id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
2,041 | https://bio-protocol.org/exchange/protocoldetail?id=2041&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Intracellular Calcium Concentration in Pseudomonas aeruginosa
Manita Guragain
AC Anthony K. Campbell
Marianna A. Patrauchan
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2041 Views: 8463
Edited by: Valentine V Trotter
Reviewed by: Amit Dey
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Characterization of the molecular mechanisms of calcium (Ca2+) regulation of bacterial physiology and virulence requires tools enabling measuring and monitoring the intracellular levels of free calcium (Ca2+in). Here, we describe a protocol optimized to use a recombinantly expressed Ca2+-binding protein, aequorin, for detecting Ca2+in in Pseudomonas aeruginosa. Upon binding to free Ca2+, aequorin undergoes chromophore oxidation and emits light, the log of which intensity linearly correlates with the amount of bound Ca2+, and therefore, can be used to measure the concentration of free Ca2+ available for binding. This protocol involves the introduction of the aequorin gene into P. aeruginosa, induction of apoaequorin production, reconstitution of the holoenzyme with its chromophore, and monitoring its luminescence. This protocol allows continuous measuring of Ca2+in concentration in vivo in response to various stimuli.
Keywords: Intracellular calcium Regulation Aequorin Luminescence Coelenterazine Pseudomonas aeruginosa
Background
Ca2+ regulates physiology and virulence of P. aeruginosa (Guragain et al., 2013; Patrauchan et al., 2005; Sarkisova et al., 2014), however, the molecular mechanisms of Ca2+ regulation are not well understood. To characterize these mechanisms, it is critically important to not only measure the concentration of Ca2+in ([Ca2+in]), but to monitor its changes in response to various stimuli. Considering that [Ca2+in] may change in response to even minute alterations in cell physiology (reviewed in [Dominguez et al., 2015]), measuring [Ca2+in] requires a tool specifically recognizing Ca2+ without significantly disturbing cells. One such tool is aequorin, a Ca2+-binding protein, which upon binding to free Ca2+, undergoes chromophore oxidation and emits light. The emitted light can be recorded as a measure of free Ca2+. Aequorin has been successfully used to monitor Ca2+in in eukaryotes (Bonora et al., 2013), as well as several bacterial species (Herbaud et al., 1998; Naseem et al., 2007; Rosch et al., 2008). Sufficient level of aequorin production and its stability within a cell enables continuous monitoring of Ca2+in (Naseem et al., 2007). Use of aequorin offers additional advantages such as targeted intracellular distribution (cytoplasm or periplasm), high dynamic range, high signal-to-noise ratio, and low Ca2+ buffering effect (Bonora et al., 2013). Alternative approaches include application of chemical indicators, such as Fura. However, due to reduced cell membrane permeability in P. aeruginosa, loading cells of this bacterium even with membrane permeable Fura acetoxymethyl (AM, ester form) is challenging and requires additional treatments, which limits physiological relevance of the measurements (not published observations). Therefore, our group pioneered the use of aequorin for measuring [Ca2+in] in P. aeruginosa (Guragain et al., 2013). The original protocol was developed for Escherichia coli (Knight et al., 1991) and further developed in (Jones et al., 1999). Here we present a modified adaptation of the protocol, successfully used to study Ca2+ homeostasis in P. aeruginosa, clinically and environmentally important organism (Guragain et al., 2013).
Materials and Reagents
General supplies
Centrifuge bottles (No specific brand is required)
Microfuge tubes (No specific brand is required)
Lumitrac 96 well white microplates (Greiner Bio One, catalog number: 655075 )
Aluminum foil
Plastic cuvettes (BrandTech Scientific, catalog number: 759086D )
Strains and plasmids
Pseudomonas aeruginosa strain PAO1 carrying pMBB66EH containing aequorin gene
Plasmid pMBB66EH encoding aequorin gene from Aequoria victoria (courtesy: Drs. Delfina Dominguez)
Culture medium
Luria bertani (LB) agar (see Recipes)
Biofilm minimal medium (BMM) (see Recipes)
10x basal salt solution
Vitamin solution
Trace metal
1 M MgSO4
Chemicals and buffers
Carbenicillin, disodium (Gold Bio, catalog number: C-103-5 )
IPTG (Gold Bio, catalog number: I2481C )
Calcium chloride dehydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
Live-Dead staining (Molecular Probes)
Yeast extract (BD, Bacto, catalog number: 212750 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 or VWR, catalog number: E529-500ML )
Tryptone (BD, Bacto, catalog number: 211705 )
Agar (BD, Bacto, catalog number: 214010 )
Nanopure water
Monosodium glutamate (Sigma-Aldrich, catalogue number: 1446600 )
Glycerol (Thermo Fisher Scientific, Fisher Scientific, catalog number: G33 )
Sodium phosphate monobasic dihydrate (NaH2PO4) (Sigma-Aldrich, catalog number: 71500 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: 17835 )
Biotin (Gold Bio, catalog number: B-950-1 )
Thiamine HCl (Gold Bio, catalog number: T-260-25 )
HCl (Pharmco-Aaper, catalog number: 284000ACS )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (Sigma-Aldrich, catalog number: 209198 ).
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: Z0251 )
Iron(II) sulfate heptahydrate (FeSO4·7H2O) (Sigma-Aldrich, catalog number: 215422 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (Avantor Performance Materials, J.T. Baker, catalog number: 2540-04 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: 230391 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
MgCl2 (Sigma-Aldrich, catalog number: 230391 )
Tergitol Type NP-40, 70% in H2O (Sigma-Aldrich, catalog number: T1135 )
Coelenterazine (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C2944 )
Ethanol (Pharmco-Aaper, catalog number: AAP-111000190CSGL )
HEPES buffer (see Recipes)
Discharge buffer (see Recipes)
1 M CaCl2 solution (see Recipes)
6 mM CaCl2 solution for injection (see Recipes)
Coelenterazine (see Recipes)
Equipment
Multichannel pipette (Finnipipette F1, Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4661030 )
Pipetman classic pipettes (Gilson, catalog numbers: F123600 , F123615 , F123601 , F123602 )
500 ml glass flasks (No specific brand is required)
SynergyTM Mx multimode microplate reader (Biotek Instruments) with Gen5TM 2.05 PC software (BioTek Instruments)
37 °C incubator (Bench top incubator) (VWR, catalog number: 89409-314 )
37 °C shaking incubator (MaxQ 4000 table top shake incubator) (Thermo Fisher Scientific, Thermo ScientificTM, model: SHKA4000 )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM RC 6 Plus Centrifuge ) with rotor type (Thermo Fisher Scientific, Thermo ScientificTM, model: F13-14x50 cy )
Centrifuge (Eppendorf, model: 5424 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Guragain, M., Campbell, A. K. and Patrauchan, M. A. (2016). Measurement of Intracellular Calcium Concentration in Pseudomonas aeruginosa. Bio-protocol 6(23): e2041. DOI: 10.21769/BioProtoc.2041.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,042 | https://bio-protocol.org/exchange/protocoldetail?id=2042&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pyocyanin Extraction and Quantitative Analysis in Swarming Pseudomonas aeruginosa
Michelle M. King
Manita Guragain
SS Svetlana A. Sarkisova
Marianna A. Patrauchan
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2042 Views: 14714
Edited by: Valentine V Trotter
Reviewed by: Amit Dey
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
This protocol describes the quantification of pyocyanin extracted from swarming colonies of Pseudomonas aeruginosa. Pyocyanin is a secondary metabolite and a major virulence factor, whose production is inducible and varies highly under different growth conditions. The protocol is based on the earlier developed chloroform/HCl extraction of pyocyanin from liquid cultures (Frank and Demoss, 1959). Swarming colonies together with the agar they occupy are split into two halves. Pyocyanin is extracted from one of them. Cells are collected from the other half and used to quantify total protein yield and normalize the estimated corresponding pyocyanin quantities.
Keywords: Pyocyanin Swarming P. aeruginosa Chloroform extraction Virulence factor Motility
Background
Pyocyanin is a blue redox-active phenazine pigment produced by a human pathogen, P. aeruginosa. Pyocyanin is present in large quantities in the sputum of cystic fibrosis patients infected by P. aeruginosa (Wilson et al., 1988) and plays a major role in the virulence of the pathogen (Lau et al., 2004). Pyocyanin production is regulated by quorum sensing, which involves a cell-density-dependent synthesis of signal molecules that modulate the expression of virulence genes (Fuqua et al., 2001). Swarming is a complex communal behavior developing in response to multiple environmental signals and enabling cell motility on a semi-solid surface and colonization of host tissues. Our earlier observations suggested that pyocyanin production in liquid cultures of P. aeruginosa differ significantly from that in swarming colonies, likely due to quorum sensing regulation. Therefore, we developed a protocol allowing extraction and quantification of pyocyanin secreted by swarming cells into the surrounding agar. The obtained quantities are normalized by total cellular protein extracted from the swarming cells. This protocol differs from commonly used quantification of pyocyanin extracted from liquid cultures (Frank and Demoss, 1959) cells scrapped from a solid agar surface (De Vleesschauwer et al., 2006), or agar itself, but without normalization per total cell protein (Gallagher and Manoil, 2001). Normalized quantification of pyocyanin from swarming colonies allows studying the regulation of pyocyanin production and secretion during swarming, which is an essential component of P. aeruginosa adaptation to a host environment.
Materials and Reagents
Glass test tubes (VWR, catalog number: 47729-578 )
Razor blade
Plastic storage containers and spatulas
Glass scintillation vials (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: B7999-6 )
Glass Pasteur pipette
96-well flat bottom plates (Greiner Bio One, catalog number: 655-101 )
50 ml Falcon tubes (VWR, catalog number: 89039-658 )
Whatman filter paper No.1 (GE Healthcare, catalog number: 1001-090 )
50 ml centrifuge vials
1.5 ml microcentrifuge tubes
0.2 μm filter
10 ml syringes
PFTE lined caps for glass vials (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: B7815-24 )
Pseudomonas aeruginosa PAO1
Chloroform (Pharmco-AAPER, catalog number: 3090000DIS )
HCl (Pharmco-AAPER, catalog number: 284000ACS )
Sodium hydroxide (NaOH) (Thermo Fisher Scientific, Fischer Scientific, catalog number: 1310-73-2 )
Bradford reagent (Alfa Aesar, catalog number: J61522-AP )
Bovine serum albumin (BSA) (Akron Biotech, catalog number: AK8917-1000 )
Monosodium glutamate (Sigma-Aldrich, catalog number: 1446600 )
Glycerol (Thermo Fisher Scientific, Fisher Scientific, catalog number: G33 )
Sodium phosphate monobasic dihydrate (NaH2PO4) (Sigma-Aldrich, catalog number: 71500 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: 17835 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 or VWR, catalog number: E529-500ML )
Biotin (Gold Bio, catalog number: B-950-1 )
Thiamine HCl (Gold Bio, catalog number: T-260-25 )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (Sigma-Aldrich, catalog number: 209198 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: Z0251 )
Iron(II) sulfate heptahydrate (FeSO4·7H2O) (Sigma-Aldrich, catalog number: 215422 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (Avantor Performance Materials, J.T. Baker, catalog number: 2540-04 )
Yeast extract (BD, Bacto, catalog number: 212750 )
Tryptone (BD, Bacto, catalog number: 211705 )
Agar (BD, Bacto, catalog number: 214010 )
Glucose (Alfa Aesar, catalog number: A16828 )
Casamino acids (Teknova, catalog number: C2000 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: 230391 )
Biofilm mineral medium (BMM) (see Recipes)
10x basal salt solution
Vitamin solution
Trace metals solution
Luria Bertani (LB) agar plates (see Recipes)
Swarming agar plates (see Recipes)
Potassium phosphate buffer
1 mM FeSO4
20 mM MgSO4
Equipment
Potato masher (see Notes)
BioMateTM 3 spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 335904P )
Note: This product has been discontinued. A similar model is BioMateTM 3S spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 840208400 ).
MaxQ 4000 table top shake incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: SHKA4000 )
SynergyTM Mx 2 Multi-Mode plate reader (BioTek Instruments) with Gen5TM 2.05 PC software (BioTek Instruments)
Fume hood
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM ST 40R ) with 50 ml bucket insert (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 75003674 )
Water bath sonicator (Thomas Scientific, Branson®, catalog number: 1207K40 )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: SorvallTM RC 6 Plus Centrifuge ) with rotor type (Thermo Fisher Scientific, Thermo ScientificTM, model: F13-14x50 cy )
Centrifuge (Eppendorf, model: 5424 )
Table top standard orbital shaker (VWR, model: 3500 )
1 L graduated cylinder
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：King, M. M., Guragain, M., Sarkisova, S. A. and Patrauchan, M. A. (2016). Pyocyanin Extraction and Quantitative Analysis in Swarming Pseudomonas aeruginosa. Bio-protocol 6(23): e2042. DOI: 10.21769/BioProtoc.2042.
Download Citation in RIS Format
Category
Microbiology > Microbial metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,043 | https://bio-protocol.org/exchange/protocoldetail?id=2043&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Various Modes of Spinal Cord Injury to Study Regeneration in Adult Zebrafish
Subhra Prakash Hui
Sukla Ghosh
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2043 Views: 12194
Edited by: Oneil G. Bhalala
Reviewed by: Jingli CaoHélène M. Léger
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Spinal cord injury (SCI) in mammals leads to failure of both sensory and motor functions, due to lack of axonal regrowth below the level of injury as well as inability to replace lost neural cells and to stimulate neurogenesis. In contrast, fish and amphibians are capable of regenerating a variety of their organs like limb/fin, jaw, heart and various parts of the central nervous system (CNS). Zebrafish embryo and adult has become a very popular model to study developmental biology, cell biology and regeneration for various reasons. Adult zebrafish, one of the most important vertebrate models to study regeneration, can regenerate many of their body parts like fin, jaw, heart and CNS. In the present article we provide information on how to inflict different injury modalities in adult fish spinal cord. Presently, the significant focus of mammalian SCI is to use crush and contusion injury. To generate an entity comparable to the mammalian mode of injury, we have introduced the crush model in adult zebrafish along with complete transection injury, which is also known to be a valuable model to study axonal regeneration. Here we provide full description of the highly reproducible surgical procedures including some representative results. This protocol has been adapted from our previous publications, viz. Hui et al., 2010 and Hui et al., 2014. Briefly, we have described the two different injury modalities, crush and complete transection, and demonstrated the outcome of inflicting these injuries in the adult zebrafish cord by histological analysis of the tissues.
Keywords: Spinal cord Zebrafish Crush injury Transection injury Regeneration
Background
Any injury to mammalian spinal cord leads to the devastating consequence of paralysis and loss of function. In contrast to mammals, injury response in zebrafish cord is quite different, resulting in repair and regeneration of cord followed by functional recovery. A variety of lesioning protocols have been employed to study spinal cord injury and functional recovery in lower vertebrates (Holtzer 1956; Egar and Singer, 1972; Filoni et al., 1984; Becker et al., 1997; Margotta et al., 1991; Hui et al., 2010; Sîrbulescu and Zupanc, 2011) in last five decades. Among them the most popular experimental protocol to study spinal cord regeneration has been tail amputation (Holtzer, 1956; Egar and Singer, 1972; Filoni et al., 1984; Margotta et al., 1991; Sîrbulescu and Zupanc, 2011). Tail amputation involves complete removal of the caudal part of tail, where muscle, skin, bone and cartilages are also removed along with spinal cord. There is complete regeneration of tail along with the spinal cord leading to functional recovery after tail amputation and a substantial progress has been made to understand the cellular mechanism of spinal cord regeneration. But there are drawbacks of using this model. The major criticism against this model is that, it does not appropriately mimic SCI in human, since there is no tail structure in humans and the nature of the injury is different.
In teleosts, the most important lesion paradigm that has been widely used to study spinal cord regeneration is complete transection (Becker et al., 1997; Goldshmit et al., 2012). Transection refers to complete severing of cord which can often lead to spinal shock in humans. It occurs rarely in comparison to hemisection which commonly occurs in gunshot wounds. Transection could be the appropriate model to study axonal regeneration since there is no axonal sparing after transection injury and some believe that axonal sparing itself could augment regeneration in mammals (Basso et al., 1996).
On the other hand, compression and crush injuries are most prevalent in mammals under experimental conditions and in human accidental injury conditions (Thuret et al., 2006). In search for an appropriate injury model to study the regeneration in teleost, we successfully established a standardized crush injury model in zebrafish, which is comparable to the mammalian mode of injury (Hui et al., 2010). Among all the experimental paradigms mentioned, standardized crush injury is the most suitable model to understand both the mammalian and the teleostean scenario compared to transection or tail amputation models. The outcome of crush injury varies when compared to transection injury, as in crush injury secondary degenerative response elicits axonal degeneration, whereas in transection injury axonal tracts are disengaged almost immediately after injury.
Materials and Reagents
Pyrex Glass Petri dishes (150 x 20 mm) (Corning, catalog number: 3160-152BO )
Pyrex crystallizing dish (Corning, catalog number: 3140-150 )
Wheaton Coplin staining jars (Sigma-Aldrich, catalog number: S6016 )
Moist tissue paper
Needle
Single edged surgical blade (Sigma-Aldrich, catalog number: S2771 )
Cotton swabs, sterile (6 inch) (Medline Industries, catalog number: MDS202000Z )
Plastic Pasteur pipettes (BRAND, catalog number: 747755 )
Phosphate buffered saline (PBS), pH 7.4 (Sigma-Aldrich, catalog number: P4417 )
Tricaine (MS222) (Sigma-Aldrich, catalog number: E10521 )
Zebrafish Aquarium System water
0.1% cresyl violet solution (Sigma-Aldrich, catalog number: C5042 )
0.1% luxol fast blue solution (Sigma-Aldrich, catalog number: L0294 )
4% paraformaldehyde (Sigma-Aldrich, catalog number: 158127 )
0.5 M EDTA (Sigma-Aldrich, catalog number: E9884 )
Paraffin (Sigma-Aldrich, catalog number: 327212 )
Xylene (Sigma-Aldrich, catalog number: 534056 )
0.05% lithium carbonate solution (Sigma-Aldrich, catalog number: 255823 )
Graded ethanol (Sigma-Aldrich, catalog number: 24102 )
Note: This product has been discontinued.
Glacial acetic acid (Sigma-Aldrich, catalog number: A6283 )
Equipment
Leica rotary microtome (Leica Biosystems Nussloch, model: RM 2125RTS )
Student Dumont #5 forceps (Sigma-Aldrich, catalog number: F6521 )
Micro dissectingspring scissors (Harvard Apparatus, catalog number: 728500 )
Stereozoom dissecting microscope (Olympus, models: SZX7 and SZ51 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Hui, S. P. and Ghosh, S. (2016). Various Modes of Spinal Cord Injury to Study Regeneration in Adult Zebrafish. Bio-protocol 6(23): e2043. DOI: 10.21769/BioProtoc.2043.
Hui, S. P., Sengupta, D., Lee, S. G., Sen, T., Kundu, S., Mathavan, S. and Ghosh, S. (2014). Genome wide expression profiling during spinal cord regeneration identifies comprehensive cellular responses in zebrafish. PLoS One 9(1): e84212.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
How to determine the volume excess of HCl, HNO3 for HAuCl4.3H2O production ?
1 Answer
13 Views
Nov 21, 2022
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,044 | https://bio-protocol.org/exchange/protocoldetail?id=2044&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of ATP Hydrolytic Activity of Plasma Membrane H+-ATPase from Arabidopsis thaliana Leaves
MO Masaki Okumura
TK Toshinori Kinoshita
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2044 Views: 9066
Edited by: Dennis Nürnberg
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Plant plasma membrane H+-ATPase, which is a P-type ATPase, couples ATP hydrolysis to H+ extrusion and thereby generates an electrochemical gradient across the plasma membrane. The proton gradient is necessary for secondary transport, cell elongation, and membrane potential maintenance. Here we describe a protocol for measurement of the ATP hydrolytic activity of the plasma membrane H+-ATPase from Arabidopsis thaliana leaves.
