id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
2,980 | https://bio-protocol.org/exchange/protocoldetail?id=2980&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Identification and Quantitation of Leukocyte Populations in Human Kidney Tissue by Multi-parameter Flow Cytometry
KK Katrina Kildey
BL Becker M.P. Law
KM Kimberly A. Muczynski
RW Ray Wilkinson
Helen Healy
AK Andrew J. Kassianos
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2980 Views: 8213
Edited by: Xiaoyi Zheng
Reviewed by: Haixia Xu
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
Inflammatory immune cells play direct pathological roles in cases of acute kidney injury (AKI) and chronic kidney disease (CKD). However, the identification and characterization of distinct populations of leukocytes in human kidney biopsies have been confounded by the limitations of immunohistochemical (IHC)-based techniques used to detect them. This methodology is not amenable to the combinations of multiple markers necessary to unequivocally define discrete immune cell populations. We have developed a multi-parameter, flow cytometric-based approach that addresses the need for panels of cell-specific markers in the identification of immune cell populations, allowing both the accurate detection and quantitation of leukocyte subpopulations from a single, clinical kidney biopsy specimen. In this approach, fresh human kidney tissue is dissociated into a single cell suspension followed by antibody-labeling and flow cytometric-based acquisition and analysis. This novel technique provides a major step forward in identifying and enumerating immune cell subpopulations in human kidney disease and is a powerful platform to complement traditional histopathological examinations of clinical kidney biopsies.
Keywords: Leukocytes Kidney Flow cytometry Kidney biopsy Immunology
Background
Diseases of the kidney are rising in incidence and prevalence, placing a significant burden on the healthcare community worldwide and significantly affecting patients’ quality of life (World Kidney Day: Chronic Kidney Disease, 2015). Kidney damage can arise from a wide range of insults including infections, ischemia, toxins, hypertension, genetic and metabolic disorders (Imig and Ryan, 2013). The immediate response to insult functionally is acute kidney injury (AKI), a clinical syndrome characterised physiologically by a rapid (hours to days) decrease in kidney function and histomorphologically by infiltration of inflammatory immune cells into the renal tubulointerstitium, the tissue compartment adjoining the tubules of the kidney (Basile et al., 2012). The subsequent biological responses aim to limit ongoing injury and repair damaged tissue. If unresolved, this inflammation may lead to chronic kidney disease (CKD). CKD is defined as a loss in kidney function that persists for at least 3 months in duration and is characterized histomorphologically, regardless of its cause, by tubulointerstitial fibrosis and chronic inflammation (Kawakami et al., 2014). The presence of inflammatory immune cells in human AKI and CKD is suggestive of functional roles in disease progression. However, the identification and enumeration of these CD45+ leukocyte populations in human kidney tissue remain poorly defined.
Until now, the identification of immune cells in human kidney disease has primarily been made using immunohistochemistry (IHC). Numerous IHC-based studies of kidney biopsies report strong associations between the loss of renal function/tubulointerstitial injury and the prominent accumulation of inflammatory immune cell populations of distinct leukocyte lineages, including: T cells (CD3+ cells [Hoffmann et al., 2006]), T helper cells (CD4+ cells [Liu et al., 2012; Pei et al., 2014]), cytotoxic T cells (CD8+ cells [Pei et al., 2014]), B cells (CD19+ or CD20+ cells [Heller et al., 2007]), natural killer (NK) cells (CD16+ or CD56+ cells [Furuichi et al., 2001; Hidalgo et al., 2010; Shin et al., 2015]), monocytes/macrophages (CD14+ cells [Zhou et al., 2010]), dendritic cells (DC) (HLA-DR+ cells [Hart et al., 1981; Markovic-Lipkovski, 1990] or DC-SIGN+ cells [Segerer et al., 2008; Pei et al., 2014]) and granulocytes (neutrophils, basophils, eosinophils; CD15+ or CD16+ cells [Weidner et al., 2004; Segerer et al., 2006]).
However, IHC staining for single antigens is not sufficiently specific to directly identify these immune cell populations, given the broader expression of many of these markers on several leukocyte and non-hematopoietic cell types. For example, single staining for DC-SIGN to identify DC will be non-specific given its co-expression on monocytes/macrophages in kidney tissue (Figel et al., 2011). Similarly, using CD16 or CD56 to identify NK cells will be inadequate, with both markers also expressed on T cells (Markey and MacDonald, 1989; Trinchieri, 1989). Furthermore, IHC-based methods are unable to effectively distinguish expression levels of these antigens, required, for instance, to distinguish subsets of functionally specialized NK cells – CD56bright CD16-/low NK cells and CD56dim CD16+ NK cells. Clearly, a progression to multi-parameter staining methodologies is required to more accurately detect and quantify immune cell populations in human kidney disease.
We have developed a novel protocol for obtaining single cell suspensions from fresh kidney biopsies to allow the identification and enumeration of immune cells subsets via multi-color flow cytometry (Kassianos et al., 2013; Law et al., 2017 and 2018; Muczynski et al., 2018). Biopsy tissue (excess to diagnostic purposes) is obtained with informed patient consent, followed by enzymatic digestion into single cells and finally, antibody labeling for acquisition by flow cytometry. This process enables precision in detecting discrete immune cell populations based on the absence/presence and intensity of multiple markers. This approach also allows differentiation of populations based on cell size (forward scatter; FSC), granularity (side scatter; SSC), cell viability (Near-IR) and absolute immune cell counts (fluorescent counting bead standard). This single platform approach is proving versatile in answering basic research questions in kidney disease and is readily translatable to human diagnostics of the future, where immune cell populations may become prognostic markers for the progressive loss of kidney function.
Materials and Reagents
Samco Extra Fine-tip polyethylene transfer pipettes (Thermo Fisher Scientific, Fisher ScientificTM, Molecular BioProducts, catalog number: 231 )
1.5 ml microcentrifuge tubes (Eppendorf, catalog number: 0030125150 )
5 ml polystyrene round-bottom tubes (flow cytometry tubes) (Corning, Falcon®, catalog number: 352008 )
Flow-Count Fluorospheres (Beckman Coulter, catalog number: 7547053 )
Aluminum foil
Hank's balanced salt solution (HBSS + Calcium + Magnesium) (Thermo Fisher Scientific, GibcoTM, catalog number: 14025076 )
Hank's balanced salt solution (HBSS, no calcium, no magnesium) (Thermo Fisher Scientific, GibcoTM, catalog number: 14175095 )
Collagenase P (Roche Molecular Systems, catalog number: 11213857001 ) (2 mg/ml stock)
DNase I (Roche Molecular Systems, catalog number: 11284932001 ) (10 mg/ml stock)
Trypsin-EDTA (0.05%), phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 25300054 )
Sodium Azide (Sigma-Aldrich, catalog number: S2002 )
Fetal Bovine Serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 1009141 )
RPMI 1640 Medium (Thermo Fisher Scientific, GibcoTM, catalog number: 11875119 )
Bovine Serum Albumin (Sigma-Aldrich, catalog number: A7906-500G )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: 158127 )
Phosphate buffered saline (PBS)
LIVE/DEADTM Fixable Near-IR Dead Cell Stain Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: L10119 )
Human TruStain FcXTM (BioLegend, catalog number: 422302 )
Brilliant Violet 510TM anti-human CD45 Antibody clone HI30 (e.g., BioLegend, catalog number: 304036 )
Phycoerythrin (PE) Mouse Anti-Human CD19 Antibody clone HIB19 (e.g., BD, catalog number: 555413 )
PE-CF594 Mouse Anti-Human CD16 clone 3G8 (e.g., BD, catalog number: 562320 )
Alexa Fluor® 700 anti-human CD14 Antibody clone M5E2 (e.g., BioLegend, catalog number: 301822 )
Brilliant Violet 605TM anti-human CD4 Antibody clone OKT4 (e.g., BioLegend, catalog number: 317437 )
Brilliant Violet 650TM anti-human CD3 Antibody clone OKT3 (e.g., BioLegend, catalog number: 317323 )
FITC anti-human CD8a Antibody clone RPA-T8 (e.g., BioLegend, catalog number: 301006 )
PerCP/Cy5.5 anti-human CD56 (NCAM) Antibody clone HCD56 (e.g., BioLegend, catalog number: 318322 )
Brilliant Violet 785TM anti-human HLA-DR Antibody clone L243 (e.g., BioLegend, catalog number: 307642 )
Digestion solution I (see Recipes)
Digestion solution II (see Recipes)
FACS buffer (see Recipes)
1% PFA (see Recipes)
Equipment
Vortex
Benchtop centrifuge
Timer
FACS flow cytometer (BD, model: LSRFortessaTM , 4 laser)
Conventional cell culture incubator (37 °C/5% CO2)
Software
FlowJo version 10.1.0 (FlowJo LLC, https://www.flowjo.com)
BD FACSDivaTM software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kildey, K., Law, B. M., Muczynski, K. A., Wilkinson, R., Healy, H. and Kassianos, A. J. (2018). Identification and Quantitation of Leukocyte Populations in Human Kidney Tissue by Multi-parameter Flow Cytometry. Bio-protocol 8(16): e2980. DOI: 10.21769/BioProtoc.2980.
Download Citation in RIS Format
Category
Immunology > Immune cell staining > Flow cytometry
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,981 | https://bio-protocol.org/exchange/protocoldetail?id=2981&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative ChIP-seq by Adding Spike-in from Another Species
KN Kongyan Niu
RL Rui Liu
NL Nan Liu
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2981 Views: 20371
Edited by: Neelanjan Bose
Reviewed by: Sabine Le Saux
Original Research Article:
The authors used this protocol in May 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2018
Abstract
Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a routine procedure in the lab; however, epigenome-wide quantitative comparison among independent ChIP-seq experiments remains a challenge. Here, we contribute an experimental protocol combined with a computational workflow allowing quantitative and comparative assessment of epigenome using animal tissues.
Keywords: Epigenome H3K27me3 Quantitative ChIP-seq Spike-in Drosophila
Background
Chromatin and epigenetic complexes that modify histones regulate the accessibility of DNA to transcriptional machinery, thereby permitting direct control of gene expression. To characterize the epigenomic feature of histone modification, chromatin immunoprecipitation followed by sequencing (ChIP-seq) has become a widely used method. However, traditional ChIP-seq protocols are not inherently quantitative and therefore prohibit direct comparison between samples derived from distinct cell types or cells that have been through different genetic or chemical perturbation. Despite the fact that several in silico normalization methods have been proposed to overcome this disadvantage, an experiment-based strategy is still lacking. In 2014, Orlando et al. (2014) developed a method, called ChIP with reference exogenous genome (ChIP-Rx), which utilizes a constant amount of reference or ‘‘spike-in’’ epigenome for cell-based comparison among epigenomes. In current protocol, we have refined this method by using the percentage of mapped spike-in reference epigenome. And we have successfully applied this protocol in direct comparison between two or more ChIP-seq datasets from animal tissues.
Materials and Reagents
Consumables
Pipette tips
1.5 ml microcentrifuge tube
15 ml microcentrifuge tube
1.5 ml Bioruptor Microtubes (Diagenode, catalog number: C30010016 )
10 cm Petri-dish
Glass Dounce tube
Biological materials
Mouse Neuro-2a cells
Drosophila (1,000 embryos [30 min-1 h after egg-laying], 30 larvae [96 h after egg-laying], and 30 pupae [7 d after egg-laying])
Starting material: Cells were cultured at 37 °C, 5% CO2, and saturated humidity in complete LG-DMEM (Thermo Fisher Scientific, Life Technologies, catalog number: 11995-065 ) containing 10% FBS (Sigma-Aldrich, catalog number: 12003C ), seeded at 1.0 x 106 cells/cm2 in a 10 cm Petri-dish. Flies were cultured in standard Drosophila media (Recipe 1) at 25 °C with 60% humidity in a 12 h light and 12 h dark cycle unless otherwise specified.
Reagents
ChIP reagents
Formaldehyde, 37% (weight/volume) (Sigma-Aldrich, catalog number: 252549 ), stored at room temperature (20-25 °C)
Glycine (Sigma-Aldrich, catalog number: G7403 ), stored at room temperature (20-25 °C)
PBS buffer, 20x (Sangon Biotech, catalog number: B548117 ), stored at room temperature (20-25 °C)
RIPA buffer (Sigma-Aldrich, catalog number: R0278 ), stored at 4 °C
Tris buffer, 1 M, PH 8.0 (Sangon Biotech, catalog number: B548127 ), stored at room temperature (20-25 °C)
Sodium chloride, 5 M (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9759 ), stored at room temperature (20-25 °C)
Triton X-100 (Sigma-Aldrich, catalog number: T8787 ), stored at 4 °C
EDTA, 0.5 M, pH 8.0 (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9260G ), stored at room temperature (20-25 °C)
SDS, 10% (weight/volume) (Sangon Biotech, catalog number: B548118 ), stored at room temperature (20-25 °C)
cOmplete proteinase inhibitors cocktail tablets (Roche Diagnostics, catalog number: 11697498001 ), stored at 4 °C
Dynabeads Protein G (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10004D ), stored at 4 °C
Anti-trimethyl Histone H3 (Lys27) antibody (Merck, catalog number: 07-449 ), stored at -20 °C
Sodium bicarbonate (Sangon Biotech, catalog number: A100865 ), stored at room temperature (20-25 °C)
Proteinase K (Sangon Biotech, catalog number: A600451 ), stored at -20 °C
RNase A, 10 mg/ml (Thermo Fisher Scientific, catalog number: EN0531 ), Stored at -20 °C
PCR purification kit (QIAGEN, catalog number: 28106 ), stored at room temperature (20-25 °C)
Qubit dsDNA HS assay kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32854 ), stored at 4 °C (Warning: protect from light)
Trypsin (Thermo Fisher Scientific, catalog number: 25300054 )
Liquid nitrogen
Glycine, 2.5 M (see Recipes)
ChIP Wash Buffer (see Recipes)
ChIP Final Wash Buffer (see Recipes)
ChIP Elution Buffer (see Recipes)
Library reagents
Agencourt AMPure XP (SPRI beads; Beckman Coulter, catalog number: A63881 ), stored at 4 °C
NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, catalog number: E7370L ), stored at -20 °C
NEBNext Multiplex Oligos for Illumina (New England Biolabs, catalog number: E7335L ), stored at -20 °C
Gel extraction kit (QIAGEN, catalog number: 20021 ), stored at room temperature (20-25 °C)
Sodium hydroxide solution, 10 M (Sigma-Aldrich, catalog number: 72068 )
Equipment
Bioruptor Pico (Diagenode)
DynaMag-2 magnet (Thermo Fisher Scientific, catalog number: 12321D )
Mortar and pestle
1 ml glass homogenizer
Water bath
Rotate
Centrifuge
Vortexing
QuantStudio 6 Flex real-time PCR system (Thermo Scientific, USA)
Qubit 2.0 Fluorometer (Life Technologies)
Agilent Bioanalyzer 2100
Illumina Miseq System
Illumina Nextseq 550 System
Software
Quality check of sequence reads: FastQC v0.11.7
(http://www.bioinformatics.babraham.ac.uk/projects/fastqc/)
Read mapping: Bowtie2-2.2.9 (Langmead and Salzberg, 2012)
Determination of the normalization factor: deeptools-2.2.4 (Ramirez et al., 2014)
Quantitative analyses: Bwtool (Pohl and Beato, 2014)
Peak calling: homer-v4.8.3 (Heinz et al., 2010)
Peak visualization: IGV-2.3.31 (Robinson et al., 2011)
J-circos-V1 (An et al., 2015)
Procedure
Crosslinking and lysis of mammalian cells and fly tissues
Mouse Neuro-2a cells
Grow mouse Neuro-2a cells to a level of ~106 cells per 10 cm Petri-dish. For this experiment, use ~106 cells. Aspirate and discard the medium. Wash two times each with 4 ml 1x PBS pre-warmed in a 37 °C water bath. Add 1 ml trypsin (Thermo Fisher Scientific, USA) and incubate at 37 °C for 2 min. Quench by adding 3 ml standard cell culture medium. Collect the mixture into a 15 ml centrifuge tube.
Add 108 μl of 37% formaldehyde (Sigma, USA) to a final concentration of 1% (weight/volume) for crosslinking. Rotate at room temperature for 10 min.
Stop crosslinking with 200 μl of 2.5 M glycine (Sigma, USA) for 5 min at room temperature. Centrifuge at 1,000 x g for 3 min at 4 °C. Discard the supernatant.
Resuspend the pellet by adding 1 ml ice-cold 1x PBS with 1x cOmplete proteinase inhibitor (Roche, Germany), and transfer it into a 1.5 ml microcentrifuge tube.
Centrifuge at 1,000 x g for 3 min at 4 °C. After removing the supernatant, wash the pellet two times each with 1 ml ice-cold 1x PBS containing 1x cOmplete proteinase inhibitor (Roche, Germany).
Add 1 ml of 1x RIPA buffer (Sigma, USA) supplemented with 1x cOmplete proteinase inhibitor (Roche, Germany). Incubate at 4 °C for 30 min.
Fly tissues
For developmental stages, use 1,000 embryos (30 min-1 h after egg-laying), 30 larvae (96 h after egg-laying), and 30 pupae (7 d after egg-laying). For adult stage, use 100 dissected fly muscles and 200 fly heads at each time point.
Collect samples into a 1.5 ml microcentrifuge tube and immediately freeze samples in liquid nitrogen.
Grind tissues into fine powder using mortar and pestle pre-cooled with liquid nitrogen.
Resuspend the fine powder in 1.2 ml 1x PBS. Add 32.4 μl of 37% formaldehyde (Sigma, USA). Incubate at room temperature for 10 min. To quench formaldehyde, add 60 μl of 2.5 M glycine (Sigma, USA). Centrifuge at 5,000 x g for 5 min at 4 °C. After removing the supernatant, wash the pellet three times with 1 ml ice-cold 1x PBS containing 1x cOmplete proteinase inhibitor (Roche, Germany).
Add 1 ml of 1x RIPA buffer (Sigma, USA) supplemented with 1x cOmplete proteinase inhibitor (Roche, Germany). Homogenize the tissue pellet with a glass Dounce tube, and transfer it into a 1.5 ml microcentrifuge tube. Rotate at 4 °C for 1 h.
Sonication
Split the lysate into 250 μl aliquots for four pre-chilled 1.5 ml Bioruptor microtubes (Diagenode, Belgium).
For mouse Neuro-2a cells, sonicate at 4 °C using Bioruptor Pico (Diagenode, Belgium) for 6 cycles with 15 sec on and 15 sec off. For fly tissues, sonicate at 4 °C using Bioruptor Pico (Diagenode, Belgium) for 15 cycles with 30 sec on and 30 sec off.
Transfer sonicated samples into a 1.5 ml microcentrifuge tube.
Centrifuge at 12,000 x g for 20 min at 4 °C, and transfer the supernatant to a new tube.
Store sonicated samples at -80 °C.
Determination of chromatin size and concentration
Use 30 μl aliquot of chromatin sample from the sonicated lysate, and add 90 μl of 1x RIPA buffer (Sigma, USA).
Add 1 μl RNase A (Thermo Scientific, USA), and incubate at 37 °C for 30 min to remove RNA.
To reverse crosslinking, add 5.04 μl of 5 M NaCl (Thermo Scientific, USA), and incubate at 65 °C for 4 h.
Add 1.5 μl of 0.5 M EDTA (Thermo Scientific, USA) and 1.2 μl of 20 mg/μl proteinase K (Sangon Biotech, China) at 55 °C for 2 h.
Isolate DNA by PCR purification kit (QIAGEN, Germany), and elute DNA in 30 μl of Milli-Q water.
Quantify DNA by Qubit dsDNA HS assay kit (Thermo Scientific, USA). A concentration of about 2-3 ng/μl DNA (~30 μl) would be expected from 200 fly heads.
Examine the chromatin DNA on a 1.5% agarose gel to visualize average size. The optimal size range is between 100 bps and 300 bps. If the chromatin is not in that range, adjust sonication conditions by adding more pulses and repeat Step C3.
Chromatin immunoprecipitation
According to the DNA mass (the volume of fly sample x the concentration of fly sample measured in Procedure C), add 5% (weight/weight) of the mouse epigenome to the fly sample, and mix well. Save 1% (volume/volume) of the sample to a new tube as ChIP input control, and freeze at -20 °C until the elution step.
Add 3 μg antibody, and rotate at 4 °C for 5 h.
Place a magnetic stand (Thermo Scientific, USA) on ice. Add 30 μl Dynabeads (Thermo Scientific, USA) to a 1.5 ml microcentrifuge tube, and wash three times with 1x RIPA buffer (Sigma, USA). Collect beads using magnetic stand (Thermo Scientific, USA), and remove supernatant by aspiration.
Add samples (Fly + Mouse Neuro-2a + antibody) to the pre-washed Dynabeads (Thermo Scientific, USA). Gently mix overnight on a rotator at 4 °C.
Apply ChIP sample to an ice-cold magnetic stand (Thermo Scientific, USA). Remove supernatant by aspiration.
Wash the beads one time with 1x RIPA buffer (Sigma, USA).
Wash the beads two times with ChIP Wash Buffer.
Wash the beads one time with ChIP Final Wash Buffer.
Elution, crosslinking reversal and DNA isolation
Resuspend the beads in 120 μl of ChIP Elution Buffer. Incubate at 65 °C for 30 min.
Add 1 μl RNase A (Thermo Scientific, USA), and incubate at 37 °C for 30 min to remove RNA. At the same time, dilute input sample with 1x RIPA buffer (Sigma, USA) to 120 μl, and incubate with 1 μl RNase A (Thermo Scientific, USA) at 37 °C for 30 min.
To reverse crosslinking, add 5.04 μl of 5 M NaCl (Thermo Scientific, USA), and incubate at 65 °C for 4 h.
Add 1.5 μl of 0.5 M EDTA (Thermo Scientific, USA) and 1.2 μl of 20 mg/μl proteinase K (Sangon Biotech, China) at 55 °C for 2 h.
Isolate DNA by PCR purification kit (QIAGEN, Germany), and elute DNA in 50 μl water.
Quantify DNA by Qubit dsDNA HS assay kit (Thermo Scientific, USA). A concentration of about 0.15-0.3 ng/μl DNA (~50 μl) would be expected from one experiment of immunoprecipitation.
Quality control for ChIP experiment
Performing ChIP-qPCR assays
Design primers to yield PCR product between 100 bps and 200 bps.
Dilute input DNA with RIPA buffer to the same concentration with IP DNA.
Set up real-time PCRs in triplicate with SYBR selected master mix (Thermo Scientific, USA), and the same volume of diluted input DNA and IP DNA.
Mix the samples by vortexing for 2 sec and precipitate samples by brief centrifugation.
Perform real-time PCR with the QuantStudio 6 Flex real-time PCR system (Thermo Scientific, USA) using cycling conditions as shown in the flowing table:
Calculate the fold difference between the experimental sample and negative control.
Preparing high-throughput sequencing library
Use 5-10 ng of DNA harvested by ChIP experiment to generate sequencing library using NEB DNA library prep kit (NEB, USA).
Check the quality of libraries with Bioanalyzer 2100 (Agilent, USA).
Perform quantification by qRT-PCR with a reference to a standard library.
Pool the libraries together in equimolar amounts to a final 2 nM concentration.
Denature the normalized libraries with 0.1 M NaOH (Sigma, USA).
Sequence the pooled libraries on the Miseq/Next-seq platform (Illumina, USA) with single end 100 bps.
Data analysis
The following procedures showed the detailed steps for data analysis (Figure 1).
Figure 1. Overview of ChIP-seq analysis
Sequence quality check
Use FastQC to assess the read quality by importing data from FastQ files.
Read mapping
Map Sequence reads to the reference genome dm6 (Drosophila) or mm10 (mouse), respectively with Bowtie2-2.2.9 by default parameters.
># Map Sequencing reads to the reference genome mm10
>nohup bowtie2 -x / seqlib/igenome/Mus_musculus/UCSC/mm10/Sequence/Bowtie2Index/genome -U {sample}.fastq.gz -S {sample}_mm10.sam --no-unal &
># Map Sequencing reads to the reference genome dm6
>nohup bowtie2 -x / seqlib/igenome/Drosophila_melanogaster/UCSC/dm6/Sequence/Bowtie2Index/genome -U {sample}.fastq -S {sample}_dm6.sam --no-unal &
># For sample in ChIP_dm6, do the following
># Convert file from sam to bam
>samtools view -Sb {sample}_dm6.sam > {sample}_dm6_nonSorted.bam
># Sort BAM file
>samtools sort {sample}_dm6_nonSorted.bam -o {sample}_dm6_Sorted.bam
># Create index files
>samtools index {sample}_dm6_Sorted.bam
Determination of the normalization factor
For quantitative comparison, we derive of the scale factor for each sample using the percentage of mapped reads from mouse genome to total reads. Details are as follows:
Combine the number of mapped reads from Drosophila and mouse genomes as total mapped reads for each sample.
Let:
α = the spike-in scale factor
β = the histone modification level
γ = the percentage of input mouse reads in total input mapped reads
Nm = the number of mouse mapped reads (in millions) in IP sample
Nd = the number of Drosophila mapped reads (in millions) in IP sample
Calculate spike-in scale factor as follows.
α = γ/Nm
Calculate histone modification level as follows.
β = Nd x α
Normalize the dm6 mapped reads to the scale factor using deeptools-2.2.4 function bamCoverage with 10 bp bin size.
># For sample in ChIP_dm6, do the following
>bamCoverage -b {sample}_ChIP_dm6_Sorted.bam -o {sample}_ChIP_dm6_scaleFactor.bw –scaleFactor α -bs 10 -p 2 –v
Quantitative analysis
Calculate the ChIP intensity for each gene or region using the Bwtool function bwtool summary with default parameters.
>bwtool summary {gene}.bed {sample}_ChIP_dm6_scaleFactor.bw {sample}_{gene}_summary.xls –header
Peak calling
Identify Peak regions by homer-v4.8.3 function findPeaks with parameter "-style histone -F 2 -size 3000 -minDist 5000".
>makeTagDirectory {sample}_ChIP_tag -fragLength 200 {sample}_ChIP.sam -single
>makeTagDirectory {sample}_input_tag -fragLength 200 {sample}_input.sam -single
>findPeaks {sample}_ChIP_tag/ -style histone -o {sample}_size3K_Peaks.xls -i {sample}_input_tag/ -F 2 -size 3000 -minDist 5000 -fragLength 200
Peak visualization
Display the confident peaks and enriched genome regions by IGV-2.3.31 with the bigwig files generated by bamCoverage.
Peak annotation
Perform peak annotation using homer function annotatePeaks with a default parameter.
>annotatePeaks.pl peaks.txt dm6.bed > annotatedPeaks.txt
Functional analyses
Generated scatter plot by R package ggplot2.
Create a .csv file containing two columns. The first column contains the log2 values of 3 days’ H3K27me3 levels for protein-coding genes. The second column contains the log2 values of 30 days’ H3K27me3 levels for protein-coding genes.
Generate a scatter plot by R package ggplot2. The results showed that H3K27me3 modification increases with age in head (Figure 2).
>contour = read.csv(file="all_gene_3_30_log2.csv", header=T)
>x=contour[,1]
>y=contour[,2]
>df = data.frame(x,y)
>df <- data.frame(x = x, y = y, d = densCols(x, y, colramp = colorRampPalette(rev(rainbow(10,s=1,v=1,start=1/10, end = 7/10,alpha = 1)))))
>ggplot(df) + geom_point(aes(x, y, col = d), size = 0.01) + geom_density2d(aes(x,y),size=0.3, col="red") + scale_color_identity() + coord_fixed() + geom_abline(slope=1) + scale_y_continuous(limits = c(-4,4)) + scale_x_continuous(limits = c(-4,4))
Figure 2. Scatter plot showing the comparison result between the H3K27me3 levels of protein-coding genes in 3 d old flies and 30 d ones. Protein-coding genes: the open reading frames of protein-coding genes annotated in dm6. The dm6 mapped reads were normalized to a scale factor to compare the relative H3K27me3 level quantitatively. Each dot on the plot represents a single gene locus. X- and Y-axis represented log2 mean value of gene’s reference-adjusted reads. Contour lines indicated that H3K27me3 signals were higher in aged flies compared to 3 d old flies (Niu and Liu, unpublished).
Generated Circos plot by J-circos-V1 with the bigwig files. The result showed the distribution of H3K27me3 peak profiles (Figure 3).
Figure 3. Circos plot showing peak profiles of H3K27me3 in 3d and 30d old flies. Black boxes and lines (innermost circle) represented common peak regions, corresponding to their chromosomal locations. Chromosome ideogram was in grey (outermost ring). ChIP-seq was from head tis sues of 3 d and 30 d old male flies. Circos plot of the H3K27me3 epigenome illustrates peak profiles with age in head (Niu and Liu, unpublished).
Recipes
Standard Drosophila media
Sucrose
36 g/L
Maltose
38 g/L
Yeast
22.5 g/L
Agar
5.4 g/L
Maizena
60 g/L
Soybean flour
8.25 g/L
Sodium benzoate
0.9 g/L
Methyl-p-hydroxybenzoate
0.225 g/L
Methyl-p-hydroxybenzoate
6.18 ml/L
ddH2O to make up 1 L of the food
Glycine, 2.5 M
Weigh 187.6 mg glycine and add 1 ml Milli-Q water
Heat the mixture at 37 °C and mix it until glycine dissolves
Store at room temperature (20-25 °C) for no more than 1 month
ChIP Wash Buffer
Mix 150 mM NaCl, 2 mM EDTA (pH 8.0), 20 mM Tris-HCl (pH 8.0), 1% Triton X-100 (volume/volume), and 0.1% SDS (volume/volume, use 10% SDS solution)
Dilute the solution with Milli-Q water
Store at 4 °C for no more than 6 months
ChIP Final Wash Buffer
Mix 500 mM NaCl, 2 mM EDTA (pH 8.0), 20 mM Tris-HCl (pH 8.0), 1% Triton X-100 (volume/volume), and 0.1% SDS (volume/volume, use 10% SDS solution).
Note: Prepare the solution with Milli-Q water. Store at 4 °C for no more than 6 months.
ChIP Elution Buffer
Mix 100 mM NaHCO3 and 1% SDS (volume/volume, use 10% SDS solution).
Note: Freshly prepare the solution with Milli-Q water before elution step. Always put the solution at room temperature (20-25 °C) and ensure that there are no SDS precipitates before use.
Acknowledgments
This article is a part of works from our published article (Ma et al., 2018). This work was supported by grants from the National Program on Key Basic Research Project of China to N.L. (2016YFA0501900) and the National Natural Science Foundation of China to N.L. (31371326).
Competing interests
The authors declare that no competing interests exist.
References
An, J., Lai, J., Sajjanhar, A., Batra, J., Wang, C. and Nelson, C. C. (2015). J-Circos: an interactive Circos plotter. Bioinformatics 31(9): 1463-1465.
Heinz, S., Benner, C., Spann, N., Bertolino, E., Lin, Y. C., Laslo, P., Cheng, J. X., Murre, C., Singh, H. and Glass, C. K. (2010). Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell 38(4): 576-589.
Langmead, B. and Salzberg, S. L. (2012). Fast gapped-read alignment with Bowtie 2. Nat Methods 9(4): 357-359.
Ma, Z. J., Wang, H., Cai, Y. P., Wang, H., Niu, K. Y., Wu, X. F., MA, H. H., Yang, Y., Tong, W. H., Liu, F., Liu, Z. D., Zhang, Y. Y., Liu, R., Zhu, Z. J. and Liu, N. (2018). Epigenetic drift of H3K27me3 in aging links glycolysis to healthy longevity in Drosophila. eLife 7: e35368.
Orlando, D. A., Chen, M. W., Brown, V. E., Solanki, S., Choi, Y. J., Olson, E. R., Fritz, C. C., Bradner, J. E. and Guenther, M. G. (2014). Quantitative ChIP-Seq normalization reveals global modulation of the epigenome. Cell Rep 9(3): 1163-1170.
Pohl, A. and Beato, M. (2014). bwtool: a tool for bigWig files. Bioinformatics 30(11): 1618-1619.
Ramirez, F., Dundar, F., Diehl, S., Gruning, B. A. and Manke, T. (2014). deepTools: a flexible platform for exploring deep-sequencing data. Nucleic Acids Res 42(Web Server issue): W187-191.
Robinson, J. T., Thorvaldsdottir, H., Winckler, W., Guttman, M., Lander, E. S., Getz, G. and Mesirov, J. P. (2011). Integrative genomics viewer. Nat Biotechnol 29(1): 24-26.
Copyright: Niu et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Niu, K., Liu, R. and Liu, N. (2018). Quantitative ChIP-seq by Adding Spike-in from Another Species. Bio-protocol 8(16): e2981. DOI: 10.21769/BioProtoc.2981.
Ma, Z. J., Wang, H., Cai, Y. P., Wang, H., Niu, K. Y., Wu, X. F., MA, H. H., Yang, Y., Tong, W. H., Liu, F., Liu, Z. D., Zhang, Y. Y., Liu, R., Zhu, Z. J. and Liu, N. (2018). Epigenetic drift of H3K27me3 in aging links glycolysis to healthy longevity in Drosophila. eLife 7: e35368.
Download Citation in RIS Format
Category
Systems Biology > Epigenomics > Sequencing
Molecular Biology > DNA > DNA sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,982 | https://bio-protocol.org/exchange/protocoldetail?id=2982&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Growth of Chlamydomonas reinhardtii under Circadian Conditions
VW Volker Wagner
MM Maria Mittag
Published: Aug 20, 2018
DOI: 10.21769/BioProtoc.2982 Views: 5502
Edited by: Adam Idoine
Reviewed by: Takuya Matsuo
Download PDF
Ask a question
Favorite
Cited by
Abstract
The green biflagellate unicellular alga Chlamydomonas reinhardtii serves as a model to study fundamental biological processes such as the structure and function of flagella or light-driven processes including photosynthesis, its behavioral responses, life cycle and circadian clock. Light-dark, as well as temperature cycles, are major Zeitgebers to entrain the algal circadian clock. In C. reinhardtii, several processes are under circadian control and many clock-controlled genes and/or proteins have been found in the past decades as well as components of the endogenous oscillator. Here, we describe a protocol for the growth of C. reinhardtii for the synchronization and analysis of its circadian clock.
Keywords: Chlamydomonas reinhardtii Circadian clock Free running conditions
Background
In the past years, several clock components of C. reinhardtii have been identified and their function has been studied (for reviews, see Schulze et al., 2010; Matsuo and Ishiura, 2011; Noordally and Millar, 2015; Ryo et al., 2016; Kottke et al., 2017). In this article, we will present growth conditions for studying circadian control in C. reinhardtii. Therefore, we introduce the chronobiology nomenclature used for the growth of the algal cells under diurnal and circadian conditions (Figure 1).
At first, the circadian clock is synchronized by a light-dark cycle of 12-h light and 12-h dark, known as LD 12:12 at constant temperature. At LD0, light is turned on, and at LD12 it is switched off. LD6 thus defines the middle of the day and LD18 the middle of the night. A rhythm observed under LD conditions is called diurnal. Time measurement under diurnal conditions goes from LD0 to LD24. The next day is defined in the same way (LD0 to LD24). To find out if this rhythm is controlled by the circadian clock, the cells have to be released under so-called “free running conditions” with constant light and temperature where a circadian rhythm will continue with a period of about 24 h (Wagner and Mittag, 2009; Boesger et al., 2014). The cells are released at the end of the dark period (LD24) to constant conditions (Figure 1). Therefore, dim light (LL) is often used for C. reinhardtii, but if effects of specific light pulses are necessary as for the rhythm of photoaccumulation or for phase shifting the circadian clock, constant darkness (DD) is also used. For the rhythm of photoaccumulation (also described as rhythm of phototaxis), specialized set-ups and needs are necessary that differ depending on the home-made instrumental device (Mergenhagen, 1984; Gaskill et al., 2010; Forbes-Stovall et al., 2014; Müller et al., 2017). These are not further described in the current protocol.
Figure 1. Light conditions for investigating circadian rhythms in C. reinhardtii
Under circadian conditions, time measurement starts at LL0 and continues with the number of hours under which the organism has been put under circadian conditions. For example, LL48 means that the organism was for two days under constant conditions. LL30 symbolizes the middle of subjective day and LL42 the middle of subjective night. Subjective day (or day phase) and subjective night (night phase) are commonly used terms for free running conditions in chronobiology. Since transients may occur upon transfer to constant conditions, circadian rhythms are usually measured after the organism has been exposed for at least 12 h to constant conditions, and often after exposure for 24 h.
Materials and Reagents
Petri dishes
Aluminum foil
Autoclave tape
Whatman® Prepleated Qualitative Filter Paper (GE Healthcare, catalog number: 1201-320 )
Sterile tooth picks
Indicator paper pH-Fix 0-14 (Machery-Nagel, catalog number: 92110 )
Cotton plug
Nunc®-flasks (NuncTM EasYFlaskTM 25cm2 with filter cap, gamma irradiated) (Thermo Fisher Scientific, catalog number: 156367 )
Chlamydomonas reinhardtii cells
Wild-type strain SAG 73.72 cells
Double-distilled water (ddH2O; conductivity ≤ 0.1 μS/cm)
NH4Cl
CaCl2•2H2O
MgSO4•7H2O
K2HPO4
KH2PO4
Na2EDTA
H3BO3
FeSO4•7H2O
20% KOH
ZnSO4•7H2O
MnCl2•4H2O
CoCl2•6H2O
CuSO4•5H2O
(NH4)6Mo7O24•4H2O
Tris [Tris(hydroxymethyl)-aminomethane]
Lugol's solution (iodine-potassium iodide solution; Merck, catalog number: 1092611000 )
Liquid nitrogen
Caution: Extremely cold liquid (-196 °C); it may cause cryogenic burns or injury and displaces oxygen, which could lead to rapid suffocation in closed rooms; transport and store it always in containers designed for cryogenic liquids; handle it with special devices using protective clothing, cold insulating gloves and a face shield.
TAP salt solution (see Recipes)
1 M potassium phosphate buffer (see Recipes)
Hutner's trace elements (see Recipes)
Tris-acetate-phosphate (TAP) medium (see Recipes)
Equipment
1 L beaker
Heater
Erlenmeyer-flasks
Magnetic stirrer
Autoclave
Sterile bench
Culture room
Laboratory sample shaker
pH-electrode
Centrifuge
Neubauer improved counting chamber (Marienfeld, catalog number: 0640010 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Phycology > Physiology
Microbiology > Microbial cell biology > Cell-based analysis
Plant Science > Plant physiology > Circadian clock
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,983 | https://bio-protocol.org/exchange/protocoldetail?id=2983&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Liposome Flotation Assay for Studying Interactions Between Rubella Virus Particles and Lipid Membranes
KS Kyoko Saito
NO Noriyuki Otsuki
Makoto Takeda
KH Kentaro Hanada
Published: Vol 8, Iss 16, Aug 20, 2018
DOI: 10.21769/BioProtoc.2983 Views: 8530
Edited by: Vamseedhar Rayaprolu
Reviewed by: Balasubramanian VenkatakrishnanShweta Kailasan
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Rubella virus (RuV) is an enveloped, positive-sense single-stranded RNA virus that is pathogenic to humans. RuV binds to the target cell via the viral envelope protein E1, but the specific receptor molecules on the target cell are yet to be fully elucidated. Here, we describe a protocol for liposome flotation assay to study direct interactions between RuV particles and lipid membranes in a qualitative manner. Interactions are examined by a Nycodenz density gradient fractionation using UV-inactivated RuV particles and fluorescent-labeled liposomes consisting of pure lipids. Fractionated RuV particles are detected using standard sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blot analysis for viral proteins. On the Nycodenz gradient, RuV particles bound to liposomes shift to lower density fractions than unbound RuV particles. Using this protocol, we provide compelling evidence that, at neutral pH in a calcium-dependent manner, RuV particles bind to lipid membranes containing both sphingomyelin (SM) and cholesterol in certain cell types.
Keywords: Liposome flotation assay Rubella virus Virus particles Liposomes Lipids Sphingomyelin Cholesterol Virus-Lipid interaction
Background
Rubella virus is the causative agent of ‘rubella’, an acute and relatively mild systemic infection and ‘congenital rubella syndrome’, a trans-placental fetal infection leading to serious birth defects (Hobman, 2013). Elucidation of molecular mechanisms of RuV entry is essential for understanding viral pathology and helpful for developing anti-RuV drugs. Though previous studies have suggested that membrane lipids of host cells serve as RuV receptors (Mastromarino et al., 1989 and 1990; DuBois et al., 2013), the detailed mechanism remains unknown. Recently, we found that RuV binds to erythrocytes and lymphoid cells in a calcium-dependent manner, and that the calcium-dependent viral binding is impaired after treatment of these cells with sphingomyelinase or cholesterol-adsorbent methyl-β-cyclodextrin, suggesting that SM and cholesterol of the host plasma membrane are critical for binding (Otsuki et al., 2018). To obtain compelling biochemical evidence, we established an assay system to detect interactions between RuV particles and lipids.
Representative biochemical assays widely applied for studying interactions between proteins and lipids are liposome co-sedimentation and co-flotation assays (Zhao and Lappalainen, 2012). Provided that RuV particles and liposomes form aggregates pelleted by low-speed centrifugation in analogy with viral hemagglutination, we initially tried to apply liposome co-sedimentation assay. Unfortunately, our trial of the co-sedimentation assay showed that only a small amount of RuV particles was pelleted at 15,000 x g in the presence of any liposomes. Nevertheless, RuV particles tended to be less pelleted in the presence of liposomes containing both SM and cholesterol, compared with those containing either or neither of the two lipids, providing us with direction for the study. Following this, we devised a flotation assay that can be performed on a small scale. For this, we employed a protocol originally applied for characterization of phosphoinositide binding of the S. cerevisiae Hsv2 (homologous with swollen vacuole phenotype 2) protein (Busse et al., 2013). After making several modifications in the original protocol to optimize for RuV analysis, we have established the protocol described below. By analysis with this protocol, we revealed that both SM and cholesterol are responsible for the calcium-dependent membrane binding of RuV particles.
Materials and Reagents
Round-bottom glass tubes (size: 16 x 100 mm) (AGC Techno Glass, IWAKI, catalog number: TST-SCR16-100 ) with screw caps (AGC Techno Glass, IWAKI, catalog number: 9998CAP415-15 )
Round-bottom glass tubes (size: 12 x 75 mm) (AGC Techno Glass, IWAKI, catalog number: 9831-1207 )
Polypropylene centrifuge tubes:
15 ml (AS ONE, VIOLAMO, catalog number: 1-3500-21 )
50 ml (Corning, Centristar, catalog number: 430829 )
Polypropylene microfuge tubes:
1.5 ml (FUKAE KASEI, Watson, catalog number: 131-415C )
1.5 ml (Safe-Lock tubes, Eppendorf, catalog number: 0030 120.086 , for heating SDS-PAGE samples)
2.0 ml (FUKAE KASEI, Watson, catalog number: 132-620C )
Polycarbonate ultracentrifuge tubes (Beckman Coulter, catalog number: 343778 )
Pipette tips (Quality Scientific Plastics):
1-200 μl (Thermo Fisher Scientific, catalog number: 110-96RSNEW )
100-1,000 μl (Thermo Fisher Scientific, catalog number: 111-NXL-R100S )
Serological pipets (Costar stripette):
5 ml (Corning, catalog number: 4487 )
10 ml (Corning, catalog number: 4488 )
Immune-Blot polyvinylidene fluoride (PVDF) membrane (Bio-Rad Laboratories, catalog number: 1620177 )
Chromatography papers (Whatman 3MM Chr, GE Healthcare, catalog number: 3030-672 )
Polystyrene containers (180 x 90 x 45 mm) (AS ONE, catalog number: 1-4698-09 )
Black 96-well strip plate (Black Combiplate 8, Labsystems, catalog number: 95029450 )
Note: This product has been discontinued.
Parafilm (Bemis, catalog number: PM996 )
1,2-Dioleoyl-sn-glycero-3-phosphocholine (DOPC) (50 mg/ml in chloroform, Avanti Polar Lipids, catalog number: 850375C )
Note: Store at -30 °C.
SM from egg (Avanti Polar Lipids, catalog number: 860061P )
Note: Store at -30 °C.
Cholesterol (Sigma-Aldrich, catalog number: C8667 )
Note: Store at -30 °C.
L-α-Phosphatidylethanolamine-N-(lissamine rhodamine B sulfonyl) (Ammonium Salt) (Rhod PE) (1 mg/ml in chloroform, Avanti Polar Lipids, catalog number: 810146C )
Note: Transfer the solution to a round-bottom glass tube with a screw cap. Seal the cap with parafilm to avoid evaporation. Protect from light and store at -30 °C. Approximate molar concentration calculated with molecular weight of predominant species (1275.678 g/mol): 0.8 mM.
Chloroform (Wako Pure Chemical Industries, catalog number: 038-02601 )
Caution: Chloroform is volatile and hepatotoxic. Thus, when using chloroform and its mixtures, one MUST deal with them in a fume hood or with alternative equipment for chemical safety.
Methanol (Sigma-Aldrich, catalog number: 19-2410-4 )
Ethanol (Wako Pure Chemical Industries, catalog number: 057-00456 )
Water (ultrapure water, e.g., Milli Q)
UV-inactivated RuV particles for hemagglutination inhibition test (RuV antigens) (Denka Seiken, catalog number: 310071 )
Note: Store at -30 °C. After reconstitution with 1 ml/vial of water, store at 4 °C and use within 3 days.
Calcium chloride dihydrate (CaCl2•2H2O) (NACALAI TESQUE, catalog number: 06731-05 )
Tris-buffered saline (10x, pH 7.4) (TBS) (NACALAI TESQUE, catalog number: 35438-81 )
Protease inhibitor cocktail for use with mammalian cell and tissue extracts (100x) (NACALAI TESQUE, catalog number: 25955-11 )
5-(N-2,3-dihydroxypropylacetamido)-2,4,6-triiodo-N,N’-bis(2,3-dihydroxypropyl) isophthalamide (Nycodenz) (Sigma-Aldrich, catalog number: D2158 )
Sodium dodecyl sulfate (SDS) (NACALAI TESQUE, catalog number: 02873-75 )
Glycerol (Wako Pure Chemical Industries, catalog number: 075-00616 )
Dithiothreitol (DTT) (NACALAI TESQUE, catalog number: 14112-94 )
Bromophenol blue (Wako Pure Chemical Industries, catalog number: 029-02912 )
Tris(hydroxymethyl)aminomethane (Tris) (NACALAI TESQUE, catalog number: 35434-21 )
Glycine (NACALAI TESQUE, catalog number: 17109-64 )
Hydrochloric acid (HCl) (Wako Pure Chemical Industries, catalog number: 080-01066 )
30% (w/v)-Acrylamide/bis mixed solution (37.5:1) (NACALAI TESQUE, catalog number: 06144-05 )
Ammonium peroxodisulfate (APS) (NACALAI TESQUE, catalog number: 02627-34 )
N,N,N',N'-Tetramethylethylenediamine (TEMED) (NACALAI TESQUE, catalog number: 33401-72 )
Prestained protein markers such as PINK prestained protein ladders (NIPPON Genetics, catalog number: MWP02 ) and ExcelBandTM 3-color regular range protein maker (SMOBIO Technology, catalog number: PM2500 )
Skim milk (BD, Difco, catalog number: 232100 )
Polyoxyethylene(20) sorbitan monolaurate (Tween 20) (Wako Pure Chemical Industries, catalog number: 167-11515 )
Goat anti-RuV virion (strain HPV-77) polyclonal antibody (Acris Antibodies, catalog number: BP1061 )
Note: Store at 4 °C. For long time storage, aliquot and store at -30 °C.
Mouse monoclonal anti-goat/sheep IgG–peroxidase antibody (Sigma-Aldrich, catalog number: A9452 )
Note: Store at 4 °C. For long-time storage, aliquot and store at -30 °C.
Immobilon Western Chemiluminescent HRP Substrate (Merck, catalog number: WBKLS0500 )
Chloroform/methanol (19/1, v/v)
0.2 M CaCl2
1 M DTT
1% (w/v) bromophenol blue in 50% (v/v) ethanol
10% (w/v) SDS
1 M Tris-HCl pH 8.8
1 M Tris-HCl pH 6.7
10% (w/v) APS
20% (w/v) Tween 20
Note: Store at 4 °C. Check bacterial or fungal contamination before use.
Lipid stock solutions
TBS (see Recipe 4)
2x TBS (see Recipe 5)
80% (w/v) Nycodenz/TBS (see Recipe 6)
30% (w/v) Nycodenz/TBS (see Recipe 7)
3x SDS sample buffer (see Recipe 8)
Note: Aliquot and store at -30 °C.
10% (w/v) polyacrylamide separating gel solution (see Recipe 9)
5% (w/v) polyacrylamide stacking gel solution (see Recipe 10)
10x Tris/Glycine (see Recipe 11)
Electrode buffer (see Recipe 12)
Transfer buffer (see Recipe 13)
TBS-T (see Recipe 14)
5% (w/v) skim milk/TBS-T (see Recipe 15)
2% (w/v) skim milk/TBS-T (see Recipe 16)
Equipment
Micropipettes durable against organic solvent dispensing (NICHIRYO, model: Nichipet EX Plus II, catalog numbers: 00-NPLO2-20 , 00-NPLO2-200 , 00-NPLO2-1000 )
Pipet-Aid XP Pipette Controller (Drummond Scientific, catalog number: 4-040-101-J )
Vortex mixer (Delta mixer, TAITEC, model: Se-08 )
Nitrogen evaporator with water bath (Nakajima seisakusho, Co., Ltd., custom-made)
Fume hood equipped with activated charcoal filters (Dalton, model: DC-183-100 )
Probe-type ultrasonic processor (Hielscher Ultrasonics, model: UP50H )
Micro refrigerated centrifuge (e.g., KUBOTA, model: 3520 )
Electronic balance (Shimadzu, LIBROR, model: EB-340HW ; Mettler-Toledo International, model: ML802/52 )
Ultracentrifuge (Beckman Coulter, model: OptimaTM TLX with TLS-55 rotor)
Block heater for microfuge tubes (Nippon Genetics, Fast GeneTM, model: FG-02N )
pH meter (TOA Electronics, model: HM-30S )
Microwave oven (TOSHIBA, model: ER-225 )
Protein electrophoresis apparatus for SDS-PAGE (e.g., BIO CRAFT, model: BE-S28 for wide mini gels)
Western blot apparatus (e.g., Bio-Rad Laboratories, CriterionTM blotter for wide mini gels, catalog number: 1704070 )
Power supply (ATTO, model: AE-8450 , for SDS-PAGE; Bio-Rad Laboratories, model: 250/2.5 , for Western blotting)
Tube rotator (SCINICS, model: RVM-101 )
Reciprocal (TAITEC, model: Personal-11 ) and/or seesaw (TAITEC, model: Wave-SI ) shakers
Chemiluminescent imaging system (ATTO, model: WSE-6200H LuminoGraph II)
Microplate reader (BMG LABTECH, model: FLUOstar Optima )
Software
ImageSaver 6 for Windows (ATTO Co.) as image acquisition software for WSE-6200H LuminoGraph II
CS Analyzer 4 for Windows (ATTO Co.) as image analysis software
Microsoft Excel 2016 (Microsoft Corp.) as spreadsheet software
GraphPad Prism 7 (Graph Pad Software) as graph drawing software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Saito, K., Otsuki, N., Takeda, M. and Hanada, K. (2018). Liposome Flotation Assay for Studying Interactions Between Rubella Virus Particles and Lipid Membranes. Bio-protocol 8(16): e2983. DOI: 10.21769/BioProtoc.2983.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Biochemistry > Lipid > Lipid-virus interaction
Microbiology > Microbe-host interactions > In vitro model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,984 | https://bio-protocol.org/exchange/protocoldetail?id=2984&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Murine Brain and Lung Microvascular Endothelial Cells
AZ Ailing Zhang
SS Shogo Sawaguchi
EW Entzu Wan
MO Mitsutaka Ogawa
TO Tetsuya Okajima
Published: Aug 20, 2018
DOI: 10.21769/BioProtoc.2984 Views: 5044
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
This protocol describes how to isolate murine endothelial cells from newborn mice brain and 3-month-old mice lung by modifying the original protocols (Sobczak et al., 2010; Ruck et al., 2014). We have used the protocol to analyze mRNA expression level in brain endothelial cells (Sawaguchi et al., 2017). Isolated lung endothelial cells were expanded in vitro for various downstream experiments such as gene expression analysis and cell-based signaling assay.
Keywords: Endothelial cell Mouse Isolation RT-PCR
Background
This protocol describes experimental procedures for isolation of murine endothelial cells from mouse brain and lung. We used newborn mice for isolation of brain endothelial cells using anti-CD31 antibody. With this protocol, 2 μg of total RNA which is suitable for gene expression analysis can be isolated from brain endothelial cells, although pericytes and astrocytes cannot be totally eliminated. We also used 3-month-old mice lung to isolate lung endothelial cells using anti-CD31 and anti-CD102 antibodies. Isolated lung endothelial cells were expanded in vitro in 6 cm dish and used for various downstream experiments such as gene expression analysis and cell-based signaling assay.
Materials and Reagents
Microtube (INA•OPTIKA, BIO-BIK, catalog number: ST-0150F )
50 ml conical centrifuge tubes (Greiner Bio One International, catalog number: 227245 )
Syringe filter with a 0.22 μm pore size membrane (Pall, catalog number: 4192 )
CellBIND surface culture dish (6 cm, Corning, catalog number: 3295 )
Sterile blotting paper
Glass Pasteur pipette (25 ml, 10 ml) (IWAKI, catalog numbers: 73-0239 , 73-0241 )
70 μm cell strainer (Corning, Falcon®, catalog number: 352350 )
Mice (postnatal day 14)
Biotin-labeled anti-CD31 antibody (clone 390; BioLegend, catalog number: 102404 )
Anti-CD102 antibody (clone 3C4; BioLegend, catalog number: 105604 )
Bovine Serum Albumin (BSA, Equitec-Bio, catalog number: BAC62 )
Collagenase type 2 (Worthington, catalog number: LS004174 )
Collagenase/dispase (Roche Diagnostics, catalog number: 10 269 638 001 )
DNase I (Boehringer Mannheim, catalog number: 104159 )
Dynabeads Biotin Binder (Veritas Technologies, catalog number: 11047 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: 172012-500ML )
Dulbecco's modified Eagle medium (NISSUI PHARMACEUTICAL, catalog number: 05915 )
HuMedia-EG2 (Kurabou, catalog number: KE-2150S )
hEGF
hFGF-b
Hydrocortisone hemisuccinate
Heparin
Gentamycin
Amphotericin B
FBS
Penicillin-streptomycin (Thermo Fisher Scientific, catalog number: 15140122 )
0.05% Trypsin/EDTA (Lonza, catalog number: CC-5012 )
Na2HPO4 (Wako Pure Chemical Industries, catalog number: 196-02835 )
KH2PO4 (Sigma-Aldrich, catalog number: P0662-25G )
NaCl (Wako Pure Chemical Industries, catalog number: 191-01665 )
KCl (Wako Pure Chemical Industries, catalog number: 163-03545 )
Complete culture media (see Recipes)
Phosphate-buffered saline (PBS) (see Recipes)
0.1% BSA in PBS (see Recipes)
Equipment
Forceps (Fine Science Tools, model: Dumont #5 )
Incubator (SANYO, model: MCO-175 )
Tube rotator (Taiyo, catalog number: RT-50 )
Orbital mixer (Tokyo Rikakikai, EYELA, catalog number: CM-1000 )
Centrifuge (KUBOTA, model: 8900 )
Magnetic tube stand [e.g., 6-Tube magnetic separation rack (New England Biolabs, catalog number: S1506S )]
Aspirator (handmade)
Procedure
Preparation of anti-CD31/CD102 antibody-conjugated magnetic beads (Dynabeads)
Transfer 200 μl of resuspended Dynabeds Biotin Binder into a 1.5 ml Eppendorf tube and wash the beads with 0.1% BSA/PBS.
Collect the beads using a magnetic tube stand.
Remove the supernatant by aspiration.
Resuspend the beads in 1 ml of sterile 0.1% BSA/PBS.
Wash the beads three more times, for a total of four washes with 0.1% BSA/PBS.
Resuspend the beads in 500 μl of 0.1% BSA/PBS.
Add 10 μl anti-CD31 antibody or anti-CD102 antibody to the tube.
Incubate the samples under gently shaking on an orbital mixer at 4 °C (in the cold room) overnight, or for 2 h on a rotator at room temperature.
Wash the beads with sterile 0.1% BSA/PBS as described in Steps A5.
Resuspend the beads in 200 μl 0.1% BSA/PBS.
Note: The anti-CD31 antibody-conjugated magnetic beads can be stored at 4 °C for up to 1 month.
Isolation of murine brain microvascular endothelial cells
Ten mice at P14 are sacrificed, and brains are isolated. Remove the Cerebellum and brainstem with forceps. Detach the meninges by rolling the brains on sterile blotting paper.
Transfer meninges-free brains to a 50 ml Falcon tube filled with 13.5 ml of DMEM (Figure 1A).
Mince the brains first with a 25 ml pipette, then with a 10 ml pipette until the medium becomes milky (Figure 1B).
Digest the tissue homogenates by adding 0.6 ml of 10 mg/ml collagenase type 2 in DMEM and 0.2 ml of 1 mg/ml DNase I in PBS for 1 h at 37 °C using an orbital mixer at 180 rpm.
After digestion (Figure 1C), add 10 ml of DMEM and centrifuge the tissue suspension at 1,000 x g for 10 min at 4 °C (Figure 1D).
Remove the supernatant by aspiration (Figure 1E).
Resuspend the pellet using a 25 ml pipette in 25 ml of 20% (w/v) BSA in DMEM approximately 25 times and centrifuge at 1,000 x g for 20 min at 4 °C (Figure 1F).
After centrifuging (Figure 1G), remove the upper myelin layer with glass Pasteur pipette (Figure 1H).
Figure 1. Isolation of murine brain microvascular endothelial cells. See text for details.
Resuspend the pellet in 9 ml of DMEM and supplement with 1 ml of 10 mg/ml collagenase type 2 and 0.1 ml of 1 mg/ml DNase.
After digestion for 1 h at 37 °C, add 15 ml of 20% FBS in DMEM containing penicillin/streptomycin to stop digestion.
After centrifugation at 1,000 x g for 5 min, resuspend the pellet with 3 ml of 0.1% BSA in PBS.
Mix the cells with 22.5 μl of Dynabeads Biotin Binder pre-coated with 5 μg of biotin-labeled anti-CD31 antibody. Incubate the mixture using a tube rotator at RT for 15 min.
Collect the beads with bound endothelial cells using a magnetic tube stand.
Wash the beads with PBS.
Isolation of murine lung microvascular endothelial cells
Mice at 3 months old are sacrificed.
Mince the lungs and digest it with 1 mg/ml of collagenase/dispase in DMEM for 45 min at 37 °C.
Pass the cells suspension through a 70 μm cell strainer, collect the cells by centrifugation.
Resuspend the cells in 1 ml 0.1% BSA/PBS.
Isolate endothelial cells using Dynabeads Biotin Binder precoated with biotin-labeled anti-CD31 antibody.
Resuspend the Beads in 10 ml HuMedia-EG2 containing 2% FCS and 10 ng/ml hEGF, 5 ng/ml hFGF-b, 1.34 μg/ml hydrocortisone hemisuccinate, 10 μg/ml heparin, 50 μg/ml gentamycin, 50 ng/ml Amphotericin B, and then, plate onto CellBIND Surface Culture Dishes.
After reaching 70-80% confluent, detach the cells are by using 0.05% Trypsin/EDTA and collect by centrifugation.
Resuspend the cells in 1 ml 0.1% BSA/PBS.
Purify the endothelial cells using Dynabeads Biotin Binder precoated with biotin-labeled anti-CD102 antibody.
Resuspend the beads in 2 ml complete HuMedia-EG2 media and plate onto CellBIND surface culture dishes.
Recipes
Complete culture media
DMEM containing 10% FBS and penicillin-streptomycin
Phosphate-buffered saline (PBS)
10 mM Na2HPO4
1.8 mM KH2PO4
137 mM NaCl
2.7 mM KCl
0.1% BSA in PBS
0.1% BSA in PBS is prepared by dissolving 50 mg BSA in 50 ml PBS
The solution is sterilized by filtering through a 0.22 μm syringe filter (can be stored at 4 °C)
Acknowledgments
We thank N. Toida (Nagoya Univ) for technical supports. This protocol was modified from the previously published article (Sawaguchi et al., 2017). This work was supported by Japan Society for the Promotion of Science grants #JP15K15064 to TO and MO, #JP26110709 to TO, #JP26291020 to TO, #JP15K18502 to MO, #JP16J00004 to MO; Takeda Science Foundation to TO; Japan Foundation for Applied Enzymology to TO; YOKOYAMA Foundation for Clinical Pharmacology #YRY-1612 to MO. The authors declare no conflict of interest.
References
Ruck, T., Bittner, S., Epping, L., Herrmann, A. M. and Meuth, S. G. (2014). Isolation of primary murine brain microvascular endothelial cells. J Vis Exp(93): e52204.
Sawaguchi, S., Varshney, S., Ogawa, M., Sakaidani, Y., Yagi, H., Takeshita, K., Murohara, T., Kato, K., Sundaram, S., Stanley, P. and Okajima, T. (2017). O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals. Elife 6: e24419.
Sobczak, M., Dargatz, J. and Chrzanowska-Wodnicka, M. (2010). Isolation and culture of pulmonary endothelial cells from neonatal mice. J Vis Exp(46): 2316.
Copyright: Zhang et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
Category
Developmental Biology > Cell signaling > Ligand
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,985 | https://bio-protocol.org/exchange/protocoldetail?id=2985&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is a correction notice. See the corrected protocol.
Peer-reviewed
Correction Notice: Dual-sided Voltage-sensitive Dye Imaging of Leech Ganglia
YT Yusuke Tomina
Daniel A. Wagenaar
Published: Aug 5, 2018
DOI: 10.21769/BioProtoc.2985 Views: 2499
Ask a question
How to cite
Favorite
Cited by
Thank you very much for dealing with our protocol issued on March 5, 2018 (https://bio-protocol.org/e2751).
We have noticed a simple, but a very problematic typo in a recipe of physiological saline in the protocol. In the Recipe section of the protocol, the concentration of CaCl2 is "8 mM" as below, but this is completely wrong. Correct concentration of CaCl2 is "1.8 mM". We are sorry that we had not noticed this typo when we submitted a manuscript. We would appreciate it if you could make a correction only to this part ("8" --> "1.8").
References
Tomina, Y. and Wagenaar, D. A. (2018). Dual-sided Voltage-sensitive Dye Imaging of Leech Ganglia. Bio-protocol 8(5): e2751.
Copyright: Tomina and Wagenaar. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite：Tomina, Y. and Wagenaar, D. A. (2018). Correction Notice: Dual-sided Voltage-sensitive Dye Imaging of Leech Ganglia. Bio-protocol 8(15): e2985. DOI: 10.21769/BioProtoc.2985.
Download Citation in RIS Format
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,986 | https://bio-protocol.org/exchange/protocoldetail?id=2986&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phagocytosis Assay for α-Synuclein Fibril Uptake by Mouse Primary Microglia
CD Cuilian Du
FZ Feifan Zhang
Claire Xi Zhang
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2986 Views: 5385
Edited by: Xi Feng
Reviewed by: Lalitha SrinivasanRosa Barreira da Silva
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Microglia are professional phagocytes in the brain and deficiency in their phagocytic activity plays an important role in Parkinson’s disease. This protocol mainly describes the phagocytosis assay for uptake of α-synuclein preformed fibrils, a pathologic form of α-synuclein, by primary microglia.
Keywords: Phagocytosis α-synuclein preformed fibrils Microglia Parkinson's disease Immunofluorescence
Background
As the immune cells of the brain, microglia play critical roles in the central nervous system. In the physiological state, microglia constantly explore the surrounding environment and are involved in synaptic pruning. Microglia can be activated by any type of pathologic event or change in brain homeostasis (Wolf et al., 2017). Upon activation, microglia undergo morphological changes, proliferate, secrete inflammatory cytokines, migrate to the lesion site, and phagocytose pathogen, sick cells, the debris, even extracellular protein aggregates (Kettenmann et al., 2011; Fu et al., 2014). α-Synuclein is an abundant protein in neurons and is the principal component of the intraneuronal inclusions known as Lewy bodies and Lewy neurites in Parkinson’s disease (Luk et al., 2012). Recent studies showed that α-synuclein undergoes cell-to-cell spreading and microglia are the primary scavengers of α-synuclein, which likely take the burden of α-synuclein from neurons (Wolf et al., 2017). Here, we describe a protocol using human α-synuclein monomer to generate pre-formed fibrils and measuring the uptake of α-synuclein preformed fibrils by microglia phagocytosis (Du et al., 2017).
Materials and Reagents
Pipette tips (Corning, Axygen®, catalog number: T-300 )
Cover Glass (VWR, catalog number: 631-0150 )
50 ml centrifuge tube (Corning, catalog number: 430828 )
15 ml centrifuge tube (Corning, catalog number: 430790 )
75 cm2 flask (Corning, catalog number: 430641U )
24-well plate (Corning, Costar®, catalog number: 3524 )
40 μm cell strainer (Corning, Falcon®, catalog number: 352340 )
10 ml serological pipets (Corning, catalog number: 4488 )
3 kD centrifugal filter units (Merck, catalog number: UFC500324 )
30 kD centrifugal filter units (Merck, catalog number: UFC503024 )
Column assembled with filter (in GST-tag Protein Purification Kit) (Beyotime Biotechnology, catalog number: P2262 )
0.22 μm filter (Merck, Millex, catalog number: SLGP033RB )
Ampicillin (Sigma-Aldrich, catalog number: BP021 )
Escherichia coli strain BL21 (DE3) (100 μl in 1.5 ml cryogenic vial, TIANGEN Biotech, catalog number: CB105 )
pGEX-4T-2-GST (Obio technology)
20 C57BL/6 postnatal day 1 mice (Charles River Laboratories) without gender preferences
Dulbecco's modified Eagle’s medium-F12 (GE Healthcare, HycloneTM, catalog number: SH30023.01 )
Fetal bovine serum (Thermo Fisher Scientific, GibcoTM, catalog number: 10099141 )
Isopropyl-β-D-thiogalactoside (IPTG) (Sigma-Aldrich, catalog number: I6758 )
EDTA (Sigma-Aldrich, catalog number: E6758 )
Lysozyme (Sigma-Aldrich, catalog number: 62971 )
DNase1 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18068015 )
PMSF (Sigma-Aldrich, catalog number: P7626 )
Protease inhibitor (Roche Diagnostics, catalog number: 04693132001 )
Glutathione SepharoseTM 4B (GE Healthcare, catalog number: 17043001 )
Bicinchoninic acid assay (BCA) kit (Thermo Fisher Scientific, catalog number: 23225 )
Penicillin Streptomycin 100x Solution (GE Healthcare, HycloneTM, catalog number: SV30010 )
Poly-L-lysine hydrobromide (PLL) (Sigma-Aldrich, catalog number: P1399 )
Cytochalasin D (Abcam, catalog number: ab143484 )
Saponin (Sigma-Aldrich, catalog number: 47036 )
Anti-myc antibody (Santa Cruz Biotechnology, catalog number: SC789 )
Alexa Fluor594 goat anti-mouse IgG (H + L) (Thermo Fisher Scientific, catalog number: A-11007 )
4',6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, catalog number: H-1200 )
PBS (ZSGB-BIO, catalog number: ZLI-9062 )
Yeast extract (Oxoid, catalog number: LP0021B )
NaCl (Sigma-Aldrich, catalog number: V900058 )
Tryptone (Oxoid, catalog number: LP0042B )
Agarose (Biowest, catalog number: 111860 )
Thrombin (Sigma-Aldrich, catalog number: T4648 )
Tris-HCl (Sigma-Aldrich, catalog number: T1503 )
KCl (MODERN ORIENTAL FINE CHEMISTRY, catalog number: JC-AR20140011 )
Na2HPO4 (Beijing Chemical Factory, catalog number: A1060056 )
KH2PO4 (Beijing Chemical Factory, catalog number: A1049020 )
SDS (GE Healthcare, catalog number: 17131301 )
4% paraformaldehyde (ALADDIN, catalog number: C104188 )
TritonTM X-100 (Sigma-Aldrich, catalog number: V900502 )
Bovine serum albumin (Sigma-Aldrich, catalog number: B2064 )
Nail polish (USHINE)
LB medium (selection plate) (see Recipes)
LB medium (1 L) (see Recipes)
0.01 M PBS (pH 7.4, 1 L) (see Recipes)
Buffer A (pH 7.5) (see Recipes)
Equipment
Pipettes (Eppendorf, model: Research® plus, catalog number: 3120000062 )
Surgical instruments: ophthalmic scissors, curved ophthalmic forcep
Dry bath (VIVO, catalog number: VHD150S )
Cell culture CO2 incubator (Thermo Fisher Scientific, catalog number: 3131 )
Shaker (Shanghai Meditry Instrument, catalog number: THZ-C-1 )
Centrifuge (Eppendorf, model: 5430 R )
Rotator (Cole-Parmer, Stuart, catalog number: SB3 )
4 °C RevcoTM High-Performance Laboratory Refrigerator (Thermo Fisher Scientific, catalog number: REC3004V )
Stereomicroscope (ZEISS, model: Axio Vert.A1 )
Ultrasonic processor (Cole-Parmer, catalog number: CN-04714-50 )
Confocal microscopy (Leica Microsystems, model: Leica TCS SP8 )
Biological safety cabinet (Thermo Fisher Scientific, catalog number: 51026654 )
Eppendorf BioPhotometer (Eppendorf, catalog number: 6133000044 )
Software
NIH ImageJ (http://fiji.sc/)
SPSS software (SPSS 16.0, Chicago, IL)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Du, C., Zhang, F. and Zhang, C. X. (2018). Phagocytosis Assay for α-Synuclein Fibril Uptake by Mouse Primary Microglia. Bio-protocol 8(17): e2986. DOI: 10.21769/BioProtoc.2986.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Immunology > Immune cell function > Macrophage
Cell Biology > Cell-based analysis > Endocytosis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,987 | https://bio-protocol.org/exchange/protocoldetail?id=2987&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In planta Transcriptome Analysis of Pseudomonas syringae
TN Tatsuya Nobori
KT Kenichi Tsuda
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2987 Views: 8029
Edited by: Zhibing Lai
Reviewed by: Chao-Jan LiaoReza Sohrabi
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
Profiling bacterial transcriptome in planta is challenging due to the low abundance of bacterial RNA in infected plant tissues. Here, we describe a protocol to profile transcriptome of a foliar bacterial pathogen, Pseudomonas syringae pv. tomato DC3000, in the leaves of Arabidopsis thaliana at an early stage of infection using RNA sequencing (RNA-Seq). Bacterial cells are first physically isolated from infected leaves, followed by RNA extraction, plant rRNA depletion, cDNA library synthesis, and RNA-Seq. This protocol is likely applicable not only to the A. thaliana–P. syringae pathosystem but also to different plant-bacterial combinations.
Keywords: RNA-Seq Bacterial pathogen Arabidopsis Transcriptome Pseudomonas
Background
Plants have evolved innate immune systems to fend off pathogen attack. Molecular mechanisms of pathogen recognition and immune signaling pathways have been intensively studied over the past decades. However, how plant immunity affects pathogen metabolism to inhibit pathogen growth is scarcely understood often because of the difficulty in profiling pathogen responses in planta. In case of bacterial pathogens, transcriptome profiling inside plant leaves is difficult to study because the amount of bacterial mRNA is much lower than that of plants; and it is particularly challenging at an early stage of infection due to the low population density of bacteria in plants. To overcome this limitation, we established a method for isolating bacteria from the infected plant leaves and profiling bacterial transcriptome with RNA-Seq. This method has been successfully used for profiling the transcriptome of the model bacterial pathogen Pseudomonas syringae pv. tomato DC3000 in the model plant Arabidopsis thaliana in various conditions (Nobori et al., 2018).
Materials and Reagents
50 ml Falcon tubes (Corning, Falcon®, catalog number: 352070 )
1.5 ml Eppendorf Safe-Lock tubes (Eppendorf, catalog number: 0030120086 )
Pipette tips, 1,000 μl and 10 μl volumes (Corning, DeckWorksTM, catalog numbers: 4124 and 4120 )
Sterile Serological Pipet, 25 ml (Corning, catalog number: 4251 )
1 ml needleless syringe (BD, Luer-LokTM, catalog number: 303172 )
4 mm stainless steel balls (Mühlmeier)
6 μm filter mesh (Bückmann, catalog number: 20000796 )
30-32 days old Arabidopsis thaliana plants
Pseudomonas syringae pv. tomato DC3000 (Pto)
100% ethanol (VWR International, catalog number: 20821.321 )
Chloroform (Carl Roth, catalog number: 4432 )
peqGOLD TriFast (VWR, PeqLab, catalog number: 30-2010 )
Phenol solution pH 8.0 (Sigma-Aldrich, catalog number: P4557 )
Nuclease-Free Water (not DEPC-Treated) (Thermo Fisher Scientific, InvitrogenTM, Ambion®, catalog number: AM9932 )
Tris(2-carboxyethyl)phosphine (TCEP) (Sigma-Aldrich, catalog number: C4706 )
RNAqueous®-Micro Total RNA Isolation Kit (Thermo Fisher Scientific, InvitrogenTM, Ambion®, catalog number: AM1931 )
TURBO DNA-free Kit (Thermo Fisher Scientific, InvitrogenTM, Ambion®, catalog number: AM1907 )
Ribo-Zero rRNA Removal Kit (Plant) (Illumina, catalog number: MRZPL1224 )
RNeasy Mini Kit (QIAGEN, catalog number: 74104 )
Ovation® Complete Prokaryotic RNA-Seq DR Multiplex Systems (NuGEN Technologies, catalog number: 0326-32 )
QIAGEN-tip 500 (QIAGEN, catalog number: 10063 )
Liquid nitrogen
NaOH (Carl Roth, catalog number: 6771 )
Bacterial isolation buffer (see Recipes)
Equipment
Eppendorf Reference Pipette (Eppendorf, 100-1,000 μl)
Gilson PIPETMAN Classic pipette (Gilson, model: P20, catalog number: F123600 )
Electric pipette (BrandTech Scientific, model: accu-jet® pro, catalog number: 26330 )
Refrigerated centrifuge (Eppendorf, models: 5417 R and 5810 R )
Roller mixer SRT1 (Stuart Scientific, model: SRT1 )
Vortex mixer (Scientific Industries, model: Vortex-Genie 2 , catalog number: SI-0236)
Shaker
Thermal cycler (DNA Engine Tetrad 2 Peltier Thermal Cycler, Bio-Rad, model: Tetrad 2 )
NanoDropTM One/OneC Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM OneC , catalog number: ND-ONE-W)
-80 °C freezer
Autoclave
Fume hood
Forceps (Fine Science Tools, model: Dumont #5, catalog number: 11251-10 )
Plastic cutter
Scissors
Illumina HiSeq-3000 sequencer
Software
BowTie2
Python package HTSeq
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nobori, T. and Tsuda, K. (2018). In planta Transcriptome Analysis of Pseudomonas syringae. Bio-protocol 8(17): e2987. DOI: 10.21769/BioProtoc.2987.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Microbiology > Microbe-host interactions > Bacterium
Molecular Biology > RNA > RNA sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,988 | https://bio-protocol.org/exchange/protocoldetail?id=2988&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Enzymatic Synthesis and Fractionation of Fluorescent PolyU RNAs
CB Christian Beren
KL Katherine N. Liu
LD Lisa L. Dreesens
CK Charles M. Knobler
WG William M. Gelbart
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2988 Views: 4125
Edited by: Vamseedhar Rayaprolu
Reviewed by: Karthik KrishnamurthyOmar Akil
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
The physical properties of viral-length polyuridine (PolyU) RNAs, which cannot base-pair and form secondary structures, are compared with those of normal-composition RNAs, composed of comparable numbers of each of A, U, G and C nucleobases. In this protocol, we describe how to synthesize fluorescent polyU RNAs using the enzyme polynucleotide phosphorylase (PNPase) from Uridine diphosphate (UDP) monomers and how to fractionate the polydisperse synthesis mixture using gel electrophoresis, and, after electroelution, how to quantify the amount of polyU recovered with UV-Vis spectrophotometry. Dynamic light scattering was used to determine the hydrodynamic radii of normal-composition RNAs as compared to polyU. It showed that long polyU RNAs behave like linear polymers for which the radii scale with chain length as N1/2, as opposed to normal-composition RNAs that act as compact, branched RNAs for which the radii scale as N1/3.
Keywords: Homopolymer polyU RNA Gel electrophoresis electroelution Dynamic light scattering RNA secondary structure Viral RNA
Background
PolyU as a Physical Object: PolyU is an abiological RNA molecule composed of repeated uridine residues, and therefore, it cannot Watson-Crick base-pair and is devoid of RNA secondary structure (Martin and Ames, 1962; Richards et al., 1963). PolyU has very weak base-stacking energy resulting in a lack of helical ordering as well–except below 4 °C (Richards et al., 1963). Due to this lack of structure polyU RNA can be described physically as a random coil (Inners and Felsenfeld, 1970), as opposed to normal RNA molecules that form complicated secondary/tertiary structures, making them more compact physical objects (Yoffe et al., 2008; Fang et al., 2011; Gopal et al., 2012; Garmann et al., 2015).
We therefore expect polyU to be less compact than viral RNA of the same length. Indeed dynamic light scattering (DLS) measurements (see Figure 3) indicate that in RNA assembly buffer (see Recipes) at 25 °C, polyU molecules are about 25% larger in average diameter than branched RNAs of the same length. Additionally, we expect polyU to be more flexible than normal-composition RNAs, as it lacks secondary and tertiary structure, resulting in a more extended, flexible molecule.
Synthesis and Fractionation of Long PolyU RNAs: The synthesis protocol used herein was developed from existing protocols used by Vanzi et al. (2003) and van den Hout et al. (2011). Specifically, polyU RNAs were synthesized from Uridine diphosphate (UDP) monomers using the enzyme polynucleotide phosphorylase (PNPase), which indiscriminately adds nucleotide diphosphates (NDPs) to the 3' end of oligonucleotides, in this case a 20-nt-long polyU seed oligo with a 5' cy5 fluorescent label (Beren et al., 2017). It is important to note that the oligo sequence and length can be changed as desired, and it can be tagged at the 5' end with fluorophores, linkers, or modified bases, enabling the synthesis of polyU with customizable markers. Because of its lack of base-pairing, polyU cannot be visualized in electrophoresis gels by the usual intercalating nucleic acid stains. For this reason, we chose to utilize a fluorophore at the 5' end of the RNA. Additionally, it is possible to make polyA, polyG or polyC using the same PNPase, by simply adding ADP, GDP or CDP, respectively (Grunberg-Manago et al., 1956).
The synthesis reactions produce a polydisperse mixture of fluorescent polyU RNAs ranging in length from 200 to 10,000 nts, with shorter lengths being represented in significantly higher copy number as determined by fluorescence detection in denaturing agarose gel electrophoresis (see Figure 1). After running the RNA mixture alongside a denatured ssRNA ladder (see Figure 1), it was fractionated by electroeluting excised portions of the gel using the ladder as a reference. In fact, we often run many lanes of polyU in parallel to increase the amount of fractionated polyU produced from a given gel, as we usually recover between 30% and 60% of the RNA after gel electroelution.
Figure 1. Denaturing electrophoresis gel analysis of unfractionated polyU. Electrophoresis gel analysis of unfractionated polyU (red, cy5 fluorescence) after synthesis using PNPase, compared with a single-stranded (ss) RNA ladder (green, ethidium bromide nucleic acid stain). This gel illustrated the high amount of polydispersity in the polyU generated from the synthesis reaction. The brightest band in the RNA ladder is 3,000-nt-long ssRNA.
We used this process to fractionate polyU into the following length fractions: 500-1,500, 1,500-2,500, 2,500-3,500, 3,500-5,000, 5,000-7,000 and 7,000-9,000 nt. The amount of polyU purified was quantified using UV-Vis absorbance measurements, and the absorbance ratio at 260 nm/280 nm was used as a measure of RNA purity (A260/A280 greater than 2.0). These fractionated polyU samples were then examined on a denaturing agarose gel to demonstrate that single contiguous RNA bands were obtained (see Figure 2).
Figure 2. Denaturing electrophoresis gel analysis of fractionated polyU. From right to left: ssRNA ladder, 5,000-7,000, 4,000-5,000, 2,500-4,000, 1,500-2,500 and 500-1,500 nt polyU RNAs. The decrease in band intensity for higher-molecular-weight polyU molecules is due to the fact that an equal mass of polyU was loaded per lane, resulting in many fewer RNAs in the higher-molecular-weight fractions, and subsequently, a decreased fluorescence signal (because of there being only one label per RNA molecule). (Adapted from Beren et al., 2017)
Materials and Reagents
PolyU synthesis
100 kDa Amicon filters (Merck, catalog number: UFC510096 )
6-8 kDa MW cutoff dialysis tubing (Repligen, Spectra/Por®, catalog number: 132650 )
Eppendorf tubes (Eppendorf, catalog number: 022363204 )
Note: We do not utilize RNase-free tubes, but always autoclave the Eppendorf tubes before use.
RNase Inhibitor (Roche Diagnostics, catalog number: 03 335 399 001 , stored at -20 °C)
Polynucleotide phosphorylase (PNPase) from Synechocystis sp. (Sigma-Aldrich, catalog number: N9914-100UG , stored at -80 °C)
Uridine diphosphate (UDP, Sigma-Aldrich, catalog number: 94330 , stored at -20 °C)
10-25 nt RNA seed oligo (IDT, DNA, stored in TE buffer at -80 °C)
Note: We utilized a 20-nt-long polyU RNA seed oligo for our experiments.
Tris base (Merck, catalog number: 648310-2.5KG ), for making buffer Tris pH 9
EDTA (Merck, Omnipur®, catalog number: 4050-1KG )
Magnesium chloride hexahydrate (MgCl2•6H2O) (Merck, Omnipur®, catalog number: 5980-500GM )
Hydrochloric Acid (Thermo Fisher Scientific, catalog number: FLA144500 )
Synthesis buffer (stored at 4 °C) (see Recipes)
TE buffer (stored at 4 °C) (see Recipes)
PolyU fractionation
100 kDa Amicon filters (Merck, catalog number: UFC510096 )
6-8 kDa MW cutoff dialysis tubing (Repligen, Spectra/Por®, catalog number: 132650 )
Eppendorf tubes (Eppendorf, catalog number: 022363204 )
Note: We do not utilize RNase-free tubes, but always autoclave the Eppendorf tubes before use.
Dialysis tubing clips (Repligen, Spectra/Por®, catalog numbers: 132743 and 132735 )
Sodium bicarbonate (Merck, catalog number: SX0320-1 )
RNase Inhibitor (Roche Diagnostics, catalog number: 03 335 399 001 , stored at -20 °C)
Polynucleotide phosphorylase (PNPase) from Synechocystis sp. (Sigma-Aldrich, catalog number: N9914-100UG , stored at -80 °C)
ssRNA ladder (New England Biolabs, catalog number: N0362S , stored at -80 °C)
1% agarose gel (prepared in TAE buffer, agarose is purchased from Merck, Omnipur®, Calbiochem, catalog number: 2125-500GM )
Formamide (Acros organics, catalog number: 327235000 , stored at 4 °C)
Gel red (Biotium, catalog number: 41001 )
Tris base (Merck, catalog number: 648310-2.5KG ), for making buffer Tris pH 8
Acetic acid (Sigma-Aldrich, catalog number: 695092 )
EDTA (Merck, Omnipur®, catalog number: 4050-1KG )
Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-10 )
Potassium chloride (KCl) (Merck, catalog number: 7300-500GM )
Magnesium chloride hexahydrate (MgCl2•6H2O) (Merck, Omnipur®, catalog number: 5980-500GM )
Hydrochloric Acid (Thermo Fisher Scientific, catalog number: FLA144500 )
TAE buffer (stored at 4 °C) (see Recipes)
RNA assembly buffer (see Recipes)
Equipment
Note: Everything is sterilized before use, either by autoclaving or rinsing with 70% ethanol.
Scalpel (Surgical Design, model: SCALPEL#15 )
70% Ethanol (We dilute 100% ethanol with ddH2O) (Decon Labs, catalog number: V1001 )
Micropipette volumes used range from 1-1,000 μl (Mettler-Toledo, Rainin, model: Pipet-Lite XLS LTS )
Micropipette tips: volumes used range from 1-1,000 μl (filtered, sterile aerosol tips with high recovery for Rainin LTS Pipettemen; VWR, catalog numbers: 83009-688 , 82003-196 , 82003-198 )
Autoclave
Heat block (set to 70 °C) (Fisher Scientific, catalog number: 11-718-2Q )
Ice or a cold block for RNA work (VWR, catalog number: 414004-285 )
37 °C incubator (Precision, catalog number: 51221089 )
Centrifuge that can run to 5,000 x g (Eppendorf, model: 5804 R )
Gel electrophoresis equipment
Gel tank/box combo (Fisher Scientific, catalog number: FB-SB-710 )
Gel combs (Thermo Fisher Scientific, catalog numbers: B1A-10 and B1A-6 )
Power supply (Fisher Scientific, catalog number: FB1000Q )
Laminar flow hood, for RNA work
UV lamp, for imaging the ssRNA ladder in the gel (Spectronics, model: ENF-260C )
Nanodrop, UV-Vis spectrophotometer for measuring RNA concentrations
Malvern particle sizer Nano-ZS
Milli-Q UV Plus (Merck, catalog number: ZD60115UV )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Beren, C., Liu, K. N., Dreesens, L. L., Knobler, C. M. and Gelbart, W. M. (2018). Enzymatic Synthesis and Fractionation of Fluorescent PolyU RNAs. Bio-protocol 8(17): e2988. DOI: 10.21769/BioProtoc.2988.
Download Citation in RIS Format
Category
Molecular Biology > RNA > RNA labeling
Biochemistry > RNA > RNA structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,989 | https://bio-protocol.org/exchange/protocoldetail?id=2989&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pentylenetetrazole (PTZ)-induced Convulsion Assay to Determine GABAergic Defects in Caenorhabditis elegans
ST Shruti Thapliyal
Kavita Babu
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2989 Views: 5073
Edited by: Alessandro Didonna
Reviewed by: Yusuke TominaDURAI SELLEGOUNDER
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
Pentylenetetrazole (PTZ) is a GABAA receptor antagonist and is used to monitor presynaptic defects in the release of the inhibitory neurotransmitter GABA. PTZ is a competitive inhibitor of GABA, and prevents binding of GABA on the GABAA receptors present on the surface of muscle. In the absence of GABA binding, the excitatory to inhibitory signal ratio increases resulting in a convulsive phenotype. This assay provides a fast and reliable method to detect presynaptic defects in GABAergic synaptic transmission. The assay is based on correlating the extent of convulsions with the degree of presynaptic GABA release defects.
Keywords: PTZ C. elegans NMJ GABA Convulsions Synaptic transmission
Background
Synapses are the asymmetric intercellular junctions that mediate synaptic transmission. They constitute the fundamental units of brain circuitry that enable execution of complex behaviors. The arrival of an action potential causes calcium influx via voltage-gated calcium channels resulting in depolarization of the plasma membrane. Upon this pre-synaptic depolarization, synaptic vesicles fuse with the plasma membrane releasing their contents into the synaptic cleft via a highly controlled process (Sudhof, 1995; Sudhof, 2004).
Locomotion is a prominent behavioral output in Caenorhabditis elegans. Neural circuits that generate coordinated dorso-ventral sinusoidal bends allow for normal locomotion in C. elegans. Locomotory behavior is orchestrated at multiple levels and involves the integration of diverse sensory cues by multiple sensory neurons that are processed by the interneurons and ultimately direct changes at the neuromuscular junctions (NMJ) (de Bono and Maricq, 2005; Bargmann, 2012). The C. elegans NMJ has three main components; the excitatory cholinergic motor neurons, the inhibitory GABAergic motor neurons and the postsynaptic muscle cells (White et al., 1976; White et al., 1986). Cholinergic signaling mediates muscle contraction while GABAergic signaling fine-tunes C. elegans locomotion by exerting a regulatory control on excitatory signaling. Any defect in GABAergic signaling results in an increased excitatory signal at the NMJ resulting in more muscle contraction.
GABA released from the presynaptic GABAergic motor neuron functions via GABAA receptors, which encode GABA-gated chloride channels (Schofield et al., 1987). GABAA receptors contain a neurosteroid or PTZ-binding site, right next to the subunit containing the GABA-binding site. In the event of reduced presynaptic GABA release and in the presence of PTZ, PTZ binds the neurosteroid-binding site hampering the binding of GABA at the GABA- binding site. A reduction in GABA binding causes a decrease in the inhibitory signaling, resulting in a convulsive phenotype called ‘head bobs’ or anterior convulsions (Williams et al., 2004; Locke et al., 2008) and depicted in Figure 1. The convulsive phenotype occurs because of an altered excitatory to inhibitory input ratio to the body-wall muscles. The PTZ assay is often used as a secondary assay in conjunction with the Aldicarb assay (Oh and Kim, 2017), to investigate the role of genes involved in GABA synaptic transmission. The results from this assay can be further supported by additional experimentation including electrophysiological recordings.
Figure 1. Mechanism of PTZ-induced anterior head bobs. PTZ is a competitive antagonist of GABA. If the presynaptic GABA release is lower than that seen in WT animals, PTZ binds at the neurosteroid binding site, thus hampering the binding of GABA at GABA-binding site. In the absence of GABA signaling, excitatory cholinergic signaling increases resulting in anterior convulsions called ‘head-bobs’. Hence, mutants showing anterior convulsions on PTZ plates suggest defective presynaptic GABA release.
Materials and Reagents
35 mm and 60 mm Petri dishes (35 mm: Tarsons, catalog number: 460035 ; 60 mm: Tarsons, catalog number: 460061 )
Spreader (Tarsons, catalog number: 920081 )
99.99% platinum wire (Sigma-Aldrich, catalog number: 267201 )
C. elegans: N2 (Wild type worms)(University of Minnesota, Caenorhabditis Genetic Center) and casy-1(tm718) (National Bio resource Project, Japan)
Escherichia coli OP50 (University of Minnesota, Caenorhabditis Genetic Center)
Pentylenetetrazole (PTZ) (Sigma-Aldrich, catalog number: P6500 )
Ethanol (Ethyl alcohol Absolute, ACS-ISO grade) (Merck, catalog number: 100983 )
Cholesterol (SRL Sisco Research Laboratories, catalog number: 54181 )
Calcium chloride dihydrate (CaCl2•2H2O) (Sigma-Aldrich, catalog number: C3306 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Potassium phosphate, monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5379 )
Potassium phosphate, dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P8281 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Bacto-agar (HiMedia Laboratories, catalog number: GRM026 )
Bacto-peptone (SRL Sisco Research Laboratories, BactoTM, catalog number: 95292 )
100 mg/ml PTZ stock solution (see Recipes)
5 mg/ml cholesterol (see Recipes)
1 M CaCl2 stock solution (see Recipes)
1 M MgSO4 stock solution (see Recipes)
1 M KPO4, pH 6.0 stock solution (see Recipes)
Nematode growth medium (NGM) agar plates (see Recipes)
Equipment
Pipettes (Eppendorf, model: Research® plus, catalog number: 2231000224 )
2 L glass conical flask (DWK Life Sciences, DURAN, catalog number: 2121763 )
Autoclave (Equitron-7431 SLEFA)
Microscope (ZEISS, model: Stemi 2000 C )
Software
GraphPad Prism v6 (GraphPad Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Thapliyal, S. and Babu, K. (2018). Pentylenetetrazole (PTZ)-induced Convulsion Assay to Determine GABAergic Defects in Caenorhabditis elegans. Bio-protocol 8(17): e2989. DOI: 10.21769/BioProtoc.2989.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Intracellular signalling
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
299 | https://bio-protocol.org/exchange/protocoldetail?id=299&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Glycophosphosphingolipid (GSPL) Purification Protocol
TD Tripti De
Published: Vol 2, Iss 23, Dec 5, 2012
DOI: 10.21769/BioProtoc.299 Views: 9453
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
Glycosylated ceramide phosphorylinositol are present in many species of fungi and mushrooms and bacteria and parasitic organisms like leishmania. These are usually membrane raft associated and are not easily extracted by conventional methodologies. This extraction method gives higher yield of the glycolipid. Glycosphingolipids are usually associated with the detergent resistance membrane rafts. They are difficult to be extracted by neutral solvents from rigid promastigote cell wall with neutral or less polar solvents. For more polar phospholipids, more polar solvents are essential. Ammonia is used to extract phosphatidylinositols.
Materials and Reagents
Promastigotes
Tris-HCl
PMSF
Fetal bovine serum (FBS)
Sucrose
Cholorform
Methanol
Ethyl acetate
Pyridine
Ammonia
Ammonium Hydroxide
Sodium Taurodeoxycholic Acid
KCl
Acetone
Silicic Acid
Medium 199
Phosphate buffered saline (PBS) (see Recipes)
Sucrose density gradient (see Recipes)
PBS-AT (see Recipes)
Equipment
Vortexer
Centrifuges
DEAE-Sephadex A-25
HPTLC plate
Iodine chamber
TLC
Erythina cristagalli-agarose column
Galactose
Dialysis device
Lyophilizor
Swinging bucket rotor
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Lipid > Lipid isolation
Microbiology > Microbial biochemistry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,990 | https://bio-protocol.org/exchange/protocoldetail?id=2990&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Artificial Inoculation of Epichloë festucae into Lolium perenne, and Visualisation of Endophytic and Epiphyllous Fungal Growth
YB Yvonne Becker
KG Kimberly A. Green
BS Barry Scott
MB Matthias Becker
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2990 Views: 8307
Edited by: Amey Redkar
Reviewed by: Cynthia L. MonacoSatyabrata Nanda
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Natural hosts for the fungal endophyte Epichloë festucae include Festuca rubra (fine fescue) and Festuca trachyphylla (hard fescue). Some strains also form stable associations with Lolium perenne (perennial ryegrass). L. perenne is a suitable host to study fungal endophyte–grass interactions, such as endophytic fungal growth within the plant and epiphyllous growth on the plant surface. Here we provide a detailed protocol based on work by, for artificial inoculation of E. festucae into L. perenne, and newly developed staining and visualization techniques for observing endophytic and epiphyllous hyphae and the expressorium, an appressorium-like structure used by the fungus to exit the plant. The staining method uses a combination of glucan binding aniline blue diammonium salt (AB) and chitin binding wheat germ agglutinin-conjugated Alexa Fluor®488 -(WGA-AF488). This protocol will be a useful tool to study Epichloë-grass interactions, particularly the comparison of different Epichloë-grass associations, various endophyte-host developmental stages, as well as the analysis of mutant Epichloë strains.
Keywords: Expressorium Fungal endophyte Inoculation Epiphyllous Growth Epichloë Confocal Laser Scanning Microscopy
Background
Latch and Christensen (1985) developed a protocol for artificial infection of grasses with Epichloë endophytes. This work has been the basis for the extensive E. festucae Fl1–L. perenne symbiosis research (reviewed in Scott et al., 2012). In our recent work, we described a newly identified fungal structure, the expressorium that enables E. festucae to exit L. perenne (Becker et al., 2016). For visualization of fungal and plant structures, we used two different fluorophores. Wheat germ agglutinin-conjugated Alexa Fluor®488 (WGA-AF488) binds to sialic acid and N-acetylglucosamine residues and is commonly used as an indicator for chitin (Figueroa-Lopez et al., 2014). Aniline blue diammonium salt (AB) is commonly used as a stain for β-D-1,3-glucans, such as callose at plant cell walls and related glucans in fungal cell walls (Wood and Fulcher, 1984). Staining of ethanol and potassium hydroxide (KOH) cleared (i.e., fixed) plant samples with AB and WGA-AF488, as per our protocol described below, enables a comprehensive visualisation of (i) Epichloë endophytic and epiphytic hyphae, (ii) plant responses based on callose depositions, and (iii) the plant cuticle. By collecting a combination of light emitted from the dyes described here and autofluorescence from the host plant, we can observe a strong signal from the plant cuticle. This overcomes the need for a specific dye for lipophilic components, which might interfere with WGA-AF488 or aniline blue imaging. Interestingly, WGA-AF488 exclusively stains the cell wall of epiphyllous Epichloë hyphae and is restricted to hyphal septa and actively growing tips of endophytic hyphae, while AB is used to stain the endophytic hyphal cell wall and plant glucans. Propidium iodide (PI), which stains plant and fungal nuclei, can also be used in combination with WGA-AF488 and AB without the need for changing the confocal settings described below.
Materials and Reagents
Seed sterilization and inoculation:
1.5 ml reaction tubes (BRAND, catalog number: 780400 )
Parafilm (Sigma-Aldrich, catalog number: P7793-1EA )
Petri dishes (SARSTEDT, catalog number: 82.1472 )
Household aluminum foil, or heavy duty foil for multiple uses
Sterile filter paper (GE Healthcare, catalog number: 1001-090 )
Potting mix (e.g., Klasmann and Deilmann, Substrat 1.090)
Microscope slides (Carl Roth, catalog number: 0656.1 )
Microscope slides coverslips (Carl Roth, catalog number: 0657.2 )
Replacement blade No.11 for metal scalpel 10621 (DAHLE, catalog number: 10722 )
Root trainers or pots (Gärtner Pötschke, catalog number: 280686 )
Grass seeds (used here: Lolium perenne cv Samson seeds, endophyte free; Agricom, New Zealand)
An Epichloë strain, E. festucae Fl1 (ATCC, catalog number: MYA-3407 )
Autoclaved distilled water
Murashige and Skoog Medium including vitamins (Duchefa Biochemie, catalog number: M0222 )
Phyto agar (Duchefa Biochemie, catalog number: P1003 )
Potato Dextrose Agar (Carl Roth, catalog number: X931 )
Agar-Agar (Carl Roth, catalog number: 6494 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 793566 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: 746436 )
Disodium hydrogen phosphate (Na2HPO4) (Sigma-Aldrich, catalog number: 795410 )
Potassium dihydrogen phosphate (KH2PO4) (Sigma-Aldrich, catalog number: 795488 )
Sulfuric acid (H2SO4) (Sigma-Aldrich, catalog number: 339741 )
Sodium hypochlorite (NaClO + H2O; 12% Cl2) (Carl Roth, catalog number: 9062.3 )
Potassium hydroxide (KOH) (Carl Roth, catalog number: 6751 )
95% Ethanol (Carl Roth, catalog number: 9065 )
Tween 20 (Carl Roth, catalog number: 9127 )
Glycerol (Carl Roth, catalog number: 7530 )
Aniline Blue diammonium salt (C37H32N5O9S3) (Sigma-Aldrich, catalog number: 415049 )
Wheat Germ Agglutinin, Alexa FluorTM 488 Conjugate (Thermo Fisher Scientific, catalog number: W11261 )
Propidium iodide solution 0.5 mg/ml (Sigma-Aldrich, catalog number: P4864 )
3% water agar (see Recipes)
2.4% potato dextrose agar (see Recipes)
Murashige and Skoog phyto agar (see Recipes)
Aniline Blue diammonium salt stock solution (see Recipes)
WGA-AF488 stock solution (see Recipes)
PBS (pH 7.4) (see Recipes)
Tween 20 stock (see Recipes)
Staining Solution (see Recipes)
Equipment
Fridge
Incubator (Thermo Fisher Scientific, Heraeus, model: BK 600 )
Stereomicroscope (Leica, model: Leica S6 D )
Metal scalpel (DAHLE, catalog number: 10621 )
Preserving jar
Autoclave
Stainless steel forceps (Sigma-Aldrich, catalog number: Z168777 )
Thermos Scientific “Mr. Frosty” Freezing Container (Thermo Fisher Scientific, catalog number: 5100-0001 )
Laminar air flow cabinet
Confocal Laser Scanning Microscope, CLSM, (Leica, models: Leica TCS SP5 and Leica TCS SP8 )
Desiccator Base (DWK Life Sciences, DURAN®, catalog number: 247714605 )
Desiccator Lid (DWK Life Sciences, DURAN®, catalog number: 244204605 )
Stopcock with PTFE Spindle (side) (DWK Life Sciences, DURAN®, catalog number: 247980306 )
Stopcock with PTFE Spindle (top) (DWK Life Sciences, DURAN®, catalog number: 247990401 )
Water jet filter pump (BRAND, catalog number: 159600 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Becker, Y., Green, K. A., Scott, B. and Becker, M. (2018). Artificial Inoculation of Epichloë festucae into Lolium perenne, and Visualisation of Endophytic and Epiphyllous Fungal Growth. Bio-protocol 8(17): e2990. DOI: 10.21769/BioProtoc.2990.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Fungus
Plant Science > Plant cell biology > Cell staining
Cell Biology > Cell staining > Chitin
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,991 | https://bio-protocol.org/exchange/protocoldetail?id=2991&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Investigating Neural Stem Cell and Glioma Stem Cell Self-renewal Potential Using Extreme Limiting Dilution Analysis (ELDA)
HN Hong PT Nguyen*
PD Paul M Daniel*
GF Gulay Filiz
TM Theo Mantamadiotis
*Contributed equally to this work
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2991 Views: 9933
Edited by: Xi Feng
Reviewed by: Subhra Prakash Hui
Original Research Article:
The authors used this protocol in Sep 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2018
Abstract
Glioma stem cells (GSC) grown as neurospheres exhibit similar characteristics to neural stem cells (NSC) grown as neurospheres, including the ability to self-renew and differentiate. GSCs are thought to play a role in cancer initiation and progression. Self-renewal potential of GSCs is thought to reflect many characteristics associated with malignancy, including tumor recurrence following cytotoxic therapy due to their proliferative dormancy and capacity to allow for the development of resistant tumor cell sub-clones due to mutations acquired during their differentiation. Here, we demonstrate that using extreme limiting dilution analysis (ELDA), subtle differences in the frequency of sphere-forming potential between PI3K-mutant oncogenic NSCs and non-oncogenic NSCs can be measured, in vitro. We further show how ELDA can be used on cells, before and after forced differentiation to amplify inherent differences in sphere-forming potential between mutant and control NSCs. Ultimately, ELDA exploits a difference in the ability of a single or a few seeded stem cells to self-renew, divide and form neurospheres. Importantly, the assay also allows a comparison between genetically distinct cells or between the same cells under different conditions, where the impact of target-specific drugs or other novel cancer stem cell therapies can be tested.
Keywords: Stem cells Glioma Glioblastoma Neural stem cells Neurospheres Self-renewal ELDA
Background
Glioblastoma (GBM) is one of the most common types of brain cancer with an extremely poor prognosis (Kaye and Morokoff, 2014). GBM treatment success or failure is determined by a complex biology due to the underlying genetics and epigenetics which regulate many signal transduction pathways, which in turn govern pro-oncogenic tumor cell behaviors and ultimately response/resistance to treatments. One of the major pathways regulating GBM cell behavior involves hyperactivation of PI3K signaling due mutations involving one or more pathway factors including the epidermal growth factor receptor (EGFR), the PI3K catalytic subunit encoded by the PIK3CA gene and deletion of the PI3K pathway negative regulator and tumor suppressor, Phosphatase and Tensin Homolog (PTEN) (Mantamadiotis, 2017). Using a genetically engineered mouse model, our recent study demonstrated that PI3K mutations, specifically targeting the Pik3ca and Pten genes in neural stem/progenitor cells (NSPs) can trigger the development of aggressive brain tumors, in vivo (Daniel et al., 2017 and 2018). In vitro analysis of NSCs isolated from mutant and wild-type mice revealed intrinsic cellular differences between genotypes, including sphere forming potential, which is a correlate of stem cell potential. This protocol describes the method used to investigate neural stem cell potential via established and variations on established methods. Extreme limiting dilution analysis (ELDA) can be used to analyze stem cell self-renewal ability and has been widely used in the stem cell field (Shackleton et al., 2006; Quintana et al., 2008; Vaillant et al., 2008). Subtle differences between NSCs or GSCs can be quantified by ELDA using a freely available webtool (Hu and Smyth, 2009). Moreover, we present a variation in stem cell potential analysis by including an intermediate differentiation step between ELDA measurements, which revealed more substantial differences in sphere forming potential between mutant and wild-type mouse NSCs, compared to performing ELDA alone, with cells which had not undergone forced differentiation. The forced differentiation step measures the inherent stability of NSCs and GBM-like NSCs, which maintain neurosphere forming potential following differentiation; stability which may correlate with faster disease relapse/recurrence following therapy.
Materials and Reagents
Pipette tips: 10 ml, 5 ml, 2 ml (Axygen)
24-well tissue culture treated plate (Corning, catalog number: 3524 ) (Storage condition: 15 °C to 25 °C)
6-well tissue culture treated plate (Corning, catalog number: 3506 ) (Storage condition: 15 °C to 25 °C)
96-well Ultra-Low Attachment plate (Corning, catalog number: 3474 ) (Storage condition: 15 °C to 25 °C)
40 μm cell strainer (Corning, catalog number: 352340 ) (Storage condition: 15 °C to 25 °C)
PIK3CAH1047R; PTENlox/lox; UBC-CreERT2 mice (Daniel et al., 2017 and 2018), aged E13.5 or 6 weeks old
Note: NSPCs can be isolated more efficiently from younger mice. Mice used here were on a C57BL/6 genetic background.
(Optional) Antibody
anti-GFAP(glial fibrillary protein)
anit-Tuj1
DMEM F12 (Thermo Fisher Scientific, GibcoTM, catalog number: 10565042 ) (storage condition: 4 °C)
Accutase cell detachment solution (BD, catalog number: 561527 ) (storage condition: 4 °C)
Fetal Calf serum (FCS) (Bovogen Biologicals, catalog number: SFBS-FR ) (storage condition: -20 °C)
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 ) (storage condition: -20 °C)
B-27 supplement (50x) (Thermo Fisher Scientific, GibcoTM, catalog number: 17504-044 ) (storage condition: -20 °C)
Epidermal growth factor (EGF) (Thermo Fisher Scientific, GibcoTM, catalog number: PHG0313 ) (storage condition: -20 °C)
Basic fibroblast growth factor (bFGF) (BioVision, catalog number: 4036 ) (storage condition: -20 °C)
Laminin (Thermo Fisher Scientific, GibcoTM, catalog number: 23017-015 ) (storage condition: -20 °C)
NaCl (Sodium Chloride, Thermo Fisher Scientific, Ajax Finechem, Univar, catalog number: AJA465-500G )
KCl (Postassium Chloride, Merck, catalog number: 1049360500 )
Na2HPO4 (di-Sodium hydrogen phosphate, Merck, catalog number: 106586 )
KH2PO4 (Potassium dihydrogen orthophosphate, Thermo Fisher Scientific, Ajax Chemicals, catalog number: 392 )
Phosphate buffered saline (PBS, see Recipes)
Neurosphere culture media (see Recipes)
Differentiated media (see Recipes)
Equipment
Pipettes (METTLER TOLEDO, Pipet-X, model: PX-100 )
Biohazard safety cabinet (EuroClone, model: BioAir-TopSafe 1.2-ABC )
Centrifuge (Dynamica Scientific, model: Velocity 18R )
DigiRetina16 camera (Tucsen)
Neubauer Hemocytometer (Sigma-Aldrich, catalog number: Z359629 )
Water bath at 37 °C (Froilabo, model: BMUTE)
Humidified incubator at 37 °C, 5% CO2 (Thermo Fisher Scientific, Heraeus, model: HeracellTM 150 )
Inverted phase contrast microscope (Nikon, model: Diaphot , with ELWD 0.3 phase contrast)
Software
ELDA online software (http://bioinf.wehi.edu.au/software/elda/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nguyen, H. P., Daniel, P. M., Filiz, G. and Mantamadiotis, T. (2018). Investigating Neural Stem Cell and Glioma Stem Cell Self-renewal Potential Using Extreme Limiting Dilution Analysis (ELDA). Bio-protocol 8(17): e2991. DOI: 10.21769/BioProtoc.2991.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Neural stem cell
Cancer Biology > Cancer stem cell > Cell biology assays
Cell Biology > Cell-based analysis > Non-adherent culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,992 | https://bio-protocol.org/exchange/protocoldetail?id=2992&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of the Effect of Sphingomyelinase on Rubella Virus Infectivity in Two Cell Lines
NO Noriyuki Otsuki
MS Masafumi Sakata
YM Yoshio Mori
KO Kiyoko Okamoto
Makoto Takeda
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2992 Views: 5039
Edited by: Vamseedhar Rayaprolu
Reviewed by: Vaibhav B ShahSaumik Basu
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Rubella is a mildly contagious disease characterized by low-grade fever and a morbilliform rash caused by the rubella virus (RuV). Viruses often use cellular phospholipids for infection. We studied the roles of cellular sphingomyelin in RuV infection. Treatment of cells with sphingomyelinase (SMase) inhibited RuV infection in rabbit kidney-derived RK13 cells and African green monkey (Cercopithecus aethiops) kidney-derived Vero cells. Our data further demonstrated that RuV used cellular sphingomyelin and cholesterol for its binding to cells and membrane fusion at the step of virus entry. Detailed protocols of our assays, which assess the effects of SMase treatment on RuV infectivity in RK13 and Vero cells, are described.
Keywords: Rubella virus Lipid Sphingomyelin Virus entry Sphingomyelinase
Background
Rubella virus (RuV) is a positive-strand RNA virus and belongs to the genus Rubivirus in the family Togaviridae. The family has two genera, Rubivirus and Alphavirus. RuV is the sole member of genus Rubivirus, whereas many viruses, such as Semliki forest virus (SFV) and Sindbis virus (SINV), are classified in the genus alphavirus. RuV is the causative agent of rubella and congenital rubella syndrome (CRS). Rubella is characterized by low-grade fever, a morbilliform rash, and lymphadenopathy. It is ordinarily a mild disease. However, CRS is a serious disease. CRS causes multiple organ defects in neonates born from mothers who suffered from rubella during the early phase of their pregnancy. Cataracts, sensorineural hearing loss and cardiovascular defects are common in CRS.
Previous studies suggested that cellular membrane lipids act as binding or entry factors for RuV infection (Mastromarino et al., 1989 and 1990), but the detailed mechanism has not yet been elucidated. Myelin oligodendrocyte glycoprotein (MOG) has been identified as a cellular receptor for RuV (Cong et al., 2011). However, the pathology of rubella cannot be solely explained by the usage of MOG because MOG is mainly expressed in the central nervous system and is barely expressed in other organs. Trinh et al. (2018) recently reported that RuV infects HaCat keratinocyte cells that do not express MOG on their surface.
Our recent study (Otsuki et al., 2018) demonstrated that RuV binds directly to sphingomyelin (SM) and cholesterol (SM/Chol)-enriched membranes in a Ca2+-dependent manner. Furthermore, the study showed that the binding is essential for membrane fusion at the early stage of rubella infection. In the current protocol, we provide a detailed method to examine whether the SM of host cells is essential for RuV infection in adherent cell lines. This protocol will be also useful to evaluate the use of host cellular SM in the infection of other viruses.
Materials and Reagents
Materials
A 6-well cell culture plate (Corning, catalog number: 3506 )
A 12-well cell culture plate (Corning, catalog number: 3512 )
A 24-well cell culture plate (Corning, catalog number: 3524 )
Pipette tips (Neptune Scientific, catalog numbers: BT20 , BT200 and BT1250 )
A 1.5 ml tube with lid (INA•OPTIKA, catalog number: ST-0150F )
Cells
RK13 cells: these cells were a gift from the Kitasato Institute
Note: These cells are maintained in Eagle’s minimum essential medium (MEM) (see Recipes) containing 8% bovine serum (BS).
Vero cells: our pre-existing stocks were originally obtained from American Type Culture Collection and have been maintained for more than 20 years in our laboratory
Note: These cells are maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 5% fetal bovine serum (FBS), 100 unit/ml Penicillin, and 100 μg/ml Streptomycin.
Viruses
Rubella virus (RuV) TO-336 vaccine strain (Takeda Pharmaceutical) (Otsuki et al., 2011)
RuV RVi/Hiroshima.JPN/01.03 wild type strain (Otsuki et al., 2011; Sakata et al., 2014)
The recombinant RuV RVi/Hiroshima.JPN/01.03 strain expressing the green fluorescent AG1 protein (rHS/p150-AG1) (reported previously in Sakata et al., 2014)
The recombinant measles virus (MeV) and human metapneumovirus (HMPV) expressing enhanced green fluorescent protein (EGFP) (MeV-IC323/Ed-H-EGFP and HMPV-rJPS02-76EGFP, respectively) (reported previously in Seki et al., 2006 and Shirogane et al., 2008)
Notes:
The TO-336 vaccine strain and RVi/Hiroshima.JPN/01.03 wild type strain were propagated in RK13 cells. The recombinant rHS/p150-AG1 was propagated in Vero cells. MeV and HMPV were propagated in Vero/hSLAM cells (Ono et al., 2001) and Vero/TMPRSS2 cells (Shirogane et al., 2008), respectively.
Viruses were diluted with MEM before use.
Virus-like particles of RuV (RuV-VLP)
RuV-VLP, whose genome encodes Renilla luciferase and AG1 reporter genes, were produced and concentrated as described previously (Sakata et al., 2014), with some modifications (Otsuki et al., 2018).
Reagents
Eagle’s MEM “Nissui” 1 (NISSUI PHARMACEUTICAL, catalog number: 05900 )
Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, catalog number: D5796 )
Dulbecco’s phosphate buffered saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 )
Fetal bovine serum (Biowest, catalog number: S1780-500 )
Bovine serum (Thermo Fisher Scientific, GibcoTM, catalog number: 16170078 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
L-Glutamine (200 mM) (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Agarose ME (IWAI CHEMICALS, catalog number: 50013R )
7.5% sodium bicarbonate (Thermo Fisher Scientific, GibcoTM, catalog number: 25080094 )
Sphingomyelinase from Bacillus cereus (Sigma-Aldrich, catalog number: S9396 )
Neutral red solution (0.33%) (Sigma-Aldrich, catalog number: N2889 )
Renilla Luciferase Assay system (Promega, catalog number: E2810 )
Note: Lysis buffer and Renilla Luciferase Assay Reagent are included in this kit.
MEM (see Recipes)
2x MEM (see Recipes)
MEM containing 2% BS (or FBS) and 0.5% (or 0.4%) agarose (see Recipes)
MEM containing 0.01% neutral red and 0.5% agarose (see Recipes)
Equipment
Micropipettes (Gilson, models: P10, P200, P1000, catalog numbers: F144802 , F123601 , F123602 )
Luminometer (Promega, model: GloMax® 20/20 )
Autoclave (TOMY SEIKO, model: ES-215 )
Biosafety cabinet (Air Tech)
Cell culture incubator (at 35 °C and 37 °C with 5% CO2) (Thermo Fisher Scientific, Forma, model: 310 )
Fluorescence microscope (ZEISS, model: Axio Observer D1 )
Cell culture microscope (Olympus, model: CKX53 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Otsuki, N., Sakata, M., Mori, Y., Okamoto, K. and Takeda, M. (2018). Analysis of the Effect of Sphingomyelinase on Rubella Virus Infectivity in Two Cell Lines. Bio-protocol 8(17): e2992. DOI: 10.21769/BioProtoc.2992.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Antiviral assay
Cell Biology > Cell-based analysis > Viral infection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,993 | https://bio-protocol.org/exchange/protocoldetail?id=2993&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Enzymatic Assays and Enzyme Histochemistry of Tuta absoluta Feeding on Tomato Leaves
Rim Hamza
José P. Beltrán
Luis A. Cañas
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2993 Views: 6540
Edited by: Samik Bhattacharya
Reviewed by: Saptashati Biswas
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
Enzymes play a key role in insect-plant relationships. For a better understanding of these interactions, we analyzed Tuta absoluta digestive enzymes. Here, we describe a detailed protocol for the detection of trypsin and papain-like enzymes in Tuta absoluta larvae by enzyme histochemistry. This assay uses frozen and unfixed samples to avoid the loss of enzymatic activity. We also describe a protocol for the quantification of trypsin and papain-like enzymes in the larvae of Tuta absoluta at different developmental instars.
Keywords: Tuta absoluta Trypsin Papain Cryostat Histochemistry
Background
Plants and insects have coexisted for million years and evolved a set of interactions which affect both organisms at different levels. Insects manage to develop different physiological and morphological adaptations to overcome plants defense mechanisms. Therefore, a better understanding of their vital functions would facilitate their targeted control. Different physiological functions in insects rely on enzymes: digestive, respiratory, circulatory, muscular, nervous, reproductive and endocrine. Several enzymes participate in the digestion. Proteases such as trypsin, chymotrypsin, pepsin or carboxypeptidases are responsible for protein digestion, which is a source of amino acids for the insect. Thus, digestive protease inhibitors have been successfully used to improve plant resistance to insects (Smigocki et al., 2013; Quilis et al., 2014; Hamza et al., 2018). In order to design such approaches, it is important to identify the target insect digestive enzymes. Enzyme histochemistry is a useful method for the localization of active enzymes in tissue sections of an organism. However, few protocols have been described for insects. One of the main issues of this method is the sensibility of the enzymes to fixatives. In a previous study, Erban and Hubert (2011) visualized the digestive enzymes in the body of the acarid mite Lepidoglyphus destructor after feeding them with chromogenic and fluorescent substrates taking advantage of their transparent body. This approach is not suitable for larvae of bigger insects such as Tuta absoluta. These larvae do not have transparent body allowing the visualization of the fluorescence and are reared with fresh tomato leaves instead of artificial diet and thus cannot be supplemented with enzymatic substrates. In our work, we designed a protocol for the detection of serine proteases and papain-like proteases in cryosections of larvae of Tuta absoluta without tissue fixation. We also quantified these enzymes in larvae at different instars using chromogenic substrates.
