer 40 μm (BD Biosciences, catalog number: 352340 )
Bell jar
0.2 μm filter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell function > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Neutrophil survival time in mice after adoptive transfer
0 Answer
16 Views
Dec 28, 2022
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.