Keywords: Arabidopsis thaliana ATP hydrolytic activity Orthovanadate P-type ATPase Plasma membrane H+-ATPase
Background
Determination of the plasma membrane H+-ATPase activity is important to elucidate its function and regulatory mechanism. However, it is sometimes difficult to determine the ATP hydrolytic activity of the plasma membrane H+-ATPase, because plant cells contain many ATP hydrolytic enzymes. This protocol is developed based on the publications by Uemura and Yoshida (1986) and Kinoshita et al. (1995). We used KNO3 as an inhibitor of V-type ATPases, ammonium molybdate as an inhibitor of acid phosphatases, oligomycin as an inhibitor of F-type ATPases, and NaF as an inhibitor of phosphatases (Shimazaki and Kondo,1987; Kinoshita et al.,1995). Orthovanadate inhibits the P-type ATPase and thus can be used to measure the activity of the plasma membrane H+-ATPase by assessing the vanadate-sensitive Pi release from ATP hydrolysis. The released Pi reacts with molybdate to form a blue complex which can then be quantified by measuring absorption at 750 nm.
Materials and Reagents
Ultracentrifuge tube (Beckman Coulter, catalog number: 349623 )
Cuvette (100 µl) (Beckman Coulter, catalog number: 523270 )
Note: This product has been discontinued.
Arabidopsis thaliana ecotype Col-0
Dithiothreitol (DTT) (NACALAI TESQUE, catalog number: 14128-04 )
Phenylmethylsulfonyl fluoride (PMSF) (NACALAI TESQUE, catalog number: 273-27 )
Leupeptin (Wako Pure Chemical Industries, catalog number: 126-03754 )
MOPS (NACALAI TESQUE, catalog number: 23415-54 )
Oligomycin (Sigma-Aldrich, catalog number: 75351 )
Sodium chloride (NaCl) (Wako Pure Chemical Industries, catalog number: 191-01665 )
Ethylenediamine-N,N,N’,N’-tetraacetic acid (EDTA) (Dojindo Molecular Technologies, catalog number: N001-10 )
Sodium fluoride (NaF) (NACALAI TESQUE, catalog number: 31420-82 )
Tris (NACALAI TESQUE, catalog number: 35406-91 )
2-(N-morpholino)ethanesulfonic acid (MES) (NACALAI TESQUE, catalog number: 21623-26 )
Magnesium sulfate (MgSO4) (Wako Pure Chemical Industries, catalog number: 131-00405 )
Potassium chloride (KCl) (Wako Pure Chemical Industries, catalog number: 163-03545 )
Potassium nitrate (KNO3) (Wako Pure Chemical Industries, catalog number: 160-04035 )
Ammonium molybdate (Wako Pure Chemical Industries, catalog number: 016-06902 )
Triton X-100 (Wako Pure Chemical Industries, catalog number: 169-21105 )
ATP (NACALAI TESQUE, catalog number: 10406-61 )
Sodium orthovanadate (Sigma-Aldrich, catalog number: S6508 )
SDS (NACALAI TESQUE, catalog number: 31607-65 )
Sodium molybdate (Wako Pure Chemical Industries, catalog number: 196-02472 )
Sulfuric acid (H2SO4) (Wako Pure Chemical Industries, catalog number: 192-04696 )
1-amino-2-naphthol-4-sulfonic acid (ANSA) (NACALAI TESQUE, catalog number: 02212-12 )
Sodium bisulfite (NaHSO3) (Wako Pure Chemical Industries, catalog number: 190-01375 )
Sodium sulfate (Na2SO4) (Wako Pure Chemical Industries, catalog number: 192-03415 )
Potassium dihydrogen phosphate (KH2PO4) (Wako Pure Chemical Industries, catalog number: 169-04245 )
DTT stock solution (see Recipes)
Protease inhibitor solution (see Recipes)
Oligomycin solution (see Recipes)
Homogenization buffer (see Recipes)
2x ATPase buffer (see Recipes)
ATPase reaction buffer (see Recipes)
ATP solution (see Recipes)
Vanadate solution (see Recipes)
Stop solution (see Recipes)
ANSA solution (see Recipes)
Pi standard stock solution (see Recipes)
Equipment
Mortar (90 mm diameter) and pestle
Refrigerated centrifuge (TOMY DIGITAL BIOLOGY, model: MX-307 )
Ultracentrifuge (Beckman Coulter, model: OptimaTM TLX )
Vortex (Scientific Industry, model: SI-0286 )
Heat block (TAITEC, model: e-ThermoBucket ETB )
Spectrophotometer (Beckman Coulter, model: DU 730 )
Note: This product has been discontinued.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Okumura, M. and Kinoshita, T. (2016). Measurement of ATP Hydrolytic Activity of Plasma Membrane H+-ATPase from Arabidopsis thaliana Leaves. Bio-protocol 6(23): e2044. DOI: 10.21769/BioProtoc.2044.
Kinoshita, T., Nishimura, M. and Shimazaki, K. (1995). Cytosolic concentration of Ca2+ regulates the plasma membrane H+-ATPase in guard cells of fava bean. Plant Cell 7(8): 1333-1342.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Ion analysis
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
How to prepare vanadate solution?
0 Answer
9 Views
Dec 18, 2022
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,045 | https://bio-protocol.org/exchange/protocoldetail?id=2045&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Vascular Smooth Muscle Cell Isolation and Culture from Mouse Aorta
CK Callie S. Kwartler
PZ Ping Zhou
SK Shao-Qing Kuang
XD Xue-Yan Duan
LG Limin Gong
DM Dianna M. Milewicz
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2045 Views: 21351
Edited by: Jia Li
Reviewed by: Guillermo Gomez
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Vascular smooth muscle cells (SMC) in the ascending thoracic aorta arise from neural crest cells, whereas SMCs in the descending aorta are derived from the presomitic mesoderm. SMCs play important roles in cardiovascular development and aortic aneurysm formation. This protocol describes the detailed process for explanting ascending and descending SMCs from mouse aortic tissue. Conditions for maintenance and subculture of isolated SMCs and characterization of the vascular SMC phenotype are also described.
Keywords: Tissue culture Smooth muscle cells Cell biology
Background
Vascular smooth muscle cells (SMCs) make up the muscular medial layer of arteries. Larger elastic arteries, such as the aorta, have multiple concentric lamellae consisting of aligned smooth muscle cells sandwiched between elastin fibers. The elastin and collagen present within the medial layer of elastic arteries allow it to distribute the force generated by the heart throughout the vessel wall (Wagenseil and Mecham, 2009). Smaller muscular arteries, by contrast, have only an internal and external elastic lamina bounding the smooth muscle layer. These arteries are downstream in the arterial tree and thus bear less force from blood flow.
Vascular smooth muscle cells, unlike cardiac and skeletal muscle cells, are capable of modulating their phenotype in response to vascular injury or environmental cues. Under normal physiologic conditions, quiescent, contractile SMCs populate the artery wall and contract to regulate vascular tone and keep blood flow continuous in response to pulsatile pressures. Contractile SMCs are characterized by high expression of smooth muscle-specific contractile genes, including smooth muscle specific α-actin and myosin heavy chain (Owens et al., 2004). However, in response to injury or mitogenic stimuli, SMCs downregulate expression of the contractile genes and take on a synthetic phenotype: they proliferate rapidly, migrate into the site of injury, and remodel the extracellular matrix by synthesizing both matrix-digesting enzymes and new matrix proteins. Many vascular diseases are associated with a synthetic SMC phenotype, including atherosclerosis (Owens, 1995).
SMCs located in different areas of the body actually arise from diverse embryonic lineages (Majesky, 2007). For example, the SMCs populating the ascending thoracic aorta and the cerebrovasculature are derived from neural crest cells. However, SMCs in the descending thoracic aorta come from mesodermal origins. These distinctions affect the ultimate properties of the SMCs, so it is important when designing experiments to use SMCs from the same developmental origin where the phenotype of interest arises.
In this protocol, we give detailed instructions for isolating and culturing SMCs from the ascending and descending thoracic aortas in the mouse. We have previously used this technique to isolate SMCs from genetically modified mice and their wild-type littermates to provide an in vitro system for looking at the effect of genetic changes on SMC phenotype (Cao et al., 2010; Kuang et al., 2012; Kuang et al., 2016; Papke et al., 2013; Kwartler et al., 2014).
Materials and Reagents
For initial explant
Dissection material: 2 sterile forceps, 2 sterile tweezers, 1 sterile scissor, 2 sterile scalpels
Disposable scalpels (Aspen Surgical, catalog number: 371621 )
Four 60 mm tissue culture dishes per sample (Corning, catalog number: 430589 )
Syringe, 10 ml
Syringe filter, 0.22 µm pore
500 ml filtration unit, 0.22 µm pore (EMD Millipore, catalog number: SCGPU01RE )
Parafilm
Aluminum foil
2.5% avertin-2,2,2-tribromoethanol (Sigma-Aldrich, catalog number: T48402-25g ) arrives as powder, make 100% stock solution by dissolved 25 g 2,2,2-tribromoethanol in 25 ml of 2-methyl-2-butanol (Sigma-Aldrich, catalog number: 240486-100ML ), then dilute to 2.5% solution in sterile water. Both the stock solution and the dilution are light sensitive, so should be stored in the dark at 4 °C
70% ethanol
Dulbecco’s phosphate buffered saline (DPBS) with calcium and magnesium (GE Healthcare, HycloneTM, catalog number: SH30028.02 )
Components of aorta biopsy storage media:
Waymouth’s MB 752/1 medium, 500 ml (Thermo Fisher Scientific, GibcoTM, catalog number: 11220035 )
Antibiotic-antimycotic, 100x (Sigma-Aldrich, catalog number: A5955 )
L-glutamine, 100x (Sigma-Aldrich, catalog number: G7513 )
Sodium bicarbonate (Sigma-Aldrich, catalog number: S8761 )
MEM non-essential amino acids (Sigma-Aldrich, catalog number: M7145 )
HEPES buffer (Sigma-Aldrich, catalog number: H0887 )
Collagenase type 1 (Sigma-Aldrich, catalog number: C1639 )
Elastase, Pancreatic type 1 from porcine pancreas (Sigma-Aldrich, catalog number: E1250 )
Soybean trypsin inhibitor (Thermo Fisher Scientific, GibcoTM, catalog number: 17075-029 )
Heat inactivated fetal bovine serum (FBS) (Atlanta Biologicals)
SmBm bullet kit (Lonza, catalog number: CC3182 )
FGF
EGF
Insulin
Gentamicin and included FBS - Do not use!
For continued culture
500 ml filtration unit, 0.22 µm pore (EMD Millipore, catalog number: SCGPU01RE )
Freeze vials (2 ml)
Fetal bovine serum (FBS, Atlanta Biologicals)
Antibiotic-antimycotic, 100x (Sigma-Aldrich, catalog number: A5955 )
SmBm bullet kit (Lonza, catalog number: CC3182 )
FGF
EGF
Insulin
Note: This kit includes a tube of gentamicin and a 25 ml aliquot of FBS that are not needed for any step of this protocol. Please do not use them! For more information, see ‘Preparation of Reagents’ below for the preparation of SmBm complete medium, which does not use the gentamicin or the provided FBS.
TrypLE express (Thermo Fisher Scientific, GibcoTM, catalog number: 12604013 )
DMSO
For immunofluorescence to confirm SMC identity
Coverslips (UV treated, please see Data analysis section below for details)
6 well plates
Hemocytometer
3-6 mice, preferably aged 4-6 weeks old
SmBm basal media (Lonza, catalog number: CC3181 )
Fetal bovine serum (FBS) (Atlanta Biologicals)
Recombinant human TGF-β1 (rhTGF- β1, R&D Systems)
16% formaldehyde (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 28906 ). Dilute 1 to 4 to a final concentration of 4% in DPBS with calcium and magnesium
Blocking buffer (0.3% Triton X, 0.5% BSA in DPBS)
DPBS
Smooth muscle α-actin antibody (Sigma-Aldrich, catalog number: A5228 )
Anti-mouse secondary antibody conjugated with fluorescence
Mounting medium with DAPI (Vectashield, catalog number: H-1200 )
Aorta biopsy storage media (see Recipes)
Complete smooth muscle media (see Recipes)
Smooth muscle cell freeze media (see Recipes)
Digestive enzyme mix (see Recipes)
Equipment
Note: The reproducibility of the experiment is not dependent on the specific brand or model of these equipment. Any microscope, tissue culture hood/incubator, centrifuge, etc., will give similar results.
Magnetic stirrer
Dissecting microscope
Sterile tissue culture hood
Sterile tissue culture incubator
10 ml pipet
Water bath
Tabletop centrifuge
200 µl pipette
T25 flasks
T75 flasks
Slow freeze container (either a foam container or an isopropanol based container will work)
Hemocytometer
Inverted microscope
Hot bead sterilizer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Developmental Biology > Cell growth and fate > Angiogenesis
Cell Biology > Cell isolation and culture > Cell isolation
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,046 | https://bio-protocol.org/exchange/protocoldetail?id=2046&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
MPM-2 Mediated Immunoprecipitation of Proteins Undergoing Proline-directed Phosphorylation
Roberta Antonelli
Paola Zacchi
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2046 Views: 7938
Edited by: Oneil G. Bhalala
Reviewed by: Emma PuighermanalPia Giovannelli
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Immunoprecipitation (IP) represents a widely utilized biochemical method to isolate a specific protein from a complex mixture taking advantage of an antibody that specifically recognizes that particular target molecule. This procedure is extremely versatile and can be applied to concentrate a specific protein, to identify interacting partners in complex with it or to detect post-translational modifications. The mitotic protein monoclonal 2 (MPM-2) is an antibody originally raised against extracts of synchronized mitotic HeLa cells to identify proteins selectively present in mitotic, and not in interphase-cells (Davis et al., 1983). MPM-2 recognizes phosphorylated serine or threonine residues followed by proline (pS/T-P), consensus epitopes generated by the concerted action of proline-directed protein kinases and phosphatases (Lu et al., 2002). These reversible phosphorylation events have emerged to control various cellular processes by promoting conformational changes on the target that are not simply due to the phosphorylation event per se. These motifs, once phosphorylated, are able to recruit Pin1 (Peptidyl-prolyl Isomerase NIMA interacting protein 1) (Lu et al., 1996; Lu and Zhou, 2007), a chaperone which drives the cis/trans isomerization reaction on the peptide bond, switching the substrate between functionally diverse conformations (Lu, 2004; Wulf et al., 2005). This protocol describes a general MPM-2 based immunoprecipitation strategy using the scaffolding molecule postsynaptic density protein-95 (PSD-95) (Chen et al., 2005), a neuronal Pin1 target (Antonelli et al., 2016), as an example to illustrate the detailed procedure.
Keywords: MPM-2 antibody Proline-directed phosphorylation Peptidyl-prolyl isomerase Pin1 Immunoprecipitation Scaffolding molecules
Background
Identification of antigens recognized by MPM-2 antibody represents a useful starting point for the discovery of target molecules undergoing post-phosphorylation prolyl-isomerization regulatory mechanism. The prolyl isomerase Pin1, in fact, shares with MPM-2 antibody the same recognition motif as well as the phospho-dependency of the binding. The main advantage of using the MPM-2 antibody in immunoprecipitation experiments is the achievement of a selective enrichment of the phosphorylated targets over the unphosphorylated counterparts, which are frequently present in much greater quantities in the cell. Precipitated antigens by virtue of such post-translational modification can be then easily identified by standard western blotting using highly specific primary antibodies.
Materials and Reagents
10 cm2 Petri dishes (Corning, catalog number: 353003 )
Dissection plate (Sigma-Aldrich, catalog number: P7741 )
1.5 ml reaction tube (SARSTEDT, catalog number: 72.706.700 )
Surgical scalpel blade number 11 (Sigma-Aldrich, catalog number: S2771 )
26 gauge needle (BD, PrecisionGlideTM, catalog number: 305110 )
Amersham Protran Premium 0.2 NC (GE Healthcare, catalog number: 10600004 )
HEK293 cells
C57BL/6 mouse strain (or any other mouse model, both genders)
pAcGFP1-C1 vector (Takara Bio, Clontech, catalog number: 632470 )
FLAG-PSD-95 plasmid DNA (Craven et al., 1999)
Dulbecco’s modified Eagle’s medium (DMEM) high glucose, GlutaMAXTM supplement (Thermo Fisher Scientific, GibcoTM, catalog number: 10566016 )
10% fetal bovine serum (FBS)
Polyethylenimine, Linear (PEI) (Polysciences, catalog number: 23966-2 )
Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140148 )
cOmpleteTM EDTA-free protease inhibitor cocktail tablets (Roche Diagnostics, catalog number: 11873580001 )
Phosphatase inhibitor cocktail 1 (Sigma-Aldrich, catalog number: P2850 )
IgG from mouse serum (Sigma-Aldrich, catalog number: I8765 )
Anti-FLAG (clone M2) (Sigma-Aldrich, catalog number: F9291 )
Phospho-Serine/Threonine-Proline MPM2 antibody (EMD Millipore, catalog number: 05-368 )
Protein G Sepharose 4 Fast Flow (GE Healthcare, catalog number: 17-0618-01 )
PageRulerTM prestained protein ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 26616 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Goat anti-mouse HRP conjugated IgG (EMD Millipore, catalog number: 12-349 )
ECL detection reagents (GE Healthcare, catalog number: RPN2209 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Disodium hydrogen phosphate (Na2HPO4) (Sigma-Aldrich, catalog number: 7558-79-4 )
Potassium dihydrogen phosphate (KH2PO4) (Sigma-Aldrich, catalog number: 7778-77-0 )
Tween 20 (Sigma-Aldrich, catalog number: P9416 )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
NP-40 (Sigma-Aldrich, catalog number: I3021 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Sodium orthovanadate (Na3VO4) (Sigma-Aldrich, catalog number: S6508 )
Sodium fluoride (NaF) (Sigma-Aldrich, catalog number: 201154 )
TEMED (Sigma-Aldrich, catalog number: T9281 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Methanol (Sigma-Aldrich, catalog number: 322415 )
Glycine (Sigma-Aldrich, catalog number: G8898 )
Acrylamide/bis-acrylamide (29:1) (Sigma-Aldrich, catalog number: A2792 )
Ammonium persulfate (Sigma-Aldrich, catalog number: A3678 )
Phosphate buffered saline (1x PBS) (see Recipes)
MPM-2 lysis buffer (see Recipes)
Phosphatase inhibitors (see Recipes)
IP wash buffer (see Recipes)
2x Laemmli sample buffer (see Recipes)
Western blot running buffer (see Recipes)
Western blot transfer buffer (see Recipes)
Tris-buffered saline-Tween 20 (TBS-T) (see Recipes)
BSA blocking solution (see Recipes)
Equipment
Nikon Diaphon 300 phase contrast inverted tissue culture microscope
Cell scraper (Sigma-Aldrich, catalog number: C5981 )
Refrigerated centrifuge (Eppendorf, model: 5424R )
Incubator (Panasonic Biomedical Sales Europe, model: MCO-18AC-PE )
DNA sonicator (EpiShear, model: Cooled Sonication Platform )
Rotator mixer (Scilogex, model: MX-RD-Pro LCD Digital Tube Rotator Mixer )
Tissue homogenizer (Thomas Scientific, catalog number: 3409Y72 )
Cold room, 4 °C
Polyacrylamide gel electrophoresis system (Bio-Rad Laboratories, catalog number: 1658000EDU )
Western blot transfer apparatus (Bio-Rad Laboratories, model : Trans-Blot® Cell )
Software
Alliance 4.7 software (UVITECH)
UVI band Imager software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Antonelli, R. and Zacchi, P. (2016). MPM-2 Mediated Immunoprecipitation of Proteins Undergoing Proline-directed Phosphorylation. Bio-protocol 6(23): e2046. DOI: 10.21769/BioProtoc.2046.