Materials and Reagents
1.5 ml microcentrifuge tubes
Petri dishes (Thermo Fisher Scientific, SterilinTM, catalog number: 122TS1 )
1.5 ml pestles (Sigma-Aldrich, catalog number: Z359947-100EA )
Tuta absoluta eggs
Note: The eggs were obtained from the Tuta absoluta colony reared in the IVIA (Instituto Valenciano de Investigaciones Agrarias). The colony was started with adults caught from tomato fields near Castellon (Spain). No commercial insects/eggs are available.
Tomato leaves (cv. Micro-Tom)
Liquid nitrogen (commercial grade)
European Bacteriological Agar (Conda, catalog number: 1800 )
Acetone (Merck, catalog number: 1000141000 , CAS: 67-64-1)
Bovine serum albumin (BSA Fraction V) (Roche, catalog number: 10 735 078 001 )
Bradford reagent (Bio-Rad Laboratories, catalog number: 5000006 )
Trichloroacetic acid (AppliChem, Panreac, catalog number: 131067 , CAS: 76-03-9)
Nα-Benzoyl-L-arginine 4-nitroanilide hydrochloride (BApNA) (Sigma-Aldrich, catalog number: B3133 , CAS: 21653-40-7)
pGlu-Phe-Leu p-nitroanilide (Sigma-Aldrich, catalog number: P3169 , CAS: 85901-57-1)
Bovine trypsin (Sigma-Aldrich, catalog number: T1426 , CAS: 9002-07-7)
Papain (Sigma-Aldrich, catalog number: P4762 , CAS: 9001-73-4)
Nα-Benzoyl-L-arginine-7-amido-4-methylcoumarin hydrochloride (BAAMC) (Santa Cruz Biotechnology, catalog number: sc-301455 , CAS: 83701-04-6)
NEG-50 gel (Thermo Fisher Scientific, catalog number: 6502 )
Pills blister (capacity: approximately 400 µl) (Enantyum 25 mg, Menarini)
Polyvinyl alcohol (Sigma-Aldrich, catalog number: P1763 , CAS: 9002-89-5)
L-Cysteine (Sigma-Aldrich, catalog number: 168149 , CAS: 52-90-4)
Ascorbic acid (Duchefa Biochemie, catalog number: A0602 , CAS: 50-81-7)
Tris (Duchefa Biochemie, catalog number: T1501.1000 , CAS: 77-86-1)
Sucrose (AppliChem, catalog number: 131621.1211 , CAS: 57-80-1)
Polyvinylpyrrolidone (PVP) (Sigma-Aldrich, catalog number: PVP10 , CAS: 9003-39-8)
Sodium phosphate (AppliChem, Panreac, catalog number: 122018.1210 , CAS: 7601-54-9)
Calcium chloride 2 hydrate (AppliChem, Panreac, catalog number: 131232.1210 , CAS: 10035-04-8)
Protein extraction buffer (see Recipes)
Trypsin assay buffer (see Recipes)
Papain assay buffer (see Recipes)
Histochemistry wash solution 1 (see Recipes)
Histochemistry wash solution 2 (see Recipes)
Histochemistry substrate solution (see Recipes)
Equipment
Pipettes (Gilson, 2-20,20-200 and 100-1,000 µl)
Growth chamber (SANYO, model: MLR 350 )
Binocular stereomicroscope (Olympus, model: SZ-St )
Brush (Staedtler permanent, model: 989 4 BK2 )
Stainless steel tweezers
Spectrophotometer (Eppendorf, model: 6131 )
Cryostat (Thermo Fisher Scientific, MICROM, model: HM520 )
Refrigerated centrifuge (Eppendorf, model: 5417R )
Fluorescence microscope (Leica, model: DM5000 B )
Poly-lysine coated slides (Thermo Fisher Scientific, catalog number: J2800AMNZ )
Camera (Nikon, model: D3200 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hamza, R., Beltrán, J. P. and Cañas, L. A. (2018). Enzymatic Assays and Enzyme Histochemistry of Tuta absoluta Feeding on Tomato Leaves. Bio-protocol 8(17): e2993. DOI: 10.21769/BioProtoc.2993.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,994 | https://bio-protocol.org/exchange/protocoldetail?id=2994&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Synchronization by Double Thymidine Block
Guo Chen
Xingming Deng
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2994 Views: 31376
Edited by: Jia Li
Reviewed by: Zinan ZhouShweta Garg
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
Cell synchronization is widely used in studying mechanisms involves in regulation of cell cycle progression. Through synchronization, cells at distinct cell cycle stage could be obtained. Thymidine is a DNA synthesis inhibitor that can arrest cell at G1/S boundary, prior to DNA replication. Here, we present the protocol to synchronize cells at G1/S boundary by using double thymidine block. After release into normal medium, cell population at distinct cell cycle phase could be collected at different time points.
Keywords: Cell synchronization Cell cycle Thymidine DNA synthesis DNA replication
Background
Cell cycle and cell division lie at the heart of cell biology. To build multicellular organism, cell duplication is necessary to generate specialized cells, which can execute particular function. The normal cell cycle is composed of interphase (G1, S and G2 phase) and mitotic (M) phase (Rodríguez-Ubreva et al., 2010; Léger et al., 2016). During interphase, the genetic materials are duplicated and make everything ready for mitosis. Whereas, during mitotic phase, the duplicated chromosomes are segregated and distributed into daughter cells (Sakaue-Sawano et al., 2008).
To precisely preserve genetic information, cell cycle progression must be tightly regulated. Cyclin/CDK complexes control the cell cycle progression through rapidly promoting activities at their respective stages, and are quickly inactivated when their stages are completed (Graña and Reddy, 1995).
Cell synchronization is particularly useful for investigating a cell-cycle regulated event. Using different methods, cells could be synchronized at different cell cycle stage. Treatment of nocodazole, which is an inhibitor of microtubule formation, could synchronize cells at G2/M phase (Ho et al., 2001), while, hydroxyurea, a dNTP synthesis inhibitor, synchronize cells at early S phase (Koç et al., 2004). As an Inhibitor of DNA synthesis (Schvartzman et al., 1984), thymidine can arrest cell at G1/S boundary. Here, we describe a detail method to synchronize cells at G1/S boundary by thymidine (Chen et al., 2018).
Materials and Reagents
10 cm culture dish (Corning, catalog number: 430167 )
Gloves (VWR International, catalog number: 82026 )
Protective clothing (VWR International, catalog number: 414004-444 )
Eyewear (VWR International, catalog number: 89187-984 )
Human tumor cell lines: H1299 (ATCC, catalog number: ATCC® CRL-5803TM )
Dulbecco's Modified Eagle's Medium (DMEM) (high glucose with L-glutamine) (Corning, catalog number: 10-013-CV )
Phosphate-Buffered Saline (PBS) (Corning, catalog number: 21-040-CV )
Fetal bovine serum (FBS) (ATLANTA BIOLOGICALS, catalog number: S11150 )
Thymidine (Sigma-Aldrich, catalog number: T9250 )
Propidium Iodide (PI) (Thermo Fisher Scientific, catalog number: P3566 )
Antibodies
Anti-Cyclin A (Abcam, catalog number: ab38 )
Anti-Cyclin D (Santa Cruz Biotechnology, catalog number: sc-753 )
Anti-β-Actin (Santa Cruz Biotechnology, catalog number: sc-58673 )
Tris-HCl, pH 8.0 (Thermo Fisher Scientific, catalog number: 15568025 )
NaCl (Sigma-Aldrich, catalog number: S9888 )
NP-40 (Abcam, catalog number: ab142227 )
EDTA (Thermo Fisher Scientific, catalog number: 15576028 )
β-Mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
EBC cell lysis buffer (see Recipes)
Electrophoresis running buffer (see Recipes)
Transfer buffer (see Recipes)
Equipment
Cell culture incubator (VWR International, model: 98000-368 )
Flow cytometry system (BD, model: FACSLyric )
X-RAY Film processor (Konica Minolta Healthcare Americas, model: SRX-101A )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, G. and Deng, X. (2018). Cell Synchronization by Double Thymidine Block. Bio-protocol 8(17): e2994. DOI: 10.21769/BioProtoc.2994.
Download Citation in RIS Format
Category
Cancer Biology > Cell cycle checkpoints > Cell biology assays
Cell Biology > Cell signaling > Intracellular Signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,995 | https://bio-protocol.org/exchange/protocoldetail?id=2995&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Human Endothelial Cell Spheroid-based Sprouting Angiogenesis Assay in Collagen
FT Fabian Tetzlaff
Andreas Fischer
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2995 Views: 19086
Edited by: Vivien Jane Coulson-Thomas
Reviewed by: Thomas KorffSudan Puri
Original Research Article:
The authors used this protocol in Apr 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2018
Abstract
Angiogenesis, the formation of new blood vessels from pre-existing ones plays an important role during organ development, regeneration and tumor progression. The spheroid-based sprouting assay is a well-established and robust method to study the influence of genetic alterations or pharmacological compounds on capillary-like tube formation of primary cultured endothelial cells. A major advantage of this assay is the possibility to study angiogenesis in a 3D environment. Endothelial cells are cultured as hanging drops to form spheroids. Those spheroids are embedded into a collagen matrix and tube formation is analyzed 24 h later. By analyzing sprout number and sprout length the effects of genetic manipulation or drug treatment on angiogenesis can be investigated.
Keywords: Endothelial cells Angiogenesis 3D cell culture Capillary sprout formation Spheroids Vascular
Background
Blood vessels supply organs with oxygen and nutrients. In cases the local demands are not met anymore, cells secrete vascular endothelial growth factor (VEGF) to induce the formation of new blood vessels. The new vessel sprout is composed of a leading tip cell which is trailed by stalk cells (Potente and Makinen, 2017). Angiogenesis occurs under physiological conditions (e.g., growth of muscle and adipose tissue) as well as pathological conditions (e.g., wound healing, macular degeneration, and tumor growth). As such, there is a great need to decipher the basic mechanisms coordinating angiogenesis and to test compounds that interfere with pathological angiogenesis.
The spheroid-based sprouting assay, which was developed by Dr. Thomas Korff and Dr. Hellmut Augustin in the late 90s (Korff and Augustin, 1999), enables researchers to investigate the effects of drugs or genetic manipulations on sprouting angiogenesis in a fast and robust manner (Heiss et al., 2015). One great advantage of the spheroid-based sprouting assay is the analysis of sprout formation in a 3D environment. This promotes cell-cell signaling between endothelial cells. Upon stimulation with VEGF endothelial cells degrade the surrounding matrix and invade it. This mimics the situation in vivo. Thereby, this assay better reflects in vivo angiogenesis than other well known in vitro angiogenesis assays such as 2D tube formation on Matrigel (Nowak-Sliwinska et al., 2018).
Sprout number and length are read-outs for the angiogenic potential. In addition, this assay can be used to analyze competition for the tip cell position. Therefore, genetically modified endothelial cells, which are labeled with different fluorophores, are mixed before spheroid formation (Figure 1). Thereby, it can be analyzed, which genetic manipulation leads to a preference for the tip or the stalk position (Tetzlaff et al., 2018). With live-cell imaging it is possible to investigate the migration of endothelial cells and the dynamic competition of endothelial cells for the tip position.
Figure 1. Endothelial cells expressing either mCherry or GFP mixed before spheroid formation. Spheroid was embedded in a collagen matrix and sprouting was analyzed 24 h later by using a fluorescence microscope. Scale bar = 100 µm.
Materials and Reagents
Pipette tips (10 µl, 200 µl, 1,000 µl) (Starlab, catalog numbers: S1111-3700 , S1111-0706 , S1111-6701 )
Reservoir (Thermo Fisher Scientific, catalog number: 95128093 )
Serological pipettes (5 ml, 10 ml, 25 ml) (Corning, catalog numbers: 4487 , 4488 , 4489 )
10 cm square Petri dish (Greiner Bio One International, catalog number: 688102 )
6-well plate (Corning, catalog number: 3516 )
24-well plate for suspension culture (Greiner Bio One International, catalog number: 662102 )
15 ml conical tube (Corning, catalog number: 352096 )
50 ml conical tube (Corning, catalog number: 352070 )
Human umbilical vein endothelial cells: freshly isolated from three different donors (also commercially available)
Rat tails
Acetic acid (Carl Roth, catalog number: 3738.2 )
Endopan 3 Basal Medium (Pan-Biotech, catalog number: P04-0010B )
Endopan 3 Medium plus Supplements (Pan-Biotech, catalog number: P04-0010K )
Ethanol (VWR, catalog number: 20821.330 )
FBS (Merck, Biochrom, catalog number: S 0615 )
FGF2 (R&D Systems, catalog number: 234-FSE-025 )
10x Medium 199 (Sigma-Aldrich, catalog number: M0650 )
Methyl cellulose, 4,000 centipoises (Sigma-Aldrich, catalog number: M0512 )
Sodium hydroxide (Sigma-Aldrich, catalog number: 30620 )
Paraformaldehyde (Sigma-Aldrich, catalog number: 158127 )
PBS (Thermo Scientific Fisher, catalog number: 14190169 )
0.05% trypsin-EDTA (Thermo Scientific Fisher, catalog number: 25300054 )
VEGF-A165 (R&D Systems, catalog number: 293-VE-010 )
Methocel stock solution (see Recipes)
Collagen stock solution (see Recipes)
Equipment
500 ml bottle (Fisher Scientific, catalog number: FB800500 )
Magnetic stirrer (Heidolph Instruments, catalog number: 505-20000-00 )
12-channel pipette (Volume 10-100 μl) (Eppendorf, catalog number: 3125000044 )
Hemacytometer; Neubauer counting chamber (BRAND, catalog number: 717805 )
Pipette-aid (BRAND, catalog number: 26304 )
Autoclave (VWR, Tuttnauer, catalog number: 481-0585 )
Balance (KERN & SOHN, catalog number: PBJ 4200-2M )
Centrifuge with swinging-bucket rotor and adaptors for 15 ml and 50 ml conical tubes (Eppendorf, model: 5810 , catalog number: 5810000320)
Humidified cell culture incubator set to 37 °C and 5% CO2 (Thermo Fisher Scientific, HeracellTM 150CU , catalog number: 50116047)
Light microscope (Leica Microsystems, model: Leica DM IRB )
Safety cabinet (Thermo Fisher Scientific, model: Safe 2020 , catalog number: 51026638)
Water bath (GFL, catalog number: 1012 )
Software
FIJI (Curtis Rueden, University of Wisconsin-Madison, Laboratory for Optical and Computational Instrumentation)
Procedure
Preparation of hanging drops
Culture human umbilical vein endothelial cells (HUVEC) in Endopan 3 medium containing supplements and FBS until cells are confluent. This protocol is adjusted to running the experiment under three conditions: basal, VEGF stimulation, FGF2 stimulation.
Wash HUVEC twice with PBS.
Detach cells from cell culture plate using trypsin-EDTA.
Stop reaction using PBS containing 10% FBS, spin down cells at 200 x g for 5 min, discard supernatant and re-suspend cells in cell culture medium.
Count cells using a hemacytometer.
Note: Twenty thousand cells are needed per condition. Due to loss of cells during the whole procedure, calculate to ensure you have an extra 20,000 cells. In total, 80,000 cells are needed for the preparation of the hanging drops.
Transfer 80,000 cells to a fresh 15 ml conical tube. Add cell culture medium (Endopan 3 medium plus supplements and FBS) to a total volume of 4 ml.
Add 1 ml of methocel stock solution, which can improve spheroid formation.
Note: Some researchers do not use methocel at this step, however in our hands, this improves spheroid formation, which was also reported elsewhere (Leung et al., 2015).
Mix solution carefully and transfer it to a sterile multichannel pipette reservoir.
Using a 12-channel pipette, pipet 25 μl drops of the solution onto a 10 cm square Petri dish. Take care to avoid air bubbles (Figure 2A) (Video 1).
Video 1. Preparation of hanging drops. Endothelial cell-methocel-solution is pipetted on a square Petri dish for hanging drop formation.
To form spheroids, incubate drops upside-down in a humidified cell culture incubator set at 37 °C and 5% CO2 for 24 h (Figure 2B).
Note: Hereon prepare the methocel solution containing 20% FBS which is needed on the next day. Mix carefully the methocel stock solution with 20% FBS. Avoid air bubbles. In case air bubbles are formed, check whether they disperse on the next day. If not, use another batch.
Figure 2. Preparation of hanging drops for spheroid formation. A. Petri dish with hanging drops. B. Representative image of a spheroid in a hanging drop 24 h after upside-down incubation. Scale bar = 100 µm.
Embedding of spheroids
Note: Before continuing with the protocol, check whether spheroids formed overnight. In case multiple small cell clumps have been formed, discard them.
Place collagen stock solution, 10x Medium 199, 0.2 N NaOH and methocel containing 20% FBS on ice.
Using a 10 ml serological pipette gently wash off the hanging drops (containing the spheroids) with 10 ml PBS by pipetting up and down. Transfer solution into a 15 ml conical tube (Video 2).
Video 2. Transfer of spheroids. Hanging drops containing spheroids are washed off and solution is transferred to a 15 ml conical tube.
Spin down spheroids at 200 x g for 5 min. Then aspirate supernatant and add 2 ml of methocel containing 20% FBS (Video 3).
Video 3. Mixing of spheroids and collagen. Spheroids are suspended in methocel containing 20% FBS and mixed with collagen. Solution is added to wells of a 24-well plate.
Prepare collagen medium: Mix 4 ml collagen stock solution with 0.5 ml 10x Medium 199 on ice. Adjust pH value by adding dropwise sterile ice-cold 0.2 N NaOH. Subsequently invert the tube carefully to ensure thorough mixing. Add NaOH until the pH indicator of the collagen medium changes the color from yellow to orange (approximately 250-500 µl).
Important: Prepare the collagen medium on ice to prevent collagen polymerization.
Add 2 ml of the collagen from Step B5 to the spheroids which were re-suspended in methocel containing 20% FBS.
Note: Mix the solution carefully. Avoid air bubbles.
Add 1 ml of the spheroid-collagen solution per well of a 24-well plate.
Incubate the plate in a humidified cell culture incubator set at 37 °C and 5% CO2 for 30 min to allow polymerization of the collagen matrix (Figure 3).
Figure 3. Collagen matrices in which spheroids are embedded were added to wells of a 24-well suspension culture plate
Stimulate spheroids with 100 µl of basal medium, 25 ng/ml VEGF-A (in basal medium) and 25 ng/ml FGF2 (in basal medium) by adding it dropwise on the collagen matrix.
Note: The volume of the added medium can be changed if necessary.
Incubate collagen matrix for 24 h in a humidified cell culture incubator.
Stop the sprouting assay by adding 1 ml of 10% paraformaldehyde and store plates at 4 °C (for up to 4 weeks).
Data analysis
To analyze the pro- or anti-angiogenic effect of a gene mutation or a chemical compound, the number of sprouts and the length of the sprouts have to be determined.
Aspirate the paraformaldehyde from the collagen matrix.
Place the 24-well plate under an inverted microscope.
Acquire images of 10 randomly selected spheroids.
Count the number of sprouts per spheroid and measure the sprout length of all sprouts per spheroid using the imaging software FIJI (Figure 4).
Figure 4. Sprouting analysis of a HUVEC spheroid. A. Image of a HUVEC spheroid embedded in a collagen matrix after 24 h of sprouting. B. Image analysis: Measuring the sprout length of all sprouts of the spheroid by using FIJI software. A line was manually drawn, and the length of the line was determined. Scale bar = 100 µm.
The following parameters are used as readout for the angiogenic activity:
Number of sprouts per spheroid.
Average sprout length of the sprouts per spheroid.
Cumulative sprout length of all sprouts per spheroid.
The parameters of ten technical replicates are averaged and at least 3 biological replicates should be analyzed. Spheroids stimulated with VEGF-A or FGF2 should show a clearly increased sprouting ability compared to basal spheroids (Figure 5).
Figure 5. HUVEC spheroid embedded in a collagen matrix after 24 h of sprouting. The assay was performed under basal conditions (A), with 25 ng/ml VEGF-A stimulation (B) and with 25 ng/ml FGF2 stimulation (C). Scale bar = 100 µm.
Notes
Methocel stock solution: Proper centrifugation of methyl cellulose solution is important to remove debris. Otherwise, cells can stick to the plate resulting in multiple small spheroids instead of a single one. Stock solution can be stored at 4 °C for up to 6 months.
Collagen stock solution: Prepare the collagen stock solution four weeks in advance, since freshly isolated collagen can cause higher inter-experimental variation. Stock solution can be stored at 4 °C for at least 6 months.
Embedding of spheroids: After neutralization, collagen medium should be clear.
Recipes
Methocel stock solution
Weigh 6 g of methyl cellulose, transfer it to a 500 ml bottle and add a clean magnetic stirrer. Autoclave it at 121 °C for 20 min
Heat up 250 ml Endopan 3 basal medium to 60 °C and add it to the autoclaved methyl cellulose
Stir the solution for 20 min at room temperature
Add 250 ml Endopan 3 basal medium (room temperature) and stir the solution overnight at 4 °C
Aliquot the stock solution into 50 ml conical tubes
Centrifuge methocel solution for 2 h at room temperature and 5,000 x g
Use supernatant of the methocel solution for spheroid culture
Collagen stock solution
Note: A detailed video protocol has been published by (Bruneau et al., 2010).
Place two rat tails in 500 ml of 70% ethanol and incubate for 20 min at room temperature
Cut the skin by using a scalpel and peel off the skin from the tail root to the tail tip
Wash tails in 70% ethanol
Break every second vertebral and isolate the tendons
Be careful: Do not isolate the attached connective tissue.
Collect tendons and incubate them in 500 ml of 70% ethanol for 20 min
Dry sterilized tendons in a safety cabinet for 30-60 min
Transfer tendons into 250 ml of 0.1 % sterile acetic acid (v/v in H2O) and incubate them for 48 h at 4 °C
Aliquot the collagen solution and centrifuge the aliquots at 4 °C and 17,000 x g for 90 min
Collect the clear supernatant, aliquot it into 50 ml conical tubes and store it at 4 °C
For equilibration, add 0.5 ml of ten-fold Medium 199 to 4 ml of collagen solution, mix and incubate it for at least 15 min on ice. In case the mixed solution solidifies, dilute the collagen stock solution with 0.1% sterile acetic acid until the Medium 199-collagen-solution stays liquid.
Acknowledgments
The assay was originally developed by Dr. T. Korff and Dr. H.G. Augustin (Korff and Augustin, 1999; Pfisterer and Korff, 2016).
This work was supported by the Deutsche Forschungsgemeinschaft (SFB-TR23, project A7) and the Helmholtz society to A.F.
Competing interests
The authors declare that they have no conflict of interest.
References
Bruneau, A., Champagne, N., Cousineau-Pelletier, P., Parent, G. and Langelier, E. (2010). Preparation of rat tail tendons for biomechanical and mechanobiological studies. J Vis Exp(41).
Heiss, M., Hellstrom, M., Kalen, M., May, T., Weber, H., Hecker, M., Augustin, H.G. and Korff, T. (2015). Endothelial cell spheroids as a versatile tool to study angiogenesis in vitro. FASEB J 29(7): 3076-3084.
Korff, T. and Augustin, H. G. (1999). Tensional forces in fibrillar extracellular matrices control directional capillary sprouting. J Cell Sci 112 (Pt 19): 3249-3258.
Leung, B. M., Lesher-Perez, S. C., Matsuoka, T., Moraes, C. and Takayama, S. (2015). Media additives to promote spheroid circularity and compactness in hanging drop platform. Biomater Sci 3(2): 336-344.
Nowak-Sliwinska, P., Alitalo, K., Allen, E., Anisimov, A., Aplin, A.C., Auerbach, R., Augustin, H.G., Bates, D.O., van Beijnum, J. R., Bender, R. H. F., Bergers, G., Bikfalvi, A., Bischoff, J., Böck, B. C. and Brooks, P. C. (2018). Consensus guidelines for the use and interpretation of angiogenesis assays. Angiogenesis 21: 425-532.
Pfisterer, L. and Korff, T. (2016). Spheroid-Based in vitro angiogenesis model. Methods Mol Biol 1430: 167-177.
Potente, M. and Makinen, T. (2017). Vascular heterogeneity and specialization in development and disease. Nat Rev Mol Cell Biol 18(8): 477-494.
Tetzlaff, F., Adam, M. G., Feldner, A., Moll, I., Menuchin, A., Rodriguez-Vita, J., Sprinzak, D. and Fischer, A. (2018). MPDZ promotes DLL4-induced Notch signaling during angiogenesis. Elife 7: e32860.
Copyright: Tetzlaff and Fischer. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Tetzlaff, F. and Fischer, A. (2018). Human Endothelial Cell Spheroid-based Sprouting Angiogenesis Assay in Collagen. Bio-protocol 8(17): e2995. DOI: 10.21769/BioProtoc.2995.
Tetzlaff, F., Adam, M. G., Feldner, A., Moll, I., Menuchin, A., Rodriguez-Vita, J., Sprinzak, D. and Fischer, A. (2018). MPDZ promotes DLL4-induced Notch signaling during angiogenesis. Elife 7: e32860.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Angiogenesis
Cancer Biology > Angiogenesis > Cell biology assays
Cell Biology > Cell movement > Cell migration
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,996 | https://bio-protocol.org/exchange/protocoldetail?id=2996&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Striatal Synaptosomes Preparation from Mouse Brain
SM Shiqi Ma
AS Alexander Sorkin
Published: Sep 5, 2018
DOI: 10.21769/BioProtoc.2996 Views: 4007
Original Research Article:
The authors used this protocol in Apr 2018
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2018
Abstract
The striatum is located in the subcortical region of the forebrain, it contains medium spiny neurons, cholinergic interneurons and GABAergic interneurons, and receives dopaminergic projection in the nigrostriatal pathway. This protocol provides a method to collect synaptosomes from mouse brain dorsal stratum. The synaptosomes can be used to study dopamine uptake activity, dopaminergic terminal endocytosis/trafficking using biochemical and microscopy methods, and protein analysis (Sorkina et al., 2018).
Keywords: Striatum Synaptosomes Dopamine Dopamine transporter Endocytosis
Materials and Reagents
Pipette tips
Eppendorf tubes
10 cm glass plates
Two 8-week HA-DAT knock-in mice (Rao et al., 2012) or wild type mice
Gey’s balanced salt solution (Sigma-Aldrich, catalog number: G9779 )
D-glucose (Sigma-Aldrich, catalog number: G8644 )
HEPES (Sigma-Aldrich, catalog number: H0887 )
Sucrose (Sigma-Aldrich, catalog number: 84097 )
NaCl (Sigma-Aldrich, catalog number: S3014 )
KCl (Sigma-Aldrich, catalog number: P5405 )
CaCl2 (Merck, catalog number: 208291 )
MgCl2 (Merck, catalog number: 442611 )
Filter units (Thermo Fisher Scientific, catalog number: 124-0045 )
Freshly-prepared sucrose buffer (see Recipes)
Krebs Ringer solution (see Recipes)
Note: Items 1-3 and 5-12 can be ordered from any qualified company.
Equipment
Gilson Pipettes
Iris dressing forceps (Kent Scientific, catalog number: INS650915 )
Mayo-operating scissors (Kent Scientific, catalog number: INS700540 )
Extra fine Bonn scissors (Fine Science Tools, catalog number: 14083-08 )
Interchangeable blades (2x) and the handles (2x) (Fine Science Tools, catalog numbers: 10035-10 ; 10035-00 )
Glass homogenizer (DWK Life Sciences, KimbleTM, catalog number: 885300-0001 )
Centrifuge (Eppendorf, model: 5424 , 24-tube, Max 21,130 x g, refrigerated)
Note: Items 1-6 can be ordered from any qualified company.
Procedure
Prepare fresh sucrose buffer (Recipe 1). Keep the buffer on ice.
Add D-glucose to 20 ml Gey's balanced salt solution to reach a final concentration of 1.8 g/L. Put the buffer in a 10 cm glass plate on ice.
Euthanize two 8-week mice using carbon dioxide. Decapitate the mice using mayo-operating scissors.
Use extra fine Bonn scissors to break the skull and use iris dressing forceps to take the brain out. Quickly rinse the brains in ice-cold Gey’s balanced salt solution with 1.8 g/L D-glucose.
Note: Keep the other brain in the buffer while dissecting one brain in Step 5. It is better not to exceed 30 min to keep brain in the buffer.
Place the brain with the ventral side facing a 10 cm glass plate. Place the dressing forceps between the cortical lobes and the cerebellum and snap the cerebellum off (see Spijker, 2011). Gently use the forceps to open the cortex on one side, the striatum can be recognized by the surrounding white tissue. Striatum looks relatively transparent. Use the two interchangeable blades with the handles to collect the striatum. Get the striatum of the other side in the same way. Place the tissue in a glass homogenizer with ice-cold sucrose buffer (1 ml sucrose buffer for striatal tissue from one brain, the tissue usually weights 45-50 mg).
Homogenize the tissue 10-15 times, carefully avoid generating bubbles. Transfer the homogenization to a new 1.5 ml tube.
Centrifuge the homogenate at 1,000 x g for 10 min at 4 °C, and move the supernatant into a new 1.5 ml tube. Centrifuge at 12,500 x g for 20 min at 4 °C. Remove the supernatant using 1 ml tip, then a 200 μl tip. The pellet in the bottom that contains the synaptosomes is white.
Re-suspend the synaptosomes in 0.5-1 ml Krebs Ringer HEPES solution. Vortex for about 30 s or until the pellet is dissolved. Use the synaptosomes to perform future experiment (such as dopamine uptake assay) immediately.
Recipes
Freshly-prepared sucrose buffer
Dilute 1 M stock-solution of sodium-HEPES buffer (pH 7.4) to 5 mM with H2O, add sucrose to a final concentration of 0.32 M, check pH and adjust if not 7.4
Note: Keep the buffer on ice. There is no need for sterilization of this buffer.
Krebs Ringer HEPES (KRH) solution
Prepare 140 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2 and 5.5 mM HEPES solution in dH2O, adjust pH to 7.4 if necessary
Note: Filter the buffer using the disposable filter unit. Add D-glucose to the final concentration of 1.8 g/L before each use.
Acknowledgments
This work was supported by the grant DA14204 from NIH/NIDA. The author declare that there are no conflicts of interest or competing interests.
References
Rao, A., Richards, T. L., Simmons, D., Zahniser, N. R. and Sorkin, A. (2012). Epitope-tagged dopamine transporter knock-in mice reveal rapid endocytic trafficking and filopodia targeting of the transporter in dopaminergic axons. FASEB J 26(5): 1921-1933.
Spijker, S. (2011). Dissection of rodent brain regions. In: Li, K. W. (Ed.). Neuroproteomics. vol. 57, pp13-26, DOI 10.1007/978-1-61779-111-6_2. Springer Science+Business Media, LLC.
Sorkina, T., Ma, S., Larsen, M. B., Watkins, S. C. and Sorkin, A. (2018). Small molecule induced oligomerization, clustering and clathrin-independent endocytosis of the dopamine transporter. Elife 7: e32293.
Copyright: Ma and Surve. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
Category
Neuroscience > Cellular mechanisms > Synaptic physiology
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,997 | https://bio-protocol.org/exchange/protocoldetail?id=2997&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assays for Oxidative Responses of Fusarium graminearum Strains to Superoxide Radicals
YW Yan-Zhang Wang
YG Yan Guo
Wei-Hua Tang
Published: Sep 5, 2018
DOI: 10.21769/BioProtoc.2997 Views: 4608
Download PDF
Ask a question
Favorite
Cited by
Abstract
The ascomycete fungus Fusarium graminearum is a major causal agent of Fusarium head blight (FHB), a devastating disease affecting small grains cereals worldwide. To better understand the pathogenesis of this fungus, we provide here an easy-to-use protocol to examine the sensitivity of the wild-type and mutant strains of F. graminearum to oxidative stress from superoxide anions (O2•-) generated by menadione. Similarly, this assay can also be used to detect other stress responses of different fungal strains to various stress agents. The change in stress response of a mutant can offer a clue for the biological function of mutated genes.
Keywords: Fusarium graminearum Mutant Mycelial disc Sensitivity Oxidative stress
Background
The ascomycete fungus Fusarium graminearum (previously also called Gibberella zeae for its sexual state) is not only the major causal agent of Fusarium head blight and seedling blight on wheat and barley, but also one of the important causal agents of Gibberella stalk rot on maize (Dal Bello et al., 2002; Bai and Shaner, 2004; Kazan et al., 2012). Apart from causing a huge yield loss of cereals, this fungus also produces mycotoxins which affect human and animal health. Therefore, this fungus has received extensive attention, and ranked the fourth among all investigated plant pathogenic fungi (Dean et al., 2012).
F. graminearum overwinters on dead organic matter, particularly on infected crop residues of small grains and corn. To survive such a wide range of environment, F. graminearum has evolved the capacity to confront various stresses. Numerous genes in F. graminearum have been explored for their roles in counteracting stress treatment, and the resulting mutants exhibited diverse responses to the stresses, which indicated the association of the stress responses and pathogenicity (Son et al., 2011). Some of the frequently used stress agents that act on cell wall or cell membrane of fungi include oxidative stress agents (e.g., menadione and H2O2), cell wall-perturbing agents (e.g., Congo red), and membrane stress agents (e.g., SDS). Detection of the stress responses of a fungal mutant strain could provide a clue for further investigating pathogenetic function. Thus, we take oxidative stress treatment as an example to describe a reliable protocol to assess stress response of F. graminearum to a superoxide radical generating agent menadione (Kawamura et al., 2006). This protocol can be used to detect other stress responses of a fungal strain in an analogous procedure.
Materials and Reagents
Pipette tips (Corning, Axygen®, catalog number: T-300-R-S )
9 cm Petri plates
Sterile toothpick
Parafilm (Bemis, catalog number: PM996 )
Fungal strains: F. graminearum wild-type strain PH-1 (NRRL 31084), and its deletion mutant ∆sod1 (Yao et al., 2016)
75% alcohol (Sinopharm Chemical Reagent, catalog number: 80176961 )
Menadione (also named Vitamin K3, Sangon Biotech, catalog number: A502486-100g )
V8 vegetable juice (CAMPBELL, V8® ORIGINAL)
Absolute ethanol (Sinopharm Chemical Reagent, catalog number: 10009259 )
CaCO3 (Acros Organics, catalog number: 403811000 )
Double distilled water
Agar powder (Oxoid, catalog number: LP0011 )
NaNO3 (Sinopharm Chemical Reagent, catalog number: 10019918 )
KH2PO4 (Sinopharm Chemical Reagent, catalog number: 10017618 )
MgSO4•7H2O (Sinopharm Chemical Reagent, catalog number: 10013018 )
KCl (Sinopharm Chemical Reagent, catalog number: 10016318 )
Sucrose (Sinopharm Chemical Reagent, catalog number: 10021418 )
N-Z Amine (Casein acid hydrolysate) (Macklin, catalog number: C822594 )
Yeast extract (Oxoid, catalog number: LP0021 )
Inositol (Sinopharm Chemical Reagent, catalog number: 63007734 )
Ca pantothenate (TCI Shanghai, catalog number: P0012 )
Choline•Cl (Sinopharm Chemical Reagent, catalog number: 69008560 ）
Thiamine (Shanghai Bo'ao Biological Technology, catalog number: H1230 )
Pyridoxine (Shanghai Bo'ao Biological Technology, catalog number: H0970 )
Nicotinamide (Shanghai Bo'ao Biological Technology, catalog number: H0850 )
Ascorbic acid (Sinopharm Chemical Reagent, catalog number: 10004014 )
Riboflavin (Sinopharm Chemical Reagent, catalog number: 67001734 )
p-aminobenzoic acid (Sinopharm Chemical Reagent, catalog number: 31000116 )
Folic acid (Shanghai Bo'ao Biological Technology, catalog number: H0550 )
Biotin (Shanghai Bo'ao Biological Technology, catalog number: H50 )
Citric acid (TCI Shanghai, catalog number: C1949 )
ZnSO4•7H2O (Sinopharm Chemical Reagent, catalog number: 10024018 )
CuSO4•5H2O (Sinopharm Chemical Reagent, catalog number: 10008218 )
Fe(NH4)2(SO4)2•6H2O (Beijing Ouhe Technology, catalog number: 01000313 )
MnSO4 (Sinopharm Chemical Reagent, catalog number: 10013418 )
H3BO3 (Sinopharm Chemical Reagent, catalog number: 10004808 )
Na2MoO4•2H2O (Sinopharm Chemical Reagent, catalog number: 10019818 )
30 mM menadione stock solution (see Recipes)
V8 juice agar medium (Yao et al., 2016; see Recipes)
CM medium (Yao et al., 2016; see Recipes)
Vitamin stock solution (see Recipes)
Trace element solution (see Recipes)
Equipment
500 ml flask
Pipettes (Eppendorf)
Incubator (Yiheng, model: MJ-150I )
Biological safety cabinet (ESCO Micro, model: FHC1200A )
Camera (Canon, model: EOS 7D )
Autoclave (Zealway Instrument, model: GI54DWS )
Ruler
Microwave oven (Galanz, model: G70F23N1P-M8(SO) )
Software
ImageJ software (http://rsbweb.nih.gov/ij/index.html)
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > Fungus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,998 | https://bio-protocol.org/exchange/protocoldetail?id=2998&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Shock-probe Defensive Burying Test to Measure Active versus Passive Coping Style in Response to an Aversive Stimulus in Rats
EF Elizabeth A. Fucich
DM David A. Morilak
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2998 Views: 5780
Reviewed by: Lara HwaKaren N Krukowski
Original Research Article:
The authors used this protocol in Feb 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2018
Abstract
Maladaptive avoidance behaviors are seen in many stress-related psychiatric illnesses. Patients with these illnesses favor passive, avoidant coping strategies rather than adaptive, active coping strategies. Preclinically, coping strategy can be measured in rats using the shock-probe defensive burying test, wherein rats receive a shock from an electrified probe inserted into a test cage that mimics their home cage environment, and behavioral output (immobility or burying) is recorded for 15 min following the shock. Immobility in response to the perceived threat of the shock-probe, associated with elevated stress hormone levels, is regarded as a passive, maladaptive coping strategy. In opposition, burying the probe is associated with lower stress hormone levels and is considered an active, adaptive coping style. In rats, chronic stress induces a shift from active to passive coping in this test (i.e., proportionally less burying and more immobility), modeling the avoidant symptoms presented across many stress-related psychiatric illnesses. The stress-induced shifts in coping style and overall behavioral reactivity to the shock-probe provide a unique and well-validated measure of not only an anxiety-like behavioral response but also coping strategy selection in rat models of psychiatric illness.
Keywords: Active coping Passive coping Stress Behavior Anxiety Coping strategy Avoidance Animal models
Background
In addition to the “fight, flight, or freeze” response, rats were reported to engage in a specific defensive behavior in response to an aversive stimulus by Hudson in 1950, termed “defensive burying”. This burying behavior was determined to be an innate response of rodents (including rats, mice, hamsters, and ground squirrels) to threats in their burrows (see De Boer and Koolhaas, 2003). Additionally, it was found that rats that are allowed to bury a shock-associated stimulus have less HPA axis activation than rats who were prevented from burying and forced to adopt a passive (immobile) response, suggesting that defensive burying is more adaptive compared with passive responses (De Boer et al., 1990; Korte et al., 1992; Bondi et al., 2007). Originally described by Pinel and Treit in 1978, we have adopted the shock-probe defensive burying test in our lab to model central components of stress-related psychiatric illness, i.e., preference for passive, avoidant coping strategies versus adaptive, active coping strategies. Using the protocol described here, we have shown that chronic unpredictable stress induces a shift from active to passive coping in adult Sprague-Dawley rats in this test (Jett et al., 2015; Hatherall et al., 2017; Fucich et al., 2016 and 2018), modeling the maladaptive, avoidant coping strategies adopted by patients across many stress-related psychiatric illnesses (Koolhaas et al., 1999; Bondi et al., 2007). We have previously described the validity of this test as a measure of anxiety-like responding (see Lapiz-Bluhm et al., 2008), and have more recently shown the efficacy of novel antidepressant drugs as well as behavioral therapy in reversing chronic stress-induced shifts in coping style choice (Jett et al., 2015; Hatherall et al., 2017; Fucich et al., 2016 and 2018). Thus, measuring coping style and aversive stimulus reactivity with the shock-probe defensive burying test in rats is useful in characterizing animal models of stress-related psychiatric illnesses like depression and posttraumatic stress disorder as well as testing novel therapeutic interventions and their mechanisms. Variations of the shock-probe defensive burying test have been used to test mice (e.g., Sluyter et al., 1996 and 1999; López-Rubalcava et al., 2000; Paez-Martinez et al., 2003) as well as various rat strains (as reviewed in De Boer et al., 2003), therefore the protocol described here may feasibly be adapted to any rodent model which displays innate defensive burying.
Materials and Reagents
Certified Sani Chips, identical to rat’s home cage bedding material (Envigo, Harlan, Teklad, catalog number: 7090C )
Polyethylene tubing, PE-50 (Scientific Commodities, catalog number: BB31695-PE/1 )
Industrial grade adhesive (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: 24006-0000 )
Abrasive sanding sheets (3MTM WetordryTM Abrasive Sheets, aluminum oxide, grade P400) (3M, catalog number: 213Q )
Paper towels
Numbered index cards to identify animals for blind scoring
Masking tape
Permanent marker
Rat (Sprague-Dawley)
Distilled water
10% ethanol
Equipment
Plastic “shoebox” rat cage with plastic barrier lid (ours are 42 cm x 20 cm x 20 cm, identical to our home cages; e.g., Allentown, catalog number: PC10198 )
Uninsulated copper wiring, 1 mm diameter (Fisher Scientific, catalog number: 15-545-1B)
Manufacturer: Arcor Electronics, catalog number: BARE18GA .
Glass stirring rods, 5 mm diameter x 200 mm length (Fisher Scientific, catalog number: S63449 )
Ring stand (EISCO, catalog number: CH0653E1RD4 )
Three prong extension clamp (Fisher Scientific, catalog number: 05-769-7Q ), attached to ring stand
Alligator clips (EISCO, catalog number: PH1053B ), cut and soldered, one to each lead of the shock output cable for the shock generator
Uninsulated wire-wrapped shock probe (Custom fabrication, see Step A1 of Procedure)
Modified test cage and lid (Custom fabrication, see Step A2 of Procedure)
Electric drill
Utility knife
Wire cutters
Shock generator (e.g., Coulbourn Instruments, model: H13-15 )
Video camera
Tripod
Computer
Timer
Software
Video recording software, e.g., QuickTime (Apple)
Statistical analysis software, e.g., Statistica (TIBCO Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Fucich, E. A. and Morilak, D. A. (2018). Shock-probe Defensive Burying Test to Measure Active versus Passive Coping Style in Response to an Aversive Stimulus in Rats. Bio-protocol 8(17): e2998. DOI: 10.21769/BioProtoc.2998.
Fucich, E. A., Paredes, D., Saunders, M. O. and Morilak, D. A. (2018). Activity in the ventral medial prefrontal cortex is necessary for the therapeutic effects of extinction in rats. J Neurosci 38(6): 1408-1417.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Neuroscience > Behavioral neuroscience > Coping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,999 | https://bio-protocol.org/exchange/protocoldetail?id=2999&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Microarray, IPA and GSEA Analysis in Mice Models
SO Stephanie N. Oprescu
KH Katharine A. Horzmann
FY Feng Yue
JF Jennifer L. Freeman
SK Shihuan Kuang
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.2999 Views: 9589
Edited by: Antoine de Morree
Reviewed by: Kirsten A. CoprenDilip Kumar
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
This protocol details a method to analyze two tissue samples at the transcriptomic level using microarray analysis, ingenuity pathway analysis (IPA) and gene set enrichment analysis (GSEA). Methods such as these provide insight into the mechanisms underlying biological differences across two samples and thus can be applied to interrogate a variety of processes across different tissue samples, conditions, and the like. The full method detailed below can be applied to determine the effects of muscle-specific Notch1 activation in the mdx mouse model and to analyze previously published microarray data of human liposarcoma cell lines.
Keywords: Microarray Ingenuity pathway analysis Gene set enrichment analysis Knowledge-based software Transcriptomic-based analysis
Background
Transcriptomic analysis of various cell types is crucial to elucidate the functional elements of a cell, provides insight into cell-specific characteristics and can highlight changes associated with different development or disease stages (Wang et al., 2009). While RNA-sequencing has become increasingly popular, the relative cost and time to analysis may be a burden. Therefore, microarray analysis is an alternative tool for comparing relative gene-expression levels between various mRNA samples (Read et al., 2001). Microarray is commonly used to investigate changes associated with disease states whose gene expression patterns can be inferred or have already been defined (Amaratunga et al., 2007). Ingenuity pathway analysis (IPA, QIAGEN) is commonly used in conjunction with large-scale omics data and provides information about pathways, genes and other signatures that may be significantly altered across different samples. Gene set enrichment analysis (GSEA) uses gene sets and characteristics that have been a priori associated with various diseases or pathways in order to provide biological application to the sample of interest.
The methods described below were used by Bi and colleagues to understand the effects of Notch signaling in muscle regeneration and liposarcoma, a common soft-tissue cancer type (Bi et al., 2016a). These methods probed the effects of myofiber-specific Notch activation in a Duchenne’s muscular dystrophy (mdx) mouse model and discovered that over-activation of Notch in the mdx mouse model displayed similar gene-expression patterns as healthy human muscle. Similarly, Bi and colleagues performed microarray analysis, IPA and GSEA to find that over-activation of Notch in mouse inguinal white adipose tissue shares signatures of human liposarcoma (Bi et al., 2016b). Both of these studies underscore the importance of comparative analyses when using animal models and since many microarray datasets are available online, gene set enrichment analysis (GSEA) can be used to evaluate already published datasets with respect to the investigator’s interest at relatively low cost. Discoveries such as these are imperative towards developing therapeutic targets and furthering our understanding of biological processes and how their perturbance may influence human disease.
Materials and Reagents
RNA isolation and cDNA synthesis
1.5 ml microcentrifuge tubes (DOT Scientific, catalog number: RN1700-GMT )
Mouse (strains purchased from the Jackson lab and used in this study: mdx (stock# 007914) and Adiponectin-Cre; transgenics were in a C57BL/6J and 129S4 mixed background)
Liquid nitrogen
Chloroform (Sigma-Aldrich, catalog number: 288306 )
Isopropanol (Fisher Scientific, catalog number: S25372 )
TRIzolTM reagent (Thermo Fisher Scientific, catalog number: 15596026 )
75% Ethanol (diluted in RNase-free water)
Nuclease-free water (Thermo Fisher Scientific, catalog number: AM9916 )
Optional: RNaseZapTM RNase Decontamination Solution (Thermo Fisher Scientific, catalog number: AM9780 ) or other RNase decontamination solution
RNaseOUTTM Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, catalog number: 10777019 )
Real-Time Quantitative PCR
LightCycler 480 96-well Multi-well Plate (Roche Diagnostics, catalog number: 04729692001 )
LightCycler 480 Sealing Foil (Roche Diagnostics, catalog number: 04729757001 )
1.5 ml microcentrifuge tube (DOT Scientific, catalog number: RN1700-GMT )
10 mM dNTP set (Thermo Fisher Scientific, catalog number: 10297018 )
RNaseOUTTM Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific, catalog number: 10777019 )
Oligo(dT)18 primer (IDTDNA)
M-MLV Reverse Transcriptase (Thermo Fisher Scientific, InvitrogenTM, catalog number: 28025013 )
5x First-Strand Buffer
DTT
SYBR Green Master Mix (Roche Diagnostics, catalog number: 4913854001 )
Gene-specific primers and house-keeping gene-specific primers (i.e., 18S ribosomal subunit) ordered from IDTDNA.
Note: Primers used to validate microarray results and for real-time quantitative PCR in Bi et al. (2016b) are listed in Supplemental file.
Microarray
Agilent SurePrint G3 Mouse GE 8 x 60 K chip (Agilent Technologies, catalog number: G4126A ; other chips can be used depending on tissue sample)
Triton X-102 (Sigma-Aldrich, catalog number: X102-500mL )
100% isopropyl alcohol (Fisher Scientific, catalog number: S25372 )
RNeasy Mini Kit (QIAGEN, catalog number: 74104 )
50 RNeasy Mini Spin Columns
Collection tubes
RNase-free Buffer RLT
Add 10 μl β-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 ) 1 ml of RPE buffer
RNase-free Buffer RPE (concentrate)
Add 4x volume of 100% Ethanol to buffer
Buffer RW1
RNase-free water
75% Ethanol (100% ethanol diluted in Nuclease-free water)
Other microarray kit components
Cyanine 3-CTP and cyanine 5-CTP
Spike A and Spike B Mix
Dilution buffer
T7 primer
5x First strand buffer
0.1 M DTT
10 mM dNTP mix
Affinity Script RNase Block Mix
NTP Mix
T7 RNA Polymerase Blend
Nuclease-free water
5x Transcription Buffer
10x blocking agent
1,250 μl Nuclease-free water to 10x gene expression blocking agent
1x HiRPM Hybridization buffer
Equal volume 2x HiRPM Hybridization buffer to Nuclease-free water
Gene expression Wash Buffers 1 and 2
Triton X-102 (10%)
RNeasy Mini Kit (see components listed above)
Slide staining dishes
Slide racks
Equipment
RNA isolation and cDNA synthesis
Balance
Pipettes (1,000 μl, 200 μl)
Vortex (e.g., Scientific Industries, model: Vortex-Genie 2 , catalog number: SI0236)
Centrifuge capable of reaching 16,000 x g and 4 °C for 1.5 ml tubes (Eppendorf, model: 5424 R )
Tissue homogenizer (e.g., Fisher Scientific, catalog number: FB120110 )
Heat block capable of maintaining following temperatures for 1.7 ml micro-centrifuge tubes: 65 °C, 37 °C, 25 °C, 70 °C
Water bath (e.g., Thermo Fisher Scientific, catalog number: TSGP02 )
Optional: Rotating incubator
Optional: Rotator rack
Microarray
Stir bar
Pipettes (1,000 μl, 200 μl, 10 μl, multi-channel pipette)
Centrifuge (Eppendorf, model: 5424)
Agilent Technology Surescan Microarray Scanner
Hybridization oven (Agilent Technologies, catalog number: G2545A )
NanoDropTM ND-1000 UV-VIS Spectrophotometer version 3.2.1 or higher (Thermo Fisher Scientific, model: NanoDropTM 1000 , catalog number: ND-1000)
Heat block capable to maintaining following temperatures for 1.7 ml micro-centrifuge tubes: 80 °C, 70 °C, 60 °C , 40 °C, 37 °C
Agilent Gene Expression Two Color Microarray (Agilent Technologies, catalog number: G4140-90050 )
RNA quantification and quality control
NanodropTM 2000c (or spectrophotometer) (Thermo Fisher Scientific, model: NanoDropTM 2000c )
Agilent Bioanalyzer 2100
qRT-PCR
Roche Light Cycler 480 PCR System for 96-well plate
Software
SAS software for statistical analysis (https://www.sas.com/en_us/software/university-edition.html)
OligoAnalyzer 3.1 (IDT) (https://www.idtdna.com/calc/analyzer)
GSEA (Gene set enrichment analysis) software available at: http://software.broadinstitute.org/gsea/index.jsp
IPA (Ingenuity pathway analysis) software available at: https://www.qiagenbioinformatics.com/products/ingenuity-pathway-analysis/
Agilent Microarray Scan Control (provided with current instrumentation)
Agilent Feature Extraction Software 12.0 (provided with current instrumentation)
Agilent GeneSpring GX software (provided with current instrumentation)
NCBI Blastn (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch)
UCSC Genome Browser, In silico PCR tool (https://genome.ucsc.edu/)
Procedure
RNA isolation
Notes:
Isolate no less than 500 ng RNA from Mus musculus adult whole tibialis anterior (TA) skeletal muscle (Figure 1).
Figure 1. Image of tibialis anterior (TA) anatomy and dissection. Dashed red lines represent location of the TA. A. Location of TA prior to the removal of fur; B. Location of TA prior to dissection of the muscle; C. TA is cut from the tendon near the foot and pulled up towards the knee. D. Image of fully dissected TA.
Maintenance of RNase-free conditions are imperative to high quantity and quality yield of RNA from tissue, and surfaces can be cleaned with RNaseZapTM. RNA will be used for microarray analysis and cDNA synthesis.
Expect yield > 4 μg RNA/sample
Dissect TA muscle or tissue of interest from respective mouse specimen (Figures 1A-1D).
Weigh TA muscle, flash freeze in liquid nitrogen and add 1 ml of TRIzolTM reagent per 50-100 mg of tissue in 1.5 ml micro-centrifuge tube.
Use a tissue homogenizer to homogenize the tissue for 2-3 sec at a time, placing the sample on ice to ensure it does not over-heat. The sample should be homogenized until no clear pieces of tissue are visible, approximately 2-4 times.
Optional: clear lysate by centrifugation for 5 min at 4 °C and 12,000 x g and transfer supernatant to a new 1.5 ml microcentrifuge tube (approximate volume ~800 μl).
Incubate the sample at room temperature for 5 min.
Add 0.2 ml of chloroform per 1 ml of TRIzolTM reagent used, and shake or vortex vigorously for 15 sec. Then incubate the sample at room temperature for 3 min.
Centrifuge for 15 min at 4 °C and 12,000 x g to separate phases.
Transfer the aqueous phase (clear, upper phase Figure 2) containing the RNA to a new tube using a 1 ml pipette (volume ~400-600 μl), making sure not to transfer any of the interphase or phenol-chloroform phase.
Figure 2. Image of phase separation following TRIzolTM reagent RNA extraction. Aqueous phase (gray) contains RNA and is to be carefully transferred into a fresh tube for downstream isolation.
Add 0.5 ml of isopropanol per 1 ml of TRIzolTM reagent used to the aqueous phase containing RNA from Step A8 and incubate at room temperature for 10 min.
Centrifuge sample for 10 min at 4 °C and 12,000 x g to precipitate RNA (RNA should form a white pellet at the bottom of the tube).
Discard the supernatant being careful not to disturb the pellet.
Resuspend pellet in 1 ml of 75% ethanol per 1 ml of TRIzolTM reagent used to wash the RNA pellet.
Gently shake sample briefly and centrifuge for 5 min at 4 °C and 7,500 x g.
Carefully discard supernatant, removing as much ethanol as possible without disturbing the pellet.
Air-dry pellet for maximum 5-10 min at room temperature. Make sure that the ethanol has evaporated but do not let the pellet dry for too long as residual ethanol and over-drying both may affect RNA quality.
Resuspend pellet in 50 μl of RNase-free water (imperative if being used for downstream microarray analysis).
Measure concentration and the ratio of A260/A280 using NanoDrop Spectrophotometer.
Notes:
One milligram of the sample should yield roughly 1 μg of RNA.
The ratio of A260/A280 in the range of 1.85-1.95 is required for downstream applications, and the RNA sample quality should be checked using the Agilent bioanalyzer.
Determination of the quality of RNA sample on an Agilent bioanalyzer should yield two large peaks corresponding to the 18S and 28S ribosomal subunits (Peterson et al., 2009). Examples of good and poor quality RNA are shown in Figure 3.
Figure 3. Images of intact (ideal), partially degraded and degraded RNA samples as determined by using the Agilent BioAnalyzer. The top panel clearly shows two peaks which correspond to the 18S and 28S ribosomal subunits, a small peak to a spike-in control and otherwise smooth lines. The middle and bottom panels represent degraded RNA in which the 18S and 28S peaks may or may not be clear and are usually preceded by multiple smaller peaks (indicative of degraded RNA). The x- and y-axis are nucleotides and fluorescence, respectively.
Transcriptomic Microarray Analysis
Microarray methods and analysis are adapted from the manufacturer’s manuals (Agilent, Two-Color Microarray-Based Gene Expression Analysis–Low Input Quick Amp Labeling)
Preparation of Spike A Mix and Spike B Mix as positive controls, all procedures should be done in an RNase-free environment to ensure stability of RNA, following steps can be done in a 1.5 ml microcentrifuge tube.
Vortex and heat Spike A and B Mix at 37 °C for 5 min upon arrival and briefly centrifuge.
To dilute Spike A Mix (for example) prepare first dilution by adding 2 μl of Spike A Mix to 38 μl dilution buffer, mix, and briefly spin down (dilution is 1:20).
Dilute solution from Step B1 b by adding 2 μl of diluted solution to 78 μl dilution buffer, mix, and briefly spin down (dilution is 1:40).
Dilute solution from Step B1 c by adding 2 μl of diluted solution to 30 μl dilution buffer, mix, and briefly spin down (dilution is 1:16).
Dilute solution from Step B1 d by adding 4 μl of diluted solution to 28 μl dilution buffer, mix, and briefly spin down (dilution is 1:8).
Add 2 μl of final diluted solution (final dilution is 1:102,400) to 25-100 ng of sample RNA (volume should not exceed 3.5 μl).
Repeat for Spike B Mix for other RNA samples (i.e., RNA from wild-type sample vs. RNA from experimental sample) and proceed with labeling reaction.
Labeling reaction, purification and quantification of fluorescently labeled complementary RNA (cRNA)
Note: For Spike A prepare with Cyanine 3-CTP and Spike B Cyanine 5-CTP dye otherwise both samples are treated the same. Have water baths or heating blocks set to 65 °C and 80 °C prior to starting procedure for Steps B2a-B2d (below).
Prepare T7 primer mix by combining 1.8 μl T7 primer to 1 μl nuclease-free water per reaction.
Add 1.8 μl T7 primer mix to each tube and incubate at 65 °C for 10 min, gently shaking the tube every couple of minutes.
Remove the reactions from heat and place on ice for 5 min.
In the meantime, pre-warm the 5x first strand buffer at 80 °C for 3-4 min, vortex and spin down so that the buffer components are fully re-suspended.
Assemble the following cDNA reaction on ice in a 1.5 ml microcentrifuge tube (scaling up according to the number of reactions with one reaction in excess to correct for pipetting error):
Add 4.7 μl cDNA reaction to each tube containing RNA + Spike Mix (final volume is 10 μl), mix by pipetting and briefly spin down.
Pre-heat blocks to 42 °C and 70 °C 10 min prior to use to ensure temperature reaches desired degrees (i.e., 42 °C and 70 °C).
Incubate reaction at 40 °C for 2 h then heat inactivate reaction at 70 °C for 15 min (occasionally shaking tube or using a circulating water bath).
Place the sample on ice for 5 min and in the meantime prepare the transcription master mix reactions (scaling up according to the number of reactions) as follows to amplify and fluorescently label the RNA:
Add 6 μl of transcription reaction to Spike A Mix or Spike B Mix (final volume per reaction now 16 μl), mix by pipetting up and down and incubate at 40 °C for 2 h.
Using the RNeasy Mini Kit, purify the cRNA from each reaction (protocol below as summarized per the manufacturer’s instructions)
Bring volume of cRNA reaction to 100 μl with nuclease-free water.
Add 350 μl of RLT and mix well.
Add 250 μl of 100% ice cold ethanol and mix by gently pipetting.
Transfer reaction to spin column, place in a collection tube and centrifuge at 16,000 x g and 4 °C for 30 sec.
Discard flow through and add 500 μl of RPE buffer to the column, centrifuge at 16,000 x g and 4 °C for 30 sec.
Repeat Steps B2j-B2k v but centrifuge at 16,000 x g and 4 °C for 60 sec.
Place column in a fresh collection tube and centrifuge at 16,000 x g and 4 °C for 30 sec to remove and remaining buffer.
Place column in a 1.5 ml microcentrifuge tube and add 30 μl of RNase-free water to the column.
Incubate at room temperature for 1-2 min and then centrifuge at 16,000 x g and 4 °C for 30 sec.
Optional: re-elute with eluate to increase yield.
Measure RNA concentration and quality with a NanoDropTM ND-1000 UV-VIS Spectrophotometer version 3.2.1 or higher.
1)
Use 'Microarray Measurement' tab and select RNA-40 as sample type.
2)
Record cyanine 3 or 5 concentration, RNA absorbance ratio and cRNA concentration (RNA absorbance ratio [260/280 nm] should be 1.9 ± 0.04 and cRNA concentration should yield at minimum 1.875 μg if using 2-pack format).
Hybridization of sample and probes
Preparation of 10x blocking: add 1,250 μl of nuclease-free water to the 10x gene expression blocking agent (supplied with the kit) and gently vortex to dissolve powder completely.
Note: If powder does not readily dissolve, heat blocking agent at 37 °C for 4-5 min.
Assemble the following reaction in a 1.5 ml microcentrifuge tube.
Note: The reaction below and subsequent volumes are for 2-pack microarray, for 1-pack, 4-pack or 8-pack refer to refer to Agilent’s Two-color Microarray-Based Gene Expression Analysis Protocol.
Incubate at 60 °C for 30 min then place reaction on ice.
Add equal volume 2x Hi-RPM Hybridization Buffer to stop reaction and mix well, being careful to not introduce any bubbles.
Briefly spin sample down and place on ice for immediate downstream use.
Load gasket slide into Agilent SureHyb (Figures 4B and 4C) chamber base with label facing up.
Slowly add 240 μl of sample onto the gasket well from left to right, being careful not to introduce any air bubbles.
Make 1x solution from 2x Hi-RPM Hybridization Buffer in any wells that remain unused.
Place the slide with the ‘active’ side down, such that the Agilent-labeled barcode is facing down and the numeric barcode facing upwards.
Place the SureHyb chamber cover onto the slides, clamp both pieces and tighten.
Double-check that there are no stationary bubbles and, if needed, tap on surface to remove.
Note: bubbles may be a source of artifacts as they may impact signal intensity.
Load the chamber onto the rotator rack in the hybridization oven, set it to rotate at 10 rpm and hybridize at 65 °C for 17 h.
Washing microarray slides
To prepare the Wash Buffers, remove outer and inner caps from container and use a pipette to add 2 ml of Triton X-102 to gene expression Wash Buffers 1 and 2.
Mix by inversion and replace the original outer and inner caps with the spigot provided with the kit.
Pre-warm gene expression Wash Buffer 2 to 37 °C before proceeding with washing the arrays.
Wash the staining dish prior to use as follows (repeat 2 x):
Add slide rack and stir bar to staining dish and fill the dish with 100% isopropyl alcohol (Figure 4A).
Turn on magnetic stir plate to wash for 5 min.
Rinse staining dish with Milli-Q water multiple times.
Figure 4. Image of microarray wash dishes, SureHyb chamber and slide. A. Image of the wash dish with metal stir bar (left) and slide holder. B. Assembled SureHyb chamber, cover and clamp. C. Individual parts of the SureHyb assembly kit. Top is the chamber, the microarray slide sits on top of it and the cover (middle) is gently placed on top. The clamp (bottom) is then used to ensure the slide and chamber stay tightly together. D. Image of microarray slides, the visible barcodes clearly state “Agilent” and are to be used for proper orientation.
Prepare staining dishes as follows
Fill slide-staining dish #1 with gene expression Wash Buffer 1.
Place slide rack into slide-staining dish #2 and add magnetic stir bar, fill with gene expression Wash Buffer 1 and place on a magnetic plate.
Place dish #3 on the stir plate, add a stir bar and only fill with pre-warmed gene expression Wash Buffer 2 immediately before use.
Remove hybridization chamber from the rotating incubator and note any bubbles that may have formed during hybridization.
Disassemble the hybridization chamber by placing it on a flat surface, remove the array-gasket while maintaining the numeric barcode facing up and immediately submerge it in slide-staining dish #1.
Keeping the array-gasket sandwich submerged, pry open the sandwich with forceps and let the gasket slide drop to the bottom of the dish.
Remove the slide and place it into the slide rack in slide-staining dish #2, being careful to only touch the slide over the numeric barcode or along the thin edges.
Repeat these steps for the remaining slides.
Incubate the slide on the magnetic stir plate for 1 min.
Add slide rack to slide-staining dish #3 and incubate on the magnetic stir plate for 1 min.
Slowly and carefully remove slide rack and place slides on the slide holder.
Add the slide without the barcode label towards the edge.
Active microarray surface should be facing up towards the slide cover.
Close the plastic cover.
Proceed to scanning slides.
Scanning microarray slides, feature selection and data collection
Place the slide holder containing slide into the scanner cassette.
Select the ‘AgilentG3_HiSen_GX_2color’ protocol.
Click ‘Start scan’.
Open Agilent Feature Extraction (FE) and add the images to be extracted to the FE project (default settings for project ok).
Note: Manual grid mapping may be required.
Save the Feature Extraction project as .fep via File > Save As.
Select Project > Start Extracting.
Validation of microarray results
Gene-specific primer design for real-time quantitative PCR (qPCR): selection of amplicon size, primers and template are imperative to generating reproducible data that can accurately determine if the results from the microarray are validated
Note: Pre-validated gene expression assays can be purchased from a variety of vendors and thus do not require optimization. For genes that are not available or have not been previously validated, primers efficiency should be evaluated (see below):
Select genes based on the microarray results. Candidate genes should be chosen based on genes that displayed a significant change across conditions and a reference gene should be chosen that did not display any change in expression across samples (for the latter examples include 18S rRNA or β-actin).
Amplicons targeted by primer should be approximately equal in size (not greater than 0.6 kb) and the secondary structures of the target sites can be determined using nucleic acid-folding software such as OligoAnalyzer 3.1 (IDT), as highly structured sequences can impact qPCR efficiency and results.
Primers target sites should be analyzed by in silico PCR tools such as NCBI BLAST or UCSC Genome Browser to determine specificity.
Each primer should have roughly the same melting temperature, however the exact ideal annealing temperature must be determined experimentally.
cDNA synthesis
One to five microgram of template RNA from tissue samples assayed in microarray analysis required (use both biological and technical replicates here; the former being another mouse sample under the same condition and the latter the same RNA that was used for microarray analysis), and quality should be determined prior to cDNA synthesis.
Thaw reagents from M-MLV RT kit, vortex and centrifuge briefly.
Assemble the following reaction on ice in the respective order:
Gently flick PCR tubes to mix contents, briefly centrifuge and incubate at 65 °C for 5 min then place on ice immediately.
Add the following components to the reaction in the respective order:
Mix reaction by pipetting up and down and incubate at 25 °C for 10 min.
Incubate reaction at 37 °C for 50 min.
Heat inactivate reaction at 70 °C for 15 min.
Resulting cDNA can be used immediately for real-time PCR analysis or stored at -20 °C.
Real-time qPCR of candidate target genes
Note: Important to set up biological and technical replicates as well as a negative control containing no template. 3 biological replicates (i.e., three RNA/cDNA samples from three different mice), 3 technical replicates (i.e., using the same RNA to generate cDNA) suggested per sample.
Primers should be re-hydrated in nuclease-free water and stored at a stock concentration of 10 μM.
Thaw reagents on ice and prepare the following reaction on ice (multiply the final reaction volume by the number of PCR reactions planned plus to [to account for pipetting error] create a master mix that can be aliquoted into Roche LightCycler 480 plates).
General Real-time Quantitative PCR cycler settings.
Cq values can then be analyzed for primer efficiency and subsequent fold-change in target gene expression (Cq values > 35 are not recommended to use).
Note: Samples requiring over 35 cycles may not provide reliable results and indicate that the cDNA quality or reaction efficiency is poor. While some very lowly expressed genes may yield a Cq value between 35-40, under those conditions it is imperative the negative control produces no signal at that cycle number
Data analysis
This part of the protocol includes the analysis of the microarray results and subsequent gene-set enrichment and ingenuity pathway analyses to determine candidate genes and enriched biological pathways/processes (respectively). Following candidate gene selection, real-time PCR analysis is performed to validate candidates (for an overview of workflow see Figure 5).
Figure 5. Overview of the workflow for microarray analysis. RNA is isolated from tissue samples (or cells) of interest. Quality of RNA is determined prior to proceeding with generation of cRNA, hybridization and data acquisition. Analysis of the microarray data is performed by the Agilent software. From there, the Gene Set Enrichment Analysis software is employed to yield genes that are significantly enriched in the assayed sample. Microarray data will also be used for Ingenuity Pathway Analysis (IPA) (and can be used for Gene Ontology [GO] analysis) to reveal pathways or biological processes that are enriched in the target sample.
Analysis of microarray results
Normalization, gene alignments and calls (to correlate gene expression levels) and evaluation of genes with statistically significant gene expression changes across the evaluated samples.
Download GeneSpring software to perform statistical analysis and open software.
Create a new project, load the text files from the feature extractor (FE) and click ‘Next’, keeping the software settings as default.
The data will be uploaded onto GeneSpring upon clicking ‘Finish’.
Assign ‘Experimental Grouping’ and then ‘Create an Interpretation’ with the respective experimental groupings properly selected.
Statistical analysis
Perform an Analysis of variance (ANOVA) using the software, selecting a Tukey post-hoc test and the appropriate pairing options (depending on samples).
If comparing wild-type and a knock out-sample, perform a Student’s t-test (in general, the statistical test performed will depend on the samples).
Fold-change analysis: elimination of probes that do not meet 1.5 fold-change.
Select ‘Fold-change’ with the same interpretation as used for the ANOVA.
Adjust fold-change to 1.5 and to determine how many probes meet this criterion.
Once ‘Finish’ has been selected, the probe lists should appear.
Combine the probes whose expression increases or decreases into one excel sheet for ingenuity pathway analysis.
Ingenuity Pathway Analysis (IPA)
IPA is used to determine pathways that may be altered across samples based on microarray results.
Login to IPA via www.ingenuity.com/products/ipa.
Upload excel file that was saved from GeneSpring to software, select ‘Agilent’ and the appropriate identified type (i.e., appropriate species).
Probe sample should be ‘ID’ and logFoldChange should be ‘Observation 1’.
Click ‘Continue’, and then use the ‘Analysis-ready’ list to select ‘Run Analysis’.
Gene ontology information will then appear and can be analyzed for pathway enrichment across samples.
Gene Set Enrichment Analysis (GSEA)
GSEA is a computational evaluation of whether the gene expression differences across biological samples among certain gene sets reach statistical significance. This requires input of the microarray data results and selection of reference dataset for GSEA (Subramanian et al., 2005).
Results from the microarray analysis should be filtered to yield a list of genes that display a ≥ 1.5-fold change in expression across experimental samples and reach a significance level with the corrected P-value of ≤ 0.05.
Download GSEA software and install per the manual’s instructions (available for both R and Java).
Determine the reference gene set on which the analysis should be performed: e.g., for Bi et al. (2016a) the human DMD gene expression dataset was compared to healthy human muscle which was chosen in order to understand the applicability of results to mouse models (NCBI dataset GDS3027).
Microarray results containing expression data from Step C1 should be converted to the GCT file-type: Details on how to convert files to the required type for GSEA can be found on GenePattern: file format guide.
A gene set database file containing a reference dataset to analyze against and a sample phenotype file must also be generated for input into GSEA (as well as an empty directory to store the output results)
Gene set database file (.gmt) formatting details can be found here on GenePattern: file format guide.
Sample phenotype file (.cls) formatting details can be found here on GenePattern: file format guide.
For the analysis used in Bi et al. (2016a and 2016b), default settings were used when calling GSEA.
Note: However, these can be changed as seen fit; see source code documentation for more details.
GSEA results and graphical analysis
The output directory should contain GSEA summary results file; determine that the parameters meet the specified values prior to proceeding (ideal values can be found at Subramanian et al., 2005).
GSEA R package contains GSEA.Analyze.Sets which generates plots of the input data, refer to the source code documentation for specific parameters.
Analysis of real-time PCR results (Bustin et al., 2009) (used for validation of target genes as discovered by microarray and GSEA)
Primer efficiency
All primers used for real-time PCR should be assessed for efficiency.
All primers should amplify a target site with similar efficiency with respective to the reference. Efficiency of the primer amplification can be determined by generating a calibration curve.
Briefly, calibration curves can be determined by reverse-transcription of high-quality RNA into cDNA. cDNA is then serially diluted by a factor of 10 4-5 times (i.e., 1:10, 1:100, 1:1,000, 1:10,000) and the primers are assayed on each dilution.
Plot initial log cDNA concentration vs. Cq value
Cq = m(log cDNA concentration) + b
where, m = slope, b = y-intercept
Determine PCR efficiency
Efficiency is measured as 10-1/slope-1
Analysis of results
The ∆∆Cq is used to determine the change in expression compared to the reference gene.
Normalize the Cq value of candidate gene to reference gene (∆Cq).
Transform normalized ∆Cq exponentially (log2(∆Cq)).
Take the average of the technical replicates (i.e., three individual reactions from same biological sample) and determine standard deviation; guidelines provided in Bustin et al. (2009).
Normalize averaged results and standard deviations to reference gene.
Fold-change is then (1-∆∆Cq) x 100.
Fold-change directionality should be consistent with results from microarray analysis.
Notes
Validation of microarray results using real-time quantitative PCR
Validation of microarray results using real-time quantitative PCR against target genes should be done prior to GSEA since it is essential to ensure that the results obtained from the microarray can be reproduced via an alternate approach (thus substantiating their biological significance).
All thresholds for gene expression and real-time quantitative PCR are detailed in the above protocol. Likewise, it is imperative to have positive and negative controls, as well as biological and technical replicates in order to reach statistical significance (generally, at least three replicates/sample, however power analysis should be used to determine the sample size). For example, a negative control reaction when generating cDNA should be used for subsequent real-time quantitative PCR to confirm no contaminating materials.
Microarray results can be validated by real-time quantitative PCR using the same RNA used for microarray analysis. However, a power analysis should be conducted to determine the appropriate sample size for each experiment and a Student’s t-test with a two-tail distribution can be to analyze results unless specified otherwise.
Validation of microarray results using Gene-ontology (GO) term analysis
Gene-ontology (GO) term analysis can also be performed on the list of genes generated from the microarray; however GSEA provides a rank and weight to each gene such that relative expression level in the sample is taken into consideration thus helping researchers identify candidate genes. GO term analysis does not provide gene-specific information however both GSEA and GO-term analysis will yield biological pathways that are significantly enriched in the assayed samples
Acknowledgments
The study is partially supported by NIH grants R01CA212609 and R01AR071649. Protocol was adapted from Bi et al. (2016a and 2016b) listed in the References below.
Competing interests
The authors declare no conflicts of interest or competing interests.
Ethics
All procedures involving the use of animals were performed in accordance with the guidelines presented by Purdue University’s Animal Care and Use Committee (PACUC).
References
Amaratunga, D., Göhlmann, H. and Peeters, P. J. (2007). 3.05 – Microarrays. In: Taylor, J. B. and Triggle, D. J. (Eds.). Comprehensive Medicinal Chemistry II. Elsevier, 87-106.
Bi, P., Yue, F., Karki, A., Castro, B., Wirbisky, S. E., Wang, C., Durkes, A., Elzey, B. D., Andrisani, O. M., Bidwell, C. A., Freeman, J. L., Konieczny, S. F. and Kuang, S. (2016b). Notch activation drives adipocyte dedifferentiation and tumorigenic transformation in mice. J Exp Med 213(10): 2019-2037.
Bi, P., Yue, F., Sato, Y., Wirbisky, S., Liu, W., Shan, T., Wen, Y., Zhou, D., Freeman, J. and Kuang, S. (2016a). Stage-specific effects of Notch activation during skeletal myogenesis. Elife 5: e17355.
Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M. W., Shipley, G. L., Vandesompele, J. and Wittwer, C. T. (2009). The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55(4): 611-622.
Peterson, S. M. and Freeman, J. L. (2009). RNA isolation from embryonic zebrafish and cDNA synthesis for gene expression analysis. J Vis Exp (30): 1470.
Read, J. and Brenner, S. (2001). Microarray Techonlogy. In: Brenner, S. and Miller, J. H. (Eds.). Encyclopedia of Genetics. Academic Press 1191.
Wang, Z., Gerstein, M. and Snyder, M. (2009). RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 10(1): 57-63.
Copyright: Oprescu et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Oprescu, S. N., Horzmann, K. A., Yue, F., Freeman, J. L. and Kuang, S. (2018). Microarray, IPA and GSEA Analysis in Mice Models. Bio-protocol 8(17): e2999. DOI: 10.21769/BioProtoc.2999.
Bi, P., Yue, F., Sato, Y., Wirbisky, S., Liu, W., Shan, T., Wen, Y., Zhou, D., Freeman, J. and Kuang, S. (2016a). Stage-specific effects of Notch activation during skeletal myogenesis. Elife 5: e17355.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Muscle stem cell
Cancer Biology > General technique > Molecular biology technique
Cell Biology > Cell-based analysis > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
30 | https://bio-protocol.org/exchange/protocoldetail?id=30&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Plasmid DNA Extraction from E. coli Using Alkaline Lysis Method
Fanglian He
Published: Feb 5, 2011
DOI: 10.21769/BioProtoc.30 Views: 206683
Download PDF
Ask a question
Favorite
Cited by
Abstract
This is a quick and efficient way to extract E. coli plasmid DNA without using commercial kits. This technique was invented by Birnboim and Doly (1979).
Materials and Reagents
RNAase (Life Technologies, Invitrogen™)
Isopropanol (EM Science)
Ethanol Absolute (200 Proof) (VWR Chemical)
Tryptone
Yeast extract
NaCl
Glucose
EDTA
0.2 N NaOH
SDS
KOAc
Potassium acetate
Glacial acetate
Tris-HCl (pH 8.0)
Luria-Bertani broth (LB) medium: Bacto-tryptone (BD Biosciences), yeast extract (BD Biosciences) (see Recipes)
Resuspension solution (P1 buffer) (see Recipes)
Lysis solution (P2 buffer) (see Recipes)
Neutralizing solution (P3 buffer) (see Recipes)
TE (see Recipes)
Equipment
Table-top centrifuges
1.5-ml eppendorf tube
Note: Use the highest speed for all centrifugation steps in this protocol.
37 °C heat blocker
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > DNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
300 | https://bio-protocol.org/exchange/protocoldetail?id=300&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Protocol for Electrophoretic Mobility Shift Assay (EMSA) from Primary Neuron
JL Jiali Li
Published: Vol 2, Iss 23, Dec 5, 2012
DOI: 10.21769/BioProtoc.300 Views: 28230
Original Research Article:
The authors used this protocol in May 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2012
Abstract
The interaction of transcriptional or co-transcriptional factors with DNA is crucial for changes of neuronal gene expression during normal brain development as well as neurodegeneration. The electrophoretic mobility shift assay (EMSA) is a very powerful technique for studying changes of neuronal gene expression and determining protein: DNA interactions. EMSA can be used qualitatively to identify specific transcriptional or co-transcriptional factors in brain crude lysates or primary neurons and, in conjunction with mutagenesis, to identify the important binding sequences within a given gene. An advantage of studying protein: DNA interaction by an electrophoretic assay provides a better understanding of epigenetic changes during normal brain development and neurodegenerative process.
Materials and Reagents
Neuronal cell pellet
Biotin 5' end-labeled and non-labeled DNA probes (competition) (Integrated DNA Technologies)
Table S- sequences of EMSA probes
Positively charged nylon membrane (Sigma-Aldrich, catalog number: Z670197 )
Tris base
Boric acid
EDTA
BSA
Poly (dIdC) (0.5 μg/μl) (Pierce Antibodies, catalog number: 20148 )
Antibody (ab1437)
5x loading buffer (QIAGEN, catalog number: 1037650 )
X-ray film
High-quality blotting paper (Whatman, catalog number: 3030-931 )
Polyacrylamide gel in 0.5x TBE
Cytoplasmic extract buffer (NE-PER Nuclear and Cytoplasmic Extraction Kit) (Pierce Antibodies, catalog number: 78835 )
Washing buffer (LightShift Chemiluminescent EMSA Kit) (Pierce Antibodies, catalog number: 20148 )
Nuclear extraction buffer (NE-PER Nuclear and Cytoplasmic Extraction Kit) (Pierce Antibodies, catalog number: 78835 )
2x reaction buffer (LightShift Chemiluminescent EMSA Kit) (Pierce Antibodies, catalog number: 20148 )
Acrylamide
Bis-acrylamide
TBE buffer
TEMED
Ammonium persufate
Phosphatase inhibitors
6% non-denature PAGE gel (see Recipes)
5x TBE (pH 8.3) (see Recipes)
Equipment
Centrifuges
UV lamp or crosslinking device equipped with 254 nm bulbs or 312 nm transilluminator
Electrophoresis apparatus
Electroblotter or capillary transfer apparatus
1.5 ml microcentrifuge tube
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Li, J. (2012). A Protocol for Electrophoretic Mobility Shift Assay (EMSA) from Primary Neuron. Bio-protocol 2(23): e300. DOI: 10.21769/BioProtoc.300.
Download Citation in RIS Format
Category
Neuroscience > Development > Neuron
Molecular Biology > DNA > DNA-protein interaction
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,000 | https://bio-protocol.org/exchange/protocoldetail?id=3000&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dual Fluorescence Reporter Based Analytical Flow Cytometry for miRNA Induced Regulation in Mammalian Cells
Nicolas Lemus-Diaz
LT Liezel Tamon
Jens Gruber
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.3000 Views: 10751
Edited by: HongLok Lung
Reviewed by: Yi Cui
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
MicroRNA-induced gene regulation is a growing field in basic and translational research. Examining this regulation directly in cells is necessary to validate high-throughput data originated from RNA sequencing technologies. For this several studies employ luciferase-based reporters that usually measure the whole cell population, which comes with low resolution for the complexity of the miRNA-induced regulation. Here, we provide a protocol using a dual-fluorescence reporter and flow cytometry reaching single cell resolution; the protocol contains a simplified workflow that includes: vector generation, data acquisition, processing, and analysis using the R environment. Our protocol enables high-resolution measurements of miRNA induced post-transcriptional gene regulation and combined with system biology it can be used to estimate miRNAs proficiency.
Keywords: miRNA Flow-Cytometry Dual fluorescence reporter Functional assay ncRNA Small RNA non-protein-coding RNA Gene regulation Reporter gene system Single cell analysis Flow cytometry
Background
MicroRNAs (miRNA) are highly conserved small non-protein-coding RNAs (21-22 nt) that regulate post-transcriptionally gene expression and modulate fundamental biological processes like development and cell homeostasis ( Lagos-Quintana et al., 2001; Fabian et al., 2010; Bartel, 2018), including as well several pathologies where miRNA expression correlates with tumor progression and aggressiveness (Lu et al., 2005; Di Leva and Croce, 2013; Krishnan et al., 2015; Bertoli et al., 2015 and 2016). The study of miRNAs has boosted the evolution of numerous biochemical and computational techniques that unravel new mechanisms and networks applicable to clinical scenarios. These high-throughput procedures include profiling methods (microarrays and NGS), in vivo target validation and single-molecule imaging (Steinkraus et al., 2016). In contrast, functional reporters that directly assess miRNA-target repression have been kept simple and with low resolution.
Deep sequencing and mass spectrometry have increased the possibilities to assess miRNAs and targets expression (Ender et al., 2008; Yang et al., 2009; Brameier et al., 2011; Schramedei et al., 2011; Bai et al., 2014a and 2014b; Muller et al., 2015; Yu et al., 2015), since quantifying the number of RNA molecules and running statistical analyses for the differential expression (miRNAs or mRNA) can generate hypotheses that need further experimental evaluation, using, for example, miRNA exogenous expression or inhibition. In brief mRNA analysis on cDNA level (qPCR or next-generation sequencing) estimates RNAs degradation, mass spectrometry defines the affected coding targets (Yang et al., 2009), and ribosome profiling determines which miRNAs targets are translationally repressed (Bazzini et al., 2012).
Moreover, to narrow down the analysis to the Argonaute bound miRNA captured-based profiling has been used, these profiles rely on RNA isolation from ribonucleoproteins, cDNA synthesis and its quantification (qPCR, microarrays or NGS). Crosslink-immunoprecipitation (CLIP) together with high-throughput sequencing increase enormously our understanding of miRNA regulation (Hafner et al., 2010), to the extent that including an RNA-RNA ligation step (in the capture) allows detecting miRNA-mRNA hybrids called chimeras (Helwak et al., 2013; Grosswendt et al., 2014; Moore et al., 2015).
FRET-based assays in vitro have calculated kinetic parameters for AGO-miRNA binding and RISC formation, increasing the structural basis of miRNA target recognition and suggesting that AGO-miRNA behaves more like RNA binding domain rather than RNA-RNA solely interaction (Wee et al., 2012; Salomon et al., 2015). Using this vast amount of information computational scientist developed algorithms to understand miRNA as an intricate network (Vera et al., 2013; Lai et al., 2016), expanding further with these integrative models the concepts of miRNA as fine-tuners and switches of gene expression (Bartel and Chen, 2004).
The increased resolution of sequencing methods did not boost the development of better in vivo reporters. Usually, studies involved in exhaustive biochemical characterizations (Bait profiling) tested functionally miRNA-mRNA interaction using luciferase reporter assays (Helwak et al., 2013; Hasler et al., 2016; Steinkraus et al., 2016). These experiments require two proteins (a reference protein and another with a miRNA response element) to create quantitative results (ratios) for miRNA regulation, dismissing the intricate functional network behind miRNAs; creating a misbalance between the high-resolution biochemical outputs (NGS, CLIP-Seq, FRET, etc.) and low-resolution reporters.
For that reason, we implemented a system for analytical flow cytometry (Denzler et al., 2016), using a single plasmid reporter system and validated it for miRNAs (Lemus-Diaz et al., 2017). To increase resolution, we used fluorescent proteins instead of luciferases, analyzed single cells by flow cytometry, and processed the data using the R environment. Furthermore, we adopted a titration model for miRNAs regulation, tested and validated its prediction, creating three categorical variables that integrate miRNA binding and expression (Mukherji et al., 2011; Lemus-Diaz et al., 2017), which can be used to estimate miRNA proficiency (Garcia et al., 2011).
Here, we provide a detailed protocol that includes plasmid generation, transfection, data acquisition, data handling and plotting using a simplified code. The reporter described here expresses two fluorescent proteins (CFP and YFP) under control of two constitutive promoters (Figure 1A), while one protein is the reference (YFP); the other has a miRNA response element (CFP). In the empty plasmid (CFP w/o miRNA target site) the two fluorescent proteins are expressed proportionally (Figure 1B), while in a plasmid with a miRNA response element this proportionality is shifted (Figure 1C).
To tidy up the raw events and analyze them using a threshold model for miRNA regulation, we process the data into a transfer function (called here Analytical function) by binning the reference protein intensities and calculating the mean for sensor protein (Bosson et al., 2014; Denzler et al., 2016). For our construct, we transfer the raw data in FCS 2.0 format into the R environment using FlowCore Bioconductor package (Gentleman et al., 2004; Hahne et al., 2009; Huber et al., 2015), then we logarithmically transform the YFP relative intensities, bin them at 0.05 intervals, and calculate the average of the log CFP intensities of each range.
Figure 1. Dual fluorescence-reporter analytical flow cytometry. A. The plasmid contains two fluorescent proteins (YFP and CFP) with two constitutive promoters and a miRNA response element. B and C. To generate analytical functions using raw cytometry data (Grey dots), the YFP relative intensities are binned at 0.05 intervals, and the average CFP intensity per bin is calculated (Green dots). Transfection of HEK 293 with two constructs: (B) Non-cognate and (C) miR-27-3p targeted insert.
Materials and Reagents
Plasmids, primers and cells
p.UTA.2.0 Empty (Addgene, catalog number: 82446 )
p.UTA.2.0 miR 19b-3p (Addgene, catalog number: 82442 )
Sequencing Primers:
psiCHECK2-R
CGAGGTCCGAAGACTCATTT
T7 Universal Primer
TAATACGACTCACTATAGGG
HEK293 cells
Other materials
Pipette tips
1,000 μl Filter Tips (SARSTEDT, catalog number: 70.762.211 )
100 μl Filter Tips (SARSTEDT, catalog number: 70.760.212 )
10 μl Filter Tips (SARSTEDT, catalog number: 70.1116.210 )
1.5 ml microfuge tubes (Eppendorf, catalog number: G_0030108116 )
2.0 ml microfuge tubes (SARSTEDT, catalog number: 72.695.200 )
24-well plates (Greiner Bio One International, catalog number: 662160 )
5 ml Ploystyrene Round-Bottom Tube (Corning, Falcon®, catalog number: 352052 )
PCR tubes 0.2 ml (SARSTEDT, catalog number: 72.737.002 )
Parafilm (Sigma-Aldrich, Bemis, catalog number: P7793-1EA )
HEK293 Human embryonic kidney cell line (ATCC, catalog number: CRL-1573TM )
One Shot® TOP10 Chemically Competent Escherichia coli (Thermo Fisher Scientific, catalog number: C404010 )
Sense and antisense strands of oligonucleotides (more information below)
Gel extraction kit (QIAquick gel extraction kit, QIAGEN, catalog number: 28704 )
GibcoTM Opti-MEMTM (+ L-Glutamine, + phenol red) (Thermo Fisher Scientific, catalog number: 31985047 )
Lipofectamine® 2000 (Thermo Fisher Scientific, catalog number: 11668027 )
NotI restriction enzyme (New England Biolabs, catalog number: R0189S )
XhoI restriction enzyme (New England Biolabs, catalog number: R0146S )
EcoRI (New England Biolabs, catalog number: R0101S )
HindIII (New England Biolabs, catalog number: R0104S )
Plasmid DNA Midiprep kit (QIAquick Plasmid Midi Kit, QIAGEN, catalog number: 10023 )
QIAprep Spin Miniprep Plasmid mini kit (QIAGEN, catalog number: 27104 )
Paraformaldehyde 4% solution (Santa Cruz Biotechnology, catalog number: sc-281692 )
T4 DNA ligase kit (New England Biolabs, catalog number: M0202S )
T4 Polynucleotide kinase (PNK) (New England Biolabs, catalog number: M0201S )
Agarose (Carl Roth, catalog number: 3810.3 )
PBS (PAN-Biotech, catalog number: P04-36500 )
Trypsin-EDTA (PAN-Biotech, catalog number: P10-023100 )
DMEM (Thermo Fisher Scientific, Life Technologies, catalog number: 41965062 )
Fetal Bovine Serum (Thermo Fisher Scientific, Life Technologies, catalog number: 10500-064 )
Equipment
Pipettes
Fridge
Agarose gel electrophoresis chamber
BD LSR II Flow Cytometer (BD, model: LSR II )
YFP: Laser 488 nm and 550LP-BP575/26 filters
CFP: Laser 408 nm and BP450/50 (Pacific Blue)
Benchtop refrigerated microcentrifuge (Thermo Fisher Scientific, model: HeraeusTM FrescoTM 21 , catalog number: 75002555)
Universal Centrifuge (Thermo Fisher Scientific, model: HeraeusTM MegafugeTM 16 , catalog number: 75004230; Rotor: Thermo Fisher Scientific, model: TX-150, catalog number: 75005701 )
Gel documentation system (INTAS Gel iX Imager) (INTAS Science Imaging Instruments, model: FACE )
NanoDropTM 2000 (Thermo Fisher Scientific, model: NanoDropTM 2000 , catalog number: ND-2000)
Thermoblock (Eppendorf, model: ThermoStat Plus , catalog number: 5352 000.010)
Thermocycler (Labcycler Sensoquest)
Vortexer (Scientific Industries, model: Vortex-Genie 2 , catalog number: SI-0236)
Software
BD-FACSDIVA (BD Biosciences)
R (https://www.r-project.org)
R studio (https://www.rstudio.com)
Bioconductor (https://www.bioconductor.org)
Serial Cloner (http://serialbasics.free.fr/Serial_Cloner.html)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lemus-Diaz, N., Tamon, L. and Gruber, J. (2018). Dual Fluorescence Reporter Based Analytical Flow Cytometry for miRNA Induced Regulation in Mammalian Cells. Bio-protocol 8(17): e3000. DOI: 10.21769/BioProtoc.3000.
Download Citation in RIS Format
Category
Molecular Biology > RNA > RNA interference
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,001 | https://bio-protocol.org/exchange/protocoldetail?id=3001&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Screening and Genetic Analysis of Ethylene-Response Mutants in Etiolated Rice Seedlings
CY Cui-Cui Yin*
BM Biao Ma*
HZ He Zhao
SC Shou-Yi Chen
JZ Jin-Song Zhang
*Contributed equally to this work
Published: Sep 5, 2018
DOI: 10.21769/BioProtoc.3001 Views: 4546
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
Ethylene, the simplest gaseous plant phytohormone, is involved in the control of rice growth and development processes, but the mechanism of ethylene regulating these pathways remains unclear in rice. Recent studies have found that ethylene-signaling pathway is conserved but different between rice and Arabidopsis. The forward genetic analysis is an essential and efficient method to reveal fully the mechanism of ethylene signaling in rice plants. Here we provide a protocol of genetic analysis of rice ethylene-response mutant, including screening ethylene-response mutants, treatment with ethylene and a chemical reagent, and ethylene-responsiveness gene expression analysis.
Keywords: Rice Ethylene response Coleoptile Root Etiolated seedlings
Background
The key molecular elements of ethylene-signaling pathway have been identified by molecular genetics and genomic approaches in Arabidopsis (Guo and Ecker, 2004). Ethylene plays important roles in rice growth, development, and environmental adaptation, including coleoptile and shoot elongation, aerenchyma development, and submergence response (Xu et al., 2006; Fukao and Bailey-Serres, 2008; Ma et al., 2010). Rice may have a distinct mechanism of ethylene-signaling pathway due to the different ethylene-regulated biological processes in rice and Arabidopsis (Yang et al., 2015a). The forward genetic analysis is essential to reveal fully the mechanism of ethylene signaling pathway in rice. So, it is prerequisite to develop an efficient method to screen ethylene-response mutants in rice. Genetic screens that are based on the triple-response have been extensively conducted on Arabidopsis (Johnson and Ecker, 1998; Stepanova and Ecker, 2000). However, the genetic screens in rice have been hamper owing to the lack of ethylene-response phenotypes.
Ethylene promotes rice coleoptile elongation of dark-grown seedlings (Ku et al., 1970). In our experimental conditions, root elongation can be inhibited by ethylene in etiolated rice seedlings. Over the past decade, based on the double-response of etiolated rice seedling, including ethylene-induced coleoptile growth promotion and root growth inhibition, several unique rice mutants have been identified. We named these ethylene-response mutants maohuzi (mhz) (Ma et al., 2013). Loss-of-function of MHZ7/OsEIN2 rice plants display insensitive to ethylene, including ethylene-insensitive coleoptile elongation and root growth. Conversely, MHZ7/OsEIN2-overexpression transgenic lines display ethylene hypersensitivity (Ma et al., 2013). Characterization of MHZ6/OsEIL1 revealed that MHZ6/OsEIL1 and its homolog gene OsEIL2 have functional diversification in rice ethylene response (Yang et al., 2015b). Identifications of MHZ4/ABA4 (Ma et al., 2014) and MHZ5/CRTISO (Yin et al., 2015) revealed that ethylene inhibits root growth requiring ABA pathway in rice, which is different with that in Arabidopsis. The study of MHZ2/SOR1 provides a candidate mechanism that auxin acts downstream to modulate ethylene inhibition of root growth in etiolated rice seedlings (Chen et al., 2018). The research of MHZ3 found that ethylene-induced MHZ3 stabilizes MHZ7/OsEIN2 and impeding protein ubiquitination to facilitate ethylene signaling pathway (Ma et al., 2018). Here, we describe the method in detail for genetic analysis of ethylene response mutants in etiolated rice seedlings. This protocol can also be used in other monocotyledonous plants to detect ethylene response (Yang et al., 2015a). Besides, the longer mesocotyl and coleoptile mutant gaoyao1(gy1) was also discovered by this method (Xiong et al., 2017).
Materials and Reagents
Syringes with needle: 2-, 5-, and 60-ml capacity
Petri dish, 60 mm (Corning, PYREX®, catalog number: 3160-60 )
Airtight plastic and cups:
5.5 L box (Lock & Lock, catalog number: HPL 836 ) matched with the 12-lattice sieve
520 ml (Lock & Lock, catalog number: HPL 931N ) cup matched with the wire mash
Note: The capacity of the cup is 520 ml when covered with its lid.
20 L box (FUDOGIKEN, catalog number: 112025 ) matched with the 100-lattice sieve
Note: There is a hole drilled into to the side of each box and fitted with a silicon rubber stopper; Cups with lid and silicon rubber stoppers (Figure 1).
Plant seeds: Wild-type, mutants, varieties or transgenic lines
Ethylene gas
1-MCP (1-Methylcyclopropene) (LuNuo Bio-Technology, Maxfresh)
Figure 1. Airtight plastic boxes and cups. Each of the containers has a fitted silicon rubber stopper in order to inject ethylene gas.
Equipment
Beaker (BOMEX, 250 ml or 500 ml, depends on the number of seeds)
Dim green light source (ordinary commercial green light is OK)
Silicon rubber stopper (Laboran, catalog numbers: 9-860-03 , 9-860-06 , 9-860-09 , 9-860-11 and so on)
Stainless sieves (custom made) and wire mesh:
12-lattice sieve (240 mm length x 180 mm width x 33 mm height) for phenotype analysis
62 mm diameter wire mesh, and 100-lattice sieve (400 mm length x 300 mm width x 33 mm height) for mutant screening, positive seedlings selection and genetic mapping
Note: Each sieve has four legs and each leg is 29 mm in height (Figure 2).
Graduated cylinders: 1,000-, 2,000-, and 4,000-ml capacity
Incubators for culturing rice seedlings set at 28 °C and 37 °C
Drying Oven
Watering can
Figure 2. 12-lattice sieve, 100-lattice sieve, and wire mesh. A. Side view of the sieves. B. Top view of the sieves. C. 62 mm diameter wire mesh.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant physiology > Phenotyping
Plant Science > Plant molecular biology > Genetic analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,002 | https://bio-protocol.org/exchange/protocoldetail?id=3002&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Soluble and Solid Iron Reduction Assays with Desulfitobacterium hafniense
LC Lucrezia Comensoli
JM Julien Maillard
WK Wafa M. Kooli
PJ Pilar Junier
Edith Joseph
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.3002 Views: 5366
Edited by: Valentine V Trotter
Reviewed by: Karolina Subrtova
Original Research Article:
The authors used this protocol in May 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2017
Abstract
There is a pressing need to develop sustainable and efficient methods to protect and stabilize iron objects. To develop a conservation-restoration method for corroded iron objects, this bio-protocol presents the steps to investigate reductive dissolution of ferric iron and biogenic production of stabilizing ferrous iron minerals in the strict anaerobe Desulfitobacterium hafniense (strains TCE1 and LBE). We investigated iron reduction using three different Fe(III) sources: Fe(III)-citrate (a soluble phase), akaganeite (solid iron phase), and corroded coupons. This protocol describes a method that combines spectrophotometric quantification of the complex Fe(II)-Ferrozine® with mineral characterization by scanning electron microscopy and Raman spectroscopy. These three methods allow assessing reductive dissolution of ferric iron and biogenic mineral production as a promising alternative for the development of an innovative sustainable method for the stabilization of corroded iron.
Keywords: Reductive dissolution of ferric iron Fe(II) quantification Biogenic minerals Desulfitobacterium hafniense Iron passivation Heritage conservation
Background
Since the Iron Age, iron has been used to produce everyday utensils. Therefore, archaeological iron findings are an extremely important testimony of the past and should be preserved. However, due to its reactivity, iron can be easily corroded and archaeological iron objects risk to be completely damaged. When buried, iron artifacts develop a complex corrosion layer according to the environmental conditions of the burial site. After excavation, conditions change and the corrosion layer becomes unstable. To avoid complete destruction, archaeological iron objects require a rapid stabilization treatment. Currently, available stabilization treatments do not provide long-term protection and have substantial drawbacks, such as toxicity, low efficiency, and production of large amount of waste (Scott and Eggert, 2009; Rimmer et al., 2012). Consequently, it is necessary to develop new technologies to stabilize archaeological iron artifacts.
Exploiting a microbial metabolism is increasingly considered for the development of more efficient, sustainable and eco-friendly treatments in conservation-restoration (Ranalli et al., 2005; Cappitelli et al., 2006 and 2007; Jonkers, 2011; Joseph et al., 2011, 2012 and 2013; Bosch-Roig and Ranalli, 2014). Our research team is developing a treatment based on the reductive dissolution of ferric iron under anaerobic conditions (Kooli et al., 2018; Comensoli et al., 2017). The unstable corrosion products are converted into more stable biogenic minerals (i.e., magnetite and vivianite), as a byproduct of bacterial iron reduction. This conversion would stabilize the corrosion layer of the object.
In order to study the suitability of the chosen bacteria, iron reduction has to be carefully monitored. Several methods are available to quantify iron. Inductive coupled plasma mass spectrometry (ICP-MS) is useful to measure trace elements with concentrations of less than 1 ppm (Meissner et al., 2004). However, it requires expensive equipment and does not provide information on the oxidation state of iron if not combined with chromatographic separation devices such as high-performance liquid chromatography (HPLC), ion chromatography (IC), gas chromatography (GC), and capillary electrophoresis (CE) (Thomas, 2013). A spectrophotometric method to measure Fe(II) uses the metal-ligand ortho-phenanthroline (Fortune and Mellon, 1938). This compound is now considered carcinogenic (Whittaker et al., 2001). Therefore, for this protocol we selected the spectrophotometric quantification of Fe(II) with the Ferrozine® assay. This simple and reliable method requires standard lab equipment and can be used to analyze many samples. In addition, the characterization of biogenic minerals was made based on their appearance, morphology and molecular composition. For these analyses, we used scanning electron microscopy and Raman spectroscopy.
This Bio-protocol consists of three main steps (Figure 1): A. Biomass production; B. Incubation with iron sources; C. Validation of iron reduction.
Figure 1. Graphical summary of the overall structure of this bio-protocol
Materials and Reagents
1.7 ml Eppendorf centrifuge tubes (Corning, Axygen®, catalog number: MCT-175-C )
Syringes
1 ml (CODAN, catalog number: 621640 )
5 ml (CODAN, catalog number: 625607 )
20 ml (CODAN, catalog number: 627602 )
Needle for syringes (Henke-Sass, Wolf, catalog number: 4710005016 )
1,000, 500, 100 and 50 ml serum bottle for anaerobic bacterial culture (DWK Life Sciences, Wheaton, catalog number: W012467A [100 ml])
100 ml serum bottle with large bottleneck (Merck, catalog number: STBMRFA12 )
Rubber stoppers for serum bottles (VWR, special request)
Metal caps for serum bottle (Thermo Fisher Scientific, catalog number: C4020-3A )
Serum bottle seal crimper (DWK Life Sciences, Wheaton, catalog number: 224322 )
0.2 μm sterile filter (SARSTEDT, catalog number: 83.1826.001 )
96-well polypropylene microplate (SARSTEDT, catalog number: 82.1581 )
96-well microcentrifuge tube flipper rack with Lid (Fisher Scientific, catalog number: 11710344 )
Desulfitobacterium hafniense strain TCE1 (Gerritse et al., 1999)
Desulfitobacterium hafniense strain LBE (Comensoli et al., 2017)
Ethanol (Thommen Furler, catalog number: 180-VL54K )
Corroded iron coupons (steel coupons presenting a natural corrosion layer produced after outdoor exposure in the city of Zurich, Switzerland)
Adhesive Carbon Tape 12 mm x 20 m (Agar Scientific, catalog number: AGG3939A )
N2 gas cylinder (Carbagas, catalog number: I4001 )
NH4HCO3 (Sigma-Aldrich, catalog number: A6141 )
NaHCO3 (Sigma-Aldrich, catalog number: S5761 )
K2HPO4•3H2O (Sigma-Aldrich, catalog number: P5504 )
NaH2PO4•2H2O (Sigma-Aldrich, catalog number: 71505 )
Peptone (BD, catalog number: 211677 )
Resazurin sodium salt (Sigma-Aldrich, catalog number: R7017 )
Cyanocobalamin (Acros Organics, catalog number: 405920010 )
Riboflavin (Sigma-Aldrich, catalog number: R4500 )
Thiamine-hydrochloride (AppliChem, catalog number: A0955 )
Biotin (Thermo Fisher Scientific, Alfa Aesar, catalog number: A14207 )
P-aminobenzoate (sodium salt) (Sigma-Aldrich, catalog number: A9878 )
Pantothenate (sodium salt) (Sigma-Aldrich, catalog number: P3161 )
Folic acid•2H2O (Sigma-Aldrich, catalog number: F7876 )
Lipoic acid (Sigma-Aldrich, Fluka, catalog number: 62320 )
Pyridoxine hydrochloride (Acros Organics, catalog number: 150770500 )
Nicotinic acid (Sigma-Aldrich, catalog number: N4126 )
EDTA disodium salt•2H2O (Sigma-Aldrich, catalog number: E1644 )
FeCl2•4H2O (Sigma-Aldrich, catalog number: 44939 )
MnCl2•4H2O (Sigma-Aldrich, catalog number: M3634 )
CoCl2•6H2O (Sigma-Aldrich, catalog number: C8661 )
ZnCl2 (Sigma-Aldrich, catalog number: 793523 )
CuCl2•2H2O (Sigma-Aldrich, catalog number: C3279 )
AlCl3 (Sigma-Aldrich, catalog number: 237051 )
H3BO3 (Sigma-Aldrich, catalog number: B6768 )
Na2MoO4•2H2O (Sigma-Aldrich, catalog number: 331058 )
NiCl2•6H2O (Sigma-Aldrich, catalog number: N6136 )
CaCl2•2H2O (Sigma-Aldrich, catalog number: 223506 )
MgCl2•6H2O (Sigma-Aldrich, catalog number: M2393 )
Na2S•9H2O (Sigma-Aldrich, catalog number: 208043 )
Sodium DL-lactate 60% solution (Sigma-Aldrich, catalog number: L1375 )
Disodium fumarate (Sigma-Aldrich, catalog number: F1506 )
HCl 37% (S-20) (Honeywell International, catalog number: 30721-1L-GL )
MilliQ water
Fe(II)-ammonium sulfate (Honeywell International, Fluka, catalog number: 09720 )
Fe(III)-citrate (Sigma-Aldrich, Fluka, catalog number: 44941-250G )
4-(2-Hydroxyethyl) piperazine-1-ethanesulfonic acid, N-(2-Hydroxyethyl) piperazine-N′-(2-ethanesulfonic acid) (HEPES) (Sigma-Aldrich, catalog number: H3375-250G )
NaOH (Sigma-Aldrich, catalog number: 71690 )
Goethite: α-FeO(OH) (Sigma-Aldrich, catalog number: 71063-100G ) (alternative source of solid Fe(III)-phase to akaganeite)
Fe2O3 (Sigma-Aldrich, catalog number: 529311-5G ) (alternative source of solid Fe(III)-phase to akaganeite)
Growth medium for D. hafniense (see Recipes)
N2-degassed H2O
Sterile serum bottles
Solution of sodium DL-lactate 40% (v/v)
Solution of disodium fumarate 16% (v/v)
Reducing agent solution 1 M
Resazurin solution 0.5 g/L
Vitamin solution 1
Vitamin solution 2
Vitamin solution 3
Vitamin solution 4
Trace elements solution
Carbonate solution
Solution A (basal medium)
Solution B (vitamin solution)
Solution C (buffering/reducing solution)
Solution D
Soluble Fe(III)-citrate (35 g/L) – 100 ml (see Recipes)
HCl solutions to adjust pH
NaOH solutions to adjust pH
Fe(III) solution
Solid Fe(III) suspension (see Recipes)
Solid Fe(III) source
Preparation of the suspension of solid Fe(III)-phase (akaganeite or goethite)
Ferrozine® reagents (see Recipes)
HCl solution 5 M
Stock solution of Fe(II) 1 M for calibration curve
Ferrozine® reagent
Equipment
1 L graduated flasks (SciLabware, catalog number: 1132/26 )
Magnetic bars (Sigma-Aldrich, BRAND, catalog numbers: Z328774 , Z328812 )
Stainless steel spatula (Sigma-Aldrich, catalog number: HS15909 )
Balance (Mettler-Toledo International, catalog number: PG5002 )
P20 pipetman (Gilson, catalog number: F123600 )
P200 pipetman (Gilson, catalog number: F123601 )
P1000 pipetman (Gilson, catalog number: F123602 )
pH meter
Bunsen burner (FIREBOY Plus) (Integra Biosciences, catalog number: 144000 )
Autoclave (Fedegari Autoklav FOB5/TS) (VITARIS, catalog number: 260000-FED , serial number: NBD801AV)
Orbital shaker (Kühner, model: SMX1200 )
Hotplate and magnetic Stirrer (Heidolph Instruments, catalog number: MR2002 )
Spinbar® Magnetic Stir bar (Sigma-Aldrich, SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: Z126942-1EA )
Spectrophotometer cuvettes (Sigma-Aldrich, catalog number: C5291-100EA )
Spectrophotometer UV-visible (GENESYSTM 10S) (Thermo Fisher Scientific, catalog number: 840-208100 )
Microplate reader (Biochrom, Asys Hitech, catalog number: UVM 340 )
pH meter (Benchtop Meter AE150) (Fisher Scientific, catalog number: 15524693 )
Biosafety cabinet equipped with UV lamp at 254 nm (Azbil Telstar, catalog number: Bio II Advance )
Chemical fume hood
Desiccator (BRAND, catalog number: 65815 )
Scanning electron microscope (SEM) (Philips ESEM XL30 FEG environmental scanning electron microscope equipped with an energy-dispersive X-ray analyzer (Philips)
Raman Microscope (HORIBA, JOBIN YVON, LabRAM Aramis microscope equipped with a Nd:YAG laser of 532 nm and controlled by LabSpec NGS spectral software. HORIBA, JOBIN YVON, catalog number: LabRAM Aramis, 3 lasers and xyz stage)
Vortex
Vacuum pump
Fridge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Comensoli, L., Maillard, J., Kooli, W. M., Junier, P. and Joseph, E. (2018). Soluble and Solid Iron Reduction Assays with Desulfitobacterium hafniense. Bio-protocol 8(17): e3002. DOI: 10.21769/BioProtoc.3002.
Download Citation in RIS Format
Category
Microbiology > Microbial metabolism > Other compound
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,003 | https://bio-protocol.org/exchange/protocoldetail?id=3003&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Using Stable Isotopes in Bone Marrow Derived Macrophage to Analyze Metabolism
CK Chih-Wei Ko
DC Daniel Counihan
DD David DeSantis
ZS Zach Sedor-Schiffhauer
MP Michelle Puchowicz
CC Colleen M Croniger
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.3003 Views: 6635
Edited by: Vivien Jane Coulson-Thomas
Reviewed by: Mindy Call
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
Using gas chromatography mass spectrometry (GC-MS) to analyze the citric acid cycle (CAC) and related intermediates (such as glutamate, glutamine, GABA, and aspartate) is an analytical approach to identify unexpected correlations between apparently related and unrelated pathways of energy metabolism. Intermediates can be as expressed as their absolute concentrations or relative ratios by using known amounts of added reference standards to the sample. GC-MS can also distinguish between heavy labeled molecules (2H- or 13C-labeled) and the naturally occurring most abundant molecules. Applications using tracers can also assess the turnover of specific metabolic pools under various physiological and pathological conditions as well as for pathway discovery.
The following protocol is a relatively simple method that is not only sensitive for small concentrations of metabolic intermediates but can also be used in vivo or in vitro to determine the integrity of various metabolic pathways, such as flux changes within specific metabolite pools. We used this protocol to determine the role of phosphoenolpyruvate carboxykinase 1 (Pck1) gene in mouse macrophage cells to determine the percent contribution from a precursor of 13C labeled glucose into specific CAC metabolite pools.
Keywords: Macrophage Bone marrow-derived macrophages Immunology Stable isotopes Metabolism Macrophage polarization Stable isotopes Chromatography mass spectrometry methods GC-MS
Background
With the development of altered gene expression in cells and mice, there is a need to understand how these deleted or over-expressed genes impact the regulation of metabolic pathways. In this protocol, we used stable isotopes to determine how the flux of glucose into the CAC altered the contribution of glucose into the pools of citrate, succinate and malate. The use of stable isotopes with targeted analysis of metabolism is just one benefit to using stable isotopes in cell culture.
The method described in this protocol for functional quantification of intracellular metabolites was done by growing bone marrow-derived macrophage cells (BMDM) in U-13C-glucose medium. The cells were extracted in organic solvent and the percent contribution of 13C glucose was calculated. The fractional amount of 13C label incorporated into each the CAC-related metabolite pools was also determined. The calculations were based on the ratio of 13C label of each intracellular metabolite versus the unlabeled metabolite; for absolute concentration analysis of cell samples, one would need to correct for reference to the intracellular volume of the extracted cells (Feldberg et al., 2009), as well as add non-interfering reference standards for quantifying of levels of CAC intermediates, as previously described (Ko et al., 2018). This protocol can also be used in isolated perfused livers or whole body metabolism studies (Yang et al., 2008a; Zhang et al., 2015).
Using a novel mouse model that had a deletion of phosphoenolpyruvate carboxykinase 1 (Pck1) in the myeloid cells (Pck1MC-KO), stable isotopes were used to determine the role of this gene in macrophages (Ko et al., 2018) with respect to glucose metabolism. The protocol explains the isolation and differentiation of BMDM. These cells were isolated, differentiated and incubated with U13C-glucose to analyze their metabolism. The BMDM cells were collected, and the fractional contribution of the precursor to the product was based on the mole percent enrichments (MPE) derived from the 13C label incorporation into the total pool of each of the metabolites (products). Mass isotopomer analysis enables the measurements of unlabeled analyte (M0) relative to the labeled analyte (M+1, 2, or 3, etc.), (Yang et al., 2008a; Kombu et al., 2011; Ko et al., 2018). The measured mass isotopomer distributions were calculated for each of the masses and expressed as mole percent enrichment (MPE) after correcting for natural isotope abundances.
Materials and Reagents
FisherbrandTM sterile 100 mm x 15 mm polystyrene Petri dish (Fisher Scientific, Fisher ScientificTM, catalog number: FB0875713 )
Costar® TC-Treated 6-well Plates (Corning, catalog number: CLS3506 )
15 ml conical tubes (SARSTEDT, catalog number: 62.554.502 )
Sterile individually packaged 5 ml pipettes (SARSTEDT, catalog number: 86.1253.001 )
Sterile 1 ml syringe with 26 G needle (Fisher Scientific, catalog number: 14-829-6A)
Manufacturer: BD, catalog number: 305537 .
10 ml syringes (Thermo Fisher Scientific, catalog number: S7515-10 )
BD Precisionglide® syringe needles, gauge 23, L3/4 in. (BD, catalog number: 305143 )
BD Precisionglide® syringe needles, gauge 18, L 1 in. (BD, catalog number: 305195 )
Cell strainer, 70 μm, sterile (Corning, catalog number: 352350 )
50 ml conical tube (SARSTEDT, catalog number: 62.547.254 )
Disposable Borosilicate Glass tubes 16 mm x 125 mm (Globe Scientific, catalog number: 1515 )
LysM-specific Pck1 knock-out mice (Pck1MC-KO mice)
Note: The mice were generated by crossing Pck1flox/flox mice with LysM-Cre+/− transgenic mice expressing Cre-recombinase under control of the LysM promoter. Pck1flox/flox mice were used as controls. All mice are in the C57Bl/6J background. All animals were housed in a temperature-controlled facility with a 12 h light/dark cycle in compliance with the Institutional Animal Care and Use Committee (IACUC) of Case Western Reserve University.
Lipopolysaccharides from Escherichia coli 026:B6 (Sigma-Aldrich, catalog number: L8274 )
IL-4, Animal-component free, recombinant, expressed in E. coli (Sigma-Aldrich, catalog number: SRP3211 )
Ethanol Solution 70%, Molecular Biology Grade (Fisher Scientific, Fisher BioagentsTM, catalog number: BP8201500 )
FBS (fetal bovine serum) (Fisher Scientific, FisherbrandTM, catalog number: 03-600-511 )
Dulbecco's modified Eagle Medium (DMEM) high glucose, pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11995065 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 10570063 )
L-glutamine GlutaMAX (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Recombinant Murine Macrophage Colony-stimulating factor (PeproTech, catalog number: 315-02 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
Lipopolysaccharide (LPS) from E. coli 02:B6 (Sigma-Aldrich, catalog number: L8274 )
Interleukin-4 (IL-4) (PeproTech, catalog number: 214-14 )
[13C]-succinate [Sodium bis (2-ethylhexyl) sulfo (succinate-13C4)] (98%) (Sigma-Aldrich, catalog number: 719269 )
[13C]-malate (Sigma-Aldrich, catalog number: 750484 )
[13C]-citrate (Sigma-Aldrich, catalog number: 492078 )
Methanol HPLC (Sigma-Aldrich, catalog number: 1005706 )
BSTFA + 10% TMCS-Regisil® (Regis Technologies, CAS: 25561-30-2; 75-77-4)
N-Methyl-N-(t-butyldimethylsilyl) trifluoroacetamide (TBDMS) (Sigma-Aldrich, catalog number: 394882-25ML )
Note: If using TMCS as a derivative, see references Yang et al. (2008a); Kombu et al. (2011); Ko et al. (2018).