Garré, J. M., Yang, G., Bukauskas, F. F. and Bennett, M. V. (2016). FGF-1 triggers Pannexin-1 hemichannel opening in spinal astrocytes of rodents and promotes inflammatory responses in acute spinal cord slices. J Neurosci 36(17): 4785-4801.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Synaptic physiology
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,047 | https://bio-protocol.org/exchange/protocoldetail?id=2047&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Lymphocyte Isolation, Th17 Cell Differentiation, Activation, and Staining
Pawan Kumar
JK Jay K Kolls
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2047 Views: 13413
Edited by: Ivan Zanoni
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
In vitro Th17 (α, β T helper cell which produce IL-17A, IL-17F and IL-22) differentiation has been routinely used for functional T cells studies. Here we describe a method for Th17 cell differentiation.
Keywords: Th17 IL-17 FACS
Background
T cells are critical to mediate host defense against bacteria, viruses and fungi as well as commensal (Kumar et al., 2016). T cells can be further subdivided into T helper (Th1), Th2 and Th17 subsets based on their ability to generate specific cytokines. Naive T cells can be differentiated into specific T cell subsets in in vitro culture in response to specific cytokine stimulation. In vitro generated Th1, Th2 and Th17 cells have helped us to understand the molecular mechanism of their differentiation and their effector functions. Here, we have described a basic protocol for Th17 cell generation.
Materials and Reagents
96-well tissue culture plate (CELLTREAT Scientific Products, catalog number: 229196 )
Falcon® 70 μm cell strainers (Corning, Falcon®, catalog number: 352350 )
50 ml conical tube (Denville Scientific, catalog number: C1056 )
1 ml syringe with cap (BD, catalog number: 305217 )
15 ml conical tube (Denville Scientific, catalog number: C1018-P )
96-well round (U) bottom plate (CELLTREAT Scientific Products, catalog number: 229190 )
C57BL\6 mice (Taconic Biosciences, catalog number: B6-F )
Coating antibodies: anti-mouse CD28 (Affymetrix, eBioscience, catalog number: 14-0281 ), anti-mouse CD3e (Affymetrix, eBioscience, catalog number: 14-0033 )
ELISA coating buffer (Biolegend, catalog number: 421701 )
EasySepTM buffer (STEMCELL Technologies, catalog number: 20144 ) or PBS containing 2% fetal bovine serum (FBS) with 1 mM EDTA
EasySepTM Mouse Naïve CD4+ T Cell Isolation Kit (STEMCELL Technologies, catalog number: 19765 )
Staining antibodies:
anti-mouse CD3-eFlour 450 (Affymetrix, eBioscience, catalog number: 48-0032 )
anti-mouse CD4-Alexa Flour 700 (Affymetrix, eBioscience, catalog number: 56-0041 )
anti-mouse IL-22-APC (Affymetrix, eBioscience, catalog number: 17-7222 )
anti-mouse IL-17A-PE (Affymetrix, eBioscience, catalog number: 12-7177 )
anti-mouse CD62L-FITC (Affymetrix, eBioscience, catalog number: 11-0621 )
Phorbol 12-myristate 13-acetate (PMA) (Sigma-Aldrich, catalog number: 79346 )
Ionomycin (Sigma-Aldrich, catalog number: I0634 )
Fixation/Permeabilization Solution Kit with BD GolgiStopTM (BD, catalog number: 554715 )
Cytofix/Cytoperm Plus Kit (with BD GolgiStopTM) (BD, catalog number: 554715 )
Iscove’s modified Dulbecco’s medium (IMDM) cell culture medium + glutamax (Thermo Fisher Scientific, GibcoTM, catalog number: 31980-030 )
HyCloneTM fetal bovine serum (U.S.), characterized FBS (GE Healthcare, catalog number: SH30071.03 )
HyCloneTM penicillin-streptomycin 100x solution (GE Healthcare, catalog number: SV30010 )
Recombinant porcine TGF-β1 (R&D Systems, catalog number: 101-B1 )
Recombinant mouse IL-6 (R&D Systems, catalog number: 406-ML )
Recombinant mouse IL-23 (R&D Systems, catalog number: 1887-ML )
Anti-mouse IFNγ (R&D Systems, catalog number: MAB485 )
Anti-mouse IL-4 (R&D Systems, catalog number: MAB404 )
Phosphate buffer saline (PBS) (Boston BioProduct, catalog number: BM220S )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3059 )
Sodium azide (Sigma-Aldrich, catalog number: S2002 )
Complete IMDM medium (see Recipes)
2x Th17 differentiation condition medium (see Recipes)
FACS buffer (see Recipes)
Equipment
Tissue culture incubator (NuAire, model: LabGard Class II type A2 )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: Sorvall Legend XFR )
BD LSRII Flow cytometer - BD
Scientific Industries Vortex Genie2 (Stellar Scientific, catalog number: SI-236 )
EasyEightTM EasySepTM magnet (STEMCELL Technologies, catalog number: 18103 )
Software
FACS Diva or Flow Jo software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kumar, P. and Kolls, J. K. (2016). Lymphocyte Isolation, Th17 Cell Differentiation, Activation, and Staining. Bio-protocol 6(23): e2047. DOI: 10.21769/BioProtoc.2047.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > Cell differentiation
Cell Biology > Cell staining > Whole cell
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,048 | https://bio-protocol.org/exchange/protocoldetail?id=2048&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Intracellular Assessment of ATP Levels in Caenorhabditis elegans
Konstantinos Palikaras
Nektarios Tavernarakis
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2048 Views: 10518
Edited by: Jyotiska Chaudhuri
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Eukaryotic cells heavily depend on adenosine triphosphate (ATP) generated by oxidative phosphorylation (OXPHOS) within mitochondria. ATP is the major energy currency molecule, which fuels cell to carry out numerous processes, including growth, differentiation, transportation and cell death among others (Khakh and Burnstock, 2009). Therefore, ATP levels can serve as a metabolic gauge for cellular homeostasis and survival (Artal-Sanz and Tavernarakis, 2009; Gomes et al., 2011; Palikaras et al., 2015). In this protocol, we describe a method for the determination of intracellular ATP levels using a bioluminescence approach in the nematode Caenorhabditis elegans.
Keywords: Ageing ATP Caenorhabditis elegans Energy homeostasis Luciferase Metabolism Mitochondria
Background
Mitochondria-derived ATP plays a crucial role in a variety of cellular and metabolic processes. Therefore, several methods have been developed to measure the levels of this important metabolite (Drew and Leeuwenburgh, 2003; Khan, 2003; Lagido et al., 2001; Vives-Bauza et al., 2007). In 1947, McElroy proposed the use of firefly bioluminescence to determine intracellular ATP levels, when he uncovered the essential role of ATP in light production (McElroy, 1947). The development of cloning and recombinant protein technology facilitated the development of the firefly luciferase assay to determine ATP levels (de Wet et al., 1985). Firefly luciferase, a monomeric 61 kD enzyme, catalyzes the oxidation of luciferin, which emits light at 560 nm. When ATP is the limiting factor of the enzymatic reaction, the intensity of light is proportional to the concentration of ATP. Thus, the use of a luminometer permits the detection of light intensity and subsequently the determination of ATP levels. In this protocol, we describe a method for ATP quantification using a bioluminescence approach in C. elegans.
Materials and Reagents
1.5 ml tube
Greiner Petri dishes (60 x 15 mm) (Greiner Bio One, catalog number: 628161 )
Toothpick
L4 larvae
C. elegans strains (wild type [N2] and pink-1[tm1779])
Escherichia coli OP50 strain (obtained from the Caenorhabditis Genetics Center)
Liquid nitrogen
Lyophilized ATP (provided with ATP bioluminescence assay kit CLS II) (Roche Diagnostics, catalog number: 11699695001 )
Distilled water
PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23225 )
Glue
70% of EtOH
ATP bioluminescence assay kit CLS II (Roche Diagnostics, catalog number: 11699695001 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: 1064041000 )
BactoTM peptone (BD, catalog number: 211677 )
Streptomycin (Sigma-Aldrich, catalog number: S-6501 )
Agar (Sigma-Aldrich, catalog number: 05040 )
Cholesterol stock solution (SERVA Electrophoresis, catalog number: 17101.01 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C-5080 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M-7506 )
Nystatin stock solution (Sigma-Aldrich, catalog number: N-3503 )
Potassium dihydrogen phosphate (KH2PO4) (EMD Millipore, catalog number: 1048731000 )
Na2HPO4 (EMD Millipore, catalog number: 1065860500 )
K2HPO4
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P-5405 )
Phosphate buffer (1 M; sterile, see Recipes)
Nematode growth medium (NGM) agar plates (see Recipes)
M9 buffer (see Recipes)
Equipment
Dissecting stereomicroscope (Olympus, model: SMZ645 )
Incubators for stable temperature (AQUA®LYTIC incubator 20 °C)
TD-20/20 luminometer (Turner Designs, model: 2020-000 )
Tabletop centrifuge (Eppendorf, model: 5424 )
Freezers (Siemens, -20 °C; So-Low Environmental Equipment, model: So-Low Ultra C85-22 horizontal -80 °C freezer)
Heat plate
Hot pot
Software
Microsoft Office 2011 Excel (Microsoft Corporation, Redmond, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Palikaras, K. and Tavernarakis, N. (2016). Intracellular Assessment of ATP Levels in Caenorhabditis elegans. Bio-protocol 6(23): e2048. DOI: 10.21769/BioProtoc.2048.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Ageing
Biochemistry > Other compound > Nucleoside triphosphate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,049 | https://bio-protocol.org/exchange/protocoldetail?id=2049&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Oxygen Consumption Rate in Caenorhabditis elegans
Konstantinos Palikaras
Nektarios Tavernarakis
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2049 Views: 10090
Edited by: Jyotiska Chaudhuri
Reviewed by: Jian Chen
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
The rate of oxygen consumption is a vital marker indicating cellular function during lifetime under normal or metabolically challenged conditions. It is used broadly to study mitochondrial function (Artal-Sanz and Tavernarakis, 2009; Palikaras et al., 2015; Ryu et al., 2016) or investigate factors mediating the switch from oxidative phosphorylation to aerobic glycolysis (Chen et al., 2015; Vander Heiden et al., 2009). In this protocol, we describe a method for the determination of oxygen consumption rates in the nematode Caenorhabditis elegans.
Keywords: Ageing Caenorhabditis elegans Metabolism Mitochondria Oxygen sensor ROS
Background
Recent evidence underlines mitochondrial function as a potential contributor in the maintenance of organismal homeostasis and viability (Vafai and Mootha, 2012). Cellular oxygen consumption is highly recognized as a fundamental indicator of mitochondrial function, reflecting reactive oxygen species (ROS) production and metabolic activity of the cell. Therefore, several methods have been developed to measure oxygen consumption rates in cells or entire organisms (Dranka et al., 2011; Li and Graham, 2012; Luz et al., 2015; Perry et al., 2013). These approaches provided insight into the pivotal roles of mitochondria in disease progression and pathogenesis (Scheibye-Knudsen et al., 2015). In this protocol, we describe a method for the determination of oxygen consumption rates in the nematode C. elegans by using a Clark-type polarographic oxygen sensor electrode (Hansatech, King’s Lynn, England).
Materials and Reagents
Consumables
Commercial cigarette paper
Polytetrafluorethylene (PTFE) membrane (provided by Hansatech, King’s Lynn, England)
15 ml tube (SARSTEDT, catalog number: 62.554.016 )
1.5 ml tube (Sigma-Aldrich, catalog number: Z606340 )
Paper towel
Greiner Petri dishes (60 x 15 mm) (Greiner Bio One, catalog number: 628161 )
Maintenance kit (Hansatech, King’s Lynn, England)
Biologicalreagents
C. elegans strains (wild type [N2] and dct-1[tm376])
Escherichia coli OP50 strain (obtained from the Caenorhabditis Genetics Center)
Chemical reagents
Distilled water
Nitrogen gas provided in a tank
PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23225 )
Potassium dihydrogen phosphate (KH2PO4) (EMD Millipore, catalog number: 1048731000 )
K2HPO4
Sodium chloride (NaCl) (EMD Millipore, catalog number: 1064041000 )
BactoTM peptone (BD, BactoTM, catalog number: 211677 )
Streptomycin (Sigma-Aldrich, catalog number: S-6501 )
Agar (Sigma-Aldrich, catalog number: 05040 )
Cholesterol stock solution (SERVA Electrophoresis, catalog number: 17101.01 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C-5080 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M-7506 )
Nystatin stock solution (Sigma-Aldrich, catalog number: N-3503 )
Na2HPO4 (EMD Millipore, catalog number: 1065860500 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P-5405 )
Potassium chloride (KCl) buffer (see Recipes)
Nematode growth medium (NGM) agar plates (see Recipes)
M9 buffer (sterile; see Recipes)
Phosphate buffer (sterile; see Recipes)
Equipment
Dissecting stereomicroscope (Olympus, model: SMZ645 )
Incubators for stable temperature (AQUA®LYTIC incubator 20 °C)
DW1/AD Clark-type polarographic oxygen sensor (Hansatech Instruments, model: Oxygraph Plus System )
Water bath at 20 °C
Tabletop centrifuge (Eppendorf, model: 5424 )
Sonicator (Sonics & Material, model: VC 130PB )
Software
Oxygraph Plus software (Hansatech, King’s Lynn, England)
Microsoft Office 2011 Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Palikaras, K. and Tavernarakis, N. (2016). Measuring Oxygen Consumption Rate in Caenorhabditis elegans. Bio-protocol 6(23): e2049. DOI: 10.21769/BioProtoc.2049.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Ageing
Biochemistry > Other compound > Oxygen
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
205 | https://bio-protocol.org/exchange/protocoldetail?id=205&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Endothelial Cells from Mice
HP Huan Pang
Published: Apr 20, 2012
DOI: 10.21769/BioProtoc.205 Views: 22282
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Endothelial cells line the entire circulatory system, from the heart to the smallest capillary. In this protocol, attaining and maintaining vitality of the organ is critical. Minimizing the processing time between removing the organ and beginning the digestions will improve yields as cells are more viable and are not under hypoxic conditions for long. For this protocol to be most effective, mice should be 5-6 weeks of age. Older mice result in lower yields of endothelial cells. In our hands, as few as 5 mice can result in good yields.
Materials and Reagents
Endothelial cells (EC)
Endothelial cell growth supplement (ECGS) (Sigma-Aldrich, catalog number: E2759 )
Collagenase I (Life Technologies, InvitrogenTM, catalog number: 17100-017 )
Anti-CD31 antibody (BD Biosciences, PharmingenTM, catalog number: 550274 )
BSA
DMEM
Fetal calf serum (FCS)
Fetal bovine serum (FBS)
EDTA
Phosphate buffered saline (PBS)
Antibiotic
Heparin
F12 medium
Isoflourane
70% ethanol
Dynabeads
M199
Gelatin
Pre-warmed digestion solution
Digestion solution (see Recipes)
Culture media (see Recipes)
Equipment
Centrifuges
Sterile culture hood
Magnet
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Pang, H. (2012). Isolation of Endothelial Cells from Mice. Bio-101: e205. DOI: 10.21769/BioProtoc.205.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > Cell isolation
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,050 | https://bio-protocol.org/exchange/protocoldetail?id=2050&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Lentiviral shRNA Screen to Identify Epithelial Integrity Regulating Genes in MCF10A 3D Culture
E Elsa Marques
JK Juha Klefström
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2050 Views: 10654
Edited by: HongLok Lung
Reviewed by: Steve Jean
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
MCF10A 3D culture system provides a reductionist model of glandular mammary epithelium which is widely used to study development of glandular architecture, the role of cell polarity and epithelial integrity in control of epithelial cell functions, and mechanisms of breast cancer. Here we describe how to use shRNA screening approach to identify critical cell pathways that couple epithelial structure to individual cell based responses such as cell cycle exit and apoptosis. These studies will help to interrogate genetic changes critical for early breast tumorigenesis. The protocol describes a library of lentiviral shRNA constructs designed to target epithelial integrity and a highly efficient method for lentiviral transduction of suspension MCF10A cultures. Furthermore, protocols are provided for setting up MCF10A 3D cultures in Matrigel for morphometric and cellular response studies via structured illumination and confocal microscopy analysis of immunostained 3D structures.
Keywords: 3D cultures MCF10A shRNA Epithelial integrity Immunofluorescence staining 3D imaging Morphometric analysis
Background
All epithelial cells form highly organized tissue structures, which provide physical support and a structured scaffold for coordinated cell signaling. Such coordinated signaling across the epithelial structures is fundamental for epithelial biology; enabling dynamic joint actions of epithelial cells in regulation of organ size, shape, function and individual cell based responses (Roignot et al., 2013; Shamir and Ewald, 2014). Joint command of epithelial signaling also presents a powerful tumor suppressor mechanism by gatekeeping extrinsic and intrinsic mitogenic signals to quiescent epithelial tissues (Partanen et al., 2013; Rejon et al., 2016). However, very little is still known about genetic mechanisms coupling the status of epithelial structure with individual epithelial cell functions. MCF10A 3D Matrigel culture system is a well-established genetically tractable model of mammary epithelial architecture that is widely used to explore epithelial context-dependent cell functions (Debnath and Brugge, 2005). However, individual structures in MCF10A 3D cultures are not fully uniform in size or symmetry, which makes high-throughput screens with shRNA or cDNA reagents challenging in this system. Here, we describe protocols that expand the use of MCF10A 3D culture system from single gene studies to cell pathway level perturbation studies. The protocols for medium-throughput 3D screen using validated lentiviral shRNAs were originally used in a screen designed to identify genes with epithelial integrity-linked proliferation functions (Marques et al., [2016], screen outlined in Figure 1). However, these protocols are suitable for any reverse genetic MCF10A 3D culture study within a range of about 50 perturbed genes of interest.
Figure 1. Overview of shRNA screen in MCF10A 3D culture designed to identify epithelial integrity regulating genes. The protocols described here were recently applied in a shRNA screen using 52 knockdown validated shRNAs, which were lentivirally transferred to MCF10A cells containing a switchable oncogenic form of Myc (MycERTM). This set up allowed two separate primary morphometric screens in MCF10A 3D cultures; one with and another without Myc oncogene challenge. These screens produced morphometric data from > 5,000 structures. The most interesting knockdown phenotypes were further analyzed with cell response markers (proliferation [i.e., Ki67], apoptosis [i.e., active caspase 3] and polarity change [i.e., α6-integrin, GM130]) and via 3D structures reconstructions obtained with confocal microscopy. The results from this screen for morphometric results have been published in Marques et al. (2016).