Acetic acid, Glacial (Certified ACS) Fisher Chemical (Fisher Scientific, catalog number: A38-212)
Manufacturer: Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FLA38212 .
Methanol, OptimaTM LC/MS Grade, Fisher Chemical (Fisher Scientific, Thermo ScientificTM, catalog number: A456-1 )
Water, OptimaTM LC/MS Grade, Fisher Chemical (Fisher Scientific, Thermo ScientificTM, catalog number: W64 )
QuickStart TM Bradford Protein Assay Kit 1 (Bio-Rad Laboratories, catalog number: 5000201 )
Generate macrophage differentiation media (MDM) (see Recipes)
5% acetic acid in methanol/water (1:1) extraction buffer (see Recipes)
LPS stock solution (see Recipes)
IL-4 stock solution (see Recipes)
Equipment
Kelly Forceps, Box Lock, Straight Steel (Grainger, catalog number: 4WPD9 )
Sterile cell scraper (Fisher Scientific, FisherbrandTM, catalog number: 08-100-241 )
GC vial cap, 9 mm (Agilent Technologies, catalog number: 5182-0717 )
GC vial, 2 ml (Agilent Technologies, catalog number: 5181-3375 )
Thermo ScientificTM NalgeneTM Polypropylene Graduated Cylinders (Fisher Scientific, catalog number: 08-572D)
Manufacturer: Thermo Fisher Scientific, Thermo ScientificTM, catalog number: N36620100 .
Dumont forceps #5 (Fine Science Tools, catalog number: 11252-20 )
Dumont forceps #55 (Fine Science Tools, catalog number: 11255-20 )
Dumont forceps AA (Fine Science Tools, catalog number: 11210-20 )
Tissue culture hood (Thermo Fisher Scientific, catalog number: 51022482 )
Refrigerated tabletop centrifuge for 15-50 ml conical tubes (Eppendorf, model: 5430R )
37 °C, 5% CO2 water-jacketed incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: 3110 )
P20 pipetman (Gilson, catalog number: F123600 )
P200 pipetman (Gilson, catalog number: F123601 )
P1000 pipetman (Gilson, catalog number: F123602 )
Homogenizer for tissues (IKA, model: T25 digital ULTRA-TURRAX®, catalog number: 0003725001 )
Dry Block Heater (VWR, catalog number: 75838-282 )
Frigidaire 13.8 cu. Ft. Frost Free Upright Freezer (The Home Depot)
Large Series, Single Door, Hinged Autoclave (Consolidated Sterilizer Systems, model: LR-36E )
Basic Laboratory Hoods (Labconco, model: 2246500 )
Inverted light microscope (Leica Microsystems, model: DM IL LED )
GC-MS (Agilent Technologies, model: 5973-MSD ) equipped with an Agilent 6890 GC system
DB-17MS capillary column, 30 m x 0.25 mm x 0.25 μm (Agilent Technologies)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Ko, C. W., Counihan, D., DeSantis, D., Sedor-Schiffhauer, Z., Puchowicz, M. and Croniger, C. M. (2018). Using Stable Isotopes in Bone Marrow Derived Macrophage to Analyze Metabolism. Bio-protocol 8(17): e3003. DOI: 10.21769/BioProtoc.3003.
Ko, C. W., Counihan, D., Wu, J., Hatzoglou, M., Puchowicz, M. A. and Croniger, C. M. (2018). Macrophages with a deletion of the phosphoenolpyruvate carboxykinase 1 (Pck1) gene have a more proinflammatory phenotype. J Biol Chem 293(9): 3399-3409.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Macrophage
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,004 | https://bio-protocol.org/exchange/protocoldetail?id=3004&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ty1 Retrotransposition Frequency Assay Using a Chromosomal Ty1his3AI or Ty1kanMXAI Element
MC M. Joan Curcio
Published: Sep 5, 2018
DOI: 10.21769/BioProtoc.3004 Views: 4673
Original Research Article:
The authors used this protocol in Feb 2018
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2018
Abstract
Here I describe a simple genetic assay to determine the frequency of retrotransposition of a single chromosomal Ty1 element that is marked with the retrotransposition indicator gene, his3AI or kanMXAI. The assay is used to determine the effect of mutations or environmental conditions on the frequency of Ty1 retrotransposition in the yeast, Saccharomyces cerevisiae.
Keywords: Ty1 Retrotransposon Saccharomyces cerevisiae Retrotransposition Indicator Gene RIG his3AI
Background
Ty1 is a long terminal repeat (LTR) retrotransposon that is structurally and evolutionarily related to retroviruses. Retrotransposition of Ty1 occurs when Ty1 RNA is reverse transcribed within cytoplasmic virus-like particles, resulting in synthesis of a cDNA that is transported back to the nucleus and integrated into the genome of its host (Boeke et al., 1985; Garfinkel et al., 1985). The integrated Ty1 element consists two LTRs in the same orientation that flank two open reading frames: GAG, which encodes a structural protein that forms the virus-like particle and binds Ty1 RNA, and POL, which encodes three enzymatic proteins- protease, reverse transcriptase and integrase (Figure 1). Ty1 elements are the most active and abundantly transcribed of all five families of LTR-retrotransposons in S. cerevisiae. Ty1 has been shown to be regulated by hundreds of genes, several different environmental conditions and various DNA damaging agents (Curcio et al., 2015). To measure the relative frequencies of Ty1 retrotransposition in different genetic backgrounds and under different environmental conditions, a chromosomal Ty1 element under the control of the native promoter was marked with a retrotransposition indicator gene (Figure 1). A retrotransposition indicator gene is a selectable marker gene whose coding sequence is interrupted by an intron in the opposite orientation to transcription (Figure 1). When placed within the Ty1 retrotransposon such that Ty1 and the marker gene are in opposite transcriptional orientations, the intron is spliced out of the Ty1 transcript but cannot be spliced out of the marker gene transcript. When the spliced Ty1 transcript undergoes retrotransposition, however, it recreates a functional marker gene in the transposed copy of the element. The fraction of viable cells in which the selectable marker gene is detected phenotypically is the retrotransposition frequency. This assay is a modification of that first described by Curcio and Garfinkel in 1991.
The specific assay conditions provided here are for derivatives of strain BY4741 containing a chromosomal Ty1 element that is marked with the retrotransposition indicator gene, his3AI or kanMXAI (Curcio and Garfinkel, 1991, Bryk et al., 2002). Cells that sustain retrotransposition of Ty1his3AI harbor a Ty1HIS3 element and are His+ prototrophs (i.e., capable of growth on medium lacking histidine; Figure 1). Cells that sustain retrotransposition of Ty1kanMXAI harbor a Ty1kanMX element and are resistant to G418.
Figure 1. Genetic assay for detection of cells that sustain a retrotransposition event of the chromosomal Ty1his3AI element. The Ty1 element consists of long terminal repeats (boxed arrowheads) flanking a GAG and a POL open reading frame. The his3AI indicator gene, which consists of the HIS3 marker gene interrupted by an intron in the antisense orientation, is inserted downstream of POL. Ty1his3AI RNA is transcribed, and the intron within the HIS3 open reading frame is spliced out. The spliced RNA is then subject to reverse transcription during the process of retrotransposition. The resulting Ty1HIS3 cDNA lacks the intron and contains functional HIS3 gene sequences. Integration of the cDNA into the host genome renders the cell His+. (Adapted from Curcio et al., 2015)
Materials and Reagents
Pipette tips for P10, P100 and P1000 micropipettes
Sterile flat wood toothpicks for obtaining single colonies (VWR, catalog number: 470146-908)
Manufacturer: Regional Distributors, catalog number: 159864 .
Sterile 12 x 75 mm polypropylene tubes with caps (4 per strain tested) (Evergreen Scientific, CaplugsTM, catalog number: 222-2367-080 )
Borosilicate glass 20 mm x 150 mm culture tubes (Sigma-Aldrich, catalog number: C1048 ) with closure caps (Sigma-Aldrich, catalog number: C1298 ), sterilized (1 per strain tested)
Sterile 1.5 ml microfuge tubes (4 per strain tested)
Petri dishes (Fisher Scientific, FisherbrandTM, catalog number: FB0875713 )
Sterile Rattler Plating Glass Beads, 4.5 mm (Zymo Research, catalog number: S1001 )
Strains
This assay is performed using derivatives of strain BY4741 that contain a Ty1his3AI[∆1] element, which has the “∆1” version of the his3AI gene. Ty1his3AI[∆1] must be used in strains such as BY4741 that have a his3∆1 allele rather than a complete deletion of the HIS3 gene. DNA recombination between his3AI[∆1] and his3∆1 cannot yield a functional HIS3 allele, so all His+ prototrophs that arise are due to the presence of a retrotransposed Ty1HIS3 element. Strains containing the chromosomal Ty1his3AI[∆1]-3114 element include JC3212 and JC3787 (Mou et al., 2006). The genotypes are:
JC3212 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 Ty1his3AI[∆1]-3114
JC3787 MATα his3∆1 leu2∆0 met15∆0 ura3∆0 Ty1his3AI[∆1]-3114
A derivative of strain BY4741 containing a single chromosomal Ty1kanMXAI element was described recently (Salinero et al., 2018). This strain has the following genotype:
JC6464 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 Ty1kanMXAI-6464
YPD agar (Sunrise Science, catalog number: 1876-500 ), sterilized, in Petri dishes (4 plates per strain tested)
SC Complete-His Powder (Sunrise Science, catalog number: 1481-100 )
Agar, Yeast Culture Grade (Sunrise Science, catalog number: 1910-1KG )
G418 Sulfate (GeneticinTM Selective Antibiotic) (Thermo Fisher Scientific, catalog number: 11811023 )
Sterile YPD broth (Sunrise Science, catalog number: 1875-019 )
Sterile deionized water (Rockland Immunochemicals, catalog number: MB-009-1000 )
Ethyl alcohol (ethanol), 190 proof, non-denatured (Sigma-Aldrich, catalog number: E7148 )
SC-HIS agar plates (see Recipe 1), or, Sterile YPD + 200 μg/ml G418 agar plates (see Recipe 3)
Note: A total of 8 plates (of either type) is needed per strain tested.
200 mg/ml G418 stock solution (see Recipe 2)
Equipment
P10, P100 and P1000 micropipettes
Pipet-Aid
Tissue Culture Rotator (Fisher Scientific, FisherbrandTM, catalog number: 14-251-250 )
Rotator drum (Fisher Scientific, FisherbrandTM, catalog number: 14-251-251 )
Benchtop centrifuge that accommodates 12 x 75 mm tubes in a swinging bucket rotor (Eppendorf, Centrifuge, model: 5810 with swing out rotor S-4-104, catalog number: 5820740000 )
Microcentrifuge (Fisher Scientific, FisherbrandTM, model: accuSpinTM Micro 17, catalog number: 13-100-675 )
Vortex Mixer (Thermo Fisher Scientific, MaxiMix®, model: M16715Q , catalog number: 12-815-50)
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > Retrotransposition
Cell Biology > Cell-based analysis > Colony formation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,005 | https://bio-protocol.org/exchange/protocoldetail?id=3005&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Selective Isolation of Retroviruses from Extracellular Vesicles by Intact Virion Immunoprecipitation
Tyler Milston Renner
Kasandra Bélanger
Marc-André Langlois
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.3005 Views: 10525
Edited by: Vamseedhar Rayaprolu
Reviewed by: Smita NairRajesh Thippeshappa
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
There exists a wide variety of techniques to isolate and purify viral particles from cell culture supernatants. However, these techniques vary greatly in ease of use, purity, yield and impact on viral structural integrity. Most importantly, it is becoming evident that secreted extracellular vesicles (EVs) co-purify with retroviruses using nearly all purification methods due to nearly indistinguishable biophysical characteristics such as size, buoyant density and nucleic acid content. Recently, our group has illustrated a means of isolating intact and highly enriched retroviral virions from EV-containing cell supernatants using an immunoprecipitation approach targeting the viral envelope glycoprotein of the Moloney Murine Leukemia Virus (Renner et al., 2018). This technique, that we call intact virion immunoprecipitation (IVIP), enabled us to characterize the accessibility of epitopes on the surface of these retroviruses and assess the orientation of the virus-encoded integral membrane protein Glycogag (gPr80) in the viral envelope. Proper implementation of this protocol enables fast, simple and reproducible preparations of intact and highly purified retroviral particles devoid of detectable EV contaminants.
Keywords: Retrovirus purification Extracellular vesicles Exosomes MLV HIV Immunoprecipitation Glycogag gPr80 Nanoscale flow cytometry Flow virometry Intact virion immunoprecipitation IVIP
Background
Widely used approaches for isolating retroviruses, such as the Human Immunodeficiency Virus (HIV) and Murine Leukemia Virus (MLV), include precipitation, chromatography, ultrafiltration, ultracentrifugation, as well as various other means of particle separation (Reviewed in Nestola et al., 2015). While each technique has its specific advantages, drawbacks and limitations, a common concern for all methods is the co-purification of cell secreted extracellular vesicles (EVs).
EVs constitute a heterogeneous population of membrane-derived vesicles secreted by all cell types (Yanez-Mo et al., 2015). There are strikingly similar biophysical and biochemical characteristics between retroviruses and EVs (Table 1), especially with the small 50-150 nm vesicles secreted through the endosomal pathway, better known as exosomes (Reviewed by Nolte-'t Hoen et al., 2016). Some retroviruses, such as HIV and MLVs, can also share with exosomes the pathways of biogenesis and egress through the endocytic system (Orenstein et al., 1988; Raposo et al., 2002; Houzet et al., 2006; Sandrin and Cosset, 2006; Akers et al., 2013; Madison and Okeoma, 2015; Martin et al., 2016; Nolte-'t Hoen et al., 2016). This imparts inherent biochemical composition similarities between the two types of particles, which extend to their cargo (e.g., proteins, mRNAs, miRNAs) and host-derived surface membrane proteins and antigens (e.g., CD9, CD63, CD81), which inevitably increases difficulties in telling them apart (Eckwahl et al., 2016; Nolte-'t Hoen et al., 2016; Telesnitsky and Wolin, 2016). Given such similarities, selective isolation of retroviruses requires a unique identifying marker to confidently discriminate them from exosomes and EVs in general.
Table 1. Retroviruses and EVs are nearly indistinguishable by their biochemical and biophysical characteristics
Nanoscale flow cytometry (NFC), also called flow virometry or NanoFACS, is an optimization of flow cytometry techniques, sample preparations and hardware for the analysis of particles smaller than 200 nm, which is the average detection limit of most commercial flow cytometers (Tang et al., 2016 and 2017; Lippe, 2018). This technology is especially useful for the immune phenotypic profiling of markers on the surface of viruses and EVs. By using this approach, we previously determined that a fluorescently tagged viral envelope glycoprotein (Env-eGFP) of the Moloney MLV (M-MLV) was almost exclusively expressed on the surface of these virus particles, and thereby constituted a very reliable selection marker (Figure 1) (Tang et al., 2017).
Figure 1. Env-eGFP represents a selection marker for identifying retroviruses by nanoscale flow cytometry. This figure has been adapted from Tang et al. (2017). 293T cells were mock transfected with an empty plasmid (A), with Env-eGFP (B) or eGFP (D) expression plasmids, or with the Env-eGFP expressing M-MLV viral plasmid (C). The M-MLV used in this study contained an eGFP reporter inserted into the proline-rich region of the extracellular domain of the envelope glycoprotein (Sliva et al., 2004). Supernatants were 450 nm-syringe filtered prior to NFC analysis. Transfection efficiency was monitored by eGFP expression in the transfected cells and was similar in each relevant condition (data not shown). For NFC analysis, particles were detected by triggering off of side-scattered light (SSC). A square gate was set above background in the Mock sample where eGFP+ events are expected (A). Side and top boundaries of this gate were determined by the limits of the eGFP+ events in the MLVeGFP sample (C). Numbers in green represent eGFP+ particles detected and enumerated in the gate during a fixed acquisition time window, which was the same for all samples analyzed. For NFC analysis, SSC is more sensitive than forward scattered (FSC) light to detect particles smaller than 200nm on our instrument (Tang et al., 2016). The results show that, in our system, the membrane-expressed Env-eGFP does not substantially associate with EVs (B). However, cytosolic eGFP is incorporated as cargo inside EVs (D). Env-eGFP is highly enriched only on the surface of viruses (C).
The protocol described here was specifically developed to study an enigmatic virus-encoded integral membrane protein called Glycogag (or gPr80) inserted in the envelope of M-MLV (Pillemer et al., 1986; Fujisawa et al., 1997 and 2001; Rosales Gerpe et al., 2015; Renner et al., 2018). Our goal was to assess the incorporation and orientation of full-length gPr80 in the envelope of M-MLV. A major caveat to this particular study was the release of EVs by the infected cells that contaminated our virus samples. This proved to be especially problematic, as we found that the gPr80 protein associated with both EVs and virions (Renner et al., 2018). But given that Env-eGFP was highly enriched on the surface of M-MLV virions and poorly incorporated on EVs (Figure 1) (Tang et al., 2017), we thus developed an intact virion immunoprecipitation (IVIP) assay designed to specifically isolate structurally intact viral particles expressing Env-eGFP on their surface. Using this approach, we successfully identified the orientation of gPr80 as a Type-I integral membrane protein on virions but as a Type-II integral membrane protein on EVs that are devoid of Env-eGFP (Renner et al., 2018). In conclusion, IVIP has the ability to selectively isolate and discriminate retroviruses from EVs with minimal physical manipulation and without compromising the structural integrity of either particle type.
Materials and Reagents
μ-Columns (Miltenyi Biotec, catalog number: 130-042-701 )
Microcentrifuge tubes (FroggaBio, catalog number: LMCT1.7B , or equivalent)
Pasteur pipettes (Fisher Scientific, catalog number: 13-678-20A , or equivalent)
PVDF membrane (Bio-Rad Laboratories, catalog number: 1620177 )
Serological pipettes, 10 ml (Corning, catalog number: 4488 , or equivalent)
Sterile 20 ml syringes with Luer-Lok (BD, catalog number: 302830 , or equivalent)
Sterile 450 nm Luer-Lok syringe filters (Pall, catalog number: 4614 , or equivalent)
Sterile 50 ml conical tubes (FroggaBio, catalog number: TB50-500 , or equivalent)
Sterile pipette tips (Diamed, DIATEC, catalog numbers: DIATEC520-5376 , DIATEC520-5876 , DIATEC520-6501 , or equivalent)
HEK 293T cells (ATCC, catalog number: CRL-3216 )
R187 Hybridoma (ATCC, catalog number: CRL-1912 )
μMACS GFP Isolation Kit (Miltenyi Biotec, catalog number: 130-091-125 )
10 cm culture dishes (Corning, catalog number: 430167 , or equivalent)
220 nm Steritop filters (Merck, catalog number: SCGPT10RE , or equivalent)
Anti-eGFP (Takara Bio, Clontech, catalog number: 632381 )
Anti-Flag, HRP conjugated (Sigma-Aldrich, catalog number: A8592-1MG )
Anti-Mouse IgG, HRP conjugated (Cell Signaling Technology, catalog number: 7076S )
Anti-Rabbit IgG, HRP conjugated (Abcam, catalog number: ab6721 )
Anti-Rat IgG, HRP conjugated (Sigma-Aldrich, catalog number: AP183P )
Anti-V5 (Merck, catalog number: AB3792 )
Dulbecco's modified Eagle’s medium (DMEM) high glucose, with L-glutamine, sodium pyruvate and phenol red (WISENT, catalog number: 319-005-CL , or equivalent)
Dynabeads M270-epoxy (Thermo Fisher Scientific, catalog number: 14321D )
ECL Substrates, i.e.:
Clarity Western ECL Substrate (Bio-Rad Laboratories, catalog number: 1705060S , or equivalent)
ClarityMax Western ECL Substrate (Bio-Rad Laboratories, catalog number: 1705062S , or equivalent)
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 12483020 , or equivalent)
Glycine (Fisher Scientific, catalog number: BP381-5 )
HCl (36.5-38%) (Fisher Scientific, catalog number: A144S-500 )
Hybridoma-SFM (Thermo Fisher Scientific, GibcoTM, catalog number: 12045076 )
KCl (Fisher Scientific, catalog number: BP366-500 )
KH2PO4 (Fisher Scientific, catalog number: P285-500 )
Methanol (VWR, catalog number: 56902-543 )
Milli-Q Water
Na2HPO4 (Fisher Scientific, catalog number: S393-3 )
NaCl (Fisher Scientific, catalog number: BP358-10 )
NaOH, 10N certified (Fisher Scientific, catalog number: SS255-1 )
NuPAGETM 4-12% Bis-Tris Gel (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0335BOX )
NuPAGETM MOPS SDS Running Buffer (Thermo Fisher Scientific, InvitrogenTM, catalog number: NP0001 )
Penicillin-Streptomycin (GE Healthcare, catalog number: SV30010 , or equivalent)
Polyethylenimine (PEI) (Polysciences, catalog number: 23966-1 , or equivalent)
Sucrose (WISENT, catalog number: 800-081-LG , or equivalent)
Tris Base (Fisher Scientific, catalog number: BP152-5 )
TweenTM 20 (Fisher Scientific, catalog number: BP337-100 )
PBS (10x) (see Recipes)
20% sucrose in PBS (see Recipes)
Complete DMEM (see Recipes)
Tris-Glycine Transfer Buffer (25x) (see Recipes)
Note: We used VWR as a distributor for Pall and Corning products.
Equipment
μMACS Separator (Miltenyi Biotec, catalog number: 130-042-602 )
4 °C refrigerator
Balance (Fisher Scientific, catalog number: 01-919-358, or equivalent)
Manufacturer: OHAUS, catalog number: 30100606/RM .
Biosafety cabinet (Thermo Fisher Scientific, catalog number: 1323TS , or equivalent)
Digital Imager (GE Healthcare, model: ImageQuant LAS 4000, catalog number: 28955810 , or equivalent)
Haemocytometer (Hausser Scientific, catalog number: 3100 , or equivalent)
MACS MultiStand (Miltenyi Biotec, catalog number: 130-042-303 )
Magnetic stand (Thermo Fisher Scientific, catalog number: 12321D )
Microscope (Fisher Scientific, catalog number: LMI6PH2, or equivalent)
Manufacturer: Laxco, catalog number: LMI6PH2 .
Pipettes (Gilson, catalog number: F167700 , or equivalent)
Refrigerated table-top centrifuge (Thermo Fisher Scientific, model: SorvallTM ST 40 , catalog number: 75004524, or equivalent)
Rocking platform (Maxi Rotator) (Labline Instruments, model: Model 4631 , or equivalent)
Tissue culture incubator, humidity, temperature and CO2 regulated (Thermo Fisher Scientific, catalog number: 3110 , or equivalent)
Tube Revolver (Thermo Fisher Scientific, catalog number: 88881002 or equivalent)
Type 70Ti Rotor (Beckman Coulter, catalog number: 337922 , or equivalent)
Type 70Ti Tubes (Polycarbonate tubes and lids) (Beckman Coulter, catalog number: 355618 , or equivalent)
Ultracentrifuge (Beckman Coulter, catalog number: 969347 , or equivalent)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Renner, T. M., Bélanger, K. and Langlois, M. (2018). Selective Isolation of Retroviruses from Extracellular Vesicles by Intact Virion Immunoprecipitation. Bio-protocol 8(17): e3005. DOI: 10.21769/BioProtoc.3005.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial physiology > Membrane property
Molecular Biology > Protein > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,006 | https://bio-protocol.org/exchange/protocoldetail?id=3006&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Studying the Mechanisms of Developmental Vocal Learning and Adult Vocal Performance in Zebra Finches through Lentiviral Injection
ZS Zhimin Shi
OT Ofer Tchernichovski
XL XiaoChing Li
Published: Vol 8, Iss 17, Sep 5, 2018
DOI: 10.21769/BioProtoc.3006 Views: 5364
Edited by: Zinan Zhou
Reviewed by: Vrish Dhwaj Ashwlayan
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
Here we provide a detailed step-by-step protocol for using lentivirus to manipulate miRNA expression in Area X of juvenile zebra finches and for analyzing the consequences on song learning and song performance. This protocol has four parts: 1) making the lentiviral construct to overexpress miRNA miR-9; 2) packaging the lentiviral vector; 3) stereotaxic injection of the lentivirus into Area X of juvenile zebra finches; 4) analysis of song learning and song performance in juvenile and adult zebra finches. These methods complement the methods employed in recent works that showed changing FoxP2 gene expression in Area X with lentivirus or adeno-associated virus leads to impairments in song behavior.
Keywords: Zebra finch Area X miR-9 Lentivirus Song learning Song performance
Background
The zebra finch, with its well-characterized song behavior and the underlying neural circuitry, provides a unique animal model to study neural mechanisms underlying vocal communication and related sensory-motor learning. In recent years, several laboratories began using viral vectors to manipulate gene expression in the zebra finch brain and to study the functional consequences. These efforts are best illustrated by studies of the FoxP2 gene, which encodes the forkhead box p2 transcription factor. The FoxP2 protein controls the expression of hundreds of downstream genes that have important roles in nervous system development. Mutations in the human FoxP2 gene cause speech and language impairments (Lai et al., 2001). In songbirds, knockdown or overexpression of the FoxP2 gene in Area X of zebra finches, a basal ganglia nucleus critical for vocal learning, profoundly impairs song behavior (Haesler et al., 2007; Murugan et al., 2013; Heston and White, 2015). These studies significantly extended the usage of the zebra finch model to study gene functions in neural circuit development, vocal communication behavior, as well as in speech and language-related neural developmental disorders. We recently reported that overexpression of miRNA miR-9 in Area X of juvenile zebra finches impairs song learning and performance (Shi et al., 2018). Hoping others might benefit from this study, here we provide step-by-step protocols for lentivirus cloning and production, stereotaxic injection of the virus into Area X of juveniles, and analysis of the impact of miR-9 overexpression on song learning and performance using the software Sound Analysis Pro (Tchernichovski et al., 2000). With minor modifications, these methods can be tailored to study other miRNAs or genes in vocal learning and performance in songbirds.
Materials and Reagents
Pipette tips and Eppendorf tubes
10 cm cell culture plates (Corning, catalog number: 430167 )
24-well cell culture plates (Corning, Costar®, catalog number: 3524 )
0.45 μm filter (Merck, catalog number: SCHVU01RE )
30 ml Polyallomer conical centrifuge tube (Beckman Coulter, catalog number: 358126 )
Insulin syringe (Smiths Medical, catalog number: 4429-1 )
25 G syringe needles
Betadine Surgical Scrub (Purdue Products)
Zebra finch tissue (e.g., the brain)
XL10 Gold Ultracompetent cells (Agilent Technologies, catalog number: 200314 )
Oneshot Stbl3 competent E. Coli (Thermo Fisher Scientific, InvitrogenTM, catalog number: C737303 )
293LTV Cells (Cell Biolabs, catalog number: LTV-100 )
A lentiviral vector that contains the human ubiquitin promoter driving the expression of the mCherry fluorescent marker (Edbauer et al., 2010)
Lentivirus packaging plasmids psPAX2 and VSVG (Addgene, catalog numbers: 12260 and 35616 )
PCR primers for miR-9 precursor amplification (Integrated DNA Technologies)
Forward primer: 5'-GATGCTAGC TGTGTGTGTGGTTCCCGGTGGCAGCT-3'
Reverse primer: 5'-CATGGCGCGCC GGACCCGCAGCCCTTACCTGGAGCCC-3'
Note: The forward primer contains a NheI site and the reverse primer contains an AscI site (underlined).
PfuUltraII Fusion HS DNA polymerase (Agilent Technologies, catalog number: 600670 )
Restriction enzymes AscI and NheI (New England BioLabs, catalog numbers: R0558S , R0131S )
T4 DNA ligase (New England BioLabs, catalog number: M0202 )
LB broth (Thermo Fisher Scientific, catalog number: 12780052 )
Agar (Thermo Fisher Scientific, catalog number: 22700025 )
Ampicillin (Sigma-Aldrich, catalog number: A0166-5G )
Genomic DNA isolation kit (QIAGEN, catalog number: 69504 )
Gel extraction kit (QIAGEN, catalog number: 28704 )
PCR purification kit (QIAGEN, catalog number: 28004 )
EndoFree Plasmid Maxi Kit (QIAGEN, catalog number: 12362 )
Agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500-500 )
50x TAE buffer (QIAGEN, catalog number: 129237 )
IMDM Glutamax cell culture medium (Thermo Fisher Scientific, catalog number: 31980097 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, catalog number: 10437028 )
2 M Calcium Solution
Penicillin-Streptomycin 5,000 U/ml (Thermo Fisher Scientific, catalog number: 15070063 )
Cell culture medium IMDM supplemented with 10% FBS and 50 U/ml Penicillin-Streptomycin unless otherwise indicated
CalPhos Mammalian Transfection Kit (Takara Bio, catalog number: 631312 )
Phosphate buffered saline (PBS, PH 7.4, Thermo Fisher Scientific, catalog number: 10010-023 )
Ketamine (Henry Schein Ketathesia)
Xylazine (Henry Schein Vet)
Metacam (Boehringer Ingelheim Vetmedica)
Fluorescent dye (Thermo Fisher Scientific, catalog number: C34775 )
Ethanol, 200 proof (Koptec)
Vetbond (3M)
Solution A (see Recipes)
Solution B (see Recipes)
Equipment
Pipettes
Gel electrophoresis apparatus (Bio-Rad)
Water bath (37 °C and 42 °C, Precision)
Incubator with shaker (32 °C or 37 °C for growing bacteria)
Tissue culture hood
Tissue culture incubator temperature at 37 °C
Ultracentrifuge and SW28 rotor (Beckman Coulter, Optima, model: LE-80K )
Bench top centrifuge (Eppendorf, model: 5804 R )
Bench top centrifuge (Eppendorf, model: 5414 R )
ND-1000 Spectrophotometer (Thermo Fisher Scientific, model: NanoDropTM 1000, catalog number: ND-1000 )
Thermocycler (Bio-Rad)
Stereotaxic head holder (MyNeurolab)
Oil hydraulic micromanipulator (NARISHIGE, model: MO-10 )
Glass needle puller (NARISHIGE, model: PC-10 )
Glass Capillary (WIRETROL 1-5 μl) (Drummond Scientific, Wiretrol®, catalog number: 5-000-1001 )
Track light (Motic, model: MLC-150C )
Thermal pat (Kent Scientific, model: DCT-15 )
Scanning microscope with fluorescent light
Surgery tools: scissors and forceps (Fine Science Tools)
Microphone (Audio-Technica, catalog number: AT803b )
Amplifier (M-Audio, model: 2626 )
Window Computer
Sound prove chamber (constructed following Sound Analysis Pro User Manual)
LED Light (Super Bright LEDs, catalog number: RLBN-NW30SMD )
Software
Sound Analysis Program (SAP) Version 1.02 (Tchernichovski et al., 2000), http://soundanalysispro.com
Procedure
Experiments involving lentivirus and animals should be approved by the Institutional Animal Care and Use Committee and the Institutional Biosafety Committee and follow institutional or national regulations. When working with bacteria or virus, all glassware, pipet tips, tubes, and solutions should be autoclaved when applicable before use. All surgery tools should be autoclaved before use, and surgical procedures should be performed under aseptic conditions.
Clone the zebra finch miR-9 gene into a lentiviral vector
Isolate genomic DNA from any zebra finch tissue (e.g., the brain) using the QIAGEN genomic DNA isolation kit.
Amplify the zebra finch miR-9 gene from the genomic DNA using PCR (denaturing: 95 °C/10 sec; annealing: 54 °C/25 sec; and extension: 72 °C/25 sec; 40 cycles).
Separate the PCR product by electrophoresis on 1.5% agarose gel.
Cut out the 290 bp band from the gel, and purify the DNA fragment using the QIAGEN Gel Extraction kit.
Digest the PCR product with the restriction enzymes NheI and AscI at 37 °C for 2-3 h.
Digest the lentiviral vector with restriction enzymes NheI and AscI at 37 °C for 2-3 h.
Purify the digested lentiviral vector by gel electrophoresis followed by gel extraction.
Ligate the miR-9 fragment to the lentiviral vector (molar ratio: 5:1) with T4 DNA ligase in 20 μl ligation buffer at 4 °C overnight.
Transform the Stbl3 cells with DNA ligation mix.
Plate the transformed Stbl3 cells onto LB agar plate with Ampicillin (100 mg/ml).
Grow the bacteria at 32 °C for 20 h.
Pick a single colony and grow in 250 ml LB broth/ampicillin at 32 °C for 15-20 h.
Purify the plasmid DNA using the QIAGEN EndoFree Plasmid Maxi Kit.
Re-suspend the plasmid DNA in 10 mM Tris buffer (pH 7.5).
Quantify the plasmid DNA with Nanodrop.
Validate the plasmid DNA by sequencing and/or digestion with restriction enzymes NheI and AscI (see the plasmid map in Figure 1).
Prepare the packaging plasmids psPAX2 and VSVG similarly as described in Steps A9-A15, except XL10 Gold Ultracompetent cells are used and the bacteria are grown at 37 °C.
Figure 1. The plasmid map of the Lenti-miR-9 vector
Production of lentivirus
Seed 293LTV cells 3 x 106/10 cm plates (typically 6 plates) in IMDM medium, supplemented with antibiotics (unless otherwise indicated) and 10% FBS the day before transfection.
Replace 75% of the medium with IMDM (no FBS) next day, 2 h before transfection (cells are about 70% confluent).
Prepare solution A and solution B in separate tubes (see Recipes below).
Add solution B to solution A dropwise while gently shake the transfection mix (A + B).
Let the transfection mix sit at room temperature for 15 min.
Gently add transfection mix dropwise to cell culture plate (1.4 ml transfection solution per 10 cm plate).
Incubate the transfected cells at 37 °C for 8-10 h.
Remove and discard the calcium phosphate-containing medium and replace with 8 ml IMDM containing 2% FBS.
Collect the virus-containing cell culture medium at 48 h after transfection (store at 4 °C until Step B11) and replace the medium with 8 ml IMDM containing 2% FBS.
Collect the virus-containing cell culture medium at 72 h after transfection (cells can be discarded afterward).
Combine the collected cell culture medium and spin at 720 x g (2,000 rpm, Eppendorf centrifuge, 5804 R )/10 min at 4 °C.
Save the supernatant and filter it with a sterile 0.45 μm filter.
Spin the supernatant at 82,700 (rav) x g (25,000 rpm, ultracentrifuge) for 2 h at 4 °C.
Discard supernatant and rinse the pellet briefly with PBS.
Re-suspend the pellet in 50-60 μl PBS at 4 °C overnight.
Bleach all waste medium and plastic wares before throwing them away.
Titer the virus
Seed 293LTV cells in a 24-well plate to 2 x 104 cells per well in IMDM w/10% FBS.
Twenty-four hours later, change medium to IMDM w/2% FBS.
Make serial viral dilutions with IMDM medium: 10-1, 10-2, 10-3, 10-4, 10-5, and 10-6.
Add 1 μl of each viral dilution to cells in each well, three wells per viral dilution.
Seventy-two hours later, count the number of fluorescent cells per well starting from the 10-5 or 10-6 dilution and average the cell counts from the triplicate wells.
The titer is the number of fluorescent cells per well times the dilution factor.
e.g., if the cell count is 3/well at 10-6 dilution, the titer would be 3 x 106 IU.
Typically we obtain a titer about 2-3 x 106 IU/μl (IU = infection unit).
Injection of the lentivirus into juvenile Area X
Prepare the male juvenile finches for injection by removing their father at day 10, and keeping them with their mothers in a sound attenuated chamber until day 30. Viral injection is performed at 25 ± 1 days of age.
Weigh and anesthetize the animal by intramuscular injection with 24 μg/Ketamine-12 μg/Xylazine per g of body weight.
Mount the animal onto the stereotaxic head holder platform with the tail up by 10 degree, and tighten the mouth bar and the ear bars.
Disinfect the scalp with iodine and pluck the feather away from the top of head.
Open the scalp along the middle line about 1-1.2 cm using a pair of scissors.
Pull a glass injection needle using a needle puller. The heating temperature can be adjusted by turning the dial so that the inner diameter at the needle tip is 25-30 μm (can be done beforehand).
Briefly spin the virus solution before injection for 5 min at 9,300 x g (10,000 rpm, Eppendorf centrifuge, 5414 R) at 4 °C.
Fill the injection needle with 1 μl mineral oil, 1-2 μl viral solution, and 0.5 μl mineral oil.
Install the injection needle onto the stereotaxic manipulator.
Move the injection needle to the bregma point using the stereotaxic manipulator and record the anterior/posterior and medial/lateral coordinates (this is the reference point for the injection coordinates).
Move the injection needle to above Area X (middle point of A/P and M/L injection coordinates) and make a mark.
Open a small window 1-1.5 mm2 on the skull at the marked site using a 25 G syringe needle.
Make an opening in the dura with a 25 G needle to facilitate entry of the glass needle.
Inject each Area X at 6 or 8 sites at the following coordinates (Figure 2B): anterior/posterior, 2.8 and 3.2 mm; medial/lateral, 1.3 and 1.5 mm; dorsal/ventral, 4.2 and 4.4 mm (from the surface of the skull). For behavioral experiments, virus is injected bilaterally.
Inject 120 nl viral solution at each site over a period of 2 min using the hydraulic pressure device.
Let the injection needle remain at the site for 2 min before injection and 5 min after injection before removal to facilitate diffusion of viral solution.
Put back the skull bone to the opening and close the skin (one side slightly over another side) and apply Vetbond to seal the scalp.
Put the animal on a thermal pat at temperature 30 °C until it wakes up (takes about 30 min).
Return the animal to the home cage.
Disinfect the surgery area with 70% ethanol, bleach the injection needles and throw them into a sharp waste container, wash and autoclave surgical tools.
Record the following information: injection date, animal ID, injection agents, coordinates and volume of injection.
Figure 2. Injecting the lentivirus into Area X of the zebra finch brain. A. Stereotaxic setup for surgical procedures. B. Schematic illustration showing the coordinates for viral injection into Area X. C. Exemplar brain section showing virally expressed mCherry signal in Area X. D. mCherry-labeled neurons in Area X.
Song recording and analysis
Keep the injected juveniles with their mothers until day 30, give an adult male tutor to each injected juvenile, and keep the pair in a sound-attenuated chamber from day 30 to day 70.
Record undirected songs for each juvenile pupil at specified age for two days in the absence of the tutor.
Sort manually all song files recorded in one day from 8 AM to 12 PM and eliminate files representing cage noise (this step can be done automatically using the SAP).
Select 20 song files approximately evenly spread across the entire set of sorted song files (e.g., select the first, 11th, 21st, 31st, etc. if there are 200 song files) for each pupil.
Counting the average number of syllables per motif
Count manually the total number of syllables and the total number of motifs in 20 pupil song files (50-80 motif renditions) and 10 tutor song files (25-40 motif renditions). In cases when a pupil or a tutor song has multiple versions of motifs, include all versions in counting and exclude partial motifs typically appearing at the beginning or the end of a song file. Divide the total number of syllables by the total number of motifs for both the pupil and its tutor. Compare the number of syllables per motif for each pupil to that of its tutor.
Counting the number of missing syllable
Count manually the number of syllable types (A, B, C, D, etc.) in 20 pupil song files (50-80 motif renditions) and 10 tutor song files (25-40 motif renditions). If a syllable type occurs only in the tutor’s song, but not in the pupil’s song, or if the frequency of a syllable in a pupil’s song is less than 10% of its frequency in the tutor’s song, it is defined as a missing syllable.
Motif similarity analysis
Compare 20 pupil motifs with 10 tutor motifs and obtain a motif similarity score for each comparison using the default asymmetric time course mode of SAP. Average % similarity of the 200 pairwise comparisons to obtain a motif similarity score.
Maximum motif similarity analysis
Rank the 200 motif similarity measurements (20 pupil motifs x 10 tutor motifs) for each pupil and average the 10 highest values (top 5%) to obtain the maximum motif similarity score.
Syllable accuracy analysis
Measure the accuracy score for each syllable of a pupil’s song motif in 20 renditions using the default asymmetric mode of SAP. Average the accuracy scores of all syllables in a pupil’s motif to obtain a syllable accuracy score for that pupil.
Syllable feature analysis
Measure each syllable feature (duration, mean frequency, goodness of pitch, frequency modulation, and Wiener entropy) for each syllable in 20 pupil motif renditions and 10 tutor motif renditions using the SAP, and average the measurements for all renditions.
Calculate the difference from the tutor (%) for each acoustic feature and for each syllable:
(pupil’s measurement - tutor’s measurement)/tutor’s measurement.
Average the percentage difference values of all syllables for each syllable feature.
Syllable feature variation
Calculate a coefficient of variation for each acoustic feature for 20 renditions of a syllable, and average the coefficients of variation for all syllable types for each acoustic feature.
Syllable transition entropy analysis
Segment all songs recorded in two days from 8 AM to 12 PM using the auto-segmentation function of SAP (Typically 10,000-19,000 syllables can be obtained).
Classify these syllables into types (clusters) using the clustering module of SAP.
Visually validate the clusters by matching clusters with syllable types in the sonograms, and manually correct obvious cases of false classification (e.g., due to segmentation inconsistency).
Calculate the transition frequencies between all pairs of syllable types, which results in a matrix. For example, for a song motif containing five syllable types (A, B, C, D, and E), calculate syllable transition frequencies for A to A, A to B, A to C, A to D, A to E; B to A, B to B, B to C, and so on.
For each syllable type t (each row in the matrix), calculate the relative transition probability: pt = transition frequency between a syllable pair divided by the sum of transition frequencies of all syllable pairs in a row.
Compute transition entropy for each syllable type t: Entropyt = sum [pt x log(pt)].
Compute a weighted transition entropy for each syllable type:
Entropytw = Entropyt x syllable weight, so as to give higher weight to the more frequent syllable types. A syllable weight is defined as the transition frequencies of a given syllable type (sum of a row in the matrix) divided by the sum of transition frequencies of all syllable types (sum of the entire matrix).
Finally, calculate the overall transition entropy for a song by averaging transition entropies of all its syllable types.
Quantifying the amount of singing
Segment all song files recorded for each bird between 8 AM to 12 PM in two days using the batch mode of SAP. This process generates the total number of syllables a bird sings during the indicated time.
Recording female-directed songs
Record female-directed songs manually between 8:00-11:00 AM (A female-directed song is defined as a song that a male sings toward a female as observed by an experimenter). A male is induced to sing female-directed songs by presenting one or two females in a nearby cage. If needed, females can be changed every 10 min.
Constant fundamental frequency analysis
Analyze the same set of syllables that contain a segment with a constant fundamental frequency (harmonic stacks), and that are produced in the contexts of both undirected singing and female-directed singing.
Measure the constant fundamental frequency using the SAP. Typically, include 20-40 syllable renditions from 20 song files in each context in the analysis.
Exemplar sonograms of pupils injected with the control or miR-9 virus are shown in Figure 3.
Figure 3. Representative sonograms of miR-9 pupils showing examples of A) Missing syllables, B) Changes in syllable sequence and C) Syllable stuttering. A. Image showing that the song motifs of both the tutor and the control pupil have 7 syllables, whereas the miR-9 pupil’s motif has 5 syllables and syllables c and e are missing. B. Image showing the scrambled syllable sequence of a miR-9 pupil. C. Image showing two motifs of a miR-9 pupil; syllable b is repeated three times in the second motif.
Statistical analysis
For song behavioral experiments, we typically use 6-8 animals per treatment group, and include 10-20 motif renditions per animal and multiple syllables per motif in the analysis as indicated above. We use various statistical analysis methods such as t-test, paired t-test, ANOVA and/or Mann-Whitney test to evaluate the data and use P < 0.05 as the cutoff for significance.
Notes
Molecular cloning
For standard molecular biology work, such as genomic DNA isolation, PCR product purification, plasmid DNA purification, restriction enzyme digestion and ligation, we follow the manufacturers' instructions, especially when using QIAGEN kits.
Handling lentivirus
Lentiviruses should not be frozen and thawed multiple cycles and/or stored for long periods of time, which could cause a drastic drop in viral titer. We routinely prepare fresh virus for each injection experiment. Thus, the injection time (depending on the age of the animals) and viral preparation need to be coordinated. Typically, viral preparation starting from growing cells takes about 10 days. Once made, the lentivirus can be kept at 4 °C for 3-4 days without a significant drop in titer.
Testing injection coordinates
The injection coordinates can be tested by injecting a fluorescent dye into a targeted area. After injection, animals are killed, and brains are sectioned into 100 μm-thick sections. The sections are imaged with bright and fluorescent lights using a scanning scope (2x lens). Images are merged in Photoshop to check whether injection hits Area X.
Validating injection sites
We recommend examining the injection sites after the last behavioral experiment. This can be done by sectioning the brains and imaging brain sections with both regular light and fluorescent light. The two sets of images are merged to examine whether injection sites are within Area X (Figure 2C). If the mCherry fluorescent signal is outside of Area X, the animal should be excluded from behavioral analysis or should be used as a control. The average area exhibiting strong mCherry signal typically accounts for ~20% of total Area X volume.
Tutors
We typically use a heterogeneous group of adult male tutors to ensure that the observed impairment in song learning is not dependent on a specific tutor song. However, it is ideal that a subset of pupils injected with the experimental or the control virus are tutored by the same tutor. This will help ensure that any difference in song learning is not due to some tutor songs are more difficult to learn than others. Because tutor songs can change gradually, pupil songs should be compared to recently recorded tutor songs (within six months of tutoring).
Song analysis
Because zebra finch songs exhibit daily structural oscillation (Deregnaucourt et al., 2005), we recommend consistently analyzing songs produced during a specified time period. We also recommend that two investigators validate the key experimental results with at least one blind to the treatment groups.
Recipes
Solution A
Add components in the following order:
Lenti-vector plasmid DNA
67 μg
psPAX2
50 μg
VSVG
34 μg
2 M Calcium Solution
347.2 μl
Sterile H2O
to 2,800 μl
Solution B
2,800 μl 2x HBS
Acknowledgments
This work was funded by the National Science Foundation grant 1258015 (XCL) and the National Institute of Health grant R01MH105519 (XCL). The funders had no roles in study design, data collection and interpretation, or the decision to submit the work for publication. We thank Drs. M. Sheng and D. Edbauer for generously providing the lentiviral vector and Dr. H. Xia for the lentiviral packaging plasmids. We thank many members of the birdsong community for their constructive inputs throughout the course of this work.
Competing interests
The authors declare no competing financial interests.
Ethics
Experiments involving animals are approved by the Institutional Animal Care and use committee (IACUC) protocol (#3187) of the LSU School of Medicine.
References
Deregnaucourt, S., Mitra, P. P., Feher, O., Pytte, C. and Tchernichovski, O. (2005). How sleep affects the developmental learning of bird song. Nature 433(7027): 710-716.
Edbauer, D., Neilson, J. R., Foster, K. A., Wang, C. F., Seeburg, D. P., Batterton, M. N., Tada, T., Dolan, B. M., Sharp, P. A. and Sheng, M. (2010). Regulation of synaptic structure and function by FMRP-associated microRNAs miR-125b and miR-132. Neuron 65(3): 373-384.
Haesler, S., Rochefort, C., Georgi, B., Licznerski, P., Osten, P., and Scharff, C. (2007). Incomplete and inaccurate vocal imitation after knockdown of FoxP2 in songbird basal ganglia nucleus Area X. PLoS Biol 5: e321.
Heston, J. B. and White, S. A. (2015). Behavior-linked FoxP2 regulation enables zebra finch vocal learning. J Neurosci 35(7): 2885-2894.
Lai, C. S., Fisher, S. E., Hurst, J. A., Vargha-Khadem, F. and Monaco, A. P. (2001). A forkhead-domain gene is mutated in a severe speech and language disorder. Nature 413(6855): 519-523.
Murugan, M., Harward, S., Scharff, C. and Mooney, R. (2013). Diminished FoxP2 levels affect dopaminergic modulation of corticostriatal signaling important to song variability. Neuron 80(6): 1464-1476.
Shi, Z., Piccus, Z., Zhang, X., Yang, H., Jarrell, H., Ding, Y., Teng, Z., Tchernichovski, O. and Li, X. (2018). miR-9 regulates basal ganglia-dependent developmental vocal learning and adult vocal performance in songbirds. Elife 7: e29087.
Tchernichovski, O., Nottebohm, F., Ho, C. E., Pesaran, B. and Mitra, P. P. (2000). A procedure for an automated measurement of song similarity. Anim Behav 59(6): 1167-1176.
Copyright: Shi et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Shi, Z., Tchernichovski, O. and Li, X. (2018). Studying the Mechanisms of Developmental Vocal Learning and Adult Vocal Performance in Zebra Finches through Lentiviral Injection. Bio-protocol 8(17): e3006. DOI: 10.21769/BioProtoc.3006.
Shi, Z., Piccus, Z., Zhang, X., Yang, H., Jarrell, H., Ding, Y., Teng, Z., Tchernichovski, O. and Li, X. (2018). miR-9 regulates basal ganglia-dependent developmental vocal learning and adult vocal performance in songbirds. Elife 7: e29087.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Molecular Biology > RNA > miRNA interference
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,007 | https://bio-protocol.org/exchange/protocoldetail?id=3007&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Classic Labyrinth Test for Neurobehavioral Evaluation in Wistar Rats
Salim Gasmi
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3007 Views: 5981
Edited by: Pengpeng Li
Reviewed by: Udita Upadhyay
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
The Classic Labyrinth Test (CLT) is a simple way to evaluate behaviors in rodents such as learning ability, memory, and anxiety. The protocol presented here describes the procedure for use with rats, but the protocol can also be adapted for use in mice if a smaller device is used. In short, the CLT uses a square-shaped maze with a starting point and a stopping point. After the animal is trained, the animal is allowed to view and explore the labyrinth freely for 10 min. During this time, all of the animal's vertical and horizontal movements within the labyrinth are recorded. This is a very challenging task because it requires the animal to remember the quickest path between the starting points and the end. In cases where the labyrinth is designed so that the animal only needs to walk forward, it is quite easy for healthy rats, but for rats exposed to neuro-xenobiotics (drugs, pesticides) there will be disturbances in their path. Researchers use many different versions of this test and the procedure for each version can vary significantly. Here, we present a working protocol that enables the detection of traces of some toxic substances that may be exposed to individuals over a long period and in very small amounts under specific conditions such as drugs, medicines and pesticides.
Keywords: Classic labyrinth Behavior Learning Drugs Pesticides Rats
Background
We set out to elucidate how animals memorize and learn when they are challenged with stress utilizing the classical labyrinth test. The CLT is performed in a square-shaped plastic enclosure (125 x 125 x 40 cm) with several labyrinth passages of identical width and height (25 x 35 cm), but with variable length (Figure 1). Usually, this labyrinth is placed on a table 90 cm high. Control rats can quickly move through the labyrinth between the starting point and the ending point. When the animal explores the maze, it increases the time it spends in the maze's passages, which will be considered as aversive or anxiety-provoking for the stressed animal; while the leak behavior will be observed when the animal spends more time in the starting point or corners, which will be associated with a refuge (Leo and Pamplona, 2014; Gasmi et al., 2017b). There are many tests similar to this test, but this test is unique because it is concerned with measuring the impact of environmental pollutants on the behavior and psychology of animals, especially rats (Serchov et al., 2016). Some advantages of this approach are that this test is inexpensive, and it is quick; the test usually takes about 10 min, and after cleaning the labyrinth with 70% ethanol, it can be used to test the next animal (Gasmi et al., 2017a and 2018).
Materials and Reagents
Paper towels
Laboratory rats (3 months old and weight between 200 and 240 g)
The rats are housed in groups of 4 per cage and kept in an environment with temperature (23 ± 2 °C) and humidity control. The animals have a 12-12 h light-dark cycle and food and water ad libitum.
Ethanol (70%) for cleaning (CID: 702)
Plastic sheets (PVC wall panel) (Dacheng, model: DCb-008 )
Adhesive glue for plastics (SG300-05)
Equipment
Home cage (Tecniplast, catalog number: 1291H001, EUROSTANDARD TYPE III H, 425 x 266 x 185 mm)
Classic Labyrinth for rats [a square shaped plastic enclosure (125 x 125 x 40 cm) with several labyrinth passages of identical width and height (25 x 35 cm) but variable length according to the crossing. This Labyrinth can be assembled manually as shown in Figure 1, where it is made of white plastic sheets. These plates are smooth and solid and should be easy to clean and unbreakable or damaged by the animal. The maze is formed at 125 x 125 x 40 cm by welding the plastic sheets together with adhesive glue. According to Figure 1, after the maze is made, it is placed on a wooden table 90 cm high on the ground (Figure 1)]
USB Camera Lenses (ITEM: 60528/ Lens for 60516, Vari-focal, 2.8-12 mm)
Note: It was placed directly in the middle above the Labyrinth at the height of 1.20 m so that only the labyrinth was exposed.
Chronometer (LCD Digital Portátil Reloj Alarma Temporizador by SYMTOP)
Figure 1. Classic Labyrinth and its dimensions
Software
Ethovision video tracking system software (version 10, Noldus Information Technology, France)
Microsoft Excel (Microsoft Corp® 2016, USA)
Minitab (Minitab® version 17.1, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gasmi, S. (2018). Classic Labyrinth Test for Neurobehavioral Evaluation in Wistar Rats. Bio-protocol 8(18): e3007. DOI: 10.21769/BioProtoc.3007.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,008 | https://bio-protocol.org/exchange/protocoldetail?id=3008&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Behavioral Assay to Examine the Effects of Kavalactones on Caenorhabditis elegans Neuromuscular Excitability
BK Bwarenaba B. Kautu*
JC Jessie Chappel*
KS Kellie Steele
JP Juliana Phillips
MM M. Shawn Mengarelli
*Contributed equally to this work
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3008 Views: 4489
Edited by: Pengpeng Li
Reviewed by: Narayan SubramanianManish Chamoli
Original Research Article:
The authors used this protocol in Jun 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2017
Abstract
Kavalactones are a class of lactone compounds found in Kava, a traditional beverage from the South Pacific Islands that is derived from the root of Piper methysticum. When consumed, these compounds produce sedative and anxiolytic effects, suggesting their potent actions on the nervous system. Here, we provide a protocol to examine the effects of kavalactones on C. elegans neuromuscular excitability. Our methodology could provide insight into the neurophysiological actions of kavalactones.
Keywords: Kava Kavalactones Lactone C. elegans Neuromuscular Pacific Beverage
Background
Kava, a tranquilizing beverage from the Pacific Islands, has been consumed by Pacific Islanders for centuries (Rowe et al., 2011; Kautu et al., 2017). Kava contains a group of lipophilic compounds called kavalactones, which are believed to be responsible for the sedative, anxiolytic, and other therapeutic effects of the drink (Rowe et al., 2011; Savage et al., 2015; Kautu et al., 2017). Here, we provide a protocol to examine the effects of kavalactones on neuromuscular activity, using C. elegans as a model system (Kautu et al., 2017). In our assay, we showed that administration of aqueous kavalactone solution induced epileptic-like convulsions and paralysis in a dose-responsive manner. These manifestations are suggestive of the modulatory actions of kavalactones on the neuromuscular junction. Thus, our protocol could provide important insight into the neurophysiological actions of kavalactones.
Materials and Reagents
Petri dishes, sterile (Carolina Biological Supply, catalog number: 741248 )
2 ml centrifuge tubes (Thomas Scientific, catalog number: 111572LK )
P1000 pipette tips, sterile (Carolina Biological Supply, catalog number: 215060 )
P200 pipette tips, sterile (Carolina Biological Supply, catalog number: 215050 )
0.5 L bottle
E. coli OP50 (Carolina Biological Supply, catalog number: 155073 )
C. elegans N2 (wild-type)
Kava pills (Gaia Herbs, catalog number: 90A10060 )
NaCl (Sigma-Aldrich, CAS: 7647-14-15)
Peptone (Sigma-Aldrich, catalog number: 70176-100G )
Difco Bacto agar (Carolina Biological Supply, catalog number: 156783B )
CaCl2 dihydrate (Fisher Scientific, catalog number: C79 500 )
MgSO4 (Sigma-Aldrich, CAS: 7487-88-9)
Potassium Phosphate Monobasic (KH2PO4) (Sigma-Aldrich, CAS: 7778-77-0)
Potassium Phosphate Dibasic (K2HPO4) (Sigma-Aldrich, CAS: 7758-11-4)
Cholesterol (Fisher Science Education, CAS: 57-88-5)
Hypochlorite solution (Sigma-Aldrich, CAS: 7681-52-9)
NaOH (Sigma-Aldrich, CAS: 1310-73-2)
95% ethanol (Sigma-Aldrich, CAS: 64-47-5)
1 M CaCl2 stock solution (see Recipes)
1 M MgSO4 stock solution (see Recipes)
1 M Potassium Phosphate stock solution (pH 6) (see Recipes)
5 mg/ml Cholesterol stock (see Recipes)
Nematode Growth Medium (NGM) Agar plates (see Recipes)
Bleach sodium hypochlorite solution (see Recipes)
Kava stock solution (5 mg/ml) (see Recipes)
Equipment
P200 and P1000 micropipette
Sharp Edged Scissors
Autoclave
Bench-top Micro Centrifuge (Oxford Lab Products, model: C12V )
Meiji EMT Stereomicroscope on PBH Stand (Meiji Techno, models: EMT-1 , PBH Stan d, MA502 )
Microscope Digital Camera (OMAX Microscope, catalog number: A3550UPA-R75 )
Platinum wire worm pick (Genesee Scientific, catalog number: 59-AWP )
Sterile incubator
Software
OMAX ToupView 3.7
Microsoft Office 2010 Excel (Microsoft Corporation, Redmond, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kautu, B. B., Chappel, J., Steele, K., Phillips, J. and Mengarelli, M. S. (2018). A Behavioral Assay to Examine the Effects of Kavalactones on Caenorhabditis elegans Neuromuscular Excitability. Bio-protocol 8(18): e3008. DOI: 10.21769/BioProtoc.3008.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,009 | https://bio-protocol.org/exchange/protocoldetail?id=3009&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sendai Virus Propagation Using Chicken Eggs
NT Narihito Tatsumoto
MA Moshe Arditi
MY Michifumi Yamashita
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3009 Views: 5807
Edited by: Longping Victor Tse
Reviewed by: Masfique MehediGeorge William Carnell
Original Research Article:
The authors used this protocol in Jul 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2012
Abstract
Sendai virus is a member of the family Paramyxoviridae, and an enveloped virus with a negative-stranded RNA genome. Sendai virus is not pathogenic to humans, but for mice and can cause pneumonia in mice. Easy and efficient techniques for propagating Sendai virus are required for studying virus replication, virus-induced innate- and adaptive-immunity, Sendai-virus-based virotherapy and IgA nephropathy. Here, we describe a protocol for Sendai virus propagation using chicken eggs. This traditional protocol enables us to generate a large amount of virus enough for animal experiments as well as cell culture experiments in a relatively inexpensive way.
Keywords: Sendai virus Chicken eggs Propagation Harvest Allantoic fluid Mouse parainfluenza virus
Background
Sendai virus (SeV) is a mouse parainfluenza virus type 1 that was discovered in Sendai, Japan, in the 1950s (Ishida and Homma, 1978). The virus was once named Hemagglutinating Virus of Japan (HVJ) by the Japanese Society for Virology, but was later termed ‘newborn virus pneumonitis (type Sendai)’ (Kuroya and Ishida, 1953). The name SeV is currently most popular, and now understood to be a pathogen of mice, not humans (Karron RA, 2007). Fukumi et al. first described SeV infections of mice in 1954 (Fukumi et al., 1954). This infection can be subclinical, but SeV is also known as one of the leading causes of pneumonia in certain mouse strains (Fukumi et al., 1954; Parker et al., 1978). SeV is an excellent tool to study the following in the various fields: the pathomechanism of a murine model of IgA nephropathy (Yamashita et al., 2007; Chintalacharuvu et al., 2008), a stimulator of RIG-I/MDA5 in innate immunity (Fensterl et al., 2008; Chattopadhyay et al., 2010, 2011 and 2013; Yamashita et al., 2012a, 2012b and 2013), oncolytic SeV-based virotherapy (Saga and Kaneda, 2015), a respiratory infection (Hermesh et al., 2010 and 2012), and a vector for AIDS vaccine (Ishii and Matano, 2015). SeV is uniquely sensitive to interferon-associated responses, and grows to high titers in both chicken eggs and in FDA-approved mammalian cell lines, an advantage for vaccine production. This protocol provides a method for SeV propagation using chicken eggs. This method can be applied for viral propagation for other viruses such as influenza virus.
Materials and Reagents
3 ml disposable transfer pipette (Bioland Scientific, catalog number: TPP02-11 )
Centrifuge bottles, 250 ml (Fisher Scientific, catalog number: 05-564-1)
Manufacturer: Thermo Fisher Scientific, catalog number: 3141-0250 .
Bucket with ice
25 G 5/8 needle (Fisher Scientific, catalog number: 14-826AA)
Manufacturer: BD, catalog number: 305122 .
1 ml syringes (BD, catalog number: 309659 )
18 G needle (Fisher Scientific, catalog number: 14-826-5G)
Manufacturer: BD, catalog number: 305195 .
50 ml syringe (Fisher Scientific, catalog number: 14-955-461 )
Pencil
Push pin (Staples, catalog number: 480117 )
Face mask (Cellucap Manufacturing, catalog number: 1826EL )
Iodine Wipes (Dynarex, catalog number: B003U463PY )
Egg holder/case (provided with embryonated eggs, or you can obtain regular ones from grocery store when you purchase regular/unembryonated eggs)
Chicken embryonated eggs (48 eggs, 9-10 days old) (Charles River, catalog number: 10100332 )
Duco® Cement Multi-Purpose Household Glue (ITW Consumer, Duco Cement, catalog number: 62435 )
Sendai virus stock (ATCC, catalog number: VR-105 or catalog number: VR-907 )
PBS with Ca2+ and Mg2+ (Thermo Fisher Scientific, catalog number: 14040133 )
70% ethanol
Bleach (Essendant, catalog number: CLO30966CT )
0.5 M EDTA (Thermo Fisher Scientific, catalog number: R1021 )
Equipment
Pipette (200 μl and 1,000 μl; any products are fine)
Biosafety cabinet (any types are fine if it is BSL2 level)
1 L Graduated cylinder (Thermo Fisher Scientific, catalog number: 3664-1000 )
Egg Incubator (up to 41 eggs; Farm Innovators, Digital Circulated Air Incubator with Auto Egg Turner, model: 4250 )
Refrigerator/4 °C cold room
High-speed Centrifuge with fixed-angle rotor of 250 ml bottles (Beckman Coulter, model: Avanti® J-E )
Sonic water bath (Skymen Cleaning Equipment, model: JP-008 )
Flashlight (Defiant, catalog number: HD15FL04-3 or Caliburn Lighting, catalog number: PISTOL-TRIPOD-RCH )
Scissors (World Precision Instruments, catalog number: 14192-G )
Forceps (World Precision Instruments, catalog number: 501974 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tatsumoto, N., Arditi, M. and Yamashita, M. (2018). Sendai Virus Propagation Using Chicken Eggs. Bio-protocol 8(18): e3009. DOI: 10.21769/BioProtoc.3009.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Virus propagation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
301 | https://bio-protocol.org/exchange/protocoldetail?id=301&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Standard 4-hours Chromium-51 (51Cr) Release Assay
JG Julie Gertner-Dardenne
Published: Vol 2, Iss 23, Dec 5, 2012
DOI: 10.21769/BioProtoc.301 Views: 22652
Original Research Article:
The authors used this protocol in May 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2012
Abstract
51Cr-release assays are commonly used for the precise and accurate quantification of cytotoxicity, particularly in the study of tumor cytolysis. This test has the advantage of requiring only very few cells.
Materials and Reagents
Target cells: Acute Myeloid Leukemia (AML) cell line (U937 or HL60 from ATCC) or AML cells isolated from patients with AML
Effector cells: γδ T cells isolated from Healthy volunteer provided by Etablissement
Francais du Sang (EFS) or patients
Medium : RPMI 1640 (Life Technologies, Gibco®)
Fetal Calf Serum (FCS) heat-inactivated 1 h at 56 °C
Chromium-51 (51Cr, 5 mCi/ml) (PerkinElmer)
Complete medium = RPMI 1640 medium supplemented with 10% heat-inactivated FCS
Equipment
Centrifuge for microplates
Microplates (96 well round-bottom) for cell incubations
LumaPlateTM (PerkinElmer)
Liquid scintillation counter
Incubator
Controls
Spontaneous Release: Target cells were incubated alone (replace effector cells by 50 μl of media). After 4 h of incubation, wells were centrifuged and 50 μl of supernatant were recovered.
Maximum load: Target cells were incubated alone (replace effector cells by 50 μl of media). After 4 h of incubation, wells were mixed and 50 μl of cell suspension were recovered rather than disrupt the cell membrane to release the radioactivity into the supernatant). This avoids the use of detergent.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gertner-dardenne, J. (2012). Standard 4-hours Chromium-51 (51Cr) Release Assay. Bio-protocol 2(23): e301. DOI: 10.21769/BioProtoc.301.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Cytotoxicity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,010 | https://bio-protocol.org/exchange/protocoldetail?id=3010&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fabrication and Use of the Dual-Flow-RootChip for the Imaging of Arabidopsis Roots in Asymmetric Microenvironments
Claire E. Stanley
JS Jagriti Shrivastava
RB Rik Brugman
EH Elisa Heinzelmann
VF Viktoria Frajs
AB Andreas Bühler
Dirk van Swaay
GG Guido Grossmann
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3010 Views: 8039
Edited by: Tie Liu
Reviewed by: Jonathan GilkersonArun Shunmugam
Original Research Article:
The authors used this protocol in Feb 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2018
Abstract
This protocol provides a detailed description of how to fabricate and use the dual-flow-RootChip (dfRootChip), a novel microfluidic platform for investigating root nutrition, root-microbe interactions and signaling and development in controlled asymmetric conditions. The dfRootChip was developed primarily to investigate how plants roots interact with their environment by simulating environmental heterogeneity. The goal of this protocol is to provide a detailed resource for researchers in the biological sciences wishing to employ the dfRootChip in particular, or microfluidic devices in general, in their laboratory.
Keywords: Dual-flow-RootChip Lab-on-a-chip Environmental sensing Calcium signaling Root development Root hairs Cell-cell communication Microfluidics Plant-microbe interactions
Background
Conditions belowground are highly heterogeneous and dynamic, hence plant roots are exposed to various stimuli and consequently have to adapt to this complex environment. Despite the importance of these developmental adaptations, the underlying mechanisms still remain to be elucidated. Microfluidic devices have proven useful to cultivate specimens in controlled microenvironments and facilitate access for live imaging of dynamic processes from the subcellular to the organismic level (Crane et al., 2010). Thanks to the possibilities of microfluidics to manipulate small fluid volumes in a controlled manner, conduct experiments in high-throughput, extract quantitative information and perform time-lapse measurements, microfluidic devices have found their way into organismal studies. For the model plant Arabidopsis thaliana, a series of microfluidic devices have been developed that enable the monitoring of gene expression during root development (Busch et al., 2012), signaling events (Keinath et al., 2015) and sensor-based imaging of nutrient uptake (Grossmann et al., 2011; Lanquar et al., 2014). Additionally, more recent advances using microfluidic platforms have included high-resolution phenotyping (Jiang et al., 2014; Xing et al., 2017) and the investigation of root-microbe interactions (Parashar and Pandey, 2011; Massalha et al., 2017). While the root microenvironment can be precisely controlled in these perfusion devices, environmental complexity, a hallmark of natural root environments, was challenging to simulate (Stanley et al., 2016; Stanley and van der Heijden, 2017). The dfRootChip was therefore developed to enable the study of single Arabidopsis roots in asymmetric microenvironments at the cellular level to investigate gene expression, signaling and development (Stanley et al., 2018). Importantly, the dfRootChip can be implemented in a range of applications, which include performing localized treatments with drugs, differential nutrient or stress conditions, probing host-microbe interactions (e.g., pathogenic and beneficial interactions, potential biocontrol agents), and investigating root physiology and root hair development.
The current protocol was developed to provide fundamental know-how to researchers wishing to implement this platform. This protocol therefore provides a detailed explanation of how to fabricate the dfRootChip, using photo- and soft lithography, and how to cultivate Arabidopsis seedlings within the dfRootChip. Due to the wide applicability of microfluidics in biology, a number of steps in this protocol will also aid the fabrication and handling of other device designs. Furthermore, this protocol illustrates how the dfRootChip can be utilized in three different experimental settings. Specifically, we highlight how to perform (i) symmetric and asymmetric root treatments over longer time-periods (hours to days), (ii) localized inoculation of plant roots with bacteria and (iii) rapid asymmetric treatments with the dfRootChip. We exemplify these applications by utilizing different phosphate treatments, the bacterium Pseudomonas fluorescens and a calcium elicitor treatment respectively.
Materials and Reagents
Note: Catalog numbers are provided for commercial, non-custom-made products (see Note 1).
Polyester film photolithography mask (Micro Lithography Services Ltd. UK, custom-made)
100 mm silicon wafers (Silicon Materials)
SU8 3050 photoresist (MicroChem)
Plastic cups (Semadeni, catalog number: 8323 )
Plastic spatulas (Semadeni, catalog number: 3340 )
Glass coverslips, 75 mm x 50 mm, No. 1 (Th. Geyer, catalog number: 11678524 )
Cutting blades (Häberle Labortechnik, catalog number: 9156110 )
Scotch® MagicTM Invisible tape (3M)
Microcentrifuge tubes 1.5 ml (Eppendorf Safe-Lock, Eppendorf, catalog number: 0030120086 )
Sterilised filter tips 100-1,000 μl (Pipetman Diamond Tips D1000ST, Gilson, catalog number: F171501 )
0.2 μm sterile syringe filters (Lab Logistic Group, catalog number: 9.055 511 )
Sterilised filter tips 0.1-20 μl (Pipetman Diamond Tips DL10ST, Gilson, catalog number: F171201 )
Sterilised filter tips 2-200 μl (Pipetman Diamond Tips D200ST, Gilson, catalog number: F171301 )
94 mm diameter sterile Petri dishes (HUBERLAB, catalog number: 7.663 161 )
Parafilm® (Bemis, HUBERLAB, catalog number: 15.1550.01 )
Silicone tubing (TYGON® 0.020” ID x 0.062” OD; type ND-100-80) (Th. Geyer, catalog number: AAD04103 )
Gauge 23 dosage needles with Luer lock fitting (Gonano Dosiertechnik, catalog number: IP423050-EAR-BULK )
Syringes 20 ml (VWR, BD PlastipakTM, catalog number: 613-3922 )
Rotilabo-screw neck ND24 vials (Carl Roth, catalog number: LC88.1 )
Screw caps with bore hole (Carl Roth, catalog number: LC97.1 )
Septa Ø 22 mm, ND24, 1.6 mm, 55° (Carl Roth, catalog number: LC98.1 )
Mini 3-way stopcock, 2 x Luer female, 1 x Luer male (NeoLab, catalog number: 270124190 )
Male-male luer connectors (Vygon, catalog number: 893.00 )
Polystyrene cuvettes (SARSTEDT, catalog number: 67.742 )
120 x 120 mm2 Petri dishes, sterile (Carl Roth, catalog number: PX67.1 )
Aluminum foil (can be purchased from any supermarket)
Arabidopsis thaliana seeds; lines are chosen based on individual needs
Optional: Pseudomonas fluorescens WCS365-GFP strain (Haney et al., 2015)
mrDev-600 developer solution (Micro Resist Technology)
Isopropyl alcohol [(CH3)2CHOH] (Sigma-Aldrich, catalog number: W292907 )
Chlorotrimethylsilane [(CH3)3SiCl] (Sigma-Aldrich, catalog number: 92361 )
Sylgard 184 Kit [Poly(dimethylsiloxane), PDMS] (Biesterfeld Helvetia, catalog number: 5498840000 )
Acetone (CH3COCH3) (Sigma-Aldrich, catalog number: 00560 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 71687 )
Ethanol (EtOH) (Sigma-Aldrich, catalog number: 51976 )
Deionised water, purified by reverse osmosis or ultrafiltration; referred to as "purified water" below
Sodium hypochlorite 14% Cl2 in aqueous solution (NaClO) (VWR, catalog number: 90350.5000 )
Micro agar (Duchefa Biochemie, catalog number: M1002.1000 )
Hoagland’s No. 2 Basal Salt Mixture (Sigma-Aldrich, catalog number: H2395-10L )
MES hydrate (C6H13NO4S•xH2O) (Sigma-Aldrich, catalog number: M8250 )
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: P5958 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Potassium dihydrogen phosphate (KH2PO4) (AppliChem, catalog number: A3620 )
Magnesium sulfate heptahydrate (MgSO4•7H2O) (Merck, catalog number: 1.05886.1000 )
Potassium nitrate (KNO3) (Sigma-Aldrich, catalog number: 31263 )
Ethylenediaminetetraacetic acid disodium salt dihydrate (Na2EDTA•2H2O) (AppliChem, catalog number: A3553 )
Calcium nitrate tetrahydrate (Ca(NO3)2•4H2O) (Sigma-Aldrich, Fluka, catalog number: 21197 )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: B6768 )
Copper(II) sulfate pentahydrate (CuSO4•5H2O) (Grüssing, catalog number: 12079 )
Zinc sulfate (ZnSO4) (Sigma-Aldrich, catalog number: Z1001 )
Sodium molybdate (Na2MoO4) (Sigma-Aldrich, catalog number: 243655 )
Manganese chloride dihydrate (MnCl2•2H2O) (Grüssing, catalog number: 12097 )
Cobalt(II) chloride hexahydrate (CoCl2•6H2O) (Carl Roth, catalog number: T889 )
Potassium chloride (KCl) (AppliChem, catalog number: A3582 )
Luria Bertani broth (Sigma-Aldrich, catalog number: L3022 )
Kanamycin sulfate (Carl Roth, catalog number: T832.3 )
½x Hoagland’s medium (½x HM) (see Recipes)
½x Hoagland’s agar medium (see Recipes)
Phosphate rich medium (see Recipes)
Phosphate deficient medium (see Recipes)
Lysogeny broth (LB) medium (see Recipes)
100 mM salt solution (see Recipes)
Equipment
Duran® laboratory bottles 500 ml (DWK Life Sciences, DURAN, catalog number: 21 801 44 5 )
Duran® laboratory bottles 1,000 ml (DWK Life Sciences, DURAN, catalog number: 21 801 54 5 )
Metal pins (New England Small Tube, catalog number: NE-1310-02 )
Schott® culture tubes, 160 mm x 16 mm (DWK Life Sciences, DURAN, catalog number: 26 135 21 5 )
Compressed air (Oil-free compressor, 9 L, 8 bar) (e.g., IMPLOTEX, catalog number: NEW-325 )
Glass beakers (HUBERLAB, catalog number: 9.0112.43 )
Forceps (VWR, RGS Solingen, catalog number: 232-0078 )
Precision air regulator (Ashcroft, Ingersoll-Rand, catalog number: PR4021200 )
250 ml Erlenmeyer flask (Sigma-Aldrich, DWK Life Sciences, DURAN, catalog number: Z232815 )
Spatula (HUBERLAB, catalog number: 13.1556.05 )
Vortex (HUBERLAB, catalog number: 17.1378.01 )
Pipettes (Pipetman classic P1000, Gilson, catalog number: F123602 )
Pipettes (Pipetman classic P200, Gilson, catalog number: F123601 )
Pipettes (Pipetman classic P10, Gilson, catalog number: F144802 )
pH meter (Mettler-Toledo International, model: FiveEasyTM FE20 )
Autoclave (Systec, model: VX-75 )
Drying oven (SalvisLab, model: VC 20 )
Standard refrigerator (4-6 °C)
Biosafety cabinet equipped with UV (Kojair, model: Kojair® SilverLine BlueSeries 200 )
Precision balance (Mettler-Toledo International, model: PB3001 )
Analytical balance (Mettler-Toledo International, model: AB104-S/FACT )
Spin coater (SAWATEC, model: SM-180-BM )
Hot plate (SAWATEC, model: HP 160 III BM )
125 mm x 125 mm x 2 mm soda lime glass plate (Willi Möller)
Mask aligner (Karl Süss, model: MA6 )
Custom-made plastic chip holder (frame with an aperture for the RootChip and outer dimensions that fit the microscope stage)
Incubator (Memmert, model: UM400 )
Incubator with flask shaker (Eppendorf, New BrunswickTM, model: Innova® 44 )
Wet bench with filtered laminar air flow (Goller Reinraum)
Spin coater (Laurell Technologies, model: WS-650-23 )
Utility knife
Hole puncher (Syneo, model: Accu-Punch MP10 )
Hole punch (cutting edge diameter, 0.71 mm) (Syneo, catalog number: CR0350255N20R4 )
Hole punch (cutting edge diameter, 1.02 mm) (Syneo, catalog number: CR0500355N18R4 )
Hole punch (cutting edge diameter, 4.75 mm) (Syneo, catalog number: HS1871730P1183S )
Ultrasonic cleaner (BANDELIN electronic, catalog number: 301 )
Plasma cleaner (Diener electronic, model: FEMTO40kHZ )
Vacuum pump (Pfeiffer Vacuum, catalog number: PK D56 712 )
Vacuum desiccator (Thermo Fisher Scientific, catalog number: 5311-0250 )
Centrifuge (Thermo Fisher Scientific, model: HeraeusTM PicoTM 21 , catalog number: 75002553)
Climate chamber (Panasonic, PHC, model: MLR-352H )
Stratalinker® UV crosslinker (Stratagene, model: 1800 , catalog number: 400071)
Syringe pumps (World Precision Instruments, model: AL-6000 )
Stereo microscope (Nikon, model: SMZ1270 )
Spectrophotometer (GE Healthcare, NovaspecTM Plus, catalog number: 80-2117-50 )
Inverted microscope (any model, specific to user and application)
Optional: source of pressurized, clean, dry air
Software
AutoCAD Mechanical 2011 (AutoDesk, USA)
Fiji (Schindelin et al., 2012)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Stanley, C. E., Shrivastava, J., Brugman, R., Heinzelmann, E., Frajs, V., Bühler, A., van Swaay, D. and Grossmann, G. (2018). Fabrication and Use of the Dual-Flow-RootChip for the Imaging of Arabidopsis Roots in Asymmetric Microenvironments. Bio-protocol 8(18): e3010. DOI: 10.21769/BioProtoc.3010.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Nutrition
Plant Science > Plant developmental biology > Morphogenesis
Cell Biology > Cell imaging > Microfluidics
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,011 | https://bio-protocol.org/exchange/protocoldetail?id=3011&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Quantification of Polyphosphate (polyP) from Gram-negative Bacteria
JD Jan-Ulrik Dahl*
LX Lihan Xie*
UJ Ursula Jakob
*Contributed equally to this work
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3011 Views: 5759
Edited by: Valentine V Trotter
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Polyphosphate (polyP), a universally conserved biomolecule, is composed of up to 1,000 phosphate monomers linked via phosphoanhydride bonds. Reaching levels in bacteria that are in the high nmoles per mg protein range, polyP plays important roles in biofilm formation and colonization, general stress protection and virulence. Various protocols for the detection of polyP in bacteria have been reported. These methods primarily differ in the ways that polyP is extracted and/or detected. Here, we report an improved method, in which we combine polyP extraction via binding to glassmilk with a very sensitive PolyP kinase/luciferase-based detection system. By using this procedure, we significantly enhanced the sensitivity of polyP detection, making it potentially applicable for mammalian tissues.
Keywords: Polyphosphate PolyP extraction method PolyP quantification Luciferase-based ATP quantification Bacterial virulence Bacterial stress response
Background
Polyphosphate (polyP), a biopolymer composed of linear chains of up to 1,000 inorganic phosphate monomers, is found in cells of all three domains of life. Yet, bacteria are the only organisms for which the enzymes of polyP metabolism have been well studied. Bacterial polyP kinase (PPK), which converts ATP into polyP, catalyzes both forward and reverse reactions. While synthesis of polyP is clearly the favored reaction in the cell, by providing sufficient amounts of ADP in vitro, the enzyme can be used to generate ATP from polyP, making a luciferase-based ATP detection possible (Ault-Riché et al., 1998). Bacteria lacking PPK are defective in biofilm formation, motility, persistence, and various stress responses, and show significantly increased sensitivity towards hypohalous acids (i.e., bleach) stress or phosphate starvation (Figure 1) (Rao et al., 2009; Gray et al., 2014; Maisonneuve and Gerdes, 2014; Gray and Jakob, 2015; Groitl et al., 2017).
Figure 1. Synthesis of polyP and its role in Gram-negative Bacteria. The bacteria-specific polyphosphate kinase (PPK) reversibly catalyzes the conversion from ATP into polyP and ADP. Various functions for polyP have been described in Gram-negative bacteria, including its involvement in biofilm formation, colonization, motility, and formation of antibiotic-resistant persister cells. PolyP also contributes to the resistance of bacteria towards various stresses, including oxidative stress and starvation, and serves as metal chelator and Pi reservoir.
Given the many roles that polyP plays in Gram-negative bacteria, PPK became attractive as drug target to interfere with biofilm formation, make bacteria less persistent, and sensitize them towards physiological oxidants such as bleach (Dahl et al., 2017). Therefore, reliable and sensitive methods to determine the polyP levels in vivo are necessary. Several methods for the extraction and detection of polyP have been reported in Bio-protocol, including extraction of polyP with (i) perchloric acid, (ii) sodium hypochlorite, and (iii) phenol/chloroform and detection of polyP via visualization with urea-PAGE or colorimetric assays using malachite green or molybdenum blue (Gomez Garcia, 2014; Canadell et al., 2016; Ota and Kawano, 2017). In this protocol, we combined extraction of polyP via binding to glassmilk (Ault-Riché et al., 1998) with a very sensitive two-step enzyme-based detection system. First, the extracted polyP is converted into ATP by E. coli PPK in the presence of ultra-pure ADP. The ATP levels are then quantified using a luciferase-based detection system and corrected for cellular ATP. In comparison to the urea-PAGE or the colorimetric methods, the luciferase-based detection allows the quantification of much lower levels of polyP. This protocol has been successfully applied to quantify polyP levels from Pseudomonas aeruginosa.
Materials and Reagents
Microcentrifuge tubes, 1.5 ml, clear (BioExpress, catalog number: C-3260-1 )
Silica membrane spin columns (Epoch Life Science, EconoSpinTM, catalog number: 1920-250 )
TempPlate non-skirted 96-well PCR plate, low profile, natural (USA Scientific, catalog number: 1402-9500 )
96-well plate solid white (Corning, catalog number: 3912 )
96-well plate clear flat bottom (Corning, catalog number: 3596 )
Bradford reagent (Bio-Rad Laboratories, catalog number: 5000006 )
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A3059-100G )
Tris (Fisher Scientific, catalog number: BP152-5 )
Ultra-pure ADP (Cell Technology, catalog number: ADP100-2 )
E. coli polyphosphate kinase (PPK) (for expression and purification of E. coli PPK, see Gray et al., 2014)
Dithiothreitol (DTT), > 99% pure, protease-free (Gold Biotechnology, catalog number: DTT25 )
Sodium-dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771-1KG )
95% v/v Ethanol
QuantiLum® Recombinant Luciferase (Promega, catalog number: E1701 ; exact concentration of aliquots may vary)
Notes:
Prepare aliquots of the enzyme and store in small glass vials at -80 °C.
Thaw and use the enzyme for each experiment.
Discard all unused product.
Do not subject to freeze-thaw cycles.
Guanidine thiocyanate (Sigma-Aldrich, catalog number: G6639-250G )
Silicon dioxide (Sigma-Aldrich, catalog number: S5631 )
NaCl (Fisher Scientific, catalog number: S271-10 )
EDTA (Fisher Scientific, catalog number: BP120-500 )
HEPES (pH 7.5) (Fisher Scientific, catalog number: BP310-100 )
Ammonium sulfate (Fisher Scientific, catalog number: A702-500 )
Tricine buffer (pH 7.8) (Sigma-Aldrich, catalog number: T0377 )
MgSO4 (Thermo Fisher Scientific, catalog number: M63500 )
Sodium azide (MP Biomedicals, catalog number: 210289125 )
Luciferin (Biotium, catalog number: 10101-1 )
Glycylglycine (pH 7.8) (MP Biomedicals, catalog number: 210185610 )
ddH2O
Hydrochloric acid (Fisher Scientific, catalog number: A144212 )
GITC lysis buffer (see Recipes)
Glassmilk (see Recipes)
New Wash (NW-) Buffer (see Recipes)
Elution Buffer (see Recipes)
PPK buffer (see Recipes)
Luciferase reaction buffer (see Recipes)
Luciferin working solution (see Recipes)
Equipment
Eppendorf Pipettes: 100-1,000 μl, 20-200 μl, 2-20 μl, 1-10 μl
Thermomixer (Eppendorf, model: 5350 )
Microcentrifuge (Eppendorf, model: 5415D )
Incubator 37 °C (VWR, model: 1555 )
-80 °C Freezer (Eppendorf, New BrunswickTM, model: Innova® U725 , catalog number: U9440-0002)
Fluostar Omega Plate Reader with luminescence reading function and injector module (BMG Labtech, catalog number: 0415-102 )
pH meter
Vortexer
Refrigerator (4 °C)
Software
Fluostar Omega Control and Evaluation Software (BMG Labtech, catalog number: 1300-501)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Dahl, J. U., Xie, L. and Jakob, U. (2018). Extraction and Quantification of Polyphosphate (polyP) from Gram-negative Bacteria. Bio-protocol 8(18): e3011. DOI: 10.21769/BioProtoc.3011.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Microbiology > Microbial physiology > Stress response
Biochemistry > Other compound > Polyphosphate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,012 | https://bio-protocol.org/exchange/protocoldetail?id=3012&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Identifying Protein Interactions with Histone Peptides Using Bio-layer Interferometry
Bingbing Ren*
Ahmed Mahmoud Mohammed Sayed*
Hwei Ling Tan*
Yu Keung Mok
Ee Sin Chen
*Contributed equally to this work
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3012 Views: 7211
Reviewed by: Anna Vangone
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
Histone post-translational modifications (PTMs) regulate numerous cellular processes, including gene transcription, cell division, and DNA damage repair. Most histone PTMs affect the recruitment or exclusion of reader proteins from chromatin. Here, we present a protocol to measure affinity and interaction kinetics between histone peptides and the recombinant protein using Bio-layer interferometry.
Keywords: Histone post-translational modification Peptide Recombinant protein Protein interaction Bio-layer interferometry Biosensor Label free
Background
Eukaryotic chromatin structure is broadly divided into euchromatin and heterochromatin (Cheung and Lau, 2005), with heterochromatin structure further subdivided depending on the combination of histone post-translational modifications (PTMs). These PTMs alter not only the chromatin conformation but also establish direct regulatory roles in gene expression and protein recruitment (Felsenfeld and Groudine, 2003; Allshire and Madhani, 2017). Myriad combinations of histone PTMs–including acetylation, phosphorylation, methylation, ubiquitination, biotinylation, sumoylation, and proline isomerization, collectively known as the “histone marks”–can be found, particularly on the unstructured N-terminal tail protruding from the nucleosomal core (Guetg and Santoro, 2012). These PTMs regulate numerous cellular processes, including gene transcription, cell division, and DNA damage repair (Suganuma and Workman, 2011), through the activities of different “readers” or effector proteins (Musselman et al., 2012). Thus, large efforts have been made to identify the readers for histone modifications.
Studying the interactions between reader proteins and their target histone PTMs using conventional methods (e.g., surface plasmon resonance [SPR] and SPR imaging [SPRi] biosensors) often requires large amounts of substrates or complex, multistep experimental methods, and is complicated by the various method-specific limitations. These concerns preclude the ease and accuracy of quantifying the strength of an interaction (Phizicky and Fields, 1995; Berggard et al., 2007; Rowley and Corces, 2016; Wierer and Mann, 2016). In recent work, we employed bio-layer interferometry (BLI) octet methodology (Kamat and Rafique, 2017; Petersen, 2017) to elucidate the binding between fission yeast Swi6, the counterpart of the human heterochromatin protein 1, and dimethylated histone H3 lysine 9 (H3K9me2) in the presence or absence of a phosphorylation moiety on tyrosine 41 residue on the histone H3 N-terminus (Ren et al., 2018). BLI is an optical technique for real-time measurement of macromolecular interaction. This aim is achieved via the analysis of interference patterns of the white light that is reflected off the biosensor surface. In a typical BLI experiment, the ligand is immobilized on the biosensor tip and then allowed to interact with the analyte (for example, a protein). The binding of the analyte to the immobilized ligand will increase the thickness of the biological layer at the surface of the biosensor tip resulting in a shift in the interference pattern, which is then documented in real time.
Akin to SPRi biosensors, BLI sensors do not entail isotopic labeling. Label-free biosensors offer a significant advantage when studying PTM-reader interactions, as small modification groups–such as a label–could affect the binding affinity of specific reader proteins. The use of label-free biosensors thus avoids any bias generated using labels with a different molecular mass. Although BLI technology has some limitations where small-sized molecules are concerned, its high flexibility and robustness for the simultaneous analysis of multiple (96) independent analyte-ligand pairs offer significant advantages. The disposable biosensors also allow for ad hoc replacement and real-time re-loading of the analytes or ligand substrate arrays (Abdiche et al., 2008). The BLI technology uses a non-fluidic system of dipping the sensors into a well plate instead of delivering the sample liquid to the sensor. This change in sample delivery not only increases the robustness of the assay but also decreases the operating costs (Nirschl et al., 2011).
Here, we present a simple, quick, and highly sensitive method for the detection of protein interactions using a synthesized peptide as bait and a recombinant protein in the BLI octet approach, in the determination of interaction kinetics of a histone PTM (H3K9me2) with its reader protein (Swi6). The protocol below describes detailed procedures for bacterial expression, extraction, and purification of recombinant protein Swi6, followed by the set-up of BLI octet, detection of Swi6 interaction with biotinylated peptide (H3K9me2), and subsequent processing and analysis of the readout data.
Materials and Reagents
96-well black, flat-bottomed, polypropylene sample microplate (Geiner Bio One International, catalog number: 655209 )
Centrifuge tubes 50 ml, screw cap (Greiner Bio One International, catalog number: 227261 )
Microcentrifuge tubes 1.5ml (Eppendorf, catalog number: 0030120086 )
Ni-NTA spin column (QIAGEN, catalog number: 31014 )
E. coli BL21 (DE3) cells (Merck, Novagen®, catalog number: 69450-3 )
pET32a plasmid (Merck, Novagen®, catalog number: 69015 )
1 M IPTG (store at -20 °C) (Thermo Fisher Scientific, catalog number: R0392 )
1 mg/ml DNase I (store at -20 °C) (Sigma-Aldrich, catalog number: DN25 )
1 mg/ml RNase A (store at -20 °C) (Thermo Fisher Scientific, catalog number: EN0531 )
10 mg/ml Lysozyme (dissolved in 10 mM Tris-HCl, pH 8.0, store at -20 °C) (Sigma-Aldrich, catalog number: L6876 )
100 mg/ml Carbenicillin (stock at -20 °C) (Thermo Fisher Scientific, GibcoTM, catalog number: 10177012 )
1x PBS (dilution from 10x PBS) (Vivantis, catalog number: PB0344-1L )
2-Morpholinoethanesulfonic acid sodium salt (MES Na) (Merck, catalog number: 1.06197.0100 )
Bromophenol blue (Sigma-Aldrich, catalog number: B8026 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Glycerol (QRec, CAS: 56-81-5)
Biotin-labeled Histone peptides (Biotin labeling is done during synthesis) (Mimotopes) dissolved in 10% acetonitrile (50 μg/μl) (Merck, catalog number: 100029 )
Imidazole (Sigma-Aldrich, catalog number: I2399 )
KCl (Sigma-Aldrich, catalog number: P9541 )
KH2PO4 (Sigma-Aldrich, catalog number: P9791 )
Na2HPO4 (QRec, CAS: 10028-24-7)
NaCl (Merck, catalog number: 1.06404.0500 )
NaCl* (Sigma-Aldrich, catalog number: S9888 )
*Note: An alternative brand of NaCl is used for Recipes 1-3; 5-7.
NaH2PO4 (Sigma-Aldrich, catalog number: S3139 )
NaOH (Fisher Scientific, catalog number: S318 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Tris (Vivantis, catalog number: PR0612 ) or Tris base (Sigma-Aldrich, catalog number: T1503 )
Tryptone (BD, catalog number: 211705 )
Tween-20 (Sigma-Aldrich, catalog number: P1379 )
Yeast extract (BD, catalog number: 288620 )
β-mercaptoethanol (store at 4 °C) (Sigma-Aldrich, catalog number: M6250 )
LB liquid medium (see Recipes)
Phosphate buffer saline (10x PBS) (see Recipes)
Lysis buffer (store at room temperature) (see Recipes)
2x Sample buffer (store at room temperature) (see Recipes)
Wash buffer (store at 4 °C) (see Recipes)
Elution buffer (store at 4 °C) (see Recipes)
Exchange buffer (store at 4 °C) (see Recipes)
MES Assay buffer (see Recipes)
PBS Assay buffer (see Recipes)
TBS Assay buffer (see Recipes)
Equipment
Biosensors/Streptavidin (SA) Tray (PALL, FortéBio®, catalog number: 18-5019 )
FortéBIO® Octet RED96 System (PALL)
Heat block (Bio Laboratories, Elite dry bath incubator)
High-speed refrigerated centrifuge (TOMY DIGITAL BIOLOGY, model: MX-305 )
NanoDrop spectrophotometer (DeNovix, model: DS-11 )
PIPETMAN® Classic Pipettes P20, P200, P1000 (Gilson, catalog numbers: F123600 , F123601 , F123602 )
PierceTM Protein concentrator 10K MWCO (Thermo Fisher Scientific, catalog number: 88517 )
Shaker incubator (Eppendorf, New BrunswickTM, model: Innova® 44 incubator shaker, catalog number: M1282-0002)
Sonifier (Emerson Electric, model: Branson ultrasonic sonifier® 450A )
Software
Data acquisition software for Octet RED96 (v9.0) was purchased from PALL FortéBIO® Co. The software can be installed in other computers with Windows 7 (or above) operating system (OS) for data analysis. This software is however incompatible with MacIntosh OS.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ren, B., Sayed, A. M. M., Tan, H. L., Mok, Y. K. and Chen, E. S. (2018). Identifying Protein Interactions with Histone Peptides Using Bio-layer Interferometry. Bio-protocol 8(18): e3012. DOI: 10.21769/BioProtoc.3012.
Download Citation in RIS Format
Category
Molecular Biology > Protein > Protein-protein interaction
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,013 | https://bio-protocol.org/exchange/protocoldetail?id=3013&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessing Classical Olfactory Fear Conditioning by Behavioral Freezing in Mice
JR Jordan M. Ross
MF Max L. Fletcher
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3013 Views: 5120
Reviewed by: Andrew L. EagleArnau Busquets-Garcia
Original Research Article:
The authors used this protocol in May 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2018
Abstract
Classical fear conditioning typically involves pairing a discrete cue with a foot shock. Quantifying behavioral freezing to the learned cue is a crucial assay for neuroscience studies focused on learning and memory. Many paradigms utilize discrete stimuli such as tones; however, given mice are odor-driven animals and the wide variety of odorants commercially available, using odors as conditioned stimuli presents advantages for studies involving learning. Here, we describe detailed procedures for assembling systems for presenting discrete odor cues during single-day fear conditioning and subsequent analysis of freezing behavior to assess learning.
Keywords: Classical conditioning Olfactory conditioning Fear learning Behavior Freezing Olfactory fear
Background
Associative fear learning, the root of several anxiety disorders, involves pairing a neutral stimulus with an aversive outcome. This pairing produces robust behavioral fear responses, in the form of freezing (LeDoux, 2003), to the conditioned stimulus, which can be quantified as a measure of fear learning and memory. Discrete stimuli, such as tones, are often used as conditioned stimuli for fear conditioning; however, olfactory cues are also highly effective at inducing learned freezing (Pavesi et al., 2012; Ross and Fletcher, 2018). This method of associative fear learning differs from those utilizing predator odors, which produces instinctive behaviors rather than learned behaviors, making it ideal for rapidly assessing olfactory learning. Behavioral freezing, defined as absence of all voluntary movements (Blanchard and Blanchard, 1969; Fanselow, 1980), can be measured through automated software that compares pixel differences on a frame-by-frame basis. We developed a protocol that uses the automated FreezeFrame software to deliver discrete olfactory cues during training and testing. This protocol supports standard fear conditioning and subsequent testing but also provides flexibility for expansion to fit broad experimental needs such as extinction, discriminate conditioning, and generalization paradigms or experimental manipulations (e.g., optogenetics or chemogenetics). In addition, olfactory fear conditioning provides a rapid method of studying mechanisms of olfactory associative learning given that training requires few trials in a single day with learning assessed the next day.
Materials and Reagents
Parafilm
Tubing
1/16” ID Kflex tubing (United States Plastic, catalog number: 65170 )
1/16” ID Tygon tubing (Fisher Scientific, catalog number: 14-171-129 )
1/8” ID Masterflex Tygon E-Lab (E-3603) Pump Tubing (Cole-Parmer Instrument, catalog number: EW-06509-16 )
1/4” ID Tygon tubing (Fisher Scientific, catalog number: 14-171-221 )
Luers and connectors
Stopcock 1-way male lock (Cole-Parmer Instrument, catalog number: EW-30600-00 )
Male Luer x 1/16” hose barb (Cole-Parmer Instrument, catalog number: EW-45518-00 )
Male Luer Lock Plug (Cole-Parmer Instrument, catalog number: EW-30800-30 )
Female Luer x 1/8” hose barb (Cole-Parmer Instrument, catalog number: SI-30800-08 )
Masterflex Y-connector (Cole-Parmer Instrument, catalog number: EW-30614-04 )
Female Luer 1/16” x 1/16” hose barb (Cole-Parmer Instrument, catalog number: EW-45508-00 )
(2) 1/4” straight barbed connectors (Cole-Parmer Instrument, catalog number: EW-30612-13 )
1/8” NPT male adapter to 1/16” barb (Cole-Parmer Instrument, catalog number: EW-06365-41 )
1/8” NPT male adapter to 1/4” barb (Cole-Parmer Instrument, catalog number: EW-30704-09 )
1/2” NPT Male adapter to 1/4” Hose Barb (Cole-Parmer Instrument, catalog number: EW-30704-17 )
Pipette tips (Eppendorf, catalog numbers: 0030073061 , 0030073100 )
20 ml glass scintillation vial with polypropylene cap (Sigma-Aldrich, catalog number: Z190535 )
16 G 1½ needle (Surgo Surgical Supply, catalog number: 150-305198)
Manufacturer: BD, catalog number: 305198 .
Mice (C57BL/6J; THE JACKSON LABORATORY, catalog number: 000664 ), preferably > 6 weeks old
Notes:
This protocol is suitable for use with other strains, but we recommend users test and determine suitability with their strains.
If using fear conditioning in conjunction with other techniques, e.g., optogenetics, prepare mice in advance and allow sufficient recovery time prior to training.
Epoxy (Thorlabs, catalog number: G14250 )
Mineral oil (Sigma-Aldrich, catalog number: M5904 )
Odorants, e.g., Ethyl Valerate (Sigma-Aldrich, catalog number: 290866 )
Alconox (Sigma-Aldrich, catalog number: 242985 )
Equipment
Single-channel pipettes (Eppendorf, catalog numbers: 3121000074 and 3121000120 )
Training chamber (Figure 1B)
Shock floor (Coulbourn Instruments, catalog number: H10-11M-TC-SF )
Training cage (Coulbourn Instruments, catalog number: H10-11M-TC )
Metal wall panels (Coulbourn Instruments, catalog number: H90-00M-M-KT01 )
25 ft shock cable (Coulbourn Instruments, catalog number: H93-01-25 )
Precision animal shocker (Coulbourn Instruments, catalog number: H13-15 )
Testing chamber (custom-made clear Plexiglas chamber, Figure 1C)
Outer dimensions: 11” x 6” x 5.5” (L x W x H) with 1/2” thick walls.
A 1/4” thick wall with 2 rows of 6 holes (1/2” dia) beginning ~1/2” from the top to allow air/odor diffusion across the middle wall divides the 11” chamber length in half, such that there are two inner compartments measuring 5” x 5” x 5.5”.
The chamber has a 1/2” thick lid that can be secured to the chamber by screws.
The chamber has one 1/2” dia hole on either side of the cage ~1/2” from the top for odor and vacuum lines, respectively.
USB Cameras (Coulbourn Instruments, catalog number: ACT-VP-02 )
Actimetrics USB Digital Interface (Coulbourn Instruments, catalog number: ACT-712 )
FreezeFrame 4 adapter cable for Coulbourn hardware (Actimetrics, catalog number: ACT-INTF )
Isolation cubicle (Coulbourn Instruments, catalog number: H10-24T )
Infrared illuminator (Stoelting, catalog number: 60540 )
Acrylic Flowmeter, 0.1-1 LPM (Cole-Parmer Instrument, catalog number: EW-32460-42 )
Aquarium air pump, non-UL (Spectrum Brands, Tetra, Whisper®, catalog number: 77851 )
2-Channel SPDT Relay Board (Winford Engineering, catalog number: RLY102-12V-DIN )
12 V wall power supply for 2-Channel SPDT Relay Board (Winford Engineering, catalog number: WSD050-10-0 )
Pinch Valves
1 Tube Normally Open pinch valve (NResearch, catalog number: 225P021-21 )
1 Tube Normally Open pinch valves (NResearch, catalog number: 648P021-82 )
Olfactory stimulus control (Coulbourn Instruments, catalog number: H15-03 )
True HEPA Air Purifier, 390 sq. ft. (Honeywell, model: 50250 )
Cool Moisture Console Humidifier (Honeywell, model: HCM-6009 )
Humidity and Temperature Monitor (such as FisherbrandTM TraceableTM Thermometer/Clock/Humidity Monitor, Fisher Scientific, catalog number: 06-662-4 )
Figure 1. Odor delivery and behavioral chambers. A. The aquarium pump provides air to the flowmeter through Tygon tubing, which is then routed to the olfactory stimulus control for programming delivery. Kflex tubing is attached to the olfactory stimulus control and the non-odorized air stopcock to provide air flow to the assembled odor vial to make odorized air. The odorized air will flow out of the odorized air stopcock and to the attached chamber via additional Kflex tubing. B. The training chamber is modified to add small holes at the left and right of the cage. An NPT pipe is fitted through each hole and secured to the inside of the chamber with a nut. Odorized air lines are attached to the barbed end of the NPT pipe at the left of the cage while a vacuum line is attached to the barbed end of the NPT pipe at the right of the cage, just beneath the shock floor. A camera is positioned above the cage for recording. C. The testing chamber is placed inside the isolation cubicle with an infrared light source positioned on the right of the chamber and a camera mounted above the chamber. Separate tubing carrying clean and odorized air enter the chamber on the left and a vacuum is attached to the right of the chamber to facilitate odor clearance.
Software
FreezeFrame 4 Software (Coulbourn Instruments, catalog number: ACT-100A)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Ross, J. M. and Fletcher, M. L. (2018). Assessing Classical Olfactory Fear Conditioning by Behavioral Freezing in Mice. Bio-protocol 8(18): e3013. DOI: 10.21769/BioProtoc.3013.
Ross, J. M. and Fletcher, M. L. (2018). Learning-dependent and -independent enhancement of mitral/tufted cell glomerular odor responses following olfactory fear conditioning in awake mice. J Neurosci 38(20): 4623-4640.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Neuroscience > Behavioral neuroscience > Olfaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,014 | https://bio-protocol.org/exchange/protocoldetail?id=3014&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
GC-MS-Based Analysis of Methanol: Chloroform-extracted Fatty Acids from Plant Tissues
Manish Kumar Patel
SD Shubhashis Das
JT Jitendra Kumar Thakur
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3014 Views: 13737
Edited by: Scott A M McAdam
Reviewed by: Bedabrata SahaAli Parsaeimehr
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Fatty acids (FAs) are carboxylic acids with long aliphatic chains that may be straight, branched and saturated or unsaturated. Most of the naturally occurring plant FAs contains an even number of carbon (C4-C24). FAs are used in food and pharmacological industries due to their nutritional importance. In addition, FAs are considered as a promising alternative for the production of biodiesel from terrestrial plant biomass. To establish commercial applications, more reliable analytical methods are needed for the identification, quantification, and composition determination of FAs. Here, we describe a relatively rapid and sensitive method for the extraction, identification, and quantification of FAs from a small quantity of plant tissue. The method includes steps of lipid extraction, conversion of lipid to fatty acid methyl esters (FAMEs) by transmethylation, identification and quantification of FAMEs using gas chromatography-mass spectrometry (GC-MS). In this protocol, an internal standard is added prior to GC-MS analysis. The amount of each FA is calculated from its peak area relative to the peak area of the internal standard.
Keywords: Biodiesel Fatty acids GC-MS Lipids Nutraceutical Plant tissue
Background
Synthesis of fatty acids is important for the storage of metabolic energy. The increasing population and energy cost have emphasized the need to produce sustainable renewable fuels. The source of second-generation biofuels is non-food oilseed crops or lignocellulosic biomass mainly comprising of wastes of crop plants like perennial grasses including switchgrass, husks, straw and forest residue (Hadar, 2013). In this context, plants can serve as an excellent system to study fatty acid for nutraceutical and biodiesel aspects. Further, in biodiesel production, clean burn properties of the fuel are influenced by structural features of FAs including chain length and the degree of unsaturation (Knothe, 2005). Lignocellulosic biomass is a greener alternative to produce these products directly from cost-effective resources. FA profiling using GC-MS permits the normalization, annotation and quantification of a relatively wide variety of fatty acids in a single plant extract. The efficiency of lipid extraction depends on the polarity of the solvent. Polar lipids (such as glycolipids or phospholipids) are more soluble in polar solvents (such as alcohols) and non-polar lipids (such as triacylglycerols) are more soluble in non-polar solvents (such as chloroform). Thus, the total lipid extraction depends on the nature of the organic solvent. Bligh and Dyer (1959) established a method for total lipid extraction using the mixture of chloroform and methanol as a solvent. The total lipids were converted to fatty acid methyl ester by transmethylation (Carreau and Dubacq, 1978). In one study, it was observed that the solvent system of chloroform/methanol is very effective for lipid extraction (Sheng et al., 2011). Moreover, lipid recovery in terms of total lipid content, lipid class and FA composition of different microalgal extracts are also affected by different types of pretreatment and cell disruption techniques and solvents (Ryckebosch et al., 2012). The chloroform/methanol mixture was also found to be useful for the extraction of lipids from microalgae (Ryckebosch et al., 2012). Similarly, there are several other reports suggest that chloroform/methanol/phosphate buffer-based solvent system has a higher efficiency for the extraction of lipids from different microalgae and plants (Kumari et al., 2013; Mishra et al., 2015; Pandey et al., 2015; Patel et al., 2016). Chloroform/methanol mixture exhibits strong dissolving power for the entire range of polarity found in lipids. This mixture is also able to break up membranes and denature the proteins (Schreiner, 2006). The buffer helps to overcome the ionic adsorption effects of salt that may hinder lipid extraction in plant tissue. In most of the studies, methanolic NaOH and methanolic HCl were found to be appropriate derivatizing agents for the profiling of FAs in plants.
Based on this information, here we provide a detailed protocol for extraction of lipids, identification, and quantification of fatty acid methyl esters. We also provide a detailed formula to estimate the total saturated fatty acids (SFA), unsaturated fatty acids (MUFAs and PUFAs), unsaturation index (Poerschmann et al., 2004), degree of unsaturation (Ramos et al., 2009), atherogenic and thrombogenic indices (Simat et al., 2015). Analyses of FAs are done by GC-MS. This protocol provides a relatively rapid and reproducible method. Moreover, this method can be used to profile fatty acids from different types of plant tissues. The produced information can be useful in several contexts of nutraceutical, pharmacological and industrial purposes.
Materials and Reagents
5 ml, 2 ml and 1 ml glass pipettes (Borosil)
Filter paper 40 (GE Healthcare, Whatman, catalog number: 1440-110 )
50 ml graduated centrifuge tube, PP (Tarsons, catalog number: 546041 )
2 ml GC vials and caps (Agilent Technologies, catalog number: 5190-2240 ) with 250 μl glass inserts (Agilent Technologies, catalog number: 5181-1270 )
Pyrex culture tube, screw cap with PTFE liner (Corning, catalog number: 9826-13 )
Plant tissue (Leaf, Stem, Root, and Fruit)
Liquid nitrogen
Nitrogen gas (> 99% Purity)
HPLC-grade methanol (Merck, catalog number: 1060020500 )
HPLC-grade chloroform (Merck, catalog number: 1024470500 )
HPLC-grade water (Avantor Performance Materials, J.T. Baker, catalog number: 1.00577.2500 )
HPLC-grade n-Hexane (Sigma-Aldrich, catalog number: 34859 )
Potassium phosphate monobasic, ACS reagent, ≥ 99.0% (Sigma-Aldrich, catalog number: P0662 )
Potassium phosphate dibasic, ACS reagent, ≥ 98% (Sigma-Aldrich, catalog number: P3786 )
Sodium hydroxide (Sigma-Aldrich, catalog number: S8045 )
F.A.M.E. Mix, C4-C24 (Sigma-Aldrich, catalog number: 18919-1AMP )
Nonadecanoic acid (Sigma-Aldrich, catalog number: N5252 )
Solvent extraction solution A (see Recipe 1)
Solvent extraction solution B (see Recipe 2)
Methanolic NaOH (see Recipe 3)
Methanolic HCl (see Recipe 4)
Internal standard (see Recipe 5)
Equipment
50 ml Flask (Borosil)
Funnel (Borosil)
Table-top centrifuge (Sigma Laborzentrifugen, model: 3-30KS )
Sample concentrator (Hangzhou Allsheng Instruments, catalog number: MD200-2 )
VacSeal liquid nitrogen dewar (Jencons-PLS, catalog number: 238-112 )
Table-top spinix-vortex (Tarsons, catalog number: 3002 )
Rotospin-Rotary mixer (Tarsons, catalog number: 3092 )
Shaking water bath (JULABO, catalog number: SW23 )
-20 °C New Brunswick premium freezers (Eppendorf)
-80 °C New Brunswick premium freezers (Eppendorf)
GC-MS (Shimadzu, model: GCMS-QP2010 ) coupled with mass spectrometer and equipped with an auto-sampler (AOC-5000) and flame ionization detection (FID)
Balance (Sartorius, model: BSA224S-CW )
The RTx-5MS capillary column (60 meters, 0.25 mm ID, and 0.5 μm df) (Rastek, catalog number: 13455 )
Software
GC-MS solution Version 2.70, Post-run analysis
Excel software (Microsoft office 2010)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Patel, M. K., Das, S. and Thakur, J. K. (2018). GC-MS-Based Analysis of Methanol: Chloroform-extracted Fatty Acids from Plant Tissues. Bio-protocol 8(18): e3014. DOI: 10.21769/BioProtoc.3014.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Lipid
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,015 | https://bio-protocol.org/exchange/protocoldetail?id=3015&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stable-isotope Labeled Metabolic Analysis in Drosophila melanogaster: From Experimental Setup to Data Analysis
YC Yuping Cai
NL Nan Liu
ZZ Zheng-Jiang Zhu
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3015 Views: 5990
Edited by: Neelanjan Bose
Reviewed by: Istvan Stadler
Original Research Article:
The authors used this protocol in May 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2018
Abstract
Stable-isotope labeled metabolic analysis is an essential methodology to characterize metabolic regulation during biological processes. However, the method using stable-isotope-labeled tracer (e.g., 13C-glucose) in live animal is only beginning to be developed. Here, we contribute a qualitative metabolic labeling experiment protocol in Drosophila melanogaster using stable-isotope-labeled 13C-glucose tracer followed by liquid chromatography-mass spectrometry (LC-MS) analysis. Detailed experimental setup, data acquisition and analysis are provided to facilitate the application of in vivo metabolic labeling analysis that might be applied in a wide range of biological studies.
Keywords: Stable-isotope labeling 13C-glucose tracer Metabolic analysis Qualitative analysis Liquid chromatography-mass spectrometry Drosophila melanogaster
Background
Metabolomics is a newly emergent omic-level study aiming to profile small molecule metabolites in a complex biological system. It has been applied in diverse research areas pertaining to human health and disease, such as biomarker discovery, disease pathogenesis, and assessment of drug toxicity. Measurement of metabolites is important to determine alterations in metabolic pathway in response to endogenous and exogenous changes. To accurately characterize metabolic pathway activity, isotope-labeled tracers (e.g., 13C and 15N) have been used (Park et al., 2016; Jang et al., 2018). There are many such studies (both quantitatively and qualitatively) in cultured cells (Buescher et al., 2015; Liu et al., 2018), however, stable-isotope based metabolic labeling experiment in live animal remain largely unexplored. In the current protocol, we describe a qualitative metabolic labeling analysis by using the labeled 13C-glucose as a tracer, and we have successfully applied this protocol to comparatively analyze the activity of glycolysis pathway in Drosophila melanogaster, during aging and between wild-type and mutant animals.
Materials and Reagents
Consumables
Pipette tips (Eppendorf, catalog number: 0030073428 )
Ceramic beads (Aoran, catalog number: 150010C )
Eppendorf tube (2 ml) (Eppendorf, catalog number: 0030120094 )
HPLC glass vial (Agilent Technologies, catalog number: 5182-0716 )
Injection needle (Agilent Technologies, catalog number: G4226-87201 )
Kimwipe filter paper (KCWW, Kimberly-Clark, catalog number: 34120 )
Biological material
Drosophila melanogaster
The Drosophila strain used was 5905 (FlyBase ID: FBst0005905, w1118). Flies were cultured in standard media (Recipe 1) at 25 °C with 60% humidity in a 12 h light and 12 h dark cycle.
Prior to the test, flies were starved on 1% Agar media for 6 h before transferred to the vials containing a small piece of Kimwipe filter paper (KCWW, Kimberly-Clark, catalog number: 34120 ) pre-soaked in 1 ml of 10% U-13C6-glucose (U-13C6-glucose was added to phosphate buffer at a final concentration of 10%). Flies were treated for 3 days, and then transferred to new vials with fresh U-13C6-glucose for additional 2 days. Fly heads were dissected from anesthetized flies with CO2 for subsequent metabolic analysis. For each experiment, 8 biological repeats were conducted, with 20 heads for each repeat. One hundred and sixty male flies were used, with 20 flies per vial.
Chemicals
LC-MS chemicals:
Methanol (MeOH), LC-MS grade (Honeywell, catalog number: LC230-2.5HC ). Store at the room temperature (20 °C-25 °C)
Acetonitrile (ACN), LC-MS grade (Merck, catalog number: 1.00029.2500 ). Store at the room temperature (20 °C-25 °C)
Water (H2O) (Honeywell, catalog number: LC365-2.5HC ). Store at the room temperature (20 °C-25 °C)
Ammonium acetate, LC-MS grade (Sigma-Aldrich, catalog number: 73594-25G-F ). Store at 4 °C
Ammonium hydroxide, LC-MS grade (Sigma-Aldrich, catalog number: 44273-100mL-F ). Store at 4 °C
Liquid nitrogen
Labeled chemicals:
D-Glucose (U-13C6, 99%) (Cambridge Isotope Laboratories, catalog number: CLM-1396-PK ). Store at the room temperature (20 °C-25 °C)
Drosophila standard media:
Sucrose
Maltose
Yeast
Agar
Maizena
Soybean flour
438 sodium benzoate
Methyl-p-hydroxybenzoate
Propionic acid
Mobile phase setup
Mobile phase A (see Recipes)
Mobile phase B (see Recipes)
Equipment
Pipettes
Homogenizer (BERTIN, model: Precellys® 24 )
Incubator
Sonicator
Centrifuge
Vacuum concentrator (Labconco, German)
Merck SeQuant ZIC-pHILIC column [particle size, 5 μm; 100 mm (length) x 2.1 mm (i.d.)]
UHPLC system (Agilent Technologies, model: 1290 Infinity )
Quadruple time-of-flight mass spectrometer (Agilent Technologies, model: 6550 Series )
Software
Pathways to PCDL (version B.07.00, Agilent Technologies)
PCDL Manager (version B.07.00, Agilent Technologies)
Profinder (version B.08.00, Agilent Technologies)
MassHunter software (version B.07.00, Agilent Technologies)
Procedure
Metabolites extraction
Quickly freeze the animal tissues (head of Drosophila) in liquid nitrogen immediately after dissection.
Homogenize the tissue sample with 200 μl of H2O and 5 ceramic beads using the homogenizer.
Add 800 μl ACN:MeOH (1:1, v/v) to homogenized solution for subsequent metabolite extraction.
Incubate the samples for 1 h at -20 °C to precipitate proteins.
Proceed with 15 min centrifugation at 15,000 x g under 4 °C.
Transfer the resulting supernatant to a new Eppendorf tube (2 ml), then evaporate to dryness in a vacuum concentrator under 4 °C.
Reconstitute the dry extracts with 100 µl of ACN:H2O (1:1, v/v).
Sonicate the reconstitution solution for 10 min, and centrifuge for 15 min at 15,000 x g under 4 °C to remove insoluble debris.
Transfer the supernatant to an HPLC glass vial and store at -80 °C if the samples will be subjected to LC-MS analysis within 3 h. For extracted samples that require long time (over 12 h) stored prior to being analyzed, we suggest storing the samples after Step A6 and then proceeding with A8-A9 before LC-MS analysis.
LC-MS analysis
Liquid chromatography
Load worklist with method embedded using MassHunter software. Please note that LC-MS operation (both instrument and software) requires specialized training.
Run batch sequence with following LC parameters:
Wash injection needle one time with needle washing solvent MeOH:H2O (1:1, v/v).
Load sample and inject 2 μl of sample.
Run LC method using the LC gradient as described in Table 1.
Table 1. The gradient elution method for LC-MS analysis
Mass spectrometry
Set MS parameters as described below:
ESI source parameters:
Sheath gas temperature, 300 °C.
Dry gas temperature, 250 °C.
Sheath gas flow, 12 L/min.
Dry gas flow, 16 L/min.
Capillary voltage, 2,500 V (+) and -2,500 V (-), respectively. Please note that the same sample is analyzed twice for each ionization mode.
Nozzle voltage, 0 V.
Nebulizer pressure, 20 psi.
Time of Flight (TOF) parameters:
TOF scan range: m/z 60-1,200 Da.
MS1 acquisition frequency: 4 Hz.
Data analysis
Extraction of isotopologues
Metabolite library construction
Use Pathways to PCDL software (version B.07.00, Agilent Technologies) and PCDL Manager software (version B.07.00, Agilent Technologies) to build a metabolite library for metabolites in both glycolysis and citric acid cycle. Specifically, each metabolite standard is analyzed under the same LC-MS condition as biological samples. The ion chromatograph of each metabolite is extracted to obtain the retention time information. Then, the retention time together with formula value is used to construct a metabolite library using PCDL manager. The input example is provided as below (Table 2):
Table 2. The metabolite library for metabolites in both glycolysis and citric acid cycle
Raw data loading
Load the acquired LC-MS raw data files (.d) into Profinder (version B.08.00, Agilent Technologies) for the extraction of metabolite isotopologues using the constructed metabolite library.
Feature extraction parameters:
Ion abundance criterion: peak core area 20% of peak height.
Mass tolerance: ± 15 ppm + 2.00 mDa.
Retention time tolerance: ± 0.20 min.
Anchor ion height threshold: 250 counts.
Sum of ion heights threshold: 1,000 counts.
Correlation coefficient threshold: 0.5.
Stable-isotope-labeled metabolic analysis
Peak integration result manual check
After isotopologues extraction in Profinder, peak integration result need to be reviewed and manually curated for subsequent accurate stable-isotope labeled metabolic analysis. Make sure the peak integration range is consistent across multiple samples. Figure 1A illustrates the extracted ion chromatography (EIC) of the key metabolite 13C3-lactate and the peak integration range.
Calculation of tracer incorporation
For each targeted metabolite, different isotope pattern will be obtained corresponding to the number of incorporated 13C atoms. For example, the isotopologues of lactate are m + 0, m + 1, m + 2, and m + 3 (Figure 1B).
Abundance of individual isotopologue is the integrated peak area.
Taken metabolite lactate as an example, Figure 1C shows the abundance level of one isotopologue of lactate M + 3 between two groups (wild type and PRC2 mutant). In the article by Ma et al., 2018, Figure 6G is generated using this calculated data.
Total metabolite abundance
Total metabolite abundance is calculated using the following formula:
Mn is the labeling pattern of the isotopologue with all atoms (C or N) labeled.
Figure 1D shows the total abundance level of lactate between two groups (wild type and PRC2 mutant). In the article by Ma et al., 2018, Figure S5E was generated using this calculated data.
Proportion of individual isotopologue
Proportion of individual isotopologue is calculated using the following formula:
Mi is the labeling pattern of individual isotopologue.
Mn is the labeling pattern of the isotopologue with all atoms (C or N) labeled.
Figure 1E shows the percentage of total pool level of one isotopologue of lactate M + 3 between two groups (wild type and PRC2 mutant). In the article by Ma et al., 2018, Figure S5B and Figure S5D were generated using this calculated data.
Total tracer incorporation
Total tracer incorporation is calculated using the following formula:
Figure 1F shows the percentage of total tracer incorporation between two groups (wild type and PRC2 mutant).
Above results demonstrated that lactate, the end product of glycolysis pathway, significantly increased in PRC2 mutants.
Figure 1. Stable-isotope-labeled metabolic analysis strategy. A. The extracted ion chromatography (EIC) of isotopologue 13C3-lactate (m + 3). (mean ± SD of 8 biological repeats with 10 flies for each measurement; Student's t-test; n.s.: not significant). Test was from muscle tissues of 30 d old male flies. Genotypes: WT: 5905. Mut: Pclc421/+; Su(z)12c253/+. B. The labeling pattern of lactate demonstrated in mass spectrum (m + 0, m + 1, m + 2, and m + 3). C. The abundance level of lactate isotopologue m + 3 between two groups (mean ± SD of 8 biological repeats with 10 flies for each measurement; Wilcox test). Genotypes: WT: 5905. Mut: Pclc421/+; Su(z)12c253/+. D. The total abundance level of lactate between two groups (wild type and PRC2 mutant) (mean ± SD of 8 biological repeats with 10 flies for each measurement; Wilcox test). Genotypes: WT: 5905. Mut: Pclc421/+; Su(z)12c253/+. E. The percentage of total pool level of one isotopologue of lactate m + 3 between two groups (mean ± SD of 8 biological repeats with 10 flies for each measurement; Wilcox test). Genotypes: WT: 5905. Mut: Pclc421/+; Su(z)12c253/+. F. The percentage of total tracer incorporation between two groups (mean ± SD of 8 biological repeats with 10 flies for each measurement; Wilcox test). Genotypes: WT: 5905. Mut: Pclc421/+; Su(z)12c253/+.
Recipes
Standard Drosophila food
Sucrose 36 g/L
Maltose 38 g/L
Yeast 22.5 g/L
Agar 5.4 g/L
Maizena 60 g/L
Soybean flour 8.25 g/L
438 sodium benzoate 0.9 g/L
Methyl-p-hydroxybenzoate 0.225 g/L
Propionic acid 6.18 ml/L
ddH2O to make up 1 L
Mobile phase A
25 mM ammonium acetate
25 mM ammonium hydroxide
For the preparation of 1 L mobile phase A, firstly weigh 1.9271 g CH3COONH4. Dissolve the CH3COONH4 in 1 L H2O. Then add 3.5 ml NH4OH (25%) to generate the mobile phase A. Store the solution at 4 °C for up to 2 weeks
Mobile phase B
Acetonitrile
Store at the room temperature (20-25 °C)
Acknowledgments
We thank the financial support provided by the startup funding from Interdisciplinary Research Center on Biology and Chemistry (IRCBC), and Agilent Technologies Thought Leader Award. N.L. and Z.-J. Z. are also supported by Thousand Youth Talents Program. This protocol is also a part of our previous work by Ma et al., 2018.
Competing interests
The authors declare no competing financial interest.
References
Buescher, J. M., Antoniewicz, M. R., Boros, L. G., Burgess, S. C., Brunengraber, H., Clish, C. B., DeBerardinis, R. J., Feron, O., Frezza, C., Ghesquiere, B., Gottlieb, E., Hiller, K., Jones, R. G., Kamphorst, J. J., Kibbey, R. G., Kimmelman, A. C., Locasale, J. W., Lunt, S. Y., Maddocks, O. D., Malloy, C., Metallo, C. M., Meuillet, E. J., Munger, J., Noh, K., Rabinowitz, J. D., Ralser, M., Sauer, U., Stephanopoulos, G., St-Pierre, J., Tennant, D. A., Wittmann, C., Vander Heiden, M. G., Vazquez, A., Vousden, K., Young, J. D., Zamboni, N. and Fendt, S. M. (2015). A roadmap for interpreting 13C metabolite labeling patterns from cells. Curr Opin Biotechnol 34: 189-201.
Jang, C., Chen, L. and Rabinowitz, J. D. (2018). Metabolomics and isotope tracing. Cell 173(4): 822-837.
Liu, L., Su, X., Quinn, W. J., 3rd, Hui, S., Krukenberg, K., Frederick, D. W., Redpath, P., Zhan, L., Chellappa, K., White, E., Migaud, M., Mitchison, T. J., Baur, J. A. and Rabinowitz, J. D. (2018). Quantitative analysis of NAD synthesis-breakdown fluxes. Cell Metab 27(5): 1067-1080 e1065.
Ma, Z., Wang, H., Cai, Y., Wang, H., Niu, K., Wu, X., Ma, H., Yang, Y., Tong, W., Liu, F., Liu, Z., Zhang, Y., Liu, R., Zhu, Z. J. and Liu, N. (2018). Epigenetic drift of H3K27me3 in aging links glycolysis to healthy longevity in Drosophila. Elife 7: e35368.
Park, J. O., Rubin, S. A., Xu, Y. F., Amador-Noguez, D., Fan, J., Shlomi, T. and Rabinowitz, J. D. (2016). Metabolite concentrations, fluxes and free energies imply efficient enzyme usage. Nat Chem Biol 12(7): 482-489.
Copyright: Cai et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Cai, Y., Liu, N. and Zhu, Z. (2018). Stable-isotope Labeled Metabolic Analysis in Drosophila melanogaster: From Experimental Setup to Data Analysis. Bio-protocol 8(18): e3015. DOI: 10.21769/BioProtoc.3015.
Ma, Z., Wang, H., Cai, Y., Wang, H., Niu, K., Wu, X., Ma, H., Yang, Y., Tong, W., Liu, F., Liu, Z., Zhang, Y., Liu, R., Zhu, Z. J. and Liu, N. (2018). Epigenetic drift of H3K27me3 in aging links glycolysis to healthy longevity in Drosophila. Elife 7: e35368.
Download Citation in RIS Format
Category
Systems Biology > Metabolomics > Whole organism
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,016 | https://bio-protocol.org/exchange/protocoldetail?id=3016&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This is a correction notice. See the corrected protocol.
Peer-reviewed
Correction Notice: Microbial Mutagenicity Assay: Ames Test
UV Urvashi Vijay
SG Sonal Gupta
PM Priyanka Mathur
Prashanth Suravajhala
PB Pradeep Bhatnagar
Published: Aug 20, 2018
DOI: 10.21769/BioProtoc.3016 Views: 4551
Ask a question
How to cite
Favorite
Cited by
We checked the composition of Vogel-Bonner media and other media and salts in our publication (https://doi.org/10.21769/BioProtoc.2763) and found some mistakes in the units. New, correct units are as follows (in bold):
Recipes
Vogel-Bonner medium E (50x)
For Minimal agar (Recipe 9)
Ingredients
Per 500 ml
Warm distilled H2O (40-50 °C)
335 ml
Magnesium sulfate (MgSO4•7H2O)
5 g
Citric acid monohydrate
50 g
Potassium phosphate, dibasic (anhydrous) (K2HPO4)
250 g
Sodium ammonium phosphate (NaNH4HPO4•4H2O)
87.5 g
Salts are added to the warm water in a flask. Place the flask on a hot plate
After each salt dissolves entirely, transfer the solution into glass bottles and autoclave for 20 min at 121 °C
When the solution gets cool, cap the bottle tightly
Store the solution at 4 °C
Salt solution (1.65 M KCl + 0.4 M MgCl2)
For S9 hepatic fraction
Ingredients
Per 250 ml
Potassium chloride (KCl)
30.75 g
Magnesium chloride (MgCl2•6H2O)
20.35 g
Distilled H2O to final concentration of
250 ml
All the components are dissolved in water. The solution is autoclaved for 20 min, at 121 °C and then stored in refrigerator.
0.2 M sodium phosphate buffer, pH 7.4
For S9 hepatic fraction
Ingredients
Per 250 ml
0.2 M sodium dihydrogen phosphate (NaH2PO4•H2O)
30 ml (6.9 g/250 ml)
0.2 M disodium hydrogen phosphate (Na2HPO4)
220 ml (7.1 g/250 ml)
Adjust pH to 7.4. Sterilize the buffer by autoclaving for 20 min at 121 °C
1 M glucose-6-phosphate
For S9 hepatic fraction
Ingredients
Per 5 ml
Glucose-6-phosphate (G-6-P)
1.41 g
Sterile distilled H2O
5 ml
Glucose-6-phosphate is dissolved in the 5 ml distilled water and mixed by vortexing. Tubes are placed in an ice bath. The solution can be used for up to six months
Ampicillin solution (4 mg/ml)
Used in tests of ampicillin resistance
Master plates for R-factor strains
Ingredients
Per 500 ml
Ampicillin trihydrate
0.4 g
Sodium hydroxide (0.02 N)
50 ml
Ampicillin trihydrate is dissolved in the 50 ml of NaOH (0.02 N) and mixed by vortexing. Tubes are placed in an ice bath
Crystal violet solution (0.1%)
Used in tests for crystal violet sensitivity (to confirm rfa mutation)
Ingredients
Per 500 ml
Crystal violet
0.05 g
Distilled H2O
50 ml
Minimal glucose plates
Used in Mutagenic bioassay
Ingredients
Per 500 ml
Agar
7.5 g
Distilled H2O
465 ml
50x VB salts (Recipe 1)
10 ml
40% glucose
25 ml
Add agar in 465 ml of distilled water and autoclave for 20 min, at 121 °C. After cooling, add the salts and glucose gently
Histidine/Biotin plates (Master plates for non R-factor strains)
Used in tests for histidine requirement
Ingredients
Per 500 ml
Agar
7.5 g
Distilled H2O
457 ml
50x VB salts
10 ml
40% glucose
25 ml
Sterile histidine (2 g per 400 ml H2O)
5 ml
Sterile 0.5 mM biotin
3 ml
Dissolve agar in the given concentration in distilled water. Autoclave each solution separately for 20 min. After cooling of solution, add each salt gently
Ampicillin and tetracycline* plates
Master plates for the cultivation of strains containing the plasmids pKM101 and pAQ1*
Ingredients
Per 500 ml
Agar
7.5 g
Distilled H2O
405 ml
50x VB salts
10 ml
40% glucose
25 ml
Sterile histidine (2 g per 400 ml H2O)
5 ml
Sterile 0.5 mM biotin
3 ml
Sterile ampicillin solution (4 mg/ml 0.02 N NaOH)
1.58 ml
*Sterile tetracycline solution (4 mg/ml 0.02 N HCl)
0.125 ml
Dissolve agar in the given concentration in distilled water. Autoclave each solution separately for 20 min. After cooling of solution, add each salt gently
*Note: TA 102 is resistant to tetracycline. The shelf life of the plates is two weeks at 4 °C.
Nutrient agar plates
Used in tests for genotypes [Crystal violet sensitivity (rfa) and UV sensitivity (AuvrB)] and viability of bacteria
Ingredients
Per 500 ml
Nutrient agar
7.5 g
Distilled H2O
500 ml
Dissolve agar in the given concentration in distilled water. Autoclave separately for 20 min. Pour the cooled solution into the Petri plates
References
Vijay, U., Gupta, S., Mathur, P., Suravajhala, P. and Bhatnagar, P. (2018). Microbial Mutagenicity Assay: Ames Test. Bio-protocol 8(6): e2763.
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Vijay, U., Gupta, S., Mathur, P., Suravajhala, P. and Bhatnagar, P. (2018). Correction Notice: Microbial Mutagenicity Assay: Ames Test. Bio-protocol 8(16): e3016. DOI: 10.21769/BioProtoc.3016.
Download Citation in RIS Format
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,017 | https://bio-protocol.org/exchange/protocoldetail?id=3017&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
High-throughput Microscopic Analysis of Salmonella Invasion of Host Cells
Jakub Voznica
JE Jost Enninga
Virginie Stévenin
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3017 Views: 5548
Edited by: Emily Cope
Reviewed by: Vishal Nehru
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
Salmonella is a Gram-negative bacterium causing a gastro-enteric disease called salmonellosis. During the first phase of infection, Salmonella uses its flagella to swim near the surface of the epithelial cells and to target specific site of infection. In order to study the selection criteria that determine which host cells are targeted by the pathogen, and to analyze the relation between infecting Salmonella (i.e., cooperation or competition), we have established a high-throughput microscopic assay of HeLa cells sequentially infected with fluorescent bacteria. Using an automated pipeline of image analysis, we quantitatively characterized a multitude of parameters of infected and non-infected cells. Based on this, we established a predictive model that allowed us to identify those parameters involved in host cell vulnerability towards infection. We revealed that host cell vulnerability has two origins: a pathogen-induced cellular vulnerability emerging from Salmonella uptake and persisting at later stages of the infection process; and a host cell-inherent vulnerability linked with cell inherent attributes, such as local cell crowding, and cholesterol content. Our method forecasts the probability of Salmonella infection within monolayers of epithelial cells based on morphological or molecular host cell parameters. Here, we provide a detailed description of the workflow including the computer-based analysis pipeline. Our method has the potential to be applied to study other combinations of host-pathogen interactions.
Keywords: Salmonella enterica serovar Typhimurium Epithelial cell infection Host cell heterogeneity High-throughput microscopy Image segmentation Mathematical modeling
Background
Salmonella enterica serovar Typhimurium infects its host via ingestion of contaminated food or water, causing salmonellosis. Once the bacterium reaches the distal ileum of the gut, they can invade a broad range of host cells, including the intestinal epithelial cells (Watson and Holden, 2010). During the first phase of host cell invasion, Salmonella chooses its targets, using its flagellum to swim and scan the surface of the epithelium (Misselwitz et al., 2012). After several stops on the surface of the cells, the bacterium eventually chooses a site where it docks (Misselwitz et al., 2011; Vonaesch et al., 2013) and triggers its uptake via the Type 3 Secretion System (T3SS) (Haraga et al., 2008; LaRock et al., 2015). The injection of bacterial effectors directly into the cytosol of the targeted cells leads to a strong remodeling of the actin cytoskeleton and the formation of membrane ruffles that engulf the pathogen (Haraga et al., 2008; LaRock et al., 2015). Within the infected cells, Salmonella remains either within a mature endomembrane compartment, the Salmonella-containing vacuole (SCV); or it reaches the cytosol by SCV membrane rupture to replicate at distinct paces within the different intracellular niches (Knodler, 2015; Fredlund et al., 2018).
Eukaryotic cell monocultures display an intrinsic cellular heterogeneity. Indeed, after seeding, cells have different characteristics with regards to their morphology and the local microenvironment, which correlates with differences of the transcriptome, proteome, and lipidome (Snijder et al., 2009; Frechin et al., 2015; Liberali et al., 2015). The selection criteria that determine which host cells are targeted by Salmonella for invasion are poorly understood. Previously, Misselwitz and colleagues proposed that Salmonella preferentially targets the topological obstacles it encountered while swimming near the cell monolayer, such as ruffles or mitotic cells (Misselwitz et al., 2012; Lorkowski et al., 2014). In contrast, Santos and colleagues suggested that cholesterol accumulation during cell metaphase is responsible for mitotic cell targeting (Santos et al., 2013). In a recent study, we investigated at the single-cell level the criteria exploited by Salmonella to select the cell to infect in a naturally heterogeneous monolayer of cells (Voznica et al., 2018).
In order to link the features of each cell with its probability to be infected, we have established a protocol of double infection of HeLa cells with fluorescent bacteria. We imaged the cells with high-throughput microscopy combined with automatic image analysis to obtain the individual features of hundreds of thousands of cells. We observed the distribution of those features in infected and non-infected cells and used a mathematical model to resolve the importance of different cellular parameters in deciphering Salmonella targeting.
This protocol provides a new tool to analyze pathogen targeting of cell features in a non-invasive manner and at the single-cell level. This opens a new path to decipher the cellular and bacterial factors involved in host cell vulnerability to infection.
Materials and Reagents
Cell culture
Falcon® 15 ml Polystyrene Centrifuge Tubes, Conical Bottom, with Dome Seal Screw Cap, Sterile (Corning, catalog number: 352095 )
Counting chamber (KOVA® Glasstic Slide 10 with Grids) (Kova International, catalog number: 87144 )
96-well cell culture microplate with clear flat bottom (Greiner Bio One International, catalog number: 655090 )
75 cm2 tissue culture flasks with tilting neck and filter caps (TPP Techno Plastic Products, catalog number: 009076 )
Human epithelial HeLa cells (ATCC, catalog number: CCL-2 )
Dulbecco’s Modified Eagle’s Medium (DMEM) 1x, High Glucose, GlutaMaxTM (Thermo Fisher Scientific, catalog number: 10566016 ) supplemented with 10% (v/v) heat-inactivated Fetal Bovine Serum (Sigma-Aldrich, catalog number: F7524 )
DPBS 1x (Thermo Fisher Scientific, catalog number: 14190144 )
0.05% Trypsin-EDTA 1x (Thermo Fisher Scientific, catalog number: 25300054 )
Heat-inactivated Fetal Bovine Serum (Sigma-Aldrich, catalog number: F7524 ) (see Recipes for heat-inactivation)
Bacteria culture
Inoculating loops (SARSTEDT, catalog number: 86.1562.010 )
Falcon® 14 ml round bottom tube with snap cap (Corning, catalog number: 352006 )
Round Petri plate (Corning, GosselinTM, catalog number: BP93B-102 )
Bacterial glycerol stock, stored at -80 °C (lab collection)
SL1344 pM965, expressing GFP under the rpsM promoter. The strain was obtained after transformation of SL1344 with the pM965 plasmid described by Stecher and colleagues (Stecher et al., 2004). See Recipes for transformation.
SL1344 pGG2, expressing dsRed under the rpsM promoter. The strain was obtained after transformation of SL1344 with the pGG2 plasmid described by Lelouard and colleagues (Lelouard et al., 2010). See Recipes for transformation.
Electroporation Cuvettes (Bio-Rad Laboratories, catalog number: 1652086 )
Ampicillin (Sigma-Aldrich, catalog number: A9393 ) (Keep the stock solution of 50 mg/ml at -20 °C)
Tryptone (BD, catalog number: 211705 )
Yeast Extract (BD, catalog number: 212750 )
NaCl (Sigma-Aldrich, catalog number: 746398 )
LB agar plate containing Ampicillin at 100 μg/ml (homemade, see Recipes)
Lysogeny broth (LB) medium supplemented with 0.3 M NaCl (homemade, see Recipes)
Infection
1.5 ml Eppendorf safe-lock tubes (Eppendorf, catalog number: 0030120086 )
Semi-micro disposable cuvettes (BRAND, catalog number: 759105 )
Parafilm® M sealing tape (Sigma-Aldrich, Parafilm, catalog number: P7543 )
Pipetting reservoir, 25 ml (Thermo Fisher Scientific, catalog number: 10717964 )
Filter tips, 200 µl (Sorenson Bioscience, catalog number: 035230 )
Gentamicin solution (Sigma-Aldrich, catalog number: G1397 ) (Keep the stock solution of 50 mg/ml at -20 °C)
NaCl (Sigma-Aldrich, catalog number: 746398 )
KCl (Thermo Fisher Scientific, catalog number: 13305 )
CaCl2 (Sigma-Aldrich, catalog number: 449709 )
MgCl2 (Sigma-Aldrich, catalog number: M8266 )
Glucose (Sigma-Aldrich, catalog number: G8270 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Heat-inactivated Fetal Bovine Serum (Sigma-Aldrich, catalog number: F7524 ) (see Recipes for heat-inactivation)
20x EM medium (homemade, see Recipes)
1x EM medium (see Recipes)
Fixation
Aluminum foil
Paraformaldehyde 16% solution (Electron Microscopy Sciences, catalog number: 15710 )
DPBS 1x (Thermo Fisher Scientific, catalog number: 14190144 )
Staining
CellMaskTM Deep Red Plasma Membrane Stain (Thermo Fisher Scientific, catalog number: C10046 )
DAPI (Thermo Fisher Scientific, catalog number: D1306 ) (stock solution at 10 mg/ml stored at -20 °C)
DPBS 1x (Thermo Fisher Scientific, catalog number: 14190144 )
Equipment
Single-channel pipettes (Eppendorf, model: Research® plus )
Multichannel Pipette, 30 to 300 μl (Thermo Fisher Scientific, catalog number: 4661030N )
Pipet Filler (Thermo Fisher Scientific, catalog number: 9501 )
Inverted Microscope (Motic, model: AE2000 )
Laminar hood (Thermo Fisher Scientific, model: 1300 Series Class II Type A2 )
Incubator set at 37 °C, 5% CO2 (Thermo Fisher Scientific, catalog number: NC0689918 )
Centrifuge 5810/5810 R (Eppendorf, model: 5810/ 5810 R )
Incubator with orbital shaker (INFORS, Multitron no series 112569-3)
Water Bath (JULABO, model: TW12, catalog number: 9550112 )
Thermomixer compact (Eppendorf, model: ThermoMixer® C )
Photometer (Eppendorf, AG 22331)
Centrifuge 5424/ 5424 R (Eppendorf, model: 5424/5424 R )
Fume hood (SORBONNE ASPRIL/1000)
Inverted widefield microscope equipped with a 20x/0.5NA air objective, an automatic programmable XY-stage, and a focusing system (Nikon), a CoolSnap2 camera (Roeper Scientific), a mercury lamp and the following filter cubes: DAPI (Excitation filter: 387/11, Emission filter: 447/60), FITC (Excitation filter: 482/35, Emission filter: 536/40), TRITC (Excitation filter: 543/22, Emission filter: 593/40) Cy5 (Excitation filter: 628/40, Emission filter: 692/40)
250 ml Erlenmeyer flask
Electroporation Systems (Bio-Rad Laboratories, model: Gene Pulser XcellTM )
Double boiler: 2 L beaker filled with 600 ml water
Microwave
Software
NIS-Elements Microscope Imaging Software (Nikon)
Icy (Copyright 2011 Institut Pasteur, Icy is free software under the terms of the GNU General Public License, http://icy.bioimageanalysis.org)
R (R is free software under the terms of the GNU General Public License, https://www.r-project.org/). The code available in the data analysis part has been written with R, version 3.4.2
GraphPad Prism version 7.00 for Windows, GraphPad Software (La Jolla California USA, www.graphpad.com)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Voznica, J., Enninga, J. and Stévenin, V. (2018). High-throughput Microscopic Analysis of Salmonella Invasion of Host Cells. Bio-protocol 8(18): e3017. DOI: 10.21769/BioProtoc.3017.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vitro model
Microbiology > Microbial cell biology > Cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,018 | https://bio-protocol.org/exchange/protocoldetail?id=3018&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Platelet Migration and Bacterial Trapping Assay under Flow
SF Shuxia Fan
ML Michael Lorenz
SM Steffen Massberg
FG Florian Gaertner
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3018 Views: 5838
Edited by: Andrea Puhar
Reviewed by: Suprabhat MukherjeeLip Nam LOH
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Blood platelets are critical for hemostasis and thrombosis, but also play diverse roles during immune responses. We have recently reported that platelets migrate at sites of infection in vitro and in vivo. Importantly, platelets use their ability to migrate to collect and bundle fibrin (ogen)-bound bacteria accomplishing efficient intravascular bacterial trapping. Here, we describe a method that allows analyzing platelet migration in vitro, focusing on their ability to collect bacteria and trap bacteria under flow.
Keywords: Platelets Cell migration Bacteria Shear flow Fibrinogen E. coli
Background
Platelets are small, anucleate cellular fragments released from megakaryocytes that reside within the bone marrow of mammalian organisms (Machlus and Italiano, 2013). Approximately 750 billion platelets circulate in human blood, constantly scanning the vasculature for damage of the endothelial surface. Upon encountering endothelial injury, platelets are immediately recruited in a well-characterized cascade of events including initial platelet tethering and rolling, followed by platelet activation, adhesion and spreading, eventually leading to fibrin (ogen)-dependent aggregation and subsequent thrombus retraction (Jackson, 2007). Platelet plug formation is a major step in physiological hemostasis, but also in pathological thrombosis after atherosclerotic plaque rupture, triggering myocardial infarction or stroke (Jackson, 2011).
In addition to their well-established role in hemostasis and thrombosis, platelets also evolved diverse immunologic functions (Semple et al., 2011). Being among the first cells recruited to sites of inflammation and infection, platelets play an essential role in initiating intravascular immune responses (Wong et al., 2013). Accordingly, platelets coordinate the recruitment of a variety of immune cells and instruct them with their effector programs (Sreeramkumar et al., 2014). Platelets also have the ability to directly fight pathogens by releasing anti-microbial mediators and/or physically trapping and encapsulating invaders, thus preventing dissemination with the blood flow (Yeaman, 2014).
We recently identified platelet migration as an autonomous platelet function and showed that migration of single platelets provides a mechanism of controlling their interaction with pathogenic bacteria within the microcirculation (Gaertner et al., 2017). Once adhering to immobilized fibrin (ogen), activated platelets use αIIbβ3 integrins to probe the resistance of their local microenvironment. When actomyosin-dependent traction forces overcome substrate resistance platelets eventually polarize and migrate thereby removing and accumulating platelet-bound ligands. As a prominent example, migrating platelets collect and bundle fibrin (ogen)-bound bacteria accomplishing efficient intravascular bacterial trapping. In contrast to phagocytes like neutrophils, platelets behave like “covercytes” that do not internalize collected bacteria but rather accumulate them on their surface within invaginations of the plasma membrane (White, 2005). When exposed to shear stress in vitro platelets strongly bind to piled-up bacteria.
Here we provide a detailed protocol for the isolation of platelets from human blood and microscopic observation of platelet migration and trapping of Escherichia coli (E. coli) under flow.
Materials and Reagents
Pipette tips 0.1-10 μl (Eppendorf, epT.I.P.S.® Reloads, catalog number: 022491504 )
Pipette tips 0.5-20 μl (Eppendorf, epT.I.P.S.® Reloads, catalog number: 022491521 )
Pipette tips 2-200 μl (Eppendorf, epT.I.P.S.® Reloads, catalog number: 022491539 )
Pipette tips 50-1,000 μl (Eppendorf, epT.I.P.S.® Reloads, catalog number: 022491555 )
15 ml Falcon tube (Corning, catalog number: 352096 )
Tygon 3350 silicone tube (Saint-Gobain Performance Plastics, catalog number: ABW00002 )
Safety-Multifly-Needle 21G (SARSTEDT, catalog number: 85.1638.935 )
Membrane adaptor (SARSTEDT, catalog number: 14.1112 )
5 ml syringes (BD, Discardit IITM, catalog number: 301285 )
50 ml syringes (BD, perfusion, catalog number: 300136 )
Bottomless 6 channel sticky slide (IBIDI, sticky slides VI0.4, catalog number: 80608 )
Glass coverslips 24 mm x 24 mm (SCHOTT, NEXTERION®, No. 1.5, catalog number: D263T )
Cuvette (Eppendorf, catalog number: 952010069 )
Human blood (taken from male and female healthy donors with the age of 25-40 years old)
Plasmid ptdTomato (Takara Bio, catalog number: 632531 )
E. coli strains (DH12S, Invitrogen)
E. coli was transformed with plasmid ptdTomato. TdTomato is encoded within the lac operon and transcription is induced in the presence of isopropylthio-β-galactoside (IPTG) (IPTG binds to the lac repressor and releases lac repressor from the lac operator). The plasmid carries the bla-gene for ampicillin resistance.
Note: E. coli stock was made in LB with 7% dimethyl sulfoxide (v/v) and kept at -80 °C.
Distilled water (ddH2O) (Millipore)
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D2438 )
Phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: D8537 )
Recombinant human albumin (rHSA) (Sigma-Aldrich, catalog number: A9731 )
Note: Dissolve rHSA in ddH2O to 8% (w/v) solution and store the aliquots at -20 °C.
Prostaglandin I2 sodium salt (PGI2) (Abcam, catalog number: ab120912 )
Note: Dissolve it in DMSO to 10 mg/ml and store the aliquots at -20 °C.
HEPES solution (Sigma-Aldrich, catalog number: H0887 )
20% HNO3 (Carl Roth, catalog number: 4337.2 )
Hexamethyldisilazane (HMDS) (Sigma-Aldrich, catalog number: 440191 )
Fibrinogen from human plasma (Sigma-Aldrich, catalog number: F3879 )
Note: Dissolve it in 0.9% NaCl to 2 mg/ml and store the aliquots at -20 °C.
Fibrinogen from human plasma, Alexa Fluor 488 conjugate (Thermo Fisher Scientific, Life technology, catalog number: F13191 )
Note: Dissolve it in 0.1 M NaHCO3 (pH 8.3) to 1.5 mg/ml and store the aliquots at -20 °C.
U46619 (Enzo Life Sciences, catalog number: BML-PG023-0001 )
Note: Dissolve it in DMSO to 28.8 mM and store the aliquots at -20 °C.
Adenosine 5′-diphosphate sodium salt (ADP) (Sigma-Aldrich, catalog number: A2754 )
Note: Dissolve it in PBS to 20 mM and store the aliquots at -20 °C.
Thrombin from bovine plasma (Sigma-Aldrich, catalog number: T4648 )
Note: Dissolve it in 0.1% (w/v) bovine serum albumin (BSA) to 100 U/ml and store the aliquots at -20 °C.
LB broth (Sigma-Aldrich, catalog number: L3022 )
Note: 20 g LB powder was dissolved in 1 L ddH2O and autoclaved.
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sigma-Aldrich, catalog number: I6758 )
Note: Dissolve IPTG in ddH2O to 100 mM and store the aliquots at -20 °C.
Ampicillin sodium salt (Sigma-Aldrich, catalog number: A9518 )
Note: Dissolve ampicillin in ddH2O to 50 mg/ml and store the aliquots at -20 °C.
Sodium citrate tribasic dehydrate (C6H5Na3O7•2H2O) (Sigma-Aldrich, catalog number: S4641 )
Citric acid monohydrate(C6H8O7•H2O) (Sigma-Aldrich, catalog number: C1909 )
Glucose (Merck, Calbiochem, catalog number: 346351 )
Sodium chloride (NaCl) (Carl Roth, catalog number: 3957.3 )
Sodium bicarbonate (NaHCO3) (Merck, catalog number: 106329 )
Potassium chloride (KCl) (Carl Roth, catalog number: 6781.3 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C8106 )
Note: CaCl2•2H2O was dissolved in ddH2O to make 100 mM stock solution and stored at 4 °C.
Acid-citrate-dextrose (ACD) buffer, pH 4.7 (see Recipes)
Modified Tyrode's buffer (see Recipes)
Fibrin buffer (see Recipes)
Equipment
Pipette 0.1-2.5 μl (e.g., Eppendorf, Research plus: O18485E)
Pipette 0.5-10 μl (e.g., Eppendorf, Research plus: O30964E)
Pipette 10-100 μl (e.g., Eppendorf, Research plus: O30379E)
Pipette 100-1,000 μl (e.g., Eppendorf, Research plus: O29260E)
Orbi-Shaker (e.g., Benchmark)
pH meter (e.g., Mettler Toledo)
BioPhotometer (e.g., Eppendorf, model: BioPhotometer 6131 )
Bunsen burner (e.g., Campingaz)
Centrifuge (e.g., Eppendorf, model: 5804 )
Cell culture incubator (e.g., Binder)
Hematology counter (e.g., Horiba Medical)
KLM spin coater (e.g., Schaefer)
Inverted phase contrast and fluorescent microscope (e.g., OLYMPUS, model: IX83 )
Syringe pump (e.g., KD Scientific, model: KDS 100 )
Software
Live cell imaging software that was connected to the microscope (e.g., CellSense)
Fiji software [National Institutes of Health (NIH)]
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fan, S., Lorenz, M., Massberg, S. and Gaertner, F. (2018). Platelet Migration and Bacterial Trapping Assay under Flow. Bio-protocol 8(18): e3018. DOI: 10.21769/BioProtoc.3018.
Download Citation in RIS Format
Category
Immunology > Host defense > Human
Microbiology > Microbe-host interactions > Bacterium
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,019 | https://bio-protocol.org/exchange/protocoldetail?id=3019&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Retroviral Capsid Core Stability Assay
Tyler Milston Renner
Kasandra Bélanger
Marc-André Langlois
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3019 Views: 4920
Edited by: Vamseedhar Rayaprolu
Reviewed by: Ravi KantSzu-Ting Chen
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
Structural stability of the capsid core is a critical parameter for the productive infection of a cell by a retrovirus. Compromised stability can lead to premature core disassembly, exposure of replication intermediates to cytosolic nucleic acid sensors that can trigger innate antiviral responses, and failure to integrate the proviral genome into the host DNA. Thus, core stability is a critical feature of viral replicative fitness. While there are several well-described techniques to assess viral capsid core stability, most are generally time and labor intensive. Recently, our group compared the relative stability of murine leukemia virus capsid cores using an in vitro detergent-based approach combined with ultracentrifugation against the popular fate of capsid assay. We found that both methods reached similar conclusions, albeit the first method was a significantly simpler and faster way to assess relative capsid core stability when comparing viral mutants exhibiting differences in core stability.
Keywords: Retrovirus Enveloped virus MLV HIV Capsid core stability assay Fate of capsid assay Glycosylated Gag gPr80 TRIM5α
Background
Retroviruses have evolved replication cycles that excel in circumventing host antiviral responses. One strategy that retroviruses have developed is to shield their replication intermediates from cytosolic nucleic acid sensors such as cGAS, TREX1, IFI203, and DDX41 (Yan et al., 2010; Gao et al., 2013; Lahaye et al., 2013; Stavrou et al., 2015). During replication, retroviruses produce RNA-DNA hybrids and unmethylated double-stranded proviral DNA in the cytosol that are common targets for innate immune sensors (Yan et al., 2010; Gao et al., 2013; Lahaye et al., 2013). The mature retroviral capsid core is constituted by about 1,500 units of the viral capsid protein (CA) that assemble to form a rigid structure that houses two copies of the retroviral RNA genome, the viral reverse-transcriptase, various other host-derived molecules (e.g., miRNAs, proteins, dNTPs), and in some cases, viral accessory proteins (Ganser et al., 1999; Briggs et al., 2004; Cantin et al., 2005; Campbell and Hope, 2015). This structure is permissive to the diffusion of dNTPs, yet it is impermeable to most host proteins (Jacques et al., 2016). In order to successfully and efficiently deliver the proviral DNA associated with the pre-integration complex (PIC) to the nucleus of the cell, the viral core must maintain a certain level of stability. Once it is physically situated proximal to a nuclear pore complex, the PIC may traverse into the nucleus and deliver the proviral DNA. Capsid cores that lack structural integrity or are destabilized by host restriction factors, like TRIM5α, will trigger innate responses and fail to deliver proviral DNA to the nucleus (Sayah et al., 2004; Stremlau et al., 2004 and 2006).
One of the most commonly used methods of analyzing retrovirus capsid core stability is known as the ‘fate of capsid assay’ (Stremlau et al., 2006; Perron et al., 2007; Yang et al., 2014). This assay involves infecting cells and then detecting the amount of intact pelletable capsid cores in the lysates of the infected cells. While this assay can compare relative levels of cores that persist in the cytosol over time, it is quite labor intensive, time-consuming and requires very large quantities of virus. In our hands, the ‘fate of capsid assay’ required the equivalent of 108 Transducing Units (TU–as measured by productive infections) of Moloney Murine Leukemia Virus (M-MLV) which was barely over the limit of detection in our conditions (Renner et al., 2018a). Additionally, this method cannot differentiate endocytosed, non-infectious capsids, from those capable of a productive infection. Other alternatives to this approach include visual tracking of intact fluorescent cores, and the direct assessment of viral uncoating kinetics in a cyclosporine A washout assay (Fricke et al., 2013; Campbell and Hope, 2015).
The protocol presented here is an adaptation of a similar method (Forshey et al., 2002; Aiken, 2009; Shah and Aiken, 2011). It is designed to rapidly assess the relative stability of capsid cores from different viral mutants. In this modified approach, retroviruses are pre-treated with a detergent to strip away the viral envelope, and then the naked capsids are spun through a sucrose gradient with a detergent layer at the top (Renner et al., 2018a). Measuring the amount of intact cores recovered following ultracentrifugation provides an easy way of determining the comparative stability of the cores from different viruses. In the context of our published study, we also directly compared this method with a conventional ‘fate of capsid assay’, which yielded similar results but was much more involved to carry out and required a substantially larger viral input. The retroviral capsid core stability assay described here poses as an easy and technically reproducible alternative to other approaches evaluating capsid stability (Renner et al., 2018a).
Materials and Reagents
10 cm culture dishes (Corning, catalog number: 430167 , or equivalent)
Pasteur pipettes (Fisher Scientific, catalog number: 13-678-20A , or equivalent)
Microcentrifuge tubes (FroggaBio, catalog number: LMCT1.7B , or equivalent)
PVDF membrane (Bio-Rad Laboratories, catalog number: 1620177 )
Sterile 0.45 μm Luer-Lok syringe filters (Pall, catalog number: 4614 , or equivalent)
Sterile 20 ml syringes with Luer-Lok (BD, catalog number: 302830 , or equivalent)
Sterile 50 ml conical tubes (FroggaBio, catalog number: TB50-500 , or equivalent)
Sterile pipette tips (Diamed Advan Tech, catalog numbers: DIATEC520-5376 ; DIATEC520-5876 ; DIATEC520-6501 , or equivalent)
Polycarbonate tubes and lids (Beckman Coulter, catalog number: 355618 , or equivalent)
Serological pipettes, 10 ml (Corning, catalog number: 4488 , or equivalent)
293T cells (ATCC, catalog number: CRL-3216 )
NIH 3T3 (ATCC, catalog number: CRL-1658 )
R187 Hybridoma (ATCC, catalog number: CRL-1912 )
Anti-eGFP (Takara Bio, catalog number: 632381 )
Anti-Mouse IgG, HRP conjugated (Cell Signaling, catalog number: 7076S )
Anti-Rat IgG, HRP conjugated (Merck, catalog number: AP183P )
Dulbecco's modified Eagle's medium (DMEM) high glucose, with L-glutamine, sodium pyruvate and phenol red (WISENT, catalog number: 319-005-CL , or equivalent)
ECL (Bio-Rad Laboratories, catalog numbers: 1705060S [ClarityTM] or 1705062S [Clarity MaxTM], or equivalents)
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 12483020 , or equivalent)
HCl, 36.5-38% (Fisher Scientific, catalog number: A144S-500 )
Hybridoma-SFM (Thermo Fisher Scientific, GibcoTM, catalog number: 12045076 )
KCl (Fisher Scientific, catalog number: BP366-500 )
KH2PO4 (Fisher Scientific, catalog number: P285 500 )
Methanol (for Transfer Buffer, see Recipes) (VWR, catalog number: 56902-543 )
Milli-Q Water (or equivalent)
Na2HPO4 (Fisher Scientific, catalog number: S393-3 )
NaCl (Fisher Scientific, catalog number: BP358-10 )
NaOH, 10N certified (Fisher Scientific, catalog number: SS255-1 )
Penicillin/Streptomycin (GE Healthcare, catalog number: SV30010 , or equivalent)
Polyethylenimine (PEI) (Polysciences, catalog number: 23966-1 , or equivalent)
Sodium dodecyl sulphate (SDS) (VWR, catalog number: 97064-496 , or equivalent)
Sucrose (WISENT, catalog number: 800-081-LG , or equivalent)
Tris-Base (for transfer buffer, see Recipes) (Fisher Scientific, catalog number: BP152-5 )
Triton X-100 (VWR, catalog number: 97062-208 , or equivalent)
10x PBS (see Recipes)
1x PBS (see Recipes)
PBS-T (see Recipes)
20% (m/v) sucrose in PBS (see Recipes)
2% (v/v) Triton X-100 or 0.2% (m/v) SDS in 5% (m/v) sucrose in PBS (see Recipes)
Complete DMEM (see Recipes)
Transfer Buffer (25x) (see Recipes)
Note: We used VWR as a distributor for Pall & Corning products.
Equipment
Pipettes (Gilson, catalog number: F167700 , or equivalent)
0.22 μm Steritop® filters (Merck, catalog number: SCGPT10RE , or equivalent)
Balance (Fisher Scientific, catalog number: 01-919-358, or equivalent)
Manufacturer: Ohaus, catalog number: 30100606/RM .
Biosafety cabinet (Thermo Fisher Scientific, model: 1323TS , or equivalent)
Digital Imager (GE Healthcare, model: ImageQuant LAS 4000, catalog number: 28955810 , or equivalent)
Fridge (4 °C) (Whirlpool, model: WRT148FZDM , or equivalent)
Hemocytometer (Hausser Scientific, Bright-LineTM, catalog number: 3100 , or equivalent)
Microscope (Fisher Scientific, catalog number: LMI6PH2 , or equivalent)
Manufacturer: Laxco, catalog number: LMI6PH2 .
Refrigerated table-top centrifuge (Thermo Fisher Scientific, model: 75004524 , or equivalent)
Tissue culture incubator, humidity, temperature and CO2 regulated (Thermo Fisher Scientific, model: 3110 , or equivalent)
Type 70Ti Rotor (Beckman Coulter, catalog number: 337922 , or equivalent)
Ultracentrifuge (Beckman Coulter, model: 969347 , or equivalent)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Renner, T. M., Bélanger, K. and Langlois, M. (2018). Retroviral Capsid Core Stability Assay. Bio-protocol 8(18): e3019. DOI: 10.21769/BioProtoc.3019.
Download Citation in RIS Format
Category
Biochemistry > Protein > Stability
Microbiology > Microbe-host interactions > Virus
Molecular Biology > Protein > Stability
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
302 | https://bio-protocol.org/exchange/protocoldetail?id=302&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of cDNA Library for dRNA-seq
Feng Li
BB Barbara Baker
Published: Vol 2, Iss 23, Dec 5, 2012
DOI: 10.21769/BioProtoc.302 Views: 15175
Original Research Article:
The authors used this protocol in Jun 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2012
Abstract
microRNAs (miRNAs) are ubiquitous regulators of gene expression in eukaryotic organisms, which guide Argonaute proteins (AGO) to cleave target mRNA or inhibit its translation based on sequence complementarity. In plants, miRNA directed cleavage occurs on the target mRNA at about 10 to 11 nucleotide (nt) up stream to the site where the 5’ end of miRNA binds. Sequencing of the miRNA directed cleavage products (degradome) is widely employed as a way to both verify bioinformatic predictions of miRNA mediated regulation and identify novel targets of known miRNAs. Here we describe a protocol for preparation of degradome RNA complementary DNA library for high-through-put sequencing (dRNA-seq) using Illumina GA II sequencing platform, which is currently most popular and cost-effective. Using this protocol we successfully generated three dRNA-seq libraries using three solanaceae plants, including tobacco, tomato and potato. Although this protocol was developed with single-plexed adapter, it should be able to generate multiplexed libraries by replacing the 3’ adapter with multiplexing compatible 3’ adapter and replacing the PCR primer with indexed primers.
Keywords: NGS Degradome MiRNA SiRNA Target
Materials and Reagents
RNeasy Plant Mini Kit (QIAGEN, catalog number: 74903 )
OligodT Dynabeads (Life Technologies, Invitrogen™, catalog number: 610-02 )
SeaKem LE Agrose (Lonza, catalog number: 50004 )
Illumina sRNA-seq 3’ adapter (Illumina, catalog number: 1000596 )
RNase free water (Life Technologies, Invitrogen™, catalog number: 10977-023 )
RNeasy Micro Kit (QIAGEN, catalog number: 74004 )
Antarctic phosphatase (New England Biolabs, catalog number: M0289S )
RNase OUT(Life Technologies, Invitrogen™, catalog number: 10777-019 )
T4 RNA Ligase 1 (New England Biolabs, catalog number: M0204S )
Illumina sRNA-seq RT primer (Illumina, catalog number: 1000597 )
Illumina sRNA-seq 5’ adapter (Illumina , catalog number: 1000595 )
Illumina sRNA-seq PCR primer (Illumina, catalog number: 1000591 , 1000592 )
Gel purification kit (QIAGEN, catalog number: 28704 )
dNTP (New England Biolabs, catalog number: N0447S )
SuperScript II RT(Life Technologies, Invitrogen™, catalog number: 18064-022 )
Zero Blunt® PCR Cloning Kit (Life Technologies, Invitrogen™, catalog number: K2700-40 )
Agrose gel (Lonza)
Equipment
PCR Thermal Cycler
Illumina GA II sequencing system
Pipette (20 μl, 200 μl, 1,000 μl)
Magnetic bar
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA interference
Systems Biology > Transcriptomics > RNA-seq
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,020 | https://bio-protocol.org/exchange/protocoldetail?id=3020&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Qualitative in vivo Bioluminescence Imaging
DS Devbarna Sinha
Zalitha Pieterse
PK Pritinder Kaur
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3020 Views: 8745
Edited by: Nicoletta Cordani
Reviewed by: Laura J. Lambert
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Bioluminescence imaging (BLI) technology is an advanced method of carrying out molecular imaging on live laboratory animals in vivo. This powerful technique is widely-used in studying a variety of biological processes, and it has been an ideal tool in exploring tumor growth and metastatic spread in real-time. This technique ensures the optimal use of laboratory animal resources, particularly the ethical principle of reduction in animal use, given its non-invasive nature, ensuring that ongoing biological processes can be studied over time in the same animal, without the need to euthanize groups of mice at specific time points. In this protocol, the luciferase imaging technique was developed to study the effect of co-inoculating pericytes (contractile, αSMA+ mesenchymal stem cell-like cells, located abluminally in microvessels) on the growth and metastatic spread of ovarian cancers using an aggressive ovarian cancer cell line–OVCAR-5–as an example.
Keywords: Bioluminescence Tumor imaging Luciferase Imaging Metastasis Ovarian cancer
Background
The principle of bioluminescence imaging (BLI) is based on the light-emitting properties of a relatively simple biochemical process, i.e., luciferase-mediated oxidation of the molecular substrate luciferin to produce light. In cancer research, BLI is a popular tool (Contag et al., 2000) used to study the metastatic spread of luciferase-transduced cancer cells in live animals in vivo. Most animal tissues have little to no baseline bioluminescent properties, which ensures that there is a very high signal to noise ratio in BLI experiments. Nevertheless, it is always pragmatic to ensure that BLI experiments are conducted with non-substrate injected rodents as a negative control group. A few crucial factors are key to ensuring best practice in performing BLI experiments on rodents for the detection of luciferase-tagged cancer cells. Firstly, BLI is a powerful tool that allows easy detection of luciferase expressing-cells by imaging emitted bioluminescence under anesthesia (Figure 1). However, this technique is essentially qualitative and attempts to quantitate BLI signal can be misleading given that the strength of signal is dependent on several factors including duration of exposure, anesthetic technique, time elapsed after injecting luciferin, etc. Moreover, published evidence indicates that light emission (i.e., quantity of photons) is not directly related to luciferase activity (Rice et al., 2001). Secondly, the location or depth of the tissue of interest, particularly its distance from the skin’s surface, and the size of the metastatic cell mass are important considerations in planning a BLI experiment (Weissleder, 2001). This is because photon loss occurs as the signal travels through the tissue mass–consequently, luciferase-tagged cells/tissues that are closer to the skin’s surface tend to appear brighter as do larger metastases. Micrometastases can be detected but may require sacrificing the animal and imaging the organs directly after skin removal in place of intact animals. Notwithstanding these and other challenges, BLI is an efficient and powerful, non-invasive technique for studying biological processes in vivo.
Figure 1. Imaging primary subcutaneous OVCAR-5 tumors and metastases. A. GFP-luciferase labeled OVCAR-5 cells, xenografted alone (OVCAR-5) or co-injected with pericytes (OVCAR-5+P) generated tumors that were imaged at regular intervals. The increased BLI signal observed in images of pericyte co-injected xenografts show that pericytes promote OVCAR-5 tumor growth rate and induce metastases compared to the control group. B. At day 28 the BLI signal from the primary tumor is saturated, and the mice were sacrificed and the primary tumors (along with the abdominal skin excised to permit clearer imaging of the metastatic nodules–metastatic nodules marked with red rings).
Materials and Reagents
Materials
Pipette tips (Interpath Services, catalog numbers: 39770 , 39730 )
Hamilton® syringe (Hamilton, catalog number: 80366 )
Tissue culture plasticware (6-well plates BD; 2, 5 and 10 ml pipettes SARSTEDT)
Steritop-GP polyethersulfone with low binding PES membrane (0.22 μm pore size) (Merck, Millipore, catalog number: SCGPS05RE )
Pasteur pipette (Biologix, catalog number: 30-0138A1 )
Biological materials
Lentiviral vector pFUGW-Pol2-ffLuc2-eGFP (Addgene, catalog number: 71394 )
OVCAR-5 cell line was obtained from NCI, and authenticated using short tandem repeat markers to confirm cell identity against the Genome Project Database (Wellcome Trust Sanger Institute)
HIV-1 packaging vector pCMV-deltaR8.2 (Addgene, catalog number: 8455 ), a kind gift from Dr. Cameron Johnstone, Anderson Lab, Peter MacCallum Cancer Centre, Melbourne
Packaging cell line HEK293T (ATCC, catalog number: CRL-3216 ), a kind gift from Dr. Cameron Johnstone, Anderson Lab, Peter MacCallum Cancer Centre, Melbourne
Mice: 6-8 weeks old female athymic nude Balb/c mice were obtained from Walter Eliza Hall Institute, housed in a pathogen-free 12 h light–dark environment, fed ad libitum were used for tumorigenicity assays. This age range of mice is optimal for good tumor take rates which decline if older mice (e.g., 10 weeks old) are used.
Reagents
Bovine serum albumin (Sigma-Aldrich, catalog number: A9418-500G )
DAPI:4’, 6’-Diamidino-2-Phenylindole Dihydrochloride (Sigma-Aldrich, catalog number: D9542-5MG )
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
Diflucan (Fluconozole) (Sigma-Aldrich, catalog number: F8929 )
D-Luciferin: Sodium salt 4,5-Dihydro-2-(6-hydroxy-2-benzothiazolyl)-4-thiazolecarboxylic acid sodium salt (Gold Biotechnology, catalog number: LUCNA-1G )
FuGENE 6 (Roche Diagnostics, Mannheim, Germany)
Endothelial basal media (EBMTM-2) (Lonza, catalog number: CC-3156 )
Endothelial growth media (EGMTM-2) SinglequotsTM (Lonza, catalog number: CC-4147 )
Fetal Calf Serum (FCS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10099141 )
Forthane/Isoflurane (Sigma-Aldrich, catalog number: 792632 )
HEPES pH 7.4 (Sigma-Aldrich, catalog number: H0887-100ML )
MatrigelTM (standard) (BD, catalog number: 356234 )
PBS without Ca2+ and Mg2+ (GE Healthcare, Hyclone, catalog number: SH30256.FS )
Penicillin-Streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Polybrene (Sigma-Aldrich, catalog number: 107689 )
Potassium chloride (Sigma-Aldrich, catalog number: P5405 )
Potassium dihydrogen phosphate (Sigma-Aldrich, catalog number: P5655 )
RMPI-1640 (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11875 )
Sodium bicarbonate (Sigma-Aldrich, catalog number: S5761 )
Sodium chloride (Astral Scientific, catalog number: AMX190 )
Sodium hydrogen phosphate (Sigma-Aldrich, catalog number: S5136 )
Trypsin 0.05% (Thermo Fisher Scientific, GibcoTM, catalog number: 25300120 )
Trypan blue (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Phosphate buffered Saline (PBS) (see Recipes)
RPMI-1640 media (see Recipes)
Equipment
Pipettes (Corning, catalog numbers: 4487 , 4488 , 4489 )
Hemocytometer (ProSciTech, catalog number: SVZ2NI0U )
Cell culture incubator (NuAire, model: NU-5510/E )
Centrifuge (Beckman Coulter, model: Allegra X-12 )
Electronic calipers (Fisher Scientific, catalog number: 14-648-17 )
SW28 Rotor (Beckman Coulter, catalog number: 342207 )
Ultracentrifuge (Beckman Coulter, model: OptimaTM XE-100 )
Fluorescent Microscope (Nikon Instruments, model: Nikon A1+ Confocal Microscope )
Xenogen Realtime Imaging System (IVIS Lumina II)
Becton Dickinson Biosciences FACS DivaTM cell sorter
Software
Prism 6 (GraphPad Inc.)
Photoshop CS 6.0 (Adobe Inc.)
Metamorph (Molecular devices)
ImageJ (NIH software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sinha, D., Pieterse, Z. and Kaur, P. (2018). Qualitative in vivo Bioluminescence Imaging. Bio-protocol 8(18): e3020. DOI: 10.21769/BioProtoc.3020.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Animal models
Stem Cell > Adult stem cell > Epithelial stem cell
Cell Biology > Cell engineering > Lentiviral delivery
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,021 | https://bio-protocol.org/exchange/protocoldetail?id=3021&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Activation of Fibroblast Contractility via Cell-Cell Interactions and Soluble Signals
Neha Pincha
Dyuti Saha
Tanay Bhatt
Ravindra K. Zirmire
CJ Colin Jamora
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3021 Views: 8177
Edited by: Jia Li
Reviewed by: Salah BoudjadiYoshihiro Adachi
Original Research Article:
The authors used this protocol in May 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2018
Abstract
The collagen contraction assay is an in vitro, three-dimensional method to determine the factor(s) affecting the contractile behavior of activated cells such as fibroblasts in either physiological or pathological scenarios. The collagen lattices/hydrogels are seeded with fibroblasts to mimic the interactions between these cells and their surrounding extracellular matrix proteins in the connective tissue. This method is an important platform to assess components as potential therapeutic targets to prevent pathologies such as fibrosis, which are manifestations of hyperactivated fibroblasts. We have described a basic version of this collagen contraction assay, which is amenable to customization using different cell types under diverse experimental conditions.
Keywords: Collagen contraction Fibroblast Mast cell Collagen lattice/hydrogel Fibrosis
Background
Tissue contraction and remodeling of the extracellular matrix are essential processes in numerous physiological conditions such as wound healing. Central to these two phenomena are fibroblasts, which not only produce and secrete the extracellular matrix proteins but can also reorganize them through mechanical interactions. Interestingly, these cellular behaviors are often exaggerated in pathological conditions such as fibrosis (Desmoulière et al., 2005), thereby illustrating the need to understand the molecular regulation of these processes. Though it has long been known that collagen, one of the main components of the extracellular matrix, is a major player in tissue contraction (Bell et al., 1979), a thorough understanding of the mechanistic details of this process remain elusive. The study of the contraction of fibroblast populated collagen matrices in vitro has enabled researchers to identify novel players which bring about tissue contraction (Ngo et al., 2006; Su and Chen, 2015). Based on this assay, soluble factors such as TGFβ (Levi-Schaffer et al., 1999) and those from immune cells (Garbuzenko et al., 2002; Zagai et al., 2004) have been identified as major factors affecting fibroblast activity. To a large extent, relative to soluble extracellular signals, the contribution of cell-cell interactions on the contractile ability of fibroblasts has been understudied. Recently, we have shown that an important player regulating fibroblast-mediated contraction is the heterotypic cell-cell interactions with immune cells such as mast cells (Pincha et al., 2018). In this protocol, we provide a method to use this assay to determine the effect of cell-cell interactions on matrix contraction. In doing so, we have elaborated upon previously published protocols (Ngo et al., 2006; Su and Chen, 2015) and provide simple alternatives to setting up the assay and the subsequent analysis of the gels. This protocol can also be modified to recapitulate the native/in vivo environments of diverse cell types to assay their regulation within their “normal” microenvironment.
Materials and Reagents
Note: The materials below can also be substituted for equivalent reagents from other companies. Cell culture media and additives will vary based on the cells to be used for the assay. For our protocol, we have used primary dermal fibroblasts from neonatal mice and the mast cell line MCP-5.
Cell culture and counting
70% ethanol
Recombinant mouse IL-3 (Thermo Fisher Scientific, GibcoTM, catalog number: PMC0034 )
Note: Lyophilized mIL-3 should be stored at 4 °C. Aliquot and store reconstituted mIL-3 at ≤ -20 °C, use within 12 months of reconstitution.
Dulbecco’s Modified Eagle’s Medium (DMEM) (HiMedia Laboratories, catalog number: AL066A )
Note: Store at 4 °C for up to 12 months.
Fetal Bovine Serum (Thermo Fisher Scientific, GibcoTM, catalog number: 26140095 )
Note: Store at -20 °C for up to 12 months.
Sodium Pyruvate (Thermo Fisher Scientific, GibcoTM, catalog number: 11360070 )
Non-Essential Amino Acids (Thermo Fisher Scientific, GibcoTM, catalog number: 11140050 )
RPMI media (Sigma-Aldrich, catalog number: R0883 )
Note: Store at 4 °C. Media is light sensitive, use within 12 months of manufacturing.
Solution of penicillin-streptomycin (10,000 U/ml penicillin G sodium and 10,000 μg/ml streptomycin sulfate, Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Note: Use within 12 months of manufacturing.
Solution of trypsin, 2.5% 10x stock (HiMedia Laboratories, catalog number: TCL051 )
Note: Use within 12 months of manufacturing.
Trypan Blue stain (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Note: Use within 3 years of manufacturing.
1x PBS (see Recipes) (Cold Spring Harbor, doi:10.1101/pdb.rec556)
Collagen lattice
10 μl, 200 μl and 1,000 μl pipette tips (any desired make)
0.22-μm syringe-driven filter units (Merck, catalog number: SLGV033RS )
10 ml Syringes (Dispo Van)
24-well cell culture plates (Eppendorf, catalog number: 0030722116 )
15 ml Graduated Centrifuge Tubes, sterilized (Tarsons, catalog number: 546021 )
1.5 ml microfuge tubes (Corning, Axygen®, catalog number: MCT-150-C )
Note: Need to be autoclaved/sterilized before use.
Rat tail collagen type 1 (Merck, catalog number: 08-115 )
Note: Store at 4 °C, use within 12 months of manufacturing.
Glacial Acetic acid 99.8% (Sigma-Aldrich, catalog number: 109088 )
Note: Store at 15-30 °C.
NaOH pellets (Sigma-Aldrich, catalog number: S8045 )
Note: Store at 15-30 °C.
Stock collagen solution (3 mg/ml) (see Recipes)
1 M NaOH Solution (see Recipes)
Acetic acid solution (0.1%) (see Recipes)
Image acquisition/analysis
Parafilm (Bemis, catalog number: PM996 )
Crystal Violet stain (Optional; Sigma-Aldrich, catalog number: C3886 )
Note: Store at 15-30 °C.
Equipment
10 μl, 200 μl and 1 ml pipettes (any desired make)
Centrifuge (Eppendorf, model: 5810 R or equivalent)
Hemocytometer (Sigma-Aldrich, catalog number: Z359629 )
Incubator (CO2 incubator, Thermo Fisher Scientific, model: FormaTM Steri-CycleTM , or equivalent)
Microscope (OLYMPUS, model: SZX16 or equivalent)
Digital Camera 3.2 megapixel (Nikon, model: COOLPIX A10 or equivalent) and stand with camera holder
Flatbed scanner (Epson, model: V39 or equivalent)
Note: Any of the individual listed equipment (5, 6 or 7) is sufficient for final imaging of the collagen gels.
Software
ImageJ Software v. 1.8.0 (National Institutes of Health, Bethesda, MD, https://imagej.nih.gov/ij/download.html) (Schindelin et al., 2012; Rueden et al., 2017)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Pincha, N., Saha, D., Bhatt, T., Zirmire, R. K. and Jamora, C. (2018). Activation of Fibroblast Contractility via Cell-Cell Interactions and Soluble Signals. Bio-protocol 8(18): e3021. DOI: 10.21769/BioProtoc.3021.
Download Citation in RIS Format
Category
Developmental Biology > Morphogenesis > Motility
Cell Biology > Cell-based analysis > Extracellular microenvironment
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,022 | https://bio-protocol.org/exchange/protocoldetail?id=3022&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extracting and Integrating Protein Localization Changes from Multiple Image Screens of Yeast Cells
AL Alex X Lu
LH Louis-Francois Handfield
Alan M Moses
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3022 Views: 4401
Reviewed by: Ajit ShahKalpa Mehta
Original Research Article:
The authors used this protocol in Apr 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2018
Abstract
The evaluation of protein localization changes in cells under diverse chemical and genetic perturbations is now possible due to the increasing quantity of screens that systematically image thousands of proteins in an organism. Integrating information from different screens provides valuable contextual information about the protein function. For example, proteins that change localization in response to many different stressful environmental perturbations may have different roles than those that only change in response to a few. We developed, to our knowledge, the first protocol that permits the quantitative comparison and clustering of protein localization changes across multiple screens. Our analysis allows for the exploratory analysis of proteins according to their pattern of localization changes across many different perturbations, potentially discovering new roles by association.
Keywords: Proteomics Image analysis Cell biology Computational biology Unsupervised machine learning Protein localization Cluster analysis
Background
Automated high-throughput microscopy technologies can now generate image datasets showing the expression and localization of the majority of the proteome in yeast cells (Mattiazzi Usaj et al., 2016). A key aim of these datasets is to identify and compare proteins that change localization in a chemical or genetic perturbation compared to an untreated wild-type baseline. Previous work has generally focused on identifying all localization changes for a single screen as accurately as possible (Tkach et al., 2012; Chong et al., 2015; Kraus et al., 2017), but has not provided a way to systematically compare these changes. In Lu et al. (2018), we showed that the pattern in which proteins change localization can be inferred by integrating information from microscopy images for each protein under different perturbations. By grouping together proteins with similar patterns of change across different perturbations, we better understand protein function. Here, we describe our protocol for extracting measurements about protein localization from images, comparing the differences between screens, and integrating data from different screens for cluster analysis. Our method is unsupervised and automatically infers proteomic changes from data (Lu and Moses, 2016), allowing it to scale to new datasets with no retraining of parameters.
Equipment
Hardware:
Cluster server and screens
The Budding Yeast Morphologist software is compatible any system that has a GNU C++ compiler. We recommend 200 GB of hard drive space per image screen (each image screen contains ~4,000 images). To detect changes, at least two screens are needed. There is no upper limit, but we used 15 screens (60,000 images, 3 TB of disk space).
We used a cluster server with CentOS 7 with 208 CPU cores and 424 GB of RAM in total.
Dell Precision Tower 5810
The Protein Change Profile software is compatible with any computer with a Python 3.6 installation. We recommend at least 4 GB of RAM, and 2.5 GB of hard drive space per image screen.
We used a Dell Precision Tower 5810 with Windows 8.0 with 8 GB of RAM and an Intel Xeon E5-1620 3.50 GHz CPU.
Software
C++ code and installation instructions
For segmenting yeast microscopy images into single cells and extracting biologically-motivated protein distribution features can be found in the Budding Yeast Morphologist repository: https://github.com/lfhandfield/Budding-Yeast-morphologist.
Python code
For averaging single cell features and unsupervised protein localization change detection can be found in the Protein Change Profile repository: https://github.com/alexxijielu/protein_change_profiles.
This code requires Python 3.6 (we recommend the Anaconda distribution: https://www.anaconda.com/download/). Required packages for the Protein Change Profile repository are listed in the README.md file.
Open source Cluster 3.0 software (de Hoon et al., 2004)
For clustering, we recommend the open source Cluster 3.0 software, available here: http://bonsai.hgc.jp/~mdehoon/software/cluster/software.htm.
Java Treeview (Saldanha, 2004)
For visualization, we recommend Java Treeview, available here: http://jtreeview.sourceforge.net/.
Procedure
Installing the required software and unpackaging the data
The Budding Yeast Morphologist code can be downloaded directly from GitHub>lfhandfield>Budding-Yeast-morphologist as a zip file, or cloned from the repository by using the command line:
git clone https://github.com/lfhandfield/Budding-Yeast-morphologist.git
This command will save a directory with the source code to your system. To install, use a make command with the directory’s path:
./make -C ./Budding-Yeast-morphologist/
The software will be installed in the ./Budding-Yeast-morphologist/bin/ folder.
The Protein Change Profile code can be downloaded directly from Github> alexxijielu/protein_change_profiles as a zip file, or cloned from the repository by using the command line:
git clone https://github.com/alexxijielu/protein_change_profiles.git
No installation is needed. The code is in the protein_change_profiles directory, and can be run directly through Python.
Data
Note: The image screens we will use as examples in this protocol are named after their abbreviations in the CYCLoPS database. Information about the strains and experimental conditions used in these screens can be found here.
Raw image data (Koh et al., 2015) are available at http://142.150.215.41/image_screens/.
Note that these screens are ~85 GB each. Each screen is divided into 20 zip files. The images are 8-channel tiff files, with each file named after and corresponding to a GFP-tagged protein. Each file contains 4 fields-of-view of 2 fluorescent channels, one of a cytosolic RFP, and one of the GFP-tagged protein. Image channels 2, 4, 6, 8 are RFP, with channels 1, 3, 5, 7 corresponding to their respective GFP. Images in this screen were acquired using a high-throughput spinning-disk microscope with a water-immersion 60x objective (NA 1.2, image depth 0.6 μm and lateral resolution 0.28 μm). For further information on strain construction, filter sets, and imaging, refer to Chong et al. (2015).
Zip files of pre-extracted single-cell features for all screens are available at: http://142.150.215.41/single_cell_features/.
Each tab-delimited file is named after and corresponds to a GFP-tagged protein, and contains all single cell features for that given protein, extracted by the Budding Yeast Morphologist software.
To unzip the provided data, you can use the following command line:
unzip <zip file> -d <directory to unzip to>
For example:
unzip ./WT2_0.zip -d ./WT2/
Segment and extract single cell features from the raw images
Note: Segmenting and extracting features from raw images is computationally time-consuming. Moreover, the datasets are large. For convenience, we also provide pre-extracted single-cell features that have been calculated using the procedure in this step. If working from these features instead of the raw images, skip to the next step.
We segmented raw images into single cells, and calculated several measures of protein distribution (as described in Handfield et al., 2013) for each cell. To be included for analysis, each set of images for a protein tag must have at least 1 cell in 5 discrete cell cycle stages; we recommend at least 20 cells per set of images to meet this requirement. Images must be provided as .tiff files. An example of a raw image is shown in Figure 1 (i).
An example of how to segment and extract features from a single image is provided in /example/example.sh in the Budding Yeast Morphologist directory. The time it takes to segment an image will depend on the number of cells in the image and how clumped they are, but in general, an image will take 1-5 min to process.
For convenience, we have provided a Python script to batch this pipeline over every .tif file in a directory, as batch_segmentation.py in the Protein Change Profile repository. Note that this script assumes the 8 channel convention for the images (as described in the Data section) and may need modifications if the user’s images are in a different format. To run this script use:
python batch_segmentation.py <directory of tif files to analyze> <location of the bin folder for the Budding Yeast Morphologist software>
For example:
python batch_segmentation.py ./WT2/ /Budding-Yeast-morphologist/bin/
This script will output two files for each image in the input directory: a tab-delimited .txt file containing the single cell features (used for Procedure B), and a _preview.tiff file that overlays the segmentation results onto the images. Simplified examples of the segmentation preview and tab-delimited text single cell feature files are shown in Figure 1 (ii) and Figure 1 (iii).
An example of a single cell feature file extracted by this step can be found in the Protein Change Profile repository in the examples folder as example_single_cell_features.txt. The columns in this file are extracted features, while the rows each correspond to a single cell. These features will be automatically post-processed in the next step. You should have a single cell feature file for each protein.
Note: It is assumed that each single cell feature file contains all single cells for a protein. The file names of the single cell features will be used to automatically pair proteins in subsequent steps, so ensure that the naming convention for files is consistent from screen to screen, with files that should be paired named identically between screens (we recommend naming the files after the protein name to facilitate interpretation of output).
Figure 1. A schematic overview of Procedure B to E in the protocol. We start with raw image files (i), where the GFP channel is shown as green and the RFP channel shown as red. We use our single cell segmentation and feature extraction software to generate segmented micrographs (ii), with single cells segmentations shown as blue lines, and single cell features (iii). The single cell features are binned and averaged into protein features (iv), that are then used to calculate the protein localization change profile (v) between an untreated wild-type and a perturbation. Finally, to integrate protein change profiles from different screens, we concatenate protein change profiles together. We visualize the features of the averaged protein features and the protein localization change profiles as a heat map in this schematic, with positive features being yellow and negative features being blue, and each bar in the heat map corresponding to a feature.
Bin and average the single cell features for each protein
Because we are interested in localization changes as properties of proteins, we use single-cell information to construct summary statistics for each protein.
For each screen, copy the tab-delimited single cell feature files into a separate directory. If you are working from the pre-extracted single-cell features, this has already been done for you. Otherwise, you can use the following command lines:
Make a directory to hold all the feature files:
mkdir <directory name>
For example:
mkdir ./WT2_features/
Copy all of the .txt files from the analyzed folder of .tif files to the directory:
cp -r <directory of analyzed tif files>/*.txt <directory to copy .txt files into>
For example:
cp -r ./WT2/*.txt ./WT2_features/
Run average_single_cells.py in the Protein Change Profile repository as follows:
python average_single_cells.py <directory of feature files> <output file>
For example:
python
average_single_cells.py ./WT2_features/ ./WT2_averaged_features.txt
average_single_cells.py will bin cells into 10 bins by mother/bud cell type and by cell cycle stage, and then calculate the truncated mean over each bin, trimming 5% of the distribution from both tails. We trim the distributions to make the means more robust to outlier cells.
Examples of averaged feature files can be found in the examples directory of the Protein Change Profile repository. Averaged features for the WT2, ALP3, and RAP3 screens can be found as WT2_averaged_features.txt, ALP3_averaged_features.txt, and RAP3_averaged_features.txt, respectively.
Each row in this file corresponds to a protein. The features (described in Handfield et al., 2013) are the columns, and are abbreviated as such in the headers of the tab-delimited output file:
SEF: Average distance between proteins
MCT: Average distance of proteins to the protein mass center
EDG: Average distance of proteins to the cell periphery
CEN: Average distance of proteins to the cell center
NEC: Average distance of proteins to the bud neck
B: Bud cells
M: Mother cells
0-4: Cell cycle stage, estimated using bud size as a heuristic; 0 is the earliest stage, while 4 is the latest stage.
Calculate the protein localization change profile between each perturbation and an untreated wild-type screen
The image features may not be directly comparable due to systematic biases and technical differences between screens. To correct for these effects, we use a locally adaptive k-nearest neighbor unsupervised localization change detection described in Lu and Moses (2016).This step will output protein localization change profiles, which represent the expectation of protein localization change for each protein between the two image screens. The protein localization change profiles consist of a z-score for each feature, describing the direction and magnitude by which each feature deviates from the expectation of there being no localization change.
Using the averaged features from Procedure C, run calculate_protein_change_profiles.py in the Protein Change Profile repository as follows:
python calculate_protein_change_profiles.py <file for untreated wild-type screen> <file for perturbation screen> <output file>
For example:
python
calculate_protein_change_profiles.py ./WT2_averaged_features.txt ./ALP3_average_features.txt ./ALP3_change.txt
calculate_protein_change_profiles.py will automatically filter the input feature files to include proteins present in both screens, and perform unsupervised localization change detection. By default, the parameter k is set to 50, as set in Lu et al., 2018. This parameter controls the number of neighbors to use in determining if the difference between the features for each protein deviates from expectation or not. In our experiments, we found this number to be robust, so it should not need much fine-tuning.
To adjust k, pass an integer as an additional parameter:
python calculate_protein_change_profiles.py <file for untreated wild-type screen> <file for perturbation screen> --k <k>
For example:
python
calculate_protein_change_profiles.py ./WT2_averaged_features.txt ./ALP3_averaged_features.txt ./ALP3_change.txt --k 100
Examples of protein localization change profile files for the RAP3 and ALP3 screens relative to the WT2 screen can be found in the examples directory of the Protein Change Profile repository, as RAP3_change.txt and ALP3_change.txt, respectively. Each row in these files is a protein, and each column is a feature, corresponding to the features introduced in Procedure C.
Note: The unsupervised localization change detection algorithm uses the Euclidean distance, and is sensitive to feature scaling. Our features are all scaled similarly, so we did not need to normalize them before applying this step. If you are using a different feature set, you may need to pre-process your data.
Concatenate the protein change profiles for different perturbations together
We integrate different screens together, so that we can consider the localization changes for proteins across multiple screens simultaneously. Note that we consider each replicate as a different screen in this protocol; we found that this facilitates clustering and interpretation, because if one replicate does not exhibit a consistent localization change, the effect will be apparent from replicates having different protein localization change profiles.
Using the protein localization change profiles calculated in Procedure D, and a master list of all proteins studied in all screens (for our screens, this is available as protein_list.txt in the Protein Change Profile repository), protein localization change profiles for different screens can be concatenated using concatenate_profiles.py as follows:
python concatenate_profiles.py -files <list of protein localization change profile files> -output <output file> -reference <master list of all proteins>
For example:
python concatenate_profiles.py -files ./ALP3_change.txt ./RAP3_change.txt -output ./concatencated_changes.txt -reference ./protein_list.txt
An example of a concatenated profile file can be found as ./concatenated_changes.txt in the examples directory of the Protein Change Profile repository. Note that if a protein does not appear in the protein localization change profiles of a screen (which may occur because the protein has been filtered out due to insufficient data), then the values of the features for that screen will be recorded as ‘nan’ (not an integer) in the file.
Cluster the concatenated protein change profiles
The clustering step will group proteins with similar protein localization change profiles together. While numerous options exist, we demonstrate how to use the Cluster 3.0 software here, which we chose due to its simple graphical interface.
Open the concatenated protein change profile file generated by Procedure E in Cluster 3.0 by selecting File > Open Data File.
Preprocess the data in the “Filter Data” tab (Figure 2A):
“% Present >=” will filter proteins with too much missing data (i.e., proteins with ‘nan’ values from the previous step), and should be selected as these proteins may adversely affect the clustering results. We suggest a value of 80.
“At least _ observation with abs(Val) >= _” will filter out proteins with very little signal in their protein localization change profiles. This filter is optional, but can improve the visualization by excluding proteins not predicted to change in any of the screens. The values will depend on how many screens incorporated, but we suggest at least 2 observations and an abs(Val) >= 4.0.
Clicking “Apply Filter” will show the number of proteins after filtering. To proceed, click “Accept Filter”.
Perform Hierarchical Clustering (Figure 2B):
Click on the “Hierarchical” tab.
In the “Genes” section, check “Cluster”. We suggest using “Correlation (uncentered) under “Similarity Metric”.
To perform clustering, select a “Clustering Method”. We suggest “Average Linkage”.
The clustered file will be saved in the same location as your original input, as a cdt file.
Figure 2. Clustering in Cluster 3.0. A. Options for data preprocessing steps. B. Options for performing hierarchical clustering.
Visualize the cluster results as a heat map
We use the Java Treeview software to visualize the clustered heat maps generated by Cluster 3.0.
Open the cdt file generated in Procedure F by selecting File → Open.
Display settings can be configured in Settings → Pixel Settings. Here, the color scheme, contrast, and scale of the heat map can be set. We recommend setting the contrast to at least 5.0 to visualize the range of our features.
Figure 3 shows clustering results for the example concatenated profile file, provided as ./concatenated_changes.txt in the examples directory of the Protein Change Profile repository, and pre-processed following the steps and recommended parameters in Procedure F. Clusters can be selected by clicking on the dendogram in the left-most panel of the Java Treeview window; the proteins involved in these clusters can be seen in the list on the right-most panel.
Figure 3. Visualizing the results of clustering with Java Treeview. We have selected a cluster of protein change profiles with strong signal in the ALP3 screen (left-most panel). The proteins inside of this cluster can be seen in the right-most panel. By default, Java Treeview will show negative values in green and positive values in red (these settings can be configured under Settings > Pixel Settings). According to this scheme, this cluster for the ALP3 screen has strongly positive values for the “average distance between proteins” (SEF) and “average distance to protein mass center” (MCT) features, and strongly negative values for the “average distance to cell edge” (EDG) features (feature headers have been highlighted in the middle panel), suggesting that these proteins are moving further away from the cell edge and becoming denser in protein distribution in the ALP3 screen.
Data analysis
We refer to Lu et al. (2018) for details and procedures for the specific downstream analyses that we conducted on the clusters obtained from this data. As a high-throughput method, there are points in the protocol in which false positives and negatives may arise; we refer users to the discussion section of Lu et al. (2018) for an overview of these, as well as best practices on how to interpret our output.
Acknowledgments
This work was funded by the National Science and Engineering Research Council, Canada Research Chairs, Canada Foundation for Innovation, Canadian Institutes of Health Research, and Canadian Institute for Advanced Research.
Competing interests
The authors declare no competing interests.
References
Chong, Y. T., Koh, J. L., Friesen, H., Duffy, S. K., Cox, M. J., Moses, A., Moffat, J., Boone, C. and Andrews, B. J. (2015). Yeast proteome dynamics from single cell imaging and automated analysis. Cell 161(6): 1413-1424.
de Hoon, M. J., Imoto, S., Nolan, J. and Miyano, S. (2004). Open source clustering software. Bioinformatics 20(9): 1453-1454.
Handfield, L. F., Chong, Y. T., Simmons, J., Andrews, B. J. and Moses, A. M. (2013). Unsupervised clustering of subcellular protein expression patterns in high-throughput microscopy images reveals protein complexes and functional relationships between proteins. PLoS Comput Biol 9(6): e1003085.
Koh, J. L., Chong, Y. T., Friesen, H., Moses, A., Boone, C., Andrews, B. J. and Moffat, J. (2015). CYCLoPs: A comprehensive database constructed from automated analysis of protein abundance and subcellular localization patterns in Saccharomyces cerevisiae. G3 (Bethesda) 5(6): 1223-1232.
Kraus, O. Z., Grys, B. T., Ba, J., Chong, Y., Frey, B. J., Boone, C. and Andrews, B. J. (2017). Automated analysis of high-content microscopy data with deep learning. Mol Syst Biol 13(4): 924.
Lu, A. X., Chong, Y. T., Hsu, I. S., Strome, B., Handfield, L. F., Kraus, O., Andrews, B. J. and Moses, A. M. (2018). Integrating images from multiple microscopy screens reveals diverse patterns of change in the subcellular localization of proteins. ELife 7: e31872.
Lu, A. X. and Moses, A. M. (2016). An unsupervised kNN method to systematically detect changes in protein localization in high-throughput microscopy images. PLoS One 11(7): e0158712.
Mattiazzi Usaj, M., Styles, E. B., Verster, A. J., Friesen, H., Boone, C. and Andrews, B. J. (2016). High-content screening for quantitative cell biology. Trends Cell Biol 26(8): 598-611.
Saldanha, A. J. (2004). Java Treeview--extensible visualization of microarray data. Bioinformatics 20(17): 3246-3248.
Tkach, J. M., Yimit, A., Lee, A. Y., Riffle, M., Costanzo, M., Jaschob, D., Hendry, J. A., Ou, J., Moffat, J., Boone, C., Davis, T. N., Nislow, C. and Brown, G. W. (2012). Dissecting DNA damage response pathways by analysing protein localization and abundance changes during DNA replication stress. Nat Cell Biol 14(9): 966-976.
Copyright: Lu et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lu, A. X., Handfield, L. and Moses, A. M. (2018). Extracting and Integrating Protein Localization Changes from Multiple Image Screens of Yeast Cells. Bio-protocol 8(18): e3022. DOI: 10.21769/BioProtoc.3022.
Lu, A. X., Chong, Y. T., Hsu, I. S., Strome, B., Handfield, L. F., Kraus, O., Andrews, B. J. and Moses, A. M. (2018). Integrating images from multiple microscopy screens reveals diverse patterns of change in the subcellular localization of proteins. ELife 7: e31872.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fluorescence
Microbiology > Microbial cell biology > Cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,023 | https://bio-protocol.org/exchange/protocoldetail?id=3023&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Behavioral Evaluation of Odor Memory in Mice
AA Afif J. Aqrabawi
JK Jun Chul Kim
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3023 Views: 4664
Edited by: Edgar Soria-Gomez
Reviewed by: Shauna ParkesDeepika Suri
Original Research Article:
The authors used this protocol in Dec 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2016
Abstract
Behavioural tests based on the spontaneous recognition paradigm have been used extensively for examining the memory capacity of rodents. By exploiting their innate preference to investigate novel stimuli, inferences can be drawn about the perceived familiarity of encountered objects. Olfaction is the dominant sense used by mice to navigate their environment, yet these tests are often conducted using visual objects. By employing odors, one can reduce the high level of variability commonly observed between subjects. In this paper, we describe a protocol for assessing context-dependent odor memory by probing spatial and temporal associations separately or in conjunction with each other. We also detail a context-independent novel odor recognition protocol. These tests offer a simple and effective method for measuring odor memory in rodents using cheap and easily obtained materials.
Keywords: Memory Olfactory Behaviour Spontaneous Novelty Context
Background
When presented with a novel and familiar odor, mice behaviorally express memory for the familiar odor by spending a greater proportion of time investigating the unknown stimulus (Ennaceur and Delacour, 1988). Previously encountered odors can also instigate an increase in investigation if it is found in a novel position in space or temporal sequence (Mitchell and Laiacona, 1998; Eacott and Norman, 2004; Dere et al., 2005; Hunsaker et al., 2008; Barker et al., 2017; Aqrabawi and Kim, 2018). This sensitivity to the contextual information associated with an odor can be useful for evaluating different aspects of memory which may manifest from unique neural substrates. This is particularly useful when investigating with animal models of memory disorders where one form of memory is affected to a greater extent. Notably, none of the behavioral paradigms require extensive training and can be easily modified to suit experimental needs.
Materials and Reagents
Woodchip bedding
3 cm wide x 1 cm high aluminum cups
Ziploc bags
Ground herbs and spices (Club House brand, although others are acceptable)
Equipment
Acrylic glass cages (50 cm x 25 cm x 20 cm and 50 cm x 50 cm x 20 cm) (Figure 1)
Video Camera
Figure 1. Adaptable apparatus. Photograph of an acrylic glass cage (50 cm x 25 cm x 20 cm) used for Procedures A-D.
Software
ANY-maze Behavioural Tracking Software (Stoelting Co)
GraphPad Prism (GraphPad Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Aqrabawi, A. J. and Kim, J. C. (2018). Behavioral Evaluation of Odor Memory in Mice. Bio-protocol 8(18): e3023. DOI: 10.21769/BioProtoc.3023.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,024 | https://bio-protocol.org/exchange/protocoldetail?id=3024&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Artificial Inhalation Protocol in Adult Mice
TE Thomas P. Eiting
MW Matt Wachowiak
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3024 Views: 4565
Edited by: Oneil G. Bhalala
Reviewed by: Tanveer AhmadEhsan Kheradpezhouh
Original Research Article:
The authors used this protocol in Feb 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2018
Abstract
Research in the area of in vivo olfactory physiology benefits from having direct access to the nasal airways through which odorants can be presented. Ordinarily, the passage of odorants through the airways is controlled by respiratory rhythm. This fact makes it difficult to control the timing and strength of an olfactory stimulus, since animals must breathe regularly, and the act of breathing itself also controls odorant presentation. However, using an artificial inhalation preparation allows us to decouple breathing from olfaction. With this technique we present oxygen and anesthetic (if desired) to the lungs directly and independently control odorant access to the nasal passages. This technique allows for direct control of odorant presentation in vivo, enabling more precise control of parameters of stimulation when investigating olfactory processing. This technique may have additional applications, for example in aerosolized drug delivery.
Keywords: Inhalation Olfaction Nasopharynx Respiration Tracheotomy
Background
Olfaction, aerosolized drug delivery, and many facets of airway humidification and homeostasis are governed by active respiration through the nasal passages. Basic research into these areas benefits from being able to actively control respiration in an anesthetized preparation. Our lab focuses in part on how active respiration controls olfactory coding in the olfactory bulb, which is the site of the first synapse in the neurobiology of odor perception. To address questions along this front in anesthetized mice, we employ an artificial respiration strategy that decouples airflow through the nasal passages from gas exchange with the lungs. This type of preparation allows experimentally manipulating nasal airflow while simultaneously delivering oxygenated air (usually incorporating a dilute aerosolized general anesthetic) to the lungs, thus producing a stable in vivo preparation that can last for eight hours or more.
This protocol is modified from an earlier form that has been briefly outlined in previous publications (Wachowiak and Cohen, 2001; Vučinić et al., 2006). Our lab and others have used this or a similar technique to investigate odor processing in the olfactory bulb of anesthetized rodents for several years (e.g., Sobel and Tank, 1993; Wachowiak and Cohen, 2001; Spors et al., 2006; Bathellier et al., 2008; Wachowiak et al., 2013; Rothermel et al., 2014; Economo et al., 2016). Here, we provide a detailed protocol for this method with the goal making it more easily adopted, and we expect that it may even find uses outside of the community working on olfactory physiology in rodents.
Materials and Reagents
Surgical thread, 6-0 Silk Suture Thread (Surgical Specialities, LOOKTM, catalog number: SP102 )
Micro swabs (Absorbent Points #501) (Henry Schein, catalog number: 9004693 )
Razor blade (Exel Surgical Blades) (Exel International, model: #11, catalog number: 29502 )
Trachea Tubing, 0.034” x 0.050” x 0.008” (A-M systems, catalog number: 801900 )
Sniff Tubing, 0.045” x 0.062” x 0.0085” (A-M systems, catalog number: 802500 )
Sniff Connector, 0.04” ID, 0.085” OD (Dow Corning, SilasticTM, catalog number: 508-005 )
T-junction tubing connector (about ¼” diameter), connected to flexible tubing (Tygon)
Y-connector (Grainger), 1/16” (for connecting and then splitting the sniff tubing)
Adult M or F mice (we use C57/Bl6, but any strain should work) of healthy weight (~20-40 g)
Super Glue (Henkel, Loctite, catalog number: LOCTITE 404 )
0.5% bupivacaine (Marcaine, Hospira Inc.)
Ketamine/xylazine cocktail
Isoflurane (VetONE Fluriso)
Nair (Church and Dwight Co.)
Denture/Dental Cement (Teets Cold Cure, Co-Oral-Ite Dental Mfg Co.)
Equipment
Isoflurane vaporizer (VetEquip)
3-way solenoid valve (Cole-Parmer, catalog number: EW-01540-11 )
Soldering iron
A vacuum line or other way of generating vacuum
Custom-cut steel headbar
Note: We use one that is roughly omega-shaped, but many shapes would suffice. Should be roughly 0.5 mm thick.
Heating pad
Two flow meters (Aalborg) (one of which is capable of 500 ml/min, the other of which is capable of 1 L/min or more)
Pressure sensor (Honeywell, catalog number: ASCX01DN or similar), mounted to circuit board and connected to Sniff Tubing via Y-connector
Tank of Compressed Oxygen Gas
Very fine surgical scissors (Roboz Surgical Instrument, catalog number: RS-5610 )
Fine Forceps (Fine Science Tools, model: Dumont #5 )
8" x 8" breadboard (ThorLabs)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Eiting, T. P. and Wachowiak, M. (2018). Artificial Inhalation Protocol in Adult Mice. Bio-protocol 8(18): e3024. DOI: 10.21769/BioProtoc.3024.
Diaz-Quesada, M., Youngstrom, I. A., Tsuno, Y., Hansen, K. R., Economo, M. N. and Wachowiak, M. (2018). Inhalation Frequency Controls Reformatting of Mitral/Tufted Cell Odor Representations in the Olfactory Bulb. J Neurosci 38(9): 2189-2206.
Download Citation in RIS Format
Category
Neuroscience > Sensory and motor systems > Animal model
Neuroscience > Neuroanatomy and circuitry > Animal model
Cell Biology > Tissue analysis > Physiology
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,025 | https://bio-protocol.org/exchange/protocoldetail?id=3025&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
6-hydroxydopamine (6-OHDA) Oxidative Stress Assay for Observing Dopaminergic Neuron Loss in Caenorhabditis elegans
SO Sarah-Lena Offenburger
AG Anton Gartner
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3025 Views: 6313
Reviewed by: Khyati Hitesh ShahAnand Ramesh Patwardhan
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
The nematode Caenorhabditis elegans is a powerful genetic model that can be used to investigate neuronal death. Research using C. elegans has been crucial to characterize cell death programmes that are conserved in mammals. Many neuronal signaling components, such as those mediating dopaminergic neurotransmission, are preserved as well. Dopaminergic neurons are progressively lost in Parkinson’s disease and an important risk factor to develop this disease appears to be oxidative stress, the increased occurrence of highly reactive oxygen species. Oxidative stress-induced dopaminergic neurodegeneration is mimicked in animal models by treatment with 6-hydroxydopamine (6-OHDA), a dopamine analog, which is specifically taken up into dopaminergic neurons. After exposing C. elegans to 6-OHDA, the loss of fluorescently labeled dopaminergic neurons can be easily monitored. An organisms’ sensitivity to oxidative stress is thought to be influenced by basal levels of intrinsic oxidative stress and the ability to counteract oxidative stress and oxidative stress-induced damage. The C. elegans ‘6-OHDA model’ led to the discovery of novel genes that are required to protect dopaminergic neurons and it has helped to determine the effects of conserved cell death and cell engulfment pathways in dopaminergic neurodegeneration. Here, we describe a simple protocol that allows for the easy detection of dopaminergic neuron loss after 6-OHDA treatment in C. elegans.
Keywords: C. elegans Caenorhabditis elegans 6-OHDA 6-hydroxydopamine Oxidative stress assay Intoxication Dopaminergic neurodegeneration
Background
The gradual loss of dopaminergic neurons can be recapitulated in animal models following exposure to the oxidative stress-inducing drug 6-hydroxydopamine (6-OHDA) (for review Schober, 2004). In contrast to other neurodegenerative drugs such as MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), 6-OHDA is safer to handle as it does not pass the blood-brain-barrier. 6-OHDA is a hydroxylated dopamine analog, which is specifically taken up into dopaminergic neurons by the dopamine transporter and blocks complex I of the respiratory chain (Schober, 2004). The resulting formation of reactive oxygen species is thought to trigger 6-OHDA-induced neurodegeneration (Schober, 2004).
6-OHDA exposure of the nematode Caenorhabditis elegans leads to the selective loss of dopaminergic neurons (Nass et al., 2002) and components of dopaminergic neurotransmission are highly conserved compared to mammals (for review Nass et al., 2001). C. elegans hermaphrodites possess eight dopaminergic neurons: four CEP (cephalic sensilla) and two ADE (anterior deirids) dopaminergic neurons in the head, and two PDE (posterior deirids) dopaminergic neurons in the midbody (Sulston et al., 1975). These neurons can be specifically labeled by expression of a fluorescent protein driven by the promoter of the dat-1 dopamine transporter (Nass et al., 2002). The C. elegans 6-OHDA model can be used to understand how dopaminergic neurons maintain their integrity when subjected to oxidative stress.
The first published 6-OHDA intoxication protocol for C. elegans used high concentrations of 6-OHDA elicit dopaminergic neurodegeneration in wild-type animals (Nass et al., 2002). Mutation of the dopamine transporter dat-1, which is required for neuronal 6-OHDA uptake, was shown to confer 6-OHDA resistance (Nass et al., 2002). After 6-OHDA exposure during larval stages (L3 and L4), dopaminergic neurodegeneration was scored in a low-throughput manner by mounting adult animals on cover slide (Nass et al., 2002; Tucci et al., 2011). We adapted the protocol to screen for mutants that are hypersensitive to 6-OHDA exposure by using lower 6-OHDA concentrations that do not elicit neurodegeneration in wild-type animals. We expose synchronized L1 stage larvae in 96-well plates and score adults directly on agar plates, allowing for high-throughput screening. This approach led to the characterization of the tetraspanin gene tsp-17, the neuroligin-like gene glit-1 and the transthyretin-related gene ttr-33, all of which protect C. elegans dopaminergic neurons from 6-OHDA-induced neurodegeneration (Masoudi et al., 2014; Offenburger et al., 2018a and 2018b). The C. elegans 6-OHDA assay was further used to describe the roles of known stress response and cell death pathways in oxidative stress-induced dopaminergic neurodegeneration (Nass et al., 2002; Tóth et al., 2007; Offenburger et al., 2018a and 2018b).
The protocol can also be used for acute liquid exposure to other soluble compounds such as the oxidative stress-inducing drug paraquat (Offenburger et al., 2018a and 2018b). The procedures we describe here are generally useful to test if compounds influence dopaminergic neuron death.
Materials and Reagents
Latex gloves
Lab coat
Platinum wire (e.g., CVS10 replacement platinum wire, 50 cm length x 0.2 mm diameter, Sigma-Aldrich, catalog number: EP1330 )
High recovery filter pipette tips (e.g., Corning, Axygen® Maxymum Recovery®, catalog number: T-200-C-L-R-S )
Bench surface protector sheets (GE Healthcare, Whatman®, catalog number: 2300-916 )
Disposable spatulas (e.g., Disposable smartSpatula, LevGo, catalog number: 17251 )
1.5 ml screw cap tubes (sterile, graduated, conical, e.g., STARLAB, catalog number: E1415-2231 )
96-well plates (Tissue culture plates, round bottom, clear, sterile, TPP Techno Plastic Products, catalog number: 92097 )
Only if filtering of L1 larval stages required: Nylon net filter, hydrophilic, 5 μm pore size (e.g., Merck, catalog number: NY0509050 with 90 mm diameter, or catalog number: NY0502500 with 25 mm diameter)
10 cm plastic Petri dishes
Wet paper towel
E. coli OP50 [Caenorhabditis Genetics Centre (CGC), University of Minnesota, Dept of GCD, 6-160 Jackson Hall, 321 Church Street S.E. Minneapolis, MN 55455, https://cgc.umn.edu/]
Experimental control strains available at the C. elegans Genetics Centre (CGC), University of Minnesota, https://cgc.umn.edu/):
TG2435 wild type-backcrossed BY200 derivate, vtIs1[pdat-1::gfp; rol-6] V (while pdat-1::gfp is always expressed, the penetrance of the roller phenotype is very low, only rarely detectable)
TG2400 dat-1(ok157) III; vtIs1V
TG4100 vtIs1 V; glit-1(gt1981) X
TG2436 vtIs1 V; tsp-17(tm4995) X
G4103 ttr-33(gt1983) V; vtIs1 V
Note: We advise researchers to backcross strains to their wild-type strain for at least 4 times.
M9 buffer (He, 2011)
Nematode growth medium (NGM) agar (He, 2011)
LB (Luria-Bertani) liquid medium (see Cold Spring Harbor Protocols, 2006)
6-hydroxydopamine (6-OHDA) hydrochloride (Sigma-Aldrich, catalog number: H4381 ) (keep at -20 °C in the dark, prepare stock solution freshly)
L-ascorbic acid (Sigma-Aldrich, catalog number: A5960 , ≥ 90%) (store at room temperature in the dark, wrap aliquots with aluminum foil)
200 mM ascorbic acid solution (freshly prepared, see Recipes)
10 mM 6-OHDA solution (freshly prepared, see Recipes)
Equipment
Pipettes
Metal inoculation loop
Precision scales
Temperature-controlled shaker (e.g., Eppendorf, model: ThermoMixer® R )
Temperature-controlled incubator (20 °C)
Fume hood
Vortex Mixer (e.g., Scientific Industries, model: Vortex-Genie 2 )
Ethanol burner (e.g., DWK Life Sciences, WheatonTM Alcohol Burner, catalog number: 237070 )
Stereomicroscope with fluorescence (e.g., Leica)
Software
R studio (version 1.0.44)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Offenburger, S. and Gartner, A. (2018). 6-hydroxydopamine (6-OHDA) Oxidative Stress Assay for Observing Dopaminergic Neuron Loss in Caenorhabditis elegans. Bio-protocol 8(18): e3025. DOI: 10.21769/BioProtoc.3025.
Download Citation in RIS Format
Category
Neuroscience > Development > Morphogenesis
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,026 | https://bio-protocol.org/exchange/protocoldetail?id=3026&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Live Confocal Imaging of Brachypodium Spikelet Meristems
Devin Lee O'Connor
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3026 Views: 5878
Edited by: Tie Liu
Reviewed by: Nat PrunetBenoit Landrein
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Live confocal imaging of fluorescent reporters and stains in plant meristems provides valuable measurements of gene expression, protein dynamics, cell polarity, cell division, and growth. The spikelet meristem in the grass Brachypodium distachyon (Brachypodium) is well suited to live imaging because of the ease of dissection, small meristem size, simple arrangement of organs, and because each plant provides abundant spikelet meristems. Brachypodium is also far easier to genetically transform than other grass species. Presented here is a protocol for the growth, staging, dissection, mounting, and imaging of Brachypodium spikelet meristems for live confocal imaging.
Keywords: Live-imaging Confocal Grasses Brachypodium Development Meristems Microscopy Plants
Background
Plant organs (leaves, branches, flowers) originate from meristems, the growing tips of a plant that contain a population of stem cells. Live confocal imaging of transcriptional reporters, fluorescent fusion proteins, and fluorescent stains has provided important spatial and temporal information about the myriad of gene products involved in meristem maintenance and organ initiation. Live imaging of the Arabidopsis thaliana inflorescence meristem is a continuing line of inquiry (Reddy et al., 2004; Bhatia et al., 2016; Prunet et al., 2016; Willis et al., 2016; Landrein et al., 2018; Shi et al., 2018), while live imaging of meristems in plants outside of Arabidopsis has been limited (Deb et al., 2015).
Presented here is a protocol for confocal live imaging the spikelet meristem of the grass Brachypodium distachyon (Brachypodium). There are several advantages to imaging Brachypodium spikelet meristems. First, the spikelet meristem is relatively small, which facilitates laser penetration and allows for ample resolution deep into the meristem tissue. Second, with attention to plant staging, spikelet meristem samples are easy to dissect and mount making rapid imaging of multiple samples easy. Third, the distichous phyllotaxy of organ initiation in the spikelet meristem, with each new organ initiated 180 degrees from the previous organ, enables the early events of organ initiation to be observed and allows for several stages of development to be captured with a single sample (O’Connor et al., 2014). Finally, the spikelet meristem of grasses is the source of approximately 50% of all calories consumed by humans world-wide, making it an agronomically important research target.
Brachypodium is a useful model system because of its rapid growth cycle, ease of growth, small genome size, availability of a high-quality genome sequence, and most importantly for live imaging, the relative ease of genetic transformation (International Brachypodium Initiative, 2010; Bragg et al., 2012; Brutnell et al., 2015; Kellogg, 2015). Imaging fluorescent fusion-protein reporters in the Brachypodium spikelet has provided valuable insight into the mechanisms of auxin transport (O'Connor et al., 2014 and 2017).
Materials and Reagents
Soil: Metro-Mix 360 (Sun Gro Horticulture)
Pots: ~5 x 7 cm square 24x cell trays (McCONKEY, catalog number: JMCS606HPB )
Clear plastic horticultural tray lids
Peters general purpose 20-20-20 fertilizer (ICL, Peters®, catalog number: G99290 )
Wet paper towels
5 cm Petri dishes (Figure 1G)
Sharp razor blades (Figure 1A) (e.g., Gillette)
Syringe needle 21 G (Figure 1D) (Optional)
Pasteur pipette (Figure 1F)
1.5 ml microfuge tubes (optional, for counterstaining)
Brachypodium spikelets
1% agarose in water or MS (Murashige and Skoog) media
Propidium iodide stain (optional) (Sigma-Aldrich, catalog number: P4170 )
FM4-64 dye (optional) (Thermo Fisher Scientific, InvitrogenTM, catalog number: T13320 )
Propidium iodide solution (see Recipes)
FM4-64 solution (see Recipes)
Equipment
Dissection equipment (see Figure 1)
Castro-Viejo Micro Scissors, 4" (102 mm), Straight Tips (Electron Microscopy Sciences, catalog number: 72933-01 , Figure 1B)
Sharp Forceps (Ideal-Tek 110 mm Extra fine tips Forceps) (IDEAL-TEK, catalog number: 5.DX.0 , Figure 1C)
Dissection Probe, Micro-Prober 45° 0.50 mm, combined with EMS Tool Handle (Electron Microscopy Sciences, catalog numbers: 62091-12 , 62090-00 ) (Optional, Figure 1E)
Dissecting Stereomicroscope (Carl Zeiss, model: Stemi 2000 ; Leica Microsystems, model: MZ6 ; or similar)
Figure 1. Equipment. A. Sharp razor-blade for cutting nodes, an alternative to micro-scissors. B. Micro-scissors used for removing samples from the plant and cutting nodes during dissection. C. Small, sharp forceps used for removing lemmas. D. Syringe needle for removing lemmas covering the meristem or breaking off awns from immature lemmas, an alternative to a probe or sharp forceps. E. Bent probe for removing lemmas and lemma awns. F. Pasteur pipette for dispensing 1% agarose during mounting. The end can be cut off to facilitate flow. G. Small Petri dish for mounting samples. See the Materials and Reagents, and Equipment sections for details.
Confocal microscope (Leica Microsystems, models: TCS SP5 , TCS SP8 ; Carl Zeiss, models: LSM 510 , LSM 780 )
Note: We have successfully used several different laser-scanning confocal microscopes, including Leica SP5, Leica SP8, Zeiss 510, Zeiss 780, etc. In general, upright scopes with water-dipping objectives are easier to use, thus upright scopes are the focus of this protocol.
Microscope objectives
Most of our current data is derived from upright scopes with long working-distance water-dipping objectives. Objectives that we have used successfully are listed below, but similar objectives will suffice.
Leica Objectives
HCX APO 40x 0.8 Numerical Aperture water-dipping
HCX IRAPO 25x 0.95NA water-dipping
Zeiss Objectives
20x, 40x, 63x W-PLAN APOCHROMAT 1.0 Numerical Aperture water-dipping
Procedure
Growth
Brachypodium plants can be grown in a variety of soils, pots, temperatures and light regimes. In general, we try to accelerate the transition to flowering while still maintaining a healthy plant with several lateral branches. Using a 20 h light/4 h dark cycle and small pot sizes stimulates flowering, but in these conditions proper watering is important. Larger pot sizes and shorter day lengths will lengthen the time to flowering, but may yield more spikelets for imaging per plant.
Plants can be grown at higher densities if they are only used for harvesting spikelets. If plants are grown for seeds, a lower planting density or culling before flowering is recommended. See the Materials and Reagents section for pot sizes and soil recommendations. Below you will find general growth guidelines.
Seed preparation (optional)
For some batches of seed, germination can be improved by removing the lemma. The lemma is the outer leaf-like organ with a long protruding tendril-like mid-vein called the awn (Figure 3E). Peel off the lemma by gripping the awn and opening away from the seed.
Sowing
Ensure soil is well watered before sowing. Place 2 seeds per pot to ensure adequate germination. Plants will need to be culled down to 1 per pot if they are being grown for seed. Sow by pushing the seed vertically just below the soil surface with the awn end facing up.
Stratification (optional)
After sowing place trays at 4 °C for 2-4 days to synchronize germination.
Growth Conditions
20 h ~300 µmol light, 4 h dark.
28 °C day, 18 °C night.
Germination
Ensure trays are well watered before placing into the light, and cover with clear plastic lids until plants are germinated, up to one week.
Fertilization
Include fertilizer with every second watering according to manufacturer’s instructions.
Watering before flowering
Watering is performed by pouring ~1 cm of water into the bottom of each tray.
Note: It is critical that young plants never sit in standing water for long periods of time, especially during the first 2-3 weeks of growth. If plants do not soak up the added water in the bottom of the tray after ~20 min it should be drained by pouring out. Use the weight of the tray to determine watering. In general, water sparingly during the first few weeks to stimulate root growth. Plants that are overwatered early will not have a well-developed root system and will suffer during flowering.
Watering during flowering and seed set
After flowering and especially during seed-set, plants will need plenty of water. After the first addition of water, allow plants to soak for 15-20 min before adding a small amount of additional water. At this stage, plants can sit in a small amount of water to ensure they do not dry out (e.g., over the weekend). Maintaining adequate watering late in development is critical to seed set. Watering can be cut off at the first sign of senescence (brown/yellowing starting in the inflorescence) to accelerate seed drying. Alternatively, watering can be extended during most of senescence to increase seed yield.
Staging
Proper staging will ensure consistent results and facilitate dissection. In our growth conditions, Brachypodium has three main branching axes at floral transition. The central apical branch will generally flower first, and it is this branch that we focus on to harvest spikelet meristems. Upon the transition to flowering the apical meristem will first initiate several lateral spikelet (LS) meristems before transitioning into the terminal spikelet (TS) meristem (Figure 2A) (Derbyshire and Byrne, 2013; O'Connor et al., 2014). The terminal spikelet will mature first, followed by the lateral spikelets proceeding from the top of the inflorescence basally.
Each spikelet meristem initiates two sterile leaf-like glumes (GL) before initiating florets in a distichous phyllotaxy (180° between each organ) (Figure 2A). The first organ in each floret is the lemma (L), a leaf-like organ that subtends the floral meristem (FM) and will cover the seed at maturity (Figure 2B). At the tip of each lemma mid-vein is a long tendril called the awn (AW) (Figures 2A, 3E).
Figure 2. Brachypodium spikelet meristems. A. Maximum projection of Citrine (a YFP variant) tagged SoPIN1 auxin transport protein in the Brachypodium inflorescence. Normally with the staging method described in the text the terminal spikelet (TS) will not be exposed as in this image. The sterile glumes (GL), floral meristems (FM), lemmas (L), and awns (AW) of the terminal spikelet (TS) are labeled. The lateral spikelets (LS) are positioned perpendicular to the terminal spikelet and mature later. B. Maximum projection of SoPIN1 in a Brachypodium spikelet meristem. This side-on view is how we normally image. The youngest to oldest incipient lemma primordia are labeled I2 and I1, while youngest to oldest primordia are labeled P1, P2, and P3. The youngest floral meristem is also labeled (FM). C. The inflorescence can be turned 90 degrees to capture a view of the spikelet meristem where lemma primordia and the floral meristem are imaged end-on. In this maximum projection I1 convergent polarization of SoPIN1 (I1), the P2 lemma (P2), and the floral meristem (FM) are labeled. Scale bars = 50 µm in (A), 25 µm in (B) and (C).
The key to staging is to identify branches where the floral transition has just occurred, but before the terminal spikelet fully emerges. This stage is easily identified because the awn of the terminal spikelet is visible emerging from the sheath of the last vegetative leaf (Figures 3B and 3C). At this stage the lateral spikelets will be immature and largely exposed. We have termed this stage the "first-awn" stage. The first-awn stage in the main axis occurs in our growth conditions starting approximately 3 weeks after moving plants to light, after the production of approximately 7 leaves. The earlier the first-awn stage is identified, the easier the lateral spikelets will be to dissect. It may be necessary to unroll the last vegetative leaf in order to see the first awn at the earliest stages (Figure 3B). Branches where the entire terminal spikelet has emerged from the last vegetative leaf (Figure 3D) are too old and are not suitable for harvesting spikelet meristems. At this late stage, the lateral spikelets are covered and tend to break off the main axis during dissection.
We have not noticed significant differences between lateral and terminal spikelet meristems, but harvesting meristems from a consistent position is recommended.
Figure 3. Inflorescence staging. Stages of Brachypodium inflorescence development (A)-(E). A. Prior to the transition to flowering the inflorescence is not visible. B. The ideal stage for dissection is when the top of the terminal spikelet just emerges from the last vegetative leaf. The most identifying feature of the transition to flowering is the appearance of the awn, the tendril-like organ at the tip of each floret, clearly visible in panel E (labeled AW in B-E). Often the last vegetative leaf needs to be unrolled and opened slightly to reveal the terminal spikelet awn. Plants at this early “first-awn” stage are the easiest to dissect. C. The end of the ideal stage occurs when the terminal spikelet completely emerges from the last vegetative leaf. Panel C shows the very end of the permissible stage. Inset shows detail of the first awn of the terminal spikelet. D. Inflorescences where the terminal spikelet has fully emerged are not suitable for imaging. E. The mature Brachypodium inflorescence with the terminal spikelet (TS) and two lateral spikelets (LS). The mature lemmas (L) and awns (AW) are clearly visible at this stage.
Dissection
Note:
See Video 1 for a demonstration of the entire dissection procedure.
These steps should be completed as quickly as possible. The sample will dry out if the cut end is not embedded in agarose quickly. A damp paper towel can be placed on the stage of the dissection scope to delay sample drying. Recommended dissection tools are shown in Figure 1.
Video 1. Video of dissection and mounting of Brachypodium spikelet meristem. Video shows how to identify the first awn stage, dissect out the spikelet meristem sample, remove organs covering the meristem, and mount for confocal imaging.
Identify branches at the "first-awn" stage (Figure 4A)
Remove the sample from the main plant by cutting just below the last visible node. Node tissue is generally white and is covered in a collar of trichomes, hereafter called the "fuzzy collar" (FC) (Figure 4A).
Release the internal tissues by cutting through the entire stem just above the fuzzy collar of the node (Figure 4B).
Gripping the base lightly with your fingers (do not crush!), carefully pull the inner tissue out of the sheath tissue of the outer leaf.
Repeat until there is a single leaf surrounding the inflorescence. Usually, 2-3 leaves cover the immature inflorescence.
Once again, cut just above the fuzzy collar of the node (Figure 4C), carefully grip the leaf base with your fingers and pull out the inflorescence (Figure 4D).
Under the dissecting scope grip the sample by the terminal spikelet and select one of the lateral spikelets for dissection. Generally, the lowest lateral spikelet is the easiest to dissect.
Using a probe, syringe needle, or fine forceps start at the base of the spikelet and remove the immature bracts (Figure 4E) and any immature lemmas covering the spikelet meristem.
Note: The immature bracts and lemmas wrap around the spikelet, so it is often easier to remove them if you insert the probe on the opposite side of the spikelet meristem from the midvein and unwrap. The organ will break at the base.
Remove immature organs until the spikelet meristem is visible (Figure 4F).
For the last few lemmas that have not grown enough to cover the spikelet meristem, only the awns should be removed by gripping with forceps and bending away from the spikelet meristem apex until the awn breaks off.
Note: If these awns are not removed a bubble will form around the spikelet meristem making staining and imaging under water impossible.
The exposed spikelet meristem is now ready for optional staining or mounting (Figure 4G).
Figure 4. Dissection and mounting of spikelet meristems. A. First remove the sample by cutting below the fuzzy collar (FC) of the last visible node. B. Using micro-scissors or razor-blade cut just above the fuzzy collar (FC) of the node to release the inner tissues. C. Once the inner nodes are removed from the sheath by pulling out, repeat by carefully cutting just above the fuzzy collar (FC) of the next node. D. Repeat until the entire inflorescence is released by pulling on the end of the terminal spikelet (TS). The basal most lateral spikelets (arrows) are typically the easiest to dissect because they are less likely to break off, and the meristems are more exposed. E. Expose the meristem by removing the glume (GL) and lemma primordia wrapped around the spikelet meristem. F. Remove the remaining lemma awns (arrows) by carefully bending down and breaking off or by using the sharp end of a syringe needle to cut off. G. Once all lemmas and lemma awns are removed the meristem is fully exposed (arrow) and ready for mounting or optional counterstaining. H. After optional counterstaining, the inflorescence is trimmed and mounted in a Petri dish by adhering the ends with drops of 1% agarose. Immerse the sample in water to prevent drying and image immediately.
Counterstains (optional)
After dissection, samples can be counterstained by placing directly into a 1.5 ml microfuge tube containing the stain of choice (Figure 5A). Make sure a bubble does not surround the spikelet meristem and that it does not contact the side of the tube.
We have successfully used propidium iodide to stain cell walls (Figures 5B and 5D, Propidium iodide:10 μg/ml in water for 10-20 min). Propidium iodide is normally excluded from the inside of the cell by the plasma membrane. Thus, damaged or dead cells will stain internally, especially in the nucleus, and damaged samples are easily identified.
We also regularly use the vital stain FM4-64 to stain cell membranes and endocytic vesicles (Figure 5C, FM4-64 (Figure 5C): 50 µg/ml in water for 5-15 min). Short stain times (5-10 min) will mark only the cell membrane, while longer stain times will mark vesicles as the stain is endocytosed.
Figure 5. Counterstains. A. Samples can be carefully placed directly in staining solution in a microfuge tube. B. Medial confocal z-section of a propidium iodide stained spikelet meristem showing the cell walls. Lemma primordia are labeled from youngest to oldest I2, I1, P1, P2. The youngest floral meristem is also labeled (FM). C. Medial confocal z-section of an FM4-64 stained spikelet meristem showing primarily the cell membrane. Internalized stain is shown with an arrow. The asterisk marks the unstained floral meristem. Incipient lemma primordia are labeled from youngest to oldest I2 and I1, while primordia are labeled P1 and P2. The youngest floral meristem is labeled (FM). D. Medial confocal z-section co-localization of Citrine-tagged PIN1b and propidium iodide stained cell walls. Left PIN1b, middle propidium iodide, and right merged image. Note the reduced staining of propidium iodide deep in the center of the spikelet (asterisk); this tissue is both hard to stain and image because of the thickness of the tissue. Lemma primordia are labeled from youngest to oldest I2, I1, P1, P2, P3. Floral meristems are labeled (FM). Scale bars = 25 µm in (B) and (C), 50 µm in (D).
Mounting
Once the target spikelet meristem is revealed, you can cut off the other spikelets so the sample will lie flat in the dish.
Note: Be sure to leave enough tissue at both ends to act as mounting points (Figure 4H).
Using molten 1% agarose and a Pasteur pipette, "glue" the two ends of the sample down in the center of a ~5 cm Petri dish (Figure 4H).
Working quickly before the agarose solidifies, adjust the sample so the target meristem sits in the plane of the dish. This may involve twisting the main branch axes quite severely.