Materials and Reagents
24-well plates (VWR, catalog number: 391-3370 )
Minisart filters 0.45 μm pore size (Sartorius, catalog number: 16537 )
6-well plates (VWR, catalog number: 700-1425 )
8-chamber slides (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 177402 )
Microscope coverslips (MEDI PLAST FENNO, catalog number: 702-1051204 )
Pipet tips
500 ml bottle
Ultra adherent cell culture plates for 293ft cells
Nunclon surface 10 cm (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 150350 )
Nunclon surface 6 well plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 145380 )
293ft cells (Thermo Fisher Scientific, InvitrogenTM, catalog number: R70007 )
MCF10A cells (ATCC, catalog number: CRL-10317TM )
MCF10A-MycER cells (Nieminen et al., 2007)
Plasmid and vectors:
pCMV-dR8.91 (Delta 8.9) packaging plasmid (Marques et al., 2016)
pCMV-VSVg envelope construct (Marques et al., 2016)
pDSL_UGIH lentiviral shRNA vector (Alliance for Cellular Signaling) (Marques et al., 2016)
pLKO lentiviral vector (Broad Institute TRC library, MISSION TRC-Hs 1.0 library) (Sigma-Aldrich) (Marques et al., 2016)
pGIPZ mir-30 based vector (Open Biosystems) (Marques et al., 2016)
Non-targeting shRNA control constructs (in pDSL_UGIH, pLKO.1 and pGIPZ lentiviral backbone) (Marques et al., 2016)
Modified entry vector pENTR-H1 (Nieminen et al., 2007; Marques et al., 2016)
Cell culture and transfection
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 21041-025 )
Mammary epithelial basal medium (MCDB 170) (BioConcept AG Costumer made product based on USB powder formulation [Labome, catalog number: M2162 ] without L-glutamine; catalog number: 9-02S77-I)
Transfection reagent - jetPEI (Polyplus, catalog number: 101-01N )
Supplements for DMEM media (added before use; See Recipes):
Fetal calf serum (FCS) (Biowest, catalog number: S1810-500 )
L-glutamine (Lanza, catalog number: 17-605E )
Penicillin-streptomycin (Lanza, catalog number: 17-602E )
Phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: P4417 ) (Bionordika, catalog number: 17-516F/12 )
Polybrene (Sigma-Aldrich, catalog number: H9268 )
Matrigel® (Corning, catalog number: 356230 )
RNeasy Mini Kit (Qiagen, catalog number: 74104 )
ELB Lysis Buffer reagents (see Recipes)
HEPES (Sigma-Aldrich, catalog number: H-3375 )
EDTA (Sigma-Aldrich, catalog number: E5134 )
Nonidet® P40 substitute (NP-40) (Sigma-Aldrich, catalog number: 74385 )
Protease inhibitor cocktails
Complete Mini (Roche Diagnostics, catalog number: 04693159001 )
PhosphoStop (Roche Diagnostics, catalog number: 04906837001 )
0.05% trypsin (diluted from 5% trypsin-EDTA [10x]) (Thermo Fisher Scientific, GibcoTM, catalog number: 15400-054 )
4% paraformaldehyde phosphate buffer stock solution (PFA) (used as diluted 2%) (from powder: Sigma-Aldrich, catalog number: 16005-1Kg-R or from 20% aqueous solution Electron Microscopy Sciences, catalog number: 15713-S )
Triton X-100, used as 0.25% dilution in PBS (Sigma-Aldrich, catalog number: 9002-93-1 )
Blocking solution (see Recipes)
Immunofluorescence (IF) buffer reagents (see Recipes)
Sodium azide (NaN3) (Sigma-Aldrich, catalog number: S-2002 )
Bovine serum albumin (BSA) (Biowest, catalog number: P6154 )
Tween 20 (Sigma-Aldrich, catalog number: P9416 )
Normal goat serum, used in 10% concentration (Thermo Fisher Scientific, GibcoTM, catalog number: PCN5000 )
Counterstaining and Antibodies:
Hoechst 33258 (Sigma-Aldrich, catalog number: 861405 )
Note: This product has been discontinued and it has been replaced by bisBenzimide H 33258 (Sigma-Aldrich, catalog number: B2883 ).
β-catenin (BD, catalog number: 610153 )
GM-130 (BD, catalog number: 610823 )
Anti-CD49f/α6-integrin (EMD Millipore, catalog number: CBL458 )
E-cadherin (BD, catalog number: 610182 )
Ki-67 (Leica Biosystems, catalog number: NCL-Ki67p )
Active caspase-3 (Cell Signaling Technology, catalog number: 9661L )
ZO-1 (Abcam, catalog number: ab59720 )
Desmoplakin I+II (Abcam , catalog number: ab16434 or ab71690 )
Desmoglein 2 (Abcam, catalog number: ab14415 )
Power SYBR Green Cells-to-CT Kit (Thermo Fisher Scientific, AmbionTM, catalog number: 4402953 )
Immu-MountTM reagent (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 9990412 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 31434-5KG-R )
Supplements for MCDB 170 media (added before use; See Recipes):
Bovine pituitary extract (BPE) (Sigma-Aldrich, catalog number: P-1476 ) when not available use BPE (150 mg/batch) from Upstate (Sigma-Aldrich, catalog number: 02-104 )
Epithelial growth factor (EGF) (Sigma-Aldrich, catalog number: E-9644 )
Transferrin (Sigma-Aldrich, catalog number: T-2252 )
Isoproterenol (Sigma-Aldrich, catalog number: I-5627 )
Hydrocortisone (Sigma-Aldrich, catalog number: H-4001 )
Insulin (Sigma-Aldrich, catalog number: I-9278 )
Amphotericin B (Sigma-Aldrich, catalog number: A-2942 )
Gentamicin (Sigma-Aldrich, catalog number: G-1397 )
100 nM 4-hydroxytamoxifen used to activate MycERTM construct (4-OHT; diluted from 1 mM stock) (Sigma-Aldrich, catalog number: H7904 )
SuperScript Vilo cDNA Synthesis Kit (Thermo Fisher Scientific, catalog number: 11754-050 )
Equipment
37 °C, 5% CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Series II 3110 )
Shaker (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 4625Q )
Confocal laser scanning Microscope (Zeiss, models: LSM Meta 510 and 780 equipped with argon [488], helium-neon [543 and 633] and diode [405] lasers and Plan-Neofluar 40x DIC objective [NA = 1.3, oil])
Zeiss Axio vert 200 microscope equipped with Apotome system (Zeiss) and 20x Plan apochromat objective (NA = 0.8, air), MRr digital camera and Axiovision 4.4 software.
Light Cycler 480 II instrument (Roche Diagnostics, model: Light Cycler 480 II )
Nanodrop (Thermo Fisher Scientific, Thermo Scientific, model: NanoDrop 8000 )
Heraeus Multifuge 3SR Plus (DJB Labcare, catalog number: 75004371 ) with Swing Swing-out rotor 4 place (DJB Labcare, catalog number: 75006445 ) and Microtitre carrier for 4 microtitre plates (DJB Labcare, catalog number: 75006449 )
Software
ImageJ software (National Institute of Health, version 1.50i)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Marques, E. and Klefström, J. (2016). Lentiviral shRNA Screen to Identify Epithelial Integrity Regulating Genes in MCF10A 3D Culture. Bio-protocol 6(23): e2050. DOI: 10.21769/BioProtoc.2050.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Cell Biology > Cell-based analysis > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,051 | https://bio-protocol.org/exchange/protocoldetail?id=2051&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for Molecular Dynamics Simulations of Proteins
MNV Prasad Gajula
Anuj Kumar
Johny Ijaq
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2051 Views: 24329
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2013
Abstract
Molecular dynamics (MD) simulations have become one of the most important tools in understanding the behavior of bio-molecules on nanosecond to microsecond time scales. In this protocol, we provide a general approach and standard setup protocol for MD simulations by using the Gromacs MD suite.
Keywords: Molecular dynamics simulations Conformational studies Gromacs Structural studies Protein dynamics
Background
While molecular dynamics (MD) simulations are increasingly getting popular in studying protein dynamics in silico, there is a strong need to correlate the results with experimental observations. It is necessary that the protein model and the chosen environment for the simulations should mimic the native environment as close as possible. In general, there are three key stages in molecular dynamics simulations: Setup, production run, and analysis of the trajectories. The setup includes the input structures, parameters, force-fields and topologies. However, the readymade setup and wrong parameters could adversely affect the outcome making a false assessment of the biological interpretation. In view of a manual setup as a better choice to setup simulations, we through this protocol, provide a general approach and standard setup protocol for MD simulations. Many online/offline tools are available to perform MD simulations. One amongst the open source tools is Gromacs (Abraham et al., 2015; Pronk et al., 2013; Van der Spoel et al.,2005), a robust and popular MD simulations suite available today which supports almost all the major force fields. In this protocol we also refer to simulations of membrane proteins previously performed in vacuum as a temporary alternative to simulations including the membrane.
Materials and Reagents
Protein structure coordinates (http://www.rcsb.org/pdb/home/home.do)
Appropriate Force field (A force field describes physical systems as collections of atoms kept together by interatomic force, e.g., chemical bonds, angles etc. [Meller, 2010]).
Molecular geometry file(.gro)
Molecular topology file(.top)
Parameter files (.mdp) (http://manual.gromacs.org/online/mdp.html)
Equipment
Note: In general, MD simulations require parallel computing to be able to run longer simulations in a shorter period. For smaller jobs/preprocessing, a desktop workstation machine preferably running on Linux is sufficient. However, it is preferable to perform initial steps on a local machine and final md run on a computer cluster.
A desktop PC with configuration below was used for initial setup of simulations :
HP Pavilion Desktop Intel 4 Core(TM) i5-4570 [email protected] each
16 GB memory
1 TB HDD
NVIDIA GeForce GT 625
Ubuntu V15.04
The basic configuration of the supercomputer is as follows:
Site: Center for Development of Advanced Computing (C-DAC)
Cores: 30,056
Memory: 14,144 GB
Processor: Xeon E5-2670 8C 2.6GHz
Operating System: CentOS
MPI: Intel MPI
Note: For the final production md run, all the jobs performed in this study were submitted to supercomputing facility at C-DAC. The resources were allocated based on the availability & requirement.
Software
Gromacs MD simulation suite v 5.1, (Abraham et al., 2015; Pronk et al., 2013; Van der Spoel et al., 2005)
Rasmol (http://www.bernstein-plus-sons.com/software/rasmol/README.html) for molecular visualization
Text editor, Gedit 3.18 (to edit the PDB file, update topology files and to edit the input run parameter files)
2D plotting program Grace (http://plasma-gate.weizmann.ac.il/Grace) (for visualization )
Win SCP (to transfer files to and fro)
SSH client/Putty (to execute the commands on a remote server from our desktop)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gajula, M. P., Kumar, A. and Ijaq, J. (2016). Protocol for Molecular Dynamics Simulations of Proteins. Bio-protocol 6(23): e2051. DOI: 10.21769/BioProtoc.2051.
Download Citation in RIS Format
Category
Systems Biology > Interactome > Protein-protein interaction
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,052 | https://bio-protocol.org/exchange/protocoldetail?id=2052&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Resin-embedded Thin-section Immunohistochemistry Coupled with Triple Cellular Counterstaining
WP William M Palmer
JP John W Patrick
YR Yong-Ling Ruan
Published: Vol 7, Iss 7, Apr 5, 2017
DOI: 10.21769/BioProtoc.2052 Views: 7459
Edited by: Tie Liu
Reviewed by: Gaston A. PizzioFang Xu
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
This protocol was developed to study protein localisation within the vascular bundles of developing tomato fruit however, it can be applied to any resin embedded plant tissue. The vascular bundle is comprised of many different cells that all have unique properties. The mature sieve elements are enucleated and contain sieve plates that comprise of callose. This method has utilised these properties of the sieve element by combining immunohistochemistry for cell wall invertase with counterstaining of aniline blue for callose, DAPI for nucleus and cell structure is shown with the final staining of the cell wall using calcofluor white. It must be noted that when following this protocol, it is vital for the sections to be flat and fixed to the slide with gelatine so cover slip removal does not move the sample section. This protocol will be applicable to all plant tissues and provides additional evidence of the protein localisation within the cell by conducting a counterstaining procedure.
Keywords: Immunolocalisation Microscopy Staining Phloem
Background
Immunolocalisation has long been a method used to study the localisation of proteins within tissue. This protocol focused on, not only localising the proteins of interest but also the molecular structures that were in surrounding tissue. It is believed that the mature sieve elements are enucleated and have abundant callose deposition within the sieve plate. Therefore, counterstaining procedures were applied in order to represent these biological phenomena. As the proteins of interest in this study were also thought to be localised within the apoplast further counterstaining was applied showing co-labelling of the protein and the cell wall.
Materials and Reagents
Size 000 gelatine capsules (ProSciTech, catalog number: RL039 )
Razor blade
Microscope slide (Livingstone, catalog number: 7107-PPN )
22 x 50 mm, 0.17 mm thick coverslip (Fisher Scientific, catalog number: 12-543C )
Tomato flowers 2 Days Before Fertilization (DBF) and 2 Days After Fertilization (DAF) harvested from glasshouse-grown cv. Moneymaker tomato plants
50 mM PIPES (Sigma-Aldrich, catalog number: F6757 )
AR grade EtOH (Sigma-Aldrich, catalog number: 32205 )
Note: This product has been discontinued.
ddH2O
LR white resin (ProSciTech, catalog number: C023 )
Gelatine (Sigma-Aldrich, catalog number: G9391 )
Cell wall invertase (LIN5) purified polyclonal primary antibody – produced in rabbit (Mimmitopes – custom made)
Inhibitor of invertase (INH) purified polyclonal primary antibody – produced in rabbit (Mimmitopes – custom made)
TBST (Sigma-Aldrich, catalog number: T9039 )
Secondary anti-rabbit IgG fluorescein isothiocyanate (FITC) (Sigma-Aldrich, catalog number: F9887 )
Anti-Rabbit IgG (whole molecule)-FITC antibody produced in goat (Sigma-Aldrich, catalog number: F6005 )
Note: This product has been discontinued.
Aniline blue (0.1% in ddH2O) (Sigma-Aldrich, catalog number: B8563 )
Mowiol-phenylenediamine (mowiol) (Sigma-Aldrich, catalog number: 10852 )
4’,6-diamidino-2-phenylindole (DAPI) (1:500) (Sigma-Aldrich, catalog number: D9542 )
Calcofluor white (0.1% in ddH2O) (Sigma-Aldrich, catalog number: F3543 )
2% paraformaldehyde
Glutaraldehyde
CaCl2
Tris
NaN3
Bovine serum albumin (BSA)
Fixing solution (see Recipes)
Blocking buffer (see Recipes)
Equipment
Rotator
Dissecting microscope or magnifying glass
Reichert Ultracut E microtome (Reichert, model: 701704 )
DiATOME Histo Knife, Diamond, 45°, 4.0-4.9 mm (ProSciTech, catalog number: UH45-40 )
Fume hood
Beaker
Axio Scope.A1 epifluorescence compound microscope (ZEISS, model: Axio Scope.A1 )
Emission FITC filter (50-490 nm excitation, long pass 515 nm)
Emission UV filter (365 nm excitation, short pass 420 nm)
AxioCam digital camera (ZEISSTM) or equivalent
Software
AxioVision V4.8 software
Adobe Bridge CS4 software
Abode Photoshop CS4 software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Palmer, W. M., Patrick, J. W. and Ruan, Y. (2017). Resin-embedded Thin-section Immunohistochemistry Coupled with Triple Cellular Counterstaining. Bio-protocol 7(7): e2052. DOI: 10.21769/BioProtoc.2052.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Fixed-tissue imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,053 | https://bio-protocol.org/exchange/protocoldetail?id=2053&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Delayed Spatial Win-shift Test on Radial Arm Maze
Simone N. De Luca
Luba Sominsky
Sarah J. Spencer
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2053 Views: 12892
Edited by: Xi Feng
Reviewed by: Xiaoyu LiuMarina Allerborn
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
The radial arm maze (RAM) is used to assess reference and working memory in rodents. This task relies on the rodent’s ability to orientate itself in the maze using extra-maze visual cues. This test can be used to investigate whether a rodent’s cognition is improved or impaired under a variety of experimental conditions. Here, we describe one way to test spatial working and reference memory. This delayed spatial win-shift (DSWS) procedure on the RAM was adapted from Packard and White (1990). The win-shift component of the test refers to the alternation of baiting, or rewarding, arms during the trial and test phase. The rodent is required to hold spatial information both within the task and across a delay to obtain the food-pellet reward (Taylor et al., 2003b). This task measures the incidence and type of memory errors made by the rodent both in the training and test phases of the learning task. A working memory error (re-entry of an arm that has been baited) can occur in both phases of the task, whilst a reference memory error (entry into an arm that has been baited during the training phase and is no longer baited) can only occur during the test phase.
Keywords: Delayed spatial win-shift (DSWS) Radial arm maze (RAM) Spatial working memory Spatial reference memory Trial phase Test phase
Background
The radial arm maze (RAM) can be used to examine the effects of hippocampal and prelimbic cortex (PLC) damage, ageing, as well as a variety of pharmacological agents (Wenk, 2001; Taylor et al., 2003b; Floresco et al., 1997; Vann et al., 2003). The hippocampus is widely accepted to be involved in both spatial working and reference memory. Lesions to the hippocampus in rodents have shown impairments in the ability to perform memory tasks, including the RAM, involving spatial navigation (O'Keefe and Nadel, 1978; Morris et al., 1982). The PLC region of the rat prefrontal cortex, the approximate equivalent of primate dorsolateral region of the prefrontal cortex (Groenewegen, 1988), is also involved in spatial working memory (Robbins, 1990). Taylor et al. have demonstrated that rodents with lesions to the PLC make more spatial reference and memory errors compared to controls in the delayed spatial win-shift (DSWS) procedure on the radial maze (Taylor et al., 2003b). The traditional RAM studies an animal’s explorative behaviour during the task, particularly investigating working memory (Seamans et al., 1995). The adaptation of the task to include the DSWS element is a well-established procedure in the literature. This technique investigates the rats’ ability to retain spatial information both within the task and across a delay (Taylor et al., 2003b; Lapish et al., 2008; De Luca et al., 2016).
Materials and Reagents
Paper towels for cleaning the maze with ethanol
Rats: Our experiments were conducted using 10-week old male Wistar rats but other rodents can be used. If using females, estrous cycle stage should be taken into consideration since spatial reference memory is attenuated during the pro-estrous phase of the cycle (Bowman et al., 2001; Pompili et al., 2010). If using young rats or adult mice, a mouse RAM of smaller dimensions should be used, see below.
Notes:
The rats are housed under normal controlled laboratory conditions, in weight-matched pairs, under a 12 h dark/light cycle, with ad libitum access to food and tap water prior to the task. The testing protocol should be undertaken during the light phase of the 12 h light cycle between 0700 and 1900 h. Circadian rhythm does not need to be accounted for throughout the experiment as the rodents undergo bi-daily sessions across a large part of the 12 h light phase. To ensure there are no time biases between the groups, spread the testing of control and treated rodents throughout the day.
During the testing protocol, access to food should be restricted to 80% of the rat’s usual food intake to encourage food-seeking behaviour in the maze. Adult (10-week old) male Wistar rats have an approximate daily food intake between 15-20 g during the 12 h dark phase and around 7 g during the 12 h light phase. Adult female Wistar rats have an approximate daily food intake between 10-15 g during the 12 h dark phase and around 5 g during the 12 h light phase (Stefanidis and Spencer, 2012).
Prior to commencement and throughout the experiment, normal controlled laboratory light settings should be in place. The maximum allowable light intensity is equivalent to 300 lux at one meter height. There is no additional light source during the experimental protocol to alter the locomotor activity of the rodent.
Ethanol, 70% (v/v), diluted in distilled water
Standard chow grain pellets (45 mg) (Bio-Serv, USA)
Equipment
RAM
The task is carried out in an eight-arm radial maze (Lafayette Instrument Company, USA), consisting of an octagonal central platform (34 cm diameter) and eight equally-spaced radial arms (87 cm long, 10 cm wide). At the end of each arm is a food well (2 cm in diameter and 0.5 cm deep; Figure 1). At the entrance to each arm is a clear Perspex door that controlled access in and out of the central area. Each door is controlled by a computerized control system (Lafayette) enabling the experimenter to regulate access to the arms. Salient visual cues of different geometric shapes and contrasting colours are placed around the maze on the walls of the room.
Note: If using young rats or adult mice, a mouse RAM of smaller dimensions should be used. The central platform should be approximately 22 cm in diameter with arms 25 cm long, 6 cm wide and 6 cm high that is transparent to enable the mice to see extra-maze visual cues (Crusio and Schwegler, 2005). The mouse RAM, should be placed on the floor to avoid elevation-induced anxiety (Crusio and Schwegler, 2005).
Digital video camcorder. In this experiment a Canon Legria FS200 was used. However, any camcorder can be used.
Tripod. The video camcorder is attached to a tripod or to the ceiling to allow recording of the entire maze.
Figure 1. Radial Arm Maze (Lafayette Instrument Company) with automated Perspex doors and spatial cues placed around the maze. The camcorder is placed on the tripod facing downwards (approximately 45° to the maze). The camcorder can also be attached to the ceiling directly above the maze.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：De Luca, S. N., Sominsky, L. and Spencer, S. J. (2016). Delayed Spatial Win-shift Test on Radial Arm Maze. Bio-protocol 6(23): e2053. DOI: 10.21769/BioProtoc.2053.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,054 | https://bio-protocol.org/exchange/protocoldetail?id=2054&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Myosin II Minifilament Orientation at Epithelial Zonula Adherens
Magdalene Michael
Xuan Liang
Guillermo A. Gomez
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2054 Views: 8662
Edited by: Nicoletta Cordani
Reviewed by: Thomas J. BartoshXuecai Ge
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Non-muscle myosin II (NMII) form bipolar filaments, which bind F-actin to exert cellular contractility during physiological processes (Vicente-Manzanares et al., 2009). Using a combinatorial approach to fluorescently label both N- and C-termini of the NMII heavy chain, recent works have demonstrated the ability to visualize NMII bipolar filaments at various subcellular localizations (Ebrahim et al., 2013; Beach et al., 2014). At the zonula adherens (ZA) of epithelia, NMII minifilaments bind the circumferential actin bundles in a pseudo-sarcomeric manner (Ebrahim et al., 2013), a conformation required to maintain junctional tension and tissue integrity (Ratheesh et al., 2012). By expressing green fluorescent protein (GFP)-NMIIA heavy chain and immunolabel it using a NMIIA C-terminus specific antibody, we were able to visualize the NMII minifilaments bound to F-actin bundles in Caco-2 cells (Michael et al., 2016), as previously reported (Ebrahim et al., 2013; Beach et al., 2014). In addition, we designed an FIJI/MATLAB analysis module to quantify the size, distance and alignment of these minifilaments with respect to junctional F-actin at the ZA. Measurements of the dispersion of minifilaments angles were proven to be a useful parameter that closely correlated to the extent of contractility at junctions (Michael et al., 2016).
Keywords: Myosin II minifilaments Structured illumination microscopy Adherens junctions Actin organization
Background
For decades, the assembly of NMII into bipolar filaments has been studied using electron microscopy (EM) techniques. These mainly involve the assembly of NMII minifilaments from purified proteins or the visualization of minifilaments in cells following extraction of the actin cytoskeleton (Pollard, 1982; Svitkina et al., 1989). Whilst these methods enabled measurements of NMII bipolar filament assemblies, they were technically challenging and did not accurately reflect the cellular distribution of these entities, notwithstanding the artifacts introduced due to the sample preparation. With the advent of super-resolution microscopy, we are now able to observe and measure these NMII minifilaments in various subcellular locations with high resolution, using a rapid process that is amenable for most laboratories equipped with a microscope that performs structured illumination microscopy (SIM, Yap et al., 2015). In this protocol, we describe a method that we have developed to assess NMII minifilaments properties at adherens junctions by measuring the lengths of the minifilaments as well as quantifying their angles with respect to the junctional F-actin and their distance from the junctions (Michael et al., 2016).
Materials and Reagents
1.6-well plates (Corning, Costar®, catalog number: 3516 )
Glass coverslips (13 mm, #1.5) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 1014355130NR15 )
ShandonTM ColorFrostTM glass slides (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 6776214 )
Caco-2 human colon adenocarcinoma cells (ATCC, catalog number: ATCCH®TB-37TM )
Plasmid: GFP-NMIIA (Addgene, catalog number: 11347 )
Roswell Park Memorial Institute (RPMI) 1640 medium (Thermo Fisher Scientific, GibcoTM, catalog number: 11875093 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 26140079 )
100x penicillin/streptomycin (10,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
100x L-glutamine (200 mM) (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Lipofectamine® 3000 (Thermo Fisher Scientific, InvitrogenTM, catalog number: L3000015 )
Opti-MEM®, reduced serum media (Thermo Fisher Scientific, GibcoTM, catalog number: 31985070 )
Alexa Fluor® 647 phalloidin (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: A22287 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Antibodies
Anti-Myosin IIA rabbit polyclonal antibody (Biolegend, catalog number: PRB-440P )
Note: This antibody targets the C-terminal portion of the NMIIA heavy chain.
Goat anti-Rabbit IgG (H+L) secondary antibody, Alexa Fluor® 546 conjugate (Thermo Fisher Scientific, Invitrogen, catalog number: A11035 )
TetraSpeckTM multi-speck 100 nm beads (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: T7279 )
ProLong® Gold antifade mountant (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: P36934 )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: 158127 )
Piperazine-N,N’-bis(2-ethanesulfonic acid) (PIPES) (Sigma-Aldrich, catalog number: P6757 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Ethylene glycol-bis(β-aminoethyl ether)-N,N,N’,N’-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E3889 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Tris-Cl (Sigma-Aldrich, catalog number: T5941 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Phosphate buffered saline (PBS), without Ca2+ and Mg2+ (Thermo Fisher Scientific, GibcoTM, catalog number: 14190250 )
10x trypsin/EDTA (0.5%) (Thermo Fisher Scientific, GibcoTM, catalog number: 15400054 )
4% paraformaldehyde (PFA) (see Recipes)
Tris buffered saline (TBS) (see Recipes)
Blocking buffer (see Recipes)
Equipment
NuncTM 75 cm2 cell culture flasks (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 156472 )
Incubator
Zeiss ELYRA superresolution microscope (ZEISS, model: ELYRA Superresolution Microscope )
Software
Zen (black version; Zeiss)
FIJI (http://imagej.net/Fiji)
Prism, GraphPad (http://www.graphpad.com/scientific-software/prism/)
Matlab, Mathworks (https://www.mathworks.com/index-c.html)
FIJI and Matlab scripts for minifilament analysis (see Appendix I and II of this Bioprotocol)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Michael, M., Liang, X. and Gomez, G. A. (2016). Analysis of Myosin II Minifilament Orientation at Epithelial Zonula Adherens. Bio-protocol 6(23): e2054. DOI: 10.21769/BioProtoc.2054.
Download Citation in RIS Format
Category
Cell Biology > Cell structure > Cell adhesion
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,055 | https://bio-protocol.org/exchange/protocoldetail?id=2055&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Shoot Apical Meristem Size Measurement
HC Hsuan Chou
HW Huanzhong Wang
GB Gerald A. Berkowitz
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2055 Views: 9094
Edited by: Tie Liu
Reviewed by: Yuan Chen
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
The shoot apical meristem (SAM) is a collection of cells that continuously renew themselves by cell division and also provide cells to newly developing organs. It has been known that CLAVATA (CLV) 3 peptide regulates a transcription factor WUSCHEL (WUS) to keep numbers of undifferentiated cells constant and maintain the size of the SAM. The interactive feedback control of CLV3 and WUS in a non-cell autonomous signaling cascade determines stem cell fate (maintenance of pluripotency or, alternatively, differentiation into daughter cells) in the SAM. Ca2+ is a secondary messenger that plays a significant role in numerous signaling pathways. The signaling system connecting CLV3 binding to its receptor and WUS expression is not well delineated. We showed that Ca2+ is involved in CLV3 regulation of the SAM size. One of the approaches we used was measuring the size of the SAM. Here we provide a detailed protocol on how to measure Arabidopsis SAM size with Nomarski microscopy. The area of the two-dimensional dome representing the maximal ‘face’ of the SAM was used as a proxy for SAM size. Studies were done on wild type (WT) Arabidopsis in the presence and absence of a Ca2+ channel blocker Gd3+ and the CLV3 peptide, as well on genotypes that lack functional CLV3 (clv3) or a gene encoding a Ca2+-conducting ion channel (‘dnd1’).
Keywords: Arabidopsis Shoot apical meristem Shoot development Cell signaling Seedlings
Background
Nomarski microscopy is widely used to study Arabidopsis SAM size. Other microscopy techniques for SAM observation are time consuming and require embedding tissue in resin and then sectioning or even more sophisticated microscopy. Nomarski microscopy, along with tissue clearing techniques is fast and convenient for whole tissue imaging. Published methods on SAM size measurement with Nomarski microscopy are often briefly described. Here, we provide a modified protocol with a detailed step by step guide including steps from dissecting Arabidopsis SAM tissues, through sample preparation for Nomarski microscopy, and SAM size measurement.
Materials and Reagents
3 x 4 cell culture multi-well plates (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 150628 )
Parafilm
Razor blade
Glass slide (75 x 38 mm) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-550B )
Coverslips (18 x 18 mm) (thickness: 0.17 mm) (Thermo Fisher Scientific, Fisher Scientific, catalog number: S17521 )
Arabidopsis thaliana wild type (ecotype Columbia), dnd1 mutant (At5g15410), clv3 mutant (At2g27250)
Synthetic CLV3 peptide RTVPhSGPhDPLHH3 (GenScript, Piscataway, NJ)
Murashige and Skoog salts (MS) (Caisson Laboratories, catalog number: MSP01-10LT )
Gadolinium(III) chloride (GdCl3) (Sigma-Aldrich, catalog number: 439770 )
Ethanol (Sigma-Aldrich, catalog number: 459836 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
MES buffer (pH 5.7) (Caisson Laboratories, catalog number: M009-100GM )
Sterilized water
Tris (Sigma-Aldrich, catalog number: 252859 )
Acetic acid (Thermo Fisher Scientific, Fisher Scientific, catalog number: A38S-500 )
Chloral hydrate (Sigma-Aldrich, catalog number: C8383 )
Glycerol (Thermo Fisher Scientific, catalog number: 17904 )
Plant culture medium (see Recipes)
Fixing solution (see Recipes)
Clearing solution (see Recipes)
Equipment
Fridge
Shaker
Growth chamber for growing plants (100 µmol m-2 sec-1 white light for 16 h and dark for 8 h, 23 °C)
Tweezers
Dissecting microscope
Microscope equipped with Nomarski optics (Nikon Instrument, model: MICROPHOT-FX )
Software
Infinity analyze program (Lumenera, Ottawa, Canada)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant developmental biology > Morphogenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,056 | https://bio-protocol.org/exchange/protocoldetail?id=2056&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Latex Bead Phagosomes from Dictyostelium for in vitro Functional Assays
Ashwin D’Souza
Paulomi Sanghavi
Ashim Rai
Divya Pathak
Roop Mallik
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2056 Views: 9305
Edited by: Kristopher Marjon
Reviewed by: Geneviève Ball
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
We describe a protocol to purify latex bead phagosomes (LBPs) from Dictyostelium cells. These can be later used for various in vitro functional assays. For instance, we use these LBPs to understand the microtubule motor-driven transport on in vitro polymerized microtubules. Phagosomes are allowed to mature for defined periods inside cells before extraction for in vitro motility. These assays allow us to probe how lipids on the phagosome membrane recruit and organize motors, and also measure the motion and force generation resulting from underlying lipid-motor interactions. This provides a unique opportunity to interrogate native-like organelles using biophysical and biochemical assays, and understand the role of motor proteins in phagosome maturation and pathogen clearance.
Keywords: Phagosome maturation Dynein Kinesin in vitro motility Dictyostelium
Background
In vitro reconstitution of biological processes is important to understand the molecular components and mechanisms underlying them. One such process is phagosome maturation, which is involved in degradation of pathogens taken up by macrophage cells of the immune system, and is also used as a process of nutrition in lower eukaryotes (Vieira et al., 2002). The transport of phagosomes on microtubules is intimately connected to their maturation (Blocker et al., 1997; Vieira et al., 2002). Notably, several intracellular pathogens disrupt phagosome transport to survive in a latent form inside cells (Harrison et al., 2004; Harrison and Grinstein, 2002; Rai et al., 2016; Sun et al., 2007). Therefore, reconstitution of phagosome transport might help to understand the strategy used by pathogens for immune evasion. Here, we describe a detailed protocol to prepare LBPs from cell extracts of the social amoeba Dictyostelium discoideum. This protocol has been adapted and modified from the work by Gotthard et al. (2006). Briefly, the cells are pulsed with latex beads and chased for different time durations to enable either early or late phagosome formation. Such phagosomes are buoyant in nature and float away from other endogenous vesicles when spun at high speeds. These phagosomes, collected along with the cytosol, show robust motion on in vitro polymerized microtubules. A detailed version of this protocol has also been published elsewhere (Barak et al., 2014). Using this method, we have recently shown cholesterol as a key regulator of phagosome transport and maturation (Rai et al., 2016). Furthermore, this assay has helped us to elucidate the mechanism of disruption of phagosome transport by lipophosphoglycan (LPG) from the parasite Leishmania donovani. A description of the phagosome extract preparation from Dictyostelium cells is detailed below. This protocol describes only the purification of LBPs. The in vitro motility assay has been described elsewhere (Barak et al., 2014).
Materials and Reagents
Glass coverslip
1.5 ml microfuge tube
Preassembled Acrodisc® syringe filters for lysing cells (5 μm pore size, Supor® membrane 32 mm diameter) (Pall, catalog number: 4650 )
Syringes of 1-2 ml capacity for lysis
1 ml syringe with needle (26 G) for collection of LBPs
Dictyostelium discoideum AX-2 strain cells (dictyBase, catalog number: DBS0238585 ) (see Note 1)
HL-5 medium for cell culture: HL-5 medium with glucose (ForMediumTM, catalog number: HLG0102 ) prepared according to manufacturer’s specifications (see Note 2)
Polystyrene beads: carboxylated polystyrene beads of 750 nm diameter (Polysciences, catalog number: 07759-15 ) (see Note 4)
Penicillin-streptomycin (Penstrep) (10,000 μg/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
Protease inhibitor cocktail (cOmplete EDTA-free) (Roche Diagnostics, catalog number: 11836145001 )
Liquid nitrogen for snap freezing
Pepstatin A (MP Biomedical, catalog number: 2195368 )
Methanol
KH2PO4
Na2HPO4
Tris
EGTA
Sucrose
DL-Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 43819 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: 78830 )
Benzamidine hydrochloride (Sigma-Aldrich, catalog number: 434760 )
Sorensen’s buffer (see Recipes)
Cell lysis buffer (see Recipes)
Centrifugation cushion buffer (see Recipes)
Equipment
Rotatory shaker
Differential Interference Contrast (DIC) microscope (Nikon Instruments, model: TE2000U or similar)
Cell culture microscope with 10x and 20x objective for observing and counting cells
Water bath sonicator (Branson 1510MT ultrasonic cleaner, frequency 40 kHz, 10 min)
Note: This product has been discontinued.
Clinical centrifuge for pelleting cells
Shaking incubator at 22 °C
Autoclaved 500 ml conical flasks for shaking suspension culture
Beckman Coulter centrifuge with JA-10 rotor
JA-10 rotor (Beckman Coulter, catalog number: 369687 )
Jars (Beckman Coulter, catalog number: 355605 )
Beckman Coulter table top ultracentrifuge with MLS-50 rotor
MLS-50 rotor (Beckman Coulter, catalog number: 367280 )
Ultra-Clear centrifuge tubes (Beckman Coulter, catalog number: 344057 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：D’Souza, A., Sanghavi, P., Rai, A., Pathak, D. and Mallik, R. (2016). Isolation of Latex Bead Phagosomes from Dictyostelium for in vitro Functional Assays. Bio-protocol 6(23): e2056. DOI: 10.21769/BioProtoc.2056.
Download Citation in RIS Format
Category
Cell Biology > Organelle isolation > Phagosome
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,057 | https://bio-protocol.org/exchange/protocoldetail?id=2057&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Chondrogenic Hypertrophy Induction of Mesenchymal Stem Cells
SJ Sang Young Jeong
ML Miyoung Lee
SC Soo Jin Choi
WO Wonil Oh
Hong Bae Jeon
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2057 Views: 12302
Reviewed by: Vivien Jane Coulson-Thomas
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
To investigate underlying mechanism of chondrogenic hypertrophy, we need proper in vitro hypertrophic model of mesenchymal stem cells (MSCs). This protocol describes our defined method for induction of in vitro chondrogenic hypertrophy of human umbilical cord blood-derived MSCs (hUCB-MSCs). By adding thyroid hormone (T3; triiodothyronine) and minimum osteogenic-inducing factors to culture medium, we could induce hypertrophy of hUCB-MSCs in vitro. Hypertrophic induction was validated using immunohistochemical analysis, Western blotting and reverse transcriptase polymerase chain reaction.
Keywords: Mesenchymal stem cell in vitro chondrogenic hypertrophy Chondrogenic differentiation Triiodothyronine
Background
Several studies have shown that expression of hypertrophy-associated genes, including type X collagen, alkaline phosphatase, and parathyroid hormone-related protein receptor (PTHrPR) in chondrogenic differentiation of MSCs. The expression of these genes suggests that chondrogenic differentiation in MSCs inevitably induce chondrogenic hypertrophy stage which is typical of endochondral ossification. In addition, it is known that the activation of the parathyroid hormone-related protein (PTHrP) pathway induces MSC transition to an osteogenic phenotype (Guo et al., 2006). Based on these reports, Mueller et al. suggested that depletion of TGF-β, low concentration of dexamethasone, and addition of triiodothyronine (T3) was important for hypertrophic induction of bone marrow-derived MSCs (Mueller et al., 2008). In Mueller’s protocol, β-glycerophosphate and dexamethasone are necessary to induce higher hypertrophy status. However, their results indicated that treatment of β-glycerophosphate is not essential to induce hypertrophic morphology of chondrocytes. In addition, a recent report showed that dexamethasone has inhibitory effects on hypertrophic induction of MSCs dependent experimental conditions (Shintani et al., 2011). Thus, the use of these agents is not necessarily required to induce hypertrophy. We established a simpler hypertrophy-inducing protocol by withdrawal of β-glycerophosphate and dexamethasone from hypertrophy-inducing culture medium.