After the agarose completely solidifies cover with water and image immediately, do not allow the sample to dry out.
Imaging
Imaging parameters will depend on the specific reporter, sample, confocal, objective, and other factors, but general recommendations are provided here.
Most confocals will have settings to automatically optimize XY and Z resolutions. These are a good starting point, but these settings often oversample for most experiments and lead to long scan times and possible bleaching. For routine moderately-high resolution imaging, we use around 1024 x 1024 resolution and a field of view of 200 µm or less. Lower resolutions around 512 x 512 may be suitable for some experiments and will greatly increase the scanning speed. We recommend a bit depth of at least 12, especially if quantifying florescence. We generally use a zoom of approximately 3x with a 20x objective and a Z step-size of 0.5-3 µm with the pinhole set to 1 airy unit, although these settings should be adjusted to the particular sample and experimental goal.
Because the spikelet meristem is symmetrical, only one half of the depth needs to be imaged in order to get a good sense of a particular expression domain. The sample can be turned 90°, re-mounted with agarose and re-imaged to get a different view (Figures 2B and 2C). The relatively small size of the Brachypodium spikelet meristem means it is generally easy to image deep into the tissue. However, the fluorescent signal will decrease deeper into the tissue, especially at the base of the spikelet meristem (Figure 5D).
Data analysis
In order to ensure reproducibility, multiple samples should be imaged from multiple plants derived from multiple transgenic events from multiple plant grow-ups. We regularly try to image at least 16 total spikelets per genotype, 8x each from two transgenic events. More samples may be necessary to account for variability.
Data can be analyzed in various ways depending on the experiment. We recommend the Fiji distribution of the ImageJ software (Schindelin et al., 2012). We regularly add a color Lookup table (Image > Lookup Tables) and reduce the maximum gray-value display range (The top slider in the Brightness/Contrast window. Image > Adjust > Brightness/Contrast). Confocal noise can also be reduced by applying a median filter (Process > Filter > Median). Finally, if the data is captured as a Z-stack, part of or the entire stack can be displayed as a 2D image by applying a maximum intensity projection (Image > Stacks > Z Project….Max Intensity). Maximum projections are suitable for display, but not for quantification.
Recipes
Propidium iodide solution
10 μg/ml in distilled water
FM4-64 solution
50 µg/ml in distilled water
Acknowledgments
This work was funded by the Gatsby Charitable Foundation. Protocols were developed when funded by the National Science Foundation and the United States Department of Agriculture. Thanks to Sarah Hake and Ottoline Leyser for supporting the development of Brachypodium as an imaging system, John Vogel and the Vogel lab for the years of successful collaboration on Brachypodium transgenics, and to the Carnegie Institution for Plant Biology for housing me during manuscript preparation. Finally, thanks to Ray Wightman and Heather Cartwright, imaging facility support is integral to microscopy innovation.
Competing interests
The author declares no competing interests.
References
Bhatia, N., Bozorg, B., Larsson, A., Ohno, C., Jönsson, H. and Heisler, M. G. (2016). Auxin Acts through MONOPTEROS to regulate plant cell polarity and pattern phyllotaxis. Curr Biol 26(23): 3202-3208.
Bragg, J. N., Wu, J., Gordon, S. P., Guttman, M. E., Thilmony, R., Lazo, G. R., Gu, Y. Q. and Vogel, J. P. (2012). Generation and characterization of the Western Regional Research Center Brachypodium T-DNA insertional mutant collection. PLoS One 7(9): e41916.
Brutnell, T. P., Bennetzen, J. L. and Vogel, J. P. (2015). Brachypodium distachyon and Setaria viridis: Model Genetic Systems for the Grasses. Annu Rev Plant Biol 66: 465-485.
Deb, Y., Marti, D., Frenz, M., Kuhlemeier, C. and Reinhardt, D. (2015). Phyllotaxis involves auxin drainage through leaf primordia. Development 142(11): 1992-2001.
Derbyshire, P. and Byrne, M. E. (2013). MORE SPIKELETS1 is required for spikelet fate in the inflorescence of Brachypodium. Plant Physiol 161(3): 1291-1302.
International Brachypodium Initiative (2010). Genome sequencing and analysis of the model grass Brachypodium distachyon. Nature 463(7282): 763-768.
Kellogg, E. A. (2015). Brachypodium distachyon as a Genetic Model System. Annu Rev Genet 49: 1-20.
Landrein, B., Formosa-Jordan, P., Malivert, A., Schuster, C., Melnyk, C. W., Yang, W., Turnbull, C., Meyerowitz, E. M., Locke, J. C. W. and Jönsson, H. (2018). Nitrate modulates stem cell dynamics in Arabidopsis shoot meristems through cytokinins. Proc Natl Acad Sci U S A 115(6): 1382-1387.
O'Connor, D. L., Elton, S., Ticchiarelli, F., Hsia, M. M., Vogel, J. P. and Leyser, O. (2017). Cross-species functional diversity within the PIN auxin efflux protein family. Elife 6: e31804.
O'Connor, D. L., Runions, A., Sluis, A., Bragg, J., Vogel, J. P., Prusinkiewicz, P. and Hake, S. (2014). A division in PIN-mediated auxin patterning during organ initiation in grasses. PLoS Comput Biol 10(1): e1003447.
Prunet, N., Jack, T. P. and Meyerowitz, E. M. (2016). Live confocal imaging of Arabidopsis flower buds. Dev Biol 419(1): 114-120.
Reddy, G. V., Heisler, M. G., Ehrhardt, D. W. and Meyerowitz, E. M. (2004). Real-time lineage analysis reveals oriented cell divisions associated with morphogenesis at the shoot apex of Arabidopsis thaliana. Development 131(17): 4225-4237.
Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J. Y., White, D. J., Hartenstein, V., Eliceiri, K., Tomancak, P. and Cardona, A. (2012). Fiji: an open-source platform for biological-image analysis. Nat Methods 9(7): 676-682.
Shi, B., Guo, X., Wang, Y., Xiong, Y., Wang, J., Hayashi, K. I., Lei, J., Zhang, L. and Jiao, Y. (2018). Feedback from lateral organs controls shoot apical meristem growth by modulating auxin transport. Dev Cell 44(2): 204-216 e206.
Willis, L., Refahi, Y., Wightman, R., Landrein, B., Teles, J., Huang, K. C., Meyerowitz, E. M. and Jönsson, H. (2016). Cell size and growth regulation in the Arabidopsis thaliana apical stem cell niche. Proc Natl Acad Sci U S A 113(51): E8238-E8246.
Copyright: O'Connor. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
O'Connor, D. L. (2018). Live Confocal Imaging of Brachypodium Spikelet Meristems. Bio-protocol 8(18): e3026. DOI: 10.21769/BioProtoc.3026.
O'Connor, D. L., Elton, S., Ticchiarelli, F., Hsia, M. M., Vogel, J. P. and Leyser, O. (2017). Cross-species functional diversity within the PIN auxin efflux protein family. Elife 6: e31804.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > Morphogenesis
Developmental Biology > Morphogenesis > Organogenesis
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,027 | https://bio-protocol.org/exchange/protocoldetail?id=3027&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Zebrafish Embryo Xenograft and Metastasis Assay
IP Ilkka Paatero
SA Sanni Alve
SG Silvia Gramolelli
Johanna Ivaska
Päivi M. Ojala
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3027 Views: 12442
Edited by: Xi Feng
Reviewed by: Michelle GoodyYONG TENG
Original Research Article:
The authors used this protocol in May 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2018
Abstract
Xenograft models, and in particular the mouse xenograft model, where human cancer cells are transplanted into immunocompromised mice, have been used extensively in cancer studies. Although these models have contributed enormously to our understanding of cancer biology, the zebrafish xenograft model offers several advantages over the mouse model. Zebrafish embryos can be easily cultured in large quantities, are small and easy to handle, making it possible to use a high number of embryos for each experimental condition. Young embryos lack an efficient immune system. Therefore the injected cancer cells are not rejected, and the formation of primary tumors and micrometastases is rapid. Transparency of the embryos enables imaging of primary tumors and metastases in an intact and living embryo. Here we describe a method where GFP expressing tumor cells are injected into pericardial space of zebrafish embryos. At four days post-injection, the embryos are imaged and the formation of primary tumor and distant micrometastases are analyzed.
Keywords: Zebrafish Embryo Cancer Xenograft Melanoma Micrometastases Protocol
Background
Zebrafish (Danio rerio) is a small fresh water fish that has gained popularity as a model organism not only in developmental biology, but also increasingly in biomedicine. One of the rapidly growing fields, is the use of zebrafish as a model for cancer biology research. Zebrafish mate efficiently and reliably, and can produce lots of offspring that are small, transparent, develop externally and can be cultured easily in e.g., multi-well plates (White et al., 2013). Interestingly, human tumor cells can be implanted into zebrafish embryo and many of these xenografts are able to faithfully recapitulate their malignant behavior by growing, invading and metastasizing in the embryo (Lee et al., 2005; Nicoli et al., 2007; Chapman et al., 2014). Zebrafish has also become a highly tractable model system for molecular studies on vascular development, angiogenesis and lymphangiogenesis and helped us to improve our understanding of vascular disease in humans (Hogan and Schulte-Merker, 2017). The possibility to visualize both blood and lymphatic vasculature using live imaging techniques makes zebrafish suitable for investigating tumor cell dissemination and metastasis from the primary site (Hogan and Schulte-Merker, 2017). As compared to mouse xenografts, the zebrafish embryo xenograft experiments require lower costs, smaller numbers of tumor cells and are faster to carry out.
Due to small size of the embryos, the transplantation needs to be performed using specific microinjection equipment. This consists of a fluorescence stereomicroscope, micromanipulator and a microinjector. Here, the xenotransplantation protocol is described using a GFP-expressing melanoma cell line WM852 (Pekkonen et al., 2018), but similar approaches can be used with a number of other cell lines (Veinotte et al., 2014). The use of cells labeled with a fluorescent protein is preferred, as this enables straight-forward quantitation of the tumor growth and direct detection of tumor cells in the embryos. Here, we have utilized mounting of the embryos inside agarose gel to allow precise transplantation of the cells into the pericardial cavity of the embryos. Other anatomical sites for injections such as yolk sac, perivitelline space, vasculature and hindbrain ventricle can be also used (Veinotte et al., 2014) and the choice of transplantation site depends on the experimental question and the used cell line. As the pericardial cavity is optically clear (in contrast to yolk sac), it enables a good view on the transplanted tumor cells, and the pericardial space is also easily accessible allowing reliable transplantation of tumor cells. Moreover, at the embryonic and larval stages used here, the pericardial cavity is not a site of prominent angiogenesis (in contrast to often used perivitelline space injections) and hence in this model, the cancer cells need to first invade locally before being able to reach the vascular network.
Materials and Reagents
Glass capillaries (World Precision Instruments, catalog number: TW100-4 )
PAP-pen (Ted Pella, catalog number: 22311 )
Pasteur glass pipettes (VWR, catalog number: 612-1702 )
Humidor made from large Petri dishes (145 mm) (Greiner Bio One International, catalog number: 639160 ) (Add wetted paper towel on the bottom of the dish to prevent mounted embryos from drying while injecting them.)
10 cm Petri dishes (Greiner Bio One International, catalog number: 633185 )
10 cm cell-culture dishes (Greiner Bio One International, catalog number: 664160 )
Normal glass microscopy slide (VWR, catalog number: 631-1551 )
Paper towel
Pipette tips (fitting for 100-1,000 μl, 20-200 μl, 2-50 μl and 0.5-10 μl pipettes)
FACS tubes with 40 μm mesh cap (BD, catalog number: 352235 )
15 ml tubes (Greiner Bio One International, catalog number: 188271 )
12-well plate (Greiner Bio One International, catalog number: 665180 )
Zebrafish (e.g., casper strain (roy-/-; mitfa-/-)
Tricaine (MS-222 or Ethyl 3-aminobenzoate methanesulfonate) (Sigma-Aldrich, catalog number: A5040 )
Low-melting-point agarose (Sigma-Aldrich, catalog number: A9414-10G )
Polyvinylpyrrolidone K 60 Solution, 45% (PVP) (Sigma-Aldrich, catalog number: 81430-500ML )
Phosphate buffered saline (PBS) (Biowest, catalog number: L0615-500 )
N-phenyl-thiourea (PTU) (Sigma-Aldrich, catalog number: P7629 )
Tris base (Sigma-Aldrich, catalog number: T1503 )
WM852 (RRID:CVCL_6804) transduced with p-lenti6 GFP lentivirus
Trypsin-EDTA solution (Lonza, catalog number: 17-161E )
Dulbecco's Modified Eagle Media (DMEM) (Sigma-Aldrich, catalog number: D6546 )
Pen-Strep solution (Sigma-Aldrich, catalog number: P0781 )
Fetal Calf Serum (FCS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
NaCl (VWR, catalog number: 27810.295 )
KCl (VWR, catalog number: 26764.260 )
CaCl2•2H2O (Honeywell, FlukaTM, catalog number: 31307-500G )
MgSO4•6H2O (Fisher Scientific, catalog number: 15640520)
Manufacturer: Honeywell, FlukaTM, catalog number: M0250-500G .
60x E3 stock solution (see Recipes)
1x E3 (see Recipes)
E3 with 0.2 mM PTU (1x E3 + 0.2 mM PTU) (see Recipes)
20x Tricaine stock solution (4 g/L) (see Recipes)
1 M Tris-HCl, pH 9.0 (see Recipes)
1,000x PTU stock solution (0.2 M) (see Recipes)
Equipment
Pipettes (100-1000 ul, 20-200 ul, 2-50 ul, 0.5-10 ul)
Zebrafish housing system (e.g., AQUA SCHWARZ, model: Stand-alone unit V30 )
Mating boxes (e.g., AQUA SCHWARZ, model: SpawningBox 3 , catalog number: AS 006-0642)
Micropipette puller (NARISHIGE, catalog number: PB-7 ).
Fluorescence stereomicroscope (e.g., ZEISS, model: SteREO Lumar. V12 )
Micromanipulator (Eppendorf, model: InjectMan® NI 2 , catalog number: 5181 000.017)
Microinjector, CellTramVario (Eppendorf, catalog number: 5176 000.033 )
CEDEX XS Cell counter (also Bürker chamber is perfectly adequate)
Incubator, 33 °C (no CO2!!)
Forceps, Dumont No. 5 or similar (Sigma-Aldrich, catalog number: F6521 )
Pipette pump (Fisher Scientific, FisherbrandTM, catalog number: 15239805 )
Glass-tubing cutter (Sigma-Aldrich, catalog number: Z150770 )
Heating-block (Eppendorf, model: Thermomixer 5355 )
Vortex mixer (Scientific Instruments, model: Vortex-Genie 2 )
Centrifuge (Eppendorf, model: 5804 )
Software
ImageJ/FIJI (https://imagej.nih.gov/ij/download.html; https://fiji.sc/)
GraphPad Prism 6.0
Procedure
Preparing the embryos
Set-up mating two days before the injection day (Day 1). Three males and three females in a 3 L mating box are usually enough.
Collect embryos in the morning around 10:00 AM (Day 0) (The zebrafish mate when the lights turn on).
Select healthy fertilized embryos and place on separate 10 cm dishes–50 embryos/dish in 25 ml of 1x E3 + 0.2 mM PTU (see Recipes). Place in a 33 °C incubator (no CO2!!) (Day 0).
On the injection day (Day 2), dissect the embryos out from the chorion membrane with fine sharp forceps (e.g., Dumont No. 5), if necessary. Many of the 2 dpf embryos may have hatched spontaneously (Figure 1).
Figure 1. An unhatched embryo encased by chorion membrane (above) and a hatched embryo (below). Scale bar: 1 mm.
Anesthetize the embryos with 200 mg/L Tricaine (MS-222, 4 g/L stock solution) (see Recipes) for 5 min.
Melt aliquots of 0.7% low-melting point agarose (see Recipes) at 95 °C heating block. Let the block cool down to 37 °C before the next step.
Note: Low-melting point agarose stays liquid at 37 °C.
Add 53 μl of 4 g/L Tricaine-stock solution into 1 ml of 0.7% low-melting point agarose (final concentration of agarose is 0.66%). Vortex briefly, and spin down. Place the tube back to 37 °C.
Prepare mounting slide. Take a normal glass microscopy slide and wipe it clean. Draw a bigger ellipse with a PAP-pen (for embryos) and a small circle (for 10 μl of cells) (Figure 2). Allow PAP-smear to dry for a couple of minutes. These hydrophobic linings will help to keep liquids in the correct place on the glass slide.
Figure 2. Glass microscope slide with PAP-pen smears (faint greenish color)
Add 15 dechorionated and anesthetized embryos in the middle of the larger circle (Figure 3).
Figure 3. Embryos in a droplet of E3 on the microscope slide
Add 200 μl of low-melting-point agarose and align the embryos gently using a gentle orientation tool (e.g., a pipette tip with a bit of attached nylon line) (Figure 4).
Figure 4. Aligned embryos inside the agarose on a microscope slide. Orientation tool made of two pipette tips and a nylon line is in the front.
Allow the agarose to solidify. (The embryos stay alive within the agarose.) Store mounted embryos in a large (150 mm) humidified Petri dish (Figure 5), until ready to inject.
Figure 5. A humidified Petri dish. Wetted paper towel is placed on the bottom of the Petri dish and covered with a lid. To prevent drying, the microscope slides with mounted embryos are placed in this chamber.
Preparing the cells
Use a 10 cm plate of GFP expressing tumor cells (50-90% confluent)/treatment.
Wash cells 2 times with PBS.
Aspirate PBS, add 3 ml of Trypsin-EDTA solution.
Incubate for 5 min at 37 °C, or until cells have detached.
Collect detached cells into a 15 ml Falcon tube and add 5 ml of DMEM + 10% FCS.
Pellet cells (180 x g), 3 min and resuspend in 10 ml of PBS.
Pellet cells (180 x g), 3 min and resuspend in 10 ml of PBS.
Pellet cells (180 x g), 3 min and resuspend in 1 ml of PBS.
Optional step, if using a cell line prone to clumping:
Pipet the cell suspension into a FACS tube through a 40 μm mesh cap (BD Falcon).
Pellet cells with a centrifuge for 3 min (180 x g).
Aspirate all liquid and resuspend the cells in 20 μl of 2% PVP/PBS injection solution. (Addition of PVP is optional, but helps to maintain stable cell suspension during injections.)
Count cell density (2 μl of cell suspension, 198 μl of PBS) using CEDEX XS cell counter.
Dilute into a final concentration of 3-10 x 107 cells/ml. In 4 nl injection, this is 120-400 cells.
Store cell suspensions on ice until ready to inject.
Injection of tumor cells into embryos
Place an empty glass capillary needle (self-made capillary without filament, e.g., TW100-4, WPI) in CellTram injector. (Figure 6)
Figure 6. Microinjection station
Break a large enough opening so that cells can be easily expelled (> 25 μm, a larger tip helps to get more cells in embryo but generates more damage to the embryo and is harder to get through the skin of the embryo) (Video 1).
Video 1. Breaking the capillary needle
Gently rotate the oil outwards, until all air bubbles are out and oil comes out from the tip of the needle (Video 2).
Video 2. Expelling the air bubbles
Gently touch the side of the tip with a paper tissue to absorb the excess oil.
Note: The glass capillary is extremely fragile!
Add 10 μl of cell suspension in the smaller circle on the slide. Go to the injection work station.
Move the needle into cell suspension and draw some cell suspension into the needle (Video 3). Monitor under a stereomicroscope that some liquid and cells actually go into the needle and it doesn’t get stuck.
Video 3. Filling the capillary needle. (Experimentation with zebrafish was performed under license ESAVI/9339/04.10.07/2016 issued by national Animal Experimentation Board (Regional State Administrative Agency for Southern Finland)).
Next, inject the embryos (Video 4). Move the needle through the skin of the embryo. Try to hit an empty space around the heart (pericardial cavity). Expel a little bit of cell suspension into the cavity (one fine notch with CellTram). Look that some cells actually went into the embryo and then move the needle out (Figure 7).
Video 4. Injection of tumor cells into pericardiac space of the embryos. (Experimentation with zebrafish was performed under license ESAVI/9339/04.10.07/2016 issued by national Animal Experimentation Board (Regional State Administrative Agency for Southern Finland)).
Figure 7. Embryos right after injection with GFP labeled tumor cells. Often some tumor cells escape from the injection site when the needle is withdrawn. Scale bar: 1 mm.
Move to the next embryo. Continue until all embryos are injected. In one session easily > 50 embryos can be injected.
After injections, discard the needle carefully according to your institutional guidelines.
Break the gel using fine forceps (Video 5) and by flushing the gel pieces into a dish with 1x E3-medium (Video 6) (see Recipes). Pipette up and down with a large bore Pasteur pipette to release the embryos from the gel (Video 7). Move the released embryos to a new Petri dish with fresh 1x E3 + 0.2 mM PTU (see Recipes).
Video 5. Breaking the gel with forceps. (Experimentation with zebrafish was performed under license ESAVI/9339/04.10.07/2016 issued by national Animal Experimentation Board (Regional State Administrative Agency for Southern Finland)).
Video 6. Releasing the gel pieces from the microscope slide. (Experimentation with zebrafish was performed under license ESAVI/9339/04.10.07/2016 issued by national Animal Experimentation Board (Regional State Administrative Agency for Southern Finland)).
Video 7. Releasing the embryos from the gel. （Experimentation with zebrafish was performed under license ESAVI/9339/04.10.07/2016 issued by national Animal Experimentation Board (Regional State Administrative Agency for Southern Finland)）.
Add antibiotics (1:100 Pen-strep) and incubate 50 embryos/dish at 33 °C until transplanted embryos are selected for the experiment.
Notes:
Culturing the embryos at a higher temperature (33 °C) than usually (28.5 °C) facilitates the growth of human tumor cells in this model.
Without a separate animal experiment license, the experiment has to be ended at latest when the embryos are 5 days old !!! Consult your Animal Experiment Board for details.
Imaging
At 1-day post-injection (1 dpi) anesthetize embryos with 200 mg/L Tricaine and select successfully transplanted and healthy embryos (Figure 8) under a stereomicroscope into the experiment.
Figure 8. A healthy transplanted embryo. Scale bar: 1 mm.
Place 1 embryo/well in a 12-well plate with 2 ml of E3 + Tricaine, orient gently with an orientation tool and image both on GFP and bright field channels. After all the embryos have been imaged, aspirate excess medium out carefully and place 2 ml of fresh 1x E3 + 0.2 mM PTU medium in the wells. (Do not let the embryos dry!)
At 4 days post-injection anesthetize the embryos with tricaine again. Image embryos again using both GFP and bright field channels. (Figure 9)
Figure 9. Timeline of the experiment and examples of the results. A. Time line of zebrafish xenograft experiments. B. Intravital fluorescence microscopy images of six dpf zebrafish embryos taken four days post injection (4 dpi). Fluorescence in GFP channel is shown. Scale bar, 500 µm. Inset shows magnification of the primary tumor. Tumor cells invading outside pericardial space are marked with an arrow, invading cells in the pericardial cavity with a triangle and unspecific fluorescence in eye and yolk sac with an asterisk (*). The outline of the pericardial cavity is depicted with dashed line. Figure and text reproduced and modified from Pekkonen et al. (2018).
Data analysis
In the image analyses, use ImageJ/FIJI software.
Subtract background (subtract background > rolling ball radius 25) in the GFP channel.
Outline the primary tumor area using a segmented line tool. Measure fluorescence intensity and shape (circularity) of the primary tumor.
Count manually the cells that have invaded outside the pericardial cavity. Adjust contrast/brightness so that you can see individual cells. These are much dimmer than the bright primary tumor.
Note: Autofluorescence is often observed in the lens and in the yolk.
For statistical analyses, use GraphPad Prism 6.0 software (other statistical software is ok too). Perform non-parametric Mann-Whitney (2 groups) or Kruskal-Wallis test (for > 2 groups).
For examples of the results, please see Figure 9b above and more detailed in Figure 7 in (Pekkonen et al., 2018).
Notes
For handling the embryos, a glass Pasteur pipette with a pipette pump works the best. The tip needs to be expanded by cutting it with a glass cutter for safe transport of embryos. Also, plastic Pasteur pipettes can be used.
Phenylthiourea (PTU) can be used to prevent pigmentation in non-albino zebrafish strains. PTU is neurotoxic → wear gloves and handle stock solution in chemical hood!
Xenograft assay also works with many other, but not all, cell types, melanoma cell line WM852 is used here as an example.
Sometimes the size of the implanted tumors may vary, if this turns out to be a problem, the relative tumor growth can be calculated and the number of invading cells normalized to the size of the primary tumor.
Due to technical and biological variability, a fairly large number of embryos (> 25) need to be xenografted and analyzed to gain robust results. This can be achieved by combining data from multiple independent experiments.
If one desires to implant a very large number of embryos (> 200/day), it is recommended to perform the experiment working as a pair. One researcher injects the embryos and the other one mounts and dismounts the xenografted embryos.
Embryos are fragile and can break easily. Avoid forceful handling and touching of embryos with sharp objects (other than the capillary needle).
Capillary needle is extremely sharp and filled with cancer cells. Caution is required so that the researcher doesn’t inject him/herself.
During low-resolution imaging with stereomicroscope, the mounting of anesthetized embryos is not necessary. If one desires to perform higher resolution imaging e.g., using confocal microscope, the mounting of embryos using low-melting point agarose on glass-bottom dishes is required.
Recipes
60x E3 stock solution (1 L) (Nüsslein-Volhard et al., 2002)
17.2 g NaCl
0.76 g KCl
2.9 g CaCl2•2H2O
4.9 g MgSO4•7H2O
1x E3
5 mM NaCl
0.17 mM KCl
0.33 mM CaCl2•2H2O
0.33 mM MgSO4•7H2O
Make by adding 16.67 ml of 60x stock solution into a 1 L vessel and fill up to 1 L with MilliQ water
E3 with 0.2 mM PTU (1x E3 + 0.2 mM PTU)
Add 1 ml of 1,000x PTU stock to 1,000 ml of E3
20x Tricaine stock solution (4 g/L)
Make by adding 4.0 g of Tricaine into a 1 L vessel and fill up to 1 L with 1x E3 medium
To adjust the pH to 7, add approximately 5 ml of Tris-HCl, pH 9.0
1 M Tris-HCl, pH 9.0
Make by adding 12.14 g of Tris into 100 ml vessel
Add 100 ml of MilliQ water and adjust the pH to 9.0 using HCl and/or NaOH
1,000x PTU stock solution (0.2 M)
3.044 g of PTU in 100 ml of ethanol
Note: This solution is toxic, store in an air-tight bottle.
0.7% low-melting point agarose
Add 0.7 g of low-melting point agarose powder into 100 ml of 1x E3 medium
Heat in microwave until agarose has melted and the solution is completely clear
Aliquot 1 ml of solution into 1.5 ml microcentrifuge tubes and store at -20 °C until used
Acknowledgments
This work was supported by the Centre of Excellence grant from the Academy of Finland (Translational Cancer Biology grant 307366; P.M.O., J.I.), Finnish Cancer Foundations (P.M.O.), Sigrid Juselius Foundation (P.M.O.), S.A. was supported by the Doctoral Program in Biomedicine (DPBM; University of Helsinki), and S.G. by the Academy of Finland grant 309544. The Zebrafish Core and Cell Imaging Core (Turku Centre for Biotechnology, University of Turku and Åbo Akademi University) are acknowledged.
These procedures have been evolved from the number of earlier work dealing with zebrafish embryo xenografting (Lee et al., 2005; Nicoli et al., 2007; Teng et al., 2013; White et al., 2013; Chapman et al., 2014; Veinotte et al., 2014; Xie et al., 2015; Yen et al., 2014).
Competing interests
The authors have no conflicts of interest or competing interests.
Ethics
Experimentation with zebrafish was performed under license ESAVI/9339/04.10.07/2016 issued by national Animal Experimentation Board (Regional State Administrative Agency for Southern Finland).
References
Chapman, A., Fernandez del Ama, L., Ferguson, J., Kamarashev, J., Wellbrock, C. and Hurlstone, A. (2014). Heterogeneous tumor subpopulations cooperate to drive invasion. Cell Rep 8(3): 688-695.
Hogan, B. M. and Schulte-Merker, S. (2017). How to plumb a Pisces: Understanding vascular development and disease using zebrafish embryos. Dev Cell 42(6): 567-583.
Lee, L. M., Seftor, E. A., Bonde, G., Cornell, R. A. and Hendrix, M. J. (2005). The fate of human malignant melanoma cells transplanted into zebrafish embryos: assessment of migration and cell division in the absence of tumor formation. Dev Dyn 233(4): 1560-1570.
Nicoli, S., Ribatti, D., Cotelli, F. and Presta, M. (2007). Mammalian tumor xenografts induce neovascularization in zebrafish embryos. Cancer Res 67(7): 2927-2931.
Nüsslein-Volhard, C., Dahm, R., Gilmour, D., Brand, M., Granato, M., Schulte-Merker, S., Schilling, T., Kane, D. a, Kishimoto, Y., Jessen, J. R. et al. (2002). Zebrafish: A practical approach. Oxford University Press, New York.
Pekkonen, P., Alve, S., Balistreri, G., Gramolelli, S., Tatti-Bugaeva, O., Paatero, I., Niiranen, O., Tuohinto, K., Perala, N., Taiwo, A., Zinovkina, N., Repo, P., Icay, K., Ivaska, J., Saharinen, P., Hautaniemi, S., Lehti, K. and Ojala, P. M. (2018). Lymphatic endothelium stimulates melanoma metastasis and invasion via MMP14-dependent Notch3 and β1-integrin activation. Elife 7: e32490.
Teng, Y., Xie, X., Walker, S., White, D. T., Mumm, J. S. and Cowell, J. K. (2013). Evaluating human cancer cell metastasis in zebrafish. BMC Cancer 13: 453.
Veinotte, C. J., Dellaire, G. and Berman, J. N. (2014). Hooking the big one: the potential of zebrafish xenotransplantation to reform cancer drug screening in the genomic era. Dis Model Mech 7(7): 745-754.
White, R., Rose, K. and Zon, L. (2013). Zebrafish cancer: the state of the art and the path forward. Nat Rev Cancer 13(9): 624-636.
Xie, X., Ross, J. L., Cowell, J. K. and Teng, Y. (2015). The promise of zebrafish as a chemical screening tool in cancer therapy. Future Med Chem 7(11): 1395-1405.
Yen, J., White, R. M. and Stemple, D. L. (2014). Zebrafish models of cancer: progress and future challenges. Curr Opin Genet Dev 24: 38-45.
Copyright: Paatero et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Paatero, I., Alve, S., Gramolelli, S., Ivaska, J. and Ojala, P. M. (2018). Zebrafish Embryo Xenograft and Metastasis Assay. Bio-protocol 8(18): e3027. DOI: 10.21769/BioProtoc.3027.
Pekkonen, P., Alve, S., Balistreri, G., Gramolelli, S., Tatti-Bugaeva, O., Paatero, I., Niiranen, O., Tuohinto, K., Perala, N., Taiwo, A., Zinovkina, N., Repo, P., Icay, K., Ivaska, J., Saharinen, P., Hautaniemi, S., Lehti, K. and Ojala, P. M. (2018). Lymphatic endothelium stimulates melanoma metastasis and invasion via MMP14-dependent Notch3 and β1-integrin activation. Elife 7: e32490.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Animal models
Cell Biology > Cell Transplantation > Xenograft
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,028 | https://bio-protocol.org/exchange/protocoldetail?id=3028&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Plant Assays for Quantifying Ralstonia solanacearum Virulence
Devanshi Khokhani
T Tuan Minh Tran
TL Tiffany M. Lowe-Power
CA Caitilyn Allen
Published: Vol 8, Iss 18, Sep 20, 2018
DOI: 10.21769/BioProtoc.3028 Views: 7034
Edited by: Modesto Redrejo-Rodriguez
Reviewed by: David Norman
Original Research Article:
The authors used this protocol in Sep 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2017
Abstract
Virulence assays are powerful tools to study microbial pathogenesis in vivo. Good assays track disease development and, coupled with targeted mutagenesis, can identify pathogen virulence factors. Disease development in plants is extremely sensitive to environmental factors such as temperature, atmospheric humidity, and soil water level, so it can be challenging to standardize conditions to achieve consistent results. Here, we present optimized and validated experimental conditions and analysis methods for nine assays that measure specific aspects of virulence in the phytopathogenic bacterium Ralstonia solanacearum, using tomato as the model host plant.
Keywords: Virulence assay Bacterial wilt Vascular plant pathogen Plant colonization Xylem sap R. solanacearum Tomato
Background
Ralstonia solanacearum is a soil-borne bacterium that causes bacterial wilt in a vast range of plants and continues to infect new hosts across the globe (Hayward, 1991; Elphinstone, 2005; Wicker et al., 2007; Genin, 2010; Weibel et al., 2016). As a result, R. solanacearum is among the most intensively studied phytopathogenic bacteria (Mansfield et al., 2012).
R. solanacearum can persist in soil or water reservoirs for long periods (Alvarez et al., 2008), and in the presence of a suitable host, it can enter the plant through wounds or lateral root emergence points (Denny, 2007). Thereafter it colonizes the water-transporting plant xylem vessels and thrives there. Massive production of exopolymeric substances (EPS) likely contributes to the clogging of the xylem channels, leading to blockage of water transport, followed by symptoms like wilting leaves, stunted growth, stem discoloration, and death. Molecular genetic studies revealed a consortium of many virulence factors that are required for pathogenesis and fitness in planta (Genin and Denny, 2012; Tran et al., 2016a and 2016b); recent in silico modeling (Peyraud et al., 2016) and in vivo transcriptomics and metabolomics (Jacobs et al., 2012; Khokhani et al., 2017; Lowe-Power et al., 2018) have further enhanced our understanding of how this bacterium switches from saprophytic to parasitic lifestyle.
To test hypotheses suggested by molecular data, researchers measure virulence on model host plants under controlled conditions. To be useful, such assays must be quantitative, biologically relevant, and replicable. We have developed or adapted several protocols to assess R. solanacearum interactions with tomato, a natural host and economically important crop plant. A naturalistic soil soak assay replicates many aspects of the infection process that occurs in the field. This assay quantifies the defects of mutant strains lacking virulence factors involved in the early phases of the disease such as sensing, invading, and colonizing host roots. For example, mutants lacking chemotaxis, swimming motility, extracellular plant cell wall-degrading enzymes, and type II and III secretion systems are all impaired in virulence following soil soak inoculation.
A petiole inoculation disease assay that introduces the pathogen directly into stem xylem vessels can identify traits that contribute to pathogen success in xylem vessels (Saile et al., 1997). Some mutants that are defective in virulence following soil soak inoculation have full wild-type virulence following cut-petiole inoculation into the stem; examples include mutants lacking motility and chemotaxis (Tans-Kersten et al., 2001; Yao and Allen, 2006). In another case, comparing results of these two assays revealed that extracellular DNA degradation, a trait initially thought to only play a role in interactions with host roots, was also critical for normal biofilm formation inside host xylem later in disease (Tran et al., 2016a and 2016b). When virulence traits are functionally redundant or make small contributions to pathogen success, neither soil soak nor petiole inoculation assays can reveal subtle differences between the wild-type and the target mutant strain (Macho et al., 2010). In those cases, we can use single or co-inoculation experiments to directly compare the growth of competing strains in planta (root and/or shoot colonization) and calculate their relative competitive fitness as a competitive index (CI). We also describe here the protocol to measure bacterial attachment to plant roots. Since R. solanacearum is a xylem-dwelling bacterium, it is important to understand how it affects and is affected by host plant xylem sap. Therefore, we provide a protocol for collection of xylem sap from healthy and infected tomato plants; this ex vivo sap can be used as a medium for bacterial growth curves or for metabolomic analyses.
Materials and Reagents
Sterile conical flask 250 ml (Corning, PYREX®, catalog number: 4980-250 )
Sterile 50 ml conical tubes (Stellar Scientific, catalog number: T50-100 )
Flasks for preparing large volume of cultures (size depends on the experimental goals)
Seedling tray (36-cell insert with holes) (J&P Park Acquisitions, Park Seed, catalog number: 96377 )
Flat trays (greenhouse megastore, 11" W x 21.37" L x 2.44" D, CN-FL)
1.5 ml microcentrifuge tubes (Sigma-Aldrich, BRAND, catalog number: Z336769 )
8 cm wide pots (greenhouse megastore)
Planting sticks (greenhouse megastore)
Metal beads (2.4 mm) (OMNI, catalog number: 19-640 )
Bead-beater tubes (USA Scientific, catalog number: 1420-9300 )
Gosselin Square Polystyrene Petri Plate with 4 vents, 120 x 120 x 15.8 mm, Sterile (Corning, catalog number: BP124-05 )
MicroporeTM Surgical Paper Tape (1 inch size) (3M, catalog number: 1530-1 )
Aluminum foil (W.W. Grainger, catalog number: 16W479 )
Paper towel (Singlefold Paper Towel, 9.1 x 10.25) (Cascades Pro, catalog number: H165 )
WhatmanTM paper (Grade 1 Qualitative Filter Paper) (GE Healthcare, Whatman)
Petri dish (Corning, Falcon®, catalog number: 351029 )
0.22-μm sterile filter (Merck, catalog number: SLGP033RS )
10 ml pipette (Disposable Polystyrene Serological Pipettes) (Corning, Falcon®, catalog number: 357551 )
1 ml syringe (New Sterile, Sealed, Tuberculin, Luer slip tube, No Needle, Disposable) (BD, catalog number: 9602 )
96-well half-area microplates (Corning, catalog number: 3697 )
Soil mix, propagation mix, Sunshine® resilience silicon enriched, Re Plug and Seed Rsi (Sun Gro Horticulture, Lot-code: Q15322; SKU: 7263924)
Ingredients:
55-65% Canadian Sphagnum peat moss, vermiculite, dolomite lime, wetting agent;
0.0001% Silicon dioxide (SiO2) from calcium silicate to increase root growth
Ralstonia solanacearum strain from glycerol or water stock
Bonny best wilt susceptible variety of Tomato seeds (Mountain valley seed) (stored at 4 °C)
Sterile reverse osmolyzed water by Milli-Q system (SMQ)
Agar (Fisher Scientific, catalog number: BP1423-2 )
Bleach (Clorox Performance Bleach with CloroMax) (The Clorox Company, catalog number: 980042447 )
70% Ethanol (Diluting 100% Ethanol 200 proof) (Decon Labs, catalog number: 2716 )
Glucose (Fisher Scientific, catalog number: D16-1 )
Peptone (Fisher Scientific, catalog number: NC9931583 )
Casamino acids (RPI, catalog number: C45000-5000.0 )
Yeast extract (Fisher Scientific, catalog number: BP1422-2 )
KOH (Fisher Scientific, catalog number: P250 10 )
1% 2,3,5-triphenyl tetrazolium chloride (TZC) (Sigma-Aldrich, catalog number: T8877 )
KNO3 (Fisher Scientific, catalog number: P383 100 )
KH2PO4 (Merck, Calbiochem, catalog number: 529568 )
MgSO4 (MP biomedicals, catalog number: 150136 )
Ca(NO3)2•4H2O (Fisher Scientific, catalog number: C109 )
H3BO3 (Fisher Scientific, catalog number: A73 1 )
MnCl2•4H2O (Sigma-Aldrich, catalog number: M8054 )
ZnSO4•7H2O (Fisher Scientific, catalog number: Z68 )
CuSO4•5H2O (VWR, BDH, catalog number: BDH9312 )
(NH4)6Mo7O24 (Sigma-Aldrich, catalog number: A1343 )
FeSO4•7H2O (Fisher Scientific, catalog number: I146 3 )
Na2EDTA (Fisher Scientific, catalog number: S311 )
Casamino acid-peptone-glucose (CPG) agar (see Recipes)
CPG broth (see Recipes)
Modified Hoagland's solution (see Recipes)
Note: All the chemicals were purchased from Sigma-Aldrich, Fisher Scientific, or other chemical companies.
Equipment
P1000 pipette (Eppendorf, catalog number: 3120000062 )
P200 pipette (Eppendorf, catalog number: 3120000054 )
P10 pipette (Eppendorf, catalog number: 3120000020 )
Forceps (VWR, catalog number: 470018-952)
Manufacturer: Dunrite Instruments, catalog number: 141001 .
Scalpel (Bard-Parker® SafeSwitchTM Reusable Scalpel Handle, Size 3 L) (Aspen Surgical, catalog number: ST-1013LNS )
Sharp razor blade (Carbon Steel Razor Blades) (Azpack, catalog number: YSJ-762-Q )
Incubator (6M Lab Incubator) (Precision Scientific, catalog number: 31487 )
Benchtop Shaker (Thermo Fisher Scientific, model: MaxQTM 4000 )
Growth chamber with the following conditions:
Light intensity: 300-500 μmol/m2•sec-1
12 h, light, 28 °C
12 h, dark, 28 °C
50-70% humidity
~500 ppm CO2 measured
Powerlyzer® 24 homogenizer (MO BiO Laboratories, catalog number: 13155 )
Centrifuge (15 amp version) (Eppendorf, model: 5810 R )
Centrifuge (Eppendorf, model: 5417 R )
Spectrophotometer (UV/Vis) (Beckman Coulter, model: DU 730 )
Vortex mixer (Vortex-Genie 2) (Scientific industries, catalog number: SI-0246 )
Biosafety cabinet (The Baker, SterilGard®, model: SG403A-HE )
Balance (Roche Diagnostics, model: 05942861001 )
Autoclave (Vacuum Steam Sterilizer) (Getinge, model: 533LS-E )
Software
PRISM Graphpad software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Khokhani, D., Tuan, T. M., Lowe-Power, T. M. and Allen, C. (2018). Plant Assays for Quantifying Ralstonia solanacearum Virulence . Bio-protocol 8(18): e3028. DOI: 10.21769/BioProtoc.3028.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,029 | https://bio-protocol.org/exchange/protocoldetail?id=3029&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Sequencing RNA Libraries through Chemical Cross-linking Coupled to Affinity Purification (cCLAP) in Saccharomyces cerevisiae
CW Congwei Wang
Julie Weidner
AS Anne Spang
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3029 Views: 5763
Edited by: David Cisneros
Reviewed by: Aswad KhadilkarPrashanth N Suravajhala
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
Ribonucleoprotein particles (mRNPs) are complexes consisting of mRNAs and RNA-binding proteins (RBPs) which control mRNA transcription localization, turnover, and translation. Some mRNAs within the mRNPs have been shown to undergo degradation or storage. Those transcripts can lack general mRNA elements, like the poly(A) tail or 5’ cap structure, which prevent their identification through the application of widely-used approaches like oligo(dT) purification. Here, we describe a modified cross-linking affinity purification protocol (cCLAP) based on existing cross-linking and immunoprecipitation (CLIP) methods to isolate mRNAs which could be deadenylated, decapped and/or partially degraded in mRNPs, opening the possibility to detect different types of non-coding RNAs (ncRNAs). Once isolated, the RNAs are subjected to adapter ligation and subsequently proceeded to Next-generation sequencing (NGS). Due to the fast and efficient cross-linking and quenching steps, this protocol is also suitable for transiently induced mRNP granules. Examples include processing bodies (PBs) or stress granules (SGs) triggered by extrinsic stressors. Its reproducibility and broad applications make this protocol a useful and powerful tool to study the RNA compositions of specific RNPs.
Keywords: RNA-Seq In vivo cross-linking Biotin-streptavidin interaction RNP RNP purification Saccharomyces cerevisiae
Background
Characterization of transcripts within the mRNPs is crucial in understanding cellular transcriptional and post-transcriptional processes. Isolation of RNAs from mRNP particles by cross-linking and immunoprecipitation followed by RNA-Seq has become a popular approach to identify the mRNA targets (Tagwerker et al., 2006; Hafner et al., 2010; Kishore et al., 2011). UV and photoactivatable ribonucleoside-enhanced techniques are widely used cross-linking methods in CLIP, however, it is not suitable for liquid cultures such as those used to grow yeast. For these studies, a centrifugation step is required to harvest cells, thus potentially introducing stress which can alter stress-related studies. Additionally, the homogeneity of UV exposure on layered yeast cells cannot be controlled and accurately monitored. In the following protocol, we apply chemical cross-linking with formaldehyde. Formaldehyde can be added directly to liquid cultures, which provides an efficient, quenchable and homogenous cross-linking process. Furthermore, cross-linking with formaldehyde can be reversed by heat, which removes the remaining peptides or residues attached on RNAs, thus ensuring an unbiased cDNA generation by reverse transcription. We used an HBH-tag (His6-biotinylation sequence-His6) for the pulldown because this tag is uniquely well-suited for crosslinking under denaturing condition approaches (Tagwerker et al., 2006, Weidner et al., 2014).
The RNA targets of a number of RBPs, particularly those involved in mRNA turnover, are difficult to identify, since poly(A) tail or 5’ cap structure can be absent. Therefore, the commonly used oligo(dT) purification method generates an incomplete and biased library of mRNAs bound by those RBPs. Compared with the oligo(dT)-based methods, we adapted and improved an affinity purification protocol allowing us to globally isolate the transcripts sequestered by specific mRNP complexes. In summary, this chemical cross-linking coupled to affinity purification (cCLAP) protocol allows unbiased isolation of RNAs present within yeast mRNPs for RNA-Seq analysis.
Materials and Reagents
Pipette tips: Filter tips low retention (SARSTEDT, catalog number: 70.1130.215 ; 70.760.216 ; 70.760.219 ; 70.762.216 )
Sterile Falcon tubes, 15 ml (SARSTEDT, catalog number: 62.554.002 )
Sterile Falcon tubes, 50 ml (SARSTEDT, catalog number: 62.547.254 )
Protein LoBind Tubes, 1.5 ml (Eppendorf, catalog number: 0030108116 )
DNA LoBind Tubes, 1.5 ml (Eppendorf, catalog number: 0030108051 )
Safe-Lock microcentrifuge tubes, 2.0 ml (Eppendorf, catalog number: 0030120094 )
PCR tubes, 0.2 ml (SARSTEDT, catalog number: 72.991.002 )
Centrifuge bottles (Thermo Fisher Scientific, NagelgeneTM, catalog number: 3120-1000 )
Glass beads, acid-washed 425-600 μm (Sigma-Aldrich, catalog number: G8772 )
Glass beads, acid-washed 212-300 μm (Sigma-Aldrich, catalog number: G1277 )
Screw Cap Micro Tube, 2 ml (SARSTEDT, catalog number: 72.693.005 )
GeneRulerTM Low Range DNA Ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: SM1192 )
Saran wrap
Carbon Steel Surgical Scalpel Blade (Swann-Morton, catalog number: 0203 )
Yeast Extract (BD, BactoTM, catalog number: 212720 )
Peptone (BD, BactoTM, catalog number: 211830 )
Agar (BD, BactoTM, catalog number: 214010 )
D(+)-Glucose 1-hydrate (AppliChem, catalog number: A1349 )
Calcium chloride dihydrate (Sigma-Aldrich, catalog number: C5080 )
Liquid nitrogen
Formaldehyde solution (Sigma-Aldrich, catalog number: 252549 )
Tris base (Carl Roth, catalog number: 4855 )
Hydrochloric acid 37% (HCl) (Carl Roth, catalog number: X942 )
Glycine (Carl Roth, catalog number: 3908 )
Ethylenediaminetetraacetic acid (EDTA) (Carl Roth, catalog number: 8043 )
Ethanol BioUltra (Sigma-Aldrich, catalog number: 51976 )
[γ-32P-ATP]Adenosine 5'-triphosphate (ATP) (HARTMANN ANALYTIC, catalog number: SRP-301 )
di-Sodium hydrogen phosphate dodecahydrate (Carl Roth, catalog number: T106 )
Sodium dihydrogen phosphate monohydrate (Merck, catalog number: 106346 )
Magnesium chloride hexahydrate (MgCl2) (Sigma-Aldrich, catalog number: M0250 )
NonidetTM P 40 Substitute (NP-40) (Sigma-Aldrich, catalog number: 74385 )
cOmpleteTM, Mini, EDTA-free Proteinase Inhibitor Cocktail (Roche Diagnostics, catalog number: 11836170001 )
Sodium deoxycholate (Sigma-Aldrich, catalog number: 30970 )
Sodium dodecyl sulfate (SDS) Pellets (Carl Roth, catalog number: 8029 )
Sodium chloride (Carl Roth, catalog number: 3957 )
Guanidine hydrochloride (GuHCl) (Carl Roth, catalog number: 0037 )
TWEEN® 20 (Sigma-Aldrich, catalog number: 93773 )
Streptavidin Agarose (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 20353 )
RNase T1 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EN0541 )
T4 Polynucleotide Kinase (PNK) (New England Biolabs, catalog number: M0201 )
Alkaline Phosphatase, Calf Intestinal (CIP) (New England Biolabs, catalog number: M0290 )
TBE buffer (10x) powder (AppliChem, catalog number: A4348 )
T4 RNA Ligase 2, truncated (New England Biolabs, catalog number: M0242 )
T4 RNA Ligase Reaction Buffer (New England Biolabs, catalog number: B0216L )
T4 RNA Ligase (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EL0021 )
NEBufferTM 3 (New England Biolabs, catalog number: B7203 )
Taq DNA Polymerase (Roche Diagnostics, catalog number: 11146173001 )
Adenosine 5'-Triphosphate (ATP) (New England Biolabs, catalog number: P0756 )
Proteinase K (Roche Diagnostics, catalog number: 03115836001 )
Phenol-chloroform-isoamyl alcohol mixture (PCI) (Sigma-Aldrich, catalog number: 77619 )
RiboMinusTM Transcriptome Isolation Kit, yeast (Thermo Fisher Scientific, InvitrogenTM, catalog number: K155003 )
SuperScriptTM III Reverse Transcriptase (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18080093 )
Oligo (dT) primer (Promega, catalog number: C1101 )
Random Primers (Promega, catalog number: C118A )
Dimethyl sulfoxide (DMSO) (New England Biolabs, catalog number: B0515 )
Acrylamide/Bis-acrylamide (Sigma-Aldrich, catalog number: A2917 )
N,N,N',N'-tetramethylethylenediamine (TEMED) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15524010 )
Ammonium peroxydisulphate (APS) (Carl Roth, catalog number: 9592 )
Urea (AppliChem, catalog number: A1049 )
GlycoBlueTM Coprecipitant (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9515 )
1,4-Dithio-DL-Threitol (DTT) (AppliChem, catalog number: A1101 )
UltraPureTM Agarose (Thermo Fisher Scientific, InvitrogenTM, catalog number: 16500 )
RNasin® Ribonuclease Inhibitors (Promega, catalog number: N2615 )
RNA Gel Loading Dye (2x) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0641 )
RedSafeTM Nucleic Acid Staining Solution (Bulldog Bio, catalog number: 21141 )
NucleoSpin® Gel and PCR Clean-up kit (MACHEREY-NAGEL, catalog number: 740609 )
Nuclease-Free Water (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9937 )
Illumina 3’ DNA adapter (RA3) (Microsynth, PAGE-purified)
Illumina 5’ RNA adapter (RA5) (Microsynth, PAGE-purified)
19nt RNA size marker (Microsynth, PAGE-purified)
RT primer (RA3_RT) ACCTTAAGAGCCCACGGTTCC (Microsynth, PAGE-purified)
Illumina RP1 primer (Microsynth, PAGE-purified)
Illumina Indexing Primer (RPI1) (Microsynth, PAGE-purified)
Illumina Indexing Primer (RPI2) (Microsynth, PAGE-purified)
Illumina Indexing Primer (RPI3) (Microsynth, PAGE-purified)
Illumina Indexing Primer (RPI4) (Microsynth, PAGE-purified)
Deoxynucleotide Solution Mix (dNTPs) (New England Biolabs, catalog number: N0447 )
Yeast Extract-Peptone-Dextrose (YPD) agar (see Recipes)
Yeast Extract-Peptone-Dextrose (YPD) medium (see Recipes)
RIPA buffer (see Recipes)
Incubation buffer (see Recipes)
Wash buffer (see Recipes)
PNK buffer (see Recipes)
2x proteinase K buffer (see Recipes)
Urea polyacrylamide gel (see Recipes)
Tris-HCl buffer (see Recipes)
Equipment
Pipettes (PIPETMAN ClassicTM) (Gilson, models: P2 , P10 , P20 , P200 and P1000 )
Orbital shaker (Infors, model: Multitron Standard )
Erlenmeyer flasks (DWK Life Sciences, Duran®, catalog number: 21 990 27 ; 21 216 32 ; 21 216 36 ; 21 216 44 )
NalgeneTM Polycarbonate culture flasks (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4105-2800 )
Balance (Sartorius, model: AZ612 )
Balance (Sartorius, model: MA160 )
Incubator (Memmert, model: ICP500 )
UV/Visible spectrometer (GE Healthcare, Amersham Biosciences, model: Ultrospec 3100 pro )
FastPrep® Cell Disrupter (Thermo Fisher Scientific, Savant, model: FP120 )
Thermomixer (Eppendorf, model: ThermoMixer® R or equivalent)
Ultracentrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM RC 6 Plus )
Cooling centrifuge (Eppendorf, model: 5810 R or equivalent)
Cooling microcentrifuge (Eppendorf, model: 5417 R or equivalent)
Microcentrifuge (Eppendorf, model: 5415 D or equivalent)
Electrophoresis power supply (Bio-Rad Laboratories, model: PowerPacTM Universal Power Supply )
Vortex mixer (Scientific Industries, model: Vortex-Genie 2 )
Phosphorimager (GE healthcare, model: Typhoon FLA 7000 )
Phosphor screen (Fujifilm, model: FUJICHROME MS )
Phosphor screen cassette (Fujifilm, model: BAS series )
Thermal Cycler (Bio-Rad Laboratories, model: T100TM )
Gel imager (ProteinSimple, model: AlphaImager HP )
Bioanalyzer (Agilent Technologies, model: 2100 )
Procedure
The major steps of this protocol are depicted in Figure 1.
Figure 1. Flowchart and summary of our approach
Streak corresponding yeast cells from a frozen stock by using a sterile tip on a YPD agar plate and incubate at 30 °C for about 48 h or until individual colonies grow.
Grow an overnight pre-culture by inoculating a single yeast colony from a YPD plate into 50 ml YPD liquid medium in an Erlenmeyer flask. Incubate at 200 rpm, 30 °C.
Next morning dilute overnight pre-culture into 1.5 L fresh YPD medium in a 2,800 ml polycarbonate culture flask with a final OD600 0.05-0.1. Continue incubation at 200 rpm, 30 °C until OD600 reaches 0.5-0.8. Approximately 20-30 L culture is required per strain or treatment for low abundant RNPs such as P-bodies.
If necessary, apply corresponding treatment to yeast culture.
Crosslink cells with 37% formaldehyde at a final concentration of 1% in a fume hood and incubate at room temperature for 2 min with gentle agitation on an orbital shaker. Process 3-4 flasks each time.
Add glycine to a final concentration of 125 mM to quench the formaldehyde and incubate at room temperature for 5 min with gentle agitation at room temperature.
Harvest the yeast cells first by centrifugation at 3,000 x g for 5 min in centrifuge bottles at 4 °C and discard the supernatant. Resuspend the cell pellet in approximately 100 ml pre-cooled ddH2O, pool the suspension by centrifugation again at 3,000 x g for 1 min in 50 ml Falcon tubes at 4 °C and discard the supernatant. Weigh the cell pellet. Flash Freeze cell pellet in liquid nitrogen and store at -80 °C. Approximately 40 g cell pellet is required per strain or treatment for low abundant RNPs such as P-bodies.
Resuspend the cell pellet in prechilled RIPA buffer (2 ml buffer per gram of cell pellet).
Transfer the cell resuspension to 2 ml screw cap tubes, approximately 1.2 ml per tube containing 200 μl (150-212 μm) and 200 μl (450-600 μm) acid-washed glass beads. Approximately 70-90 tubes are required.
Lyse cells by using a Fastprep® kept at 4 °C at a speed of 6.5 M/sec for 3-5 cycles of 45 sec each with 5 min ice incubations in between each lysis step. Assess the lysis under a microscope.
Remove large cell debris by centrifugation at low speed, 1,300 x g for 5 min at 4 °C. Transfer the supernatant into clean 2 ml microcentrifuge tubes. Pool two to three tubes from last step into one clean 2 ml microcentrifuge tube. Approximately 30-40 tubes are required.
Treat the supernatant with RNase T1 at a final concentration of 50 U/ml at 22 °C for 15 min with end over end rotation followed by 5 min on ice.
Pellet the membrane fraction by centrifugation at 20,000 x g for 10 min at 4 °C and discard the supernatant. Wash the pellet once with 1 ml RIPA buffer per tube by centrifugation at 20,000 x g for 10 min at 4 °C and discard the supernatant.
Pre-wash streptavidin beads in a 15 ml Flacon tube, once with 3-4 bed vol. nuclease-free water and once with 3-4 bed vol. incubation buffer followed by centrifugation at 800 x g at room temperature. Discard supernatant. Resuspend the beads with incubation buffer in a 1.5 ml or 2 ml tube to make 50% slurry.
Resuspend the pellets in 1 ml incubation buffer per 5-8 tubes (from Step 14) and incubate with 50 μl pre-washed streptavidin agarose beads (bed volume) per 1 ml incubation buffer in a 15 ml Falcon tube at room temperature with end over end rotation overnight. Approximately 250-400 μl streptavidin agarose beads (bed volume) is used.
Wash the beads 3-4 times each with 10 ml wash buffer followed by centrifugation at 800 x g at room temperature. Discard supernatant. During the last wash, transfer the beads into a 1.5 ml protein low LoBind tube, centrifuge at 800 x g at room temperature and discard supernatant.
Wash the beads 3 times each with 1 ml PNK buffer (without DTT) by centrifugation at 800 x g at 4 °C. Discard supernatant.
Resuspend the beads with one bed volume PNK buffer (without DTT) and add RNase T1 to a final concentration of 100 U/μl. Incubate the reaction at 22 °C for 15 min with occasional mixing. After RNase treatment, place reaction on ice for 5 min.
Wash the beads 5 times each with 1 ml PNK buffer (without DTT) by centrifugation at 800 x g at 4 °C. Discard supernatant.
Resuspend the beads with one bed volume NEBufferTM 3 containing CIP at a final concentration of 0.5 U/μl. Incubate the reaction at 37 °C for 10 min with shaking at 800 rpm.
Wash the beads twice each with 1 ml PNK buffer (without DTT) and twice with 1 ml PNK buffer by centrifugation at 800 x g at 4 °C.
Resuspend the beads with one bed volume PNK buffer, add T4 PNK and γ-32P-ATP to a final concentration of 1 U/μl and 0.5 µCi/µl, respectively. Incubate the reaction at 37 °C for 30 min with shaking at 800 rpm. Set up the same reaction with 50-100 ng 19 nt ssRNA size marker in a final volume of 20 μl (All the following steps are done with the marker sample as control).
Add ATP into the reaction to a final concentration of 100 μM and continue to incubate for 5 min at 37 °C.
Wash the beads 3 times each with 1 ml PNK buffer (without DTT) and twice with 1 ml PNK buffer by centrifugation at 800 x g at 4 °C. Discard supernatant.
Wash once with one bed volume of 2x proteinase K buffer. Discard supernatant.
Resuspend the beads with one bed volume of 2x proteinase K buffer and add proteinase K to a final concentration of 1.2 mg/ml. Incubate the reaction at 55 °C for 30 min with shaking at 800 rpm.
Add one bed volume of PCI, vortex for 10 sec and spin down for 10 min at 20,000 x g at room temperature.
Transfer the aqueous phase to a 1.5 ml DNA LoBind tube.
Add 200 μl chloroform per tube, vortex for 10 sec and spin down for 10 min at 20,000 x g at room temperature.
Transfer the aqueous phase to a new 1.5 ml DNA LoBind tube. Heat sample at 65 °C for at least 2 h to reverse cross-linking.
Add NaCl to a final concentration of 0.4 M, 1 μl GlycoBlueTM and 2-3 vol. 100% Ethanol.
Incubate sample for at least 30 min at -80 °C for precipitation.
Spin down for 30 min at 20,000 x g at 4 °C. Discard the supernatant.
Wash the pellet with 200 μl of 70% ethanol by centrifugation at 20,000 x g at 4 °C. Discard the supernatant. Air dry the pellet.
Resuspend the pellet in 10 μl nuclease-free water and add 1 μl 3' adapter (50 μM). Denature at 95 °C for 30 sec and immediately place the tube on ice for at least 3 min.
Assemble the 20 μl reaction by adding:
50% (v/v) DMSO
6 μl
10x T4 RNA ligase buffer
2 μl
T4 RNA ligase 2, truncated
1 μl
Incubate on ice overnight (at least 12 h) in a cold room.
Pre-run gel at 250 V for at least 30 min and wash the wells extensively with 1x TBE.
Add 1 vol. of 2x RNA loading dye and run sample on 15% urea polyacrylamide gel with 1x TBE. Load ligated and non-ligated 19 nt size markers on the same gel.
Run gel at 200-250 V for 2-3 h or until the dye front (bromophenol blue) reaches 2 cm above the bottom of the gel.
Wrap the gel with Saran wrap and place phosphor screen on top of the gel. Scan screen at various time points (e.g., 5 min-1 h) using a phosphorimager. After use, blank phosphor screen on a light source for 15-20 min.
Excise the gel piece around and above 3' ligated 19nt size marker and place it into a clean 2 ml microcentrifuge tube. To cut, print a 1:1 size copy of the phosphoimager scan. Put the saran wrapped gel on top and cut at indicated sizes. If the gel piece cannot fit into one 2 ml tube, additional tube(s) is required (Figure 2).
Figure 2. Example gel picture after 3' adapter ligation. The red rectangle indicates the gel region to be excised.
Elute the RNA by incubating the gel piece with 0.4 M NaCl solution (1 ml per cm2 gel piece) supplemented with RNase inhibitor to a final concentration of 0.1 U/μl. Incubate for 15-20 h at 4 °C with rotation/shaking.
Transfer the liquid to new 1.5 ml DNA LoBind tubes, 300-400 μl per tube. Add 1 μl GlycoBlueTM and 2-3 vol. 100% Ethanol per tube.
Incubate sample for at least 30 min at -80 °C for precipitation.
Spin down for 30 min at 20,000 x g at 4 °C. Discard the supernatant.
Wash the pellet with 200 μl of 70% ethanol by centrifugation at 20,000 x g at 4 °C. Discard the supernatant. Air dry the pellet.
Resuspend the pellet in 9 μl nuclease-free water and add 1 μl 5' adapter (50 μM). Denature at 95 °C for 30 sec and immediately place the tube on ice for at least 3 min.
Assemble the 20 μl reaction by adding:
50% (v/v) DMSO
6 μl
10x reaction buffer (supplied)
2 μl
T4 RNA ligase 2
2 μl
Incubate at 37 °C for 1 h
Add 1 vol. of 2x RNA loading dye and run sample on 12% urea polyacrylamide gel with 1x TBE. Load ligated and non-ligated 19 nt size markers on the same gel.
Pre-run gel at 250 V for at least 30 min and wash the wells extensively with 1x TBE. Run gel at 200-250 V for 1.5-2 h or until the dye front (bromophenol blue) reaches 2 cm above the bottom of the gel.
Wrap the gel with Saran wrap and place phosphor screen on top of the gel. Scan screen at various time points (e.g., 10 min-2 h) using a phosphorimager. After use, blank phosphor screen on a light source for 15-20 min.
Excise the gel piece above 3' ligated 19 nt size marker and place it into a 2 ml microcentrifuge tube. If the gel piece cannot fit into one 2 ml tube, additional tube(s) is required.
Elute the RNA by incubating the gel piece with 0.4 M NaCl solution (1 ml per cm2 gel piece) supplemented with RNase inhibitor to a final concentration of 0.1 U/μl. Incubate 15-20 h at 4 °C with rotation/shaking.
Transfer the liquid to new 1.5 ml DNA LoBind tubes, 300-400 μl per tube. Add 1 μl GlycoBlueTM and 2-3 vol. 100% Ethanol per tube.
Incubate sample for at least 30 min at -80 °C for precipitation.
Spin down for 30 min at 20,000 x g at 4 °C. Discard the supernatant.
Wash the pellet with 200 μl of 70% ethanol by centrifugation at 20,000 x g at 4 °C. Discard the supernatant. Air dry the pellet.
Resuspend RNA pellet in 15 μl of nuclease-free water.
Deplete the rRNA by using yeast RiboMinusTM isolation kit according to the manufacturer’s instructions.
Elute RNA with 10-15 μl nuclease-free water into a 1.5 ml DNA LoBind tube.
Perform the reverse transcription (cDNA synthesis) with SuperScriptTM III reverse transcriptase kit and RA3_RT primer according to the instruction manual.
To define the final PCR cycle number with optimum ratio between libraries and empty adapter-adapter species, perform a pilot PCR before the final PCR amplification. Assemble the reaction in a 1.5 ml DNA LoBind tube by adding:
10x Taq DNA polymerase buffer (supplied with enzyme)
10 μl
dNTPs 10 mM
2 μl
PCR forward primer (RP1) 100 μM
0.5-1 μl
Indexing Primer (RPI1) 100 μM
0.5-1 μl
cDNA (direct after RT)
4 μl
Nuclease-free water
to total vol. 100 μl
Divide the reaction mix into 5-10 clean PCR tubes, each with 10-20 μl. Set up the PCR program as following:
Take out one sample each time at indicated cycle numbers (e.g., 10, 12, 14, 16, 18, 20, 22, 24…) and run on 2.5% agarose gel supplemented with RedSafeTM dye (1:50,000) at 180 V for 0.5-1 h. Load low Range DNA ladder on the outermost lane on the gel.
Visualize the DNA with a gel imager and define the optimum cycle number (desired PCR product is clearly visible while unwanted 5’-adapter-3’-adapter is not overamplified) (Figure 3).
Figure 3. Example gel picture of test PCR. The red arrow indicates the optimal cycle number. The red rectangle indicates the gel region to be excised. The blue rectangle shows overamplifications which increase 5'-adapter-3'-adapter species.
Run final PCR with defined cycle number (same PCR program). Assemble the reaction in a PCR tube by adding:
10x Taq DNA polymerase buffer (supplied with enzyme)
20 μl
dNTPs 10 mM
4 μl
PCR forward primer (RP1) 100 μM
1-2 μl
Indexing Primer (RPI1-4) 100 μM
1-2 μl
cDNA (direct after RT)
8 μl
Nuclease-free water
to total vol. 200 μl
Run PCR products on 2.5% agarose gel supplemented with RedSafeTM dye (1:50,000) at 180 V for 1 h. Load low Range DNA ladder on the outermost lane on the gel.
Visualize the DNA with a gel imager and cut out the gel piece corresponding to your library.
Use NucleoSpin® gel purification kit to isolate library from the gel according to the manufacturer’s instruction manual. Elute with 20 μl nuclease-free water into a 1.5 ml DNA LoBind tube.
Assess the library with Bioanalyzer. Proceed to sequencing.
Notes
In this protocol, Fastprep® was used to lyse the yeast cells. To improve the lysis efficiency, a Freezermill could be used. The starting material (amount of cells) may vary according to the abundancy of target RNPs. A centrifugation step is included in our protocol (Step 12) to separate cytosolic from membrane fractions since our target mRNP granules (PBs) have been shown to be associated with ER membrane. Depending on the expected library size, different ssRNA size markers and/or RNA ladder could be used when running a polyacrylamide gel.
Recipes
Yeast Extract-Peptone-Dextrose (YPD) agar
1% (w/v) Yeast extract
2% (w/v) Peptone
2% (w/v) Dextrose
2% Agar
Yeast Extract-Peptone-Dextrose (YPD) medium
1% (w/v) Yeast extract
2% (w/v) Peptone
2% (w/v) Dextrose
RIPA buffer
50 mM Tris-HCl (pH 8.0)
150 mM NaCl
1% (v/v) NP-40
0.5% (w/v) Sodium deoxycholate
0.1% (w/v) SDS
Add proteinase inhibitor cocktail before use, one tablet per 50 ml buffer
Incubation buffer
50 mM sodium phosphate buffer (NaPi, pH 8.0)
300 mM NaCl
6 M GuHCl
0.5% (v/v) TWEEN® 20
Wash buffer
50 mM sodium phosphate buffer (NaPi, pH 8.0)
300 mM NaCl
6M GuHCl
0.5% (v/v) TWEEN® 20
0.5% (v/v) NP-40
PNK buffer
50 mM Tris-HCl (pH 7.5)
50 mM NaCl
10 mM MgCl2
5 mM DTT
2x proteinase K buffer
100 mM Tris-HCl (pH 7.5)
200 mM NaCl
2 mM EDTA
1% (w/v) SDS
Urea polyacrylamide gel
15% or 12% (w/v) Acrylamide/Bis-acrylamide
8 M Urea
Add 1x TBE buffer to desired volume
Further add 40 μl 10% (w/v) APS and 4 μl TEMED per 10 ml
Tris-HCl buffer (1M)
121.14 g Tris base
Adjust the pH by adding HCl at RT
Acknowledgments
This protocol was established and optimized with the help of Shivendra Kishore, Lukasz Jaskiewicz and Nitish Mittal. This work was supported through grants from HFSP (RGP0031), the Swiss National Science Foundation (31003A_141207, 310030B_163480) and the University of Basel to AS. CW and JW were supported by Werner Siemens Fellowships.
Competing interests
The authors have declared that no competing interests.
References
Hafner, M., Landthaler, M., Burger, L., Khorshid, M., Hausser, J., Berninger, P., Rothballer, A., Ascano, M., Jr., Jungkamp, A. C., Munschauer, M., Ulrich, A., Wardle, G. S., Dewell, S., Zavolan, M. and Tuschl, T. (2010). Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell 141(1): 129-141.
Kishore, S., Jaskiewicz, L., Burger, L., Hausser, J., Khorshid, M. and Zavolan, M. (2011). A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods 8(7): 559-564.
Tagwerker, C., Flick, K., Cui, M., Guerrero, C., Dou, Y., Auer, B., Baldi, P., Huang, L. and Kaiser, P. (2006). A tandem affinity tag for two-step purification under fully denaturing conditions: application in ubiquitin profiling and protein complex identification combined with in vivocross-linking. Mol Cell Proteomics 5(4): 737-748.
Weidner, J., Wang, C., Prescianotto-Baschong, C., Estrada, A. F. and Spang, A. (2014). The polysome-associated proteins Scp160 and Bfr1 prevent P body formation under normal growth conditions. J Cell Sci 127(Pt 9): 1992-2004.
Copyright: Wang et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Wang, C., Weidner, J. and Spang, A. (2018). Preparation of Sequencing RNA Libraries through Chemical Cross-linking Coupled to Affinity Purification (cCLAP) in Saccharomyces cerevisiae. Bio-protocol 8(19): e3029. DOI: 10.21769/BioProtoc.3029.
Wang, C., Schmich, F., Srivatsa, S., Weidner, J., Beerenwinkel, N. and Spang, A. (2018). Context-dependent deposition and regulation of mRNAs in P-bodies. eLife 7: e29815.
Download Citation in RIS Format
Category
Biochemistry > RNA > RNA-protein interaction
Molecular Biology > RNA > RNA sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
303 | https://bio-protocol.org/exchange/protocoldetail?id=303&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Grafting of Potato Plants
PS Paula Suárez-López
Published: Vol 2, Iss 23, Dec 5, 2012
DOI: 10.21769/BioProtoc.303 Views: 11351
Original Research Article:
The authors used this protocol in May 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2012
Abstract
Grafting is a very useful technique for testing the transmission of long-distance signals in plants and is used in agriculture and gardening for different purposes. This protocol, based on a previously published one (Jackson et al., 1998), describes a grafting method for potato plants, which has successfully been used to test the transmission of tuber-inducing signals (Martin et al., 2009; González-Schain et al., 2012). We describe first the procedures for plant growth and then the grafting procedure. Although this method has been used for grafting plants that were initially grown in vitro, it should work as well with plants grown from tubers in soil. This protocol probably works well for other plant species, with small modifications.
Keywords: Grafting Potato Solanum tuberosum
Materials and Reagents
Murashige & Skoog medium including vitamins (Duchefa Biochemie, catalog number: M0222 )
Sucrose
MES (Sigma-Aldrich, catalog number: M8250 )
ddH2O
KOH
GelriteTM (Duchefa Biochemie, catalog number: G1101.5000 )
Soil composed of blocking compost (Plantaflor® Presstopfsubstrat) and sand in a 3:1 proportion
KNO3
NH4NO3
K2HPO4
KH2PO4
Ca(NO3)2.4H2O
MgSO42.7H2O
FeSO42.7H2O
Kelamix
Fertilization solution: modified Hoagland’s solution (Johnson et al., 1957) diluted 1/60 (see Recipes)
2MS medium (see Recipes)
Equipment
Plant growth chamber
Laminar flow hood
Sterile forceps
Glass jars, glass tubes or plastic containers suitable for in vitro growth
Note: Equipments 1-4 is not required if plants are grown from tubers in soil.
Sterile scalpels
Pots
Stakes
Plant twist ties (e.g. Garden Odyssey, catalog number: T001 )
Beaker
Paper surgical tape (e.g. 3 M Micropore medical tape, catalog number: 1530-0 )
Transparent plastic bags
Adhesive tape
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant developmental biology > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,030 | https://bio-protocol.org/exchange/protocoldetail?id=3030&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Ni-NTA-Agarose Purification of Recombinant Hepatitis C Virus E2 Ectodomain Produced in a Baculovirus Expression System
JG Julián Gómez-Gutiérrez*
MR Mar Rodríguez-Rodríguez
FG Francisco Gavilanes
BY Belén Yélamos*
*Contributed equally to this work
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3030 Views: 5378
Edited by: David Paul
Reviewed by: Jan-Ulrik DahlSteven James Burgess
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
In this protocol, we describe the production and purification of the ectodomain of the E2661 envelope protein (amino acids 384-661) of the Hepatitis C virus, which plays a fundamental role in the entry of the virus into the host cell. This protein has been expressed in both prokaryotic and eukaryotic systems but in small quantities or without native protein characteristics. In our case, we use the Baculovirus expression system in insect cells. E2661 is secreted into the extracellular medium and purified by means of affinity chromatography a Ni-NTA-column because the protein has a tag of six histidines at its amino terminal end. The purified protein possesses a native-like conformation and it is produced in large quantities, around 5-6 mg per liter.
Keywords: Hepatitis C virus Envelope protein Affinity chromatography Baculovirus expression system Recombinant proteins Ectodomain
Background
Hepatitis C virus (HCV) is a major cause of chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma worldwide (Major et al., 2001; Alter, 2006). At this moment, there is no vaccine for HCV and antivirals are used to treat the HCV infection (Imran et al., 2014). However, treatments are expensive and not 100% effective (Kohli et al., 2014). The HCV envelope glycoprotein E2 is responsible for the interaction with cellular receptors, thus it is a major candidate to study the first steps of the infective cycle of the virus. Previous expression systems produce low levels of heterogeneous protein due to glycosylation and aggregation, and it is difficult to distinguish between molecules that undergo productive and non-productive folding (Flint et al., 2000). In this protocol, we describe the production of the recombinant ectodomain of E2 tagged with a 6xHis extension at N-terminal end of the protein in a baculovirus/insect cell system. The gp67 signal peptide fused to the E2 ectodomain mediates the forced secretion of the recombinant protein. The protein is secreted to the cell supernatant and purified by means of affinity chromatography with a Ni-NTA-Agarose column. The yield of the process was 5-6 mg of protein per liter of media. This protein possesses a native-like conformation as determined by different spectroscopic techniques such as circular dichroism or fluorescence spectroscopy, as well as by its recognition in an enzyme immunoassay by a conformation specific antibody (Rodriguez-Rodriguez et al., 2009). The use of this independent folding domain that is able to acquire its proper folding in absence of the E1 glycoprotein, may contribute to shed light on the biology of HCV (three-dimensional or secondary structure of the protein and its role in the fusion of the HCV virus and the host cell membranes). Also, it could also be used as a vaccine in the prevention of HCV infection.
Materials and Reagents
Pipette tips 200 μl (Sigma-Aldrich, catalog number: P5161 )
Tissue culture flasks F75 (75 cm2 surface area) (TPP Techno Plastic Products, catalog number: 90075 )
Tissue culture flasks F150 (150 cm2 surface area) (TPP Techno Plastic Products, catalog number: 90150 )
Cell culture flasks F25 (25 cm2 surface area) (Corning, catalog number: 3055 )
Tissue culture dish 35 mm (SARSTEDT, catalog number: 83.3900 )
Sterile tube 50 ml (SARSTEDT, catalog number: 62.547.254 )
Sterile tube 15 ml (Fisher Scientific, catalog number: 05-539-12 )
Serological pipette 10 ml (SARSTEDT, catalog number: 86.1254.001 )
Dialysis membrane Spectra/Por® 6 (VWR, Spectrum, catalog number: 734-0646 )
Insect cell line Spodoptera frugiperda (Sf9) (Oxford Expression Technologies, catalog number: 100201 )
Insect cell line Trichopulsia ni (High Five) (Tni) (generously donated by PhD J. Pérez-Gil, Dpt. Biochemistry and Molecular Biology, Faculty of Biology, University Complutense of Madrid, Madrid, Spain)
Baculovirus transfer vector pAcGP37A (BD, BD PharmingenTM, catalog number: 21220P )
Recombinant transfer vector pAcGP67A-E2661, obtained according to the procedure described in Rodriguez-Rodriguez et al., 2009)
FlashBAC GOLD kit (Oxford Expression Technologies, catalog number: 100201 ) composed of:
flashBACTM DNA
Positive control transfer plasmid DNA (expressing lacZ)
Baculofectin II
Insect-XPRESSTM Protein-free Insect Cell Medium with L-glutamine (Lonza, catalog number: 12-730Q )
Neubauer's counting camera (VWR, MARIENFELD, catalog number: 631-0696 )
Gentamicin (Sigma-Aldrich, catalog number: G1264 )
TC100 Insect Medium (Lonza, catalog number: BE02-011F )
Ni2+-nitrilotriacetic acid agarose (Ni-NTA agarose) resin (QIAGEN, catalog number: 30230 )
Tris-Base (Sigma-Aldrich, catalog number: T1503 )
NaCl (Merck, catalog number: 106404 )
Imidazole (Sigma-Aldrich, catalog number: 56750 )
EDTA (Sigma-Aldrich, catalog number: 03695 )
Dodecyl sulfate sodium salt (Merck, catalog number: 1.13760.1000 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Glycine (Sigma-Aldrich, catalog number: G8898-1KG )
Bromophenol blue (United States Biological, catalog number: 12370 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Acrylamide (Sigma-Aldrich, catalog number: A8887-500G )
N,N′-Methylenebis(acrylamide) (Sigma-Aldrich, catalog number: M7279-250G )
Ammonium persulphate (Sigma-Aldrich, catalog number: A3678-100G )
N,N,N',N',N'-tetramethylethylenediamine (TEMED) (Bio-Rad Laboratories, catalog number: 1610801 )
Coomassie Brilliant Blue R-250 (Sigma-Aldrich, catalog number: B8647 )
Methanol (Sigma-Aldrich, catalog number: 322415-1L )
Acetic acid (Merck, catalog number: 1000063 )
3x Protein electrophoresis application buffer (see Recipes)
Running electrophoresis buffer (see Recipes)
Blue staining solution (see Recipes)
Bleaching solution (see Recipes)
Separating gel (see Recipes)
Concentrating gel (see Recipes)
Equipment
Pipettes
-80 °C freezer
CO2 Water-jacketed Incubator (NuAire, model: NU-2700 IR Autoflow )
Laminar flow chamber (Azbil Telstar, model: BV-100 )
Laboratory centrifuge (MPW MED. INSTRUMENTS, model: MPW-223e )
Upright microscope (Nikon Instruments, IZASA, model: H550S )
5 ml plastic syringe
Mini-PROTEAN® Tetra Electrophoresis System (Bio-Rad Laboratories, catalog number: 165-8001 )
Plastic bucket (Labotienda, catalog number: BTL006 )
UV-Spectrophotometer (Shimadzu, model: UV-1800 )
15 L Plastic bucket for dialysis
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gómez-Gutiérrez, J., Rodríguez-Rodríguez, M., Gavilanes, F. and Yélamos, B. (2018). Expression and Ni-NTA-Agarose Purification of Recombinant Hepatitis C Virus E2 Ectodomain Produced in a Baculovirus Expression System. Bio-protocol 8(19): e3030. DOI: 10.21769/BioProtoc.3030.
Download Citation in RIS Format
Category
Biochemistry > Protein > Expression
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,031 | https://bio-protocol.org/exchange/protocoldetail?id=3031&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Real-time PCR Analysis of PAMP-induced Marker Gene Expression in Nicotiana benthamiana
FL Fan Liu
YX Yuanpeng Xu
Yan Wang
Yuanchao Wang
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3031 Views: 7814
Edited by: Wende Liu
Reviewed by: Satyabrata Nanda
Original Research Article:
The authors used this protocol in Feb 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2018
Abstract
Perception of pathogen-associated molecular patterns (PAMPs) often triggers various innate immune responses in plants. The transcriptional changes of defense-related genes are often used as a marker to assay PAMP-triggered plant immune response. Here we described a protocol to monitor the relative expression level of marker genes in Nicotiana benthamiana upon treatment with PAMPs. The procedure includes leaf treatment using PAMPs, total RNA isolation, cDNA synthesis, quantitative real-time PCR and data analysis. This protocol is applicable to monitor marker gene expression triggered by different PAMPs in N. benthamiana.
Keywords: PAMPs PTI Real-time PCR Nicotiana benthamiana Defense-related marker gene
Background
Pathogen-associated molecular patterns, namely PAMPs, are a class of molecules derived from pathogens and are relatively conserved across microorganisms. Multiple PAMPs such as flg22 and XEG1 (Felix et al., 1999; Ma et al., 2015), have been characterized that can be detected by plant cell surface localized pattern-recognition receptors (PRRs) and thereby induce PAMP-triggered immunity (Couto and Zipfel, 2016). One of the predominant PAMP-triggered responses is the activation of defense-related maker genes (Navarro et al., 2004; Zipfel et al., 2006). Nicotiana benthamiana has been used extensively as a model plants and is sensitive to multiple PAMPs. In N. benthamiana, the marker genes, such as NbCYP71D20, NbACRE31 and NbWRKY22, were previously found that are rapidly activated upon PAMP treatment (Heese et al., 2007; Segonzac et al., 2011; Wang et al., 2018). Here, we describe a detailed protocol for checking the PAMP-triggered marker gene expression in N. benthamiana. The relative gene expression was also determined in parallel using a negative control to exclude the background noise.
Materials and Reagents
MicroAmpTM Splash-Free 96-Well Base (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4312063 )
1,000 µl pipette tips (Corning, Axygen®, catalog number: TF-1000-R-S )
200 µl pipette tips (Corning, Axygen®, catalog number: TF-200-R-S )
10 µl pipette tips (Corning, Axygen®, catalog number: TF-300-R-S )
1 ml needless syringe (BD, catalog number: 309659 )
1.5 ml RNase-free tube (Corning, Axygen®, catalog number: MCT-150-C )
Axygen® 0.2 ml Polypropylene PCR Tube Strips (8-Tubes/Strip) (Corning, Axygen®, catalog number: PCR-0208-C )
MicroAmpTM Optical 96-Well Reaction Plate with Barcode (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4306737 )
MicroAmpTM Optical Adhesive Film (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4360954 )
Tissue paper
Healthy 5-6 weeks N. benthamiana plants (see Figure 1)
Any PAMPs of interest and corresponding control solution
Liquid nitrogen
β-mercaptoethanol (Solarbio, catalog number: M8210 )
E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek, catalog number: R6834-01 )
DNase/RNase-free ddH2O (Solarbio, catalog number: R1600 )
PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara Bio, Clontech, catalog number: RR047A )
TB GreenTM Premix Ex TaqTM (Tli RNase H Plus) (Takara Bio, Clontech, catalog number: RR420A )
1 mM flg22 stock solution (Gene Script, RP19986) (see Recipes)
1 mM XEG1 stock solution (see Recipes)
70% ethanol (see Recipes)
Equipment
Mortar and pestle
Growth chamber
NanoDropTM 1000 spectrophotometer (Thermo Fisher Scientific, model: NanoDropTM 1000 )
Vortexer (Scientific Industries, model: Vortex-Genie 2 , catalog number: SI-0246)
Cold Centrifuge (Eppendorf, model: 5424 R , catalog number: 5404000014)
Pipettes 100-1,000 µl (Eppendorf, catalog number: 3120000062 )
Pipettes 10-100 µl (Eppendorf, catalog number: 3120000046 )
PCR Thermal Cyclers (Thermo Fisher Scientific, Applied BiosystemsTM, model: 2720, catalog number: ED000651 )
MicroAmpTM Adhesive Film Applicator (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4333183 )
MPS 1000 Mini PCR Plate Spinner (Labnet International, catalog number: C1000 )
ABI 7500 fast real-time PCR system (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4351107 )
Software
Applied Biosystems Sequence Detection Software v1.4.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, F., Xu, Y., Wang, Y. and Wang, Y. (2018). Real-time PCR Analysis of PAMP-induced Marker Gene Expression in Nicotiana benthamiana. Bio-protocol 8(19): e3031. DOI: 10.21769/BioProtoc.3031.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Plant Science > Plant physiology > Biotic stress
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,032 | https://bio-protocol.org/exchange/protocoldetail?id=3032&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Culture of Mouse Lung ILC2s
Pauline Schmitt
Anais Duval
Emilie Mirey
Jean-Philippe Girard
Corinne Cayrol
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3032 Views: 8688
Edited by: Ruth A. Franklin
Reviewed by: Francesco BorrielloXiaoping Xie
Original Research Article:
The authors used this protocol in Apr 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2018
Abstract
Group 2 Innate Lymphoid Cells (ILC2) play an important role in immune responses at barrier surfaces, notably in the lung during airway allergic inflammation or asthma. Several studies have described methods to isolate ILC2s from wild-type naive mice, most of them using cell sorting to obtain a pure population. Here, we describe in detail, a simple, efficient method for isolation and culture of lung mouse ILC2s. Lungs from Rag2-/- mice pretreated with IL-33 are collected and processed into single cell suspensions. Lymphoid cells are then recovered by density gradient separation. Lin-CD45+ cells are selected by depletion of lineage positive cells followed by positive selection of CD45+ cells. Culture of the isolated cells for several days results in a highly purified ILC2 population expressing typical cell surface markers (CD90.2, Sca1, CD25, CD127, and IL-33R). These cells can be expanded in culture for up to 10 days and used for diverse ex vivo assays or in vivo adoptive transfer experiments.
Keywords: Innate immunity Allergic inflammation ILC2 IL-33 Type 2 cytokine Lung Culture
Background
Group 2 Innate Lymphoid Cells (ILC2) are tissue resident cells that play crucial roles in anti-parasitic innate immunity as well as in the development of allergic inflammation. They respond to epithelial cell-derived cytokines such as interleukin-33 (IL-33) by producing large amounts of type 2 cytokines IL-5 and IL-13, which in turn induce eosinophilia and mucus production (Cayrol and Girard, 2018). In order to better characterize the function and regulation of these cells, numerous groups have sorted ILC2s from the lung of wild-type mice (WT) by fluorescence-activated cell sorting (FACS). Due to the low number of the ILC2s present in the lungs at steady state, this method results in a low yield of purified cells (1 x 104 per mouse) (for a review, see Moro et al., 2015). In the present protocol, we pretreat mice with IL-33, which triggers the in vivo expansion of lung ILC2s, resulting in a better yield of purified cells (1.3 x 106 per mouse). Moreover, we use Rag2-/- mice instead of WT mice because 1) the absence of B and T cells in these mice facilitates the purification of ILC2s, and 2) the number of ILC2s is greater in these mice. Culture of the isolated Lin-CD45+ cell population for a couple of days ex vivo provides highly purified lung ILC2s without the need to use a cell sorter. In summary, the procedure we describe is highly reproducible and provides abundant highly purified mouse lung ILC2s.
Materials and Reagents
Sterile disposable scalpel (LABELIANS, NahitaTM, catalog number: SCMEC24 )
96-Well polystyrene conical bottom MicroWellTM Plates (Thermo Fisher Scientific, catalog number: 249570 )
15 ml and 50 ml conical centrifuge polypropylene tubes (Corning, Falcon®, catalog numbers: 352096 and 352070 respectively)
5 ml round-bottom polystyrene tubes (Corning, Falcon®, catalog number: 352054 )
Cell culture 60 x 15 mm Petri dishes (Thermo Fisher Scientific, catalog number: 150288 )
1 ml tuberculin syringes (with 25 G x 16 mm disposable) (Terumo, catalog number: SS-01T )
BD Micro-Fine+TM Insulin Syringes 0.3 ml; 30 G x 8 mm needle (BD, catalog number: 324826 )
70 μm cell strainer (Corning, Falcon®, catalog number: 352350 )
Plunger of 2.5 ml syringes (Terumo, catalog number: SS*02SE1 )
Hypodermic needles (Terumo, catalog number: NN-2516R )
Non cottoned open Pasteur pipettes (150 mm 2 ml) (Hilgenberg, catalog number: 3150102 )
MS columns (Miltenyi Biotec, catalog number: 130-042-201 )
6-well polystyrene (PS) multidish (Thermo Fisher Scientific, catalog number: 140675 )
1.2 ml Cluster Tubes loose (Thermo Fisher Scientific, Abgene®, catalog number: AB-0672 )
Rag2-/- mice on a C57BL/6J background (B6.129-Rag2tm1Fwa) (European Mouse Mutant Archive [EMMA])
Human recombinant Interleukin-33 (rIL-3395-270), natural form (home-made; previously described in Lefrançais et al., 2014)
Note: Alternatively, recombinant IL-33 can be purchased from R&D Systems (R&D Systems, catalog number: 3625-IL ).
Ice
Dulbecco's Modified Eagle Medium (DMEM, high glucose, GlutaMAXTM Supplement, pyruvate) (Thermo Fisher Scientific, GibcoTM, catalog number: 31966021 )
Dulbecco's Phosphate-Buffered Saline (DPBS, no calcium, no magnesium) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190169 )
RPMI 1640 with high glucose, L-Glutamine, HEPES (ATCC, catalog number: 30-2001 )
Penicillin/Streptomycin 100x liquid (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Recombinant mouse IL-2 (Cys 160 Ser) Protein (R&D Systems, catalog number: 1150-ML-020 ; Reconstitute at 100 μg/ml in sterile DPBS containing 0.1% bovine serum albumin. Store stock solution at -70 °C)
Collagenase Type IV (Thermo Fisher Scientific, GibcoTM, catalog number: 17104019 )
DNase I, from bovine pancreas (Roche Diagnostics, catalog number: 11284932001 )
Fetal Bovine Serum (Thermo Fisher Scientific, GibcoTM, catalog number: 10270-106 )
Normal mouse serum (Thermo Fisher Scientific, catalog number: 10410 )
Lympholyte®-M (CEDARLANE, catalog number: CL5035 )
EasySepTM mouse hematopoietic progenitor cell isolation kit (STEMCELL Technologies, catalog number: 19856 )
CD45 MicroBeads, mouse (Miltenyi Biotec, catalog number: 130-052-301 )
FACS reagents
Note: Dilutions have to be determined for each lot of reagent.
Fixable Viability Dye eFluor 506 (dilution: 1/1,000) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 65-0866-14 )
Streptavidin, PE-CyTM 7 conjugated (dilution: 1/100) (BD PharmingenTM, catalog number: 557598 )
FACS Monoclonal Antibodies
Note: Dilutions have to be determined for each lot of antibody.
Rat anti-Mouse CD16/CD32 (mouse BD Fc BlockTM) (clone 2.4G2, dilution: 1/200) (BD PharmingenTM, catalog number: 553142 )
Rat Anti-Mouse CD4, FITC conjugated (clone GK1.5, dilution: 1/2,000) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 11-0041-85 )
Rat Anti-Mouse CD3, FITC conjugated (clone 17A2, dilution: 1/600) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 11-0032-80 )
Rat Anti-Mouse CD19, FITC conjugated (clone 1D3, dilution: 1/2,000) (BD PharmingenTM, catalog number: 553785 )
Rat Anti-Mouse CD45R/B220, FITC conjugated (clone RA3-6B2, dilution: 1/1,000) (BD PharmingenTM, catalog number: 553088 )
Hamster Anti-Mouse CD11c, FITC conjugated (clone N418, dilution: 1/300) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 11-0114-82 )
Rat Anti-Mouse CD11b, FITC conjugated (clone M1/70, dilution: 1/100) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 11-0112-85 )
Rat Anti-Mouse Ter119, FITC conjugated (clone Ter119, dilution: 1/100) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 11-5921-85 )
Rat Anti-Mouse Ly-6G/Ly-6C, FITC conjugated (clone RB6-8C5, dilution: 1/100) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 11-5931-85 )
Hamster Anti-Mouse FceR1α, FITC conjugated (clone MAR-1, dilution: 1/100) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 11-5898-85 )
Mouse Anti-Mouse NK1.1, FITC conjugated (clone PK136, dilution: 1/300) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 11-5941-85 )
Rat Anti-Mouse CD45, PerCP conjugated (clone 30-F11, dilution: 1/1,000) (BD PharmingenTM, catalog number: 557235 )
Rat Anti-Mouse CD90.2, APC-CyTM7 conjugated (clone 53-2.1, dilution: 1/600) (BD PharmingenTM, catalog number: 561641 )
Rat Anti-Mouse CD25, eFluor 450 conjugated (clone PC61.5, dilution: 1/300) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 48-0251-82 )
Rat Anti-Mouse CD127, PE conjugated (clone A7R34, dilution: 1/100) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 12-1271-83 )
Rat Anti-Mouse Ly-6A/E (Sca-1), APC conjugated (clone D7, dilution: 1/300) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 17-5981-83 )
Rat Anti-Mouse T1/ST2 (IL-33R), biotinylated (clone DJ8, dilution: 1/100) (MD Biosciences, catalog number: 101001B )
FACS Isotype controls
Note: Isotype controls are used at the same concentration as the specific antibody. So, dilutions have to be determined according to the concentration of the matched antibody.
Rat IgG1 κ Isotype Control, eFluor 450 (clone eBRG1, dilution: 1/300) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 48-4301-80 )
Rat IgG2a κ Isotype Control, APC (clone eBR2a, dilution: 1/300) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 17-4321-81 )
Rat IgG2a, κ Isotype Control, PE (clone eBR2a, dilution: 1/100) (Thermo Fisher Scientific, eBioscienceTM, catalog number: 12-4321-82 )
Rat IgG2a, κ Isotype Control, APC-CyTM 7 (Clone R35-95, dilution: 1/600) (BD PharmingenTM, catalog number: 552770 )
Rat IgG1, κ Isotype Control, Biotin (Clone R3-34, dilution: 1/50) (BD PharmingenTM, catalog number: 553923 )
Lung digestion solution (see Recipes)
PEF buffer (see Recipes)
PEB buffer (see Recipes)
ILC2 culture medium (see Recipes)
FACS buffer (see Recipes)
FACS staining buffer (see Recipes)
Equipment
MiniMACSTM separator (Miltenyi Biotec, catalog number: 130-042-102 )
EasySepTM Magnet (STEMCELL Technologies, catalog number: 18000 )
Malassez Hemocytometer
Water bath
Centrifuge (Eppendorf, model: 5804 R )
4 °C refrigerator
Flow cytometer (BD, model: LSR I I)
Software
FlowJo software (Tree Star)
BD FACSDivaTM software (BD Biosciences)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Schmitt, P., Duval, A., Mirey, E., Girard, J. and Cayrol, C. (2018). Isolation and Culture of Mouse Lung ILC2s. Bio-protocol 8(19): e3032. DOI: 10.21769/BioProtoc.3032.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Lymphocyte
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,033 | https://bio-protocol.org/exchange/protocoldetail?id=3033&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Method for SUMO Modification of Proteins in vitro
CL Christine C. Lee
BL Bing Li
HY Hongtao Yu
MM Michael J. Matunis
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3033 Views: 6189
Edited by: Gal Haimovich
Reviewed by: deepika jaiswalMaría Victoria Martin
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
The Small Ubiquitin-related Modifier (SUMO) is a protein that is post-translationally added to and reversibly removed from other proteins in eukaryotic cells. SUMO and enzymes of the SUMO pathway are well conserved from yeast to humans and SUMO modification regulates a variety of essential cellular processes including transcription, chromatin remodeling, DNA damage repair, and cell cycle progression. One of the challenges in studying SUMO modification in vivo is the relatively low steady-state level of a SUMO-modified protein due in part to the activity of SUMO deconjugating enzymes known as SUMO Isopeptidases or SENPs. Fortunately, the use of recombinant SUMO enzymes makes it possible to study SUMO modification in vitro. Here, we describe a sensitive method for detecting SUMO modification of target human proteins using an in vitro transcription and translation system derived from rabbit reticulocyte and radiolabeled amino acids.
Keywords: SUMO In vitro sumoylation assay SUMO1 E1 activating enzyme E2 conjugating enzyme
Background
Like other ubiquitin protein family modifications, SUMO modification occurs through an ATP-dependent enzymatic cascade involving the sequential activity of an E1 activating enzyme (the Aos1/Uba2 heterodimer in humans), an E2 conjugating enzyme (Ubc9), and one of many E3 ligating enzymes (Gareau and Lima, 2010). Proteins with a SUMO conjugation consensus site, ΨKxE (Ψ is a hydrophobic residue, followed by a lysine, any amino acid, and glutamic acid), can be efficiently modified by one or several of the SUMO paralogs expressed in mammals, including SUMO1, SUMO2 or SUMO3 (collectively referred to as SUMO2/3, due to their 97% sequence homology) (Gareau and Lima, 2010; Flotho and Melchior, 2013). SUMO is also reversibly removed by the activity of SUMO isopeptidases, or SENPs (Mukhopadhyay and Dasso, 2007; Hickey et al., 2012). Although the dynamic cycling between conjugation and deconjugation can result in a relatively low steady-state level of a modified protein, SUMO modification nonetheless produces profound effects on substrate function in a variety of cellular pathways.
SUMO modification is most commonly detected by immunoblotting. Like other post-translational modifications such as ubiquitylation and PARylation, whole cell lysates immunoblotted for SUMO1 or SUMO2/3 reveal high molecular-weight smears due to the large number of cellular conjugates. Notably, SUMO modification of RanGAP1 can be identified as a band appearing on an immunoblot at ~90 kDa, an ~12 kDa shift above the unmodified 70 kDa protein (Matunis et al., 1996). To directly observe SUMO modification of specific substrates, immunoblots may also be performed with substrate-specific antibodies if modification levels are sufficiently high. For example, APC4 is a subunit of the Anaphase Promoting Complex/Cyclosome (APC/C) that is SUMO-modified robustly during the mitotic stage of the cell cycle as observed by immunoblot analysis of whole cell lysates from synchronized cells (Lee et al., 2018). Although SUMO modification by a single protein subunit can be detected as a ~12 kDa shift in molecular weight (Figure 1), this shift cannot be distinguished from modification by other ubiquitin-like proteins without further validation. An alternative method for demonstrating SUMO modification utilizes a cell line with His-SUMO, followed by Ni-NTA purification under denaturing conditions and immunoblotting for co-purifying proteins of interest (Lee et al., 2018). Complimentary approaches for detecting and validating SUMO-modified proteins utilize overexpression of SUMO E1 and E2 enzymes, or the depletion of SENPs, followed by immunoblotting for the protein of interest. Furthermore, recent advances in proteomic methods have made the sensitive identification of SUMO-modified proteins possible, leading to hundreds of SUMO substrates that must be further validated and characterized. (Matic et al., 2010; Schimmel et al., 2014; Cubeñas-Potts, et al., 2015).
In addition to these cellular assays, detection and verification of SUMO modification using biochemically purified components in vitro also represents an important approach to validating and characterizing novel SUMO substrates (Park-Sarge and Sarge, 2008; Werner et al., 2009; Yunus and Lima; 2009; Yang et al., 2018). With in vitro analysis of a substrate, mutants can also be particularly valuable in verifying specific modification sites. Here we describe a protocol for in vitro SUMO modification routinely used in our laboratory (Zhu et al., 2008; Reiter et al., 2016), as recently illustrated by our analysis of the APC4 subunit of APC/C (Lee et al., 2018).
Figure 1. HeLa cell lysates were synchronized with a double thymidine block and released into mitosis, as indicated by immunoblots to CyclinB1 and Cdc20. Immunoblot to APC4 shows unmodified APC4 at ~100 kDa and SUMO-modified forms indicated by asterisks (*). Glyceraldehyde 3-phosphate dehydrogenase (GAPD) immunoblot is used as a loading control.
Materials and Reagents
Pipette tips (USA Scientific, catalog numbers: 1111-3700 , 1111-0700 , 1112-1720 )
X-Ray Film, Blue Base for Autoradiography, 8 x 10 inch (RPI, Research Products International, catalog number: 248300 )
WhatmanTM Grade 2 Qualitative Filter Paper Sheet, Size 46 x 57 cm, Pore Size: 8 μm (GE Healthcare, WhatmanTM, catalog number: 1002-917 )–cut into 10 x 9 cm rectangles
Clear plastic wrap (Fisher Scientific, catalog number: 22-305654 )
1.5 ml Eppendorf tube
Recombinant SUMO1 or SUMO2 (see Procedure B)
Recombinant SUMO E1 activating enzyme (Aos/Uba2) (see Procedure B)
Recombinant SUMO E2 conjugating enzyme (see Procedure B)
Appropriate plasmid containing substrate cDNA under control of T7 or SP6 promoters (For example, RanGAP1 can be used as a positive control, Plasmid) (Addgene, catalog number: 13379 )
(Optional) Recombinant GST-RanGAP1 (Enzo Life Sciences, catalog number: BML-UW9755-0100 )
TNT® Quick Coupled Transcription/Translation System (Promega, catalog number: L1170 or L2080 for 40 reactions)
EasyTagTM L-[35S]-Methionine, 5 mCi (185 MBq), Stabilized Aqueous Solution (PerkinElmer, catalog number: NEG709A005MC )
Adenosine 5'-triphosphate (ATP) disodium salt hydrate (Sigma-Aldrich, catalog number: A1852 )
Phosphocreatine disodium salt hydrate (Sigma-Aldrich, catalog number: P7936-10MG )
Pyrophosphatase, Inorganic from baker's yeast (S. cerevisiae) (Sigma-Aldrich, catalog number: I1643 )
HEPES (Molecular Biology Grade) (Fisher Scientific, Fisher BioReagents, catalog number: BP310-500 )
Potassium hydroxide (ACS reagent, pellets) (Sigma-Aldrich, catalog number: 221473 )
Potassium acetate (Molecular biology grade) (Sigma-Aldrich, catalog number: P1190 )
Magnesium acetate tetrahydrate (Molecular biology grade) (Sigma-Aldrich, catalog number: M5661 )
1,4-Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 10197777001 )
Acrylamide (Bio-Rad Laboratories, catalog number: 1610101 )
2% Bis Solution (Bis-acrylamide) (Bio-Rad Laboratories, catalog number: 1610142 )
Ammonium persulfate (APS) (Bio-Rad Laboratories, catalog number: 1610700 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: 436143 )
PageRulerTM Prestained Protein Ladder, 10 to 250 kDa (Thermo Fisher Scientific, catalog number: 26619 )
Glycerol (Molecular biology grade) (Sigma-Aldrich, catalog number: G5516 )
Bromophenol Blue (Sigma-Aldrich, catalog number: B0126 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Trizma® base (Tris base) (Sigma-Aldrich, catalog number: T1503 )
Hydrochloric acid (Molecular biology grade) (Sigma-Aldrich, catalog number: H1758 )
Creatine phosphokinase (Sigma-Aldrich, catalog number: C3755 )
Methanol (Fisher Scientific, catalog number: A412-4 )
Acetic acid, glacial (Fisher Scientific, catalog number: A38-212 )
Glycine (Sigma-Aldrich, catalog number: G7126-5KG )
SDS Sample Buffer (2x) (see Recipes)
SUMO Master Mix (see Recipes)
12.5% SDS Polyacrylamide Gels (see Recipes, Note E)
Destaining solution (see Recipes)
Equipment
Pipettes
Isotemp Digital Block Heater (Heats up to 100 °C) (Fisher Scientific, catalog number: 88-860-021 )
Benchtop Centrifuge for 1.5 ml tubes (Eppendorf, model: 5430 )
Small Stainless Steel Spatula (Fisher Scientific, catalog number: 21-401-10 )
30 °C water bath
Razor blade (Fisher Scientific, catalog number: 12-640 )
Autoradiography cassette, 8 x 10 inches (RPI, Research Products International, catalog number: 420810 )
Liquid Scintillation counter (Beckman Coulter, catalog number: 8043-30-1194 )
Geiger counter
Radiation disposal receptacle (Provided by institution)
Mini-trans blot cell (Bio-Rad Laboratories)
Gel dryer (Bio-Rad Laboratories, model: 583 )
Autoradiography case (VWR, catalog number: 95039-986 )
Film processer
Benchtop Shaker (Thermo Fisher Scientific, catalog number: 88880022 )
Procedure
Safe handling of radioactive materials
Please note that this procedure utilizes radioactive [35S]-Methionine. All users must be appropriately trained to handle and dispose of radioactive materials. A dedicated laboratory space should also be demarcated for containment. Safe handling and disposal of all tips, tubes, and reagents are important for minimizing the risks of exposure contamination.
Preparation of SUMO enzymes from E. coli
Prior to performing the in vitro SUMO modification assay, recombinant SUMO and pathway enzymes must first be expressed in E. coli and purified. Methods for protein expression and purification have been described elsewhere (Yang et al., 2018).
In vitro transcription/translation of protein of interest
Remove a tube of rabbit reticulocyte from the kit stored at -80 °C and thaw on ice.
For each substrate, add 20 μl of rabbit reticulocyte to an Eppendorf tube on ice.
Return any remaining rabbit reticulocyte back to -80 °C for future use; avoid freeze/thaw cycles.
Add 2 μl of [35S]-Methionine to each tube, keep on ice.
Add 500 ng of plasmid DNA for substrate protein of interest to each reaction, keep on ice.
Incubate in a 30 °C water bath for at least 1 h (60-90 min).
In vitro SUMO modification
Each reaction will have 28 μl of SUMO Master Mix solution; place in a 1.5 ml Eppendorf tube, at room temperature. It is recommended to prepare fresh SUMO Master Mix solution (see Recipe 2).
Remove 2 μl of transcription/translation product and add to the 28 μl SUMO Master Mix, for a total volume of 30 μl, pipetting gently several times up and down to mix, at room temperature.
Incubate each reaction in a 30 °C water bath (see Note C).
Add 20 μl of sample buffer (2x) to stop the reaction.
Place on a 95 °C heat block for 5 min.
Briefly centrifuge at 10,000 x g for 30-60 sec, at room temperature.
SDS polyacrylamide gel electrophoresis
Prepare a 12.5% SDS-PAGE gel.
Load 10 μl of completed reaction to a well in a 12.5% SDS-PAGE gel, reserving a lane for 2 μl of protein ladder (lane 1).
Run SDS-PAGE at 70 V, room temperature, for approximately 20 min, or until the bottom dye indicator reaches just below the stacking gel and in the running gel. Run at 120 V, room temperature, for an additional 2 h. Stop electrophoresis before the 10 kDa molecular weight marker reaches the bottom of the gel (or until the bottom dye indicator just reaches the bottom of the gel).
Gently separate gel plates using a spatula. Gently slide surgical blade along sides of the glass plate to release gel and remove the stacking gel away from the running gel with blade and discard.
Carefully remove the gel and place in a small dish or plastic container (a pipet tip box lid is suitable) pre-filled with destaining buffer at room temperature.
Wash with gentle shaking for 10 min, at room temperature.
Carefully discard destaining buffer (free [35S]-Methionine may be in the solution, so pour in a radiation waste container).
Add MilliQ water and wash with gently shaking for 10 min, at room temperature. Repeat at least 3 times (see Notes).
Autoradiography
Lay a piece of WhatmanTM paper on a clean benchtop space demarked as a radiation exposure area (room temperature).
Carefully place gel onto the WhatmanTM paper so that lane 1 is the protein ladder.
Overlay the gel with a piece of plastic wrap.
Lay the gel and WhatmanTM paper onto the gel dryer (the WhatmanTM paper is placed directly onto the foam of the gel dryer and the plastic wrap is on top).
Gently cover the gel and dry for approximately 30 min (see Notes).
Carefully remove the plastic wrap from the gel and place on benchtop demarked as a radiation exposure area for 5 min.
In a dark room protected from light, place the dried gel affixed to the WhatmanTM paper inside the cassette.
Carefully place a sheet of X-ray film on top of the gel.
Carefully close the cassette. Do not bring into contact with light.
Keep the cassette in a dark area overnight at room temperature.
Develop the exposed film according to manufacturer’s instructions.
Note: For a video and detailed protocol for how to perform autoradiography, please refer to Karra et al. (2017).
Data analysis
Overlay developed film over dried gel and use molecular weight markers to demarcate molecular weights using a permanent pen.
Locate the unmodified protein of interest and any shifts in molecular weight (~12 kDa shift represents modification by a single SUMO, 24 kDa shift represents modification by two SUMOs, etc.) (Figure 2). It is possible for several SUMO consensus sites to be present in the protein of interest, and several SUMO-modified bands may be represented.
If amino acid substitutions have been made to SUMO consensus site lysines, high molecular weight band shifts should decrease in number until a complete SUMO mutant is generated (Figure 2).
Figure 2. In vitro SUMO2 modification of APC4. APC4 is a 808 amino acid protein with two consensus SUMO sites at K772 and K798 (A). Full-length wild-type APC4 (B) or the indicated lysine to alanine substitution mutants (C, D, E) were expressed in rabbit reticulocyte lysate in the presence of [35S]-Methionine and incubated for the indicated times in modification reactions containing SUMO E1 and E2 enzymes and SUMO2. Proteins were detected by SDS-PAGE and autoradiography. Asterisks indicate sumoylated forms of APC4.
Notes
Identification of SUMO modification consensus sites and SUMO mutant generation
GPS SUMO is a web-based tool (Zhao et al., 2014) that identifies potential SUMO conjugation sites or SIM Motifs (Yunus and Lima, 2009). Input of the amino acid sequence in FASTA format is used.
Preparation of SUMO enzymes from E. coli
Depending on whether the protein of interest is modified by SUMO1 or SUMO2/3, the appropriate recombinant protein should be used in the assay. If unknown, it is recommended that modification by both SUMO1 and SUMO2/3 be tested. Of note, SUMO2/3 can generate polymeric chains due to a SUMO consensus site at K11 in both SUMO2 and SUMO3.
In human cells, the SUMO E1 enzyme is expressed as a heterodimer Aos1/Uba2. Co-expression and purification of these two proteins can be prepared in batch. The conjugating enzyme, Ubc9, is used in relatively high concentrations and may circumvent the requirement of an E3 ligating enzyme. Caution should be used, however, in possible misinterpretation of results and the possibility that E3’s may be critical for site-selective modification. It is also possible for some substrates to require an E3 ligase (such as the PIAS family of proteins [Zhu et al., 2008]) for efficient SUMO modification in vitro.
In vitro SUMO Modification–time-course analysis
In general, the time required for SUMO modification at 30 °C must be determined empirically, as the concentrations of SUMO enzymes in addition to increases in temperature (up to 37 °C) can change the efficiency of conjugation. Generally, with this protocol, SUMO substrates are modified within one hour. However, a time-course is recommended for each protein of interest, as some proteins are more readily SUMO-modified than others. Substrate recognition by SUMO conjugating enzymes or properties inherent in the SUMO protein itself can affect the kinetics of modification. For example, the presence of SUMO Interacting Motifs (SIMs) in the substrate protein can enhance SUMO modification. SIMs are composed of hydrophobic amino acids (V/I)-x-(V/I)-(V/I) flanked by an acidic residue. The hydrophobic amino acids in SIMs interact non-covalently with a hydrophobic pocket situated in the β2 strand on the surface of SUMO, creating a parallel or antiparallel β-strand conformation. SIM Motifs can also be identified through GPS SUMO (Zhao et al., 2014).
In vitro SUMO Modification–enzyme concentrations
The concentrations of enzymes used can also be empirically adjusted. For example, BLM and APC4 are readily SUMO-modified with the concentrations of SUMO enzymes described above, but RanGAP1 is more efficiently SUMO-modified and therefore requires a lower concentration of conjugation enzymes and shorter incubation periods to achieve complete modification. For example, 15 mM E1, 45 nM E2, and 0.5 μM SUMO proteins are required for complete SUMO modification of RanGAP1 within 5-10 min of incubation at 30 °C.
SDS polyacrylamide gel electrophoresis
It is critical to sufficiently wash the gel following destaining. The presence of destaining solution can cause the gel to crack during drying.
A 12.5% gel is recommended because free SUMO is a relatively small protein and this composition has proven to resolve proteins well in our experiments. A 4-15% gradient gel can also be used.
Autoradiography
Time for gel drying can vary. Monitor carefully to sufficiently dry the gel but taking care not to over-dry and generate cracks.
Positive and negative controls
As a positive control for SUMO modification, recombinant RanGAP1 can be used. RanGAP1 is a labile SUMO substrate and can be modified efficiently at room temperature. Concentrations of SUMO conjugating enzymes should be adjusted (15 mM E1, 45 nM E2, 0.5 μm SUMO1), as this protein is modified rapidly. Plasmids for expression in E. coli for protein purification (Werner et al., 2009) are available through Addgene (Plasmid #13379) or recombinant GST-RanGAP1 is commercially available (can be purchased from Enzo Life Sciences, Inc.) Lysine to arginine substitutions can be made as mutations on the substrate of interest to prevent SUMO conjugation. For example, one possible negative control is RanGAP1 with K526R cannot be modified by SUMO (Mahajan et al., 1998). Reactions without ATP or the SUMO E1 enzyme can also be utilized as negative controls for the reaction.
Recipes
SDS Sample Buffer 2x
0.313 M Tris-HCl, pH 6.8
4% SDS
20% glycerol
3.5 M β-mercaptoethanol
0.1% (w/v) bromophenol blue
Store working aliquots at room temperature (and stock solutions at -20 °C)
SUMO Master Mix
Notes:
The following enzymes and reagents should be generated in a 1.5 ml Eppendorf tube as a SUMO Master Mix.
Each reaction will have 28 μl of SUMO Master Mix + 2 μl of in vitro transcribed/translated protein of interest.
Prepare all solutions using ultrapure water (resistivity of 18.2 MΩ cm at 25 °C).
As a negative control, a reaction without ATP can be used (SUMO conjugation is an ATP-dependent pathway). ATP should be added to the SUMO Master Mix last.
20 mM HEPES-KOH, pH 7.3
110 mM potassium acetate
2 mM magnesium acetate
200 nM SUMO E1
600 nM SUMO E2
1 μM of SUMO1 or SUMO2
20 units/ml creatine phosphokinase
5 mM phosphocreatine
0.6 units/ml inorganic pyrophosphatase
1 mM DTT
1 mM ATP
12.5% SDS Polyacrylamide Gels
Prepared as previously described (Guzzo et al., 2012):
Stacking gel acrylamide
30% Acrylamide
0.44% Bis-acrylamide
Store at 4 °C protected from light
Stacking gel buffer
0.5 M Tris-HCl, pH 6.8
Store at 4 °C
Resolving gel acrylamide
33.5% Acrylamide
0.3% Bis-acrylamide
Store at 4 °C protected from light
Resolving gel buffer
1 M Tris-HCl, pH 9.1
Store at 4 °C
Ammonium persulfate
3% solution prepared in ultrapure water
Store at -20 °C
SDS-PAGE running buffer (1x)
0.025 M Tris-HCl
0.192 M glycine
0.1% SDS
Prepare a working solution from a 4x stock by diluting 250 ml into 750 ml ultrapure waters
Destaining solution
20% methanol, 10% acetic acid solution made in distilled/deionized water
Acknowledgments
We would like to thank members of the Yu and Matunis Labs. Work in the Yu laboratory is supported by grants from the Cancer Prevention and Research Institute of Texas (RP120717-P2 and RP160667-P2) and the Welch Foundation (I-1441). HY is an Investigator with the Howard Hughes Medical Institute. This work was funded by the National Institutes of Health Grant R01 HM060980 (to MJM) and T32 CA009110 (to CL). This protocol was adapted from Lee et al. (2018).
Competing interests
Authors do not declare any conflicts of interest or competing interests.
References
Cubeñas-Potts, C., Srikumar, T., Lee, C., Osula, O., Subramonian, D., Zhang, X. D., Cotter, R. J., Raught, B. and Matunis, M. J. (2015). Identification of SUMO-2/3-modified proteins associated with mitotic chromosomes. Proteomics 15(4): 763-772.
Flotho, A. and Melchior, F. (2013). Sumoylation: a regulatory protein modification in health and disease. Annu Rev Biochem 82: 357-385.
Gareau, J. R. and Lima, C. D. (2010). The SUMO pathway: emerging mechanisms that shape specificity, conjugation and recognition. Nat Rev Mol Cell Biol 11(12): 861-871.
Guzzo, C. M., Berndsen, C. E., Zhu, J., Gupta, V., Datta, A., Greenberg, R. A., Wolberger, C. and Matunis, M. J. (2012). RNF4-dependent hybrid SUMO-ubiquitin chains are signals for RAP80 and thereby mediate the recruitment of BRCA1 to sites of DNA damage. Sci Signal 5(253): ra88.
Hickey, C. M., Wilson, N. R. and Hochstrasser, M. (2012). Function and regulation of SUMO proteases. Nat Rev Mol Cell Biol 13(12): 755-766.
Karra, A. S., Stippec, S. and Cobb, M. H. (2017). Assaying protein kinase activity with radiolabeled ATP. J Vis Exp(123): e55504.
Lee, C. C., Li, B., Yu, H. and Matunis, M. J. (2018). Sumoylation promotes optimal APC/C activation and timely anaphase. Elife 7: e29539.
Mahajan, R., Gerace, L. and Melchior, F. (1998). Molecular characterization of the SUMO-1 modification of RanGAP1 and its role in nuclear envelope association. J Cell Biol 140(2): 259-270.
Matic, I., Schimmel, J., Hendriks, I. A., van Santen, M. A., van de Rijke, F., van Dam, H., Gnad, F., Mann, M. and Vertegaal, A. C. (2010). Site-specific identification of SUMO-2 targets in cells reveals an inverted SUMOylation motif and a hydrophobic cluster SUMOylation motif. Mol Cell 39(4): 641-652.
Matunis, M. J., Coutavas, E. and Blobel, G. (1996). A novel ubiquitin-like modification modulates the partitioning of the Ran-GTPase-activating protein RanGAP1 between the cytosol and the nuclear pore complex. J Cell Biol 135(6 Pt 1): 1457-1470.
Mukhopadhyay, D. and Dasso, M. (2007). Modification in reverse: the SUMO proteases. Trends Biochem Sci 32(6): 286-295.
Mukhopadhyay, D. and Dasso, M. (2017). The SUMO pathway in mitosis. Adv Exp Med Biol 963: 171-184.
Park-Sarge, O. K. and Sarge, K. D. (2008). Methods in Molecular Biology. Methods Mol Biol 464: 255-265.
Reiter, K. H. and Matunis, M. J. (2016). Detection of SUMOylation in Plasmodium falciparum. Methods Mol Biol 1475: 283-290.
Schimmel, J., Eifler, K., Sigurethsson, J. O., Cuijpers, S. A., Hendriks, I. A., Verlaan-de Vries, M., Kelstrup, C. D., Francavilla, C., Medema, R. H., Olsen, J. V. and Vertegaal, A. C. (2014). Uncovering SUMOylation dynamics during cell-cycle progression reveals FoxM1 as a key mitotic SUMO target protein. Mol Cell 53(6): 1053-1066.
Werner, A., Moutty, M. C., Moller, U. and Melchior, F. (2009). Performing in vitro sumoylation reactions using recombinant enzymes. Methods Mol Biol 497: 187-199.
Yang, W. S., Campbell, M., Kung, H. J. and Chang, P. C. (2018). In vitro SUMOylation assay to study SUMO E3 ligase activity. J Vis Exp(131): e56629.
Yunus, A. A. and Lima, C. D. (2009). Purification of SUMO conjugating enzymes and kinetic analysis of substrate conjugation. Methods Mol Biol 497: 167-186.
Zhao, Q., Xie, Y., Zheng, Y., Jiang, S., Liu, W., Mu, W., Liu, Z., Zhao, Y., Xue, Y. and Ren, J. (2014). GPS-SUMO: a tool for the prediction of sumoylation sites and SUMO-interaction motifs. Nucleic Acids Res 42(Web Server issue): W325-330.
Zhu, J., Zhu, S., Guzzo, C. M., Ellis, N. A., Sung, K. S., Choi, C. Y. and Matunis, M. J. (2008). Small ubiquitin-related modifier (SUMO) binding determines substrate recognition and paralog-selective SUMO modification. J Biol Chem 283(43): 29405-29415.
Copyright: Lee et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lee, C. C., Li, B., Yu, H. and Matunis, M. J. (2018). A Method for SUMO Modification of Proteins in vitro. Bio-protocol 8(19): e3033. DOI: 10.21769/BioProtoc.3033.
Lee, C. C., Li, B., Yu, H. and Matunis, M. J. (2018). Sumoylation promotes optimal APC/C activation and timely anaphase. Elife 7: e29539.
Download Citation in RIS Format
Category
Biochemistry > Protein > Isolation and purification
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,034 | https://bio-protocol.org/exchange/protocoldetail?id=3034&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dissection and Whole Mount Staining of Retina from Neonatal Mice
MO Mitsutaka Ogawa
TO Tetsuya Okajima
Published: Oct 5, 2018
DOI: 10.21769/BioProtoc.3034 Views: 7429
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Here we provide a detailed protocol for whole mount staining of mouse retina. This protocol was used to analyze retinal angiogenesis in newborn mice (Sawaguchi et al., 2017) by modifying the original protocols (Powner et al., 2012; Tual-Chalot et al., 2013). This protocol can also be used for whole mount staining of adult retina.
Keywords: Retina Angiogenesis Whole mount stain
Materials and Reagents
1 ml Pipette tips (Thermo Fisher Scientific, QSP, catalog number: 111-N-Q )
100 μl Pipette tips (Thermo Fisher Scientific, QSP, catalog number: TTW110RLNS-Q )
Microtube (INA•OPTIKA, BIO-BIK, catalog number: ST-0150F )
Postnatal day 5 (P5) or P15 mouse
4% paraformaldehyde (PFA) (Wako Pure Chemical Industries, catalog number: 163-20145 )
Methanol (Wako Pure Chemical Industries, catalog number: 137-01823 )
Donkey (ImmunoBio Science, catalog number: IHR-8135 ) or goat serum (Wako Pure Chemical Industries, catalog number: 143-06561)
Cy3- or FITC-conjugated anti-αSMA (clone 1A4) (Sigma-Aldrich, catalog number: F3777 )
CF®488A-conjugated Streptavidin (Biotium, catalog number: 29034 ) or Dylight 649-conjugated streptavidin (Vector Laboratories, catalog number: SA-5649 )
Dylight 594-conjugated IB4 (Vector Laboratories, catalog number: DL-1178 )
Vectashield® antifade mounting medium (Vector Laboratories, catalog number: H-1000 )
Griffonia Simplicifolia IB4, Biotinylated (Vector Laboratories, catalog number: B-1105 )
Na2HPO4 (Wako Pure Chemical Industries, catalog number: 196-02835 )
KH2PO4 (Sigma-Aldrich, catalog number: 24-5260 )
NaCl (Wako Pure Chemical Industries, catalog number: 191-01665 )
KCl (Wako Pure Chemical Industries, catalog number: 163-03545 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
Bovine serum albumin (BSA) (Equitec-Bio, catalog number: BAC62 )
Phosphate buffered saline (PBS), pH 7.4 (see Recipes)
PBSTX (see Recipes)
Perm/Block solution (see Recipes)
Equipment
Pipettes (various sizes) (Gilson)
Tweezers (Fine Science Tools, model: Dumont #5 )
Dissecting scissors (Fine Science Tools, catalog number: 15003-08 )
Dissecting microscope (Olympus, model: SZX7 )
Tube rotator (TAIYO ELECTRIC, model: RT-50 )
Fluorescence microscope (Nikon Instruments, model: TiE-A1R-KT5 )
Procedure
Note: All experimental procedures were conducted in accordance with the Guidelines for Animal Experimentation in Nagoya University Graduate School of Medicine and Japanese Government Animal Protection and Management Law.
Fix eyes from the postnatal day 5 (P5) or P15 mouse in 4% paraformaldehyde (PFA) at room temperature (RT) for 15 min.
Note: For detecting filopodia at the vascular front, eyes are fixed for 2 h on ice.
Dissect retinas in PBS using tweezers and dissecting scissors under a microscope (Figure 1).
Figure 1. Dissection of retinas in PBS using tweezers
Prepare flat retinas by dropping cold methanol onto dissected retinas (Figure 2).
Note: Retina becomes flat by fixing with cold methanol.
Figure 2. Preparation of flat retina by dropping cold methanol
Incubate retinas in Perm/Block solution supplemented with 5% donkey or goat serum for 1 h at RT using a tube rotator.
Incubate retinas with Cy3- or FITC-conjugated anti-αSMA and biotin-IB4 in Perm/Block solution overnight at 4 °C using a tube rotator.
Wash retinas 4 times with PBSTX each for 10 min at RT.
Incubate retinas with Dylight 649-conjugated streptavidin or CF®488A-conjugated streptavidin in Perm/Block solution for 2 h at 4 °C.
Note: Retinas can be directly labeled with Dylight 594-conjugated IB4.
Wash retinas for 4 times with PBSTX each for 10 min at RT and rinse with PBS.
Mount retinas using Vectashield® antifade mounting medium and observe under a TiE-A1R-KT5 microscope (Figure 3).
Note: A coronal view cannot be acquired as it is whole mount staining of retina.
Figure 3. Whole staining of P5 retina using IB4 lectin
Recipes
Phosphate buffered saline (PBS), pH 7.4
10 mM Na2HPO4
1.8 mM KH2PO4
137 mM NaCl
2.7 mM KCl
PBSTX
0.3% Triton X-100
PBS, pH 7.4
Perm/Block solution
PBS, pH 7.4
0.3% Triton X-100
0.2% bovine serum albumin (BSA)
Acknowledgments
We thank N. Toida (Nagoya Univ) for technical support. This protocol is modified from the previously published article (Sawaguchi et al., 2017). This work was supported by Japan Society for the Promotion of Science grants # JP15K15064 to TO and MO, #JP26110709 to TO, #JP26291020 to TO, #JP15K18502 to MO, #JP16J00004 to MO; Takeda Science Foundation to TO; Japan Foundation for Applied Enzymology to TO; YOKOYAMA Foundation for Clinical Pharmacology #YRY-1612 to MO. The authors declare no conflict of interest.
References
Powner, M. B., Vevis, K., McKenzie, J. A., Gandhi, P., Jadeja, S. and Fruttiger, M. (2012). Visualization of gene expression in whole mouse retina by in situ hybridization. Nat Protoc 7(6): 1086-1096.
Sawaguchi, S., Varshney, S., Ogawa, M., Sakaidani, Y., Yagi, H., Takeshita, K., Murohara, T., Kato, K., Sundaram, S., Stanley, P. and Okajima, T. (2017). O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals. Elife 6: e24419.
Tual-Chalot, S., Allinson, K. R., Fruttiger, M. and Arthur, H. M. (2013). Whole mount immunofluorescent staining of the neonatal mouse retina to investigate angiogenesis in vivo. J Vis Exp (77): e50546.
Copyright: Ogawa and Okajima. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
Category
Developmental Biology > Morphogenesis > Cell structure
Cell Biology > Cell imaging > Fixed-tissue imaging
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,035 | https://bio-protocol.org/exchange/protocoldetail?id=3035&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Chromatin-bound Proteins from Subcellular Fractions for Biochemical Analysis
Sébastien Gillotin
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3035 Views: 18374
Reviewed by: Pabitra Kumar SahooAnna La Torre
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
Shuttling of proteins between different cellular compartments controls their proteostasis and can contribute in some cases to regulate their activity. Biochemical analysis of chromatin-bound proteins, such as transcription factors, is often difficult because of their low yield and due to the interference from nucleic acids. This protocol describes a method to efficiently fractionate cells combined with a mechanical (i.e., sonication) or an enzymatic treatment (i.e., benzonase) that facilitates analysis of chromatin-bound protein extracts by Western blot analysis or by protein pull-down assays. This approach can be valuable to enrich a particular protein within a particular subcellular fraction either to study specific post-translational modification patterns or to identify specific protein-protein interactions.
Keywords: Chromatin-bound proteins Cellular fractionation Western blot Protein pull-down assay Benzonase Sonication
Background
The activity and post-translational regulation of many chromatin-bound proteins are poorly studied due to technical difficulties in isolating them for biochemical analysis. This is, even more, the case with transcription factors, such as the basic Helix-loop-Helix (bHLH) transcription factors that often harbor scarce temporal and spatial pattern of expression in tissues or cellular models (Dennis et al., 2018). Protocol refinement helps to lift technical limitation when the amount of biological materials become a barrier to investigate molecular pathways (Gillotin and Guillemot, 2016). In our recent study, we endeavored to understand how proteolysis of the proneural bHLH transcription factor Ascl1 is regulated in cellular models of neuronal differentiation (Gillotin et al., 2018). For this, we adapted existing protocols for subcellular fractionation to obtain efficient separation of the cytoplasm, nuclear and chromatin fractions. To be able to perform biochemical analysis on the chromatin fraction, we either used sonication to shear nucleic acids or treated this fraction with benzonase to degrade nucleic acids. These steps were essential to perform Western blot analysis or protein pull-down assays (Figure 1). This approach successfully led to the analysis of Ascl1 ubiquitylation pattern in the cytoplasm and in the chromatin fractions (Gillotin et al., 2018) and can be extended to the study of other chromatin-bound proteins and to other post-translational modifications.
Figure 1. Workflow of the protocol. First, the collection of each subcellular fraction is performed by successive protein extractions with the buffer E1, then with the buffer E2 and with the buffer E3. Second, the chromatin fraction is either sonicated to shear the DNA or treated with benzonase to digest nucleic acids. Third, each fraction is biochemically analyzed for a protein of interest. The purity of each fraction should be controlled by Western blot for α-Tubulin, LaminB and Histone H3 depicting respectively the cytoplasmic fraction, the nuclear fraction and the chromatin fraction.
Materials and Reagents
Note: All stock solutions should be stored at room temperature except when indicated otherwise.
Microcentrifuge tubes (Sigma-Aldrich, catalog number: Z336769 )
10 cm tissue culture dishes (Thermo Fisher Scientific, NuncTM, catalog number: 150350 )
Cell scraper (TPP Techno Plastic Products, catalog number: 99002 )
Pipette tips (STARLAB, TipOne® filter tips, catalog number: S1120 )
Neural stem cells Cor3-1 (from Steve Pollard, University of Edinburgh)
P19 cells (ATCC, catalog number: CRL-1825 )
Protease cocktail inhibitor (Roche Diagnostics, catalog number: 04693116001 )
500 mM HEPES-KOH, pH 7.5 prepared from powder (Sigma-Aldrich, catalog number: H3375 )
0.5 mM EDTA, pH 8.0 (Sigma-Aldrich, catalog number: 93283 )
500 mM EGTA, pH 8.0 prepared from powder (Sigma-Aldrich, catalog number: E3889 )
5 M NaCl prepared from powder (Sigma-Aldrich, catalog number: S7653 )
1 M MgCl2 prepared from powder (Sigma-Aldrich, catalog number: M8266 )
1 M Tris-HCl, pH 8.0 prepared from powder (Sigma-Aldrich, catalog number: RDD008 )
1 M Tris-HCl, pH 7.5 prepared from powder (Sigma-Aldrich, catalog number: RDD008 )
1 M Tris-HCl, pH 6.8 prepared from powder (Sigma-Aldrich, catalog number: RDD008 )
50% Glycerol (Sigma-Aldrich, catalog number: G5516 ) diluted in deionized water
10% SDS (Sigma-Aldrich, catalog number: 71736 )
10% NP-40 (Sigma-Aldrich, catalog number: I8896 ) diluted in deionized water
10% Triton X-100 (Sigma-Aldrich, catalog number: T8787 ) diluted in deionized water
100 mM DTT prepared from powder (Sigma-Aldrich, catalog number: 43815 ), store at -20 °C
PBS (Thermo Fisher Scientific, catalog number: 10010023 )
Benzonase 10 ku (Merck, Novagen®, catalog number: 70664-3 )
α-Tubulin antibody (Abcam, catalog number: ab7291 )
LaminB (Santa Cruz Biotechnology, catalog number: sc-6216 or Gene Tex, catalog number: GTX103292 )
Histone H3 (Abcam, catalog number: ab1791 )
E1 Buffer (see Recipes)
E2 Buffer (see Recipes)
E3 Buffer (see Recipes)
E3 (benzonase) Buffer (see Recipes)
Equipment
Pipettes
Nanodrop (e.g., Thermo Fisher Scientific, model: NanoDropTM 3300 )
Water bath sonicator (e.g., Diagenode, model: Bioruptor® )
Refrigerated centrifuge (e.g., Eppendorf, model: 5415 R )
Rotating platform (e.g., Grant Instruments, 360° Vertical Multi-function Rotator)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gillotin, S. (2018). Isolation of Chromatin-bound Proteins from Subcellular Fractions for Biochemical Analysis. Bio-protocol 8(19): e3035. DOI: 10.21769/BioProtoc.3035.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Protein isolation
Stem Cell > Pluripotent stem cell > Cell-based analysis
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
2 Q&A
How many nucleoproteins can be mentioned from 10^6 cells
1 Answer
9 Views
Sep 5, 2023
What is the minimum number of cells required to extract nucleoprotein
1 Answer
9 Views
Sep 5, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,036 | https://bio-protocol.org/exchange/protocoldetail?id=3036&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Image Analysis Pipeline to Quantify Emerging Cracks in Materials or Adhesion Defects in Living Tissues
Stéphane Verger
GC Guillaume Cerutti
OH Olivier Hamant
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3036 Views: 5447
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Apr 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2018
Abstract
Microcracks in materials reflect their mechanical properties. The quantification of the number or orientation of such cracks is thus essential in many fields, including engineering and geology. In biology, cracks in soft tissues can reflect adhesion defects, and the analysis of their pattern can help to deduce the magnitude and orientation of tensions in organs and tissues. Here, we describe a semi-automatic method amenable to analyze cell separations occurring in the epidermis of Arabidopsis thaliana seedlings. Our protocol is applicable to any image exhibiting small cracks, and thus also adapted to the analysis of emerging cracks in animal tissues and materials.
Keywords: Cracks Cell adhesion Image analysis Mechanical properties Tension Github
Background
Microcracks are present in most materials; their number and extent generally increase when repeated stress is applied or when the temperature fluctuates, causing material fatigue and eventually, failure. Microcracks can reveal the magnitude and direction of the principal stresses that the material is experiencing. This property is widely used in mechanical engineering and geology (e.g., Kowallis and Wang, 1983; Kranz, 1983; Joseph et al., 2002). Microcracks are also present in biological structures, like bones. As in any material, they can lead to rupture (fatigue fracture). Such cracks also trigger signaling cascades involving osteoblasts and osteoclasts, resulting in bone remodeling (e.g., Mori and Burr, 1993). Cracks can also be observed in soft tissues, notably as a result of cell to cell adhesion defects. This is particularly obvious in plant tissues, where cells do not migrate or intercalate (e.g., Bouton et al., 2002). Although many tools have been developed to study cracks in material sciences, they are often adapted to analyze long and thin cracks (e.g., Griffiths et al., 2017); they have not been customized for the analysis of emerging cracks in soft biological tissues. Here we describe a pipeline that detects and analyzes such cracks.
Our pipeline is based on a script that segments regions exhibiting a clear-cut pixel intensity contrast corresponding to cell separations or cracks. In our original publication, we stained Arabidopsis thaliana seedlings with propidium iodide (see Verger et al., 2018 for the staining procedure), a fluorescent molecule that specifically binds to pectins in the cell wall. After washing the dye off, the cell contours are clearly marked. In a wild-type plant, this reveals a continuous epidermis where cells are fully attached to one another. However, when performing the same staining on a mutant with cell adhesion defects, holes between cells are revealed: a bright signal between cells marks emerging separations between these cells (Verger et al., 2018). The contrast between the cells and the cracks is in fact strong enough to detect and quantify cell separations. After segmenting these cracks, a principal component analysis is performed on each of these segmented areas, yielding various information: area of the crack as well as its principal orientation (angle of the crack) and the shape anisotropy (derived from the eigen values and vectors calculated in the principal component analysis of the crack shape). These data can then be compared for multiple samples and sample series. In principle, other staining method may be used on any types of tissues or materials, as long as the contrast is strong enough for the script to detect the cracks.
Software
Fiji program (http://fiji.sc/)
Open-source plugin-based image analysis software based on ImageJ (https://imagej.nih.gov/ij/)
Python 2.7 (Interpreted high-level programming language for general purpose programming) (https://www.python.org/)
Python modules:
Matplotlib (2D visualization and data plotting library) (https://matplotlib.org/)
Nose (Python unit test framework) (http://nose.readthedocs.io/)
Numpy (N-dimensional linear algebra library) (www.numpy.org/)
Pandas (Data manipulation and analysis library) (https://pandas.pydata.org/)
Pillow (Image manipulation library) (https://pillow.readthedocs.io/)
Pycircstat (Circular statistics library) (https://github.com/circstat/pycircstat/)
Scipy (Scientific computing library) (https://www.scipy.org/)
Open source package management and environment management system
Miniconda: https://conda.io/docs/
LINUX: https://repo.continuum.io/miniconda/Miniconda2-latest-Linux-x86_64.sh
MAC: https://repo.continuum.io/miniconda/Miniconda2-latest-MacOSX-x86_64.sh
Windows: https://repo.continuum.io/miniconda/Miniconda2-latest-Windows-x86_64.exe
Cell Separation Image Analysis Pipeline (Image analysis script described in this protocol) (https://github.com/sverger/Cell_separation_analysis)
Note: See "Installation procedure" in "Procedure" for the installation of Software 2 to 5.
Procedure
Image acquisition
Our image analysis pipeline was developed to detect and quantify cell separations in plant epidermis. Such images can be obtained using a confocal microscope and by either staining the cell wall or cell contour with a fluorescent dye, or by imaging plants expressing a fluorescent reporter of the cell contours (typically, a protein at the plasma membrane). Z-Stacks can be obtained and projected in 2D (e.g., using Fiji, max intensity). It is however crucial to obtain images in which there is a strong contrast between the cells and the “cracks” (i.e., the zone where cells are separated. In Figure 1C the regions corresponding to cells are of comparable pixel intensity as the gaps between cells, making it impossible to automatically distinguish them). Furthermore, because our pipeline works by segmenting the whole cracks, the cracks need to form a closed domain (For example, in Figure 1D, the joints marking the cracks (white zones), overlap with one another, making it impossible to distinguish them individually with our pipeline). Thus our pipeline can in principle work with any 2D grayscale image containing clear-cut closed cracks (see examples of suitable and non-suitable images in Figure 1).
Figure 1. Suitable image type. A. Z-projection (maximal intensity) of a confocal image stack from a propidium iodide stained light-grown hypocotyl from the qua1-1 mutant with cell adhesion defects (see Verger et al., 2018). B. Cracks in rocks (credit photo: Pierre Thomas). In A and B the cracks are marked by a high pixel intensity contrast and form closed domains. C. Z-projection (maximal intensity) of a confocal image stack from a qua1-1 pPDF1::mCit:KA1 (plasma membrane reporter) cotyledon epidermis (see Verger et al., 2018). Although such fluorescent reporter can provide suitable images for our analysis, in this particular case the contrast between the cracks and the cell content is too low to allow a segmentation of the cracks with our pipeline. D. Picture of cracks in rocks (credit photo: Pierre Thomas). In this case the cracks do not form closed domains as most of them overlap. In addition, the pixel intensity is very variable throughout the picture such that some cracks do not exhibit a strong differential in pixel intensity. White arrowheads point to examples of cracks or cell separations in these images.
Prerequisite: Image quality, preprocessing and threshold for “crack detection” in Fiji
In order to determine if your images are suitable for this image analysis pipeline you need to make sure that the cracks will be properly segmented by pixel intensity:
Load your 2D image in Fiji (Software 1).
Change your image type to 8-bit. Image > Type > 8-bit (Figure 2B) and/or pick the right channel from a multichannel (e.g., RGB) image (Image > Color > Split channels).
Optionally you may enhance the contrasts of your image using the “Enhance Contrast...” function (Process > Enhance Contrast…> Set “Saturated pixels” to 0.3%).
Note: You may use a different approach (e.g., increase exposition time or laser intensity during image acquisition) to obtain enough contrast to segment the cracks.
Smooth your image with a median filter to remove noise (Process > Filters > Median… [Figure 2C]). Set the radius to a suitable value to reduce the noise, without blurring the image too much. Here again, you may also use a different approach to reduce the noise of your image, as long as in the end, you obtain a smoother detection of the cracks.
Using the “Threshold...” tool, determine the suitable threshold that best separates the cracks from the surrounding regions (Figures 2D and 2E).
CRITICAL STEP: Depending on the nature and quality of your image, it may be difficult or impossible to segment the cracks based on a pixel intensity threshold. If most of your images are in this situation, this image analysis pipeline is not adapted to your study.
If you are able to properly separate the cracks from the surrounding regions, you may proceed with the analysis. Save your image in .tif or .jpg (File > Save As > Tiff… or JPEG…) and add ”_XXXthld” at the end of the name (where XXX is the threshold value previously determined in Step B5 as suitable to segment the cracks (e.g., “sample_1_162thld.tif”. See Figures 2D-2F). The value before “thld” is the threshold value that will be used for the image segmentation later on (it has to be three digit long).
You can pre-process as many images as you need before going further with the analysis. They will all be automatically processed if they are grouped in a folder. Note that in order to quantify and compare cracks orientation in multiple images, the images should be in a consistent orientation. The corresponding arborescence has to be organized as follows: A “main” directory (later on referred as “updir” in the script), containing subdirectories (e.g., different mutants or growth conditions), each containing all the corresponding images (Figure 2F).
Figure 2. Image preprocessing in Fiji. A. Z-projection (maximal intensity) of a confocal image stack from a propidium iodide stained light-grown hypocotyl from a qua1-1 mutant with cell adhesion defects (see Verger et al., 2018). B-C. Images are preprocessed in imageJ: The image is converted to 8-bit (B) and a median blur with a radius of 3 is applied to reduce the noise and ease the segmentation (C). D-E. The threshold tool is used to determine the suitable threshold for segmentation in the pipeline. (D) Red zones will be segmented as cracks. (E) The threshold is adjusted in order to segment the cracks properly (e.g., here to a value of 162). F. Example of file arborescence required for the pipeline to process the image series. G. Z-projection (maximal intensity) of a confocal image stack from a propidium iodide stained light-grown hypocotyl from a wild-type seedling showing no cell adhesion defects and thus not suitable to detect cracks with our pipeline (see Verger et al., 2018). H-I. Because the differences in pixel intensity are locally small (unlike the qua1-1 mutant with bright cell separation signals in panel A-D), we are unable to segment properly the image either with a threshold value of 50 (H) or 45 (I) as an example.
Installation procedure
You will need to have python (Software 2) installed on your computer in order to run the script (Software 5). The script has been designed, and should thus run properly, with python 2.7. You can then either directly run the script if you already have all the required dependencies (Software 3) in your python environment or install all the required dependencies in your python environment. If you do not have Python installed, or do not wish to interfere with your current Python environment, proceed with the steps below for our recommended installation using miniconda (Software 4), which will install python and all the required dependencies.
Download the miniconda installer from the official website (link below “Software 4”, or here LINUX, MAC and WINDOWS). Alternatively you can use wget to perform this download from a terminal (LINUX or MAC). Open a new terminal window and run the command line below:
For LINUX:
wget https://repo.continuum.io/miniconda/Miniconda2-latest-Linux-x86_64.sh
For MAC:
wget https://repo.continuum.io/miniconda/Miniconda2-latest-MacOSX-x86_64.sh
Install miniconda by running the installer:
For LINUX and MAC: Open a new terminal window, navigate to the directory where you downloaded the installer (most likely in your “Downloads” folder. e.g., cd path/to/Downlaods/.
Note: Input the actual path that leads to the folder “/Downlaods/”) and run:
For LINUX:
bash Miniconda2-latest-Linux-x86_64.sh
rm Miniconda2-latest-Linux-x86_64.sh
For MAC:
bash Miniconda2-latest-MacOSX-x86_64.sh
rm Miniconda2-latest-MacOSX-x86_64.sh
For WINDOWS: Execute the installer and follow the instructions.
During the installation (LINUX, MAC and WINDOWS) you will be asked a number of choices. You can set the directory of your choice when asked (e.g., ~/.miniconda). Make sure to answer YES when asked to add conda to your PATH.
At this point, you should have miniconda installed. Test your installation by closing your current terminal window and running conda in a new terminal to make sure the command is found:
conda
Download and extract the “cell_separation_analysis” repository from Github (following the link in Software 5, or here). On the Github page, click on the “Clone or download” green button at the right of the page. Then download and extract the zip.
Note: This folder contains the script (“Cell_separation_analysis.py”), a dependencies installation file for miniconda (“cell-sep-env.yml”) and test sample images (“Test_files”).
In a terminal, navigate to the “/cell_separation_analysis-master” folder that you have extracted.
cd path/to/Cell_separation_analysis-master/
Note: Input the actual path that leads to the folder “/Cell_separation_analysis-master”.
In the same terminal, create a new conda environment using the provided YAML file that lists all the software dependencies:
conda env create -f cell-sep-env.yml
Note: This will install Python and all the required dependencies. It may take a few minutes to complete the installation.
When the installation is complete, in the same terminal, activate the environment:
source activate cell-sep-env
Note: You will have to run this command every time you want to use the cell separation analysis program, just after opening a new terminal window.
You can then check your installation and whether the script runs properly by running the script on our test images. In a terminal, run:
ipython
This will launch ipython. In ipython, navigate to the “/cell_separation_analysis-master” folder that you have downloaded:
cd path/to/Cell_separation_analysis-master/
In the python console, type:
%run Cell_separation_analysis.py
This should run the script and generate its output in the “/Test_files” folder of “/Cell_separation_analysis-master”.
Running the script
In order to run the script with your own images, you need to edit the “parameter” section of the script. To do so, open the “Cell_separation_analysis.py” file in a text editor. Scroll down to the section called “parameters” where there are 7 entries that you may modify (see Figure 3):
Figure 3. Parameter settings. Cell_separation_analysis.py Python script opens in a text editor, displaying the “parameters” section. The parameters can be modified according to your own requirements and the file can be saved before running the script.
Set the directory where you placed the images to analyze. Remember that your folder has to be organized in a specific way: A “main” directory corresponding here to “updir”, containing subdirectories (e.g., different mutants or growth conditions), each containing all the corresponding images (Figure 2F). You can either enter the full path to the directory (e.g., /Home/Path/to/updir/), or simply enter ./updir/ (where you replace “updir” by the actual name of your folder). In the latter case, you will have to navigate to the parent folder of your “updir” in Ipython before running the script (as described in Step C8).
Set the pixel size. This is required in order to perform analyses of crack area. Usually, for confocal images this information can readily be found by loading the original image in Fiji and looking at its properties (Image > Properties… > Pixel width or height). The unit of length should be micron. For other types of images, you will need to determine the actual pixel size, for example in Fiji, using an internal scale (Analyze > Set Scale…).
Determine the minimum and maximum area of crack. This step corresponds to a filter as it eliminates areas which are too small (“min_area_of_crack”, e.g., background noise) as well as the global background of the image (“max_area_of_crack”, e.g., the empty space around the tissue). These values are in pixel number. You may have to try several times with different values in order to determine the right parameters empirically.
Set the threshold type. The cracks can be of either a higher or lower pixel intensity than the surrounding region. Thus the threshold can be set as “min” or max”. The “max” will detect and segment zones with lower signal intensity (i.e., the crack is darker than the surrounding region) and the “min” will detect and segment zones with higher signal intensity (i.e., the crack is lighter than the surrounding region).
You may then decide to run more global analyses if you have multiple sample types (“Global_Output_Size”) and multiple images by sample type (Global_Polarhist_output). See “Data analysis” section to determine if you should run these analyses. These are by default set to “False” which mean they will not be performed. Replace “False” by “True” if you want them to be performed.
Once all the parameters are correctly set, save the script and run it as described in Step C8.
Data analysis
As explained in the background section, this script can generate different outputs. From the detected cracks in each image, the script will generate three images: a pixel intensity inverted version of the image, the same image with an overlay of the segmented areas, and the same image with an overlay of the anisotropy and principal angle of the area, directly saved as vectorial PDFs. It will also generate a .csv file containing, for each segmented cracks, the label number, center position, area in pixels and micrometer square, the main orientation (angle) of the crack, the shape anisotropy, the eigen values and vectors. Finally for each image, a polar histogram representing the distribution of crack orientations in the image is created and saved as a vectorial PDF (see output generated in the test of the script in the previous step and Figure 4).
Figure 4. Output of the cell separation analysis pipeline. A. Pixel intensity inverted version of the image (Figure 2C). B. Same image as in (A) with an overlay of the segmented areas that are identified and labeled using different colors to ease visualization. C. Same image as in (B) with a representation of the vectors resulting from the principal component analysis of the crack shapes (Red crosses). To improve the visual output, the eigen vector that are mapped on the images are multiplied by a factor 2 and by the square root of the corresponding eigen value. D. A polar histogram representing the distribution of the crack orientations in an image. The square root of the principal eigen value for each plotted angle is added to normalize the angle value by its relative weight. A color map is used in the polar histograms representing the relative number of angles binned in each histogram bar (independently of their weight) where yellow is high and purple is low.
If you process multiple images from one sample series (e.g., technical or biological replicates), you can output a summary of their properties (see Step D5, "Global_Polarhist_Output = True"). It will generate a polar histogram representing the distribution of cracks orientation for all the images of a sample series pooled together, and save it as a vectorial PDF. It will also output a .txt file containing for each image the circular mean angle (between 0° and 180°), the resultant vector length (an estimation of the coordinated directionality of the cracks, between 0 and 1; a value of 0 means that the crack orientations are homogeneously distributed whereas, a value of 1 means that all the cracks have the same orientation) and the mean anisotropy of the crack shapes. At the end of the text file, a global analysis of all the images of a sample series is generated: circular mean angle, resultant vector length and shape anisotropy for the pooled values of all the images of the sample series. It will also output the result of an RAO's spacing test, which assesses whether the angles are uniformly distributed (statistically no preferential angle orientations), or if there is a significant angular bias.
The script also offers the possibility to compare different type of samples. You can compare the total area of the cracks in two sets of samples (e.g., 10 images of mutants 1 compared with 10 images from mutants 2) (see Step D5, "Global_Output_Size = True"). This will run statistical tests on the compared samples to determine if the average area of cracks in images of one sample series is different from that of another sample series. The choice of statistical test depends on the normality and the variance of the data. First, a Shapiro's test for population normality is run on both sample series. If at least one of the sample series does not have a normally distributed population, a non-parametric Wilcoxon rank sum test is run to test whether the samples are statistically different. Otherwise, if both sample series are normally distributed, a Bartlett's test for equal variances is run. If both sample series have equal variance, a Student's t-test is run and otherwise a Welch's t-test is run to test whether the samples are statistically different. A summary of these tests is saved as a .txt file, and a boxplot of this comparison is saved as a vectorial PDF.
You may then perform further analyses depending on your needs, using the different output files containing all the raw data.
Notes
The most critical step in this protocol is to check the suitability of your images as described in “Procedure B”. If most of your images do not pass this test, this image analysis pipeline may not be suited for your study. Conversely, it is important to realize that it is also rare to be able to segment 100% of the objects that you would identify as cracks visually. You should then decide what is an acceptable yield in your case.
Following our recommended installation procedure you should in principle be able to run our image analysis pipeline on any system (LINUX, MAC, and WINDOWS). However, the script has so far only been tested on a computer running Ubuntu 14.04 and Python 2.7. We recommend testing the macro with our sample images (Step C8) and check if the output images look similar to what is reported in our original publication (Verger et al., 2018).
Acknowledgments
This work was supported by the European Research Council (ERC-2013-CoG-615739 ‘‘MechanoDevo’’). We would like to thank Pierre Thomas (Professor at ENS de Lyon) for providing us the pictures in Figures 1B and 1D. This protocol was adapted from the published study (Verger et al., 2018).
Competing interests
The authors declare no conflict of interest or competing interests.
References
Bouton, S., Leboeuf, E., Mouille, G., Leydecker, M. T., Talbotec, J., Granier, F., Lahaye, M., Hofte, H. and Truong, H. N. (2002). QUASIMODO1 encodes a putative membrane-bound glycosyltransferase required for normal pectin synthesis and cell adhesion in Arabidopsis. Plant Cell 14(10): 2577-2590.
Griffiths, L., Heap, M. J., Baud, P. and Schmittbuhl, J. (2017). Quantification of microcrack characteristics and implications for stiffness and strength of granite. Int J Rock Mech Min 100: 138-150.
Joseph, P. V., Rabello, M. S., Mattoso, L. H. C., Joseph, K. and Thomas, S. (2002). Environmental effects on the degradation behaviour of sisal fibre reinforced polypropylene composites. Compos Sci Technol 62(10-11): 1357-1372.
Kowallis, B. J. and Wang, H. F. (1983). Microcrack study of granitic cores from Illinois deep borehole UPH 3. J Geophys Res-Sol Ea 88(B9): 7373-7380.
Kranz, R. L. (1983). Microcracks in rocks: A review. Tectonophysics 100(1-3): 449-480.
Mori, S. and Burr, D. B. (1993). Increased intracortical remodeling following fatigue damage. Bone 14(2): 103-109.
Verger, S., Long, Y., Boudaoud, A. and Hamant, O. (2018). A tension-adhesion feedback loop in plant epidermis. eLife 7: e34460.
Copyright: Verger et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Verger, S., Cerutti, G. and Hamant, O. (2018). An Image Analysis Pipeline to Quantify Emerging Cracks in Materials or Adhesion Defects in Living Tissues. Bio-protocol 8(19): e3036. DOI: 10.21769/BioProtoc.3036.
Verger, S., Long, Y., Boudaoud, A. and Hamant, O. (2018). A tension-adhesion feedback loop in plant epidermis. eLife 7: e34460.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Tissue analysis
Cell Biology > Tissue analysis > Tissue imaging
Cell Biology > Cell structure > Cell adhesion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,037 | https://bio-protocol.org/exchange/protocoldetail?id=3037&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Drosophila Endurance Training and Assessment of Its Effects on Systemic Adaptations
D Deena Damschroder *
TC Tyler Cobb*
AS Alyson Sujkowski
RW Robert Wessells
*Contributed equally to this work
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3037 Views: 6416
Reviewed by: Sunanda MarellaDivya Sitaraman
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Exercise induces beneficial systemic adaptations that reduce the incidence of age-related diseases. However, the molecular pathways that elicit these adaptations are not well understood. Understanding the molecular mechanisms that underlie the exercise response can lead to widely beneficial therapies. Large populations, relatively short lifespan, and easily modifiable genetics make Drosophila a well-suited model system for complex, longitudinal studies. We have developed an enforced climbing apparatus for Drosophila, known as the Power Tower, for the study of systemic exercise adaptations. The Power Tower takes advantage of the fly’s natural instinct for negative geotaxis, an innate behavior to run upwards after being tapped to the bottom of their vial. Flies will continuously run either to the point of exhaustion or until the machine is turned off, whichever comes first. After 3 weeks of exercise, male Drosophila adapt to training with a number of conserved, easily quantifiable physiological improvements similar to those seen in mammalian models and humans. Here, we describe a useful endurance training protocol and a suite of post-training assessments that effectively quantify training effects.
Keywords: Drosophila melanogaster Exercise Endurance training Flight Cardiac Function
Background
Endurance exercise reduces the incidence of nearly every age-related disease (Ciolac, 2013). Endurance training has potent effects on cardiovascular function, energy metabolism, and mobility which are highly conserved from flies to humans (Piazza et al., 2009; Booth et al., 2015; Wilson et al., 2015). A better understanding of genetic mediators of exercise may lead to therapeutics that can benefit individuals that are unable to exercise due to illness or injury. Drosophila is a well-equipped model organism to help identify genetic mediators of exercise due to its short lifespan, easily modifiable genetics, and well-defined exercise response (Piazza et al., 2009).
We created a machine called the Power Tower, which utilizes Drosophila’s natural instinct for negative geotaxis to induce endurance training (Tinkerhess et al., 2012a). Wild-type male Drosophila respond to endurance training with increased endurance, speed, flight ability, resistance to cardiac stress, and increased lysosomal activity when compared to unexercised control flies (Piazza et al., 2009; Sujkowski et al., 2012; Tinkerhess et al., 2012b; Sujkowski et al., 2017). Here, we describe an updated endurance training protocol and a suite of post-training assessments that are useful for analyzing exercise adaptations. This suite of assessments has led to the identification of genes required for the exercise response in Drosophila, such as spargel (PGC-1α homolog) (Tinkerhess et al., 2012b) and to the identification of essential physiological mediators of the exercise response such as the biogenic amine octopamine (Sujkowski et al., 2017).
Our ramped endurance training protocol consists of three weeks of training, with flies being exercised daily for five consecutive days (Table 1), followed by two days of rest. Exercise adaptations can be assessed using a suite of five complementary assessments: fatigue, longitudinal climbing assessment, flight, cardiac pacing, and LysoTracker staining. The fatigue, flight, and longitudinal climbing assessments examine the flies’ endurance, flying ability, and speed, respectively. Cardiac pacing evaluates the heart’s ability to resist stress (Wessells and Bodmer, 2004). LysoTracker staining measures lysosomal activity, which increases in adipose tissue with exercise (Sujkowski et al., 2012). Together, these assessments constitute a collection of diverse responses to chronic exercise that can be used to evaluate potential genetic or pharmaceutical exercise mimetics.
Materials and Reagents
Microscope Slides (Fisher Scientific, FisherbandTM, catalog number: 12-550-343 )
Cover Slips (Fisher Scientific, FisherbandTM, catalog number: 12-548B )
Aluminum Foil
Drosophila Vials (VWR, catalog number: 89092-722 )
Clear Polycarbonate Sheet (McMASTER-CARR, catalog number: 85585K25 )
Plastic Funnel (Fisher Scientific, FisherbrandTM, catalog number: 10-500-3 )
Polycarbonate Cylinder (McMASTER-CARR, catalog number: 8585K62
Acrylic Cylinder Tube (36” length, 4” diameter) (McMASTER-CARR, catalog number: 8486K943 )
Polystyrene Weighing Dish (Fisher Scientific, FisherbrandTM, catalog number: S67091A )
Drosophila (Bloomington Drosophila Stock Center: https://bdsc.indiana.edu/)
Carbon Dioxide
Tangle Trap (BIOCONTROL NETWORK, catalog number: 268941 )
Mineral Oil (Fisher Scientific, BioReagents, catalog number: BP26291 )
FlyNap (Carolina Biological Supply, catalog number: 173025 )
Signa Gel Electrode Gel (Parker Laboratories, SIGNAGEL®, catalog number: 15-60 )
LysoTracker Green (Thermo Fisher Scientific, Molecular Probes®, catalog number: L7526 )
Phosphate Buffered Saline (pH 7.0)
VectaShield (Vector Laboratories, catalog number: H-1000 )
Fly Food made by experimenter (see Recipes)
Brewer’s Yeast (MP Biomedicals, catalog number: 903312 )
Sucrose (Sigma-Aldrich, catalog number: 84097-5KG )
Gelidium Agar (MoorAgar, catalog number: 41080 )
Methyl 4-hydroxybenzoate (Sigma-Aldrich, catalog number: H5501-5KG )
Propionic Acid (Sigma-Aldrich, catalog number: P1386-1L )
Equipment
Power Tower
40” x 24” Plywood Board (Base)
AC/DC Gearmotor (W.W. Grainger, model: 1LRA6 )
Manufacturer: Dayton, model: 1LRA6 .
Rigid Shaft Coupling (Climax Metal Products, model: ISCC-025-025-S )
12” x 5” x 1½” Boards x 4
12” x 5” x ¾” Plywood Board
AC/DC Speed Control (Dayton, model: 4Z827 )
20 AMP Fuse (Cooper Bussmann, item number: 286547)
Bent ¾” Square Tube Stock
14” x 11” Plywood Board x 2 (Platforms)
Door Hinge
Drawer Sliders x 4
Styrofoam Pad x 2
C-Clamp (W.W. Grainger, model: 2HUK2 )
Manufacturer: WESTWARD, model: 2HUK2 .
Nalgene Unwire Test Tube Racks x 4 (Thermo Fisher Scientific, ResmerTM, catalog number: 5970-0013PK )
Shelf Bracket x 4
Skateboard Wheel
Jaece Identi-plugTM Plastic Foam Stopper (Jaece Industies, catalog number: L800-B2 )
Incubator
Square Rectangular Grid Screen (W.W. Grainger, model: 49N590)
Manufacturer: DIRECT METALS, model: 12002E063Y-48X96 .
10" Bungee Cord (Home Depot Product Authority, model: 56052 )
Bel-Art No Wire Test Tube Rack (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F18745-0004 )
Traceable Nano Timer (Fisher Scientific, FisherbrandTM, catalog number: 14-649-83 )
Ring Stand x 2 (Eisco Labs, catalog number: CH0653E1RD4 )
Claw Clamps (Fisher Scientific, FisherbrandTM, catalog number: 05-769-7Q )
Chain Clamps x 2 (VWR, catalog number: 21573-275 )
Three-prong Extension Clamp (Fisher Scientific, FisherbrandTM, catalog number: 05-769-7Q )
Isolated Square-Wave Stimulator (Phipps & Bird, catalog number: 7092-611 )
Olympus Camera (OLYMPUS, model: SP-570 UZ )
Dissecting Microscope (OLYMPUS, model: SZ61 )
Fluorescent Microscope (Leica Microsystems, model: DMI6000 B )
Hemostat Straight (Specialized Products, catalog number: 083X020 )
Software
ImageJ (National Institutes of Health, Bethesda, Maryland, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Damschroder, D., Cobb, T., Sujkowski, A. and Wessells, R. (2018). Drosophila Endurance Training and Assessment of Its Effects on Systemic Adaptations. Bio-protocol 8(19): e3037. DOI: 10.21769/BioProtoc.3037.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,038 | https://bio-protocol.org/exchange/protocoldetail?id=3038&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
CRISPR/Cas9-mediated ssDNA Recombineering in Corynebacterium glutamicum
JL Jiao Liu*
Yu Wang*
Ping Zheng
Jibin Sun
*Contributed equally to this work
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3038 Views: 6944
Edited by: David Cisneros
Reviewed by: Juan Facundo Rodriguez AyalaPeter E Burby
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Corynebacterium glutamicum is a versatile workhorse for industrial bioproduction of many kinds of chemicals and fuels, notably amino acids. Development of advanced genetic engineering tools is urgently demanded for systems metabolic engineering of C. glutamicum. Recently unveiled clustered regularly interspaced short palindromic repeats (CRISPR) and their CRISPR-associated proteins (Cas) are now revolutionizing genome editing. The CRISPR/Cas9 system from Streptococcus pyogenes that utilizes NGG as protospacer adjacent motif (PAM) and has good targeting specificity can be developed into a powerful tool for efficient and precise genome editing of C. glutamicum. In this protocol, we described the general procedure for CRISPR/Cas9-mediated ssDNA recombineering in C. glutamicum. Small modifications can be introduced into the C. glutamicum chromosome with a high editing efficiency up to 90%.
Keywords: CRISPR/Cas9 Genome editing ssDNA recombineering Corynebacterium glutamicum Nucleotide editing Lagging strand
Background
The Gram-positive soil bacterium Corynebacterium glutamicum is a versatile workhorse for industrial bioproduction of amino acids, biofuels, and polymer building blocks (Becker et al., 2016). At the early stage of engineering of C. glutamicum, random mutagenesis combined with positive selection by phenotypic resistance to amino acid analogs was the most commonly used strategy (Vertes et al., 2005). Genetic manipulations in C. glutamicum were initiated in 1984 and became a key enabling strategy for strain improvement (Ozaki et al., 1984). A routinely used method for gene disruption and insertion in C. glutamicum is based on integration of a suicide vector into its chromosome, followed by a second recombination event to remove the plasmid backbone and a counter-selection step using a conditionally lethal marker. Nevertheless, due to the frequent spontaneous inactivation of the counter-selectable marker sacB, up to 45% of colonies obtained in the screening process were false-positive, making this multi-step procedure time-consuming and inefficient (Schafer et al., 1994). To engineer C. glutamicum more efficiently, simple but versatile genome editing tools are still in urgent demand.
Recently, clustered regularly interspaced short palindromic repeats (CRISPR) and their CRISPR-associated proteins (Cas) have been explored as a leading-edge tool for bacterial genome editing (Choi et al., 2016). The CRISPR/Cas9 system accepts NGG protospacer adjacent motif (PAM) and has good targeting specificity (Jiang et al., 2013). Therefore, the CRISPR/Cas9 system is expected to possess abundant editing targets in GC-rich C. glutamicum. We successfully developed a CRISPR/Cas9 toolbox for efficient and comprehensive engineering of C. glutamicum strains (Liu et al., 2017; Wang et al., 2018). By using the tailor-made CRISPR/Cas9 system, efficient deletion and insertion of large DNA fragments using plasmid-borne editing templates were achieved. By combining CRISPR/Cas9 and ssDNA recombineering, small modifications were introduced into the genome with efficiencies up to 90% (Liu et al., 2017). Besides, targeted based editing without donor DNA was also realized using Cas9 and cytidine deaminase fusions (Wang et al., 2018). The toolbox developed is simple and versatile, which is expected to overcome the major limitations of existing genome editing tools of C. glutamicum and advance the genetic manipulation of this industrial workhorse. Herein, we described the detailed protocol for CRISPR/Cas9-mediated ssDNA recombineering in C. glutamicum.
Materials and Reagents
0.2 ml PCR tubes (Biosharp, catalog number: BS-02-P )
1.5 ml Eppendorf tubes (Biosharp, catalog number: BS-15-M )
Pipette tips (Biosharp, catalog numbers: BS-10-T , BS-200-T , BS-1000-T )
Petri dishes (NEST Biotechnology, catalog numbers: 752001 )
Competent Escherichia coli DH5α cells (CWBIO, catalog number: CW0808 )
pgRNA5 plasmid (Liu et al., 2017)
pCas9 plasmid (Liu et al., 2017)
Agarose (Biowest, catalog number: 111860 )
GoldView I Nuclear Staining Dyes (10,000x) (Solarbio, catalog number: G8140 )
AxyPrepTM DNA Gel Extraction Kit (Corning, Axygen®, catalog number: AP-GX-250 )
Tryptone (Oxoid, catalog number: LP0042 )
Yeast extract (Oxoid, catalog number: LP0021 )
Kanamycin (Solarbio, catalog number: K8020 )
Chloramphenicol (Fisher Scientific, catalog number: BP904-100 )
Q5® High-Fidelity DNA polymerase (New England Biolabs, catalog number: M0491L )
AxyPrepTM Plasmid Miniprep Kit (Corning, Axygen®, catalog number: AP-MN-P-250 )
Vazyme ClonExpress® II One Step Cloning Kit (Vazyme Biotech, catalog number: C112-01/02 )
2x EasyTaq PCR SuperMix (+dye) (Beijing TransGen Biotech, catalog number: AS111-11 )
Tris base (Solarbio, catalog number: T8060 )
Glacial acetic acid (Sinopharm Chemical Reagent, catalog number: 10000218 )
EDTA (Solarbio, catalog number: E8030 )
NaCl (Sinopharm Chemical Reagent, catalog number: 10019328 )
Agar (Solarbio, catalog number: A8190 )
(NH4)2SO4 (Solarbio, catalog number: A8821 )
K2HPO4 (Solarbio, catalog number: D9880 )
NaH2PO4 (Solarbio, catalog number: S5830 )
MgSO4•7H2O (Sinopharm Chemical Reagent, catalog number: 10013018 )
Brain Heart Infusion (BHI) (BD, catalog number: 237500 )
Tween 80 (Solarbio, catalog number: T8360 )
DL-threonine (DL-Thr) (Tokyo Chemical Industry, catalog number: T3105 )
Glycine (Gly) (Solarbio, catalog number: G8200 )
Glucose (Beijing Dingguo Changsheng Biotechnology, catalog number: DS063 )
Trisodium citrate (Solarbio, catalog number: S8220 )
Sorbitol (Solarbio, catalog number: S8090 )
Isonicotinic acid hydrazide (INH) (Sigma-Aldrich, catalog number: I3377 )
IPTG (Solarbio, catalog number: I8070 )
Sodium propionate (Sigma-Aldrich, catalog number: P1880 )
Oligo for ssDNA recombineering:
AGGTAAGGCGCACACGAGCGACCTTACGAAGAGCAGAGTTAGGCTTGCGAGGGGTGGTGGTGTACACACGGGTGCATACGCCACGACGCT (synthesized and page-purified in Genewiz, Suzhou, China)
Primers for gRNA plasmid construction (synthesized and page-purified in Genewiz, Suzhou, China):
gRNA-1: AGAGCAGAGTTAGGCTTCTTGTTTTAGAGCTAGAAATAGCAAG
gRNA-2: TGCTCTTTCATTGATGGCTGG
gRNA-3: CAGCCATCAATGAAAGAGCAAC
gRNA-4: AAGAAGCCTAACTCTGCTCTTGAATTACACTGTACCTGTTGCGTC
50x TAE electrophoresis buffer (see Recipes)
1x TAE electrophoresis buffer (see Recipes)
LB medium (see Recipes)
LB solid medium (see Recipes)
BHI medium (see Recipes)
NCM medium (see Recipes)
BHIS medium (see Recipes)
LBHIS solid medium (see Recipes)
25 mg/ml kanamycin stock (see Recipes)
5 mg/ml chloramphenicol stock (see Recipes)
0.1 M IPTG stock (see Recipes)
500 g/L sodium propionate stock (see Recipes)
Equipment
Pipettes (Eppendorf, catalog number: 022575442 )
Thermal cycler (Thermo Fisher Scientific, Thermo ScientificTM, model: ArktikTM Thermal Cycler )
Water bath (Beijing Ever Bright Medical Treatment Instrument, model: DZKW-S-4 )
NanoDrop (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 )
Milli-Q H2O dispenser (Thermo Fisher Scientific, Thermo ScientificTM, model: BarnsteadTM GenPureTM Pro , catalog number: 50131950)
Centrifuge (Eppendorf, model: 5084 R , catalog number: 5805000696)
Electroporation cuvette (Bio-Rad Laboratories, catalog number: 1652082 )
-20 °C freezer (Panasonic, catalog number: MDF-U548D-C )
pH meter (Fisher Scientific, model: Fisher ScientificTM accumetTM AB150, catalog number: 13-636-AB150 )
DNA electrophoresis apparatus (Beijing LIUYI Biotechnology, catalog numbers: DYY-6C and DYCP-32B )
Electroporator (Eppendorf, model: Electroporator 2510 )
Autoclave (SANYO, catalog number: MLS-3750 )
Software
Primer Premier 5 (Premier Biosoft International)
sgRNAcas9 (Xie et al., 2014)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, J., Wang, Y., Zheng, P. and Sun, J. (2018). CRISPR/Cas9-mediated ssDNA Recombineering in Corynebacterium glutamicum. Bio-protocol 8(19): e3038. DOI: 10.21769/BioProtoc.3038.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > Chromosome engineering
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,039 | https://bio-protocol.org/exchange/protocoldetail?id=3039&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Cell Death in Planarians
Nídia de Sousa
TA Teresa Adell
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3039 Views: 5790
Edited by: Ivan Zanoni
Reviewed by: Yang FuAchille Broggi
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
Planarians are freshwater flatworms, well known for their ability to regenerate a complete organism from any piece of their body. Furthermore, planarians are constantly growing and degrowing throughout their lives, maintaining a functional and proportioned body. These properties rely on the presence of a population of adult stem cells and on the tight control of their cell renewal, which is based on the balance between the proliferation of new cells and their differentiation, and the death of unnecessary cells. Due to the importance of these two processes in planarian biology, over the years, researchers have optimized molecular techniques to detect both cell proliferation and cell death in planarians. Here, we present the two main protocols currently used for cell death detection and quantification in the planarian field: Caspase-3 activity quantification and TUNEL assay.
Keywords: Caspase-3 activity TUNEL assay Planarians Cell death Cell turnover
Background
Cell renewal in adult organisms is a complex mechanism based on three processes: (a) the elimination of selected cells by cell death; (b) the replacement of eliminated cells through cell division, typically involving adult stem cells and their descendants; and (c) the differentiation of newly generated cells and their integration with preexisting tissue (Pellettieri and Sanchez Alvarado, 2007; González-Estévez and Saló, 2010). In planarians, cell renewal must be continuously coordinated, since they grow and degrow depending on food availability and temperature (Baguñá and Romero, 1981). It is known that the changes in size result mainly from changes in cell number, rather than in cell size, so the ratio of dying/proliferating cells is controlled by environmental conditions (González-Estévez and Saló, 2010). Planarians are able to tolerate long starvation periods, and during this time, they degrow up to minimum sizes. Under these stressful conditions, food reserves from gastrodermis and mesenchyma are the firsts to be used, and at more extreme points, the sexual strains digest the sexual organs, and become asexual (González-Estévez and Saló, 2010; Miller and Newmark, 2012). When food is available, planarians are able to grow back, and in the sexual strains, the reproductive organs reappear. These cycles of grow and degrow occur throughout planarian lives without damage to the animal.
During planarian starvation, cell death increases to re-organize the organs and structures, and planarian adult stem cells (neoblasts) self-renewal is maintained at basal levels, resulting in a decrease of planarian body size (Figures 1A and 1B) (González-Estévez et al., 2012). The tissue remodeling is critical during planarian starvation because it maintains a proportioned planarian body. It was shown that JNK signaling, and Gtdap-1 are controlling the planarian body re-scaling during degrowing through the modulation of apoptotic cell death (González-Estévez et al., 2007; Almuedo-Castillo et al., 2014).
Because cell death is a relevant process in planarian, in the last few years molecular techniques to detect and measure cell death have been developed and optimized. Here, we will explain step-by-step the two main protocols used to detect cell death in planarians: measurement of Caspase-3 activity and TUNEL assay.
Figure 1. Planarian homeostasis. A. Planarians are able to grow and degrow during their lives, maintaining their body proportions and functionality. Image provided by Gustavo Rodriguez-Esteban. B. After a stimulus, proliferation and/or cell death can change in planarians. After feeding, neoblast proliferation increases throughout planarian body, and cell death is reduced to minimum levels, resulting in the increase of animal’s size. Conversely, when planarians are in starvation, neoblast proliferation is maintained at basal levels and cell death increases, which not only results in a decrease in body size but allows the reorganization of the tissues. Image from Nídia de Sousa Ph.D. thesis (de Sousa, 2017).
Part I: Caspase-3 activity assay
The Caspase-3 activity assay is a fluorescent assay that detects the activity of Caspase-3 in cell lysates using the fluorogenic substrate acetyl Asp-Glu-Val-Asp 7-amido-4-methylcoumarin (Ac-DEVD-AMC). It is based on the hydrolysis of Ac-DEVD-AMC by Caspase-3, resulting in the release of the fluorescent 7-amino-4-methylcoumarin (AMC). AMC that can be detected using a luminescence spectrophotometer with excitation at 380 nm and emission between 420 nm and 460 nm. Cleavage of the substrate only occurs in lysates in which Caspase-3 is present, which is a gene required for apoptosis; therefore, the amount of AMC produced is proportional to the number of apoptotic cells in the sample.
Materials and Reagents
Petri dish (VWR, catalog number: 391-0439 )
Slides (VWR, catalog number: 631-1551 )
Razor blade (MARTOR, catalog number: NO. 743 )
Eppendorf tubes (VWR, Eppendorf, catalog number: 700-5239 )
15 ml Falcons (LF Equipamentos, catalog number: 166 )
Spectrophotometry Cuvettes (VWR, catalog number: 634-0677BTU )
96-well plate (VWR, Corning, catalog number: 734-1664 )
MilliQ water
Ice
Micro BCA Protein Assay Kit (Thermo Fisher Scientific, PierceTM, catalog number: 23235 )
Tris-HCl, pH 8 (Sigma-Aldrich, catalog number: 93362 )
EDTA, pH 8 (Sigma-Aldrich, catalog number: 1233508 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
HEPES pH 7.5 (Sigma-Aldrich, catalog number: H3375 )
Glycerol 10% (Sigma-Aldrich, catalog number: G5516 )
DTT (Sigma-Aldrich, catalog number: 646563 )
Caspase-3 inhibitor Z-DEVD-FMK (Merck, catalog number: 264155 )
Caspase-3 substrate Ac-DEVD-AMC (BD Biosciences, PharmingenTM, catalog number: 556449 )
Lysis buffer (see Recipes)
Assay buffer (see Recipes)
Equipment
Oven
Luminescence spectrophotometer
Pipettes
Vortex
Centrifuge
Platform shaker
4 °C refrigerator
-20 °C freezer
37 °C incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sousa, N. D. and Adell, T. (2018). Detection of Cell Death in Planarians. Bio-protocol 8(19): e3039. DOI: 10.21769/BioProtoc.3039.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Proliferation
Cancer Biology > Cell death > Animal models
Cell Biology > Cell viability > Cell death
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
304 | https://bio-protocol.org/exchange/protocoldetail?id=304&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation
WH Willemijn Hobo
WN Wieger Norde
Harry Dolstra
Published: Vol 2, Iss 23, Dec 5, 2012
DOI: 10.21769/BioProtoc.304 Views: 15038
Original Research Article:
The authors used this protocol in Jul 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2012
Abstract
Proliferative capacity and degranulation are important features of antigen-specific CD8+ T cells. By combining tetramer staining with a CFSE staining, we were able to enumerate the total number of antigen-specific T cells, as well as their number of divisions upon antigen-specific stimulation during a week. In addition, we performed restimulation of these cells, to analyze their ability to secrete cytolytic granules, visualized by CD107a staining.
Materials and Reagents
Mouse-anti-human CD107a PE (clone H4A3) (BD Biosciences, catalog number: 555801 )
Mouse-anti-human CD3 PE-Cy7 (clone UCHT1) (Biolegend, catalog number: 300420 )
Mouse-anti-human CD8 Alexa-Fluor-700 (clone 3B5) (Life Technologies, Invitrogen™, catalog number: MCHD0824 )
Note: The above antibodies have been tested by the author and may be substituted with the antibodies desired by users.
CFSE (Molecular Probes Europe BV)
Iscove’s Modified Dulbecco’s Medium (IMDM) (Life Technologies, Invitrogen™)
Heat-inactivated fetal calf serum (FCS) (Integro)
Human serum (HS) (Sanquin Blood Bank)
Recombinant human IL-2 (Proleukin, Chiron)
Recombinant human IL-15 (Immunotools, catalog number: 11340155 )
Antigen-specific peptide (For example MiHA or CMV-peptide, Thinkpeptides)
APC-conjugated antigen-specific tetramer (Kindly provided by Prof. dr. J. H. F. Falkenburg, Leiden University Medical Centre, the Netherlands)
Sytox blue (Life Technologies, Invitrogen™, catalog number: S34857 )
Mature monocyte-derived DC [cultured following the protocol described in Hobo et al. (2010)]
FACS buffer (see Recipes)
Equipment
Beckman Coulter Navios flow cytometer
24-wells plate
37 °C incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hobo, W., Norde, W. and Dolstra, H. (2012). Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation. Bio-protocol 2(23): e304. DOI: 10.21769/BioProtoc.304.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Lymphocyte
Immunology > Immune cell staining > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,040 | https://bio-protocol.org/exchange/protocoldetail?id=3040&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Maintenance of Schmidtea mediterranea in the Laboratory
Nídia de Sousa
TA Teresa Adell
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3040 Views: 5724
Edited by: Ivan Zanoni
Reviewed by: Achille BroggiMarco Di Gioia
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
In the last years, planarians have emerged as a unique model animal for studying regeneration and stem cells biology. Although their remarkable regenerative abilities are known for a long time, only recently the molecular tools to understand the biology of planarian stem cells and the fundamentals of their regenerative process have been established. This boost is due to the availability of a sequenced genome and the development of new technologies, such as interference RNA and next-generation sequencing, which facilitate studies of planarian regeneration at the molecular and genetic level. For these reasons, maintain a healthy and stable planarian population in the laboratory is essential to perform reproducible experiments. Here we detail the protocol used in our laboratory to maintain the planarian species Schmidtea mediterranea, the most widespread as a model.
Keywords: Planarian Schmidtea mediterranea Culture Planarium Model organism Regeneration
Background
Planarians are bilaterally symmetric platyhelminthes, members of the superphylum lophotrochozoa. There are terrestrial, marine, and freshwater planarians. They prey predominantly upon injured insects, insect larvae, and other invertebrates. Planarians are triploblastic and acoelomated animals that lack circulatory, skeletal, and respiratory systems (Figure 1A). These animals have the amazing ability to restore any missing part of their body after an amputation in a few days (Reddien and Alvarado, 2004; Salo, 2006); and to grow and degrow depending of the environmental conditions and food availability (Baguñá and Romero, 1981). These characteristics are due to the presence of an adult stem cell population – called neoblasts – that is able to give rise to any planarian cell type (Reddien and Alvarado, 2004; Salo, 2006). The high regenerative capacity of planarians, with the presence of a unique totipotent stem cell system, provides an ideal model for studying cell renewal, regeneration, and stem cell regulation. Schmidtea mediterranea is the most common planarian species used in molecular biology to perform molecular and cellular studies, because it presents special features that optimize research. For instances, they are easily maintained as a stable clonal line in the laboratory due to their robust ability to regenerate, which allows a uniform genetic background and minimizes the experimental variability. Here we detail the protocol used in our laboratory to maintain the planarian species Schmidtea mediterranea.
Materials and Reagents
Glass Tupperware (Figure 1B)
The size may vary depending on the requirements of each experiment. You must avoid large containers that can be too heavy and difficult to manipulate.
Assexual planarian clonal line of the asexual strain of Schmidtea mediterranea
This species can be found in coastal areas in the Western Mediterranean. The origin of the strain used in most labs are the fountains of Montjuic in Barcelona. The easiest source nowadays is asking directly from our laboratory or any that has already stablished it as a model organism.
Organic beef liver
Note: It can be purchased in any butcher shop that sells organic meat.
NaOH (Merck, catalog number: 106462 )
MgSO4•7H2O (Merck, catalog number: 105886 )
NaHCO3 (Merck, catalog number: 106329 )
KCl (Merck, catalog number: 104936 )
MgCl2•6H2O (Merck, catalog number: 105833 )
CaCl2•2H2O (Merck, catalog number: 102382 )
MilliQ water
100x Planarians Artificial Medium (PAM) stock solution (see Recipes)
100x CaCl2 Stock solution (see Recipes)
Equipment
"Planarium"–room or incubator at 20 °C (Figure 1C)
1 L Beaker
Magnetic stirrer
Stir bar
1 L Graduated cylinder
1 L Crystal bottle
Water tank
Figure 1. Culture of Schmidtea mediterranea. A. In vivo planarian from the species Schmidtea mediterranea. B. Glass Tupperware with planarians. C. “Planarium” (room at 20 °C).
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sousa, N. D. and Adell, T. (2018). Maintenance of Schmidtea mediterranea in the Laboratory. Bio-protocol 8(19): e3040. DOI: 10.21769/BioProtoc.3040.
Download Citation in RIS Format
Category
Cell Biology > Model organism culture > Maintenance
Stem Cell > Adult stem cell > Maintenance and differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,041 | https://bio-protocol.org/exchange/protocoldetail?id=3041&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescence Titrations to Determine the Binding Affinity of Cyclic Nucleotides to SthK Ion Channels
Philipp A.M. Schmidpeter
Crina M. Nimigean
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3041 Views: 7885
Edited by: Vamseedhar Rayaprolu
Reviewed by: Malgorzata LichockaQiangjun Zhou
Original Research Article:
The authors used this protocol in Jun 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2018
Abstract
The cyclic-nucleotide modulated ion channel family includes cyclic nucleotide-gated (CNG) and hyperpolarization-activated and cyclic nucleotide-modulated (HCN) channels, which play essential roles in visual and olfactory signaling and the heart pacemaking activity. Functionally, these channels have been extensively characterized by electrophysiological techniques from protein heterologously expressed in Xenopus oocytes and mammalian cells. On the other hand, expression and purification of these proteins for biophysical and structural analyses in vitro is problematic and expensive and, accordingly, only limited information on the purified channels is available in the literature. Here we describe a protocol for binding studies of fluorescently labeled cyclic nucleotides to a homologue of eukaryotic CNG channels. Furthermore, we describe how to directly probe binding of unlabeled cyclic nucleotides in a competition assay. The use of fluorescence as a sensitive probe for ligand binding reduces the amount of protein needed and enables fast and easy measurements using standard laboratory equipment.
Keywords: Fluorescence titration Ligand binding Ligand discrimination Fluorescent nucleotides Competition assay
Background
Understanding the function of a protein in molecular detail requires extensive microscopic characterization. For ligand-gated ion channels different assays are needed to gain information about the specific interaction of the protein with the ligand, the communication between the ligand binding site and the pore, as well as channel-specific characteristics such as ionic throughput and inactivation or desensitization properties. Together with structural data for channel conformations corresponding to various functional states, this allows the development of a complete mechanistic description of channel function and regulation. Cyclic nucleotide-gated (CNG) ion channels are tetrameric potassium channels that are of particular interest due to their function in olfactory and visual signaling cascades (Kaupp and Seifert, 2002; Craven and Zagotta, 2006). However, there is only very limited data available on purified CNG channels under defined conditions, mostly from single molecule force spectroscopy (Higgins et al., 2002; Maity et al., 2015; Goldschen-Ohm et al., 2016; Mazzolini et al., 2018). Electrophysiological characterization of CNG channels expressed in Xenopus oocytes or mammalian cells (Biel et al., 1993 and 1994; Baumann et al., 1994; Weyand et al., 1994; Yu et al., 1996; Zagotta and Siegelbaum, 1996), shows that they are activated by micromolar concentrations of cyclic nucleotides (cNMP), but cAMP and cGMP can act differentially on different channel subtypes. High resolution structures of a few cyclic nucleotide-modulated channels have recently been solved (James et al., 2017; Lee and MacKinnon, 2017; Li et al., 2017; Rheinberger et al., 2018), highlighting the need for biophysical assays to characterize these channels in order to gain a better understanding of the molecular interactions during gating and regulation.
Recently, we introduced SthK, a bacterial homologue of eukaryotic CNG channels, as a model to analyze the allosteric regulation of these channels in vitro (Schmidpeter et al., 2018). One interesting observation was that cAMP and cGMP activate SthK with considerably different efficacies but interact with the protein with very similar affinities. We used fluorescently labeled cyclic nucleotides (Figure 1) to measure the binding affinity of these ligands to full-length SthK channels. The fluorescence of the NBD moieties increases upon interaction with a binding partner and thus directly reports the complex formation with SthK. To probe direct binding of unlabeled nucleotides to the channel we employed fluorescence-based competition assays. In the following we will provide detailed protocols for both experiments which can be performed in any protein-biochemistry laboratory using standard equipment and are applicable to protein-ligand interactions in general. Furthermore, this assay can be adapted to a plate-reader format which might increase the throughput and at the same time account for possible pipetting errors.
Figure 1. Structural formula of fluorescently labeled cyclic nucleotides. A. 8-NBD-cAMP. B. 8-NBD-cGMP. For both compounds the fluorescent group is labelled separately, the exact chemical name, the abbreviation and the trivial name are given. The representations were adapted from Biolog (Bremen, Germany, www.biolog.de).
Materials and Reagents
Amicon Ultra-15 Centrifugal Filter MWCO 100 kDa (Merck, catalog number: UFC910024 )
Amicon Ultra-4 Centrifugal Filter MWCO 100 kDa (Merck, catalog number: UFC810024 )
BenchMarkTM Pre-stained Protein Ladder (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10748010 )
Detergent Removal Column (Thermo Fisher Scientific, PierceTM, catalog number: 87779 )
Ethanol ≥ 95% (Decon Labs, catalog number: V1116 )
Amphipol A8-35 (Anatrace, catalog number: A835 )
3',5'-cyclic AMP, cAMP (Alfa Aesar, catalog number: J62174-03 )
3',5'-cyclic GMP, cGMP (Sigma-Aldrich, catalog number: G6129 )
8-NBD-cAMP, f-cAMP (BIOLOG, catalog number: N 002 )
8-NBD-cGMP, f-cGMP (BIOLOG, catalog number: N 001 )
Glutaraldehyde (Sigma-Aldrich, catalog number: G6257 )
HEPES (Simga-Aldrich, catalog number: H3375 )
KCl (Simga-Aldrich, catalog number: P9333 )
Superdex 200 10/300 GL (GE Healthcare, catalog number: 17517501 )
Amphipol stock solution (see Recipes)
200 mM cAMP stock solution (see Recipes)
Assay buffer (see Recipes)
Equipment
Stir bar (suitable for the cuvette)
Set of single channel pipettes, ranging from 0.1-1,000 μl (VWR, catalog number: 75788-460 )
Äkta Chromatography System (GE Healthcare)
NanoDropTM (Thermo Fisher Scientific)
Fluorescence-spectrophotometer (HORIBA, PTI QuantaMasterTM, model: 800 )
UV cuvette (suitable for wavelengths between 230 and 800 nm, volume according to the specifications of the spectrometer between 1 and 4 ml)
Refrigerated Microcentrifuge (Eppendorf, model: 5418 R )
Rotator (Fixed Speed Rotator, Cole-Parmer, Stuart, model: SB2 )
Software
Data can be analyzed using any software capable of programmable, non-linear least-squares fitting (We analyzed the data using GraFit 5)
GraFit 5.0.13 (Erithacus Software Limited, http://www.erithacus.com/grafit/)
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Schmidpeter, P. A. and Nimigean, C. M. (2018). Fluorescence Titrations to Determine the Binding Affinity of Cyclic Nucleotides to SthK Ion Channels. Bio-protocol 8(19): e3041. DOI: 10.21769/BioProtoc.3041.
Download Citation in RIS Format
Category
Molecular Biology > Protein > Ion channel signaling
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,042 | https://bio-protocol.org/exchange/protocoldetail?id=3042&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Filter Retardation Assay for Detecting and Quantifying Polyglutamine Aggregates Using Caenorhabditis elegans Lysates
Olga Sin
AM Alejandro Mata-Cabana
RS Renée I. Seinstra
EN Ellen A. A. Nollen
Published: Vol 8, Iss 19, Oct 5, 2018
DOI: 10.21769/BioProtoc.3042 Views: 7870
Reviewed by: Saumik BasuManoj B. Menon
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
Protein aggregation is a hallmark of several neurodegenerative diseases and is associated with impaired protein homeostasis. This imbalance is caused by the loss of the protein’s native conformation, which ultimately results in its aggregation or abnormal localization within the cell. Using a C. elegans model of polyglutamine diseases, we describe in detail the filter retardation assay, a method that captures protein aggregates in a cellulose acetate membrane and allows its detection and quantification by immunoblotting.
Keywords: Protein aggregation Polyglutamine Amyloid Filter trap assay Filter retardation assay Dot blot C. elegans
Background
One pathological feature of neurodegenerative diseases like Parkinson’s, Alzheimer’s and polyglutamine diseases is the presence of protein aggregates in distinct areas of the brain (reviewed in Soto, 2003; Stroo et al., 2017). In the case of polyglutamine diseases, abnormal expansion of glutamine (CAG) repeats in the coding sequence disturbs the native folding of the protein. As a result, the misfolded protein exposes regions of its amino acid sequence, which makes it prone to aggregate with other proteins, forming large, insoluble aggregates that can hamper normal cellular function (reviewed in Kuiper et al., 2017).
Several methods have been developed for the detection of insoluble protein aggregates including, for instance, dye binding assays (e.g., Thioflavin T, Congo red, NIAD-4) and electron microscopy. Filter retardation assay is a quick and sensitive method that detects and quantifies protein aggregates formed in vivo and in vitro, including polyglutamine (Scherzinger et al., 1997; Wanker et al., 1999), alpha-synuclein (Recasens et al., 2018), and amyloid-beta aggregates (Bieschke et al., 2009). In this assay, sodium dodecyl sulfate (SDS)-resistant protein aggregates are filtered and retained in a cellulose acetate membrane, while monomeric intermediate species are not captured. The protein aggregates retained in the membrane are subsequently detected by antibodies, which allows for their quantification.
This protocol describes a method to detect and quantify SDS-resistant polyglutamine aggregates in the nematode Caenorhabditis elegans and can be applied to investigate the aggregation of aggregation-prone proteins in vivo and in vitro.
Materials and Reagents
200 µl pipette tips (Greiner Bio-one, catalog number: 741065 )
1000 µl pipette tips (Greiner Bio-one, catalog number: 741045 )
15 ml conical tubes (SARSTEDT, catalog number: 62.554.502 )
2 ml Screw cap tubes (SARSTEDT, catalog number: 72.693.105 )
0.5 mm Glass beads (Carl Roth, catalog number: N030.1 )
11.3 x 7.7 cm Bio-Dot/Bio-Dot SF Filter Paper (Bio-Rad Laboratories, catalog number: 1620161 )
Cellulose acetate membranes, 0.22 micron, Sphaero (Sterlitech, catalog number: CA023001 )
1.5 ml microfuge tube (Greiner Bio One International, catalog number: 616201 )
Rubber seal
Plastic wrap
50 ml conical tube (SARSTEDT, catalog number: 62.547.004 )
Worms
PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific, catalog number: 23227 )
Complete protease inhibitors (Roche Diagnostics, catalog number: 11697498001 )
ECLTM Prime Western Blotting Detection (GE Healthcare, Amersham, catalog number: RPN2232 )
Liquid nitrogen
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
DL-Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
1 M Tris-HCl
5 M NaCl
10% SDS
Milli-Q water
Non-fat dry milk powder (Campina)
Antibodies against green fluorescent protein (GFP)/yellow fluorescent protein (YFP) and tubulin (Table 1)
Table 1. List of primary and secondary antibodies
Primary antibody
Host
Company/catalog number
Dilution primary antibody
Secondary antibody
α-GFP
Mouse
TaKaRa Bio,
Clontech Laboratories ( 632381 )
1:5,000
Anti-mouse (1:10,000)
Bio-Rad ( 1706516 )
α-tubulin
Mouse
Sigma-Aldrich ( T6074 )
1:5,000
Anti-mouse (1:10,000)
Bio-Rad ( 1706516 )
Sodium phosphate dibasic heptahydrate (Na2HPO4•7H2O) (Acros Organics, catalog number: 424380010 )
Sodium chloride (NaCl) (Merck, catalog number: 1064041000 )
Potassium chloride (KCl) (Fisher Chemicals, catalog number: 10010310 )
10x Phosphate buffered saline (PBS) (see Recipes)
1x PBS-Triton 0.1% (see Recipes)
1x PBS-Triton 0.05% (see Recipes)
Filter trap assay (FTA) sample buffer (see Recipes)
FTA wash buffer (see Recipes)
1 M dithiothreitol (DTT, see Recipes)
Blocking solution (see Recipes)
Equipment
P20 Pipetman (Gilson, catalog number: F123600 )
P200 Pipetman (Gilson, catalog number: F123601 )
P1000 Pipetman (Gilson, catalog number: F123602 )
30-300 μl multi-channel pipette (Eppendorf, catalog number: 3125000052 )
10 ml Serological glass pipettes (SARSTEDT, catalog number: 86.1254.001 )
Centrifuge (Thermo Fisher Scientific, model: SL 40R , rotor: TX-750 )
Bead beater (MP Biomedicals, model: FastPrep-24 )
48-well Bio-Dot Microfiltration System (Bio-Rad Laboratories, catalog number: 1703938 )
Vacuum pump
20 °C incubator (LIEBHERR, model: WK 4126 )
Vortex (Fisher scientific, model: ZX Wizard vortex, catalog number: 11746744 )
Fuji Super RX-N 13x18 film (Fujifilm, catalog number: RX1318 )
Autoclave
Software
ImageJ (Open source: https://imagej.nih.gov/ij/)
Microsoft Excel (Microsoft Corporation, Redmond, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sin, O., Mata-Cabana, A., Seinstra, R. I. and Nollen, E. A. A. (2018). Filter Retardation Assay for Detecting and Quantifying Polyglutamine Aggregates Using Caenorhabditis elegans Lysates. Bio-protocol 8(19): e3042. DOI: 10.21769/BioProtoc.3042.
Download Citation in RIS Format
Category
Biochemistry > Protein > Quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,043 | https://bio-protocol.org/exchange/protocoldetail?id=3043&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification of Soluble Recombinant Human Tau Protein from Bacteria Using Double-tag Affinity Purification
Joseph McInnes
Lujia Zhou
Patrik Verstreken
Published: Vol 8, Iss 22, Nov 20, 2018
DOI: 10.21769/BioProtoc.3043 Views: 7718
Reviewed by: Laia Armengot
Original Research Article:
The authors used this protocol in Feb 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2018
Abstract
Dysfunction of the microtubule-associated protein Tau (encoded by the MAPT gene) has been implicated in more than twenty neurodegenerative diseases, including Alzheimer’s. As such, the physiological and disease-relevant functions of Tau have garnered great interest in the research community. One barrier hampering investigations into the functions of Tau and the generation of pharmacological agents targeting Tau has been the difficulty of obtaining soluble Tau protein in purified form. Here, we describe a protocol that uses dual affinity tag purification to selectively purify soluble recombinant Tau protein from bacteria that is functionally active for downstream applications including immunization, microtubule binding assays, and protein-protein interaction studies.
Keywords: Tau MAPT Protein purification Soluble Tau Recombinant Tau Alzheimer’s
Background
Tau is traditionally defined as a microtubule binding protein; however, in human diseases Tau can dissociate from axonal microtubules and mislocalize to other neuronal compartments including the soma, dendrites, and synapses, where interactions with non-microtubule proteins and structures drive neuronal dysfunction (Iqbal et al., 2016; Wang and Mandelkow, 2016; Zhou et al., 2017; McInnes et al., 2018). Although Tau aggregates in the form of neurofibrillary tangles are commonly found in post-mortem diseased brain tissue, studies suggest that soluble Tau, not aggregated Tau, is largely responsible for neuronal dysfunction (Crimins et al., 2012; Polydoro et al., 2014; Koss et al., 2016). As such, investigating the soluble functions of Tau in disease, such as identifying protein-protein interaction partners, is therefore of critical importance to target Tau dysfunction.
Purifying soluble Tau protein has been challenging since many ectopically expressed recombinant proteins aggregate into insoluble inclusion bodies in bacteria. Tau furthermore contains aggregation-prone motifs, making purifying recombinant Tau even more difficult. We have therefore developed a protocol that overcomes these obstacles by optimizing two key aspects of this process: first, we express Tau as a fusion protein with an N-terminal Glutathione S-transferase (GST) tag to enhance solubility of the protein, and utilize a mild induction paradigm to minimize the formation of insoluble Tau aggregates. We chose GST over other fusion proteins because it is relatively small, robustly enhances protein solubility and stability, can be easily cleaved, and is relatively inexpensive to purify. Second, our purification protocol utilizes dual affinity tag purification of both an N-terminal GST tag and a C-terminal 8xHis tag (Figure 1); because this purification protocol requires both N- and C-terminal tags to be available to bind affinity resin, the protocol therefore specifically enriches for soluble, non-aggregated protein (in the event of aggregation, at least one of these epitopes is hidden within the aggregate). Following the first purification step against the N-terminal GST tag, the GST fusion protein is cleaved using PreScission protease, resulting in a final product of purified Tau protein that contains only an additional eight histidine residues (8xHis tag) at its C-terminal domain that can also be used for downstream applications including pull-down experiments or detection using anti-His antibodies. This method is versatile and can be easily modified to purify different isoforms of Tau, Tau carrying point mutations, or Tau truncations by altering the pGEX_GST-Tau0N4R-8xHis plasmid using site-directed mutagenesis or traditional cloning methods. We have successfully utilized this protocol to produce various isoforms of Tau, including with point mutations or domain truncations, for use in in vitro binding assays with synaptic vesicles (Zhou et al., 2017) and as bait in protein-protein interaction studies (McInnes et al., 2018).
Figure 1. Schematic overview of the recombinant GST-Tau-8xHis fusion protein and purification steps
Materials and Reagents
1 ml micropipette tips
Microcentrifuge tubes
Amicon Ultra-0.5 Centrifugal Filter Unit with Ultracel-10 membrane (Merck, catalog number: UFC501024 )
Plasmid pGEX_GST-Tau0N4R-8xHis
Note: This plasmid can be generated by cloning a cDNA encoding human MAPT into a pGEX-6P-1 vector backbone (such as the BamHI/EcoRI restriction sites of Addgene plasmid number 46408). The cDNA should be at downstream of N-terminal GST fusion with PreScission Protease cleavage site. The 8xHis tag can be inserted into the 3’ primer used to amplify the hTau cDNA. In this protocol, we use human MAPT cDNA corresponding to the 0N4R isoform.
RosettaTM bacteria cells (Merck, catalog number: 70953 )
LB Broth (Sigma-Aldrich, catalog number: L3522 )
Ampicillin (Sigma-Aldrich, catalog number: A9393 )
Chloramphenicol (Sigma-Aldrich, catalog number: C0378 )
Anti-His antibody (such as Thermo Fisher Scientific, catalog number: 37-2900 ) or anti-Tau antibody (such as Agilent Technologies, DAKO, catalog number: A0024 )
Isopropyl β-D-thiogalactoside (IPTG) (Sigma-Aldrich, catalog number: I6758 )
Note: Prepare 100 mM stock in sterile H2O and freeze aliquots at -20 °C. Do not re-freeze after thawing.
Glutathione Sepharose 4B (GE Healthcare, catalog number: 17075601 )
Complete protease inhibitor tablets, EDTA-free (Roche Diagnostics, catalog number: 11873580001 )
Phenylmethanesulfonyl fluoride (PMSF), 100 mM solution (Sigma-Aldrich, catalog number: 93482 )
Benzonase Nuclease, 250 units/μl (Sigma-Aldrich, catalog number: E1014 )
PreScission Protease, 2,000 units/ml (GE Healthcare, catalog number: 27084301 )
Note: Upon receiving stock, thaw on ice and prepare ~10 μl aliquots and freeze at -20 °C. Do not re-freeze aliquots after thawing.
Ni-NTA ProfinityTM IMAC Resin, Ni-charged (Bio-Rad Laboratories, catalog number: 1560131 )
Quick StartTM Bradford Protein Assay (Bio-Rad Laboratories, catalog number: 5000201 )
PageBlueTM Protein Staining Solution (Thermo Fisher Scientific, catalog number: 24620 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Lysozyme (Sigma-Aldrich, catalog number: L6876 )
Sodium phosphate dibasic anhydrous (Na2HPO4) (Sigma-Aldrich, catalog number: 795410 )
DL-Dithiothreitol (DTT), 1 M stock solution in H2O (Sigma-Aldrich, catalog number: 646563 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Tween-20 (Sigma-Aldrich, catalog number: P1379 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S8045 )
Imidazole (Sigma-Aldrich, catalog number: 792527 )
Bacteria lysis buffer (see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
PBS + 250 mM NaCl (see Recipes)
PreScission protease cleavage buffer (see Recipes)
Ni-NTA wash buffer (see Recipes)
Ni-NTA elution buffer (see Recipes)
Equipment
Pipettes
Table-top microcentrifuge capable of speeds up to 16,000 x g
Microplate reader or spectrophotometer capable of absorbance readings at 600 nm for bacterial density measurements and at 595 nm for Bradford protein assay
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：McInnes, J., Zhou, L. and Verstreken, P. (2018). Purification of Soluble Recombinant Human Tau Protein from Bacteria Using Double-tag Affinity Purification. Bio-protocol 8(22): e3043. DOI: 10.21769/BioProtoc.3043.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Protein isolation
Neuroscience > Nervous system disorders > Cellular mechanisms
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,045 | https://bio-protocol.org/exchange/protocoldetail?id=3045&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation and Purification of Proteins Secreted from Phytophthora sojae
YX Yeqiang Xia
Yan Wang
Yuanchao Wang
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3045 Views: 5975
Edited by: Zhibing Lai
Reviewed by: Juan Du
Original Research Article:
The authors used this protocol in Jul 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2015
Abstract
Phytophthora sojae, the causal agent of soybean root and stem rot, is responsible for enormous economic losses in soybean production. P. sojae secrets various effectors to reprogram host immunity. The plant apoplastic space is a major battleground in plant-pathogen interactions. Here we describe a protocol for purification and isolation of secreted proteins from P. sojae, including precipitation of secreted proteins from P. sojae culture filtrate, chromatographic purification of the secreted proteins and analysis of the proteins by Mass spectrometry. With this protocol, it will be easier to identify potential apoplastic effectors in Phytophthora and will benefit our understanding of plant-microbe interactions.
Keywords: Phytophthora sojae Soybean root and stem rot Secreted proteins Chromatographic purification ÄKTA Apoplastic effectors
Background
Purification of proteins secreted from Phytophthora species is essential for understanding Phytophthora pathogenesis. In the past, V8 juice and Plant (tomato, and Lima bean) juice medium have been used to culture Phytophthora and the culture filtrated was used for the subsequent analysis of Phytophthora secreted proteins. The drawback of these protocols is the culturing media contain huge amount of plant proteins, which represent a large proportion of the detected proteins. In this protocol, we made use of the Synthesis Liquid Medium, which does not contain any proteins. This medium significantly reduces the background of the Phytophthora culturing filtrate. Furthermore, making use of the Gel Filtration desalting and sieving columns instead of Ion Exchange columns, allows efficient and large-scale purification of Phytophthora secreted proteins.
Materials and Reagents
Pipette tips
Scalpel
Filter paper (Whatman filters) (No. 1)
0.22 μm Millex-GV filter (Merck, catalog number: SLGP033NS )
Amicon Ultra-15 Centrifugal Filter Unit 3KD (Merck, catalog number: UFC900308 )
P. sojae strain (P6497)
V8 juice (https://www.campbells.com/v8/vegetable-juice/)
Calcium carbonate (CaCO3) (Sigma-Aldrich, catalog number: 398101 )
Potassium Dihydrogen Phosphate (KH2PO4) (Merck, catalog number: 1048730250 )
Yeast extract (Sigma-Aldrich, catalog number: Y1625-1KG )
Magnesium sulfate heptahydrate (MgSO4•7H2O) (Sigma-Aldrich, catalog number: RES0089M-A702X )
D-glucose (Sigma-Aldrich, catalog number: G8270-100G )
L-asparagine (Sigma-Aldrich, catalog number: A0884-100G )
β-sitosterol (Sigma-Aldrich, catalog number: S1270-10MG )
Thiamine(VB1) (Sigma-Aldrich, catalog number: T4625-5G )
Milli-Q-filtered H2O
Ammonium sulfate (NH4)2SO4 (Sigma-Aldrich, catalog number: A4418-100G )
Tris-aminomethane (Tris-HCl) (Sigma-Aldrich, catalog number: 154563-1KG )
Ethylene Diamine Tetraacetic Acid (EDTA) (Sigma-Aldrich, catalog number: 80849-10MG )
30% acrylamide
10% sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771-100G )
10% ammonium persulfate (Sigma-Aldrich, catalog number: A3678-25G )
N,N,N',N'-Tetramethylethylenediamine (TEMED) (Sigma-Aldrich, catalog number: T9281-25ML )
Coomassie brilliant blue (CBB-R-250) (Beyotime Biotechnology, catalog number: P0017 )
Ethanol (ALADDIN-E, catalog number: A112719 )
Acetic acid (ALADDIN-E, catalog number: A116174 )
Methanol (ALADDIN-E, catalog number: M116127 )
V8 juice with 2% agar (see Recipes)
Synthesis liquid medium (see Recipes)
TE buffer (see Recipes)
SDS-PAGE Gel (see Recipes)
R-250 staining solution (see Recipes)
Destaining solution (see Recipes)
Equipment
Pipettes
Conical flask (1 L)
Beaker (5 L)
Measuring cylinder (1 L)
Constant temperature incubator (CTI) (25 °C)
Constant temperature shaker (CTS) (25 °C, 100 rpm)
Centrifuge
Liquid chromatograph (GE Healthcare, model: ÄKTA avant 25 )
Column Sephadex G-25S (GE Healthcare, catalog number: 17140801 )
Chromatography column (GE Healthcare, model: SuperdexTM 200 Increase, catalog number: 28990944 )
Note: The materials, reagents and equipment not provided company and catalog number can be ordered from any qualified company for using in this experiment.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Xia, Y., Wang, Y. and Wang, Y. (2018). Preparation and Purification of Proteins Secreted from Phytophthora sojae. Bio-protocol 8(20): e3045. DOI: 10.21769/BioProtoc.3045.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Fungus
Molecular Biology > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,046 | https://bio-protocol.org/exchange/protocoldetail?id=3046&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Optical Clearing and Index Matching of Tissue Samples for High-resolution Fluorescence Imaging Using SeeDB2
MK Meng-Tsen Ke
Takeshi Imai
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3046 Views: 11179
Reviewed by: Shaarika Sarasija
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Tissue clearing techniques are useful for large-scale three-dimensional fluorescence imaging of thick tissues. However, high-resolution imaging deep inside tissues has been challenging, as it is extremely sensitive to light scattering and spherical aberrations. Here, we present a water-based optical clearing and mounting media, SeeDB2, which is designed for high numerical aperture (NA) objective lenses with oil or glycerol immersion. Using quick and simple soaking procedures, the refractive indices of samples can be matched either to that of immersion oil (1.52) or glycerol (1.46), thus minimizing light scattering and spherical aberrations. Fine morphology and various fluorescent proteins are highly preserved during the clearing and imaging process. Our method is useful for the three-dimensional fluorescence imaging of neuronal circuitry at synaptic resolution using confocal and super-resolution microscopy. SeeDB2 is also useful as a mounting media for the super-resolution imaging of fluorescent proteins.
Keywords: Tissue clearing Fluorescence imaging Confocal imaging Super-resolution imaging Connectome SeeDB2
Background
Biological tissues are organized in 3D. In addition, many of important cellular machineries, e.g., synapses in neurons, are at sub-micron scale. Therefore, there have been increasing demands for a method for sub-micron-scale 3D imaging. Serial electron microscopy techniques (e.g., FIB-SEM or SBF-SEM) are promising, but they cannot make the best use of the genetic fluorescent labeling tools available in modern life science. To facilitate 3D imaging with fluorescence microscopy, a number of tissue clearing techniques have been developed in recent years (Richardson and Lichtman, 2015 and 2017). They are designed for large-scale 3D imaging, and some of them allow for whole-brain, and even whole-body-scale fluorescence imaging of fixed samples combined with confocal, two-photon, or light-sheet microscopy. However, many of them have not been fully optimized for high-resolution imaging.
In fluorescence microscopy, lateral resolution (d) is given as:
d = 0.61λ/NA
where λ is the wavelength of the light and NA represents the numerical aperture. The resolution improves as d decreases. Therefore, we need to use high NA objective lenses for high-resolution imaging.
NA is defined as:
NA = n sinα
where n is the refractive index (RI) of the immersion media, and α is the half angular aperture. Therefore, many of the high NA objective lenses are designed for oil (RI = 1.52) or glycerol (RI = 1.46) immersion for the best resolution. Previously, high NA objective lenses are intended to image thin sections or just the surface of samples. However, if we try to image deeper in the samples with these objective lenses, image quality will be easily impaired due to “spherical aberrations”. As RI of tissue samples are lower than that of immersion oil (RI = 1.52) and a glass coverslip (RI ~1.52), the excitation light will refract at the interface between the coverslip and samples, and it will no longer converge onto a small focal spot. This is known as spherical aberrations, reducing resolution and brightness in microscopy.
To minimize spherical aberrations, index matching of samples is crucial. However, many of the existing mounting media and clearing solutions have low RI, ranging from 1.33 (water) to 1.46 (glycerol-based mounting media). Even our previous clearing agent, SeeDB (RI = 1.49), did not reach RI 1.52 (Ke et al., 2013, 2014). 2,2'-thiodiethanol (TDE, RI = 1.52) has been previously proposed for index matching for oil-immersion objective lenses and has been widely used for synthetic fluorescent dyes (Staudt et al., 2007). However, a major drawback of TDE is that most of fluorescent proteins are totally quenched in TDE. To overcome this limitation, we developed a new tissue clearing agent, SeeDB2S, that has a high refractive index (RI = 1.52), but also highly preserves fluorescent proteins (Ke et al., 2016). We also formulated SeeDB2G (RI = 1.46) for glycerol-immersion objective lenses. As fluorescent proteins are better preserved than in commercialized mounting media, SeeDB2G/S are also useful as mounting media for high-resolution imaging. SeeDB2G/S is particularly powerful for high-resolution confocal microscopy and super-resolution microscopy of fluorescent proteins in tissues, sections, and cells.
Materials and Reagents
1.5 ml Eppendorf tube (Eppendorf, for 1 ml solution)
5 ml Eppendorf tube (Eppendorf, catalog number: 0030119401 ; optional for 3 ml solution, for thick brain slices or whole-mount samples)
Paint brush (for thin brain slices, No. 1-2, see Figure 1)
Silicone rubber sheet (translucent, 0.2 mm thick; e.g., AS ONE, catalog number: 6-9085-13 ; see Figure 1)
Note: Various thickness of silicone rubber sheets are available from Togawa Rubber (AS ONE), Professional Plastics, CS Hyde, etc., ranging from 0.1 mm to 8.0 mm. The thickness should match that of brain slices.
Glass slide (76 mm x 26 mm; MATSUNAMI Glass; Figure 1)
Coverslips (18 x 18 mm, No 1.5H; e.g., Paul Marienfeld, catalog number: 0107032 or ZEISS, catalog number: 474030-9000-000 ; Figure 1)
Note: No 1.5H (170 ± 5 μm thick) is highly recommended for super-resolution imaging.
Sodium chloride (NaCl)
Sodium hydrogen phosphate dodecahydrate (Na2HPO4•12H2O)
Potassium chloride (KCl)
Potassium dihydrogen phosphate (KH2PO4)
4% paraformaldehyde (PFA; e.g., NACALAI TESQUE, catalog number: 26126-25 ) in PBS
20% Saponin (NACALAI TESQUE, catalog number: 30502-42 ) in ddH2O with filter sterilization
Note: Different vendors prepare saponin from different species of plants. We strongly recommend NACALAI TESQUE. Brownish lots (often found in Sigma-Aldrich) should be avoided.
Low-melting point agarose (e.g., Thermo Fisher Scientific, catalog number: 16520100 )
Omnipaque 350 (e.g., DAIICHI SANKYO, Omnipaque 350 Injection, 50 ml in 1 bottle; also available from GE healthcare)
Histodenz (e.g., Sigma-Aldrich, catalog number: D2158 )
Sodium azide (e.g., Sigma-Aldrich, catalog number: 13412 )
1 M stock of Tris-HCl, pH 7.6 (e.g., NACALAI TESQUE, catalog number: 35436-01 ), used to prepare Tris-EDTA buffer
0.5 M stock of EDTA, pH 8.0 (e.g., Dojindo, catalog number: 347-07481 ), used to prepare Tris-EDTA buffer
Immersion media:
Glycerol (e.g., Type G Immersion Liquid, Leica Microsystems, catalog number: 11513910 ; Glycerine solution, Leica Microsystems, catalog number: 11513872 ) for SeeDB2G
Oil (Type F, Olympus, MOIL-30; also available from Leica, Zeiss, etc.) for SeeDB2S
(Optional) SeeDB2 Trial Kit (Wako Pure Chemical Industries, catalog number: 294-80701 )
Phosphate-buffered saline (PBS) (see Recipes)
Tris-EDTA buffer, pH 7.6 (see Recipes)
Permeabilization solution (see Recipes)
Solution 1 (see Recipes)
Solution 2 (see Recipes)
SeeDB2 solutions (see Recipes)
SeeDB2G with saponin (clearing)
SeeDB2G (mounting)
SeeDB2S with saponin (clearing)
SeeDB2S (mounting)
Figure 1. Materials required for preparing imaging chamber and slice mounting
Equipment
Perforated spoon (optional for handling thick brain slices, custom-ordered, flat head, head diameter = 15 mm, see Figure 1 and Video 1)
Ring forceps (optional for whole-mount samples, e.g., Natsume Seisakusho, NAPOX, catalog number: A-26 , see Figure 1)
Vibratome (e.g., LinearSlicer, DOSAKA, model: PRO7N )
Seesaw shaker (e.g., Bio Craft, model: BC-700 )
Rotator (e.g., TAITEC, model: RT-30mini, catalog number: 0057154-000 )
Fluorescence microscope
Confocal microscope (e.g., Olympus, model: FV3000 ; Leica Microsystems, model: Leica TCS SP8 ; Nikon, model: A1+ )
Super-resolution microscope (e.g., Zeiss, model: LSM 880 with Airyscan; Leica Microsystems, model: Leica TCS SP8 with HyVolution 2; Leica Microsystems, model: Leica TCS SP8 STED )
Objective lenses
Examples: 63x oil-immersion (NA = 1.4, WD = 0.14 mm) (Leica Microsystems, model: HC PL APO 63x/1.4 Oil CS2, catalog number: 15506350 ); 100x oil-immersion (NA = 1.4, WD = 0.13 mm) (Leica Microsystems, model: HC PL APO 100x/1.4 Oil CS2, catalog number: 15506325 ); 63x glycerol-immersion (NA = 1.3, WD = 0.28 mm) (Leica, model: HCX PL APO 63x/1.30 GLYC CORR, catalog number: 11506193 ); 63x oil-immersion (NA = 1.4, WD = 0.19 mm) (Carl Zeiss, model: Plan-Apochroamt 63x/1.40 Oil DIC, catalog number: 440762-9904-000 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ke, M. and Imai, T. (2018). Optical Clearing and Index Matching of Tissue Samples for High-resolution Fluorescence Imaging Using SeeDB2. Bio-protocol 8(20): e3046. DOI: 10.21769/BioProtoc.3046.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Fluorescence imaging
Developmental Biology > Morphogenesis > Organogenesis
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,047 | https://bio-protocol.org/exchange/protocoldetail?id=3047&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Examining Autophagy in Plant by Transmission Electron Microscopy (TEM)
XZ Xiyin Zheng
CZ Chenguang Zhao
Yule Liu
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3047 Views: 6356
Edited by: Zhibing Lai
Reviewed by: Xiaohong Zhuang
Original Research Article:
The authors used this protocol in Apr 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2015
Abstract
In plants, macroautophagy, here referred as autophagy, is a degradation pathway during which the double-membrane structure named autophagosome engulfs the cargo and then fuses with vacuole for material recycling.
To investigate the process of autophagy, transmission electron microscopy (TEM) was used to monitor the ultrastructure of autophagic structures and identify the cargo during this process due to its high resolution. Compared to other autophagy examination methods including biochemical assays and confocal microscopy, TEM is the only method that indicates the morphology of autophagic structures in nanoscale, which is considered to be one of the best ways to illustrate the morphology of autophagic intermediates and the substrate of autophagy. Here, we describe the autophagy examination assay using TEM in Nicotiana benthamiana leaf cells.
Keywords: Plant Nicotiana benthamiana Autophagosome Autophagic body Autophagy TEM
Background
Autophagy is a highly conserved macromolecular degradation pathway in eukaryotes (Dikic, 2017). In plants, autophagy is induced by several stress conditions including starvation, oxidative stress, salt stress and senescence (Doelling et al., 2002; Hanaoka et al., 2002; Liu et al., 2005; Bassham, 2007; Liu and Bassham, 2009; Luo et al., 2017). During autophagy, double-membrane vesicles named autophagosomes form in cytoplasm and transport into the central vacuole, where the outer membrane of autophagosomes fuses with vacuolar membrane. Then the single-membrane structure termed as autophagic body enters into the vacuole lumen and ultimately gets degraded (Ohsumi, 2001; Liu and Bassham, 2012).
Till now, numerous methods for examining autophagy in plants have been established. The frequently used assays are confocal microscopy, electron microscopy and biochemical methods. As for confocal microscopy detection, autophagy marker including ATG8, ATG5 and SH3P2 fused with fluorescent proteins were used to label autophagy related structures (Zhuang et al., 2013; Le Bars et al., 2014; Zhuang and Jiang, 2014; Kliosnky et al., 2016). In addition, fluorescentacidotropic dye such as monodansylcadaverine (MDC) was also used to label autophagic structures in plant cells. Biochemical methods to measure autophagic flux is to detect the ratio of ATG8 and ATG8-PE, or the ratio of GFP-ATG8 and GFP. Nevertheless, TEM is dramatically outstanding among these methods for its high resolution thus provides more legible information of autophagic structure as well as its cargo. Thus, both qualitative and quantitive analysis of autophagy could be performed using TEM observation.
Under TEM observation, autophagosome is distinctly visible as two membrane bilayers which are separated by an electron-translucent aperture (Kliosnky et al., 2016). Meanwhile, it contains cargos for degradation. Generally, during nonselective autophagy, the size of autophagic structures is 0.5-1.5 μm. As for selective autophagy, the size of autophagic structures relies on the specific substrates. Here, we describe the protocol for examining autophagy activity by TEM in Cytoplastic Glyceraldehyde-3-Phosphate (GAPC) silenced plant cells.
Materials and Reagents
0.1-10 μl pipette tips (Thermo Fisher Scientific, QSP, catalog number: 104-Q )
1-200 μl pipette tips (Thermo Fisher Scientific, QSP, catalog number: 110-B-Q )
1-1,000 μl pipette tips (Corning, Axygen®, catalog number: T-1000-B )
1.5 ml microcentrifuge tubes
Toothpick (Yin Sha, catalog number: 918 )
Grid (Emcn, catalog number: AZH75HH )
40 holes flat embedding mold (Emcn, catalog number: DZ10590-40 )
4 weeks-old Nicotiana benthamiana plants
Agrobacterium strain GV3010
E-64d (Sigma-Aldrich, catalog number: E8640-1MG )
Paraformaldehyde (Electron Microscopy Sciences, catalog number: 157-8 )
Glutaraldehyde (Structure Probe, SPI-CHEM, catalog number: 02607-BA )
Sodium dihydrogen phosphate dehydrate (NaH2PO4•2H2O) (Sigma-Aldrich, catalog number: 1.06342.1000 )
Disodium hydrogen phosphate dodecahydrate (Na2HPO4•12H2O) (Sigma-Aldrich, catalog number: 04273 )
Potassium hexacyanoferrate (K3[Fe(CN)6]) (Sigma-Aldrich, catalog number: 702587 )
OsO4 (Ted Pella, catalog number: 18451 )
ddH2O
Uranyl acetate (DEUTSCHL AND LUXEMBURGPRODUZIER TSPE ZIA LCHEMIKALIEN PROD UKTION)
Lead acetate (Structure Probe, SPI-CHEM, 1161108)
Ethanol (Sinopharm Chemical Reagent, catalog number: 10009218 )
Epoxypropane (Sinopharm Chemical Reagent, catalog number: 80059118 )
1% (w/v) uranyl acetate in ddH2O and 2% (w/v) uranyl acetate in ddH2O
DDSA (Structure Probe, SPI-CHEM, catalog number: 02827-AF )
SPI-PONTM812 (Structure Probe, SPI-CHEM, catalog number: 02659-AB )
NMA (Structure Probe, SPI-CHEM, catalog number: 02828-AF )
DMP-30 (Structure Probe, SPI-CHEM, catalog number: 02823-DA )
HCl (Sinopharm Chemical Reagent, catalog number: 10011008 )
NaOH (Sinopharm Chemical Reagent, catalog number: 10019762 )
Trizol reagent (Tiangen)
RNase-free DNase I (Sigma-Aldrich)
Oligo(dT)
TRANScript moloney murine leukemia virus reverse transcriptase (Tiangen)
Power SYBRGreen PCR master mix (Applied Biosystems)
Paraformaldehyde-glutaraldehyde Fixative Solution (2%/2.5%), pH 7.2 (see Recipes)
0.1 M phosphate buffer (PB), pH 7.2 (see Recipes)
OsO4-hexacyanoferrate fixative solution (see Recipes)
1% (w/v) uranyl acetate (see Recipes)
2% (w/v) uranyl acetate (see Recipes)
0.2% lead acetate (see Recipes)
Epon 812 (see Recipes)
20 μM E-64d (see Recipes)
Equipment
Water Purification System (Merck, Milli-Q®, model: Advantage A10 )
Art knife (FLYING EAGLE, catalog number: 74-S )
Pincette (Beijing XXBR Technology, catalog number: T5889 )
Diamond knife (DiATOME, catalog number: DU4535 )
Eppendorf Research® plus Pipette 0.5-10 μl
Eppendorf Research® plus Pipette 10-200 μl
Eppendorf Research® plus Pipette 100-1,000 μl
Diaphragm vacuum pump (Tianjin Jinteng Experiment Equipment, catalog number: GM-0.50II )
Shaking incubator (Miulab, catalog number: ES-60 )
Electronic balance (Sartorius AG)
Electro-heating standing-temperature cultivator (Tianjin Taisite Instrument, model: DH4000BII )
Electrothermal constant-temperature dry box (Tianjin Taisite Instrument, model: 202-0AB )
Ultramicrotome (Leica Microsystems, model: EM UC6 )
Eyelash pen
Dyeing machine (Leica Microsystems, model: EM AC20 )
Electron microscope (Hitachi High-Technologies, model: H-7650 )
Bio-Rad CFX96 real-time PCR detection system
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zheng, X., Zhao, C. and Liu, Y. (2018). Examining Autophagy in Plant by Transmission Electron Microscopy (TEM). Bio-protocol 8(20): e3047. DOI: 10.21769/BioProtoc.3047.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Metabolism
Cell Biology > Cell imaging > Electron microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,048 | https://bio-protocol.org/exchange/protocoldetail?id=3048&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Vascular Permeability Assay in Human Coronary and Mouse Brachiocephalic Arteries
LG Liang Guo
RF Raquel Fernandez
AS Atsushi Sakamoto
AC Anne Cornelissen
KP Ka Hyun Paek
PL Parker J. Lee
LW Leah M. Weinstein
CC Carlos J. Collado-Rivera
EH Emanuel Harari
RK Robert Kutys
TS Torie S. Samuda
NS Nicole A. Singer
MK Matthew D. Kutyna
FK Frank D. Kolodgie
RV Renu Virmani
AF Aloke V. Finn
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3048 Views: 6195
Edited by: Jia Li
Reviewed by: sonal arvind patelChen Huei Leo
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
Coronary artery disease remains an important cause of morbidity and mortality. Previous work, including ours, has focused on the role of intraplaque hemorrhage, particularly from immature microvessel angiogenesis, as an important contributor to plaque progression via increases in vascular permeability leading to further intraplaque hemorrhage, which increases red cell membrane-derived free cholesterol in plaque content and inflammatory cell recruitment. Evans Blue Dye (EBD) assay is widely used as a standard assay for vasculature permeability. However, the method has not been established in fresh human coronary artery autopsy samples to evaluate intraplaque microvessel permeability and angiogenesis. In this protocol, we describe a method to evaluate human coronary samples for microvascular permeability, including procedures to perfuse coronary arteries, collection of artery samples for histological analysis and immunostaining as well as the use of appropriate methodology to analyze the images. An optional procedure is also provided for the use of FITC-dextran in mouse model to evaluate vascular permeability. These Evans Blue Dye procedures may be useful in providing functional measure of the endothelium integrity and permeability in both human samples and animal models in various pathological conditions.
Keywords: Coronary artery disease Atherosclerosis Microvessel permeability Evans blue dye FITC-dextran Angiogenesis Intraplaque hemorrhage
Background
Vascular endothelial cells actively regulate the infiltration of plasma constituents and circulating cells, including leukocytes, from blood to sub-endothelial tissues. This mechanism is generally considered to be a critical step of initiation and progression of atherosclerosis (Mundi et al., 2018). The regulation of vascular permeability is achieved through the coordinated opening and closure of endothelial cell-cell junctions. In several diseased conditions, endogenous agents such as histamine, thrombin, and vascular endothelial growth factors (VEGF) dramatically, but reversibly, alter the function and organization of cell-cell junctional complexes in diverse ways, resulting in various degrees of increase in permeability (Dejana et al., 2008). We recently demonstrated a unique mechanism, by which CD163-positive alternative macrophages [M(Hb)] engulf hemoglobin-haptoglobin complexes at the sites of intra-plaque hemorrhage (IPH), promoting the release of vascular endothelial growth factor (VEGF), which further causes internalization of vascular endothelial cadherin (VE-cad) from inter-cellular adherens junctions, thus increasing vascular permeability and leading to atherosclerotic plaque progression (Guo et al., 2018). In the aforementioned study, we conducted a novel technique to assess vascular permeability of human coronary arteries by using Evans Blue Dye (EBD) solution. In the same study, FITC-dextran was used as an alternative indicator in one-year-old apoE mouse model to demonstrate the intraplaque hemorrhage in brachiocephalic artery, due to the small size of the mouse arteries and dye sensitivity required for confocal imaging.
Among the vast range of blue dyes that were created during the 20th century, EBD has been the one with the longest biological history since its first application by Herbert McLean Evans in 1914 (Evans and Schulemann, 1914). EBD is an alkaline synthetic bis-azo (benzidine group) with a molecular weight of 961 Da., and high water solubility, allowing the dye to quickly diffuse throughout the blood stream. Most importantly, when the dye is injected intravenously, it has a high affinity for plasma albumin, giving the dye the ability to remain stable and remain distributed throughout the body for a longer time as a result of a slow excretion rate. All the features of EBD allow it to be an extraordinary agent with multiple potential applications in biomedicine as recently reviewed by Linpeng Yao (Yao et al., 2018). These include but are not limited to estimation of plasma volume, identification of tumors and lymph nodes and as a potential marker of vessel permeability by the use of fluorescence when exposed to green light (Hamer et al., 2002). The principles behind the use of EBD in assays to determine vascular permeability lies in the fact that in normal tissues with normal vascular integrity, albumin is not able to migrate out into the interstitium through the vessel wall endothelial layer. This means that in cases of Albumin-EBD complex, the dye would be limited only to circulation. EBD is relatively non-toxic when used in appropriate concentrations. In vivo experiments using both mice and human subjects have demonstrated that when used in excess, albumin reaches its maximum percent of saturation causing vascular leakage and resulting in a rapid bluish discoloration of tissues (Miles and Miles, 1952). In normal conditions, an adequate permeability barrier is maintained through tight cell-to-cell adherens junctions that are strictly controlled by growth factors, cytokines and other molecules (Radu and Chernoff, 2013). However, in pathological conditions where the integrity of the endothelial layer is affected, plasma proteins including albumin, are able to leak out the vessels as may occur in various disease states. The most common pathophysiological event leading to an increase vascular permeability is acute inflammation which may occur when the vascular wall including the endothelial layer is injured. Vasodilatation, increase in blood flow, disruption of endothelial cell junctions and infiltration of leukocytes are the key players in this process. The EBD-Albumin complex can be seen microscopically as basophilic color in interstitial tissues and indicated increased vascular permeability. In our recent study on endothelial barrier dysfunction after drug-eluting stents implantation, EBD perfusion was performed in rabbit iliac artery stenting model to demonstrate the arteries permeability is associated with poor endothelial VE-cadherin/P120 junctions and higher macrophage infiltration (Harari et al., 2018). Given the advantages of EBD, we decided to use the technique to study the human coronary arteries permeability.