Materials and Reagents
15 ml sterile conical tubes (Corning, catalog number: 430055 )
50 ml sterile conical tubes (Corning, catalog number: 430829 )
Microslide glass (Thermo Fisher Scientific, Fisher Scientific, catalog number: 22-230-900 )
0.22 μm syringe filter (Pall, catalog number: PN4192 )
Umbilical cord blood-derived mesenchymal stem cells (Neonatal umbilical cord blood was collected from umbilical veins, with informed maternal consent. For UCB collection, a 16-gauge needle was inserted into the umbilical vein, and UCB was allowed to flow by gravity; See Yang et al. [2004] for the protocol of isolation and maintenance of cells)
Minimum essential medium-alpha (Thermo Fisher Scientific, GibcoTM, catalog number: 12571 )
Dulbecco’s phosphate buffered saline without calcium & magnesium (Mediatech, catalog number: 21-031-CVR )
TrypLETM Express enzyme (Thermo Fisher Scientific, GibcoTM, catalog number: 12605 )
4% paraformaldehyde solution (Biosesang, catalog number: P2031 )
Ethanol
DAKO EnVisionSystem Peroxidase (DAB) Kit (Agilent Technologies, catalog number: K4006 )
DAKO Protein block, serum-free (Agilent Technologies, catalog number: X0909 )
Antibody for type II collagen (EMD Millipore, catalog number: MAB8887 , antibody dilution 1:100)
Antibody for type X collagen (Thermo Fisher Scientific, Invitrogen, catalog number: MA5-14268 , antibody dilution 1:100)
Antibody for RUNX2 (Abcam, catalog number: ab76956 , antibody dilution 1:1500)
Antibody for phospho-GSK-3β(Ser9) (Cell Signaling Technology, catalog number: 5558 , antibody dilution 1:1000)
Antibody for β-Catenin (Cell Signaling Technology, catalog number: 9582 , antibody dilution 1:1000)
Antibody for phosphor-Smad1(Ser206) (Cell Signaling Technology, catalog number: 5753 , antibody dilution 1:1000)
Antibody for GAPDH (Abcam, catalog number: ab9485 , antibody dilution 1:4000)
Tris-HCl
BSA
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
Mayer’s hematoxylin (Agilent Technologies, catalog number: S3309 )
Shandon Xylene Substitute (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 6764506 )
Shandon Xylene Substrate Mountant (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 9999122 )
Fetal bovine serum, certified grade, US origin (Thermo Fisher Scientific, GibcoTM, catalog number: 16000-044 )
Gentamicin (Thermo Fisher Scientific, GibcoTM, catalog number: 15750 )
Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11965 )
BMP-6 (R&D Systems, catalog number: 507-BP-020/CF )
TGF-β3 (R&D Systems, catalog number: 243-B3-002/CF )
ITS+ (Corning, catalog number: 354352 )
Ascorbic acid (Sigma-Aldrich, catalog number: A8960 )
Dexamethasone (Sigma-Aldrich, catalog number: D2915 )
L-proline (Sigma-Aldrich, catalog number: P5607 )
Sodium pyruvate (Sigma-Aldrich, catalog number: P8574 )
Triiodothyronine (Sigma-Aldrich, catalog number: T6397 )
Primers for Runx2
Forward 5’-CGG AGT GGA TGA GGC AAG AG-3’
Reverse 5’-GGC TCA GGT AGG AGG GGT AA-3’
Primers for GAPDH
Forward 5’- CTT CTT TTG CGT CGC CAG CCG A-3’
Reverse 5’-TGG CCA GGG GTG CTA AGC AGT-3’
Complete culture media (see Recipes)
In vitro chondrogenesis-inducing media (see Recipes)
In vitro hypertrophy-inducing media (see Recipes)
Equipment
175T flask (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 159910 )
Centrifuge with swinging-bucket rotor and adaptors for 15 ml conical tubes
Humidified cell culture incubator set to 37 °C and 5% CO2
Hemacytometer (VWR, INCYTO C-ChipTM, catalog number: DHCN015 )
Cryostat (Leica Biosystems Nussloch, model: CM1850 )
OCT compound (VWR, Tissue-Tek®, catalog number: 25608-930 )
Microscope for immunohistochemical staining image analysis (Nikon ECLIPSE 50i with DS-Fi1 digital microscope camera head) (Nikon Instruments, model: ECLIPSE 50i )
Software
ImageJ program
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jeong, S. Y., Lee, M., Choi, S. J., Oh, W. and Jeon, H. B. (2016). In vitro Chondrogenic Hypertrophy Induction of Mesenchymal Stem Cells. Bio-protocol 6(23): e2057. DOI: 10.21769/BioProtoc.2057.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Mesenchymal stem cell
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,058 | https://bio-protocol.org/exchange/protocoldetail?id=2058&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Efficient AAV-mediated Gene Targeting Using 2A-based Promoter-trap System
SK Sivasundaram Karnan
Akinobu Ota
YK Yuko Konishi
MW Md Wahiduzzaman
ST Shinobu Tsuzuki
YH Yoshitaka Hosokawa
Hiroyuki Konishi
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2058 Views: 9702
Edited by: Nicoletta Cordani
Reviewed by: Pinchas TsukermanMartin V Kolev
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Adeno-associated virus (AAV)-based targeting vectors have 1-4-log higher gene targeting efficiencies compared with plasmid-based targeting vectors. The efficiency of AAV-mediated gene targeting is further increased by introducing a promoter-trap system into targeting vectors. In addition, we found that the use of ribosome-skipping 2A peptide rather than commonly used internal ribosome entry site (IRES) in the promoter-trap system results in significantly higher AAV-mediated gene targeting efficiencies (Karnan et al., 2016). In this protocol, we describe the procedures for AAV-mediated gene targeting exploiting 2A for promoter trapping, including the construction of a targeting vector based on the platform plasmid pAAV-2Aneo or pAAV-2Aneo v2, production of AAV particles, infection of cells with resulting AAV-based targeting vectors, and isolation and verification of gene-targeted cell clones.
Keywords: Adeno-associated virus AAV Targeting vector Gene targeting Promoter trap 2A Internal ribosome entry site IRES
Background
The procedures for AAV-mediated gene targeting in general (corresponding to Sections B-G of this protocol) were previously described in other protocols (Kohli et al., 2004; Rago et al., 2007; Khan et al., 2011; Howes and Schofield, 2015). However, this protocol provides a detailed description of how to perform AAV-mediated gene targeting using a 2A-based promoter–trap system for the first time.
Materials and Reagents
Pipette tips
10-cm culture dish
1.5-ml or 2-ml cryovial
96-well plate
15-ml (or 50-ml) conical tube
24-well plates
6-well plates or tissue culture dishes/flasks
0.22 µm filter
1.5-ml tubes
Aluminum foil
Disposable pipetting reservoir (AS ONE, catalog number: 2-7844-02 )
E. coli DH5α competent cells (Takara Bio, catalog number: 9057 )
Note: This product has not been discontinued.
HEK293 or HEK293T cell line
Cell line(s) for gene targeting
pAAV-2Aneo (Addgene, catalog number: 80032 )
pAAV-2Aneo v2 (Addgene, catalog number: 80033 )
Agarose (NIPPON GENE, catalog number: 318-01195 )
Pwo SuperYield DNA polymerase (Roche Diagnostics, catalog number: 04340850001 )
PureLink® Quick Gel Extraction Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: K2100-25 )
PureLink® PCR Purification Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: K3100-02 )
Quick LigationTM Kit (New England BioLabs, catalog number: M2200S )
Dry ice
Restriction enzymes BspEI, MluI, or BsrGI (New England BioLabs, Ipswich, MA)
Restriction enzyme buffers
LB broth (NACALAI TESQUE, catalog number: 20068-75 )
Mini PlusTM Plasmid DNA extraction system (Viogene, catalog number: GF2002 )
BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4337455 )
Alkaline phosphatase, calf intestinal (CIP) (New England BioLabs, catalog number: M0290L )
Custom-made PCR primers (for the amplification of 5’ and 3’ homology arms)
Custom-made sequencing primers (for the sequencing of 5’ and 3’ homology arms)
Custom-made PCR primers (for the screening of gene-targeted clones)
PureLink® HiPure Plasmid Maxiprep Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: K210007 )
Dulbecco’s modified Eagle’s medium (D-MEM) (Wako Pure Chemical Industries, catalog number: 044-29765 )
Fetal bovine serum (FBS) (NICHIREI, catalog number: 172012-500ml )
Opti-MEM® I reduced-serum medium (Thermo Fisher Scientific, GibcoTM, catalog number: 31985-070 )
pRC and pHelper plasmids in AAV Helper-free system (Agilent Technologies, catalog number: 240071 )
TransIT®-293 transfection reagent (Mirus Bio, catalog number: MIR 2705 )
Penicillin-streptomycin solution (x100) (Wako Pure Chemical Industries, catalog number: 168-23191 )
Methanol
Distilled water
RNase-free DNase set (QIAGEN, catalog number: 79254 )
NeoR-Rev #1: 5’-GGCATCAGAGCAGCCGATTG
NeoR-Fwd #1: 5’-CATTCGACCACCAAGCGAAA
NeoR-Rev #2: 5’-CTTGAGCCTGGCGAACAGTT
KOD FX Neo (TOYOBO, catalog number: KFX-201 )
Growth medium appropriate for the cell line(s) undergoing gene targeting
0.25% (w/v) trypsin solution with phenol red (Wako Pure Chemical Industries, catalog number: 201-18841 )
PCR buffer
dNTPs
SYBR® Green I nucleic acid stain (Lonza, catalog number: 50512 )
PureLink® Genomic DNA Mini Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: K182002 )
Ampicillin sodium (Wako Pure Chemical Industries, catalog number: 012-23303 )
Dimethyl sulfoxide (DMSO) (Wako Pure Chemical Industries, catalog number: 048-21985 )
NaCl
KCl
Na2HPO4•12H2O
KH2PO4
Ampicillin working solution (see Recipes)
SYBR Green I working solution (see Recipes)
PBS(-) (see Recipes)
Equipment
Humidified CO2 incubator
VeritiTM thermal cycler (Thermo Fisher Scientific, model: Veriti Thermal Cycler )
Mupid®-2plus submarine-type electrophoresis system (Takara Bio, model: Mupid-2plus System )
NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific)
StepOnePlusTM Real-Time PCR system (Thermo Fisher Scientific, Applied BiosystemTM, model: StepOnePlusTM Real-Time PCR system )
Centrifuge for molecular biology experiments
-20 °C freezer
Tissue culture hood
Phase-contrast microscope
Swing bucket centrifuge for tissue culture
-80 °C deep freezer
Water bath
12-channel pipettor
Two permanent markers of different colors
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Karnan, S., Ota, A., Konishi, Y., Wahiduzzaman, M., Tsuzuki, S., Hosokawa, Y. and Konishi, H. (2016). Efficient AAV-mediated Gene Targeting Using 2A-based Promoter-trap System. Bio-protocol 6(24): e2058. DOI: 10.21769/BioProtoc.2058.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA cloning
Molecular Biology > DNA > DNA recombination
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,059 | https://bio-protocol.org/exchange/protocoldetail?id=2059&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Golden Gate-based Protocol for Assembly of Multiplexed gRNA Expression Arrays for CRISPR/Cas9
JV Johan Vad-Nielsen*
Lin Lin *
KJ Kristopher Torp Jensen
A Anders Lade Nielsen
Yonglun Luo
*Contributed equally to this work
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2059 Views: 25684
Edited by: Renate Weizbauer
Reviewed by: Gal Haimovich
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
The CRISPR (clustered regularly interspaced short palindromic repeats)-associated protein 9 (Cas9) has become the most broadly used and powerful tool for genome editing. Many applications of CRISPR-Cas9 require the delivery of multiple small guide RNAs (gRNAs) into the same cell in order to achieve multiplexed gene editing or regulation. Using traditional co-transfection of single gRNA expression vectors, the likelihood of delivering several gRNAs into the same cell decreases in accordance with the number of gRNAs. Thus, we have developed a method to efficiently assemble gRNA expression cassettes (2-30 gRNAs) into one single vector using a Golden-Gate assembly method (Vad-Nielsen et al., 2016). In this protocol, we describe the detailed step-by-step instructions for assembly of the multiplexed gRNA expression array. The gRNA scaffold used in our expression array is the gRNA 1.0 system for the Cas9 protein from Streptococcus pyogenes driven by the human U6 promoter.
Keywords: CRISPR SpCas9 Golden-Gate assembly Multiplexed gRNA array Simultaneously genetic manipulation
Background
The broadened CRISPR toolbox based on wild-type Cas9 or nuclease-deficient Cas9 (dCas9) has greatly facilitated genome/epigenome editing and regulation in all organisms. Multiplexed gene editing or regulation requires simultaneous expression of several gRNAs in the same cell. The traditional way of delivering several gRNAs into cells is based on either co-transfection of individual gRNA expression vectors or generation of a vector carrying multiple gRNA expression cassettes using traditional cloning; a process which is extremely time consuming. Another way of generating a vector containing multiple gRNA expression cassettes is based on gene synthesis, which is costly and only applicable when working with a very limited number of gRNA expression cassettes. The current protocol is based on Golden Gate cloning which can be used to assemble up to 30 individual gRNA expression cassettes into a single vector within 7 days (Figure 1), with each cassette being driven by an individual human U6 promoter. In our study, we have validated the applicability of this system in both human and porcine cells, but it is in principle compatible with applications in any other organisms that can utilize the human U6 promoter. Compared with existing methods, our method is cost effective, rapid (7 days) and flexible (applicable with any gRNAs that do not contain a BbsI, BsaI or BsmBI recognition site). Many applications of CRISPR/Cas9 may benefit from using our system, including multiplexed gene knockout by CRISPR/SpCas9, multiplexed gene inhibition by CRISPRi, and multiplexed gene activation by CRISPRa.
Figure 1. Schematic illustration of the principle of the current protocol. The current protocol is carried out in 2-3 major steps which vary depending on the number of gRNA expression cassettes to be assembled. Step 1: The gRNA oligonucleotides (T#) are cloned into individual modular single gRNA expression vectors (pMA-SpCas9-g#). Step 2: The individual gRNA expression vectors (pMA-T#) are assembled into 1-3 array vectors depending on the total number of gRNAs. Step 3: For assembly of 11-30 gRNA expression cassettes, 2 to 3 individual array vectors are subjected to a second round of assembly to yield the final EGFP expressing vector (pMsgRNA-EGFP).
Materials and Reagents
200 µl PCR tubes
1.5 ml Eppendorf tubes
10 or 100 µl pipette tips
Competent E. coli cells (No particular preference, but should be recombination deficient)
The modular gRNA plasmids (available from Addgene, see Table 1 for corresponding Addgene plasmid IDs)
The pFUS-B1 to pFUS-B10, pFUS-A, pFUS-A30A and pFUS-A30B plasmids (available from Addgene, Golden Gate TALEN and TAL Effector Kit 2.0) (Addgene, catalog number: 1000000024 )
NEB buffer 2 (New England BioLabs, catalog number: B7002S )
BbsI (FastDigest) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FD1014 )
T4 DNA ligase (5 U/μl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EL0014 )
Distilled H2O
Ampicillin (Sigma-Aldrich, catalog number: A1593 )
LB medium
dNTP
DreamTaq or other equivalent DNA polymerase (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: K1072 )
Agarose
Plasmid prep mini kit (No particular preference, we used the Nucleo Spin plasmid easy pure kit from MACHEREY-NAGEL, catalog number: 740727 )
BsaI (BpiI) (FastDigest) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FD0293 )
Plasmid-SafeTM ATP-Dependent DNase (Epicentre, catalog number: E3101K , ATP is included in this kit)
Spectinomycin (Sigma-Aldrich, catalog number: PHR1441 )
X-gal (Sigma-Aldrich, catalog number: B4252 )
IPTG (dissolved IPTG in water) (Sigma-Aldrich, catalog number: I6758 )
AflII (BspTI) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FD0834 )
XbaI (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FD0684 )
BsmBI (Esp3I) (FastDigest) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: FD0454 )
Universal primers for PCR screening (see Table 1)
Table 1. Plasmids and primers. Plasmids developed for this protocol are available from Addgene with corresponding Addgene IDs. Single modular plasmids (pMA-SpCas9-g1 to pMA-SpCas9-10) for cloning gRNA oligonucleotides into individual gRNA expression plasmids. Array plasmid (pMA-MsgRNA-EGFP) for assembly of gRNA expression array containing 11-30 gRNA expression cassettes. Primer sequences used in this protocol for screening of assembled array plasmids.
Plasmid
Addgene ID
pMA-MsgRNA-EGFP
80794
pMA-SpCas9-g10
80793
pMA-SpCas9-g9
80792
pMA-SpCas9-g8
80791
pMA-SpCas9-g7
80790
pMA-SpCas9-g6
80789
pMA-SpCas9-g5
80788
pMA-SpCas9-g4
80787
pMA-SpCas9-g3
80786
pMA-SpCas9-g2
80785
pMA-SpCas9-g1
80784
Primers
Sequences (5’-)
Universal U6 Forward
ATAAGGATCCGGTCTCGCTATGAGGGCCTATTTCCCATG
Universal Scr Reverse
ATAATGTACAGGTCTCCCATGTAACTTGCTATTTCTAGCTC
Note: The Universal U6 and Scr primers have been modified to suit the PCR conditions in this protocol.
Equipment
Heating block (Grant Instruments, model: QBD2 )
Microcentrifuge (Eppendorf, model: Centrifuge 5424 )
37 °C Thermo incubator (Labnet International, model: 211DS )
37 °C shaking incubator (environmental incubator shaker G24 ) (Eppendorf, New Brunswick Scientific, model: G24)
Thermal cycler (Thermo Fisher Scientific, Applied BiosystemsTM, model: Veriti® 96 well thermal cycler )
DNA electrophoresis apparatus (Bio-Rad Laboratories, model: Wide mini-sub cell GT )
Nanodrop (Thermo Fisher Scientific, model: Nanodrop 1000 Spectrophotometer )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Vad-Nielsen, J., Lin, L., Jensen, K. T., Nielsen, A. L. and Luo, Y. (2016). A Golden Gate-based Protocol for Assembly of Multiplexed gRNA Expression Arrays for CRISPR/Cas9. Bio-protocol 6(23): e2059. DOI: 10.21769/BioProtoc.2059.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
206 | https://bio-protocol.org/exchange/protocoldetail?id=206&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunofluorescence Detection and F-actin Staining of MTLn3 Cells
HP Huan Pang
Published: Apr 20, 2012
DOI: 10.21769/BioProtoc.206 Views: 15487
Download PDF
Ask a question
Favorite
Cited by
Abstract
Epidermal growth factor (EGF)-stimulated MTLn3 cells protrusion play an important role in cell migration. Phalloidin which binds F-actin in cells is an imaging tool used with light microscopy to investigate the distribution of actin. The protocol described here can be useful for observing signaling in the EGF pathway.
Materials and Reagents
MTLn3 cells
Type I rat tail collagen (BD Biosciences, catalog number: 354236 )
Leibovitz's L15 media w/o phenol red (Life Technologies, InvitrogenTM, catalog number: 21083-027 )
Leibovitz's L15 media w/ phenol red (Life Technologies, InvitrogenTM, catalog number: 11415-064 )
Rhodamin phalloidin red Cy3 (Life Technologies, InvitrogenTM, catalog number: R415 )
Phosphate buffered saline (PBS)
Trypsin-EDTA
HCI
95% ethanol
Acetic acid
FBS-alpha-MEM
Paraformaldehyde
Triton X-100
Glycine
BSA
N-propyl gallate
Glycerol
Methanol
Nail polish
Collagen solution
EGF (EMD Millipore, catalog number: 01-102 ) (see Recipes)
Rhodamine phalloidin (see Recipes)
Equipment
Centrifuges
Coverslips
Tissue culture flask
Parafilm
Culture dish
Humidified chamber
Sharp forceps
Water bath
Culture hood
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell imaging > Fluorescence
Cell Biology > Cell movement > Cell migration
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,060 | https://bio-protocol.org/exchange/protocoldetail?id=2060&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Tandem Purification of His6-3x FLAG Tagged Proteins for Mass Spectrometry from Arabidopsis
He Huang
Dmitri Anton Nusinow
Published: Vol 6, Iss 23, Dec 5, 2016
DOI: 10.21769/BioProtoc.2060 Views: 12220
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Tandem affinity purification is a powerful method to identify protein complexes that function in association with a known gene of interest. This protocol describes a methodology to capture proteins tagged with His6-3x FLAG explicitly for the purpose of on-bead digestion and identification by mass spectrometry. The high sensitivity and specificity of our methods allow for purification of proteins expressed at native levels from endogenous promoters to enable uncovering the functional roles of plant protein complexes.
Keywords: Tandem affinity purification Mass spectrometry Arabidopsis thaliana Protein purification
Background
Protein complexes function as signaling platforms, molecular machines, and scaffolds upon which cellular life is built. Identification of protein-protein interaction (PPI) or the composition of a protein complex is of enormous importance to provide insight into the biochemical function of genes. Therefore, facile and robust methods for discovering PPI are required to understand how genotype determines phenotype in plants.
Commonly used protein purification methods involve chromatography, such as size-exclusion chromatography (also known as gel filtration), ion exchange chromatography and affinity chromatography. Combining several different chromatographic approaches is often required to reach sufficient purity to identify relevant complexes. Recently, affinity purification coupled with mass spectrometry (AP-MS) has emerged as a powerful biochemical approach of systematically identifying in vivo protein-protein associations. By fusing one (for one-step AP-MS) or two (for tandem AP-MS) affinity tags to a protein that serves as a bait, one can simultaneously isolate the bait protein and co-purify any proteins directly or indirectly associated with the bait from crude protein extracts. One-step AP-MS method can suffer a high false positive rate because of many sticky or highly abundant contaminating proteins. The tandem AP-MS method leverages an additional affinity purification step to increase selectivity, further filter out contaminants, and simultaneously enrich for captured complexes. Several affinity tags have been widely used, such as the FLAG peptide (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) and polyhistidine (e.g., His6), each of which has different binding capacity and methods of elution, resulting in different yields and purity (Lichty et al., 2005). It is noteworthy that AP-MS has its limitations, such as different tags or combinations may lead to distinct group of non-specific interactors (false positives), long protocols may lead to loss of weakly associate partners (false negatives), and AP-MS cannot distinguish direct from indirect interaction. For more information on comparing different PPI techniques, as well as challenges or limits of those approaches, we would like to point to several in-depth reviews (Van Leene et al., 2008; Fukao, 2012; Braun et al., 2013; LaCava et al., 2015).