Materials and Reagents
Pipette tips
250 ml Stericup filter unit (Merck, catalog number: SCGPU02RE )
Coverslips (Fisher Scientific, catalog number: 12-543D )
Kimwipes (KCWW, Kimberly-Clark, catalog number: 34155 )
Ultra-fine Syringe (BD, catalog number: 324911 )
Human coronary artery samples selected from freshly collected autopsy specimens (from the CVPath Registry)
[Optional] One-year-old apoE knockout (KO) mouse (THE JACKSON LABORATORY, catalog number: 002052 )
EcoMount (Biocare Medical, catalog number: EM897L )
CoverMount for non-EBD staining, Xylene based (Avantik, catalog number: SL6012-A )
Evans blue dye (Sigma-Aldrich, catalog number: E2129-50G )
FITC-dextran (Sigma-Aldrich, catalog number: 46945 )
5% BSA (Fisher, catalog number: BP1600-100 )
PBS (1x, Ultra Pure Grade, VWR, catalog number: 97063-658 )
Neutral buffered formalin (NBF) (Sigma-Aldrich, catalog number: HT501128 )
Tissue-Tek® O.C.T. Compound (Sakura Finetek, Miles, catalog number: 4583 )
Hydrogen peroxide H2O2 3% (VWR, catalog number: BDH7540-2 )
Dako protein block (Agilent Technologies, DAKO, catalog number: X0909 )
CD163 antibody (Santa Cruz Biotechnology, catalog number: sc-20066 , clone GHI/61)
CD68 antibody (Dako, clone Kp1)
Von Willebrand factor (vWF) antibody (SDIX, Strategic BioSolutions, catalog number: S4003GND1 )
Hypoxia induced factor 1α (HIF1α) antibody (Novus Biologicals, catalog number: NB100-105 )
Vascular endothelial growth factor-A (VEGF-A) antibody (BioGenex, catalog number: PU483-UP )
VE-cadherin antibody (R&D Systems, catalog number: AF1002 , dilution 1:100, and BD Biosciences, catalog number: 555661 )
Vascular cell adhesion protein (VCAM) antibody (Abcam, catalog number: ab134047 )
CD3 antibody (Roche Diagnostics, catalog number: 790-4341 , prediluted)
Biotinylated goat anti-rabbit, horse anti-mouse, and rabbit anti-goat (Vector Laboratories, catalog numbers: BA-1000 , BA-2000 , BA-5000 , respectively)
Alexa Flour 488 and 555 streptavidin (Thermo Fisher Scientific, InvitrogenTM, catalog numbers: S32354 and S32355 , respectively)
DAPI (Thermo Fisher Scientific, InvitrogenTM, catalog number: D3571 )
2-methylbutane (Spectrum Chemical Manufacturing, catalog number: M1246 )
Liquid nitrogen
20% paraformaldehyde (Electron Microscopy Sciences, catalog number: 15713-S )
Acetone (Fisher Scientific, catalog number: A929-1 )
Liquid blocker (Ted Pella, catalog number: 22309 )
Glacial acetic acid (Fisher Scientific, catalog number: A38-212 )
Hematoxylin and Eosin
Xylene, Reagent grade/ACS (Avantik, catalog number: RS4050 )
Mounting media/Permount (Fisher Scientific, catalog number: SP15-500 )
Deionized water from laboratory
Mayer’s Hematoxylin Solution (Astral Diagnostics, catalog number: 7020 )
Gill 3 (Sigma, catalog number: GHS3128 )
Eosin-phloxine stain (Astral Diagnostics, catalog number: 7010 )
100% reagent alcohol (Avantik, catalog number: RS4029 )
95% reagent grade alcohol (Avantik, catalog number: RS4031 )
Ammonium hydroxide, ACS grade (Sigma-Aldrich, catalog number: A6899 )
Evans blue dye solution (see Recipes)
Equipment
Pipettes
Belly button shaker (IBI Scientific)
Axio Scan.Z1 digital slide scanner (Carl Zeiss, catalog number: Axio Scan.Z1 )
Bright OTF 5000 microtome cryostat (Hacker Instruments, Hacker, catalog number: OTF 5000 ) using sectioning blades (Thermo Fisher Scientific, catalog number: 3152735 )
CryoJane tape transfer system (Leica Biosystems, catalog number: 39475205 )
LSM 800 confocal laser scanning microscope (Carl Zeiss, catalog number: LSM 800 )
Olympus BX51 microscope (Olympus, model: BX51 )
RNAscope Probe-Hs-CD163-C2 (Advanced Cell Diagnostics, catalog number: 417061-C2 )
RNAscope Probe-Hs-VEGFA (Advanced Cell Diagnostics, catalog number: 423161 )
TLE series ultra-low freezer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: TLE60086A )
Stemi DV4 Stereo dissecting microscope (ZEISS, model: Stemi DV4 )
Software
HALO Image Analysis Platform (Indica Labs) version 2.0
Zen Blue 2012 (Carl Zeiss) version 2.0
Zen Black 2012 (Carl Zeiss) version 2.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Guo, L., Fernandez, R., Sakamoto, A., Cornelissen, A., Paek, K. H., Lee, P. J., Weinstein, L. M., Collado-Rivera, C. J., Harari, E., Kutys, R., Samuda, T. S., Singer, N. A., Kutyna, M. D., Kolodgie, F. D., Virmani, R. and Finn, A. V. (2018). Vascular Permeability Assay in Human Coronary and Mouse Brachiocephalic Arteries. Bio-protocol 8(20): e3048. DOI: 10.21769/BioProtoc.3048.
Download Citation in RIS Format
Category
Cell Biology > Tissue analysis > Physiology
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,049 | https://bio-protocol.org/exchange/protocoldetail?id=3049&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transcytosis Assay for Transport of Glycosphingolipids across MDCK-II Cells
MG Maria Daniela Garcia-Castillo
Wayne I. Lencer
Daniel J.-F. Chinnapen
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3049 Views: 6445
Edited by: Ralph Thomas Boettcher
Reviewed by: Alexandros KokotosNaoshad Muhammad
Original Research Article:
The authors used this protocol in May 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2018
Abstract
Absorption and secretion of peptide and protein cargoes across single-cell thick mucosal and endothelial barriers occurs by active endocytic and vesicular trafficking that connects one side of the epithelial or endothelial cell (the lumen) with the other (the serosa or blood). Assays that assess this pathway must robustly control for non-specific and passive solute flux through weak or damaged intercellular junctions that seal the epithelial or endothelial cells together. Here we describe an in vitro cell culture Transwell assay for transcytosis of therapeutic peptides linked covalently to various species of the glycosphingolipid GM1. We recently used this assay to develop technology that harnesses endogenous mechanism of lipid sorting across epithelial cell barriers to enable oral delivery of peptide and protein therapeutics.
Keywords: Transcytosis Endocytic sorting Glycosphingolipids Epithelial barriers Drug delivery
Background
Transport of large molecules across the single-cell thick epithelial barriers lining mucosal surfaces and tight endothelial barriers lining vessels serving the heart muscle and brain occurs by an endocytic process that connects one side of these polarized cells with the other. This process is termed transcytosis (Garcia-Castillo et al., 2017). The absorption and secretion of immunoglobulins by receptor-mediated endocytosis and vesicular transport across the mucosa of the alimentary and respiratory tracts most famously typifies this process. Interest in transcytosis is also stimulated by the potential to harness this pathway for the delivery of therapeutic peptides and proteins across tight epithelial and endothelial barriers (Thuenauer et al., 2017).
Transcytosis is an active (ATP-driven) process. In some cases, transport of large molecules across tight epithelial and endothelial barriers can occur by passive diffusion around the cell through intercellular tight junctions (Fung et al., 2018). But aside from this small level of paracellular leakiness, physiologic meaningful paracellular transport of large molecules around cells occurs only when intercellular tight junctions are dismantled–usually under pathologic conditions. Non-specific and low levels of transcellular transport for large solutes may also occur by fluid-phase endocytosis and miss-sorting of cargo into transcytotic vesicles rather than into the late endosome/lysosome pathway, which receives the bulk of cargo internalized by non-receptor mediated mechanisms. Thus, any assay for transcytosis across healthy epithelial or endothelial barriers in vitro or in vivo needs to control for these confounding non-specific pathways.
We have recently discovered that the endogenous sorting of glycosphingolipids across epithelial barriers can be harnessed for oral delivery of therapeutic peptides in vivo (Garcia-Castillo et al., 2018). Here we describe the in vitro assay using cultures polarized epithelial cells grown on transwell filters that we used to develop the technology that co-opts these endogenous mechanisms of lipid sorting for this purpose. The test compounds used to harness glycolipid sorting are modified to contain a biotin residue to allow for biochemical capture and a fluorophore for detection. Transwell inserts are composed of an inner chamber made with a permeable polycarbonate membrane support where the cells are seeded (Figure 1). After 3-7 days the epithelial cells assemble into a single cell thick monolayer with sealed tight junctions among cells. As such, the inner chamber of the transwell is exposed to the apical membrane of the epithelial monolayer and models the lumenal surface and can hold 200 µl of solution. The outer chamber–the chamber below the permeable support–is exposed to the basolateral surface of the monolayer and models the serosal surface of the epithelial barrier. This chamber holds 1 ml of basolateral solution. The assembly of the monolayer into a “tight” epithelial barrier with sealed functional tight junctions is routinely measured by passive resistance to small ion transport (TER–Transepithelial Resistance) measured by standard direct current electrophysiology or using the alternate current based machine EVOM. Test compounds are added to the apical chamber, and the assay is allowed to proceed to allow for transport across the barrier, where the basolateral chamber is then sampled for the transcytosed analyte using streptavidin-coated beads (Figure 2).
Figure 1. Schematic representation of MDCK-II transwell inserts and transcytosis assay
Figure 2. Capture and read of biotinylated peptide–fusions from basolateral media (Adapted from Figure 1A in Garcia-Castillo et al., 2018. Creative Commons Attribution License)
Mid-picomolar sensitivity can be achieved with this assay. Our basic approach can be used to measure transport by other molecules that enter the transcytotic pathway–such as for IgG that binds to the Fcγ-receptor FcRn that traffics in both directions across polarized epithelial monolayers (Nelms et al., 2017). The strength of our assay is the ability to directly, quantitatively, and sensitively measure the amount of compound transcytosed. Non-specific paracellular leak between cells versus real transport through cells is controlled in several ways, such as by using an analyte that cannot engage the transcytotic pathway (in our case the reporter peptide lacking fusion to the glycolipid carrier, or by fusion to a glycolipid with ceramide structure that cannot enter the transcytotic pathway), or by inhibiting endocytosis or transcytosis via a 4 °C temperature block, by chemical inhibition of endocytosis using Dyngo, and by siRNA knockdown of genes responsible for transcytosis as described in Garcia-Castillo et al. (2018).
Materials and Reagents
Notes:
Material and reagents are stored as per the manufacturer’s recommendation.
Fluorescent peptides and glycosphingolipid-peptide fusions are used as described in Garcia-Castillo et al., 2018. The assay requires the presence of both a fluorophore and a biotin covalently attached to compound you want to measure (see Figure 3). Peptide fusions containing biotin and fluorophore attached to ganglioside GM1 were synthesized in-house using specialized methods described in (Garcia-Castillo et al., 2018). Precursor peptides were synthesized by New England Peptide (Gardner, MA, USA), and gangliosides were purchased from Dr. Sandro Sonnino (U. Milan, Italy). However, in theory, any macromolecule (peptide, protein, nucleic acid or chemical) containing both a fluorophore and biotin will work in this assay. An example compound is shown below. Here, lower-cased amino acids are depicting D-isomers. Since glycine (shown as upper-cased G) does not have chirality, the peptide essentially contains no L-amino acids that can be susceptible to degradation in vivo.
Figure 3. Structure of peptide-lipid fusion constructs used in transcytosis assay
Pipette tips (USA Scientific, catalog numbers: 1126-7810 , 1120-8810 , 1121-3810 )
0.4 μm pore size Transwell® inserts (Corning, catalog number: 3413 )
Note: Transwell® plates are kept at room temperature.
96-well Assay Plate (No Lid, Black Flat Bottom, Non-treated, polystyrene) (Corning, Costar®, catalog number: 3916 )
Aluminium-foil (Fisher Scientific, FisherbrandTM, catalog number: S05356A )
MDCK-II cells (Parental line from American Type Culture Collection) (ATCC, catalog number: CCL-34 ) (Kind gift from Dr. Steven Claypool)
Fatty acid-free bovine serum albumin (Sigma-Aldrich, catalog number: A6003-10G ) (lyophilized powder, essentially fatty acid free)
PierceTM Streptavidin magnetic beads (Thermo Fisher Scientific, catalog number: 88817 )
Note: Beads are stored at 4 °C per the manufacturer's recommendation.
Formamide (Sigma-Aldrich, catalog number: F9037-100ML )
Dimethylformamide (DMF) (Sigma-Aldrich, catalog number: 227056 )
Biotin (Sigma-Aldrich, catalog number: B4501-1G )
DMEM 4.5 g/L D-glucose (Corning, catalog number: 10-013-CVR )
Pen/Strep, 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 15140148 )
Fetal Bovine Serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: A3160502 )
Tris base (Sigma-Aldrich, catalog number: T1503-1KG )
NaCl (Sigma-Aldrich, catalog number: S9625-10KG )
Tween 20 (Sigma-Aldrich, catalog number: P2287-500ML )
0.25% Trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25200072 )
PBS (Thermo Fisher Scientific, GibcoTM)
EDTA (Sigma-Aldrich, catalog number: E4884-500G )
MDCK-II complete growth media (see Recipes)
Basolateral solution (see Recipes)
Apical solution (see Recipes)
TBS 10x (see Recipes)
1x TBS-T (see Recipes)
0.5 M EDTA pH 8.0 (see Recipes)
Elution buffer (see Recipes)
Equipment
Portable Pipet-Aid® XP Pipette Controller (Drummond Scientific, model: 4-000-101 )
Incubator Forma Scientific CO2 water-jacketed incubator (Thermo Fisher Scientific, model: FormaTM Series II , catalog number: 3110)
Centrifuge (Eppendorf, model: 5415C )
EVOM2 Epithelial Voltohmmeter (World Precision Instruments, model: EVOM2 )
TECAN Spark multimode microplate reader (Tecan Trading, model: Spark® )
MagneSphere® Technology Magnetic Separation Stand (Promega, catalog number: Z5342 )
Sonicator (Stainless Steel AquaSonic Ultrasonic cleaner, VWR, model: 50T )
Software
GraphPad Prism 7
GraphPad Software 7825 Fay Avenue, Suite 230 La Jolla, CA 92037 USA (https://www.graphpad.com/scientific-software/prism/)
Procedure
Day 1: Plating and polarizing cells
Trypsinization
Aspirate MDCK-II growth media from the stock cell culture flask used for passaging.
For a T-75 flask of MDCK-II cells, add 5-10 ml of warmed, sterile PBS. Gently tilt/rotate flask to wash the cells. Remove PBS.
For a T-75 flask, add 3 ml of 0.25% Trypsin-EDTA. Tilt/rotate flask to make sure cell surface is evenly coated.
Return to a 37 °C incubator with 5% CO2 under humidified conditions for 5-10 min.
Observe under a light microscope with phase contrast. If cells are properly detached, they will appear round and floating in suspension.
Collect cell suspension in conical tube and pipet cells 6-8 times up and down. No clumps should be observed. Cell suspension should be a homogeneous mixture.
Add MDCK-II cells at a density of 200,000 cells in 200 μl in complete growth media (see Recipes) to the apical side of a Transwell® insert (12-well 0.4 μm pore size Transwell®-65 mm). In addition, 1 ml complete growth media is added to the basolateral chamber.
Two Transwell® inserts are prepared for (Untreated) controls, 2 Transwell® inserts for reporter peptide, and 2 Transwell® per glycosphingolipid-peptide fusion tested.
Each condition is tested as biological duplicates (i.e., 2 Transwell® inserts per condition). Experiments must always include untreated and reporter-peptide controls.
Incubate the plate for 2-3 days to allow for polarization at 37 °C with 5% CO2 under humidified conditions.
Day 3: Preparation of testing glycosphingolipid compounds
Centrifuge the tube containing lyophilized compound at 13,000 rpm (~13,800 x g) for 3 min to pellet the material to the bottom of tube.
Add 1 part volume of DMF (actual volume depends on stock concentration–for our compounds, this is ~60 μl), sonicate for 30-60 sec, followed by ~5 sec vortex.
Notes:
Sonication is done in a bath sonicator (VWR, AquaSonic, model 50T ).
You want to reach a high final concentration in the ~50-200 μM range (in a tube containing approximately 100 μg of lyophilized peptide [MW ~2,103], add 50 μl of DMF and 100 μl of water to obtain a stock solution in the ~50-200 μM range). The concentration of all test compounds is determined using NanoDrop (For the Alexa Flour 488 used in our studies, we use absorbance at 495 nm).
The solution may appear cloudy and orange-red at this point.
Add 2 parts H2O (for example 120 μl water to give a final volume of 180 μl) followed by a quick 5 sec vortex to reach a final 33% DMF in H2O.
Notes:
The solution should be bright green and clear of particulates. If it is orange, then add either more DMF or H2O until it turns green. (The color change we observed is for an Alexa Flour 488 attached to the reporter peptide)
At this point, this stock solution will be used to make the final dilution into “Apical” media for adding onto cells.
To prepare this Apical test solution, dilute the appropriate volume of stock into Apical Solution (see Recipes) to reach a final concentration of 0.1 μM.
Note: The goal is to have a final 1:1 ratio of lipid to dfBSA.
Transcytosis in MDCKII cells
Check electrical resistance of MDCK-II Transwell® inserts after 2-3 days using EVOM Epithelial Voltohmmeter to measure integrity of tight junctions.
Note: Acceptable electrical resistances of MDCK-II monolayers used for transcytosis experiments is in the 250Ω-300Ω range.
Prepare apical and basolateral solutions (see Recipes).
Wash transwells 2 times using serum-free DMEM. Replace media with apical (200 μl) and basolateral (1 ml) solutions in the respective chamber.
Allow cells to equilibrate for 15 min in a 37 °C/5% CO2 cell culture incubator.
Replace apical chamber with 200 μl apical solution containing 0.1 μM reporter peptide or 0.1 μM glycosphingolipid fusion.
Note: Reporter peptide and glycosphingolipid fusion stocks range from 30 μM to 150 μM in 33% DMF/66% H2O.
Incubate for 3 h in a 37 °C/5% CO2 cell culture incubator.
To quantify transcytosed peptide and lipid-peptide fusions, collect basolateral media in pre-labeled Eppendorf tubes and proceed to streptavidin pull-down assay.
To calculate the apparent permeability coefficient (PAPP, cm/sec), apical chamber solution is also collected in pre-labeled Eppendorf tubes. A standard curve ranging from 0 nM to 200 nM is used to interpolate concentration of peptide or lipid-peptide fusion in apical chamber after 3 h.
Streptavidin Pull-down Assay of basolateral media samples
Wash Streptavidin magnetic beads 3 times with TBS-T.
Notes:
Beads are never vortexed. They are brought into solution in stock tube by gentle inverting.
Ten microliter beads are needed per sample.
Example: For 12 samples, place 120 μl Streptavidin beads in an Eppendorf tube and wash 3 times each with 1 ml TBS-T using magnetic rack.
Resuspend 10 μl beads in 50 μl TBS then add to 1 ml basolateral sample
Example: For 12 samples, resuspend 120 μl Streptavidin beads by adding 600 μl TBS. Then, add 50 μl Streptavidin beads to each basolateral sample.
Incubate basolateral samples with streptavidin beads overnight at 4 °C with head-over rotation covered in foil.
Day 4: Elution and read-out of basolateral samples
Collect the beads using a magnetic rack and wash 3 times with TBS-T.
Note: Each wash is done with 1 ml TBS-T and beads mixed by inverting.
Bound peptide or lipid-peptide fusions are eluted from beads by addition of 220 μl elution buffer (See Recipes) and boiling.
Notes:
Invert the beads to ensure that they are in solution.
After beads are in solution, boil for 2 min at 65 °C in a heat block.
After boiling, collect the beads using a magnetic rack.
Pipet 100 μl of each sample x 2 (technical replicates) on a black 96-well plate.
Fluorescence is read on a TECAN Spark microplate reader for Alexa-488 channel and against a standard curve for each compound.
Settings:
Sample standard curves (Figure 4)
Figure 4. Sample standard curves for peptide (blue) and lipid-peptide fusion (red) used to calculate the amount of transcytosed compound. Plotted are the mean ± SEM of 3 technical replicates.
A basolateral standard curve for each compound being tested is made in elution buffer ranging from 0 pM to 1,000 pM.
Make 1 μM solutions of peptide and lipid-peptide stocks in elution buffer.
Make 1 ml of 10 nM solutions (10 μl 1 μM + 990 μl elution buffer).
Make serial dilutions with elution buffer beginning with 1,000 pM:
1,000 pM = 100 μl 10 nM + 900 μl elution buffer
500 pM = 500 μl 1,000 pM + 500 μl elution buffer
250 pM = 500 μl 500 pM + 500 μl elution buffer
125 pM = 500 μl 250 pM + 500 μl elution buffer
62.5 pM = 500 μl 125 pM + 500 μl elution buffer
31.5 pM = 500 μl 62.5 pM + 500 μl elution buffer
15.6 pM = 500 μl 31.5 pM + 500 μl elution buffer
0 pM = elution buffer
Data analysis
GraphPad Prism software is used to calculate the concentration of lipid-peptide fusion. As detailed above, a standard curve for each test compound is used to relate fluorescence intensity to a known concentration of peptide or lipid-peptide fusion. Absorbance at 495 nm is initially used to calculate stock concentrations. For detailed instructions on graphing and interpolating standard curves, the reader is referred to the GraphPad software website.
To calculate the apparent permeability coefficient (PAPP, cm/sec) a standard curve ranging from 0 nM to 200 nM is used to interpolate concentration of peptide or lipid-peptide solution remaining in the apical chamber after a 3 h continuous incubation.
The apparent permeability coefficient (PAPP, cm/sec) is calculated across cell monolayers grown in transwells based on the appearance rate of lipid-peptide fusions in the basolateral compartment over time:
Papp (cm/sec) = [VD/(A x MD)] x (DMR/Dt)
Papp (cm/sec) = [cm3/(cm2 x mol)] x (mol/sec)
VD = apical (donor) volume (cm3) (e.g., 0.2 ml = 0.2 cm3)
MD = apical (donor) amount (mol)
A = membrane surface area (cm2) of apical (donor) chamber (i.e., transwell surface area = 0.33 cm2 in this protocol)
DMR/Dt = the amount of compound (mol) transferred to the basolateral (receiver) compartment over time (sec).
Notes
This protocol is also used routinely in our lab with human intestinal T84 cells and human colonic Caco-2 cells.
Tight junction integrity must be confirmed using EVOM measurements.
To dissolve reporter peptide and glycosphingolipid-reporter peptide fusions first add DMF and sonicate for 30-60 sec, then add water.
Assay is done in serum-free DMEM.
The molar ratio 1:1 of compound to defatted-BSA is used.
When preparing compound solutions, keep solutions at 37 °C and never place diluted lipids on ice as they may form micelles.
A typical control for paracellular leak is a 4 °C temperature block to stop endocytosis/transcytosis machinery.
We use this assay in our lab to test the effect of gene silencing (using esiRNAs) and small molecule drugs (as is described for Dyngo-4a in Garcia-Castillo et al., 2018).
Using this assay, we performed structure-function studies of glycosphingolipid-peptide fusions containing modifications to the ceramide moiety. Also, using this assay, we tested for transcytosis of the incretin hormone GLP-1 (glucagon-like peptide 1).
Recipes
MDCK-II complete growth media
DMEM
10% FBS
1x Pen/Strep
Store at 4°C
Basolateral solution (40 ml)
40 ml DMEM
400 mg defatted-BSA (df-BSA) (final concentration: 1% [w/v])
Prepared fresh on the day of assay
Apical solution (40 ml)
40 ml DMEM
24.6 μl basolateral solution (Recipe 2, df-BSA final concentration: 0.1 μM)
Prepared fresh on the day of assay
TBS 10x (1 L)
24 g Tris base
88 g NaCl
Dissolve in 900 ml distilled water and pH 7.4
Add distilled water to a final volume of 1 L
Store at room temperature
1x TBS-T (1 L)
100 ml 10x TBS
1 ml Tween 20
900 ml distilled water
Store at room temperature
0.5 M EDTA pH 8.0 (1 L)
186.1 g Na2EDTA to 800 ml MilliQ H2O
Add NaOH to reach pH 8.0
Add MilliQ H2O up to 1 L
Elution buffer (95% Formamide, 10 mM EDTA, 0.4 mg/ml biotin) (100 ml)
95 ml 100% formamide
2 ml 0.5 M EDTA, pH 8.0
40 mg biotin
3 ml MilliQ H2O
Acknowledgments
This project was supported by an NIH F-32 DK111072-01 to M.D.G-C; DK084424, DK048106, DK104868, and an unrestricted innovator grant from Novo Nordisk to W.I.L; DK104868 to D.C. We acknowledge the Harvard Digestive Disease Center DK034854. We are grateful to all members of the Lencer and Chinnapen laboratories for their helpful discussions.
Competing interests
The authors declare that there are no conflicts of interest or competing interests.
References
Fung, K. Y. Y., Fairn, G. D. and Lee, W. L. (2018). Transcellular vesicular transport in epithelial and endothelial cells: Challenges and opportunities. Traffic 19(1): 5-18.
Garcia-Castillo, M. D., Chinnapen, D. J. and Lencer, W. I. (2017). Membrane transport across polarized epithelia. Cold Spring Harb Perspect Biol 9(9): a027912.
Garcia-Castillo, M. D., Chinnapen, D. J., Te Welscher, Y. M., Gonzalez, R. J., Softic, S., Pacheco, M., Mrsny, R. J., Kahn, C. R., von Andrian, U. H., Lau, J., Pentelute, B. L. and Lencer, W. I. (2018). Mucosal absorption of therapeutic peptides by harnessing the endogenous sorting of glycosphingolipids. Elife 7: e34469.
Nelms, B., Dalomba, N. F. and Lencer, W. (2017). A targeted RNAi screen identifies factors affecting diverse stages of receptor-mediated transcytosis. J Cell Biol 216(2): 511-525.
Thuenauer, R., Muller, S. K. and Romer, W. (2017). Pathways of protein and lipid receptor-mediated transcytosis in drug delivery. Expert Opin Drug Deliv 14(3): 341-351.
Copyright: Garcia-Castillo et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Garcia-Castillo, M. D., Lencer, W. I. and Chinnapen, D. J. (2018). Transcytosis Assay for Transport of Glycosphingolipids across MDCK-II Cells. Bio-protocol 8(20): e3049. DOI: 10.21769/BioProtoc.3049.
Garcia-Castillo, M. D., Chinnapen, D. J., Te Welscher, Y. M., Gonzalez, R. J., Softic, S., Pacheco, M., Mrsny, R. J., Kahn, C. R., von Andrian, U. H., Lau, J., Pentelute, B. L. and Lencer, W. I. (2018). Mucosal absorption of therapeutic peptides by harnessing the endogenous sorting of glycosphingolipids. Elife 7: e34469.
Download Citation in RIS Format
Category
Cell Biology > Cell-based analysis > Transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
305 | https://bio-protocol.org/exchange/protocoldetail?id=305&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Ag Cross-presentation and in vivo Ag Cross-presentation by Dendritic Cells in the Mouse
MG Mallika Ghosh
LS Linda H Shapiro
Published: Vol 2, Iss 24, Dec 20, 2012
DOI: 10.21769/BioProtoc.305 Views: 22780
Original Research Article:
The authors used this protocol in Jun 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2012
Abstract
Antigen cross presentation is important for effective immune responses to tumors and viral infections. Dendritic cells are professional antigen presenting cells and are unique in their ability to cross-present exogenous antigens on MHC class I molecules and activate antigen specific cytotoxic T cells. This protocol describes antigen cross presentation by dendritic cells (DCs) (bone marrow derived DCs and splenic DCs) in an in vitro and in an in vivo assay system using soluble ovalbumin protein.
Keywords: Antigen cross presentation BMDC Splenic DC B3Z Soluble OVA antigen Dendritic cell isolation In vivo cross-presentation OVA OT-1 T cell proliferation
Materials and Reagents
Anti-Mouse CD45.1-APC (eBiosciences, catalog number: 17-0453-81 )
Rat anti-mouse CD8-PerCpCy5.5 (Biolegend, catalog number: 100733 )
Anti-mouse CD3-PE (Biolegend, catalog number: 100307 )
Anti-mouse CD19-PE (Biolegend, catalog number: 115507 )
Note: The above antibodies have been tested by the authors but may be substituted with antibodies conjugated with other fluorochromes obtained from other manufacturers.
B3Z CD8+ T cell hybridoma is a kind gift from Dr. PK Srivastava (University of Connecticut Health Center)
RPMI Medium 1640 + L-Glutamine (Life Technologies, catalog number: 11875-093 )
Phosphate buffered saline (PBS) (Life Technologies, Gibco®, catalog number: 10010-023 )
Fetal bovine serum (FBS) (Hyclone, catalog number: SH303397.03 )
RBC lysis buffer (Sigma-Aldrich, catalog number: R7757 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M7522 )
Antibiotic-Pen-Strep (Life Technologies, Gibco®, catalog number: 15140-122 )
Nonidet-P40 (NP40 (US Biological, catalog number: N3500 )
CPRG Chlorophenol red-D-galactopyranoside (Roche Diagnostics, catalog number: 10884308001 )
Endograde ovalbumin (Biovendor, catalog number: 321000 )
CFSEcarboxyfluorescein diacetate, succinimidyl ester (Life Technologies, Molecular Probes®, catalog number: C34554 )
CD8a (Ly-2) microbeads (Miltenyi Biotec, catalog number: 130-049-401 )
Anti-PE MicroBeads (Miltenyi Biotec, catalog number: 130-048-801 )
CD11c MicroBeads, mouse (Miltenyi Biotec, catalog number: 130-052-001 )
Recombinant GM-CSF (Pierce Biotechnology, catalog number: RMGMCSF20 )
16% paraformaldehyde (Electron Microscopy Sciences, catalog number: 15710 )
L-glutamine
BMDC medium (see Recipes)
Soluble ovalbumin protein solution (see Recipes)
FACS buffer (see Recipes)
MACS buffer (see Recipes)
CPRG solution (see Recipes)
CPRG lysis solution (see Recipes)
CFSE dye solution (see Recipes)
Equipment
LSR II flow cytometer (Becton-Dickinson)
MACS Multi Stand (Mitenyi Biotec, catalog number: 005126 )
Microplate reader (Bio-Rad Laboratories)
FlowJo software (Tree Star)
96-well plates round bottom (Corning Incorporated, catalog number: 3799 )
96-well plates flat bottom (Cell Star, catalog number: 655180 )
100 mm TC-Treated culture dishes (Corning Incorporated, catalog number: 430293 )
40 μm cell strainer (BD Biosciences, Falcon®, catalog number: 352340 )
FACS tube, polystyrene (BD Biosciences, Falcon®, catalog number: 352054 )
Note: Perform the entire method with sterile pyrogen free dishes or plates, pipettes, tips, microfuge and conical tubes. Autoclave and filter all the buffers through 0.22 μm filter.
Incubator
10 mm culture dish
5 ml conical tube
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ghosh, M. and Shapiro, L. H. (2012). In vitro Ag Cross-presentation and in vivo Ag Cross-presentation by Dendritic Cells in the Mouse. Bio-protocol 2(24): e305. DOI: 10.21769/BioProtoc.305.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Dendritic cell
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,050 | https://bio-protocol.org/exchange/protocoldetail?id=3050&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
HIVGKO: A Tool to Assess HIV-1 Latency Reversal Agents in Human Primary CD4+ T Cells
Emilie Battivelli
EV Eric Verdin
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3050 Views: 6788
Edited by: Marielle Cavrois
Reviewed by: Kara Lassen
Original Research Article:
The authors used this protocol in May 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2018
Abstract
While able to suppress HIV replication in HIV infected individuals, combination antiretroviral therapy (ART) fails to eliminate viral latent reservoir, which consists in integrated transcriptional silenced HIV provirus. So far, identification of latently-infected cells has relied on activating cells to induce expression of HIV proteins which can then be detected. Unfortunately, this activation significantly changed the cell phenotype. We developed a novel HIV reporter, named HIVGKO, that allows the purification of latently-infected cells in absence of reactivation. Indeed, latent cells can be identified by expression of the EF1a-driven mKO2 and lack of expression of the LTR-driven csGFP. This protocol can be used to study the effectiveness of LRAs (Latency Reversal Agents) in reactivating latent HIV in primary cells.
Keywords: HIV-1 latency Latency reversal Latency reversal agents Reservoirs Human cells Dual-fluorescence reporter HIVGKO Flow cytometry
Background
The new version of dual-labeled virus (HIVGKO), contains a codon-switched eGFP (csGFP) under the control of the HIV-1 promoter in the 5’ LTR and a distinct, unrelated fluorescent protein mKO2 under the control of the cellular elongation factor one alpha promoter (EF1α). It is important to use unrelated fluorescent proteins in those reporters due to recombination issues when using fluorescent proteins genetically related. Productively infected cells are thus mostly csGFP+ mKO2+ (some might only be GFP+), while latently infected cells are csGFP- mKO2+. Flow cytometers such as the sorter AriaII allows the purification of pure infected population (productive, latent and/or uninfected), while the analyzer LSRII allows for the assessment of the transcriptional activation of the HIVGKO LTR within a short time frame post-infection.
Materials and Reagents
Production of HIVGKO in HEK293T cells
182 cm2 tissue culture flask (VWR, catalog number: 10062-864 )
Tips
0.1-10 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-681-440 )
1-200 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-502 )
101-1,000 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-509 )
Pipettes
2 ml aspirating pipettes (VWR, catalog number: 414004-265 )
5 ml (VWR, catalog number: 89130-896 )
10 ml (VWR, catalog number: 89130-898 )
25 ml (VWR, catalog number: 89130-900 )
15 ml conical tube (VWR, catalog number: 89039-666 )
1.5 ml Eppendorf tubes (Fisher Scientific, catalog number: 05-408-129 )
50 ml conical tube (VWR, catalog number: 89039-658 )
UltraClear Centrifuge Tubes 25 x 89 mm (Beckman Coulter, catalog number: 344058 )
50 ml centrifuge tube filtration (VWR, catalog number: 89220-710 )
HEK293T cells (ATCC, catalog number: CRL-3216 )
Plasmids:
HIVGKO (Battivelli et al., 2018)
HIV dual-tropic envelope (pSVIII-92HT593.1) (NIH AIDS Reagent Program, catalog number: 3077 )
DMEM (Corning, catalog number: 10-013-CVR )
RPMI (Corning, catalog number: 10-040-CVR )
Fetal bovine serum (FBS) (Gemini Bio-Products, BenchMarkTM, catalog number: 100-106 )
100x penicillin/streptomycin (Corning, catalog number: 30-002-CI )
1x PBS (Corning, catalog number: 21-031-CVR )
Trypsin-EDTA (Corning, catalog number: 25-053-CI )
Cell culture water (Corning, catalog number: 25-055-CV )
Chloroquine diphosphate salt (Sigma-Aldrich, catalog number: C6628 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Dextrose (Fisher Scientific, catalog number: BP350-1 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Sodium phosphate dibasic (Na2HPO4) (Fisher Scientific, catalog number: BP332-500 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C1016 )
Nuclease-free H2O (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9937 )
FlaQ Assay reagents (Gesner et al., 2014)
25 mM chloroquine (see Recipes)
2x HBSS buffer (see Recipes)
2 M CaCl2 (see Recipes)
Isolation of human primary CD4+ T cells
182 cm2 tissue culture flask (VWR, catalog number: 10062-864 )
Tips
0.1-10 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-681-440 )
1-200 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-502 )
101-1,000 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-509 )
Pipettes
2 ml aspirating pipettes (VWR, catalog number: 414004-265 )
5 ml (VWR, catalog number: 89130-896 )
10 ml (VWR, catalog number: 89130-898 )
25 ml (VWR, catalog number: 89130-900 )
50 ml conical tube (VWR, catalog number: 89039-658 )
Blood or LRC
RosetteSepTM Human CD4+ T cell enrichment cocktail (STEMCELL Technologies, catalog number: 15062 )
Histopaque 1077 (Sigma-Aldrich, catalog number: 10771-500ML )
RPMI (Corning, catalog number: 10-040-CVR )
Fetal bovine serum (FBS) (Gemini Bio-Products, BenchMarkTM, catalog number: 100-106 )
100x penicillin/streptomycin (Corning, catalog number: 30-002-CI )
1x PBS (Corning, catalog number: 21-031-CVR )
Ammonium chloride (NH4Cl) (Sigma-Aldrich, catalog number: A9434-500G )
Potassium bicarbonate (KHCO3) (Sigma-Aldrich, catalog number: 237205-100G )
Ethylenediaminetetraacetic acid disodium salt dihydrate (Na2EDTA) (Sigma-Aldrich, catalog number: E6635-100G )
Recombinant human Interleukin-2 (R&D Systems, catalog number: 202-IL-010 )
AKC lysis buffer (see Recipes)
Infection of human primary CD4+ T-cells with HIVGKO
182 cm2 tissue culture flask (VWR, catalog number: 10062-864 )
Tips
0.1-10 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-681-440 )
1-200 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-502 )
101-1,000 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-509 )
Pipettes
2 ml aspirating pipettes (VWR, catalog number: 414004-265 )
5 ml (VWR, catalog number: 89130-896 )
10 ml (VWR, catalog number: 89130-898 )
25 ml (VWR, catalog number: 89130-900 )
50 ml conical tube (VWR, catalog number: 89039-658 )
15 ml conical tube (VWR, catalog number: 89039-666 )
96-well plate V-bottom (Thermo Fisher Scientific, NuncTM, catalog number: 249570 ) and lids (Thermo Fisher Scientific, catalog number: 263339 )
Pipetting reservoirs (VWR, catalog number: 89094-662 )
Isolated CD4+ T cells
Viral stock
RPMI (Corning, catalog number: 10-040-CVR )
Fetal bovine serum (FBS) (Gemini Bio-Products, BenchMarkTM, catalog number: 100-106 )
100x penicillin/streptomycin (Corning, catalog number: 30-002-CI )
Recombinant human Interleukin-2 (R&D Systems, catalog number: 202-IL-010 )
Dynabeads human T-activator CD3/CD28 (Thermo Fisher Scientific, catalog number: 111.32D )
Sorting cells
Tips
0.1-10 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-681-440 )
1-200 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-502 )
101-1,000 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-509 )
Pipettes
2 ml aspirating pipettes (VWR, catalog number: 414004-265 )
5 ml (VWR, catalog number: 89130-896 )
10 ml (VWR, catalog number: 89130-898 )
25 ml (VWR, catalog number: 89130-900 )
50 ml conical tube (VWR, catalog number: 89220-710 )
15 ml conical tube (VWR, catalog number: 89039-666 )
96-well plate V-bottom (Thermo Fisher Scientific, NuncTM, catalog number: 249570 ) and lids (Thermo Fisher Scientific, catalog number: 263339 )
Falcon round-bottom 5 ml tubes with 35 μm cell strainer cap (Corning, catalog number: 352235 )
RPMI (Corning, catalog number: 10-040-CVR )
Fetal bovine serum (FBS) (Gemini Bio-Products, BenchMarkTM, catalog number: 100-106 )
100x penicillin/streptomycin (Corning, catalog number: 30-002-CI )
Recombinant human Interleukin-2 (R&D Systems, catalog number: 202-IL-010 )
1x PBS (Corning, catalog number: 21-031-CVR )
Ethylenediaminetetraacetic acid disodium salt dihydrate (Na2EDTA) (Sigma-Aldrich, catalog number: E6635-100G )
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: S2002 )
FACS buffer (see Recipes)
Drug treatment
Tips
0.1-10 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-681-440 )
1-200 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-502 )
101-1,000 μl (Fisher Scientific, FisherbrandTM, catalog number: 02-707-509 )
RPMI (Corning, catalog number: 10-040-CVR )
Fetal bovine serum (FBS) (Gemini Bio-Products, BenchMarkTM, catalog number: 100-106 )
100x penicillin/streptomycin (Corning, catalog number: 30-002-CI )
Recombinant human Interleukin-2 (R&D Systems, catalog number: 202-IL-010 )
LRAs
Analysis of LRAs efficacy by flow cytometry
RPMI (Corning, catalog number: 10-040-CVR )
Fetal bovine serum (FBS) (Gemini Bio-Products, BenchMarkTM, catalog number: 100-106 )
100x penicillin/streptomycin (Corning, catalog number: 30-002-CI )
Recombinant human Interleukin-2 (R&D Systems, catalog number: 202-IL-010 )
1x PBS (Corning, catalog number: 21-031-CVR )
Ethylenediaminetetraacetic acid disodium salt dihydrate (Na2EDTA) (Sigma-Aldrich, catalog number: E6635-100G )
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: S2002 )
LIVE/DEAD Violet Fixable Dead Cell Stain Kit (Thermo Fisher Scientific, catalog number: L34963 ) (small kit)
FACS buffer (see Recipes)
Equipment
Pipetman
FInnpipetteTM F2 multichannel pipettes
5-50 μl (Thermo Fisher Scientific, catalog number: 4662050 )
30-300 μl (Thermo Fisher Scientific, catalog number: 4662070 )
Pipette-Aids
Tabletop centrifuge for Eppendorf tubes (Eppendorf, model: 5415D )
Vortex (VWR, catalog number: 10153-838 )
Tabletop centrifuge for 96-well plates, Eppendorf, 15 ml and 50 ml tubes; used for spin infection (Beckman Coulter, model: Allegra X-14R )
High Speed Ultracentrifuge (Beckman Coulter, model: Optima L-60 ) with SW 28 Ti Swinging-Bucket rotor (Beckman Coulter, model: SW 28 Ti )
5% CO2 tissue culture incubator, 37 °C (Thermo Fisher Scientific, model: FormaTM Steri-CultTM CO2 Incubators, catalog number: 3307)
DynaMagTM-5 Magnet (Thermo Fisher Scientific, catalog number: 12303D )
FACS AriaII (BD Biosciences, San Jose, CA)
FACS LSRII (BD Biosciences, San Jose, CA)
Hemacytometer (Hausser Scientific, catalog number: 3200 ) or automated cell counter (ORLFO Technologies, catalog number: MXZ001 ) with cassettes type M (ORLFO Technologies, catalog number: MXC001 )
Biosafety cabinet 'Level 2'
Ice bucket (VWR, catalog number: 10146-298 )
Software
FlowJo 10 or other versions (Tree Star)
Procedure
Production of HIVGKO viral particles in HEK293T cells
Note: HIVGKO particles are produced after calcium phosphate transfection in HEK293T cells.
HEK293T cell culture
HEK293T cells are cultured in DMEM medium (supplemented with 10% FBS, 1% penicillin/streptomycin) in 182 cm2 tissue culture flasks in 20 ml medium.
For maintenance of the HEK293T culture, when approaching confluence (~80%) cells, aspirate media, wash once with PBS, then trypsinize (0.05% trypsin) and plate cells after 1/12 dilution in complete DMEM, in 182 cm2 tissue culture flasks. HEK293T cells are split every 3 days.
One day before transfection, plate approximately 4 x 106 of HEK293T cells per 182 cm2 tissue culture flasks in 18 ml of complete DMEM.
Note: After thawing frozen cell vials, HEK293T cells are cultured for at least one week before transfecting them for virus production. In order to maximize viral particle production, HEK293T cells are never kept more than 4 weeks in culture. HEK293T cells should never be grown to 100% confluency as they lose their ability to be transfected.
Calcium phosphate transfection
Note: Protocol below describes the transfection of cells plated in one 182 cm2 tissue culture flask. To utilize the maximum space available in the ultracentrifuge, transfect about 15 flasks.
Remove all medium from the flask.
Add 17 ml of fresh DMEM medium (supplemented with 10% FBS, 1% penicillin/streptomycin) containing a final concentration of 25 μM of chloroquine (do not add on cells but, at the bottom of the flask–Figure 1), slowly swirl the flask to distribute the solution evenly and, incubate for 30-60 min before transfection.
Prepare DNA mix in nuclease-free H2O in a 15 ml conical tube (45 μg of HIVGKO and 25 μg of HIV-1 dual-tropic envelope [pSVIII-92HT593.1]).
Add nuclease-free H2O to the DNA mixture for a final volume of 1.5 ml.
Add 1.75 ml of 2x HBSS buffer.
Vortex mixture at a medium-high setting while slowly adding (dropwise) 220 μl of 2 M CaCl2 to the diluted DNA, and keep vortexing for about 45 sec.
Incubate at room temperature for 10-30 min before adding the prepared DNA solution to the bottom of the flask.
Slowly swirl the flask to distribute the solution evenly.
Culture for 6-8 h at 37 °C.
Remove supernatant.
Add 17 ml of DMEM (supplemented with 10% FBS, 1% penicillin/streptomycin) medium (add at the bottom of the flask, as shown in Figure 1, to avoid detaching cells).
Incubate for 48 h at 37 °C to allow viral production.
Collect the supernatant into a 50 ml Falcon tube.
Centrifuge for 20 min at 800 x g at RT or 4 °C.
Filter supernatant through a 50 ml centrifuge tube filtration.
Transfer filtered supernatant into UltraClear Centrifuge Tubes (To avoid the collapse of the tube, make sure it is filled with at least 34 ml–add media or PBS to viral supernatant if necessary to reach that volume).
Spin viral supernatant in the ultracentrifuge for 2 h at 100,000 x g at 4 °C.
Pour out supernatant, dry as much as you can the inside of the tube and resuspend the pellet with 50 μl of cold RPMI (supplemented with 10% FBS, 1% penicillin/streptomycin) medium or FBS, make aliquots in 1.5 ml Eppendorf tubes and freeze at -80 °C.
Notes:
When scaling up the viral production, you should be able to see a pellet. Also, scale up the volume used to resuspend the pellet. Do not make air bubbles when resuspending the pellet and, pipet up and down at least 50 times.
Concentrated viral supernatant can also be titered and used fresh. However, even though the p24 content will not change, fresh versus frozen virus will give different infection outcomes, which will require different viral input to start with (described in Step C2).
Thaw one aliquot, make viral dilutions up to 10,000 to 1 million and, titer virus for p24 content using the FlaQ assay protocol (Gesner et al., 2014).
Note: In addition of tittering p24 content of the virus with the FlaQ assay, I would recommend directly titering the infection rate of your viral stock on activated cells using 4 or 5 viral dilutions, before proceeding with big experiments. You want to avoid total infection greater than 15%.
Figure 1. Adding media to cells without detaching cells. Steps A2b and A2k require to add fresh media with and without chloroquine, respectively. First, aspirate media, and then add fresh media directly at the bottom of the flask to prevent detaching the cells. Once the media is in the bottom of the flask, slowly swirl the flask to distribute the solution evenly and place the flask back into the incubator.
Isolation of human primary CD4+ T cells
Human primary CD4+ T cells culture
Human primary CD4+ T cells are cultured in RPMI medium (supplemented with 10% FBS, 1% penicillin/streptomycin) + 20 U/ml of IL-2 in tissue culture flasks or plates at a concentration of 5 x 106/ml, in a CO2 incubator at 37 °C.
Half of the medium is replaced with fresh RPMI medium (supplemented with 10% FBS, 1% penicillin/streptomycin) + 20 U/ml of IL-2 every other day.
Isolation of human primary CD4+ T cells
Note: This protocol describes CD4+ T cells isolation using the RosetteSep Human CD4+ T Cell Enrichment Cocktail. Any other CD4+ T cells isolation kit can be used, but the protocol might slightly differ. Always follow the manufacturer’s protocol.
Order fresh blood or LRC in advance to have it delivered on the day of the experiment.
Note: One blood/LRC corresponds to one donor. Three donors should be tested at least, in two different experiments at least.
Transfer blood into a 50 ml Falcon tube (if using LRC, cut both extremities of the chamber with clean scissors and let the blood drops into the tube).
Add 1,800 μl of RosetteSep Cocktail to sample, incubate at RT for 20 min, and mix sample by swirling the tube every 5 min.
In a new 50 ml Falcon tube, add 10 ml of Histopaque-1077.
Dilute sample with equal volume of PBS containing 2% FBS.
Slowly and carefully layer diluted sample on density gradient medium to minimize their mixing.
Centrifuge sample for 20 min at 800 x g, RT, with brake off.
CD4+ T cells are contained in the white ring, below the plasma phase (Figure 2). Pipet the ring and transfer it to a new 50 ml Falcon tube.
Wash cells by filling up the tube with PBS containing 2% FBS.
Centrifuge for 3 min at 800 x g and discard supernatant.
If pellet appears red, resuspend pellet with 15 ml of cold AKC lysis buffer (see Recipes), incubate for 2 min at RT.
Fill the tube up to 50 ml with PBS containing 2% fetal bovine serum, centrifuge for 3 min at 800 x g, and get rid of the supernatant.
If the pellet is still red, repeat Steps B2k-B2l, if not, proceed to Step B2n.
Resuspend pellet (CD4+ T cells) with warm, fresh RPMI medium (supplemented with 10% FBS, 1% penicillin/streptomycin) + 20 U/ml of IL-2.
Count cells using an automated cell counter or a hemacytometer.
Culture cells at a concentration of 5 x 106/ml (250 million cells are cultured into 185 cm2 [flat]).
Note: Isolated CD4+ T cells are mainly resting and can be kept in culture as such for several days. Medium can be changed every 4 to 5 days.
Figure 2. Isolation of human primary CD4T+ cells by histopaque density gradient. A. Slowly layer the blood (containing the RosetteSep Cocktail and diluted to half with PBS + 2% FBS) on top of histopaque density gradient. Centrifuge for 20 min at 800 x g, RT, with brake off. B. CD4+ T cells are contained in the white ring, below the plasma phase, but above the histopaque and red cell phases. Carefully pipet out the ring.
Infection of human primary CD4+ T-cells with HIVGKO
Note: This protocol describes the activation of 250 million CD4+ T cells using Dynabeads Human T-Activator CD3/CD28. Any other human CD4+ T cells activators kit can be used, but the protocol might slightly differ. Always follow the manufacturer’s protocol.
Activation of human primary CD4+ T cells
Vortex the Dynabeads Human T-Activator CD3/CD28 in the vial.
Transfer 3.125 ml of Dynabeads (1 bead for 2 cells, which is half of the manufacturer’s protocol) to a 15 ml tube.
Place the tube on a magnet for 1 min and discard the supernatant.
Remove the tube from the magnet and resuspend the washed Dynabeads with 10 ml of the CD4+ T cells to activate (at a concentration of 5 x 106/ml), and add those 10 ml to the rest of the CD4+ T cells to activate. Transfer the whole suspension to an appropriate vessel (5 millions of activated cells can be cultured in one well of a 24-well plate).
Culture in a CO2 incubator at 37 °C for three days as such (you should see cells aggregates due to activation).
Infection of human primary CD4+ T cells with HIVGKO
Note: The spin-infection of 1 million activated CD4+ T cells requires 30 μl of a 10,000 ng p24Gag/ml viral dilution to reach a total infection rate of 9%-12% (to keep the ratios of latent versus productive infections consistent, avoid infection rates greater than 15%). However, the total infection rate (productive + latent infections) might slightly change according to fresh versus frozen stocks, viral stocks themselves and donors. Thus, in addition of titering the virus with the FlaQ assay, I would recommend directly titering your viral stock on activated cells using 4 or 5 viral dilutions, before proceeding with big experiments. Using frozen viral stocks requires the use of bigger amount of virus to reach 9%-12% infection rate.
Three days post-activation, mix cells and beads and, transfer cells to 15 ml tubes.
Place the tube on a magnet for 1 min and transfer the supernatant into a new 50 ml tube.
Centrifuge cells for 3 min at RT at 800 x g.
Discard supernatant and resuspend the cell pellet of 250 million cells with media containing the viral preparation at 10,000 ng p24Gag/ml.
Transfer resuspended cells to a pipetting reservoir and distribute 30 μl of the cells/virus suspension per one well of a 96 well V-bottom plate using a multi-channel pipetman.
Centrifuge (= spin-infection) the plate for 2 h, at 800 x g, 32 °C.
Add 100 μl of fresh RPMI medium (supplemented with 10% FBS, 1% penicillin/streptomycin) + 20 U/ml of IL-2 in each well and pool cells back together. Resuspend cells in a final volume of 100 ml of fresh RPMI medium (supplemented with 10% FBS, 1% penicillin/streptomycin) + 20 U/ml of IL-2 and, transfer into a 182 cm2 flask
Note: Viral solution stays in, but it is possible to wash it away after spin-infection.
Culture as such for 4 to 5 days in a CO2 incubator at 37 °C.
Replace half of the medium by centrifuging down cells, with fresh RPMI medium (supplemented with 10% FBS, 1% penicillin/streptomycin) + 20 U/ml of IL-2 every other day.
Sorting cells
Five days post-infection, collect and transfer cells to 50 ml tubes.
Centrifuge cells for 3 min at RT at 800 x g.
Discard supernatant and resuspend cells in 2 ml of FACS buffer (see Recipes).
Pipette resuspended cells through a 5 ml 35 μm cell strainer capped tube and place on ice.
Prepare several 15 ml collection tubes with 2 ml of FBS and place on ice. Do not forget to label your tubes.
Then proceed directly to cell sorting using the flow cytometer FACS AriaII (PE channel for mKO2, and FITC channel for GFP) (see Figure 3 for gating strategy).
Note: The sort can take up to 10 h, thus sort cells at 4 °C. Use the 85 μm nozzle to prevent spontaneous reactivation of latently infected cells. When collecting populations into 15 ml tubes, you can only collect 2 different populations at once. Keep sorting the latent population at all time, and exchange tubes for uninfected and productively infected cells when you have reached 5 million cells per population. You should be able to collect 1.5-2.5 million latently infected cells depending on your infection rate.
Spin down sorted cells for 3 min at RT, 800 x g.
Resuspend cell populations with fresh RPMI medium (supplemented with 10% FBS, 1% penicillin/streptomycin) + 20 U/ml of IL-2 and, distribute equally into a 96-well V-bottom plate.
Note: To test 5 LRAs, sorted populations should be divided equally into 5 wells. Given that each well contains 200 μl, the pellet should be resuspended in 1 ml final of RPMI media. Note that a few hundred thousand cells/well are enough to assay LRAs activity.
Let cells rest overnight in a CO2 incubator at 37 °C.
Drug treatment
After 24 h incubation, prepare 2x LRAs dilutions (dilute drugs with complete RPMI).
Remove 100 μl of medium from each well and add 100 μl of 2x concentrated LRAs dilutions.
Incubate for 24 h in a CO2 incubator at 37 °C.
Analysis of LRAs efficacy by flow cytometry
Twenty-four hours later, remove all medium from wells, and wash with FACS buffer.
Spin down cells for 3 min at RT, 800 x g and discard supernatant.
Stain cells with live/dead violet marker (1/1,000 dilution of the marker in FACS buffer, 100 μl/well, incubate for 10-15 min on ice in the dark).
Note: Live/dead violet marker is perfect since it does not overlap with FITC and PE channels, and thus no compensation is needed.
Wash cells once with FACS buffer and, proceed directly to flow analysis (see Figure 4 for gating strategy).
Notes:
Avoid fixing samples with PFA since it decreases fluorescence intensity.
For flow cytometry, AriaII sorter was used to run samples since fluorescence intensity is higher. However, other flow cytometers such as LSRII or Calibur are also suitable for these experiments as long as they have the right filters.
Data analysis
Sorting Cells (Figure 3)
Figure 3. Gating strategy to sort out uninfected, productively and latently infected cells. A. Set the gate on live cells. Cell viability is monitored by forward (FSC-Area) and side scatter (SSC-Area) analysis. B and C. Gate successively on singlets FSC-Area vs. FSC-Width, and SSC-Area vs. SSC-Width. D. Set the gate on GFP/FITC-Area+ to sort productively infected cells, or on GFP/FITC-Area- vs. mKO2/PE-Area+ to sort latently infected cells, or to GFP/FITC-Area- vs. mKO2/PE-Area- to sort uninfected cells. Run briefly each sorted sample when the sort is over to check purity (usually > 90%).
Analysis of LRAs efficacy by flow cytometry (Figure 4)
Figure 4. Gating strategy to analyze LRAs efficacy on the reversal of HIV-1 latency. A. Set the gate cells (avoid the left bottom corner where it is mainly debris) based on size (FSC-Area) and granularity (SSC-Area) analysis. B. Gate on singlets (FSC-Area vs. FSC-Height). C. Gate on live cells (Live) (Pacific Blue-Area vs. FSC-Height). D. Quantify the number of GFP+ cells which is the number of productively infected cells (GFP/FITC-Area+ vs. FSC-Area). Deduce the % of GFP+ cells quantified in the control sample to obtain the number of latently reactivated cells by the LRA tested. Each LRA is tested at least on 3 independent HIVGKO infected C donors.
Notes
The HIVGKO construct has a defective envelop and requires the addition of exogenous envelop while producing viral particles. We use an HIV CXCR4 tropism envelop to target human primary CD4+ T cells. It is possible to pseudotype that construct with other envelops such as VSV-G or HIV CCR5 tropism envelops to target other cell types (Cavrois et al., 2006).
Recipes
25 mM chloroquine
25 mM chloroquine in PBS
2x HBSS
50 mM HEPES
10 mM KCl
12 mM dextrose
280 mM NaCl
1.5 mM Na2HPO4
Adjust pH to 7.1
Note: The pH is crucial!
2 M CaCl2
2 M CaCl2 in nuclease-free H2O
AKC Lysis buffer
850 ml H2O
8.02 g (150 mM) of NH4Cl
1 g (10 mM) of KHCO3
37.2 mg (0.1 mM) of Na2EDTA
Adjust pH to 7.2
Add H2O to 1,000 ml, and store at 4 °C for months
FACS buffer
2% FBS
2 mM EDTA
0.1% Sodium Azide
PBS
Acknowledgments
E.B. was supported by a post-doctoral fellowship from UCSF CFAR and a CHRP fellowship. E.V. was supported by funds from NIH 1R01DA030216, 1DP1DA031126, NIH/NIAID R01Ai117864 NIH/NIDA/1R01DA041742-01, NIH/NIDCR/1R01DE026010-01, and 5-31532. We would also like to thank Marielle Cavrois and Herk Kasler, respectively directors of the Gladstone and Buck Flow Cores. The Gladstone Flow Core was funded by NIH Grants P30AI027763 and S10 RR028962 and by the University of California, San Francisco-Gladstone Institute of Virology and Immunology Center for AIDS Research (CFAR). We thank the amfAR Institute for HIV Cure Research.
Competing interests
The authors declare that there is no conflict of interest or competing interest regarding the publication of this article.
References
Battivelli, E., Dahabieh, M. S., Abdel-Mohsen, M., Svensson, J. P., Tojal Da Silva, I., Cohn, L. B., Gramatica, A., Deeks, S., Greene, W. C., Pillai, S. K. and Verdin, E. (2018). Distinct chromatin functional states correlate with HIV latency reactivation in infected primary CD4+ T cells. Elife 7: e34655.
Cavrois, M., Neidleman, J., Kreisberg, J. F., Fenard, D., Callebaut, C. and Greene, W. C. (2006). Human immunodeficiency virus fusion to dendritic cells declines as cells mature. J Virol 80(4): 1992-1999.
Gesner, M., Maiti, M., Grant, R. and Cavrois, M. (2014). Fluorescence-linked antigen quantification (FLAQ) assay for fast quantification of HIV-1 p24Gag. Bio-protocol 4(24): e1366.
Copyright: Battivelli and Verdin. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Battivelli, E. and Verdin, E. (2018). HIVGKO: A Tool to Assess HIV-1 Latency Reversal Agents in Human Primary CD4+ T Cells. Bio-protocol 8(20): e3050. DOI: 10.21769/BioProtoc.3050.
Battivelli, E., Dahabieh, M. S., Abdel-Mohsen, M., Svensson, J. P., Tojal Da Silva, I., Cohn, L. B., Gramatica, A., Deeks, S., Greene, W. C., Pillai, S. K. and Verdin, E. (2018). Distinct chromatin functional states correlate with HIV latency reactivation in infected primary CD4+ T cells. Elife 7: e34655.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Cell Biology > Cell isolation and culture > Cell isolation
Cell Biology > Cell-based analysis > Viral infection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,051 | https://bio-protocol.org/exchange/protocoldetail?id=3051&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Microtitre Plate Based Cell-SELEX Method
MS Munish Shorie*
HK Harmanjit Kaur*
*Contributed equally to this work
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3051 Views: 6798
Edited by: Longping Victor Tse
Reviewed by: Vaibhav B. Shah
Original Research Article:
The authors used this protocol in Dec 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2017
Abstract
Aptamers have emerged as a novel category in the field of bioreceptors due to their wide applications ranging from biosensing to therapeutics. Several variations of their screening process, called SELEX have been reported which can yield sequences with desired properties needed for their final use. We report a facile microtiter plate-based Cell-SELEX method for a gram-negative bacteria E. coli. The optimized protocol allows the reduction of number of rounds for SELEX by offering higher surface area and longer retention times. In addition, this protocol can be modified for other prokaryotic and eukaryotic cells, and glycan moieties as target for generation of high affinity bio-receptors in a short course of time in-vitro.
Keywords: Aptamers SELEX Bacteria Microbial detection E. coli Gram negative bacteria Bio-receptor screening
Background
Aptamers are single strands of synthetic DNA or RNA described in 1990 (Ellington and Szostak, 1990; Tuerk and Gold, 1990) with a distinct 3D geometry, which is a manifestation of their sequences. Different sequences allow the synthesis of aptamers, which can bind to an array of molecules ranging from small molecules to large proteins. This allowed aptamers to emerge as the rivals to conventional antibodies, which are limited to proteins as their targets due to structural limitations and can not be raised against high-risk pathogens as these usually kill the host much earlier than the time required to generate high affinity antibodies. Aptamers are generated in in-vitro setups and thus can effectively be used for high-risk pathogens. SELEX (Systematic Evolution of Ligands by EXponential enrichment) is an iterative process involving repeated exposures and separation leading to screening of a pool with dissociation constants in low nM ranges. Several variations of SELEX have been proposed which use a variety of stationary matrices including capillary electrophoresis SELEX, affinity chromatography based SELEX, magnetic bead SELEX, in-vivo SELEX, FACS SELEX and Microfluidics based SELEX, etc. These methods present various advantages over others but the number of SELEX rounds are consistently high.
A standard SELEX method has four major steps; exposure of random sequence single stranded nucleotide oligo library to target, binding of oligos to target molecule, selection of binders and removal of non-binding oligos, amplification of the binder fraction and portioning of the amplicon to single strand. These steps are iteratively performed till pool of high binding aptamer are screened out from the library. The oligonucleotide library consists of a random base-sequence flanked on both ends by primer binding sites, which aids in amplification and enrichment (Safeh et al., 2010; Kim et al., 2013).
We report a microtiter plate-based Cell-SELEX method, which can be employed over a wide number of molecules and cell types (Figure 1). The advantage proposed by the method is uniquely low number of rounds, which are the outcome of large surface area, higher retention times and a novel superior bio-probe based partitioning process (Priyanka et al., 2014).
Figure 1. Concise Protocol Schematic. A step-by-step flowchart showing the various steps of Cell-SELEX. (Modified from author’s work Kaur et al., 2017)
Materials and Reagents
Pipette tips, 10 μl (Tarsons, catalog number: 523100 )
Pipette tips, 200 μl (Tarsons, catalog number: 523101 )
Pipette tips, 1 ml (Tarsons, catalog number: 523104 )
Nunc Maxisorp F96 microtitre plates (Thermo Fisher Scientific, catalog number: 437111 )
Centrifuge tubes 50 ml (Tarsons, catalog number: 546041 )
Microcentrifuge tubes (MCT) 1.5 ml (Tarsons, catalog number: 500010 )
PCR Tubes 0.2 ml (Tarsons, catalog number: 510051 )
Bacterial strains (E. coli)
ssDNA library and primers (IDT custom synthesis):
Forward Primer: 5'-ATCCAGAGTGACGCAGCA-3'
Reverse Primer: 5'-biotin-ACTAAGCCACCGTGTCCA-3'
Library: 5'-ATCCAGAGTGACGCAGCA-45N-TGGACACGGTGGCTTAGT-3'
LB broth (HiMedia Laboratories, catalog number: M1245 )
Phenylboronic acid (HiMedia Laboratories, catalog number: RM1599 )
Streptavidin-Gold from Streptomyces avidinii (Sigma-Aldrich, catalog number: 53134 )
Tris-HCl (HiMedia Laboratories, catalog number: MB030 )
Glycine (HiMedia Laboratories, catalog number: MB013 )
Magnesium chloride (HiMedia Laboratories, catalog number: MB040 )
Sodium chloride (HiMedia Laboratories, catalog number: MB023 )
Sodium phosphate monobasic (HiMedia Laboratories, catalog number: GRM3963 )
Sodium phosphate dibasic (HiMedia Laboratories, catalog number: MB024 )
Tris base (HiMedia Laboratories, catalog number: TC072 )
Sodium carbonate (HiMedia Laboratories, catalog number: GRM851 )
Sodium bicarbonate (HiMedia Laboratories, catalog number: TC230 )
Hydrochloric acid 37% (Merck, catalog number: 100317 )
PCR mastermix (2x) (Thermo Fisher Scientific, catalog number: K0171 )
PCR grade DMSO (Sigma-Aldrich, catalog number: D9170 )
Tryptone (HiMedia Laboratories, catalog number: RM014 )
Yeast extract powder (HiMedia Laboratories, catalog number: RM027 )
LB growth media (see Recipes)
Carbonate buffer (see Recipes)
Tris-HCl binding buffer (see Recipes)
Glycine-HCl elution buffer (see Recipes)
Tris neutralization solution (see Recipes)
Phenylboronic acid (PBA) coating solution (see Recipes)
Phosphate buffered saline (see Recipes)
Equipment
Pipettes (Thermo Fisher Scientific, model: FinnpipetteTM F1 variable volume single channel pipettes)
Incubator-Shaker (Eppendorf, model: Innova® 44 )
4 °C refrigerator (Vestfrost Solutions, model: AKG 377 )
-20 °C freezer (Vestfrost Solutions, model: CFS 344 )
pH meter (Hanna Instruments, model: pH 211 )
Spectrophotometer (GE Healthcare, model: NanoVue Plus )
Centrifuge (Eppendorf, model: 5430 R )
Thermocycler (Bio-Rad Laboratories, model: C1000 TouchTM )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Shorie, M. and Kaur, H. (2018). Microtitre Plate Based Cell-SELEX Method. Bio-protocol 8(20): e3051. DOI: 10.21769/BioProtoc.3051.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA-protein interaction
Microbiology > Microbial proteomics > Membrane proteins
Biophysics > Bioengineering > Artificial receptors
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,052 | https://bio-protocol.org/exchange/protocoldetail?id=3052&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Gene Knockout and Gene Replacement with Complete Removal of Full-length Endogenous Transcript Using CRISPR-Trap
JM Jonas Mechtersheimer*
Stefan Reber*
Marc-David Ruepp
*Contributed equally to this work
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3052 Views: 7871
Edited by: Renate Weizbauer
Reviewed by: Indranil MalikMolly Leung
Original Research Article:
The authors used this protocol in Jan 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2018
Abstract
This protocol describes the application of the CRISPR-Trap from designing of the gene targeting strategy to validation of successfully edited clones that was validated on various human cell lines, among them human induced pluripotent stem cells (hiPSCs). The advantage of CRISPR-Trap over conventional approaches is the complete removal of any endogenous full-length transcript from the target gene. CRISPR-Trap is applicable for any target gene with no or little coding sequence in its first exon. Several human cell lines and different genes have so far been edited successfully with CRISPR-Trap.
Keywords: CRISPR CRISPR-Trap Gene knockout Gene replacement Gene editing hiPSCs
Background
The advent of CRISPR/Cas9 technology facilitated the genomic targeting for the generation of gene knockouts and gene editing. The conventional method to perform a knockout relies on the introduction of a frameshift leading to premature termination codons (PTCs), truncating the open reading frame (ORF) and subsequent degradation of the transcript of the targeted gene by nonsense-mediated mRNA decay (NMD). A possible pitfall of this approach is full-length transcripts which may escape NMD and give rise to C-terminal truncated proteins harboring residual or even dominant negative functions. This protocol presents the CRISPR-Trap, a method we recently established (Reber et al., 2018), which upon successful editing will prevent the expression of any full-length transcript from the target gene locus (Figure 1). Simply put, this approach targets the first intron of the gene of interest with CRISPR/Cas9. Using homology-directed repair (HDR) a customizable cassette flanked by a strong 3’-splice site and a strong polyadenylation signal is introduced in the first intron, thereby generating an artificial second and effectively last exon. Since transcription is terminated by the introduced polyadenylation signal, only the first endogenous exon and the inserted cassette is transcribed. The customizable cassette can be used to introduce a selection marker, thereby enabling easy selection for at least heterozygous edited clones. If a gene replacement is wanted, the customizable cassette can be used to introduce the replacement gene, followed by an internal ribosomal entry site (IRES) and a selection marker (Reber et al., 2016 and 2018).
Figure 1. Schematic of the application of the CRISPR-Trap. The first intron of the target gene is cleaved using the CRISPR/Cas9 system and template DNA for homology-directed repair is provided. The template DNA contains a strong 3’ prime splice signal (dark green), a customizable cassette (light green) and a strong polyadenylation signal (turquoise). The customizable cassette can be utilized to either knockout (left) or replace the target gene (right). The cassette contains a selection marker that will be under the control of the endogenous promoter of the target gene upon successful editing. For gene replacements, an IRES is introduced in between the replacement gene and the selection marker. Figure adapted from Reber et al. (2018).
Materials and Reagents
Pipette tips
10 µl sapphire bulk non-sterile pipette tips (Greiner Bio One International, catalog number: 771250 )
200 µl polypropylene universal pipette tips with graduation (Greiner Bio One International, catalog number: 739282 )
1,250 µl sapphire bulk non-sterile pipette tips (Greiner Bio One International, catalog number: 750250 )
TPP® tissue culture plates
24-well (Sigma-Aldrich, catalog number: Z707791 )
6-well (Sigma-Aldrich, catalog number: Z707767 )
15 cm plate (Sigma-Aldrich, catalog number: Z707694 )
TPP cell scraper 20 cm (MIDSCI, catalog number: TP 99010 )
Cloning cylinder sterile, 3/16’’ ID x 5/16’’ H (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: 37847-0100 )
Cell strainer (EASYstrainer, 70 µm) (Greiner Bio One International, catalog number: 542070 )
Bel-ArtTM SP SciencewareTM BelpenTM black markers (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: F13374-0000 )
Plasmid of choice, serving as homology directed repair donor template (donor plasmid)
Plasmid of choice for Cas9 and sgRNA expression, e.g., pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene, catalog number: 42230 )
Transformation competent E. coli strain of choice for cloning and plasmid amplification (e.g., XL10 Gold) (Agilent, catalog number: 200314 )
Transfection reagent of choice
DogTor (OZ Biosciences, catalog number: DT51000 )
TransIT®-LT1 (Mirus Bio, catalog number: MIR 2300 )
LipofectamineTM 3000 reagent (Thermo Fisher Scientific, catalog number: L3000015 )
Cell detachment solutions
hiPSCs
To generate single cells: StemProTM AccutaseTM Cell Dissociation Reagent (Thermo Fisher Scientific, catalog number: A1110501 )
To split cells as clumps: DPBS (STEMCELL Technologies, catalog number: 37350 ) containing 0.5 mM EDTA (Thermo Fisher Scientific, catalog number: 15575020 )
Other human cell lines: Trypsin-EDTA (0.05%), phenol red (Thermo Fisher Scientific, catalog number: 25300054 )
To grow hiPSCs as single cells: Y-27632, RHO/ROCK pathway inhibitor (STEMCELL Technologies, catalog number: 72302 )
ZeocinTM (InvivoGen, catalog number: ant-zn )
Puromycin dihydrochloride (Santa Cruz Biotechnology, catalog number: sc-108071A )
PBS (Ca2+, Mg2+ free) (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
TRIZOL (Sigma-Aldrich, catalog number: T9424 )
Dow Corning® High-Vacuum silicone Grease (Sigma-Aldrich, catalog number: Z273554 )
TOPOTM TA CloningTM Kit, Dual Promoter (Thermo Fisher Scientific, catalog number: 450640 )
Chloroform for analysis EMSURE® ACS, ISO, Reag. Ph Eur (Merck, catalog number: 102445 )
Absolute EtOH (Sigma-Aldrich, catalog number: 59176 )
Trisodium citrate (Sigma-Aldrich, catalog number: W302600 )
2-propanol for analysis EMSURE® ACS, ISO, Reag. Ph Eur (Merck, catalog number: 109634 )
RNase free glycogen (Thermo Fisher Scientific, catalog number: R0551 )
DNA extraction kit (Quick-DNATM miniprep Kit) (ZYMO RESEARCH, catalog number: D3025 )
NaOH (Sigma-Aldrich, catalog number: 306576 )
Maximo Taq DNA Polymerase 2X-preMix/PCR Master Mix (GeneON, catalog number: S113 )
KAPA Taq ReadyMix PCR Kit (KAPA Biosystems, catalog number: KK1006)
Equipment
Pipettes
Pipetman P10 (Gilson, catalog number: F144802 )
Pipetman P20 (Gilson, catalog number: F123600 )
Pipetman P200 (Gilson, catalog number: F123601 )
Pipetman P1000 (Gilson, catalog number: F123602 )
Mammalian culture equipment
Heat block (VWR, catalog number: 444-0938 )
Thermocycler (VWR, catalog number: 732-2551 )
NanoDrop (Thermo Fisher Scientific, model: NanoDropTM 2000 , catalog number: ND-2000)
Cooling Centrifuge (Eppendorf, model: 5424 R , catalog number: 5404000010)
Wide-field microscope
Vortex (Scientific Industries, catalog number: SI-0266 )
Software
Clone manager (http://www.scied.com/pr_cmpro.htm) or other cloning software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mechtersheimer, J., Reber, S. and Ruepp, M. (2018). Generation of Gene Knockout and Gene Replacement with Complete Removal of Full-length Endogenous Transcript Using CRISPR-Trap. Bio-protocol 8(20): e3052. DOI: 10.21769/BioProtoc.3052.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Mutagenesis
Molecular Biology > DNA > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,053 | https://bio-protocol.org/exchange/protocoldetail?id=3053&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Nuclear/Cytoplasmic Fractionation of Proteins from Caenorhabditis elegans
AM Alejandro Mata-Cabana
Olga Sin
RS Renée I. Seinstra
EN Ellen A. A. Nollen
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3053 Views: 9465
Reviewed by: Matthias Rieckher
Original Research Article:
The authors used this protocol in Mar 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2017
Abstract
C. elegans is widely used to investigate biological processes related to health and disease. To study protein localization, fluorescently-tagged proteins can be used in vivo or immunohistochemistry can be performed in whole worms. Here, we describe a technique to localize a protein of interest at a subcellular level in C. elegans lysates, which can give insight into the location, function and/or toxicity of proteins.
Keywords: C. elegans Subcellular fractionation Protein localization Nucleus Cytoplasm Immunoblot
Background
Subcellular fractionation has been used in different model organisms to identify and study protein function in nuclei, membranes and cytoplasm. For example, aggregation-prone proteins may be more toxic when they are localized in the nucleus or in the cytosol (Kontopoulos et al., 2006; Barmada et al., 2010). Here we provide a protocol (adapted from Chen et al., 2000 and La Rocca et al., 2007) to localize specific proteins in the nuclear and cytoplasmic fractions of C. elegans.
Materials and Reagents
94 mm plates (Greiner Bio One International, catalog number: 633185 )
15 ml conical tube (SARSTEDT, catalog number: 62.554.502 )
1.5 ml tubes (Greiner Bio One International, catalog number: 616201 )
Pellet pestle (Sigma-Aldrich, catalog number: Z359947-100EA )
Glass slides (Fisher Scientific, catalog number: 12164682 )
Nitrocellulose (Bio-Rad Laboratories, catalog number: 1620112 )
C. elegans strain
Escherichia coli OP50 strain
Deionized water (dH2O)
Cholesterol (Fisher Scientific, catalog number: 10263660 )
Ethanol absolute (Merck, catalog number: 1009831000 )
Magnesium sulphate (MgSO4) (Fisher Scientific, catalog number: 10264630 )
Calcium dichloride (CaCl2) (Fisher Scientific, catalog number: 10171800 )
di-Potassium hydrogen phosphate (K2HPO4) (Merck, catalog number: 105101 )
Potassium dihydrogen phosphate (KH2PO4) (Merck, catalog number: 104873 )
Casein digest, Difco (BD, catalog number: 211610 )
Select agar (Thermo Fisher Scientific, InvitrogenTM, catalog number: 30391049 )
Disodium hydrogen phosphate (Na2HPO4) (Acros Organics, catalog number: 424380010 )
Sodium chloride (NaCl) (Merck, catalog number: 106404 )
DL-Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
HEPES (Sigma-Aldrich, catalog number: H4034 )
Potassium hydroxide (KOH) (Fisher, catalog number: 10705921 )
Potassium chloride (KCl) (Fisher Scientific, catalog number: 10010310 )
Magnesium dichloride (MgCl2) (Fisher Scientific, catalog number: 10518060 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Sucrose (Fisher Scientific, catalog number: 10386100 )
Tween 20 (Sigma-Aldrich, catalog number: P1379-100ML )
Protease inhibitors (cOmplete) (Roche, catalog number: 11697498001 )
Benzonase nuclease (Merck, catalog number: 70746 )
PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific, catalog number: 23225 )
Liquid nitrogen
Ammonium persulfate (APS) (Thermo Fisher Scientific, catalog number: A/6120/60 )
N,N,N′,N′-Tetramethylethylenediamine (TEMED) (Fisher Scientific, catalog number: 10142863 )
40% Acrylamide/Bis solution (29:1) (Bio-Rad Laboratories, catalog number: 1610146 )
Sodium dodecyl sulfate (SDS) (Merck, Calbiochem, catalog number: 428015 )
Tris Base (Roche Diagnostics, catalog number: 11814273001 )
Hydrochloric acid 37% (Acros Organics, catalog number: 124630010 )
Glycine (Fisher Scientific, catalog number: 10070150 )
Methanol (Merck, catalog number: 106009 )
Bromophenol blue (Acros Organics, catalog number: 403160100 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
β-Mercaptoethanol (Merck, catalog number: 444203 )
Milk powder (Campina)
PageRulerTM Plus Prestained Protein Ladder (Thermo Fisher Scientific, catalog number: 26619 )
Amersham ECL Prime Western Blotting Detection Reagent (GE Healthcare, catalog number: RPN2236 )
Antibodies (see Table 1)
Table 1. List of primary and secondary antibodies
Primary antibody
Host
Company/Catalog number
Dilution primary antibody
Secondary antibody
α-LMN-1
Rabbit
Novus Biologicals,
catalog number:
38530002
1:1,000
Anti-rabbit (1:10,000)
(Bio-Rad Laboratories, catalog number: 1706515 )
α-tubulin
Mouse
Sigma-Aldrich,
catalog number:
T6074
1:10,000
Anti-Mouse (1:10,000)
(Bio-Rad Laboratories, catalog number: 1706516 )
α-GFP
(Living Colors® A.v. Monoclonal Antibody (JL-8)
Mouse
Takara Bio,
catalog number:
632381
1:10,000
Anti-Mouse (1:10,000)
(Bio-Rad Laboratories, catalog number: 1706516 )
M9 buffer (see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
PBS-T (see Recipes)
Blocking solution (see Recipes)
Nematode growth medium (NGM) plates (see Recipes)
Phosphate buffer (see Recipes)
Hypotonic buffer (see Recipes)
Hypertonic buffer (see Recipes)
25x protease inhibitors (see Recipes)
1 M DTT (see Recipes)
12% acrylamide gel (see Recipes)
Running buffer (see Recipes)
Transfer buffer (see Recipes)
SDS lysis buffer (see Recipes)
Equipment
Single channel pipettes (Gilson, models: P2G , P20G , P200G , P1000G )
Orbital shaker (Thermo Fisher Scientific, model: MaxQTM 2000)
20 °C incubator (Winecooler, LIEBHERR, model: WK 4126 )
Stereo microscope (Leica, model: MZ7.5 )
Pellet pestle (motor) (Sigma-Aldrich, catalog number: Z359971 )
Tabletop centrifuge, cooled (Eppendorf, model: 5424 R )
Centrifuge (Thermo Fisher Scientific, model: SL 40R )
Autoclave (VWR, model: VAPOUR-Line Lite )
-80 °C freezer (Sanyo, model: VIP plus )
Mini PROTEAN 3 system (Bio-Rad Laboratories, catalog number: 1658001edu )
WB Imager (GE Healthcare, model: ImageQuant LAS 4000 mini, catalog number: 28955813 )
Software
ImageJ (Open source: https://imagej.nih.gov/ij/)
Microsoft Excel (Microsoft Corporation, Redmond, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mata-Cabana, A., Sin, O., Seinstra, R. I. and Nollen, E. A. A. (2018). Nuclear/Cytoplasmic Fractionation of Proteins from Caenorhabditis elegans. Bio-protocol 8(20): e3053. DOI: 10.21769/BioProtoc.3053.
Download Citation in RIS Format
Category
Biochemistry > Protein > Quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
What is meant by washing the supernatant in step 4 of the procedure?
0 Answer
13 Views
Mar 4, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,054 | https://bio-protocol.org/exchange/protocoldetail?id=3054&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
SDS-PAGE for Silk Fibroin Protein
YZ Yu-Qing Zhang
Published: Oct 20, 2018
DOI: 10.21769/BioProtoc.3054 Views: 10013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
The method and detailed procedure of SDS-PAGE for silk proteins are exactly the same as for other proteins, but the electrophoresis profile of silk protein is often unsatisfactory. The main reason is that their molecular masses are too large, and the regenerated liquid silk is easily coagulated and denatured, resulting in a significant adverse effect on normal electrophoresis. A satisfactory SDS-PAGE profile for silk protein can be obtained by rapidly loading samples, reducing time and temperature when mixing the sample with the loading dye.
Keywords: SDS-PAGE Silk protein Fibroin Regeneration Coagulation Denature
Background
SDS-PAGE for protein or polypeptide is one of the most classic, basic and commonly used experimental methods for analyzing the molecular masses of protein subunits (Laemmli, 1970). Therefore, it is generally not difficult to obtain a good SDS-PAGE electrophoretic profile with clear bands for most proteins.
However, for researchers involved in electrophoresis experiments with silk protein, it seems that it is not easy to obtain a good SDS-PAGE profile with clear band of light chain, a subunit of silk fibroin. This is especially true for beginners or students who do not have a long experience with electrophoresis. Where is the problem? The main difficulty is not related to the SDS-PAGE technique itself but is related to the preparation of liquid silk fibroin from silk fiber, as well as the unique properties of the silk fibroin itself.
Silk protein is a general term for silk fibroin and sericin. Two parallel monofilaments spun by matured larvae of silkworm Bombyx mori are composed of 65%-75% fibroin, 20%-30% sericin, and 5% wax, pigments, sugars, and other impurities. Silk fibroin is a crystalline polymer-based fiber surrounded by several layers of the gum sericin protein. The outermost layer of sericin is easily solubilized in hot or boiling water. The innermost layer of sericin closest to the fibroin fiber is hardly solubilized in boiling water (Wang and Zhang, 2011). All layered sericins are easily solubilized in alkaline hot or boiling water. Therefore, boiling and degumming (removing sericin) in a 0.1%-0.5% Na2CO3 solution have been used most frequently in the laboratory. However, it not only causes a large amount of sericin degradation and hydrolysis but also leads to a decrease in its mechanical properties (Wang and Zhang, 2013). These layered sericins can also be solubilized in 8 M urea buffer at 80 °C (Yamada et al., 2001), aqueous neutral soap (Yuksek et al., 2012) and surfactant solution (Wang and Zhang, 2017) under repeated treatments. In general, the process of removing sericin from the surface of silk fibers is called as degumming. The use of these solvents for degumming treatments hardly results in a decrease of mechanical properties. But the overall degumming efficiency is very low and the repetition of treatments for more than 3 times barely remove all the sericin.
The degummed fibroin fibers are about 10-25 μm in diameter and consist mainly of a 391-kDa heavy chain (H) (Zhou et al., 2000) and a 26-kDa light chain (Yamaguchi et al., 1989), which are present in a 1:1 ratio and linked by a single disulfide bond (Tanaka et al., 1999a). In addition, a 25 kDa glycoprotein, named P25, is non-covalently linked to these proteins (Tanaka et al., 1999b). The structure of fibroin is primarily attributed to its composition of only 3 amino acids organized in a repeating 6-residue sequence of (Gly-Ala-Gly-Ala-Gly-Ser)n. The fibroin in natural silk fiber is a semi-crystalline macromolecule in which the polypeptide chains are strongly held together by hydrogen bonds in an anti-parallel arrangement to form β-sheets which result in crystalline regions (Silk II), while the random coils and α-helix chains form the amorphous regions (Silk I).
Silk fibroin fiber is processed into an aqueous silk fibroin solution via a series of processing, degumming, dissolution, purification and concentration steps that are often referred to as silk regeneration. The resulting liquid silk fibroin is often referred to as regenerated liquid silk. The regenerated liquid silk is very unstable in aqueous solution and its molecular structure changes easily from Silk I into Silk II form due to environmental factors including physics and chemistry, such as temperature, pH, UV radiation, organic solvents, ion strength, stress and ultrasonic treatment. Due to the structural transition of silk protein, the regenerated liquid silk can be easily made into various forms of silk biomaterials, such as micro- or nano-particles (Zhang et al., 2007), regenerated fibers (Matsumoto and Uejima,1996), artificial skin(Jin et al., 2005), porous matrix or 3D scaffolds (Mandal and Kundu, 2009), biomimetic nanofibrous scaffolds (Park et al., 2006), and a platform for transistors (Capelli et al., 2011) and various classes of photonic devices (Kim et al., 2013), due to its biocompatibility.
The structure and properties of the final forms of silk biomaterials depend evidently on the molecular size of the regenerated liquid silk which is affected by a series of processing, degumming, and dissolution steps. The purification, concentration, and storage conditions easily induce regenerated liquid silk gelling or coagulating and denaturing. Therefore, determination of the molecular mass of the protein by SDS-PAGE is a necessary step before processing silk biomaterials.
Materials and Reagents
Notes:
The purification grade, CAS No., catalog number and manufacturer of the main reagents used in the electrophoretic experiment are listed as below. It should be emphasized here that the reagents used in the experiments need to be of high purity or electrophoresis grade. It is important to note that all water used to prepare the reagents, including water in the running buffer, must be ultrapure water.
MB, molecular biology; GR, Guaranteed reagent.
Eppendorf tube
DPH2O (Double distilled purified water)
Tris (CAS No. 77-86-1, MB > 99.9%) (Bio Basic, catalog number: TB0195-500g )
SDS (CAS No. 151-21-3, MB > 99%) (Bio Basic, catalog number: SB0485-500g )
APS (Ammonium persulfate) (CAS No. 7727-54-0, ACS) (Amresco, catalog number: 0486-100G )
TEMED (N,N,N',N'-Tetramethyl ethylenediamine) (CAS No. 110-18-9, GR) (Sigma-Aldrich, catalog number: T9281-50mL )
Glycine (CAS No. 56-40-6, MB) (Bio Basic, Sangon Biotech, catalog number: A610235-0500 )
Acrylamide (CAS No. 79-06-1, MB ≥ 99%) (Sigma-Aldrich, catalog number: A8887-500G )
BIS (N,N'-methylenebisacrylamide) (CAS No. 110-26-9, MB ≥ 99.5%) (Sigma-Aldrich, catalog number: M7279-100G )
The cocoons of silkworm Bombyx mori (provided by Sericultural Institute, Soochow University, Suzhou, P. R. China)
Na2CO3 (AR, General Chemicals)
CaCl2 (AR, General Chemicals)
Ethanol (AR, General Chemicals)
0.2% Na2CO3 solution (see Recipes)
CaCl2/ethanol/H2O ternary system (Ajisawa’s reagent) (see Recipes)
30% acrylamide monomer solution (Cryl/Bis) (see Recipes)
Condensing gel buffer (1 mol/L Tris-HCl, 0.4%SDS, pH 6.8) (see Recipes)
Resolving gel buffer (1.5 mol/L Tris-HCl, 0.4% SDS, pH 8.8) (see Recipes)
10% SDS (see Recipes)
10% APS (ammonium persulfate) (see Recipes)
10% TEMED (see Recipes)
5% condensing gel buffer and 10% resolving gel buffer (see Recipes)
Equipment
Beaker
Hot plate
Triangular bottle
Water bath
Centrifuge (Beckman Coulter, model: Avanti J-30I , Rotor, catalog number: 363420 )
Dialysis cassette (Thermo Fisher Scientific, 5,000 MW cutoff, Slide-A-LyzerTM)
Mini-PROTEAN® 3 electrophoresis cell (Bio-Rad Laboratories, catalog number: 165-3301 )
PowerPac 1000 (Bio-Rad Laboratories, catalog number: 165-5054 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, Y. Q. (2018). SDS-PAGE for Silk Fibroin Protein. Bio-101: e3054. DOI: 10.21769/BioProtoc.3054.
Download Citation in RIS Format
Category
Biophysics > Bioengineering > Medical biomaterials
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,055 | https://bio-protocol.org/exchange/protocoldetail?id=3055&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Highly Sensitive Anion Exchange Chromatography Method for Measuring cGAS Activity in vitro
AH Andreas Holleufer
RH Rune Hartmann
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3055 Views: 5092
Edited by: Andrea Puhar
Reviewed by: Thomas Alexander PackardSaskia F. Erttmann
Original Research Article:
The authors used this protocol in Oct 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2017
Abstract
Cyclic GMP-AMP synthase (cGAS) is a pattern recognition receptor (PRR) that senses double stranded DNA (dsDNA) in the cytosol and this leads to the activation of stimulator of interferon genes (STING) via the secondary messenger 2’3’-cyclic GMP-AMP (2’3’-cGAMP). STING then recruits TANK binding kinase 1 (TBK-1) and this complex can phosphorylate and activate interferon regulatory factor 3 (IRF3) leading to the induction of type I interferons and other antiviral genes. The cGAS:DNA complex catalyzes the synthesis of 2’3’-cGAMP and the purpose of the protocol presented here is to measure the in vitro activity of purified cGAS in the presence of dsDNA. The protocol was developed to elucidate the relationship between dsDNA length and the level of cGAS activity. The method involves an in vitro reaction with low concentrations of cGAS and dsDNA followed by quantification of the reaction product using anion exchange chromatography. The low concentrations of cGAS and dsDNA and the high sensitivity of this assay is a key advantage when comparing different DNA fragments’ ability to activate cGAS.
Keywords: Cyclic GMP-AMP synthase cGAS 2'3'-Cyclic GMP-AMP cGAMP Nucleotidyl transferase Label-free enzyme assay
Background
The presence of double stranded DNA within the cytosol of a cell is a potential sign of infection by a DNA or retrovirus. The nucleotidyl transferase cGAS functions as a pattern recognition receptor that senses cytosolic dsDNA. cGAS is allosterically activated by dsDNA and catalyzes the conversion of ATP and GTP into the cyclic dinucleotide 2’3’-cGAMP (or simply cGAMP) (Ablasser et al., 2013; Civril et al., 2013; Diner et al., 2013; Gao et al., 2013; Kranzusch et al., 2013; Sun et al., 2013), which subsequently acts as a secondary messenger that induces an antiviral program in the infected cell. The active site of cGAS contains three acidic residues coordinating two magnesium ions. The role of these ions is to coordinate the triphosphate group of the donor nucleotide and the attacking hydroxyl group of the acceptor nucleotide. cGAS catalyzes the formation of cGAMP in two sequential steps. First, the triphosphate group of ATP is coordinated by the magnesium ions and the 2’-hydroxyl group of GTP makes a nucleophilic attack on the α-phosphate of ATP, which releases the β- and γ-phosphate as pyrophosphate. This leads to the formation of a noncanonical 2’,5’-phosphodiester linkage. The intermediate is then flipped around in the active site and now the triphosphate group of GTP is coordinated by the magnesium ions. This time the 3’-hydroxyl group of the AMP moiety makes the nucleophilic attack on the α-phosphate of GTP forming a 3’,5’-phosphodiester linkage (Civril et al., 2013; Gao et al., 2013; Hornung et al., 2014). Thus, the final product contains both a canonical and noncanonical phosphodiester linkage.
Not all dsDNA is equally efficient at activating cGAS. The minimum DNA length reported to activate cGAS in cells is 12 bp with guanosine overhangs (Herzner et al., 2015). However, the DNA’s ability to activate cGAS is strongly related to the length of the DNA. Increasing the DNA length leads to an increase in its ability to activate cGAS (Andreeva et al., 2017; Luecke et al., 2017). This effect is observed even when increasing the DNA length from 2 kb to 4 kb (Luecke et al., 2017). Furthermore, certain Y-form DNA generated during the reverse transcription of the HIV-1 genome is more potent at activating cGAS compared to conventional dsDNA of similar length (Herzner et al., 2015).
cGAMP acts as a secondary messenger that binds to the adaptor protein STING, and this leads to the induction of antiviral genes (Ablasser et al., 2013; Diner et al., 2013; Li et al., 2013; Sun et al., 2013; Zhang et al., 2013). STING is a transmembrane protein located in the endoplasmic reticulum (ER) membrane with a large C-terminal domain protruding into the cytosol (Ishikawa and Barber, 2008). When STING binds cGAMP, the complex moves to the Golgi apparatus and from there it moves to punctuated foci in the cytoplasm (Saitoh et al., 2009). The STING:cGAMP complex recruits TBK-1, and this leads to the phosphorylation of both STING and TBK-1. This phosphorylated complex can then phosphorylate and thereby activate IRF3, which then translocates to the nucleus where it induces the transcription of antiviral genes including type I interferons (Ishikawa et al., 2009; Tanaka and Chen, 2012). The STING:cGAMP complex will also activate nuclear factor kappa B (NFκB) transcription factors (Abe and Barber, 2014).
The method described in this protocol was used to show that the in vitro activation of recombinant human cGAS truncated to amino acids 155-522 (cGAS [155-522]) is dependent on DNA length. The tested interval of DNA lengths varied from 100 bp to 4,000 bp (Luecke et al., 2017). This method offers an alternative to thin layer chromatography (TLC)-based assays with radiolabeled ATP. Due to poor sensitivity, TLC-based assays normally use concentrations of both dsDNA and cGAS well above physiologically realistic concentrations. The advantage of using the protocol presented here is that no radioactivity or labeling of the substrates are needed and that the high sensitivity of this method makes it possible to use very low concentrations of both cGAS and dsDNA. In this protocol, the concentration of cGAS is ten-fold lower compared to classical TLC assays and we have avoided oversaturating the reaction with DNA. We use 1 ng/μl of dsDNA corresponding to 1.646 x 10-6 M bp. Assuming that one cGAS molecule covers approx. 20 bp (Andreeva et al., 2017), then 1.646 μM bp corresponds to 82.32 nM cGAS binding sites. Under this assumption, there is enough DNA to occupy about 82% of the cGAS used in this protocol. The use of low and approx. equimolar concentrations of cGAS and DNA (measured in cGAS binding sites) is important if you test DNA with small differences in affinity for cGAS. The impact of different affinities might be diminished if for example the DNA concentration is substantial above the saturation point.
This protocol allows for easy and robust quantifications of the cGAS product and compare reaction conditions (such as different buffers, DNA structures, DNA lengths, and cGAS preparations) but it is more time consuming than TLC when running multiple samples. The method described in this protocol was developed from a method designed to measure the activity of the oligoadenylate synthetase (OAS) proteins (Turpaev et al., 1997).
Materials and Reagents
1 ml single-use syringes (CHIRANA T. Injecta, catalog number: CH03001L )
100 ml and 500 ml GL45 thread reagent bottles including screw caps (SIMAX, catalog numbers: 1632414321100 and 1632414321500 )
50 ml tubes (SARSTEDT, catalog number: 62.547.254 )
Autoclaved 1.5 ml tubes (BRAND, catalog number: 780500 )
Cellulose acetate filter membranes 0.22 μm pore size (Frisenette, catalog number: CA047022 )
Disposable nitrile gloves
PCR tubes (VWR, catalog number: 211-0338 )
Pipette tips with barrier (Thermo Fisher Scientific, ARTTM)
Serological pipettes 10 ml (Th. Geyer, Labsolute, catalog number: 7695553 )
dsDNA diluted to a concentration of 5 ng/μl in water or buffer NE (NucleoSpin® Gel and PCR Clean-up) (MACHEREY-NAGEL, catalog number: 740609 )
Note: If agarose gel purification of the DNA is desired, use NucleoSpin® Gel and PCR Clean-up for extraction of the DNA (MACHEREY-NAGEL, catalog number: 740609 ).
Ice
100 mM ATP (Thermo Fisher Scientific, catalog number: R0441 )
100 mM GTP (Thermo Fisher Scientific, catalog number: R0461 )
Concentrated hydrochloric acid (Sigma-Aldrich, catalog number: 30721-1L )
Magnesium chloride hexahydrate (Sigma-Aldrich, catalog number: M2670-1KG )
Sodium hydroxide (VWR, catalog number: 28240.292 )
Sodium chloride (VWR, catalog number: 27810.295 )
Tris (VWR, catalog number: 103156X )
Ultrapure water 18.2 MΩ obtained from PURELAB Chorus 1 (Elga Veolia)
Zinc chloride (VWR, catalog number: 29156.231 )
Glycerol (VWR, catalog number: 24388.295 )
HEPES (VWR, catalog number: 30487.297 )
2 μM purified cGAS [155-522] stock (see Recipes)
MgCl2 (200 mM) (see Recipes)
ZnCl2 (10 mM) (see Recipes)
NaOH (5 mM) (see Recipes)
Tris (pH 7.5, 1 M) (see Recipes)
5x reaction buffer (see Recipes)
Buffer A (see Recipes)
Buffer B (see Recipes)
ATP (10 mM) (see Recipes)
GTP (10 mM) (see Recipes)
Equipment
2 ml sample loop for ÄKTApurifier 10 (GE Healthcare, catalog number: 18111402 )
ÄKTApurifier 10 (GE Healthcare)
Aluminum cooling block for PCR tubes (e.g., Sigma-Aldrich, catalog number: Z740270-1EA )
-80 °C freezer
Vacuum pump
Centrifuge for 1.5 ml tubes (Eppendorf, model: MiniSpin® , catalog number: 5452000018)
Injection needle for ÄKTApurifier 10 (GE Healthcare, catalog number: 18180142 )
Laboratory balance with a readability of 0.001 g
Microcentrifuge for PCR tubes (SpectrafugeTM Mini) (Sigma-Aldrich, Labnet International, catalog number: S7816EU-1EA )
pH electrode (VWR, catalog number: 662-1157 )
pH meter (VWR, catalog number: 662-1421 )
Pipetboy
Pipettes (Finnpipette, Thermo Fisher Scientific)
RESOURCE Q 1 ml (GE Healthcare, catalog number: 17117701 )
Thermal Cycler PCR machine (Bio-Rad Laboratories, model: T100TM )
Vacuum filter funnel for GL45 threaded reagent bottles and 47 mm filter membrane diameter, e.g., NalgeneTM Polysulfone Reusable Bottle Top Filter (Thermo Fisher Scientific, catalog number: DS0320-5045 )
Software
Unicorn 5.11 AA or 7 (GE Healthcare, catalog numbers: 28400955 or 29203853)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Holleufer, A. and Hartmann, R. (2018). A Highly Sensitive Anion Exchange Chromatography Method for Measuring cGAS Activity in vitro. Bio-protocol 8(20): e3055. DOI: 10.21769/BioProtoc.3055.
Download Citation in RIS Format
Category
Immunology > Host defense > General
Biochemistry > Other compound > cGAMP
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,056 | https://bio-protocol.org/exchange/protocoldetail?id=3056&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Murine Pharmacokinetic Studies
Alix F. Leblanc
Kevin M. Huang
Muhammad Erfan Uddin
JA Jason T. Anderson
MC Mingqing Chen
SH Shuiying Hu
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3056 Views: 13861
Edited by: Jia Li
Reviewed by: Rani OjhaGiada G Mondanelli
Original Research Article:
The authors used this protocol in Feb 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2018
Abstract
Murine pharmacokinetics (PK) represents the absorption, distribution, metabolism, and elimination of drugs from the body, which helps to guide clinical studies, ultimately resulting in more effective drug treatment. The purpose of this protocol is to describe a serial bleeding protocol, obtaining blood samples at six time points from single mouse to yield a complete PK profile. This protocol has proved to be rapid, highly repeatable, and relatively easy to acquire. Comparing with the conventional PK studies, this method not only dramatically reduces animal usage, but also decreases sample variation obtained from different animals.
Keywords: Blood Plasma Pharmacokinetic Submandibular vein Orbital venous plexus Cardiac puncture
Background
Pharmacokinetic, from ancient Greek pharmakon “drug” and kinetikos “movement”, studies how the body handle drugs. In vivo murine PK studies are crucial to ensure compounds have appropriate PK properties in preclinical pharmacology and toxicity studies. The drug concentration can be measured in the blood, plasma, urine or other easily sampled fluids. However, in vivo PK studies have been traditionally low-throughput experiments: 6-12 terminal blood samples per compound in triplicate, requires 18-36 mice per study. The high animal usage and labor-intensive sampling are main hurdle for this conventional assay. With the improving sensitivity of bioanalytical method, efforts to increase the PK throughout have been reported including the use of cassette dosing (Berman et al., 1997, Korfmacher et al., 2001), Snapshot PK method (Liu et al., 2008) and more recently, Fast PK (Reddy et al., 2012). We have established a serial bleeding protocol, in which six blood samples can be collected from same mice by a submandibular vein (cheek) bleed, the orbital bleed and a cardiac puncture (terminal bleed) at a very narrow time window after administration of drugs. The protocol ensures collection of blood at specific time point and decreases variability among multiple subjects with dramatically decreased animal usage. This method is extremely valuable for the murine pharmacokinetics study with limited number of animals, and compounds with short half-life or fast clearance property.
Materials and Reagents
Syringe: BD 1 ml Syringe with 27 G x 1/2 in needle (BD, catalog number: 309623 )
Capillary (Fisher Scientific, FisherbrandTM, catalog number: 22-362566 )
Oral gavage needle (Reusable Small Animal Feeding Needles) (Cadence Science, catalog number: 7905 )
Eppendorf tubes (Eppendorf® Safe-Lock microcentrifuge tubes) (Eppendorf, catalog number: 022363611 )
Non-sterile cotton gauze sponges (Fisher Scientific, FisherbrandTM, catalog number: 22-362178 )
Tubes to collect blood obtained from cardiac puncture (SARSTEDT, catalog number: 2022-07-31 )
Oatp1b2 KO and wild-type DBA mice (between 8 and 12 weeks of age, see Procedure for details)
Nilotinib (Chemietek, catalog number: CT-NL001 )
Paclitaxel (LC Laboratories, catalog number: P-9600 )
Saline (Hospira, NDC:0409-4888-02)
Hydroxypropyl methylcellulose (HPMC) (Sigma-Aldrich, catalog number: 09963-25G )
Cremophor EL (Sigma-Aldrich, catalog number: 238470-1SET )
Ethyl alcohol (Sigma-Aldrich, catalog number: E7023 )
Pipet rubber bulb for capillary tubes (Globe Scientific, catalog number: 51674 )
Isoflurane (Henry Schein, NDC 11695-7667-1)
0.5% (m/v) HPMC (see Recipes)
Equipment
Lancet, Goldenrod 4 or 5 mm (MEDIpoint, catalog number: Goldenrod ANIMAL LANCET 4MM )
Pipettes, 200 μl and 20 μl single channel pipette4 (Mettler-Toledo, ShopRAININ, model: Pipet-Lite XLS+, catalog numbers: 17014391 and 17014392 )
Red lamp (UL E187949F, 250V, 660W)
Scout Pro Balance (OHAUS, model: SP202 )
Tail vein injection platform (in low tail injection platform) (AIMS, catalog number: IL300 )
Centrifuge (Eppendorf, Mini spin plus, model: 5453 )
Sonicator (QSONICA, model: Q55 )
Vaporstick anesthesia Machine (Smiths Medical, Surgivet, model: V7015 )
Classic T3Vaporizer (Smiths Medical, Surgivet, model: VCT302 )
Digital vortex mixer (Fisher Scientific, FisherbrandTM, catalog number: 02-215-370 )
Software
WinNonlin 6.2 software (Pharsight, Leblanc et al., 2018)
Graph Pad prism 6.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Leblanc, A. F., Huang, K. M., Uddin, M. E., Anderson, J. T., Chen, M. and Hu, S. (2018). Murine Pharmacokinetic Studies. Bio-protocol 8(20): e3056. DOI: 10.21769/BioProtoc.3056.
Download Citation in RIS Format
Category
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,057 | https://bio-protocol.org/exchange/protocoldetail?id=3057&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Testing for Assortative Mating by Diet in Drosophila melanogaster
PL Philip T Leftwich
TC Tracey Chapman
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3057 Views: 4644
Reviewed by: Qin Tang
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Experimental studies of the evolution of reproductive isolation in real time are a powerful way to reveal the way that fundamental processes, such as mate choice, initiate divergence. Mate choice, while frequently described in females, can occur in either sex, and can be affected by the genetics or environment of an individual. Here we describe simple protocols for assessing mating outcomes in fruit flies, which in this context can be used to assess reproductive isolation derived from rearing on different diets over multiple generations.
Keywords: Ecological adaptation Diet Assortative mating Reproductive isolation Drosophila Mate choice Behavioural ecology
Background
Drosophila melanogaster is an important model for studying sexual selection, of which mate choice is a central component. Mate choice can be effected by many different variables such as direct and indirect genetic effects, environment and nutrition. This protocol was implemented in the previously published study (Leftwich et al., 2017). In that study, this assay was combined with microbiome characterization and manipulation to assess the impact of splitting a single population into two isolated groups reared on different diets over multiple generations.
Materials and Reagents
Flystuff Drosophila tube polypropylene (Scientific Laboratory Supplies, Flystuff, catalog number: FLY1318 )
Flystuff Cotton balls (Scientific Laboratory Supplies, Flystuff, catalog number: large for bottles FLY1200 and small for vials FLY1028 )
Fly morgue (Plastic Funnel and Plastic Beaker)
Thin paintbrush
Dissecting needle (Watkins & Doncaster, catalog number: D416 )
Pooter (homemade) (3 ml graduated Pasteur pipette, 6 mm rubber tubing, muslin)
The plastic pipette is connected to the rubber tubing with muslin acting as a physical barrier between pipette and tube. Individual flies may be collected into the pipette by inhaling gently through the rubber tubing.
Polystyrene Petri dishes, 90 mm (Fisher Scientific, FisherbrandTM, catalog number: 12654785 )
Filter paper, 90 mm, QL 100 (Fisher Scientific, FisherbrandTM, catalog number: 11566873 )
Parafilm
Drosophila melanogaster – stock lines Oregon-R and Dahomey (Bloomington Stock Center)
Carbon Dioxide, Industrial Grade, BOC, 40-VK
Fly food ingredients (store in a cool, dry place to maximize shelf life, do not keep for more than 12 months)
Active Dried Yeast, 500 g (BakeryBits, catalog number: BB-1606 )
Molasses
Agar (ForMedium, catalog number: AGA01 )
Cornmeal/Maize Flour
Sugar
Starch (Fisher Scientific, FisherbrandTM, catalog number: S/7960/60 )
Inactivated Brewer's Yeast
Propionic Acid (Sigma-Aldrich, catalog number: 402907 )
Nipagin M (Sigma-Aldrich, catalog number: H3547 )
Ethanol absolute (Thermo Fisher Scientific, catalog number: E/0600DF/C17 )
Red Grape Juice (BTP Drewitt Ltd.)
Sugar yeast agar (SYA) medium (see Recipes)
Cornmeal molasses yeast (CMY) medium (see Recipes)
Starch medium (see Recipes)
Grape juice plates (Purps) (see Recipes)
Equipment
Flystuff Drosophila Glass Stock Bottle (Scientific Laboratory Supplies, Flystuff, catalog number: FLY1086 )
Sharp scalpel
Flystuff Benchtop Flow Buddy System with Fly Pad and Gun (Scientific Laboratory Supplies, Flystuff, catalog number: FLY1010 )
Stereomicroscope (Leica Microsystems, model: Leica MZ75 )
Watson Marlow Food Dispenser (Watson-Marlow Fluid Technology Group, catalog number: 520Di )
Embryo collection cage Large (Scientific Laboratory Supplies, Flystuff, catalog number: FLY1214 )
Software
R v3.3.2 (R Core Team, 2017)
JMating v1.0 (Carvajal-Rodriguez and Rolan-Alvarez, 2006)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Leftwich, P. T. and Chapman, T. (2018). Testing for Assortative Mating by Diet in Drosophila melanogaster. Bio-protocol 8(20): e3057. DOI: 10.21769/BioProtoc.3057.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,058 | https://bio-protocol.org/exchange/protocoldetail?id=3058&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection and Differentiation of Multiple Viral RNAs Using Branched DNA FISH Coupled to Confocal Microscopy and Flow Cytometry
NB Nicholas van Buuren
KK Karla Kirkegaard
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3058 Views: 5217
Edited by: Longping Victor Tse
Reviewed by: Elizabeth V. Clarke
Original Research Article:
The authors used this protocol in Mar 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2018
Abstract
Due to the exceptionally high mutation rates of RNA-dependent RNA polymerases, infectious RNA viruses generate extensive sequence diversity, leading to some of the lowest barriers to the development of antiviral drug resistance in the microbial world. We have previously discovered that higher barriers to the development of drug resistance can be achieved through dominant suppression of drug-resistant viruses by their drug-susceptible parents. We have explored the existence of dominant drug targets in poliovirus, dengue virus and hepatitis C virus (HCV). The low replication capacity of HCV required the development of novel strategies for identifying cells co-infected with drug-susceptible and drug-resistant strains. To monitor co-infected cell populations, we generated codon-altered versions of the JFH1 strain of HCV. Then, we could differentiate the codon-altered and wild-type strains using a novel type of RNA fluorescent in situ hybridization (FISH) coupled with flow cytometry or confocal microscopy. Both of these techniques can be used in conjunction with standard antibody-protein detection methods. Here, we describe a detailed protocol for both RNA FISH flow cytometry and confocal microscopy.
Keywords: RNA flow cytometry RNA FISH Branched DNAs HCV Drug Resistance Genetic selection Viral evolution
Background
The barriers to development of antiviral drug resistance vary greatly depending on the compound used and the host or viral target chosen. RNA viruses have particularly low genetic barriers to the development of drug resistance as their polymerases have error rates as high as 10-4 to 10-5 misincorporations per nucleotide synthesized. This leads to exceptionally high genetic variability amongst progeny. However, the high level of diversity observed in RNA virus progeny does not always lead to high rates of genetic selection for progeny with increased fitness. This is often due to genetic dominance of drug-susceptible viruses that are present in the same cell as newly synthesized drug-resistant variants. Drug-resistant viral RNA must first be amplified and translated in its cell of origin, making newly synthesized drug-resistant viruses susceptible to dominant suppression by their drug-susceptible parents and cousins. We have coined the term “dominant drug targets” to describe viral targets with higher barriers to the development of antiviral drug resistance due to genetic dominance of drug-susceptible viruses. Study of genetic interactions and physical location of distinct viral genomes in the same cell required the development of the new technology described here.
To identify dominant drug targets for which tool antiviral compounds are available, we first generated drug-resistant viruses and built the mutations into an infectious cDNA clone. To test whether drug-resistant or drug-susceptible viruses were genetically dominant, we generated cells co-infected with drug-susceptible and drug-resistant viruses and then monitored selection from within them. In studies using poliovirus (Crowder and Kirkegaard, 2005; Tanner et al., 2014) and Dengue virus (Mateo et al., 2015) we were able to generate sufficiently high-titer virus stocks to perform coinfections at high multiplicities of infection and thus ensure that all cells in our cultures were coinfected. Recently, we expanded tests for dominance to hepatitis C virus (HCV) (van Buuren et al., 2018), for which high-titer stocks are often difficult to obtain, especially for drug-resistant variants that have reduced fitness. Therefore, when we co-infected Huh7.5.1 cells with two strains of HCV at multiplicities of infection of less than 1 PFU/cell, we generated four cell populations: co-infected cells, two types of singly infected cells and a significant population of uninfected cells. We needed to differentiate co-infected cells from the two types of singly infected cells and learn about genetic selection while doing so. To accomplish this, we were early adopters of the branched DNA (bDNA) technology originally developed by Affymetrix (now Thermo Fisher Scientific). This technology uses tiered DNA oligos to build a network of up to 8,000 fluorophores on each target RNA. This unique type of RNA fluorescent in situ hybridization (FISH) can be coupled with protein detection using standard antibody conjugation and detected using confocal microscopy (ViewRNA® Cell Plus Assay) and flow cytometry (PrimeFlowTM RNA Assay).
These bDNA FISH techniques first generate a series of target probes that bind the RNA of interest at adjacent sequences, but leave 3’ extensions of unique sequence to bind the pre-amplifier DNA that is complementary to two different probes. Cooperative binding of the pre-amplifier DNA to two probes increases the signal-to-noise ratio because any individual mistargeted probe cannot be amplified. Typically, twenty pairs of target probes are designed to bind the RNA of interest; this requires roughly 1,000 nucleotides of sequence space. Each of the twenty pre-amplifier DNAs is then bound by a series of amplifier DNAs, and then subsequently by a series of oligonucleotide-conjugated fluorophores. This process leads to the labeling of each individual target RNA with up to 8,000 fluorophores, sufficient to visualize individual RNAs by confocal microscopy. The PrimeFlow RNA Assay and ViewRNA Cell Plus Assay kits allow for simultaneous detection of three target RNAs. The available fluorophores for PrimeFlow are Alexa Fluor® 488, Alexa Fluor® 647 and Alexa Fluor® 750 and for ViewRNA are Alexa Fluor® 488, Alexa Fluor® 546 and Alexa Fluor® 647.
To apply this technology to dominant drug targeting in HCV, we needed to generate a strain of HCV with sufficient dissimilarity in its RNA sequence that we could differentiate it from wild-type viral RNA. To accomplish this, we generated three codon-altered versions of the JFH1 strain of HCV. Codon optimization algorithms available through GeneArt (Thermo Fisher Scientific) were used to design three approximately 1,000-nucleotide regions of the JFH1 genome that had altered codon usage but retained the same protein sequence. These codon-altered JFH1 strains all contained 200-250 synonymous mutations over the 1,000-nucleotide regions. Of these three strains, two demonstrated decreased fitness, likely due to disruption of RNA secondary structures required for viral replication (Pirakitikulr et al., 2016). The third strain, however, displayed growth kinetics that mimicked wild-type virus and could be used in co-infection experiments and differentiated from wild-type JFH1 using both RNA FISH and flow cytometry.
Materials and Reagents
Pipette tips (with or without filter tips)
Micro slides (VWR, catalog number: 48311-702)
Micro cover glass (VWR, catalog number: 48380-046)
GenePulser cuvettes, 4 mm (Bio-Rad Laboratories, catalog number: 1652088)
BD FACS tubes (BD Falcon, catalog number: 352054)
12-well cell culture dish (e.g., Corning, Costar, catalog number: 3513)
10 cm tissue culture dish (e.g., Corning, catalog number: 430167)
T150 tissue culture flask (e.g., Corning, catalog number: 430825)
15 ml conical centrifuge tube (e.g., AccuFlow, catalog number: EK-4020)
500 ml Rapid-Flow Filter Unit, 0.2 μm (Thermo Fisher Scientific, catalog number: 566-0020)
Huh7.5.1 cells (Gift from Dr. Michael Gale Jr., University of Washington)
PrimeFlowTM RNA Assay Kit (Thermo Fisher Scientific, catalog number: 88-18005-210) contains:
Flow Cytometry Staining Buffer
Fixation Buffer 1
Permeabilization Buffer with RNase Inhibitors
Fixation Buffer 2
Wash Buffer
Target Probe Diluent
PreAmp Mix
Amp Mix
Label Probe Diluent
100x Label Probes
ViewRNA® Cell Plus Assay Kit (Thermo Fisher Scientific, catalog number: 88-19000) contains:
Fixation/Permeabilization Buffer
Blocking/Antibody Diluent
Fixative
Probe Set Diluent
Amplifier Diluent along with Pre-Amplifiers and Amplifiers
Label Probe Diluent and Label Probes
Wash Buffer
PBS
DAPI
Target Probes (Thermo Fisher Scientific)
Wild-type JFH1 (VF1-14301)
Codon altered JFH1 (VF4-6000723)
Permafluor Mounting Reagent (Thermo Fisher Scientific, catalog number: TA-030-FM)
0.05% Trypsin-EDTA (Thermo Fisher Scientific, Gibco, catalog number: 25300-054)
XbaI and CutSmart Buffer (New England Biolabs, catalog number: R0145L)
MEGAscript T7 Kit (Thermo Fisher Scientific, Invitrogen, catalog number: AMB1334-5)
Trizol® Reagent (Thermo Fisher Scientific, Ambion, catalog number: 15596018)
QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106)
Human AB Serum (Omega, catalog number: HS-20)
Pen/Strep (Thermo Fisher Scientific, catalog number: 15140-122)
Glutamax (Thermo Fisher Scientific, catalog number: 35050-061)
Non-essential amino acids (Thermo Fisher Scientific, catalog number: 11140-050)
DMEM (GE Healthcare, Hyclone, catalog number: SH30243.01)
Fetal bovine serum (Omega, catalog number: FB-22)
KCl
CaCl2
K2HPO4
HEPES
EDTA
MgCl2
Human serum media (see Recipes)
10% FBS media (see Recipes)
CytoMix (see Recipes)
Equipment
Pipettes (with or without filter tips)
Ultrafine forceps (e.g., Excelta, catalog number: 5-SN)
Modified BD FACScan (Scanford) or LSRII Flow Cytometer
Bio-Rad GenePulser XCell
Biosafety Cabinet (BSC)
Incubator (VWR, model: Model 1565)
Heat Block (e.g., Anodized Aluminum, see Figure 2)
Leica SP8 Confocal Microscope (Leica Microsystems, model: Leica TCS SP8)
Sorvall Centrifuge (e.g., Thermo Fisher Scientific, model: Legend RT plus)
Heracell 150i CO2 Incubator (Thermo Fisher Scientific, model: HeracellTM 150i)
-20 °C Freezer
Refrigerator
Software
FlowJo® v10.0
Volocity v6.0 (PerkinElmer)
Adobe Photoshop vCS4
GraphPad Prism v7.0
Microsoft Excel v16.0
Procedure
Construction of codon altered sequences
Roughly 1,000 nucleotides of RNA sequence are required to support the hybridization of twenty bDNA trees and 8,000 fluorophores. Targets that contain less than the full complement of bDNAs can still be detected by flow cytometry but require higher copy numbers to achieve the same resolution.
For viral RNAs, when possible, scan the literature for any structural information available to determine which areas of the genome are the least likely to contain essential RNA secondary structures. If possible, also choose a region that has convenient cut sites for insertion of your codon-altered sequence. We chose to clone three codon-altered regions of the JFH1 genome because we anticipated decreased viability from some of the codon-altered strains.
GeneArt is a product offered through Thermo Fisher Scientific and can be used to synthesize genes up to 9,000 bp in length (https://www.thermofisher.com/us/en/home/life-science/cloning/gene-synthesis/geneart-gene-synthesis.html). The GeneArt homepage offers several tools, including the gene optimizer tool. Use the gene optimizer algorithms to design codon-altered sequences with wild-type viral RNA sequence as your template. We submitted three regions of JFH1 that were all roughly 1,000 nucleotides in length and flanked by convenient cut sites. The optimizer tool was able to alter nearly 25% of nucleotides in all three cases.
The newly synthesized sequence will arrive incorporated into a plasmid with a defined antibiotic-resistance marker. At this time, your codon-altered gene fragment can be subcloned into a plasmid that encodes the viral genome using restriction digestion and ligation.
Target Probes that differentiated viral RNA sequences were designed and manufactured by Affymetrix (now Thermo Fisher Scientific) for use with both the ViewRNA and PrimeFlow platforms (Figure 1).
Figure 1. Detection of target RNAs using branched DNA technology. Branched DNA technology for RNA detection can be coupled with confocal microscopy or flow cytometry. Target RNAs are first bound by pairs of Target Probes. Typically, twenty sets of target probe pairs are designed per target RNA. The Pre-Amplifier DNA only binds target probe pairs that are bound to target RNAs in the correct orientation; this greatly limits the signal to noise ratio. Pre-Amplifier DNAs are then bound by Amplifier DNAs and subsequently by Label Probes. This process results in the labeling of target RNAs by up to 8,000 fluorophores.
Collection of codon-altered JFH1 virus stocks
The pJFH1 plasmid encodes the full-length genome of the JFH1 strain of HCV. The wild-type plasmid and all codon-altered versions contain an XbaI cut site at the 3’ end of the genome. Digest 5 μg of plasmid DNA with 20 U of XbaI in the CutSmart Buffer provided in a final reaction volume of 25 μl. Incubate digestions at 37 °C for 2 h.
Purify linearized DNA using the QIAquick PCR Purification Kit, as per manufacturer’s protocol.
Using 1 μg of linearized plasmid as your template, perform in vitro transcription with the MEGAscript T7 kit to make full-length genomic viral RNA. Incubate in vitro transcription reaction at 37 °C for 6 h. The temperature and duration of this incubation can be altered for optimal yield of individual transcripts.
Isolate synthesized viral RNA using Trizol as per the manufacturer’s protocol. Resuspend vRNA pellet in 50 μl of RNase-free water.
Seed 107 Huh7.5.1 cells into a 10 cm tissue culture plate and incubate overnight.
To electroporate 10 μg vRNA into 107 Huh7.5.1 cells to produce continuous HCV cultures:
Wash Huh7.5.1 cells with 5 ml PBS.
Add 2 ml of Trypsin and incubate at 37 °C for 5 min.
Add 5 ml of 10% FBS media and harvest cell suspension into a 15 ml conical tube.
Centrifuge cells at 400 x g for 4 min.
Resuspend cell pellet in 5 ml of PBS.
Centrifuge cells at 400 x g for 4 min.
Resuspend cell pellet with 5 ml of CytoMix. Cytomix recipe can be found below under “Recipes”.
Centrifuge cells at 400 x g for 4 min.
Resuspend cell pellet in 400 μl of CytoMix and transfer to a 4 mm GenePulser cuvette.
Mix 10 μg of viral RNA into cell suspension inside cuvette and gently pipet up and down to mix.
Electroporate RNA-cell mixture using the Bio-Rad GenePulser XCell. Settings set to 950 μF capacitance, 270 V, ∞ resistance and 4 mm cuvette size.
Allow cells to rest at room temperature for 10 min.
Transfer electroporated cells to a fresh 10 cm culture dish with 10 ml of 10% FBS media (see Recipes).
Culture electroporated cells for up to two weeks in 10% FBS media, passaging every 3-4 days as required. As you passage, expand the culture. Typically, cultures of 107 electroporated cells are expanded into either five or ten T150 flasks. This gives HCV time to spread and generates a culture with a higher percentage of cells that are infected and productively synthesizing progeny virus. Further expansion of cells to larger capacity can be done if needed.
Convert JFH1 cultures to Human Serum Media (Steenbergen et al., 2013). Growth of HCV in human serum has two benefits. First, Huh7.5.1 cells differentiate and cease cell division, therefore trypsinization and biweekly passage are no longer required. Instead, virus containing cell supernatants can simply be collected biweekly and directly replaced with fresh medium. Second, growth in Human Serum Media increases viral yield by 10 to 100-fold.
Simultaneous infection with two HCV strains and detection of co-infected cells with Prime-Flow
The description of this protocol has been adapted from the PrimeFlow Assay user’s manual.
Huh7.5.1 cells are seeded into 12-well plates at a density of 105 cells per well using 1 ml of 10% FBS media.
In our hands, JFH1 cultured in human serum media can produce viral titers of 105-106 focus forming units (FFU) per ml. Infect Huh7.5.1 cells at a multiplicity of infection of one virus particle per cell with both wild-type and codon-altered JFH1. This often equates to roughly 1-2 ml of each virus preparation. A total volume of 4 ml can be used carefully in 12-well plates.
Incubate infected cells in a CO2 incubator at 37 °C for 4-6 h. Following initial incubation, remove virus-containing media by aspiration. Replace media with fresh 10% FBS media and incubate infected cells for 72 h.
Replace 10% FBS media with fresh 10% FBS media that either contains antiviral drugs or vehicle and incubate infected cells for 24-36 h.
Aspirate off media containing antivirals or vehicle and wash cells with 1 ml PBS.
Harvest infected cells by treating cells with 0.5 ml trypsin and incubating at 37 °C with CO2 for 5 min.
Inhibit trypsin by adding 1 ml of 10% FBS media to each well. Harvest all cells and transfer to one of the 1.5 ml microfuge tubes supplied in the PrimeFlow Assay kit.
Spin cells at 400 x g for 5 min.
Aspirate off media and trypsin, being careful not to lose any cells. This is achieved by only aspirating down to the 100 μl marker on the side of the Eppendorf tube. Wash cells with 1 ml of Flow Cytometry Staining Buffer. Vortex and spin at 400 x g for 5 min.
Aspirate Flow Cytometry Staining Buffer and fix cells using 1 ml of Fixation Buffer 1 at 4 °C for 30 min.
Spin cells at 800 x g for 5 min.
Resuspend cells in 1 ml of Permeabilization Buffer. Spin cells at 800 x g for 5 min. Repeat wash with Permeabilization Buffer 3 x.
Aspirate final Permeabilization Buffer wash and resuspend cells in 1 ml of Fixation Buffer 2. Incubate cells in the dark at room temperature for 60 min.
Spin cells at 800 x g for 5 min and resuspend in 1 ml of Wash Buffer.
Repeat wash step.
Dilute Target Probes in Target Probe Diluent at 1:20.
Resuspend cells in 100 μl of the Target Probe mixture. Incubate at 40 ± 1 °C for 2 h. We use a heat block in our 40 °C incubator to increase heat conduction to the tubes and protect from large fluctuation in heat (Figure 2). This incubation can be extended from 2 h to overnight. Longer incubations periods allowed for all amplification steps, flow cytometry and data analysis to be completed the following day.
Figure 2. 40 ± 1 °C incubator setup. Two heat blocks are stored in the incubator to regulate the temperature of RNA FISH flow cytometry samples. A thermometer is kept inside to confirm the digital temperature readings.
Wash cells by adding 1 ml of Wash Buffer, vortex, and spin at 800 x g for 5 min.
Repeat wash step.
Resuspend cells in 100 μl of PreAmp Mix. Incubate at 40 ± 1 °C for 1.5 h.
Wash cells by adding 1 ml of Wash Buffer, vortex, and spin at 800 x g for 5 min.
Repeat wash step.
Resuspend cells in 100 μl of Amp Mix. Incubate at 40 ± 1 °C for 1.5 h.
Wash cells by adding 1 ml of Wash Buffer, vortex, and spin at 800 x g for 5 min.
Repeat wash step.
Prepare Label Probe mix by diluting Label Probes into the Label Probe Diluent at 1:100.
Resuspend cells in 100 μl of Label Probe mix. Incubate at 40 ± 1 °C for 1 h.
Wash cells by adding 1 ml of Wash Buffer, vortex, and spin at 800 x g for 5 min.
Repeat wash step.
Aspirate Wash Buffer leaving 100 μl of residual liquid to resuspend stained cells. Resuspend cells by pipetting up and down and transfer to a labeled BD FACS tube containing 250 μl of PBS.
Analyze cells using a flow cytometer and FlowJo software (details below).
Quantitation of RNA-protein colocalization using confocal microscopy
Huh7.5.1 cells are plated on Micro Cover Glass inside 12-well tissue culture plates at a density of 105 cells per well one day prior to infection (Figure 3).
Figure 3. Reagents setup for confocal microscopy. Huh7.5.1 cells are plated onto Micro Cover Glass within a 12-well tissue culture plate. These cells are infected following a 24 h incubation to allow cell adherence to the glass. Following infection, the cells are fixed, stained for protein and RNA using the ViewRNA Cell Plus Assay kit, all within the 12-well plate. The Micro Cover Glass is then carefully transferred to a Microslide spotted with PermaFluor/DAPI using fine forceps.
Co-infect cells with wild type JFH1 and codon altered JFH1 at a multiplicity of infection equal to one virus per cell.
At 6 h post infection, aspirate inoculum and replace with 1 ml of 10% FBS media.
At 24 h post infection, wash cells 2 x with 1 ml of PBS.
Add 400 μl of Fixation/Permeabilization Buffer to each well and incubate for 30 min at room temperature.
Wash cells 3 x each with 800 μl of PBS.
Overlay cells with 400 μl of Blocking/Antibody Diluent and incubate at room temperature for 20 min.
Dilute primary antibody in 400 μl Blocking/Antibody Diluent as required. Overlay cells with antibody mixture and incubate at room temperature for 1 h.
Wash cells three times with PBS.
Dilute secondary antibody in 400 μl Blocking/Antibody Diluent as required. We use anti-mouse AlexaFluor-647 diluted at 1:200 for our experiment with HCV. Overlay cells with antibody mixture and incubate at room temperature for 1 h.
Wash cells 3 x with PBS.
Add 400 μl of Fixation Solution to each well and incubate in the dark at room temperature for 1 h.
Wash cells 3 x with PBS.
Dilute Target Probes1:100 in Target Probe Diluent.
After the final wash, overlay cells with 400 μl of Target Probe mixture. Incubate at 40 ± 1 °C for 2 h.
Wash cells 3 x with 800 μl Wash Buffer at room temperature.
Dilute Pre-Amplifiers 1:25 in Amplifier Diluent.
After the final wash, overlay cells with 400 μl of Pre-Amplifier mixture and incubate at 40 ± 1 °C for 1 h.
Wash cells 3 x with 800 μl Wash Buffer at room temperature.
Dilute Amplifiers 1:25 in Amplifier Diluent.
After the final wash, overlay cells with 400 μl of Amplifier mixture and incubate at 40 ± 1 °C for 1 h.
Wash cells 3 x with 800 μl Wash Buffer at room temperature.
Dilute Label Probes 1:100 in Label Probe Diluent.
After the final wash, overlay cells with 400 μl of Label Probe mixture and incubate at 40 ± 1 °C for 1 h.
Wash cells 3 x with 800 μl Wash Buffer at room temperature.
Dilute DAPI 1:100 in Permafluor mounting reagent.
Spot 12.5 μl of Permafluor/DAPI mixture onto a Micro Slide.
Using forceps, carefully remove stained Micro Cover Glass from the 12-well dish, dab on a Kimwipe to remove excess Wash Buffer and place “cells down” onto the drop of Permafluor/DAPI. Allow to harden for at least 4 h.
Visualize cells using a confocal microscope. We use a Leica SP8 Confocal Microscope fitted with a White Light Laser.
Data analysis
Flow cytometry
We analyze all flow cytometry data using FlowJo software. Data are exported from the flow cytometer as individual .fcs files for each sample as well as a .wsp file for the entire experiment. We use FlowJo to open the .wsp file and can then access all .fcs files in the same analysis window. Once files are open in FlowJo data analysis proceeds as follows:
Open your first sample and select forward scatter versus side scatter to view cells collected. Draw a gate around the healthy cells only so that any debris or dead cells are not included in your analysis.
Within your healthy cell subgate, plot the two viral RNA fluorophores against one another. In our case this was typically Alexa Fluor 488 versus Alexa Fluor 750 which did not require compensation. If you are working with Alexa Fluor 657 and Alexa Fluor 750 you will need to run the compensation algorithm within FlowJo before further analysis.
Once data are plotted and compensated, if needed, reset the axes to biexponential (Biex) which minimizes the uninfected cells and emphasizes the viral RNA-positive populations for clearer resolution.
Draw quadrants that divide uninfected cells from the two singly infected cells and coinfected cells.
The percentages from each population will be used to determine the dominance relationships between viral species. In the absence of drug, four cell populations will be visible. In the presence of drug, the cells singly infected with drug-susceptible virus will become uninfected and shift into the lower left quadrant. The singly infected drug-resistant virus will persist. The genetic outcome of the co-infected cells will determine their fate (Figure 4).
Figure 4. Identification of co-infected cells by PrimeFlow RNA FISH. Huh7.5.1 cells were infected with JFH1-CA, JFH1-WT or co-infected at multiplicities of infection equal to one virus per cell with each virus. Infected cells were incubated for 72 h before labeling viral RNAs using PrimeFlow. Analysis and compensation was performed using FlowJo.
Confocal microscopy
The Leica SP8 creates a file containing all images as a .lif file. The individual channels are exported as individual .tif files for image processing and figure construction (Figure 5).
Figure 5. Analysis of viral RNA-protein colocalization using ViewRNA Cell Plus. Huh7.5.1 cells were co-infected with JFH1-WT and JFH1-CA on Micro Cover Glass for 72 h. Cells were stained for HCV core protein and both viral RNAs using the ViewRNA Cell Plus Assay. Quantification of colocalization was performed using Volocity software. Scale bars are 2.5 μm in length.
The .lif file can also be opened using Volocity software created by PerkinElmer.
Volocity has a spot-counting algorithm to determine how many puncta exist within each channel. We define a single punctum as larger than 0.1 μm2 and smaller than 0.25 μm2, and ask Volocity to break larger spots into individual units. Confirm that your size range is appropriate by giving a few cells an eye test. Does the number of puncta counted appear to be the same number that you can count by eye? You may need to adjust your maximum and minimum punctum sizes based on this test.
We then ask Volocity to determine colocalization by counting how many spots on our Red channel shared at least 0.05 μm2 of “Mutual Space” with puncta the Green channel. The result is plotted as the total number of puncta that share mutual space between channels versus the total number of puncta in each channel.
Determining colocalization between RNA and protein requires a separate algorithm as the proteins often not localize into discrete countable puncta. We therefore ask Volocity to determine how many of the viral RNA puncta “Touch” anywhere within the protein signal. We then graph the number of RNA puncta that touched protein versus the total number of RNA puncta in each cell.
Notes
We prefer to use the swinging bucket Sorvall centrifuge for all spins for flow cytometry as the cell pellet accumulates at the bottom of the PrimeFlow assay kit-supplied microfuge tubes, which limits cell loss during the multiple-step procedure. However, it is possible to complete the protocol and limit cell loss using a traditional bench top, fixed-angle centrifuge, with careful supernatant removal.
Simultaneous analysis of the Alexa Fluor 647 and Alexa Fluor 750 channels requires a high degree of compensation. To identify double-positive cells unambiguously, use Alexa Fluor 488 in combination with either of the other two channels.
As PrimeFlow is often coupled with antibody staining, it should be noted that not all fluorophores survive the RNA staining protocol. Specifically, all PerCP fluorophores will be inactivated by this technique and should be avoided in panel design.
Coverglass slips are very delicate and can easily break as they are being lifted out of the 12-well plate and placed onto the microslide. Using anything other than fine forceps makes this challenging. New students in our lab are encouraged to practice this technique using blank Micro Cover Glass in PBS prior to attempting a real experiment.
Recipes
Human serum media
2% human AB serum
1x Pen/Strep
1x glutamax
1x non-essential amino acids
DMEM
10% FBS media
10% fetal bovine serum
1x Pen/Strep
1x glutamax
1x non-essential amino acids
DMEM
CytoMix
120 mM KCl
0.15 mM CaCl2
10 mM K2HPO4
25 mM HEPES
2 mM EDTA
5 mM MgCl2
Adjust pH to 7.6
Filter through a 0.2 μm Rapid-Flow Filter Unit
Acknowledgments
We thank Drs. Yury Goltsev and Garry Nolan for advice on fluorescent cell sorting-based visualization of RNA, Affymetrix for the design and manufacturing of custom viral RNA probes, and Drs. Michael Gale Jr. and Ralf Bartenschlager for the generous donation of reagents.
This work was supported by funding to KK from NIH U19AI109662 (Jeffrey Glenn, P.I.), an NIH Director's Pioneer Award and the Alison and Steve Krausz Innovation Fund. NvB was supported by the Canadian Institutes for Health Research NCRTP-HepC training program and the American Liver Foundation. The Cell Sciences Imaging Facility used for confocal microscopy was supported by ARRA award number 1S10OD010580 from the NCRR. The contents of this manuscript are solely the responsibility of the authors and do not necessarily represent the official views of the NCRR or the National Institutes of Health.
Competing interests
The authors have no conflicts of interest or competing interests.
References
Crowder, S. and Kirkegaard, K. (2005). Trans-dominant inhibition of RNA viral replication can slow growth of drug-resistant viruses. Nat Genet 37(7): 701-709.
Mateo, R., Nagamine, C. M. and Kirkegaard, K. (2015). Suppression of drug resistance in dengue virus. MBio 6(6): e01960-01915.
Pirakitikulr, N., Kohlway, A., Lindenbach, B. D. and Pyle, A. M. (2016). The coding region of the HCV genome contains a network of regulatory RNA structures. Mol Cell 62(1): 111-120.
Steenbergen, R. H., Joyce, M. A., Thomas, B. S., Jones, D., Law, J., Russell, R., Houghton, M. and Tyrrell, D. L. (2013). Human serum leads to differentiation of human hepatoma cells, restoration of very-low-density lipoprotein secretion, and a 1000-fold increase in HCV Japanese fulminant hepatitis type 1 titers. Hepatology 58(6): 1907-1917.
Tanner, E. J., Liu, H. M., Oberste, M. S., Pallansch, M., Collett, M. S. and Kirkegaard, K. (2014). Dominant drug targets suppress the emergence of antiviral resistance. Elife 3: e03803.
van Buuren, N., Tellinghuisen, T. L., Richardson, C. D. and Kirkegaard, K. (2018). Transmission genetics of drug-resistant hepatitis C virus. Elife 7: e32579.
Copyright: van Buuren and Kirkegaard. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
van Buuren, N. and Kirkegaard, K. (2018). Detection and Differentiation of Multiple Viral RNAs Using Branched DNA FISH Coupled to Confocal Microscopy and Flow Cytometry. Bio-protocol 8(20): e3058. DOI: 10.21769/BioProtoc.3058.
van Buuren, N., Tellinghuisen, T. L., Richardson, C. D. and Kirkegaard, K. (2018). Transmission genetics of drug-resistant hepatitis C virus. Elife 7: e32579.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > RNA
Cell Biology > Cell imaging > Confocal microscopy
Molecular Biology > DNA > DNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,059 | https://bio-protocol.org/exchange/protocoldetail?id=3059&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pneumatic Method to Measure Plant Xylem Embolism
PB Paulo R. L. Bittencourt*
LP Luciano Pereira*
RO Rafael S. Oliveira
*Contributed equally to this work
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3059 Views: 5974
Edited by: Amey Redkar
Reviewed by: Christine ScoffoniDheeraj Singh Rathore
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Embolism, the formation of air bubbles in the plant water transport system, has a major impact on plant water relations. Embolism formation in the water transport system of plants disrupts plant water transport capacity, impairing plant functioning and triggering plant mortality. Measuring embolism with traditional hydraulic methods is both time-consuming and requires large amounts of plant material. While the stem hydraulic methods measure loss of xylem hydraulic conductance due to embolism formation, the pneumatic method directly quantifies the amount of emboli inside the xylem as changes in xylem air content. The pneumatic method is an easy and fast (8+ embolism curves per day) method to measure plant embolism requiring minimal plant material. Here, we provide detailed descriptions and recent technical improvements on the pneumatic method.
Keywords: Embolism resistance Plant drought stress Hydraulic failure Plant pneumatics
Background
Plant xylem embolizes due to the entry of air into the xylem vessels under drought conditions. Resistance to embolism formation is one of the most important plant traits strongly determining species distribution, mortality and evolution (Choat et al., 2012; Rowland et al., 2015; Larter et al., 2017) and has been recently suggested as a key trait to model plant function and predict plant responses to global changes (Sperry and Love, 2015; Brodribb, 2017). Most methods used to estimate embolism resistance measures the hydraulic conductivity of embolized branch segments and relate it to the hydraulic conductance of the branch segment without embolism (Sperry et al., 1988; Melcher et al., 2012). These methods are usually time-consuming and prone to several artifacts (Wheeler et al., 2013; Trifilò et al., 2014; Beikircher and Mayr, 2016).
The pneumatic method has been recently proposed as an alternative method to estimate embolism resistance from a different point of view, not from the water flow perspective but from the direct consequence of embolism-air presence in the xylem (Pereira et al., 2016). As plant embolizes, air spaces inside the xylem increase. Embolism thus changes the pneumatic properties of branch segments. In this method, a vacuum is applied to a cut branch and the air flowing outside the branch is measured as an estimate of xylem air content. A strong relationship exists between air flow outside the branch segment and the amount of emboli in the branch xylem (Pereira et al., 2016; Zhang et al., 2018). The vacuum method presents a simple, low cost, fast and practical method to measure plant embolism. Additionally, the pneumatic method does not require rehydrating (flushing water) through samples in which the effects of drought are being studied.
Materials and Reagents
Pneumatic apparatus
Adapter Luers (Cole-Parmer, catalog numbers: EW-30800-06 and EW-30800-24)
1 L Kitasato flask (Prolab, catalog number: PL287)
Silicone tubing (3 mm ID and 5.2 mm OD and 4.9 mm ID and 9.7 mm OD, larger or smaller sizes depending on sample diameter, with preferences for thick walled tubes, as they seal better after clamping)
Rigid tubing (Cole-Parmer, catalog number: EW-30600-62)
Vacuum source, either a syringe or vacuum pump (Prolab, catalog numbers: 032357 and VAC29-110, respectively)
Three-way stopcock (Cole-Parmer, catalog number: EW-30600-07)
Vacuum reservoir (a container or tube with rigid walls to store vacuum; 1-10 ml volume is usually enough)
Vacuum meter, 30 to 110 kPa recommended (Honeywell, catalog numbers: 142PC05D or 26PCCFA6D or MPX5100AP; NXP Semiconductors; Netherlands. Farnell, catalog numbers: 1386589, 731766 and 1457156, respectively)
Sample preparation and handling
Plastic glue
Plastic paraffin film (Prolab, catalog number: PM996)
Plastic clamps (Cole-Parmer, catalog number: RZ-06832-02) and/or zip ties
Equipment
Voltage meter
Pliers
Sharp razors
Voltmeter or voltage logger (1 mV precision for 142PC05D or MPX5100AP, 0.01 mV precision for 26PCCFA6D)
Alternative: Pneumatic Shield for Arduino UNO microcontroller board (Plant Technology and Environmental Monitoring–PLANTEM), to use with 26PCCFA6D (see details in the Figure 4)
Xylem water potential measurement
Pressure chamber (PMS Instruments, model: PMS 1000, or other)
Notebook and USB digital microscope (Jiusion, or other)
Note: We discourage the use of magnifying glasses because of safety issues.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bittencourt, P. R. L., Pereira, L. and Oliveira, R. S. (2018). Pneumatic Method to Measure Plant Xylem Embolism. Bio-protocol 8(20): e3059. DOI: 10.21769/BioProtoc.3059.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Plant Science > Plant physiology > Water transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
306 | https://bio-protocol.org/exchange/protocoldetail?id=306&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Nuclear Extraction from Arabidopsis thaliana
Fang Xu
Charles Copeland
Published: Vol 2, Iss 24, Dec 20, 2012
DOI: 10.21769/BioProtoc.306 Views: 33697
Original Research Article:
The authors used this protocol in Jun 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2012
Abstract
This protocol is to isolate nuclei from Arabidopsis cells. They can be further used for other experiments, such as nuclear protein detection, nuclear protein immunoprecipitation and so on.
Materials and Reagents
Tris-HCl (pH 7.4)
Glycerol
KCl
EDTA (pH 7.5)
MgCl2
Sucrose
Triton X-100
Murashige and Skoog basal medium (Sigma-Aldrich, catalog number: M0404-10L )
Phenylmethanesulfonylfluoride (PMSF)
Dithiothreitol (DTT)
Proteinase inhibitor (PI) (complete EDTA-free) (Roche Diagnostics, catalog number: 04693132001 )
Phytagel (Sigma-Aldrich, catalog number: P8169-1KG )
Liquid nitrogen
Lysis buffer (LB) (see Recipes)
Nuclei resuspension buffer with 0.2% Triton X-100 (NRBT) (see Recipes)
Nuclei resuspension buffer (NRB) (see Recipes)
Nuclei storage buffer (NSB) (see Recipes)
MS (see Recipes)
Equipment
Centrifuges (e.g. Eppendorf centrifuge 5810 R that can be refrigerated and will hold 50 ml tubes)
Mortar and pestle
100 μm and 40 μm nylon mesh (BD Biosciences, Falcon®, catalog number: REF352360 , REF352340 )
50 ml conical tube
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Organelle isolation
Systems Biology > Proteomics > Nuclear
Cell Biology > Organelle isolation > Nuclei
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,060 | https://bio-protocol.org/exchange/protocoldetail?id=3060&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Rice Ragged Stunt Virus Propagation and Infection on Rice Plants
CZ Chao Zhang
CS Chaonan Shi
DC Dong Chen
Jianguo Wu
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3060 Views: 5112
Edited by: Feng Li
Reviewed by: Sonali Chaturvedi
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
Virus inoculation is a basic experimental procedure to evaluate the resistance of a rice variety or a transgenic material upon virus infection. We recently demonstrated that Rice Ragged Stunt Virus (RRSV), an oryzavirus that is transmitted by brown planthopper (BPH), can suppress jasmonic acid-mediated antiviral defense through the induction of microRNA319 and facilitate virus infection in rice. To verify this, we performed virus inoculation experiments on wild-type rice plants and miR319-TCP21-associated transgenic rice plants through a modified group inoculation method. Here, we presented the detailed procedure of RRSV propagation and infection process on rice plants.
Keywords: Rice ragged stunt virus RRSV Brown planthopper Virus inoculation
Background
Studying mechanism of viral pathogenesis and screening virus-resistant rice varieties have been doing to overcome rice virus diseases and keep food security. In this field, virus inoculation is the essential and reliable method to evaluate the resistance of a transgenic material or a rice variety. Rice Ragged Stunt Virus (RRSV) can transmit rice ragged stunt disease by brown planthopper in a persistent propagative manner in many Asian countries (Ling et al., 1978; Hibino, 1979). Two classical methods, including single seedling inoculation and group inoculation, had been applied to conduct virus inoculation experiments (Zhang et al., 2013). By modifying traditional group inoculation method, we provided a convenient approach which closely resembles the natural infection condition.
Materials and Reagents
Pipette tips (RNase free 1 ml, 0.2 ml and 0.02 ml, Corning, Axygen®, catalog numbers: T-1000 , T-200 , TF-20 )
1.5 ml clear Microtubes (Corning, Axygen®, catalog number: MCT-150-C )
Clip-cage (Home-made, 40 x 30 x 35 cm, Figure 1A)
Artificial suction-implement (Home-made, Figure 1B)
Ceramic mortar (external diameter = 120 mm)
PVDF membrane (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88585 )
Filter paper (Bio-Rad Laboratories, catalog number: 1703967 )
Figure 1. Home-made clip-cage and artificial suction-implement used in this study. A. Clip-cage used for raising insect vectors and virus transmission. B. An artificial suction-implement used for transferring insect vectors.
X-ray film
RRSV-infected rice plants (at vegetative growth phase)
Host plants (Oryza sativa L. spp. japonica var. Nippobare) (all the transgenic lines are Nippobare background)
Insect vector (Nilaparvate lugens Stal) (collected from a field population in Fuzhou, Fujian Province, China, and cultured at 25 °C with a photoperiod of 16 h/8 h [light/dark] in a tissue culture frame); the insect vectors will mate during cultivation naturally.
Primers
For β-Actin gene:
5'-CAGCCACACTGTCCCCATCTA-3’
5'-AGCAAGGTCGAGACGAAGGA-3’
For RRSV CP:
5'-GAGCAAACTTGAGGCGTA-3’
5'-AAGCTACCGTGTAGGTGGCG-3’
Plant RNA Kit (Omega Bio-Tek, catalog number: R6827 )
DNase I (Omega Bio-Tek, catalog number: E1091 )
ReverTra Ace qPCR RT Kit (TOYOBO, catalog number: FSQ-301 )
THUNDERBIRD qPCR Mix (TOYOBO, catalog number: QPS-201 )
Liquid nitrogen
Agarose
A homemade monoclonal antibody against RRSV-encoded CP
ProteinFind Anti-β-Tubulin Mouse Monoclonal Antibody (TransGen Biotech, catalog number: HC201-02 )
ProteinFind Goat Anti-Mouse IgG(H+L), HRP Conjugate (TransGen Biotech, catalog number: HS201-01 )
Chemiluminescent HRP substrate (Merck, catalog number: WBKLS0100 )
Prestained marker
Ethanol (ALADDIN, catalog number: E111963 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: 75746-1KG )
Tris-HCl (Sigma-Aldrich, catalog number: V900312 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: 97622 )
Glycerinum (Sigma-Aldrich, catalog number: G5516 )
NaCl (Sigma-Aldrich, catalog number: S7653 )
KCl (Sigma-Aldrich, catalog number: P9333 )
KH2PO4 (Sigma-Aldrich, catalog number: P0662 )
Na2HPO4•12H2O (Sinopharm Chemical Reagent, CAS number: 10039-32-4)
Skim milk powder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: LP0031B )
30% acrylamide solution
(NH4)2S2O8 (Sigma-Aldrich, catalog number: A3678-25G )
TEMED (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 17919 )
Tween 20 (Xilong Scientific, CAS number: 9005-64-5)
Glycine (Solarbio, catalog number: G8200 )
Methanol (Sinopharm Chemical Reagent, catalog number: 10014108 )
10% PAGE gel (see Recipes)
Plant total protein extraction buffer (see Recipes)
10x PBS buffer (see Recipes)
PBS-T (see Recipes)
Blocking solution (see Recipes)
Transferring buffer (see Recipes)
Monoclonal anti-CP antibody solution (see Recipes)
Equipment
Eppendorf pipettes suite (1 ml, 0.2 ml, 0.02 ml, 0.01 ml and 0.0025 ml)
Ceramic mortar
Centrifuge (Eppendorf, models: 5424 R and 5427 R )
Vortex (Kylin-Bell Lab Instruments, model: VORTEX-5 )
PCR amplifier (Bio-Rad Laboratories, model: T100 )
Fluorescence quantitative PCR detection system (Bio-Rad Laboratories, model: CFX ConnectTM )
Gel Imaging System (Bio-Rad Laboratories, model: GelDocTM XR+ )
Basic electrophoresis apparatus (Bio-Rad Laboratories, model: PowerPacTM Basic )
Mini-Protean Tetra (Bio-Rad Laboratories, model: Mini-PROTEAN Tetra Cell )
Semi-dry transfer slot (Bio-Rad Laboratories, model: Trans-Blot SD )
Ultra-micro UV spectrophotometer (Thermo Fisher Scientific, model: NanoDropTM 2000 )
Developing machine (Carestream Health, model: 102 )
Decolorizing orbital shaker (Kylin-Bell Lab instruments, catalog number: TS-1000 )
Black box
Film Cassette (Guangdong YueHua Medical Instrument Factory, model: AX-II )
Software
SPSS for Windows version 11.5 (IBM, Armonk, NY, USA)
Gel imaging software (Bio-Rad Laboratories, model: GelDocTM XR+ )
Bio-Rad qPCR software (Bio-Rad Laboratories, model: CFX ConnectTM )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, C., Shi, C., Chen, D. and Wu, J. (2018). Rice Ragged Stunt Virus Propagation and Infection on Rice Plants. Bio-protocol 8(20): e3060. DOI: 10.21769/BioProtoc.3060.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,061 | https://bio-protocol.org/exchange/protocoldetail?id=3061&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Behavioral Evaluation of Seeking and Preference of Alcohol in Mice Subjected to Stress
AC Ana Canseco-Alba
NS Norman Schanz
HI Hiroki Ishiguro
QL Qing-Rong Liu
Emmanuel S. Onaivi
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3061 Views: 5622
Edited by: Edgar Soria-Gomez
Reviewed by: Mohammed Mostafizur RahmanOscar Prospero
Original Research Article:
The authors used this protocol in Dec 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2017
Abstract
The alcohol preference model is one of the most widely used animal models relevant to alcoholism. Stressors increase alcohol consumption. Here we present a protocol for a rapid and useful tool to test alcohol preference and stress-induced alcohol consumption in mice. In this model, animals are given two bottles, one with a diluted solution of ethanol in water, and the other with tap water. Consumption from each bottle is monitored over a 24-h period over several days to assess the animal’s relative preference for the ethanol solution over water. In the second phase, animals are stressed by restraining them for an hour daily and their subsequent preference of tap water or the ethanol solution is evaluated. Preference is measured by the volume and/or weight or liquid consumed daily, which is then converted to a preference ratio. The alcohol preference model was combined with the conditioned place preference paradigm to determine alcohol conditioning and preference following the deletion of CB2 cannabinoid receptors in dopaminergic neurons in the DAT-Cnr2 Cre-recombinant conditional knockout (cKO) mice in comparison with the wild-type control mice.
Keywords: Alcohol Stress Mouse model Behavior Cannabinoid Conditioned place preference
Background
Many aspects of alcoholism and alcohol consumption can be studied through animal models. Alcohol induces positive reinforcement, and animals can seek alcohol and even work for it. However, alcohol can also be a negative reinforcement, since it is capable of reducing anxiety. No animal model is able to duplicate the complex features of alcoholism. Oral ethanol self-administration is widely used for examining specific aspects of behavior and physiology relevant for understanding alcoholism (Mardones and Segovia-Riquelme, 1983; Cunningham et al., 2000). Mice can be genetically manipulated at cell type specific levels and therefore are valuable for research into the cell type specific genetic determinants of alcoholism.
The alcohol preference model is one of the most widely used animal models relevant to alcoholism. This model meets important criterion, which is that the ethanol should be self-administered orally (Cicero, 1980; Crabbe et al., 2010). An animal’s genotype exerts a strong influence on self-administration in this model. Some mouse strains, like the inbred strain of mouse C57BL/6J (Rhodes et al., 2005), present a genetically influenced high preference for ethanol and they voluntarily consume it orally (Yoneyama et al., 2008; Barkley-Levenson and Crabbe, 2012). The conditioned place paradigm (CPP) is widely used to explore the effects of addictive substances including alcohol, taking advantage of learned associations. Therefore, alcohol CPP measures the association of alcohol with a particular environment to determine whether mice can acquire alcohol CPP.
Stress can interact with ongoing ethanol consumption to trigger increased intake (e.g., self-medicating behavior), thereby increasing initial susceptibility to alcohol use disorders. Among the stressors, a restraint model of acute and chronic stress can increase ethanol consumption (Yang et al., 2008).
New advances and accumulating evidence support a role for the endocannabinoid system in the effects of alcohol. The endocannabinoid system consists of two cannabinoid receptors, CB1Rs and CB2Rs, with endocannabinoids and the enzymes for the biosynthesis and inactivation of the endocannabinoids. Our goal here was to summarize the protocol used to measure alcohol preference in combination with stress-induced alcohol consumption. We also provide evidence that the endocannabinoid system plays a role in alcohol preference following dopaminergic neuron specific deletion of CB2Rs in the mouse model (Liu et al., 2017).
Materials and Reagents
50 ml Polypropylene Centrifuge Tubes with Attached Caps (Boekel Scientific, catalog number: 120021 )
Bottles (see Figures 1B and 1C) with Sipper Caps (Chewy, catalog number: 101445 )
Mice: Adult (7 weeks or older) mice (C57BL/6J) (THE JACKSON LABORATORY, catalog number: 000664 )
Note: Alternate strains and ages of mice may also be used. Mice are housed alone, each in their respective cages, in an environment with controlled temperature (around 23 °C) and humidity under a 12-12 h light-dark cycle with free access to food. See Animal considerations in Notes for more details.
100% Alcohol and dilutions: 8%, 16% and 32% (Sigma-Aldrich, catalog number: 1012768 )
Figure 1. Photos showing experimental set-up for the evaluation of alcohol preference. A. Tubes in which naïve or conditional knockout mice and wild-type controls are subjected to acute stress. B. Tubes, water bottles, and a clean empty mouse cage. C. Image of the control cage. D. Image of the apparatus for conditioned place preference.
Equipment
Mouse polycarbonate home cages (7.5 in W x 11 in L x 5 in H) with standard woodchip mouse bedding (Fisher Scientific, catalog number: 01-286-13A)
Manufacturer: Tecniplast, catalog number: 1290D00SU .
Note: Standard cage changes are allowed during the habituation period (see below). However, it is recommended to avoid cage changes during the period of data collection to prevent leakage. The cage can be cleaned between phases. One cage for each subject mouse.
Stainless steel wire cage lid modified to allow space for two bottles and the food (Fisher Scientific, catalog number: 01-286-13A)
Manufacturer: Tecniplast, catalog number: 1290D00SU .
Drill with small (1 mm) drill bit (for making three small holes in top of 50 ml Polypropylene Centrifuge Tubes, to allow the mouse to breathe, and a single larger hole in the cap to insert the tail)
Thermo Scientific weighing scale (Thermo Fisher Scientific, catalog number: 20031 )
Software
Activity Monitor software (Med Associates, St. Albans, VT) (for automated data collection)
GraphPad PRISM 6.0 software (GraphPad Software. Inc., San Diego, CA, USA) (for data analysis)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Canseco-Alba, A., Schanz, N., Ishiguro, H., Liu, Q. and Onaivi, E. S. (2018). Behavioral Evaluation of Seeking and Preference of Alcohol in Mice Subjected to Stress. Bio-protocol 8(20): e3061. DOI: 10.21769/BioProtoc.3061.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Neuroscience > Nervous system disorders > Animal model
Molecular Biology > RNA > RNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,062 | https://bio-protocol.org/exchange/protocoldetail?id=3062&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
H1N1 Virus Production and Infection
BZ Binbin Zhao
JS Jiaoyu Shan
RX Rui Xiong
KX Ke Xu
Bin Li
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3062 Views: 5886
Edited by: Alka Mehra
Reviewed by: Migla Miskinyte
Original Research Article:
The authors used this protocol in Dec 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2017
Abstract
Influenza A virus is a member of orthomyxoviridae family causing wide-spread infections in human respiratory tract. Mouse infection model is widely used in antiviral research and pathogenesis study against influenza A virus. Here, we report a protocol in infected mice with different virus doses and strains to explore how an inhibitor of lysine-specific demethylase (LSD1) impacts disease progression.
Keywords: Influenza A virus Infected mouse model H1N1 Virus production Plaque assay
Background
Influenza A virus, a member of the family Orthomyxoviridae, is a negative-sense RNA virus with eight segmented genomes of single-stranded viral RNAs (vRNAs) that encode more than 10 proteins. During the past 100 years, outbreaks of influenza-virus strains regularly appeared in human populations, including “Spanish flu” in 1918 caused by the H1N1 subtype, “Asian flu” in 1957 by H2N2, “Hong Kong flu” in 1968 by H3N2, “Russian flu” in 1977 by H1N1, and “swine flu” in 2009 by H1N1 (Smith et al., 2009; Lim and Mahmood, 2011; Kumar et al., 2018). Seasonal influenza A viruses also circulate worldwide, spread easily from person to person, and result in the hospitalization of three to five million individuals worldwide annually (Molinari et al., 2007). The seasonal influenza infections are responsible for 290,000-650,000 deaths annually, mainly among young children, elderly adults, and critically ill patients (Kumar et al., 2018).
Animal models are used in influenza virus research not only to elucidate the viral and host factors that affect disease outcomes and spread among susceptible hosts but also to evaluate interventions designed to prevent or reduce influenza morbidity and mortality (Thangavel and Bouvier, 2014). In this paper, we use two strains of influenza A virus, A/WSN/33(H1N1) (WSN) which is a commonly-used lab strain, and A/Sichuan/01/2009 (SC09) which is a natural isolate to infect mice. This experiment aims to explore how Trans-2-phenylcyclopropylamine hydrochloride (TCP) (a chemical inhibitor against LSD1 [Shan et al., 2017]) impacts disease progress. Moreover, we applied different doses of virus to infect the mice for different purposes to reveal the function of TCP.
Materials and Reagents
1.5 ml Eppendorf tubes (Eppendorf)
10 µl, 200 µl, and 1 ml pipette tips (FUKAEKASEI and WATSON, catalog number: 1201-705C )
24-well plates (Corning, catalog number: 3526 )
6-well plates(Corning, catalog number: 353046 )
6 cm dish (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 150288 )
Syringes
75 cm flask (T75 flask) (Corning, catalog number: 430641U )
0.22 μm filters (Axiva Sichem Biotech, catalog number: SFPV13 R )
Pencil
BALB/c mice (6-8W, female)
293T cells (ATCC, catalog number: CRL-3216 )
MDCK cells (ATCC, catalog number: CCL-34 )
A/WSN/33(H1N1) (WSN) virus (Hoffmann et al., 2000)
A/Sichuan/1/2009 (H1N1) (SC09) (Kindly provided by Prof. Yuelong Shu in China CDC)
TCP (Santa Cruz Biotechnology, catalog number: sc-208452 )
1x PBS (Lonza, catalog number: 17-516Q )
Isoflurane (Abbott, catalog number: 5260-04-05)
Picric acid (Fisher Scientific, catalog number: 13205 ) (Used for labeling the mice)
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
Paraformaldehyde (Sigma-Aldrich, catalog number: P6148 )
True Blue substrate (KPL, catalog number: 50-78-02 )
anti-nucleoprotein antibody (Antibody Research Centre, Shanghai Institute of Biological Science)
Anti-rabbit IgG secondary antibody (Antibody Research Centre, Shanghai Institute of Biological Science)
Avicel (FMC BioPolymer, catalog number: CL 611 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3912 )
2x DMEM (Thermo Fisher Scientific, catalog number: 12800017 )
Trypsin (TPCK) (Sigma-Aldrich, catalog number: 4370285 )
Fetal bovine serum heat inactivated (FBS) (Sigma-Aldrich, catalog number: F9665 )
BactoTM agar (BD, BactoTM, catalog number: 214010 )
18 MΩ H2O
Overlay medium (DMEM + 2% FBS + 0.9% BactoTM-Agar)
Infection medium (DMEM + 1 μg/ml TPCK)
Trans-2-phenylcyclopropylamine hydrochloride (TCP) (1 mg/ml) (see Recipes)
2.4% Avicel (see Recipes)
6% BSA (see Recipes)
Overlay medium (see Recipes)
Equipment
Pipettes (Thermo Fisher Scientific, catalog number: 1156-6963 )
Dissection equipment (forceps, tweezers, scissors)
Anesthesia machine (Parkland Scientific, catalog number: V3000PK )
Eppendorf centrifuge
Class II biological safety hood (Thermo Fisher Scientific)
Incubator
Freezer (4 °C, -20 °C and -80 °C)
Ultraviolet (UV) light
Software
GraphPad Prism (https://www.graphpad.com/)
Statistical Product and Service Solutions (SPSS) (https://www.ibm.com/analytics/data-science/predictive-analytics/spss-statistical-software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhao, B., Shan, J., Xiong, R., Xu, K. and Li, B. (2018). H1N1 Virus Production and Infection. Bio-protocol 8(20): e3062. DOI: 10.21769/BioProtoc.3062.
Download Citation in RIS Format
Category
Microbiology > in vivo model > Viruses
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,063 | https://bio-protocol.org/exchange/protocoldetail?id=3063&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessing Membrane Fluidity and Visualizing Fluid Membrane Domains in Bacteria Using Fluorescent Membrane Dyes
Michaela Wenzel
NV Norbert O. E. Vischer
HS Henrik Strahl
LH Leendert W. Hamoen
Published: Vol 8, Iss 20, Oct 20, 2018
DOI: 10.21769/BioProtoc.3063 Views: 11477
Edited by: David Cisneros
Reviewed by: Ron Saar DoverAgnieszka Zienkiewicz
Original Research Article:
The authors used this protocol in Feb 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2018
Abstract
Membrane fluidity is a key parameter of bacterial membranes that undergoes quick adaptation in response to environmental challenges and has recently emerged as an important factor in the antibacterial mechanism of membrane-targeting antibiotics. The specific level of membrane fluidity is not uniform across the bacterial cell membrane. Rather, specialized microdomains associated with different cellular functions can exhibit fluidity values that significantly deviate from the average. Assessing changes in the overall membrane fluidity and formation of membrane microdomains is therefore pivotal to understand both the functional organization of the bacterial cell membrane as well as antibiotic mechanisms. Here we describe how two fluorescent membrane dyes, laurdan and DiIC12, can be employed to assess membrane fluidity in living bacteria. We focus on Bacillus subtilis, since this organism has been relatively well-studied with respect to membrane domains. However, we also describe how these assays can be adapted for other bacteria such as Staphylococcus aureus and Streptococcus pneumoniae.
Keywords: Membrane fluidity Membrane domains Laurdan GP Regions of increased fluidity RIFs Bacillus subtilis Cytoplasmic membrane Antibiotic mode of action
Background
Bacterial membranes have long been viewed as homogenous lipid bilayers following the classical fluid mosaic membrane model. However, many studies have later shown that membranes are in fact highly organized structures and possess distinct domains that can be characterized by containing specific membrane proteins, the enrichment of certain lipid species, or by having a higher or lower membrane fluidity than the neighboring membrane areas (Lopez and Kolter, 2010; Bach and Bramkamp, 2013; Barák and Muchová, 2013; Strahl et al., 2014; Bramkamp and Lopez, 2015; Schneider et al., 2015; Müller et al., 2016). Two types of membrane domains that are characterized by a specific membrane fluidity are rigid lipid and regions of increased fluidity (RIFs). Both have been well-characterized in the Gram-positive model organism Bacillus subtilis (Bach and Bramkamp, 2013; Strahl et al., 2014). Evidence for specific membrane domains has also been found in the pathogenic bacteria Staphylococcus aureus (Garcia-Fernandez et al., 2017 and Weihs et al., 2018) and Streptococcus pneumoniae (Rosch and Caparon, 2005; Vega et al., 2013). Membrane fluidity appears to be a key factor that distinguishes these specific domains from the rest of the membrane. This is achieved by enrichment of fluidizing lipid species, i.e., branched-chain, unsaturated, and short-chain fatty acid-containing lipids. Bacteria can adapt their membrane fluidity by changing the ratios of branched/non-branched, unsaturated/saturated, and short-chain/long-chain fatty acids. In B. subtilis, lipid desaturation (rapid adaptation) and adjusting the ratio of iso and anteiso branched chain fatty acids (long-term adaptation) are the main mechanisms to adapt membrane fluidity in response to environmental challenges (Beranova et al., 2008; Kingston et al., 2011).
Recently, it has emerged that membrane fluidity and membrane domains of specific fluidity play a key role in the mechanism of action of membrane-active antibiotics (Epand and Epand, 2009; Müller et al., 2016; Saeloh et al., 2018). Therefore, it is crucial to be able to assess changes in both overall membrane fluidity and membrane domains when studying the in vivo activity of these compounds. We have recently established protocols for measuring membrane fluidity using two different fluorescent membrane probes, laurdan (Figure 1A) and DiIC12 (Figure 1B) (Strahl et al., 2014; Müller et al., 2016; Saeloh et al., 2018). Laurdan is a fluorescence probe that intercalates into the membrane bilayer and displays an emission wavelength shift depending on the amount of water molecules in the membrane (Parasassi and Gratton, 1995; Sanchez et al., 2007).
Laurdan generalized polarization (GP) can therefore be used as a reporter for head group density and fatty acyl spreading (Figure 1C). Laurdan fluorescence can be measured in a fluorescence plate reader and allows both end-point and kinetic measurements. It works well in 96-well plate format and allows relatively high throughput screening. Laurdan fluorescence can also be visualized under the microscope and used for single-cell analysis. It can further be employed for measuring the fluidity of liposomes, which can be important to distinguish direct and indirect antibiotic effects.
DiIC12 displays affinity for membrane areas of increased fluidity due to its short hydrocarbon tail (Baumgart et al., 2007; Zhao et al., 2013). Since fluid membranes are typically thinner (Reddy et al., 2012; Karabadzhak et al., 2018), it can be used as a reporter for membrane thickness and fluidity (Figure 1D). DiIC12 has been of key importance in the discovery of RIFs, fluid membrane microdomains that harbor the cell wall synthetic machinery in B. subtilis and E. coli (Strahl et al., 2014; Müller et al., 2016; Oswald et al., 2016). These domains are easily disturbed by membrane-active antibiotics and appear to play a key role in the mechanism of action of the last resort antibiotic daptomycin and the new antibiotic candidate rhodomyrtone (Müller et al., 2016; Saeloh et al., 2018). DiIC12 is ideally suited to visualize fluid membrane domains, whether natural or antibiotic-induced, in living cells. It can, however, also be used to stain liposomes. Together, laurdan and DiIC12 constitute a very useful assay combination to study both overall membrane fluidity and membrane domain formation in bacteria. We here describe the detailed protocols for measuring overall fluidity in batch culture and in liposomes as well as the distribution of membrane domains of different fluidity in single cells.
Figure 1. Mechanism of fluidity measurements with Laurdan and DiIC12. A. Structure of Laurdan; B. Structure of DiIC12; C. Laurdan inserts into membrane bilayers of different fluidity. Head group spreading and fatty acyl chain mobility determine the amount of water molecules around the laurdan molecule, which in turn causes a peak shift of the fluorescence probe. D. DiIC12 displays affinity for fluid membranes due to its short hydrocarbon tail, which is better accommodated in flexible, thin lipid bilayers. As a result, the dye accumulates in fluid membrane regions (RIFs). Note that due to better readability, dyes and lipids are not depicted to scale (dyes would be smaller).
Materials and Reagents
0.1-10 µl pipette tips (Gilson, catalog number: F161630)
0.1-2 µl pipette tips (Eppendorf, catalog number: 3120000011)
0.5-10 µl pipette tips (Eppendorf, catalog number: 3120000020)
0.2 µm Filtropur filters S (SARSTEDT, catalog number: 83.1826.001)
10 ml combitips for multistep pipette (Eppendorf, catalog number: 0030069.269)
100-1,000 µl pipette tips (Greiner, catalog number: 686290)
2 ml micro tubes (Greiner, catalog number: 623201)
2-20 µl pipette tips (Eppendorf, catalog number: 3120000038)
2-200 µl pipette tips (Greiner, catalog number: 739290)
5 ml combitips (Eppendorf, catalog number: 0030069.250)
50 ml Falcon tubes (SARSTEDT, catalog number: 62.547.254)
96-well plates, black flat-bottom (Screening Devices b.v., catalog number: 324002)
Glass coverslips (Carl Roth GmbH, catalog number: NK75.1)
Glass slides (Fisher-Emergo B.V., catalog number: 361000)
Multi-spot glass slides (Hendley-Essex, catalog number: SM011, white)
TetraSpeck microspheres, 0.2 µm, fluorescent blue/green/orange/dark red (Invitrogen via Thermo Fisher, catalog number: T7280)
Black clear bottom microtiter plates (Greiner, catalog number: 675096)
B. subtilis 168 (DSMZ, catalog number: 402)
Agarose (Sphaero Q, catalog number: S103b)
Ammonium iron (II) sulfate (Fe(II)NH4 citrate) (Sigma-Aldrich, catalog number: F5879)
Ammonium sulfate ((NH4)2SO4) (Sigma-Aldrich, catalog number: A6387)
Benzyl alcohol (Sigma-Aldrich, catalog number: 305197)
Calcium chloride dihydrate (CaCl2•2H2O) (Merck, catalog number: 102382)
Casein hydrolysate (casamino acids) (Duchefa, catalog number: C1301.0250)
DiIC12 (1,1'-didodecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate) (Anaspec, catalog number: AS-84902)
Dimethylformamide (DMF) (Sigma-Aldrich, catalog number: 227056)
Dimethylsulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418)
Disodiumhydrogenphosphate (Na2HPO4) (VWR, catalog number: 26932.290)
E. coli polar lipid extract (Avanti Polar Lipids, catalog number: 100600P)
Glucose (Duchefa Biochemie, catalog number: G0802)
L-glutamic acid potassium salt (Sigma-Aldrich, catalog number: G1501)
Gramicidin S (Sigma-Aldrich, catalog number: G0900)
Note: This product has been discontinued. The batch used in this study was kindly supplied by Marina Rautenbach, Stellenbosch University.
Hydrochloric acid (Merck, catalog number: 1003171000)
Iron sulfate heptahydrate (FeSO4•7H2O) (Sigma-Aldrich, catalog number: 215422)
Laurdan (6-Dodecanoyl-N,N-dimethyl-2-naphthylamine) (Sigma-Aldrich, catalog number: 40227)
Magnesium sulfate heptahydrate (MgSO4•7H2O) (Roth, catalog number: T888.1)
Manganese sulfate tetrahydrate (MnSO4•4H2O) (Fischer Scientific, catalog number: M/2250/53)
MP196 (synthesized by solid-phase peptide synthesis according to Albada et al., 2012 and Sanchez et al., 2007); the batch used in this study was kindly supplied by Nils Metzler-Nolte, Ruhr University Bochum
Potassium chloride (KCl) (VWR, catalog number: 26764.298)
Potassiumdihydrogenphosphate (KH2PO4) (Merck, catalog number: 104873)
Rhodomyrtone (purified form Rhodomyrtus tomentosa leaves according to Limsuwan et al. (Zhao et al., 2013); the batch used in this study was kindly supplied by Supayang Voravuthikunchai, Prince of Songkla University)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 1.06404.1000)
Todd-Hewitt broth (Sigma-Aldrich, catalog number: T1438-500G)
Tris (Merck, catalog number: 1083821000)
Trisodium citrate dihydrate (Na3citrate•2H2O) (Merck, catalog number: 106448)
Tryptone (Duchefa Biochemie, catalog number: T1332,1000MG)
L-tryptophane (Sigma Aldrich, catalog number: T0254)
Yeast extract (Duchefa Biochemie, catalog number: Y133)
K2HPO4
Agarose solution (see Recipes)
BMM basic medium (see Recipes)
BMM supplements (see Recipes)
DiIC12 washing medium (see Recipes)
Laurdan buffer (see Recipes)
Lysogeny broth (LB) medium (see Recipes)
SMM basic medium (see Recipes)
SMM supplements (see Recipes)
Equipment
100-1,000 µl pipette (Eppendorf, catalog number: 3120.000062)
20-200 µl pipette (Eppendorf, catalog number: 3120000054)
HeraCell 150 stove (Kendro, catalog number: 50075549B)
Cy3 filter cube (Nikon, catalog number: MXU96213)
DAPI filter cube (Nikon, catalog number: MBE41300)
Laurdan custom filter cube composed of:
C-FL filter block, frame only (Nikon, catalog number: MXA22030)
FF01-360/23-25 excitation filter (Nikon, catalog number: MXR00637)
Important note: The same filter as in the DAPI filter cube.
Di02-R405-25x36 dichroic mirror (Nikon, catalog number: MXR00604)
Important note: The same dichroic mirror as in the DAPI filter cube.
FF01-535/5--25 emission filter (Nikon, catalog number: MXX99999)
Multi step pipette (Eppendorf, catalog number: 022260201)
Nikon Eclipse Ti inverted epi-fluorescence (wide-field) microscope (Nikon, catalog number: MEA53100) equipped with:
CFI Plan Apochromat DM 100x NA 1.45 oil objective (Nikon, catalog number: MRD31905)
Intensilight HG 130 W light source (MBF72665)
C11440-22CU Hamamatsu ORCA Flash USB 3.0 camera (Nikon, catalog number: MHC11441)
NIS elements AR software (Nikon, catalog number: MQS31000)
Plate reader (BioTek Synergy Mx, catalog number: SMATBCL)
Temperature-controlled microtube centrifuge (Eppendorf, model: 5424R, catalog number: 5404000010)
Thermomixer (Eppendorf, catalog number: 5350000013)
Water bath (GFL, catalog number: 5905985)
Incubator Heraeus HERAcell (Kendro Laboratory Products, catalog number: 50042307)
Autoclave (Sanyo, catalog number MLS-3780)
Monochromators
Spectrofluorometer Quantamaster 2000-4 (Photon Technology International)
Software
ImageJ (https://imagej.nih.gov/ij/download.html)
Fluorescence spectrophotometer software (PTI acquisition software FeliX32 version 1.2 Build 56)
Microplate reader software Gen5 version 2.00 (Biotek)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wenzel, M., Vischer, N. O. E., Strahl, H. and Hamoen, L. W. (2018). Assessing Membrane Fluidity and Visualizing Fluid Membrane Domains in Bacteria Using Fluorescent Membrane Dyes. Bio-protocol 8(20): e3063. DOI: 10.21769/BioProtoc.3063.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell staining
Microbiology > Antimicrobial assay > Antibacterial assay
Cell Biology > Cell staining > Lipid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,064 | https://bio-protocol.org/exchange/protocoldetail?id=3064&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Blood-retina Barrier Permeability Assay in Young Mice Using Sulfo-NHS-LC-biotin Perfusion
EW Entzu Wan
MO Mitsutaka Ogawa
TO Tetsuya Okajima
Published: Oct 20, 2018
DOI: 10.21769/BioProtoc.3064 Views: 4085
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Brain and retinal vasculatures exhibit restricted vascular permeability known as blood-brain barrier and blood-retina barrier. Vascular permeability can be evaluated by perfusion of the amine reactive ester derivatives of biotin such as sulfo-NHS-LC-biotin. This protocol describes experimental procedures of sulfo-NHS-LC-biotin perfusion to evaluate retinal vascular permeability. Perfused sulfo-NHS-LC-biotin remained within vessels in wild-type postnatal day 15 (P15) retinas, confirming an intact blood-retina barrier. In contrast, sulfo-NHS-LC-biotin was occasionally detected in extravascular spaces in perfused Eogt−/− retinas suggesting a partly impaired vascular integrity in the absence of Eogt (Sawaguchi et al., 2017).
Keywords: Mouse Retina Blood retinal barrier Sulfo-NHS-LC-biotin
Materials and Reagents
Microtube (Ina-optika, catalog number: ST-0150F )
10 cm culture dish (Corning, catalog number: 3295 )
6-well cell culture plate (Greiner Bio One International, catalog number: 657160 )
Sulfo-NHS-LC-biotin (Thermo Fisher Scientific, catalog number: 21335 )
Methanol (Wako Pure Chemical Industries, catalog number: 139-01827 )
CF488A-conjugated streptavidin (10 mg/ml) (Biotium, catalog number: 29034 )
Dylight 594-conjugated isolectin B4 (IB4) (Vector Laboratories, catalog number: DL-1207 )
Vectashield® antifade mounting medium (Vector Laboratories, catalog number: H1000 )
NaCl (Wako Pure Chemical Industries, catalog number: 191-01665 )
KCl (Wako Pure Chemical Industries, catalog number: 163-03545 )
Na2HPO4 (Wako Pure Chemical Industries, catalog number: 196-02835 )
KH2PO4 (Sigma-Aldrich, catalog number: 24-5260-5 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
CaCl2 (Wako Pure Chemical Industries, catalog number: 039-00475 )
MgCl2 (Wako Pure Chemical Industries, catalog number: 136-03995 )
Bovine serum albumin (BSA) (MEDICAL & BIOLOGICAL LABORATORIES, catalog number: BAC61-0500 )
Normal goat serum (NGS) (Wako Pure Chemical Industries, catalog number: 143-06561 )
10% formalin (Wako Pure Chemical Industries, catalog number: 060-01667 )
4% paraformaldehyde (PFA) (Wako Pure Chemical Industries, catalog number: 161-20141 )
Sulfo-NHS-LC-biotin solution (see Recipes)
10x Calcium-magnesium free phosphate-buffered saline (CMF-PBS) (see Recipes)
10x Phosphate-buffered saline (PBS) (see Recipes)
2x Phosphate-buffered saline (PBS) (see Recipes)
1x Phosphate-buffered saline (PBS) (see Recipes)
Perm/Block solution including 5% goat serum (see Recipes)
Equipment
Forceps (Fine Science Tools, Dumont, model: #5, catalog number: 11254-20 )
Iris scissors (Fine Science Tools, Muromachi, catalog number: 15003-08 )
Terumo Syringe (Tuberculin), 1 ml (Terumo Medical, catalog number: 51906 )
Terumo Syringe (Tuberculin), 10 ml (Terumo Medical, catalog number: 51904 )
26 G x 1/2", Regular Wall Needle (Terumo Medical, catalog number: NN-2613R )
SZX7 Zoom Stereo Microscope (Olympus, model: SZX7 )
Confocal microscope A1R-TiE (Nikon)
Orbital mixer (Tokyo Rikakikai, EYELA, model: CM-1000 )
Procedure
Note: All experimental procedures were conducted in accordance with the Guidelines for Animal Experimentation in Nagoya University Graduate School of Medicine and Japanese Government Animal Protection and Management Law.
Anesthetize P15 mice deeply by inhalation of diethyl ether and then place it in a 10 cm dish.
Expose the mouse heart using iris scissors and forceps (Figure 1A).
After making an incision to the right atrium using iris scissors, inject 10 ml of sulfo-NHS-LC-biotin solution into the left ventricle for 10 min at the flow rate of 1 ml/min using a 26 gauge needle connected to a 10 ml syringe (Figure 1B).
Note: The sulfo-NHS-LC-biotin dose is 0.75 μg/g body weight. P15 average weight is 6 g.
Immediately after that, inject 10 ml of 10% formalin in sodium phosphate, pH 7.4 into the left ventricle.
Remove Eyes and transfer into a 1.5 ml tube filled with 1 ml of 4% PFA in PBS on ice (Figure 1C).
Figure 1. The procedures of mouse dissection. A. Making an incision to the right atrium using iris scissors. B. Sulfo-NHS-LC-biotin followed by PBS-CMF are injected to the left ventricle. C. The eyes are removed and transferred into a 1.5 ml microtube filled in 4% PFA in PBS.
After 15 min, remove the 4% PFA.
Wash the eyes with 1x PBS.
Subsequently, soak the eyes in 1 ml of 2x PBS for 15 min on ice.
Note: Use of 2x PBS decreases the osmotic pressure, and thus facilitate dissection of eyes.
Dissect retinas from eyes (Figures 2A and 2B) in 2x PBS under the microscope and flatten by dropping 1 ml of cold methanol (Figure 2C).
Pausing point: The retina can be stored at 4 °C in cold methanol for up to 1 week or -20 °C for 1 year.
Figure 2. The procedures of obtaining and flattening a retina. A. The eye is placed in a 10 cm dish with PBS, and nerve fibers and other tissues are ready to be removed from the eyeball. B. The choroid and other tissue are removed, and only the retina is isolated. C. The retina is transferred to a 6-well plate with cold methanol.
Wash the flat retinas with PBS.
Incubate the flat retinas in the 100 μl of Perm/Block solution for 30 min at RT or overnight at 4 °C.
Stain the retinas with 100 μl of Perm/Block containing CF488A-conjugated streptavidin (10 g/ml) and Dylight 594-conjugated IB4 (2.5 μg/ml) for 2 h at RT or overnight at 4 °C with mixing.
Note: IB4 is a marker for endothelial cells.
After four washes with 1x PBS, mount retinas in 50 μl of Vectashield antifade mounting medium and observe by using confocal microscope A1R-TiE.
Figure 3. The confocal microscope images of P15 retinas from WT and Eogt-/- mice. Perfused sulfo-NHS-LC-biotin (green) remained within vessels (red) in wild-type P15 retinas, confirming an intact blood-retina barrier. In contrast, sulfo-NHS-LC-biotin was occasionally detected in extravascular spaces in perfused Eogt−/− retinas (arrowhead) suggesting a partly impaired vascular integrity in the absence of Eogt.
Recipes
Sulfo-NHS-LC-biotin solution
0.75 μg/g (mouse weight) of Sulfo-NHS-LC-biotin (Thermo Fisher Scientific) dissolved in 10 ml PBS-CMF
10x CMS-PBS
80 g NaCl
2 g KCl
14.4 g Na2HPO4
2.4 g KH2PO4
Dissolve the reagents listed above in 800 ml of distilled water. Adjust the pH to 7.4 with HCl, and then add distilled water to
1 L
10x Phosphate-buffered saline (PBS)
80 g NaCl
2 g KCl
14.4 g Na2HPO4
2.4 g KH2PO4
1.33 g CaCl2
1.0 g MgCl2
Dissolve the reagents listed above in 800 ml of distilled water. Adjust the pH to 7.4 with HCl, and then add distilled water to
1 L
2x Phosphate-buffered saline (PBS)
Take 10x PBS 200 ml and add distilled water to 1 L
1x Phosphate-buffered saline (PBS)
Take 2x PBS 100 ml and add distilled water to 200 ml
Perm/Block solution including 5% goat serum
1x PBS 10 ml
5% normal serum 0.5 ml
0.3% Triton X-100 30 μl
Acknowledgments
We thank N. Toida (Nagoya Univ) for technical support. This protocol is modified from the previously published article (Chow and Gu, 2017; Sawaguchi et al., 2017). This work was supported by Japan Society for the Promotion of Science grants # JP15K15064 to TO and MO, #JP26110709 to TO, #JP26291020 to TO, #JP15K18502 to MO, #JP16J00004 to MO; Takeda Science Foundation to TO; Japan Foundation for Applied Enzymology to TO; YOKOYAMA Foundation for Clinical Pharmacology #YRY-1612 to MO. The authors declare no conflict of interest.
References
Chow, B. W. and Gu, C. (2017). Gradual suppression of transcytosis governs functional blood-retinal barrier formation. Neuron 93(6): 1325-1333 e1323.
Sawaguchi, S., Varshney, S., Ogawa, M., Sakaidani, Y., Yagi, H., Takeshita, K., Murohara, T., Kato, K., Sundaram, S., Stanley, P. and Okajima, T. (2017). O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals. Elife 6:e24419.
Copyright: Wan et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
Category
Cell Biology > Cell imaging > Confocal microscopy
Cell Biology > Cell staining > Cell wall
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,065 | https://bio-protocol.org/exchange/protocoldetail?id=3065&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Innovative Approach to Study Ralstonia solanacearum Pathogenicity in 6 to 7 Days Old Tomato Seedlings by Root Dip Inoculation
Niraj Singh
Rahul Kumar
SR Suvendra Kumar Ray
Published: Vol 8, Iss 21, Nov 5, 2018
DOI: 10.21769/BioProtoc.3065 Views: 6315
Edited by: Samik Bhattacharya
Reviewed by: Mahmoud Kamal Ahmadi
Original Research Article:
The authors used this protocol in Apr 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2018
Abstract
Ralstonia solanacearum (F1C1) is a Gram-negative plant pathogenic bacterium that causes lethal wilt disease in a wide range of plant species. This pathogen is very well known for its unpredictable behavior during infection and wilting its host. Because of its mysterious infection behavior, virulence and pathogenicity standardization are still a big challenge in the case of R. solanacearum. Here, we report an innovative pathogenicity assay of R. solanacearum (F1C1) in the early stage of tomato seedlings by root dip inoculation. In this assay, we employed 6-7days old tomato seedlings for infection grown under nutrients free and gnotobiotic condition. After that, pathogenicity assay was performed by maintaining the inoculated seedlings in 1.5 or 2 ml sterile microfuge tubes. During infection, wilting symptom starts appearing from ~48 h post inoculation and the pathogenicity assay gets completed within seven days of post inoculation. This method is rapid, consistent as well as less resource dependent in terms of labor, space and cost to screen large numbers of plants. Hence, this newly developed assay is an easy and useful approach to study pathogen virulence functions and its interaction with the host plant during wilting and disease progression at the seedling stage.
Keywords: Ralstonia solanacearum Root inoculation Tomato seedling Pathogenicity Wilting
Background
Bacterial wilt pathogen Ralstonia solanacearum dwells in soil. When favorable condition comes, the bacterium enters inside the suitable host plant through root, grows, colonizes there and ultimately kills the plant. R. solanacearum strain (F1C1) had been isolated and characterized from a wilted chilli plant nearby Tezpur (Assam), north-east India (Kumar et al., 2013). Owing to the lethality and its exceptional wide host range, R. solanacearum considered as the second most devastating bacterial phytopathogen around the world (Mansfield et al., 2012). In spite of that, no effective approach so far is available to deal with this pathogen and its associated disease.
Regarding its virulence and pathogenicity assay, several existing methods are commonly in use such as soil drenching, leaf clip, petiole cut as well as stem inoculation but, in the other hand it is also reported that these methods are not found to be very much appropriate in analyzing minute virulence and pathogenicity differences in few mutants strain of R. solanacearum (Macho et al., 2010). In the wake of developing a potent pathogenicity assay, we have developed and standardized an innovative root inoculation method to study R. solanacearum pathogenicity in tomato seedling (Singh et al., 2018). Along with the pathogenicity assay (Figure 1), this approach is also equally helpful in bacterial bio-control development and plant protection assay against this wilt pathogen at the seedling stage. Recently many other research groups also have employed seedling stages of tomato plants for studying R. solanacearum pathogenicity in number of occasions (Pradhanang et al., 2000; Artal et al., 2012; Kumar, 2014; Kumar et al., 2017). This vascular pathogen is well known for its mysterious infection behavior and wide range of host adaptability, therefore R. solanacearum is also referred as a suitable model to investigate fundamental aspects of plant-pathogen interaction and host adaptations (Genin and Boucher, 2002; Genin, 2010; CollandValls, 2013; Singh et al., 2018).
Materials and Reagents
1.5 ml and 2.0 ml micro centrifuge tubes (Tarson, catalog numbers: 500010 and 500020)
Pipette tips (10 μl) (Tarson, catalog number: 521000)
Pipette tips (200 μl) (Tarson, catalog number: 521010)
Pipette tips (1,000 μl) (Tarson, catalog number: 521020)
13 mm screw vial (Borosil, catalog number: VO04C113005000)
30 ml culture tubes (Riviera, catalog number: 71200305)
50 ml Falcon tube (Tarson, catalog number: 546041)
250 ml conical flask (Borosil, catalog number: 4980021)
Plastic tray (13 cm x 22 cm)
Petri dishes (90 mm) (Tarson, catalog number: 460090)
120-well 1.5 ml to 2.0 ml tube rack (Tarson)
Meta loop (Himedia, catalog number: LA650-1)
Cotton wool(SN surgical & health care science (P) LTD, catalog number: DL-160M)
Tissue paper (Hygienics Plus, catalog number: HPTP02)
Ralstonia solanacearum (F1C1) (Lab collection)
Tomato seeds (Durga: Selection-22) [Durga seed farm(REGD), Chandigarh, India]
Sterile distilled water
Peptone (Himedia, catalog number: RM001-500G)
Casamino acid or casein acid hydrolysate (SRL, catalog number: CI019)
Glucose (Himedia, catalog number: MB037-500G)
Agar powder (Himedia, catalog number: GMR026-500G)
Yeast extract powder (Himedia, catalog number: RM027-500G)
BG agar media (see Recipes)
BG broth media (see Recipes)
20% Glucose supplement (see Recipes)
Equipment
Pipettes (Eppendorf-these pipettes can accommodate pipette tips of 10 μl, 200 μl, 1,000 μl respectively)
Water distillation system (Riveria, catalog number: 7222010)
Autoclave (EquitronMedica, model: 7431PAD)
Incubator and shaker (28 °C) (Scigenics Biotech, Orbitek®, model: LE0102DCBA)
Macro centrifuge (Eppendrof, model: 5804R)
Laminar Air Flow (Ikon Instruments, model: 1K-137)
Weighing balance (Mettle Toledo, model: ME204)
Growth chamber (ScigenicsBiotech, Orbitech®, model: GC350)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Singh, N., Kumar, R. and Ray, S. K. (2018). An Innovative Approach to Study Ralstonia solanacearum Pathogenicity in 6 to 7 Days Old Tomato Seedlings by Root Dip Inoculation. Bio-protocol 8(21): e3065. DOI: 10.21769/BioProtoc.3065.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Plant Science > Plant immunity > Host-microbe interactions
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,066 | https://bio-protocol.org/exchange/protocoldetail?id=3066&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Eicosanoid Isolation from Mouse Intestinal Tissue for ELISA
Isabella Rauch
Published: Vol 8, Iss 21, Nov 5, 2018
DOI: 10.21769/BioProtoc.3066 Views: 3902
Edited by: Ivan Zanoni
Reviewed by: XIAOMING SunChangyi Zhang
Original Research Article:
The authors used this protocol in Apr 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2017
Abstract
Activation of inflammasomes in peritoneal macrophages and intestinal epithelial cells (IEC) leads to the release of eicosanoids. To assess the amount of eicosanoids released by IEC, lipids need to be isolated from whole tissue previous to analysis by lipid mass spectrometry or ELISA. This protocol describes how to isolate lipids from intestinal tissue for analysis by PGE2-ELISA and normalize to tissue protein content.
Keywords: Intestine Eicosanoid ELISA Prostaglandin Lipid extraction
Background
Inflammasome induced eicosanoid release is a relatively recent observation. It is not clear which cell/tissue types other than peritoneal macrophages and intestinal epithelial cells (IEC) (Rauch et al., 2017) can release prostaglandins upon inflammasome activation yet. This protocol can be adapted for other types of tissue as well as measurement of eicosanoid release induced by other stimuli than inflammasome activation in intestinal tissue.
Note that this protocol is specifically for use of eicosanoid analysis by ELISA, other protocols have been described for eicosanoid analysis by lipid mass spectrometry.
Materials and Reagents
Culture tubes (Corning, Falcon, catalog number: 352059)
15 ml tubes (Corning, Falcon, catalog number: 352097)
Flat bottom 96-well plates, transparent (Corning, Costar, catalog number: 3370)
pH test strips (GE Healthcare, Whatman, catalog number: 2613-991)
SPE Cartridges (C-18) (Cayman Chemical, catalog number: 400020)
Paper towel
Liquid nitrogen
UltraPureTM water (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977)
Indomethacin (Sigma-Aldrich, catalog number: I8280-5G)
PBS (Thermo Fisher Scientific, GibcoTM, catalog number: 10010)
200 proof Kopec Ethanol (Decon Labs, catalog number: V1001)
Methanol (Fisher Scientific, catalog number: A452SK)
Ethyl acetate (Sigma-Aldrich, catalog number: 270989)
Prostaglandin E2 ELISA Kit (Monoclonal) (Cayman Chemical, catalog number: 514010)
BCA assay kit (Thermo Fisher Scientific, PierceTM, catalog number: 23227)
K2HPO4 (Fisher Scientific, catalog number: P288)
KH2PO4 (Fisher Scientific, catalog number: P285)
DMSO (Sigma-Aldrich, catalog number: D8418)
EDTA (Life Technologies, catalog number: 15575020)
Sodium acetate (Sigma-Aldrich, catalog number: S2889)
Acetic acid (Sigma-Aldrich, catalog number: A6283)
Phosphate buffer (see Recipes)
1 M acetate buffer (see Recipes)
Equipment
Forceps
Scissors
POLYTRON® PT 2500 E Stand Dispersion Unit (Ecoline) with 12 mm aggregate (Kinematica) or similar
Fridge
Centrifuge for 15 ml reaction tubes capable of cooling (Eppendorf 5810R or similar)
Vortex
96-well plate reader capable of measuring absorbance between 405 and 420 nm and 562 nm (e.g., Molecular Devices, model: Spectramax® M2)
Reacti-VapTM Evaporator (Thermo Fisher Scientific, catalog numbers: TS-18825 or TS-18826) or similar
Nitrogen gas with pressure gauge hooked up to evaporator
SPE Vacuum Manifold (Sigma-Aldrich, catalog number: 57250-U or similar)
Vacuum trap (e.g., Fisher Scientific, FisherbrandTM Reusable Heavy-Wall Filter Flasks, catalog number: FB3001000) connected to central vacuum system or pump (e.g., Merck, Chemical Duty Vacuum Pressure Pump, catalog number: WP6122050) via tubing and rubber stopper
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rauch, I. (2018). Eicosanoid Isolation from Mouse Intestinal Tissue for ELISA. Bio-protocol 8(21): e3066. DOI: 10.21769/BioProtoc.3066.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Immunology > Mucosal immunology > Digestive tract
Biochemistry > Lipid > Lipid isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,067 | https://bio-protocol.org/exchange/protocoldetail?id=3067&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for in situ Proximity Ligation Assay (PLA) and Microscopy Analysis of Epidermal Growth Factor Receptor (EGFR) Homodimerization
KO Keiichi Ota
TH Taishi Harada
Published: Vol 8, Iss 21, Nov 5, 2018
DOI: 10.21769/BioProtoc.3067 Views: 7563
Edited by: Chiara Ambrogio
Reviewed by: Mauro Sbroggio'
Original Research Article:
The authors used this protocol in Jul 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2017
Abstract
Oncogenic drivers play central roles in tumorigenesis as well as in tumor cell survival and proliferation. Mutations of the epidermal growth factor receptor gene (EGFR) that result in constitutive activation of the receptor tyrosine kinase have been identified as oncogenic drivers in a subset of non-small cell lung cancer (NSCLC). PCR-based assays are usually adopted for the detection of EGFR mutations, but no methods to detect EGFR activation that are not based on mutation identification have been established in the clinical setting. We describe a proximity ligation assay (PLA) used to visualize and quantitate EGFR homodimerization in NSCLC cell lines and tissue specimens. Rabbit monoclonal antibodies against EGFR were conjugated to PLUS or MINUS PLA oligonucleotide arms using Probemaker. Annealing of the PLUS and MINUS PLA probes occurred when two EGFR monomers were in close proximity, and repeat sequences in the annealed oligonucleotide complexes were amplified then recognized by a fluorescently-labeled oligonucleotide probe. PLA signals were detected and counted with a fluorescence microscope. We demonstrate the detection of EGFR homodimers by PLA analysis in a quantitative manner in both NSCLC cell lines and tissue samples obtained by transbronchial lung biopsy. PLA methods are a new tool for the detection and quantitation of protein-protein interactions such as homodimers, heterodimers, and fusion proteins.
Keywords: Oncogenic driver Epidermal growth factor receptor (EGFR) Anaplastic lymphoma kinase (ALK) Non-small cell lung cancer (NSCLC) Proximity ligation assay (PLA) Dimerization
Background
Activating mutations of the epidermal growth factor receptor gene (EGFR) are currently detected by PCR-based assays (Nagai et al., 2005). However, the visual detection and quantitation of activated EGFR in the clinical setting has not been established. In situ proximity ligation assay (PLA) is a technology that uses Duolink® In situ reagents (see References 1 and 2) to create probes by conjugating oligonucleotides to antibodies. When two different types of PLA probes (PLUS and MINUS) are in close proximity (40 nm), annealing occurs which generates an amplified circular DNA. The signal from each detected pair of PLA probes is visualized as an individual spot, and the number of PLA signals per cell can be counted with a fluorescence microscope (Figure 1).
The PLA method can be used to detect any protein-protein interactions in close proximity. We have now applied the PLA using primary antibodies derived from the same species to visualize and quantitate EGFR homodimerization. Furthermore, we detected the formation of EGFR-human epidermal growth factor receptor2 heterodimers and echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion protein in NSCLC cell lines (Ota et al., 2017). This method will be applicable to the detection of other dimerizations and fusions.
Figure 1. In situ PLA principle for EGFR homodimer. A. PLA probes, created by conjugating PLA oligonucleotides and monoclonal antibodies for EGFR, bind to EGFR. B. Connected oligonucleotides hybridize and create multiple circular DNA molecules. C. Fluorescently-labeled detection of oligonucleotides hybridizing to the DNA circle. (Pictures were taken from the Duolink® In situ User Guide [References 1 and 2]).
Materials and Reagents
Standard pipette tips with a volume capacity of 10 μl, 20 μl, 100 μl, 200 μl, and 1,000 μl (Thermo Fisher Scientific, catalog numbers: 2140, 2149P, ART 10REACH, ART 20P)
Kimwipe waste paper sheet S-200 (Crecia, catalog number: 62011)
12-mm-diameter uncoated cover glasses (Matsunami Glass, catalog number: C012001)
24-well plates (Greiner Bio-One, cell culture multiwell plates, catalog number: 66)
Staining jar (Matsunami, catalog number: No. 13 BT500)
Dako Pen (Daido Sangyo, PAP-SPAP Pen Super-Liquid Blocker)
Serological pipettes
Slide glasses
NSCLC cell lines: H1975 cells
Roswell Park Memorial Institute (RPMI) 1640 medium (Invitrogen, Gibco, catalog number: 61870-036)
Dulbecco's modified Eagle’s medium (DMEM) (Invitrogen, Gibco, catalog number: 12634010)
Fetal bovine serum (FBS) (Sigma, catalog number: 14C438FBS)
Penicillin/Streptomycin solution (Invitrogen, catalog number: 15140122)
Phosphate-buffered saline (PBS) (LSI, catalog number: RM102-PN)
4% paraformaldehyde in PBS (Wako, catalog number: 16320145)
ImmunoSaver (Wako, catalog number: 9706192)
Duolink® In situ oligonucleotide PLUS (-20 °C) (Sigma-Aldrich, catalog number: DUO92009)
Duolink® In situ oligonucleotide MINUS (-20 °C) (Sigma-Aldrich, catalog number: DUO92010)
Conjugation buffer (-20 °C) (Sigma-Aldrich, catalog number: DUO92009)
Stop reagent (-20 °C) (Sigma-Aldrich, catalog number: DUO92009)
Storage solution (-20 °C) (Sigma-Aldrich, catalog number: DUO92009)
20x assay reagent (-20 °C) (Sigma-Aldrich, catalog number: DUO92009)
Blocking solution (4 °C) (Sigma-Aldrich, catalog number: DUO92009)
PLA probe diluent (4 °C) (Sigma-Aldrich, catalog number: DUO92009)
Rabbit monoclonal antibodies to EGFR (Abcam, catalog number: ab52894)
5x Ligation buffer (-20 °C) (Sigma-Aldrich, catalog number: DUO92008)
1x Ligase (-20 °C) (Sigma-Aldrich, catalog number: DUO92008)
5x Amplification Red (-20 °C) (Sigma-Aldrich, catalog number: DUO92008)
1x Polymerase (-20 °C) (Sigma-Aldrich, catalog number: DUO92008)
Duolink® In situ mounting medium with DAPI (Sigma-Aldrich, catalog number: DUO82040)
10% neutral-buffered formalin
Paraffin
Xylene
Ethanol solutions
Nail polish
Culture media (10% FBS) (see Recipes)
Wash buffer A (Sigma-Aldrich, catalog number: DUO82049, see Recipes)
Wash buffer B (Sigma-Aldrich, catalog number: DUO82049, see Recipes)
Equipment
Manual pipettes: set of 10 μl, 20 μl, 100 μl, 200 μl, and 1,000 μl (Mettler Toledo, catalog number: Pipet-Lite XLS+ 17014409, 17014412, 17014408, 17014411, 17014407)
Tweezers
Freezer
Direct-Q® 5 UV Remote Water Purification System (Merck, model: Direct-Q® UV 5 Remote, catalog number: ZRQSVR5WW)
Autoclave (Tomy, catalog number: LSX-500)
Vortex mixer (Scientific Industries, model: Vortex-Genie 2, catalog number: S1-0286)
Humidity chamber (Incubation Chamber, Cosmo Bio, catalog number: 10DO)
Freeze block for enzymes (-20 °C) (Eppendorf, catalog number: 3880001018)
Fluorescence microscope (Keyence, model: BZ-8100)
Software
BZ Analyzer software (Keyence)
Excel (Microsoft)
GraphPad Prism 5.0 (GraphPad Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ota, K. and Harada, T. (2018). Protocol for in situ Proximity Ligation Assay (PLA) and Microscopy Analysis of Epidermal Growth Factor Receptor (EGFR) Homodimerization. Bio-protocol 8(21): e3067. DOI: 10.21769/BioProtoc.3067.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Molecular biology technique
Molecular Biology > Protein > Phosphorylation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,068 | https://bio-protocol.org/exchange/protocoldetail?id=3068&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Infectious Sendai Virus Using Plaque Assay
NT Narihito Tatsumoto
TM Takamasa Miyauchi
MA Moshe Arditi
MY Michifumi Yamashita
Published: Vol 8, Iss 21, Nov 5, 2018
DOI: 10.21769/BioProtoc.3068 Views: 6609
Edited by: Longping Victor Tse
Reviewed by: Welsch Charles Jeremy
Original Research Article:
The authors used this protocol in Jul 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2012
Abstract
Sendai virus (SeV) is an enveloped, single-stranded RNA virus of the family Paramyxoviridae. SeV is a useful tool to study its infectious pathomechanism in immunology and the pathomechanism of a murine model of IgA nephropathy. Virus quantification is essential not only to determine the original viral titers for an appropriate application, but also to measure the viral titers in samples from the harvests from experiments. There are mainly a couple of units/titers for Sendai viral quantification: plaque-forming units (PFU) and hemagglutination (HA) titer. Of these, we here describe a protocol for Sendai virus plaque assay to provide PFU using LLC-MK2 cells (a rhesus monkey kidney cell lines) and Guinea pig red blood cells. This traditional protocol enables us to determine Sendai virus PFU in viral stock as well as samples from your experiments.
Keywords: Sendai virus Plaque assay Titration Paramyxivirus Plaque-forming units PFU
Background
SeV is a mouse parainfluenza virus type I (Faisca and Desmecht, 2007) that was discovered in Sendai, Japan, in the 1950s (Ishida and Homma, 1978). SeV is a useful tool to study its infection and immune reaction (Fensterl et al., 2008; Chattopadhyay et al., 2010, 2011 and 2013; Yamashita et al., 2012a, 2012b and 2013; Veleeparambil et al., 2018) and the pathomechanism of a SeV-induced of IgA nephropathy (Yamashita et al., 2007; Chintalacharuvu et al., 2008). SeV is Precise viral quantification is essential to perform animal and cell culture experiments using an appropriate dose of SeV and also to obtain correct results from experimental samples containing SeV. In 1970s, SeV was quantitated by inoculation into embryonated eggs using hemagglutinin production as a criterion for infection (Shibuta et al., 1971). This method is highly sensitive but time consuming and complex. Therefore, a kidney cell-based plaque assay, a simple and reliable assay using hemadsorption (the attachment of red blood cells to the surface of cell monolayers infected with virus) has been developed (Jessen et al., 1987). This protocol provides a method for SeV PFU using LLC-MK2 cells (a rhesus monkey kidney cell lines) and Guinea pig red blood cells. This method can be applied for most types of samples including cell culture media, cell lysates, tissue homogenates, serum, urine, and bronchoalveolar lavage.
Materials and Reagents
96-well Polypropylene 1.2 ml Cluster Tubes (Sigma-Aldrich, catalog number: CLS4401-960EA)
CorningTM 6-well plate (Thermo Fisher Scientific, catalog number: 07-200-83)
CorningTM 10 ml pipettes (Thermo Fisher Scientific, catalog number: 07-200-574)
15 ml tubes (Thermo Fisher Scientific, catalog number: 12-565-268)
Sendai virus (ATCC, catalog number: ATCC VR-105) as positive control
HyClone® Characterized Fetal Bovine Serum, U.S. Origin (GE Healthcare Life Sciences, catalog number: SH30071.03HI)
GibcoTM Gentamicin, 10 mg/ml (Thermo Fisher Scientific, catalog number: 11500506)
L-Glutamine, 200 mM (Thermo Fisher Scientific, catalog number: A2916801)
LLC-MK2 Original (ATCC, catalog number: CCL-7)
Note: These cells are maintained in Medium 199 (Thermo Fisher Scientific, catalog number: 11150-067) containing 5% Fetal Bovine Serum, 20 μg/ml gentamicin, and 2 mM L-glutamine (complete Medium 199). LLC-MK2 cells should be used only up to about passage of 50. The plaques will become gradually smaller as the cell line ages.
Guinea Pig Blood in Alsevers (Rockland antibodies & assays, catalog number: R305-0050)
Note: This needs to be less than 2 weeks old.
Medium 199 (10x) (Thermo Fisher Scientific, catalog number: 11825015)
Medium 199 (1x) (Thermo Fisher Scientific, catalog number: 11150067)
HBSS, calcium, magnesium (Thermo Fisher Scientific, catalog number: 14025092)
Sodium Bicarbonate 7.5% solution (Thermo Fisher Scientific, catalog number: 25080094)
BD Difco Agar (Fisher Scientific, catalog number: DF0812-17-9)
Trypsin (0.25%), phenol red (Thermo Fisher Scientific, catalog number: 15050065)
Note: The final concentration is 0.00025% (2.5 μg/ml). This reagent needs optimization for a particular lot. 2.5 μg/ml ± 0.25 μg/ml can make the difference between nice large plaques and the cells detached from the plates.
Sterile PBS (with Ca2+ and Mg2+)
Penicillin-Streptomycin (5,000 U/ml) (Thermo Fisher Scientific, catalog number: 15070063)
Complete 2x medium (see Recipes)
Equipment
Multichannel pipette (Gilson, catalog number: FA10015)
Pipettes, P20, P200, P1000 (Gilson, catalog number: F167300)
Biosafety cabinet (Thermo Fisher Scientific, catalog number: 1305)
Tissue culture incubator (at 37 °C with 5% CO2) (Thermo Fisher Scientific, catalog number: 51025983)
100 ml glass bottles (Research Products International, catalog number: 219510)
PrecisionTM General Purpose Water bath (Thermo Fisher Scientific, catalog number: TSGP02)
Autoclave (Steris Amsco Eagle, catalog number: 3021-C Gravity Steam Sterilizer)
Sonic water bath (Skymen Cleaning Equipment, model: JP-008)
Vortex mixer (Research Products International, catalog number: 155560)
Portable Mini Light Box, Benchtop Light Source (Research Products International, catalog number: 815500)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tatsumoto, N., Miyauchi, T., Arditi, M. and Yamashita, M. (2018). Quantification of Infectious Sendai Virus Using Plaque Assay. Bio-protocol 8(21): e3068. DOI: 10.21769/BioProtoc.3068.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Can Sendai virus form plaques in A549 cells? I cannot seem to find articles on that
1 Answer
16 Views
May 14, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,069 | https://bio-protocol.org/exchange/protocoldetail?id=3069&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Electroporation of Labeled Antibodies to Visualize Endogenous Proteins and Posttranslational Modifications in Living Metazoan Cell Types
Sascha Conic
DD Dominique Desplancq
LT László Tora
EW Etienne Weiss
Published: Vol 8, Iss 21, Nov 5, 2018
DOI: 10.21769/BioProtoc.3069 Views: 4912
Edited by: David Cisneros
Reviewed by: Yi CuiTrinadh Venkata Satish Tammana
Original Research Article:
The authors used this protocol in Apr 2018
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2018
Abstract
The spatiotemporal localization of different intracellular factors in real-time and their detection in live cells are important parameters to understand dynamic protein-based processes. Therefore, there is a demand to perform live-cell imaging and to measure endogenous protein dynamics in single cells. However, fluorescent labeling of endogenous protein in living cells without overexpression of fusion proteins or genetic tagging has not been routinely possible. Here we describe a versatile antibody-based imaging approach (VANIMA) to be able to precisely locate and track endogenous proteins in living cells. The labeling is achieved by the efficient and harmless delivery of fluorescent dye-conjugated antibodies or antibody fragments (Fabs) into living cells and the specific binding of these antibodies to the target protein inside of the cell. Our protocol describes step by step the procedure from testing of the suitability of the desired antibody, over the digestion of the antibody to Fabs until the labeling and the delivery by electroporation of the antibody or Fab into the cells. VANIMA can be adapted to any monoclonal antibody, self-produced or commercial, and many different metazoan cell lines. Additionally, our method is simple to implement and can be used not only to visualize and track endogenous factors, but also to specifically label posttranslational modifications, which cannot be achieved by any other labeling technique so far.
Keywords: Antibodies Fab fragments Live-imaging Antibody delivery Single cells Endogenous proteins Posttranslational modifications
Background
The fluorescent labeling of proteins to follow in real time their spatiotemporal localization in living cells was mainly achieved until now by using transgenic or overexpression-based approaches. However, the labeling of specific endogenous proteins or even posttranslational modifications in living cells is not yet routinely possible. Imaging of cellular structures and processes is typically performed by either immunofluorescence (IF) labeling on fixed cells or by exogenously overexpressing fluorescent fusion proteins in living cells. Although these well-established techniques showed to be very powerful to locate or follow proteins inside the cells, they inherit also some important drawbacks. In IF, the cells need to be chemically fixed and permeabilized to be able to incubate them with specific primary and secondary antibodies. Despite many variables and potential artifacts (Schnell et al., 2012; Teves et al., 2016) like fixation-related protein denaturation or permeabilization efficiency, IF is still often used to visualize target proteins in fixed cells or tissues. Otherwise, imaging of proteins in living cells is mainly achieved through the exogenously expression of fluorescent fusion proteins (Ellenberg et al., 1999; Betzig et al., 2006; Schneider and Hackenberger, 2017) or by knock-in of a fluorescent tag into the endogenous locus using the CRISPR/Cas9 technology (Ratz et al., 2015). Although fluorescent fusion proteins have been proven to be very powerful, they often do not behave as their endogenous counterparts due to their increased levels when exogenously overexpressed (Burgess et al., 2012). On the other hand, endogenous fusion proteins containing knocked-in tags are difficult to obtain as knock-in efficiencies are often very low. Consequently, there is a need for new and easy to implement imaging approaches to visualize endogenous target proteins in single living cells. Previous studies and methods, like FabLEM or the expression of mintbodies, showed that intracellular labeling of proteins with fluorescently labeled antibody fragments can give new insights into the dynamics of histone modifications (Hayashi-Takanaka et al., 2009; Hayashi-Takanaka et al., 2011; Sato et al., 2013). However, these techniques suffer from lower delivery efficiencies into living cells, or potential poor solubility of the intracellular expressed mintbodies. Recently, another method achieved fluorescent labeling of endogenous proteins by using a bacterial toxin called streptolysin O, which creates pores in the membrane of cells and allows for the delivery of fluorescent probes into living cells (Teng et al., 2016). However, this method requires additional steps to be able to reseal the membrane after treatment which can be quite harmful for the cells and can decrease cell viability. In contrast, our versatile antibody-based imaging approach (VANIMA) uses fluorescent dye-conjugated antibodies or Fabs, which are delivered into the cells by electroporation (Freund et al., 2013; Brees and Fransen, 2014). The antibody labeling reaction is highly efficient and can result in up to 5-7 fluorescent dyes per molecule of antibody depending on the antibody and the labeling kit used. The transduction of the antibodies has a very high delivery efficiency and viability of the cells is above 90% in human cancer cell lines such as U2OS. Afterwards, the transduced antibodies will bind to the endogenous target protein inside the cell and for nuclear targets they will be transported with the target protein into the nucleus (piggyback mechanism). Otherwise, for faster delivery into the nucleus of the cells, the antibodies can be digested to produce Fabs which can freely diffuse into the nucleus to find and bind their target. Thus, even proteins with posttranslational modifications in the nucleus can be visualized specifically using fluorescently-labeled Fabs against the target. Considering that there are several thousands of commercially-available antibodies that specifically recognize intracellular target proteins with high affinity, VANIMA can be used to uncover the dynamical behavior of a plethora of targets in living cells (Conic et al., 2018). Besides nuclear targets, the antibodies could also be used to label and image cytoplasmic structures/proteins. However, it is important to note that only proteins that are either directly accessible for the antibodies/Fabs or that can be reached through the piggyback mechanism can be labeled using this technique. We were already able to label α-tubulin in the cytoplasm but other accessible targets like the mitochondrial membrane or cytoplasmic vesicles could also be tested for labeling with VANIMA. However, specific labelling of cytoplasmic targets would only be possible if the target molecules are highly expressed. If their abundance in the cell is below the one of the introduced antibodies, a large fraction of the antibodies does not bind and will generate background staining. Additionally, the method is easy to implement in any laboratory and can also be used to perform multicolor imaging with different targets just by labeling two different antibodies with different dyes or by combining it with an already established endogenous knock-in clone. Finally, VANIMA can also be used with identified inhibiting antibodies to disrupt protein functions inside living cells.
Materials and Reagents
15 ml conical Falcon tubes (Corning, Falcon, catalog number: 352095)
1.5 ml Eppendorf tubes (Sigma-Aldrich, Eppendorf, catalog number: Z66505-100EA)
0.5 ml Eppendorf tubes (Sigma-Aldrich, Eppendorf, catalog number: Z666491-100EA)
Falcon 12-well clear flat bottom cell culture plate (Corning, catalog number: 351143)
µ-slide 8-well glass bottom: No. 1.5H (170 µm +/- 5 µm) (Ibidi, catalog number: 80827)
18 mm high precision cover glasses (Marienfeld, catalog number: 117580)
Microscope slides ground edges plain (VWR, catalog number: 631-1552)
Poly-Prep chromatography column (Bio-Rad, catalog number: 731-1550)
DiaEasy dialyzer (3 ml) MWCO 6-8 kDa (Biovision, catalog number: K1013-25)
DiaEasy dialyzer (800 µl) MWCO 6-8 kDa (Biovision, catalog number: K1019-25)
Amicon Ultra-4 centrifugal filter units 10 kDa (Merck-Millipore, catalog number: UFC801024)
Amicon Ultra-0.5 centrifugal filter units 10 kDa (Merck-Millipore, catalog number: UFC501096)
CountessTM cell counting chamber slides (Thermo Fisher, catalog number: C10312)
Sterile individually packaged 5 ml pipettes (Sigma-Aldrich, catalog number: SIAL1487)
Sterile individually packaged 10 ml pipettes (Sigma-Aldrich, catalog number: SIAL1488)
U2OS osteosarcoma cells [American Type Culture Collection (ATCC, catalog number: HTB-96)]
Neon transfection 10 µl kit (including the Neon 10 µl tips) (Invitrogen, catalog number: MPK1096)
AlexaFluor-488 antibody labeling kit (Invitrogen, catalog number: A20181)
Dulbecco's Modified Eagle Medium (DMEM) (Thermo Scientific, Gibco, catalog number: 10567-014)
Heat-inactivated fetal calf serum (FCS) (Gibco, catalog number: 15750-037)
Gentamicin (Gibco, catalog number: 15750-037)
16% Paraformaldehyde (16% PFA) (Electron Microscopy Sciences, catalog number: 50-980-487)
Phosphate Buffered Saline (PBS) (GE Healthcare, catalog number: SH30013.03)
Triton X-100 (Sigma-Aldrich, catalog number: X100-100ML)
Vectashield antifade mounting medium with DAPI (Vector-Laboratories, catalog number: H-1200-10)
Alexa Fluor 488 goat-anti-mouse IgG (life technologies, catalog number: A11001)
Protein G Sepharose FastFlow (GE Healthcare, catalog number: GE17-0618-01)
Protein A Sepharose FastFlow (GE Healthcare, catalog number: GE17-5280-01)
Papain-coated magnetic beads (Spherotech, catalog number: PAPM-40-2)
Tris-HCl (Sigma-Aldrich, catalog number: 10812846001)
Glycine (Sigma-Aldrich, catalog number: G8898)
Sodium bicarbonate (Sigma-Aldrich, catalog number: S5761-1KG)
Tris(2-carboxyethyl) phosphine hydrochloride (TCEP) (Sigma-Aldrich, catalog number: C4706)
Sodium dodecyl sulfate (SDS) (Euromedex, catalog number: EU0660)
Acrylamide/Bis-acrylamide 40% solution (Euromedex, catalog number: EU0077-B)
Tetramethylethylendiamin (TEMED) (Serva, catalog number: 35930.01)
Ammonium persulfate (APS) (Sigma-Aldrich, catalog number: A3678)
Trypsin (Sigma-Aldrich, catalog number: T4799)
U2OS growth medium (see Recipes)
4% Paraformaldehyde (4% PFA) (see Recipes)
10x Phosphate Buffered Saline (10x PBS) (see Recipes)
Triton X-100 solutions (see Recipes)
10% Triton X-100
0.1% Triton X-100
0.02% Triton X-100
1 M Tris-HCl pH 8.2 (see Recipes)
0.1 M glycine-HCl pH 2.7 (see Recipes)
Sodium bicarbonate buffers (see Recipes)
1 M sodium bicarbonate pH 8.2
0.1 M sodium bicarbonate
2.5% Trypsin (see Recipes)
Equipment
Pipetman P2 pipette (Gilson, catalog number: F144801)
Pipetman P20 pipette (Gilson, catalog number: F123600)
Pipetman P200 pipette (Gilson, catalog number: F123601)
Pipetman P1000 pipette (Gilson, catalog number: F123602)
Jewelers forceps, Dumont No. 5 (Sigma-Aldrich, Dumont, catalog number: 6521)
Pipette boy (Corning, Falcon, catalog number: 357469)
Water bath (Julabo, model: ED (v.2))
Magnetic tube rack (Diagenode, catalog number: B04000001)
Fume hood Hera Safe KS (Thermo Scientific, catalog number: 51023175)
Cell culture incubator with CO2 supply (Sanyo, catalog number: MCO-19AIC)
SP8UV confocal microscope (Leica)
Eppendorf centrifuge 5804 R (Eppendorf, model: 5804 R, catalog number: 805000620)
Beckman Coulter Allegra centrifuge (Beckman, catalog number: 21R)
NanoDrop 2000 spectrophotometer (Thermo Scientific, model: NanoDropTM 2000, catalog number: ND2000)
Countess Cell Counter (Thermo-Fisher, catalog number: AMQAX1000)
Neon Transfection System (Invitrogen, catalog number: MPK5000S)
Software
Fiji/Image J (https://fiji.sc/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Conic, S., Desplancq, D., Tora, L. and Weiss, E. (2018). Electroporation of Labeled Antibodies to Visualize Endogenous Proteins and Posttranslational Modifications in Living Metazoan Cell Types. Bio-protocol 8(21): e3069. DOI: 10.21769/BioProtoc.3069.
Conic, S., Desplancq, D., Ferrand, A., Fischer, V., Heyer, V., Reina San Martin, B., Pontabry, J., Oulad-Abdelghani, M., Babu, N. K., Wright, G. D., Molina, N., Weiss, E. and Tora, L. (2018). Imaging of native transcription factors and histone phosphorylation at high resolution in live cells. J Cell Biol 217(4): 1537-1552.
Download Citation in RIS Format
Category
Cell Biology > Cell-based analysis > Transport
Immunology > Antibody analysis > Antibody detection
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
307 | https://bio-protocol.org/exchange/protocoldetail?id=307&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sphere Formation (Osteosphere/Sarcopshere) Assay
UB Upal Basu-Roy
CB Claudio Basilico
AM Alka Mansukhani
Published: Vol 2, Iss 24, Dec 20, 2012
DOI: 10.21769/BioProtoc.307 Views: 21221
Original Research Article:
The authors used this protocol in May 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2012
Abstract
Self-renewing cells from adult tissue (such as bone) that represent a progenitor population can be grown in suspension cultures in the presence of defined serum-free medium. Progenitor cells can be identified by this property of anchorage-independent growth in suspension cultures. These spherical clusters of progenitor bone cells growing under non-adherent conditions are called osteospheres. Such progenitor populations often possess characteristics of multipotency and can differentiate into multiple mesenchymal lineages. Cancer cells capable of growing in suspension have also been reported in osteosarcomas, tumors of the bone tissue. These spherical colonies formed from single cells (clonal) in non-adherent conditions are generally considered to represent self-renewing, stem-like cells and can be employed for other assays such as multipotency and limiting dilution analysis (LDA).
Materials and Reagents
Osteosarcoma cells (Basu-Roy et al., 2012)
Trypsin
Trypan blue from Invitrogen (Life Technologies, Invitrogen™, catalog number: 15250-061 )
N2B27-defined serum free medium
DMEM/F-12 1:1 from Invitrogen (Life Technologies, Invitrogen™, catalog number: 11330-057 )
Neurobasal medium from Invitrogen (Life Technologies, Invitrogen™, catalog number: 21103-049 )
Glutamax – from Invitrogen (Life Technologies, Invitrogen™, catalog number: 35050-061 )
55 mM Beta-mercaptoethanol – from Invitrogen (Life Technologies, Invitrogen™, catalog number: 21985-023 )
B27 serum-free supplement – from Invitrogen (Life Technologies, Invitrogen™, catalog number: 17504-044 )
Ndiff Neuro-2-medium supplement from Millipore (EMD Millipore, catalog number: SCM012 )
Complete N2B27-medium (see Recipes)
Equipment
Standard tissue culture equipment
Ultra-low attachment tissue culture plastic ware from Corning (Corning Incorporated, catalog number: 3473 for 24 well plate; catalog number: 3474 for 96 well plate)
40 μM cell trainer from BD Falcon (BD Biosciences, Falcon®, catalog number: 352340 )
Dissecting microscope
Accumax (Innovative Cell Technologies, model: AM 105 )
Hemocytometer
10-cm plate (Corning Incorporated, catalog number: 3262 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Basu-Roy, U., Basilico, C. and Mansukhani, A. (2012). Sphere Formation (Osteosphere/Sarcopshere) Assay. Bio-protocol 2(24): e307. DOI: 10.21769/BioProtoc.307.
Download Citation in RIS Format
Category
Cancer Biology > Cancer stem cell > Cell biology assays
Cancer Biology > General technique > Cell biology assays
Stem Cell > Adult stem cell > Maintenance and differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
3,070 | https://bio-protocol.org/exchange/protocoldetail?id=3070&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Single-molecule Fluorescence in situ Hybridization (smFISH) for RNA Detection in Adherent Animal Cells
Gal Haimovich
JG Jeffrey E. Gerst
Published: Vol 8, Iss 21, Nov 5, 2018
DOI: 10.21769/BioProtoc.3070 Views: 31736
Reviewed by: Samantha E. R. Dundontakashi nishina
Original Research Article:
The authors used this protocol in Nov 2017
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2017
Abstract
Transcription and RNA decay play critical roles in the process of gene expression and the ability to accurately measure cellular mRNA levels is essential for understanding this regulation. Here, we describe a single-molecule fluorescent in situ hybridization (smFISH) method (as performed in Haimovich et al., 2017) that detects single RNA molecules in individual cells. This technique employs multiple single-stranded, fluorescent labeled, short DNA probes that hybridize to target RNAs in fixed cells, allowing for both the quantification and localization of cytoplasmic and nuclear RNAs at the single-cell level and single-molecule resolution. Analyzing smFISH data provides absolute quantitative data of the number of cytoplasmic (“mature”) mRNAs, the number of nascent RNA molecules at distinct transcription sites, and the spatial localization of these RNAs in the cytoplasm and/or nucleoplasm.
Keywords: mRNA Transcription Fluorescence in situ hybridization Single molecule resolution Fluorescence microscopy Adherent cells
Background
Regulation of gene expression is one of the key determinants of cell fate and behavior. A major parameter of gene expression is mRNA level, which is determined by the rates of transcription and degradation. Therefore, measuring mRNA levels, as well as transcription and decay rates for particular transcripts (or all transcripts) has been the focus of numerous research projects.
Common molecular biology techniques, such as reverse transcription-PCR (RT-PCR), Northern blot analysis or RNA sequencing (RNA-Seq), typically require RNA extraction from the entire cell population. However, the results provide only a relative measure of mRNA content for the entire cell population, with a loss of single cell information. Single-cell RNA-Seq can provide more insight on the cell-to-cell variability of transcript levels. However, the current lower limit of detection is ~10 molecules/cell for a given RNA transcript (Svensson et al., 2017). RNA localization studies have shown that the spatial distribution of RNA in the cell can play a pivotal role in its function (Buxbaum et al., 2015), but the above-described methods lose that information in the process.
Single-molecule Fluorescence in situ Hybridization (smFISH) overcomes these limitations. In this method, the cells are first fixed and permeabilized. Then the cells are hybridized with a set of probes consisting of multiple short fluorescently labeled DNA oligonucleotides, which tile the length of the mRNA (Figure 1). The multiplicity of probes on a single RNA molecule increases the signal-to-noise ratio and allows for their detection by microscopy as diffraction-limited spots of similar intensity and dimensions. A 3D Gaussian fitting algorithm is used in image analysis tools to detect the spots in the images. smFISH can detect as little as a single RNA molecule and as much as several thousands. Importantly, smFISH provides spatial information of RNA localization in the cell. Although this protocol uses the example of mRNA, smFISH can be used to detect and quantify many types of RNA molecules, for example long non-coding RNAs (lncRNA) (Cabili et al., 2015), viral RNA genomes (Chou et al., 2013), ribosomal RNA (Buxbaum et al., 2014) and more.
There are two major disadvantages to smFISH. First, since the cells are fixed, smFISH cannot be used for temporal analysis of gene expression in the same cell (i.e., live imaging). Second, due to fluorophore limitations (i.e., only a small number of colors can be used for microscopy), smFISH is currently limited to study only 1-4 genes in a single experiment. However, multiple variations of smFISH exist leading to signal enhancement, increased resolution and/or multiplexing, and ultimately the simultaneous detection of transcripts from tens to hundreds of genes (reviewed at Buxbaum et al., 2015; Pichon et al., 2018). smFISH can be used in any organism, in cell culture and in tissue slices. Although the basic protocol concepts are similar, specialized protocols (which are abundant in the literature) are required for each sample type. Here we provide a detailed protocol for smFISH in adherent animal cells. smFISH originated in the lab of Prof. Robert H. Singer, which initially used a few (~5) 50-mer multiple-labeled probes (which were synthesized in-lab) for detection (Femino et al., 1998). Prof. Arjun Raj improved the method (Raj et al., 2008) by using a larger number of shorter single-label oligos (20-mer) that tile the entire length of the RNA. These protocols are available at their respective lab websites (e.g., Singer lab and Raj lab). However, these protocols are outdated (e.g., in regards to reagents and types of probes), and are lacking in details. There are published method papers for smFISH, but surprisingly only a few on adherent cells (e.g., Lee et al., 2016). Furthermore, many labs that use smFISH routinely develop in-house software for smFISH analysis. This is inefficient, confusing, and not very user-friendly to biologists that lack programming background.
This protocol was originally developed at the Singer lab (e.g., Haimovich et al., 2017) and it is presented here with minor modifications made at the Gerst lab. It is partially based on the Raj protocol and the Stellaris® RNA FISH protocol (see Biosearch technologies website). A major difference from other protocols is that we recommend use of the FISH-quant program (Mueller et al., 2013; Tsanov et al., 2016), which is user-friendly, and hope it will be used to standardize smFISH analysis.
Figure 1. A scheme depicting the main principle of smFISH: multiple fluorescently labeled probes tile the length of the mRNA
Materials and Reagents
Pipette tips
Microscope Glass slides 25 x 75 mm x 1 mm thick (e.g., Thermo Scientific, catalog number: 421-004T or equivalent)
Glass coverslips, round, 18 mm, #1 (e.g., Thermo Scientific, catalog numbers: 11709875 or equivalent)
1.7 ml plastic tubes
15 ml plastic tubes
Nuclease-free Barrier tips (10 µl, 200 µl, 1,000 µl)
Hybridization chamber (e.g., closed plastic box, 15 cm tissue culture dish, Petri dish)
Parafilm (Bemis, catalog number: PM996)
Kimwipes (e.g., KCWW, Kimberly-Clark, catalog number: 34120 or equivalent)
12-well plates (e.g., Costar, catalog number: 3513 or equivalent)
Aluminum foil
Adherent cells of interest (e.g., mouse embryonic fibroblasts [MEFs], Gastric carcinoma NCI-N87 cells)
Suitable culture media and supplements (e.g., DMEM supplemented with 10% FBS and penicillin/streptavidin)
(Optional) Extracellular matrix substrate, e.g., Fibronectin (Sigma-Aldrich, catalog number: F1141-5mg)
70% ethanol
Sterile PBS x1 pH 7.4, no calcium, no magnesium (e.g., Thermo Fisher Scientific, GibcoTM, catalog number: 10010-015 or equivalent)
10x PBS, no calcium, no magnesium (e.g., Thermo Fisher Scientific, GibcoTM, catalog number: 14200-067 or equivalent)
MgCl2 (e.g., Sigma-Aldrich, catalog number: M8266-100G or equivalent)
Glycine (e.g., Sigma-Aldrich, catalog number: G8898-500G or equivalent)
32% paraformaldehyde (PFA) (Electron Microscopy Sciences)
Surfact-AmpsTM X-100 (Triton X-100) 10% solution (Thermo Scientific, catalog number: 28314)
Note: This high-purity Triton X-100 gives the best results, but other Triton X-100 products will provide satisfactory results.
20x Saline-sodium citrate (SSC) buffer (e.g., Sigma-Aldrich, catalog number: S6639-1L or equivalent)
Formamide (Sigma-Aldrich, catalog number: 47671-250ml or equivalent) (keep at 4 °C)
Dextran sulfate (Sigma-Aldrich, catalog number: D6001 or equivalent)
E. coli tRNA (100 mg) (Roche, catalog number: 10109541001) (keep at -20 °C)
Bovine serum albumin (BSA) (20 mg/ml) (Roche, catalog number: 10711454001) (keep at -20 °C)
Vanadyl ribonucleoside complex (VRC) 200 mM (e.g., Sigma-Aldrich, catalog number: 94742-1 ml or equivalent) (keep at -20 °C)
Nuclease-free water
DAPI (nuclear stain) (e.g., Sigma-Aldrich, catalog number: D9542-1mg or equivalent)
Fluorescent oligo probe set (e.g., Stellaris probes against human HER2-Quasar570 (Biosearch technologies, DesignReady catalog number: VSMF-2102-5) (see Procedure A for design and production of probes) (keep at -20 °C)
Anti-fade reagent (e.g., ProLong anti-fade series from Thermo scientific)
(Optional) High-quality nail polish (e.g., Electron Microscopy Sciences, catalog number: 72180)
Immersion oil 1.518, suitable for the microscope/objective
PBSM buffer (see Recipes)
Fixation buffer (see Recipes)
Quenching buffer (see Recipes)
Permeabilization buffer (see Recipes)
Pre-hybridization (Pre-hyb) buffer (see Recipes)
Hybridization buffer (see Recipes) (keep at -20 °C)
Hybridization chamber (see Recipes)
DAPI stain solution (see Recipes) (keep at 4 °C)
Equipment
Pipet aid (recommended: S1 pipet filler, Thermo Fisher Scientific, catalog number: 9501)
Tweezer, straight, pointed, stainless steel tip (e.g., Ideal-Tek, catalog number: 4 SA or equivalent)
(Optional) Vacuum trap
Chemical (fume) hood
Biological hood/biosafety cabinet (for cell culture work)
Cell culture incubator suitable for cell culture of your choice (e.g., 37 °C, 5% CO2)
37 °C incubator (e.g., an incubator that is used to culture bacterial plates)
Cardboard tray for slides (e.g., Thermo Fisher Scientific, catalog number: 12-587-10)
Wide-field fluorescent microscope (e.g., Olympus, model: BX-61; Nikon, model: Eclipse Ti-E inverted fluorescence microscope or Zeiss, model: AxioObserver Z1) equipped with the following:
Fluorescent light source [e.g., Illuminator HXP 120 V light source (Carl Zeiss, model: Illuminator HXP 120 V) or X-cite 120 PC lamp (Excelitas Technologies, X-Cite® 120PC)]
Filter sets suitable for the fluorophores used + DAPI (blue) filter
Automated motorized stage for sub-micron movement in X, Y, and Z axes [e.g., MS 2000 XYZ automated stage (ASI, model: MS 2000) or motorized XYZ scanning stage, 130x100 PIEZO (Zeiss, catalog number: 432027-9001-000)]
Plan-Apo 100x (preferred) or 63x oil immersion objective with high NA (1.35 NA or more)
CCD or sCMOS high-resolution digital camera [e.g., Flash 4 sCMOS (Hamamatsu) or Pixis 1024 CCD camera (Photometrics)]
Software suitable to control the microscope (according to manufacturer) for automated imaging of multiple channels, multiple z-stacks and multiple fields (e.g., MetaMorph, ZEN2, µmanager)
Computer capable of image processing (strong CPU, at least 32 GB RAM)
Computer for data storage
Data storage on computer or external drive to allow for storage of 10’s of GBs and up to TB’s of cumulative image data.
Software
MATLAB–R2015a version or higher
FISH-quant (Mueller et al., 2013; Tsanov et al., 2016) (free software https://bitbucket.org/muellerflorian/fish_quant)
ImageJ/FIJI (Schindelin et al., 2012) (free software https://imagej.net/Fiji)
Stellaris FISH probe designer (https://www.biosearchtech.com/support/tools/design-software/stellaris-probe-designer); requires a user account (free)
Excel or equivalent program
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2018 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Haimovich, G. and Gerst, J. E. (2018). Single-molecule Fluorescence in situ Hybridization (smFISH) for RNA Detection in Adherent Animal Cells. Bio-protocol 8(21): e3070. DOI: 10.21769/BioProtoc.3070.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fluorescence
Molecular Biology > RNA > RNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.