We have developed a methodology for tandem-affinity purification for use in plants that is designed for the specific identification of protein complexes by mass spectrometry (Huang et al., 2016a and 2016b). We fused a His6-3x FLAG tandem affinity tag to the C-terminus of the bait protein, transformed the construct expressing the fusion protein into the model plant Arabidopsis thaliana by the floral dipping method (Zhang et al., 2006), and conducted tandem AP-MS to identify associated proteins using this methodology. The pB7HFC3.0 construct we used for cloning and expressing the fusion protein has been described (Huang et al., 2016a; 2016b; 2016c). We choose the FLAG purification over other affinity purification methods as the first purification step. This is because FLAG antibodies have low background in Arabidopsis thaliana, and by applying excessive free FLAG peptides, we can elute off FLAG-tagged proteins from beads in gentle, non-denaturing conditions. We then used Cobalt beads to bind His6-tagged proteins present in the FLAG eluates since the high binding capacity of Cobalt beads facilitates the enrichment, FLAG elution peptide removal, and further cleanup of all His6-tagged proteins from the first purification step. The tandem AP-MS protocol using the His6-3x FLAG tag was previously shown able to be sensitive and selective enough to identify protein complexes expressed at near native levels in Arabidopsis thaliana seedlings (Huang et al., 2016a).
Materials and Reagents
125 mm Qualitative Whatman paper (GE Healthcare, catalog number: 1001125 )
2 ml Seal-Rite microcentrifuge tubes (USA Scientific, catalog number: 1620-2700 )
P1000 pipet tip
50 ml centrifuge tubes (VWR, catalog number: 89039-658 )
Oak Ridge centrifuge tubes, 50 ml (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3118-0050 )
15 ml conical tubes (VWR, catalog number: 89039-666 )
0.45 µm PVDF syringe filters with luer lock (EMD Millipore, catalog number: SLHVM33RS )
Serological pipets
1.5 ml tube
1.7 ml Low Retention microtubes (PHENIX Research Products, catalog number: MAX-715L )
0.22 µm PVDF syringe filters with luer lock (EMD Millipore, catalog number: SLGV033RS )
15 cm plates (VWR, catalog number: 25384-326 )
30 ml syringe (BD, Luer-LokTM, catalog number: 302832 )
5 ml syringe (BD, catalog number: 305855 )
3.2 mm stainless steel balls (Bio Spec Products, catalog number: 11079132ss )
Arabidopsis seedlings (Col-0 ecotype) containing transgenes that express His6-3x FLAG epitope tagged proteins (Huang et al., 2016a; 016b; 2016c)
Liquid N2 for flash freezing samples
Dry Ice to maintaining samples cold
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: 10837091001 )
Isopropanol
Protease inhibitor tablets, EDTA-free (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88266 )
Phosphatase inhibitor cocktail 2 (Sigma-Aldrich, catalog number: P5726 )
MG-132 (Peptides International, catalog number: IZL-3175-v )
Phosphatase inhibitor 3 (Sigma-Aldrich, catalog number: P0044 )
Dynal Talon Magnetic beads (Thermo Fisher Scientific, NovesTM, catalog number: 10104D )
M2 anti-FLAG antibody (Sigma-Aldrich, catalog number: F1804 )
Dynal Protein G Magnetic beads (Thermo Fisher Scientific, NovesTM, catalog number: 10003D )
3x FLAG elution buffer
3x FLAG peptide (Sigma-Aldrich, catalog number: F4799 )
Murashige and Skoog medium (MP BIOMEDICALS, catalog number: 092610024 )
Agar (Sigma-Aldrich, catalog number: A1296 )
Sodium phosphate monobasic dehydrate (NaH2PO4·H2O) (Sigma-Aldrich, catalog number: 71505 )
Sodium phosphate dibasic dehydrate (Na2HPO4·H2O) (Sigma-Aldrich, catalog number: 71662 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
EDTA (Sigma-Aldrich, catalog number: EDS )
EGTA (Sigma-Aldrich, catalog number: E3889 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
Ammonium bicarbonate (Sigma-Aldrich, catalog number: A6141 )
ddH2O
½x MS-agar media (see Recipes)
SII buffer (store at 4 °C) (see Recipes)
SII+ buffer (make fresh) (see Recipes)
FLAG to His buffer (store at 4 °C) (see Recipes)
Ammonium bicarbonate buffer (make fresh) (see Recipes)
3x FLAG peptide (store at -80 °C) (see Recipes)
Equipment
Autoclave
Retsch 400 mixer mill (Retsch, model: 400 Mixer Mill )
Retsch mixer mill adapter racks for single use tubes (Retsch, catalog number: 22.008.0008 )
35 ml grinding jars with 20 mm stainless steel balls (referred as ‘ball mill’ hereafter) (Retsch, catalog numbers: 01.462.0214 , 05.368.0062 )
Growth chamber for seedlings (Geneva Scientific, catalog number: CU-36L6 )
Probe sonicator with microtip attachment (Thermo Fisher Scientific, Fisher Scientific, model: 505 )
High speed centrifuge (≥ 20,000 x g) (Beckman Coulter, model: any Avanti J series )
High speed rotor (Beckman Coulter, model: JA-20 )
Microcentrifuge (Eppendorf, model: 5424 )
Swinging bucket centrifuge (Eppendorf, model: 5810 R )
Magnetic stand to capture beads, Dynamag-15 (Thermo Fisher Scientific, catalog number: 12301D )
Magnetic stand to capture beads, Dynamag-2 (Thermo Fisher Scientific, catalog number: 12321D )
Heating mixer (Eppendorf, model: 5355 )
Procedure
Harvest tissue
Grow Arabidopsis seedlings expressing His6-3x FLAG tagged proteins on sterilized Whatman on top of ½x MS 15 cm plates for 10-12 days under specific light conditions.
For small scale experiments (approximately 0.5 g tissue per sample), collect tissue into 2~5 2 ml bullet tubes containing three 3.2 mm stainless steel balls. For large scale affinity purification/mass spectrometry (AP/MS), harvest 5 g tissue per sample in foil and harvest 3 packages (5 g) as replicates.
Label with date, name of tissue, weight, growth conditions (constant light, 12 h light:12 h dark, Short Days, Long Days, constant dark, constant blue, constant red, etc.), and Zeitgeber time.
Freeze in Liquid N2 and store at -80 °C.
Note: Growing seedlings on Whatman facilitates seedling removal while minimizing transfer of growth media. For large scale affinity purification and mass spectrometry (AP/MS), put tissues in a corner of the foil and form a ball, so that it is easy to be broken up and poured into the metal ball mill.
Grind tissue using the Retsch 400 mixer mill
Put Retsch mixer mill adapter racks (for 2 ml tubes) or the 35 ml grinding Jar which contains one 20 mm stainless steel ball (ball mill) into Liquid N2 to cool before use. Carefully put 5 g frozen tissue into the 35 ml grinding Jars using a pre-cooled spatula.
Break up tissue by gently inverting the ball mill (large scale) or by using pre-cooled P1000 tip to crunch tissue in bullet tubes (small scale).
For small scale, grind samples either 4 times at 30 Hz for 45 sec for bullet tubes. For large scale using the ball mill, first grind at 25 Hz for 45 sec to create cushion of tissue in ball mill to prevent damage, then 4 times at 30 Hz for 45 sec.
Cool the ball mill in Liquid N2 between grinding. For 2 ml bullet tubes, open caps once to release pressure inside the tube between each grinding. Also scrape compacted sample off lid with pre-cooled pipet tip to dislodge. During handling, keep grinding jars, adapter racks, holders and tubes in Liquid N2 and work quickly to prevent samples from thawing.
When finished, transfer bullet tubes to dry ice (open once to release pressure), for ball mill transfer powder to 50 ml conical on dry ice.
Continue to the purification steps, or store at -80 °C for up to one month.
Notes:
When handling samples: Use Liquid N2 and dry ice to keep everything cool. Label 50 ml Falcon conical tubes (on both cap and side) for the ground powder (large scale) and put them on dry ice. The grinding process takes ~1 h with clean up, so we grind multiple samples one day before the IP.
If you will go directly from grinding samples into the prep, before grinding preps you should make fresh 100 mM phenylmethylsulfonyl fluoride (PMSF) in isopropanol, add protease inhibitor tablet to buffer SII and thaw the phosphatase inhibitor 2 and MG-132 at RT, (at 4 °C it will freeze again). Do not add into the buffer until you grind tissue into powders. Put all 15 ml, 50 ml Falcon conical tubes, 50 ml centrifugation tubes, long pipet tips, tips with filter into the cold room to cool before use. Put the cross-linked anti-FLAG beads on a roller to fully resuspend (use the magnetic stand to help get beads off the bottom, or just tapping the tube bottom with fingers).
Resuspend ground tissue
Make up SII+ buffer with protease inhibitor tablet (1 mini tablet for 10 ml or 1 tablet up to 50 ml), 1 mM PMSF (100x stock freshly made in isopropanol), 1x phosphatase inhibitors 2&3 (from 100x stocks), 50 µM MG-132 (from 200x,10 mM stock). 30 ml is enough for two packages of 5 g tissue.
Add 1 packed tissue volume of SII+ (typically 500~800 µl for 0.5 g of tissue for small scale or ~12-14 ml for 5 g of tissue) to ground tissue and rotate at 4 °C for 10 min. Do not vortex (you can put a rotator onto a shaker, so that it is resuspended gently).
Note: During this time, label 1.5 ml tubes for quality control steps: Input before FLAG IP/total extraction, FLAG IP flow through, FLAG beads, FLAG elution 1-4 (E1-E4), FLAG elution combined/His IP input, His IP flow through, His beads/Talon beads as well as washes if you want to save. Three low retention tubes are needed for each sample, and they are for: FLAG IP transfer, FLAG IP combined elutes, Talon Dynal beads (His beads, final tube, label well).
Sonicate
Sonicate resuspension twice at 40% amplitude (power) for 20 sec, with 1 sec on/off pulse. Keep the sample tubes on ice between each sonication. For small scale preparations, move resuspended tissue to a new tube to avoid damaging the sonicator tip with the stainless steel beads used for tissue disruption in Liquid N2.
Note: Wear earplugs to protect your ears. Let the sample sit on ice to cool before moving on to the next sonication. Move the 50 ml tubes up and down while sonicating so that the microtip will thoroughly break up any chunks. Also, precool the centrifuge and rotor to 4 °C at this time.
Clarify extract
Spin clarify the samples at ≥ 20,000 x g, 10 min, 4 °C, twice.
Filter the clarified supernatant to remove any chunks with a 0.45 µm filter attached to syringe of adequate size (e.g., 30 ml syringe). The filtered extract goes into a 15 ml conical tube. Note volume.
Save 90 µl for input control.
Measure protein concentration. Usually for 5 g 10-day-old Arabidopsis seedlings, we had a concentration of 5-10 mg/ml. So for large scale, we use a total protein of 75-150 mg.
Pre-wash the crosslinked anti-FLAG Dynal beads
During the second centrifugation, add 900 µl SII buffer without supplements in a tube.
Add 250 µl of crosslinked anti-FLAG Dynal beads (we calculated ~5 µl beads/1 mg of extract [e.g., 250 µl for 5 g tissues]) into the liquid, pipet several times to wash the tip so that all beads go into the solution.
Spin tubes for 1 min at ≥ 1,000 x g to collect solution from caps.
Put beads on magnetic stand Dynamag-2, and wait 1 min for beads being separated from supernatant.
Remove supernatant.
Wash once more with 900 µl SII buffer without supplements, then remove supernatant and add 400 µl SII+ buffer. Keep pre-washed beads sit on ice.
Note: Crosslink 2 µg of M2-FLAG antibody per 60 µl of Protein G beads following instructions in the manual for Dynal Protein G beads.
Begin incubation with anti-FLAG Dynal beads
When ready to incubate beads with extract, put beads on magnetic stand and wait 1 min.
Remove supernatant.
Pipet ~500 µl of extract onto the beads, resuspend, and pipet back all the beads into the 15 ml conical tube, repeat 2 more times to transfer all the beads.
Start the immunoprecipitation (IP) on a rotator for 30 min-1 h, 4 °C.
Note: Preparation during FLAG-IP: prep the 3x FLAG elution buffer. To make 500 µg/ml 3x FLAG peptide in the FLAG to His buffer, pipet 54.5 µl of 33 mg/ml 3x FLAG stock solution into 3.6 ml buffer (3.6 ml gives a little extra volume for two samples’ elution).
Bead capture, washes, and transfer to 1.5 ml low retention tube
Spin tubes for 1 min at ≥ 1,000 x g to collect solution from caps.
Place tubes on magnetic rack Dynamag-15. Wait 2 min.
Remove flow through without disturbing beads. Stick a P1000 pipet tip on end of 14 ml serological pipet to control flow for large scale capture.
Save the flow through for controls.
Wash beads in 10 ml SII buffer (no supplements needed) (≥ 20 bead volumes, so at least 5 ml for large scale or 1 ml for small scale).
Rotate for 5 min.
Spin tubes for 1 min at ≥ 1,000 x g to collect solution from caps.
Place tubes on magnetic rack Dynamag-15. Wait 2 min.
Remove Wash without disturbing beads. Save for controls.
Wash beads in 10 ml SII buffer (no supplements needed).
Rotate for 1 min.
Spin tubes for 1 min at ≥ 1,000 x g to collect solution from caps.
Place tubes on magnetic rack. Wait 2 min.
Remove Wash without disturbing beads. Save for controls.
On the third wash, wash beads off wall with 900 µl FLAG to His buffer.
Transfer beads to a 1.5 ml low retention tube labeled as FLAG IP transfer.
Place tubes on magnetic stand Dynamag-2. Wait 1 min.
Remove Wash without disturbing beads.
Transfer any remaining beads from 15 ml conical to 1.5 ml tube in 900 µl FLAG to His buffer.
Place tubes on magnetic stand Dynamag-2. Wait 1 min.
Remove Wash without disturbing beads.
Repeat washing with 900 µl FLAG to His buffer two more times.
Note: On the third wash, control volume so that you can transfer all beads from 15 ml conical tube to 1.5 ml low retention tube to do the following washes. The FLAG to His buffer has no EDTA/EGTA and less detergent, so it is compatible with Cobalt/Nickel NTA beads.
Elution off the beads
Remove supernatant off beads.
Add 400 µl elution buffer made earlier (FLAG to His buffer + 500 µg/ml [ng/µl] 3x FLAG peptide).
Rotate beads for 15 min at 4 °C.
Spin tubes for 1 min at ≥ 1,000 x g to collect solution from caps.
Place tubes on magnetic stand Dynamag-2. Wait 1 min.
Remove elution without disturbing beads, transfer 1/10 vol to elution 1 (E1) sample tubes, rest to low retention protein tube labeled FLAG IP combined elutes.
Repeat elution at 4 °C for 15 min, save the same amount from the second elution for quality control and put the rest of the 2nd elution to low retention protein tube labeled FLAG IP combined elutes.
Elute another two times with 400 µl elution, rotate beads at 30 °C for 15 min. Save 1/10 of each elution for quality controls and combine the rest of the 3rd and 4th elution to the low retention protein binding tube.
Mix combined elution tube. Remove 1/20 volume to tube for analysis.
Note: During the 2nd~3rd elution, pre-wash Talon Dynal beads (His beads) with FLAG to His buffer (No EDTA or EGTA, since it will strip cobalt off the resin). Use at least ~1/5 volume of beads that you used in FLAG IP, but can go higher if you observe protein in Talon bead flow through. Also, make ≥ 5 ml 25 mM ammonium bicarbonate buffer, prepared fresh. Filter through a 0.22 µm filter.
His IP
Transfer combined eluates to low protein binding tube with washed Talon beads.
Incubate for 20 min, at 4 °C with rotation.
Spin tubes for 1 min at ≥ 1,000 x g to collect solution from caps.
Place tubes on magnetic stand Dynamag-2. Wait 1 min.
Remove Wash without disturbing beads.
Wash with 900 µl FLAG to His buffer by mixing by gently inverting the tube.
Spin tubes for 1 min at ≥ 1,000 x g to collect solution from caps. Then repeat the wash one more time.
Remove the 2nd FLAG to His wash without disturbing beads. Then wash beads with 900 µl 25 mM ammonium bicarbonate buffer and gently invert the tube. Repeat twice as previous washes.
During the last wash with 900 µl 25 mM ammonium bicarbonate buffer, once the beads are completely resuspended by gently inverting the tube, remove 1/10 (90 µl) volume to new tube for quality control.
Spin tubes for 1 min at ≥ 1,000 x g to collect solution from caps.
Place tubes on magnetic stand Dynamag-2. Wait 1 min and then remove all of wash without disturbing beads.
Flash freeze beads in Liquid N2, store in -80 °C.
After His IP, running a Western blot or silver staining to check the quality of the affinity purification. For example, load on 10% SDS-PAGE gel of combined FLAG eluates (serves as an input for His purification), 10% of flow-through/unbound for the His purification, and 10% of His beads after binding. This is to test if the bait protein is well enriched after His purification. A good practice is to also compare protein purifications of your protein of interest to control purifications (using a His6-3x FLAG tagged control protein such as Green Fluorescent Protein) by silver stain (Chevallet et al., 2006) to identify unique bands associated with your protein of interest. Submit protein/beads complex for digestion and sequencing at mass spectrometry facility.
Data analysis
Two to four independent biological replicate affinity purifications should be done to determine reproducibility of mass spectrometry identifications from purifications, as mentioned previously (Huang et al., 2016a and 2016b). All epitope-tagged lines should be checked for functionality prior to use, preferably by complementing characterized mutants (Huang et al., 2016a).
Notes
Wear and change gloves often. The top identified contaminating proteins are keratin and collagen from humans. Do not touch clothes with gloved hands. All the buffers, tips, filters, syringes are kept in cold room and separated from others, and for MS-use only.
Other than when specified, all the work should be done in the cold room with ice bucket.
The use of non-carbohydrate based resins, such as the polystyrene paramagnetic Dynal beads, will reduce background from plant tissues.
Refer to the resin manufactures specifications for information about buffer, salt and detergent compatibility.
Recipes
½x MS-agar media (1 L)
2.205 g Murashige and Skoog medium
7 g agar
Autoclave, and dispense ~40 ml per 15 cm dish
SII buffer, store at 4 °C
100 mM Na-Phosphate, pH 8.0
150 mM NaCl
5 mM EDTA
5 mM EGTA
0.1% Triton X-100
Filter through a 0.22 µm filter to sterilize
SII+ buffer (make fresh)
Note: Add following supplements to SII buffer above just before use.
1 mM phenylmethylsulfonyl fluoride
1x protease inhibitor mix
1x phosphatase inhibitor II
1x phosphatase inhibitor III
50 µM MG-132
FLAG to His buffer (store at 4 °C)
100 mM Na-Phosphate, pH 8.0
150 mM NaCl
0.05% Triton X-100
Filter through a 0.22 µm filter to sterilize
Ammonium bicarbonate buffer (make fresh)
25 mM ammonium bicarbonate in ddH2O, made fresh, then filter through a 0.22 µm filter to sterilize
3x FLAG peptide (store at -80 °C)
≥ 33 mg/ml MDYKDHDGDYKDHDIDYKDDDDK resuspended in phosphate buffer, pH 8.0
Acknowledgments
The Nusinow lab acknowledges support by the National Science Foundation (IOS 1456796). This protocol was adapted from Huang et al., 2016a.
References
Braun, P., Aubourg, S., Van Leene, J., De Jaeger, G. and Lurin, C. (2013). Plant protein interactomes. Annu Rev Plant Biol 64: 161-187.
Chevallet, M., Luche, S. and Rabilloud, T. (2006). Silver staining of proteins in polyacrylamide gels. Nat Protoc 1(4): 1852-1858.
Fukao, Y. (2012). Protein-protein interactions in plants. Plant Cell Physiol 53(4): 617-625.
Huang, H., Alvarez, S., Bindbeutel, R., Shen, Z., Naldrett, M. J., Evans, B. S., Briggs, S. P., Hicks, L. M., Kay, S. A. and Nusinow, D. A. (2016a). Identification of evening complex associated proteins in Arabidopsis by affinity purification and mass spectrometry. Mol Cell Proteomics 15(1): 201-217.
Huang, H., Alvarez, S. and Nusinow, D. A. (2016b). Data on the identification of protein interactors with the Evening Complex and PCH1 in Arabidopsis using tandem affinity purification and mass spectrometry (TAP-MS). Data Brief 8: 56-60.
Huang, H., Yoo, C. Y., Bindbeutel, R., Goldsworthy, J., Tielking, A., Alvarez, S., Naldrett, M. J., Evans, B. S., Chen, M. and Nusinow, D. A. (2016c). PCH1 integrates circadian and light-signaling pathways to control photoperiod-responsive growth in Arabidopsis. Elife 5: e13292.
LaCava, J., Molloy, K. R., Taylor, M. S., Domanski, M., Chait, B. T. and Rout, M. P. (2015). Affinity proteomics to study endogenous protein complexes: pointers, pitfalls, preferences and perspectives. Biotechniques 58(3): 103-119.
Lichty, J. J., Malecki, J. L., Agnew, H. D., Michelson-Horowitz, D. J. and Tan, S. (2005). Comparison of affinity tags for protein purification. Protein Expr Purif 41(1): 98-105.
Van Leene, J., Witters, E., Inze, D. and De Jaeger, G. (2008). Boosting tandem affinity purification of plant protein complexes. Trends Plant Sci 13(10): 517-520.
Zhang, X., Henriques, R., Lin, S. S., Niu, Q. W. and Chua, N. H. (2006). Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat Protoc 1(2): 641-646.
Copyright: Huang and Nusinow. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Huang, H. and Nusinow, D. A. (2016). Tandem Purification of His6-3x FLAG Tagged Proteins for Mass Spectrometry from Arabidopsis. Bio-protocol 6(23): e2060. DOI: 10.21769/BioProtoc.2060.
Huang, H., Yoo, C. Y., Bindbeutel, R., Goldsworthy, J., Tielking, A., Alvarez, S., Naldrett, M. J., Evans, B. S., Chen, M. and Nusinow, D. A. (2016c). PCH1 integrates circadian and light-signaling pathways to control photoperiod-responsive growth in Arabidopsis. Elife 5: e13292.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,061 | https://bio-protocol.org/exchange/protocoldetail?id=2061&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Reactive Oxygen Species in Oryza sativa L. (Rice)
NK Navdeep Kaur
IS Isha Sharma
KK Kamal Kirat
PP Pratap Kumar Pati
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2061 Views: 21504
Reviewed by: Pooja Saxena
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Superoxide ions (O2-) and hydrogen peroxide (H2O2) are the reactive oxygen species (ROS) that play a significant role in regulation of many plant processes. The level of O2- ions is determined qualitatively using nitrobluetetrazolium (NBT) assay while the H2O2 is qualitatively estimated using 3,3-diaminobenzidine (DAB) and 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) assay. Further the aqueous content of H2O2 is estimated quantitatively using ferrous oxidation-xylenol orange (FOX) assay.
Keywords: Rice Reactive oxygen species Superoxide Hydrogen peroxide Nitrobluetetrazolium 3,3-diaminobenzidine
Background
Superoxide ions (O2-) and hydrogen peroxide (H2O2) are the vital reactive oxygen molecules that play a central role in many processes involved in plant growth and development including abiotic stress tolerance. To get better insights into the ROS mediated regulation of these processes, qualitative and quantitative estimation of different types of ROS is of significant importance. O2- is produced by the transfer of electrons from NADPH to oxygen (O2) mediated by the NADPH oxidase enzyme system. These ions are estimated in rice seedlings using NBT assay which is based upon the principle of reduction of yellow coloured NBT into dark blue coloured insoluble formazan by O2- (Kaur et al., 2016).
H2O2 is another reactive oxygen molecule that acts as an important signaling molecule regulating different plant processes. The content of H2O2 is estimated qualitatively in rice seedlings using DAB and H2DCFDA assay (Kaur et al., 2016). DAB assay is based upon the principle of formation of deep brown polymerization product on the reaction of DAB with H2O2 while H2DCFDA assay is based upon the principle of fluorescent microscopy. When non fluorescent H2DCFDA binds to ROS (predominantly H2O2), it gets converted into highly fluorescent 2’,7’-dichlorofluorescein (DCF). DCF gives a green coloured fluorescence when excited with a laser beam of excitation 488 nm using confocal microscope. Further, the quantitative measurement of aqueous H2O2 is carried out using ferrous oxidation-xylenol orange (FOX) method (Kaur et al., 2016). FOX assay is based upon the principle of oxidation of ferrous ions by H2O2 to ferric ions. Ferric ions then bind with xylenol orange to give a coloured complex having absorption maxima at 560 nm.
Materials and Reagents
Petri dish (35 mm) (Tarsons, catalog number: 460035 )
Microscopic glass slides
Glue or nail enamel
Whatman filter paper No.1 (Thermo Fisher Scientific, Fisher Scientific, catalog number: 09-805 )
Amber Eppendorf (Capacity: 2 ml) (Tarsons, catalog number: 500013 )
Glass tubes
Tubes (Capacity:15 ml and 50 ml) (Tarsons, catalog numbers: 546021 [15 ml]; 546041 [50 ml])
Disposable cuvettes (Sigma-Aldrich, catalog number: Z330361 )
Note: This product has been discontinued.
Leaf of 14 days old fresh rice seedlings
Tri-sodium citrate dihydrate (HiMedia Laboratories, catalog number: RM1415 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Absolute ethanol
Activated charcoal (HiMedia Laboratories, catalog number: PCT1001 )
Trichloroacetic acid (Sigma-Aldrich, catalog number: T6399 )
Liquid nitrogen
30 % hydrogen peroxide solution (H2O2) (Sigma-Aldrich, catalog number: H1009 )
Hydrochloric acid (HCl) (Molychem, catalog number: 23540 )
Diaminobenzidine (DAB) (Sigma-Aldrich, catalog number: D8001 )
Nitrobluetetrazolium (NBT) (HiMedia Laboratories, catalog number: MB107 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 1310-73-2 )
2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D399 )
Dimethyl sulphoxide (Minimum assay: 99.0%) (S D Fine-Chem, catalog number: 38216 )
Ammonium ferrous sulfate (HiMedia Laboratories, catalog number: GRM1026 )
Sulfuric acid (HiMedia Laboratories, catalog number: AS016 )
Xylenol orange (LobaChemie, catalog number: 06507 )
Methanol (HPLC grade) (Minimum Assay: 99.7%) (HiMedia Laboratories, catalog number: AS061 )
Butylated hydroxytoluene (HiMedia Laboratories, catalog number: GRM797 )
NBT solution (see Recipes)
DAB solution (see Recipes)
H2DCFDA solution (see Recipes)
Ferrous oxidation-xylenol orange (FOX) reagent (see Recipes)
Standard H2O2 solutions (see Recipes)
Equipment
Pipette (Corning, model: Lambda Plus)
Vacuum infiltration equipment (Dessicator connected to vacuum pump) (Vacuum pump: Rocker 300 , Rocker Scientific, model: Rocker 300]; Dessicator vacuum: tarsons 403010 [Tarsons, model: 403010 ] )
Water bath (Polyscience, model: WB02S )
Stereomicroscope (Olympus, model: SZ61 )
Confocal microscope (Nikon A1R, Laser scanning confocal microscope system)
Centrifuge (REMI, model: C-24 PLUS )
Spectrophotometer (PerkinElmer, model: Lambda 25 )
Note: This product has been discontinued.
Weighing balance (Citizen Scale, model: CY220 )
pH meter (Systronics, model: µ361 )
Pestle mortar
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kaur, N., Sharma, I., Kirat, K. and Pati, P. K. (2016). Detection of Reactive Oxygen Species in Oryza sativa L. (Rice). Bio-protocol 6(24): e2061. DOI: 10.21769/BioProtoc.2061.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,062 | https://bio-protocol.org/exchange/protocoldetail?id=2062&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Affinity Pulldown of Biotinylated RNA for Detection of Protein-RNA Complexes
Amaresh C Panda
J Jennifer L. Martindale
MG Myriam Gorospe
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2062 Views: 24111
Edited by: Antoine de Morree
Reviewed by: Xiaoyi ZhengEmily Cope
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
RNA-binding proteins (RBPs) have recently emerged as crucial players in the regulation of gene expression. The interactions of RBPs with target mRNAs control the levels of gene products by altering different regulatory steps, including pre-mRNA splicing and maturation, nuclear mRNA export, and mRNA stability and translation (Glisovic et al., 2008). There are several methodologies available today to identify RNAs bound to specific RBPs; some detect only recombinant molecules in vitro, others detect recombinant and endogenous molecules, while others detect only endogenous molecules. Examples include systematic evolution of ligands by exponential enrichment (SELEX), biotinylated RNA pulldown assay, RNA immunoprecipitation (RIP) assay, electrophoretic mobility shift assay (EMSA), RNA footprinting analysis, and various UV crosslinking and immunoprecipitation (CLIP) methods such as CLIP, PAR-CLIP, and iCLIP (Popova et al., 2015). Here, we describe a simple and informative method to study and identify the RNA region of interaction between an RBP and its target transcript (Panda et al., 2014 and 2016). Its reproducibility and ease of use make this protocol a fast and useful method to identify interactions between RBPs and specific RNAs.
Keywords: Tagged RNA RNA-binding proteins Ribonucleoprotein complex Biotin pulldown in vitro transcription
Background
RNA-protein interactions critically influence gene expression patterns. The identification of these ribonucleoprotein (RNP) complexes is essential for understanding the regulatory mechanisms governed by RNA-binding proteins (RBPs). Recently, extensive efforts have led to the development of methods for systematic analysis of RNA-protein interactions. Highly informative methods to identify RNP complexes include a number of different types of RNP immunoprecipitation (IP) analyses. RIP methods involve RNP IP without crosslinking, while CLIP methods involve crosslinking of the RNP before IP. While RIP is fast, inexpensive, and capable of assessing many endogenous RBPs and RNAs, it does not typically permit the identification of the precise RNA region that interacts with the RBP. CLIP analysis (including its variant forms HITS-CLIP, PAR-CLIP, and iCLIP) does allow the discovery of the precise RNA sequences that interact with an RBP, as it includes an RNase step that digests all unprotected RNA and yields the RNA bound to the RBP. However, CLIP analysis is costly, time-consuming, and technically challenging (Panda et al., 2016). Therefore, alternatives to testing the binding of endogenous proteins to RNAs of interest are needed.
The biotinylated RNA-pulldown method described here theoretically works for all RBPs, as this assay is performed in a cell-free system. The method involves the in vitro synthesis of RNAs of interest in the presence of biotinylated CTP; the RNA tagged in this manner is then incubated with a cell-free system to allow RBPs to recognize RNA regions to which it has affinity, while regions without affinity do not interact with RBPs. After the binding is complete, the biotinylated RNA is pulled down using streptavidin-coated beads and the RBPs are typically detected by Western blot analysis. This method can be used to map the RNA sequence with which the RBP interacts if the user tests progressively smaller RNA fragments in a systematic fashion, as described here. Furthermore, this method allows for the identification of all of the proteins that interact with the RNA of interest if the biotin-RNA pulldown is followed by mass spectroscopy. In summary, this approach can successfully identify the interaction of an endogenous (or recombinant) RBP with in vitro-synthesized RNAs of interest.
Materials and Reagents
ThermoGridTM rigid strip 0.2-ml PCR tubes (Denville Scientific, catalog number: C18064 [1000859])
Posi-Click 1.7-ml microcentrifuge tube (Denville Scientific, catalog number: C2171 )
1.5-ml tubes
10-cm dishes
NucAway spin columns (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM10070 )
Disposable cuvettes, 1.5-ml (Stockwell Scientific, catalog number: 2410 )
Nuclease-free water (Thermo Fisher Scientific, AmbionTM, catalog number: AM9930 )
cDNA prepared from total RNA
DreamTaq DNA polymerase (5 U/µl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EP0701 )
dNTP mix (10 mM each) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0193 )
Agarose LE (Denville Scientific, catalog number: CA3510-8 )
QIAquick Gel Extraction Kit (50) (QIAGEN, catalog number: 28704 )
MEGAshortscriptTM T7 Kit with manual (for RNA shorter than 0.5 Kb) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM1354 )
RiboLock RNase inhibitor (40 U/µl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EO0381 )
Biotin-14-CTP (Thermo Fisher Scientific, InvitrogenTM, catalog number: 19519-016 )
MEGAscript® T7 Transcription Kit (*for RNA longer than 0.5 Kb) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM1333 )
Novex® TBE-urea gels, 6% (Thermo Fisher Scientific, InvitrogenTM, catalog number: EC6865BOX )
1x TBE buffer
Dulbecco’s phosphate-buffered saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14040-133 )
cOmplete protease inhibitor cocktail (Sigma-Aldrich, catalog number: 11697498001 )
2x Laemmli sample buffer (Bio-Rad Laboratories, catalog number: 1610737 )
Dynabeads® M-280 streptavidin (Thermo Fisher Scientific, InvitrogenTM, catalog number: 11205D )
2-mercaptoethanol (β-mercaptoethanol/BME)
10x Tris/glycine/SDS running buffer (Bio-Rad Laboratories, catalog number: 1610732 )
4-20% Mini-PROTEAN® TGX Stain-FreeTM protein gels (Bio-Rad Laboratories, catalog number: 4568094 )
Ethidium bromide solution (Sigma-Aldrich, catalog number: E1510 )
SpectraTM multicolor broad range protein ladder (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 26634 )
Bio-Rad protein assay dye reagent concentrate (Bradford reagent) (Bio-Rad Laboratories, catalog number: 500-0006 )
Tris-HCl (pH 8.0)
KCl
MgCl2
Nonidet P-40
EDTA
NaCl
Triton X-100
Polysome extraction buffer (PEB) (see Recipes)
2x Tris, EDTA, NaCl, Triton (TENT) buffer (see Recipes)
1x TENT (see Recipes)
Equipment
PCR strip tube rotor, mini centrifuge C1201 (Denville Scientific, catalog number: C1201-S [1000806])
Veriti® 96-Well thermal cycler (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4375786 )
Ultraviolet transilluminator
NanoDrop One spectrophotometer (Thermo Fisher Scientific, Thermo Scientific, catalog number: ND-ONE-W )
Eppendorf Thermomixer® R (Eppendorf, catalog number: 022670581 )
Incubator
Vortexer
Cell scrapers
Refrigerated centrifuge (Eppendorf, model: 5430R )
SmartSpec Plus spectrophotometer (Bio-Rad Laboratories, catalog number: 1702525 ) or other spectrophotometer with 595 nm wavelength
MagneSphere(R) stand (Promega, catalog number: Z5342 )
Trans-Blot® TurboTM transfer starter system (Bio-Rad Laboratories, catalog number: 1704155 )
Mini-PROTEAN® Tetra vertical electrophoresis cell (Bio-Rad Laboratories, catalog number: 1658004 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Panda, A. C., Martindale, J. L. and Gorospe, M. (2016). Affinity Pulldown of Biotinylated RNA for Detection of Protein-RNA Complexes. Bio-protocol 6(24): e2062. DOI: 10.21769/BioProtoc.2062.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Molecular Biology > RNA > RNA-protein interaction
Molecular Biology > Protein > Detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,063 | https://bio-protocol.org/exchange/protocoldetail?id=2063&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Infection of Nicotiana benthamiana Plants with Potato Virus X (PVX)
EA Emmanuel Aguilar
FT Francisco J. del Toro
BC Bong-Nam Chung
TC Tomás Canto
FT Francisco Tenllado
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2063 Views: 15474
Edited by: Arsalan Daudi
Reviewed by: Tie Liu
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Potato Virus X (PVX) is the type member of Potexvirus genus, a group of plant viruses with a positive-strand RNA genome (~6.4 kb). PVX is able to establish compatible infections in Nicotiana benthamiana, a commonly used host in plant virology, leading to mild symptoms, such as chlorotic mosaic and mottling. PVX has been widely used as a viral vector for more than two decades (Chapman et al., 1992; Baulcombe et al., 1995; Aguilar et al., 2015). It provides a feasible means for the systemic expression in plants of heterologous proteins, such as avirulence factors, proteins with pharmacological properties, etc., (Hammond-Kosack et al., 1995; Gleba et al., 2014), and also as a tool to help decipher the function of genes in plants by virus-induced gene silencing (VIGS) (Lacomme and Chapman, 2008). Two different protocols, i.e., rubbing (A) and agroinfiltration (B), that allow efficient multiplication and propagation of PVX in N. benthamiana are described here in detail. The rubbing method requires previously infected sap, and infection is achieved by inducing mechanical damages to leaf tissue, allowing viral particles to penetrate the plant surface. Agroinfiltration needs previously modified Agrobacterium to carry and deliver T-DNA with PVX sequences into the plant cell. Agrobacterium is grown until saturation and infection is established by infiltrating it into plant tissue with a syringe. Any of these two methods can be successfully applied, and the choice should be based mainly on the availability of material and time, but it is recommended to use agroinfiltration when chimeric viruses are being used.
Keywords: Potato Virus X Inoculation Agroinfiltration Heterologous protein expression Virus-induced gene silencing Gene function
Background
PVX is transmitted by mechanical means, so the easiest and fastest way to infect plants is by rubbing the leaves with sap from infected tissue. However, since RNA viruses have high mutation rates, caution must be taken when rubbing is used as propagation method. In this regard, the number of serial passages between plants should be limited, and the inoculum should be used fresh from original stocks. To solve this inconvenience, an infectious PVX cDNA clone has been introduced into a binary T-DNA vector, which allows its easy delivery into N. benthamiana by Agrobacterium tumefaciens. Agroinfiltration should be considered as preferred method when recombinant PVX is being used, in order to prevent serial propagation of deleted viral forms from a previous experiment to the next one (Chung et al., 2007).
Materials and Reagents
Rubbing
2 ml safe-lock tubes (Eppendorf, catalog number: 022363352 )
Note: This product has been discontinued.
Latex powder-free gloves (Staples, Ambitex®, catalog number: SS2072105 )
Gauze (Fisaude. Kinefis, catalog number: 10901 )
N. benthamiana plants at the stage of 4-6 fully expanded true leaves (see Figure 1)
Flash frozen, infected tissue (PVX virus inoculum from DSMZ Plant Virus Collection, Reference No.: 15649, DSMZ No.: PV-0847, Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures)
Liquid nitrogen
Ice
Sodium dihydrogen phosphate (NaH2PO4) (EMD Millipore, catalog number: 106346 )
Di-sodium hydrogen phosphate (Na2HPO4) (EMD Millipore, catalog number: 106559 )
Abrasive carborundum powder (CARLO ERBA Reagents, catalog number: 434786 )
Sodium phosphate buffer (see Recipes)
Agroinfiltration
Petri dishes (Gosselin, catalog number: BP93B-102 )
50 ml conical centrifuge tubes (Corning, Falcon®, catalog number: 352070 )
13 ml centrifuge tubes (SARSTEDT, catalog number: 62.515.006 )
1 ml syringes, without needle (BD, catalog number: 309659 )
10 ml sterile pipettes (Corning, Falcon®, catalog number: 357551 )
N. benthamiana plants (at the 4-6 leaves stage, see Figure 1)
Agrobacterium tumefaciens (any disarmed strain, like GV3101) carrying a T-DNA binary vector with a full-length cDNA clone of PVX (Chapman et al., 1992; Lu et al., 2003, see Notes)
Agrobacterium tumefaciens (any disarmed strain, like GV3101) carrying the empty T-DNA binary vector, as control
Magnesium chloride (MgCl2) (EMD Millipore, catalog number: 105833 )
2-morpholinoethanesulfonic acid (MES) (SERVA Serving Scientists, catalog number: 29834 )
3’,5’-dimethoxy-4’-hydroxyaceto-phenone (Acetosyringone) (Sigma-Aldrich, catalog number: D134406 )
Dimethyl sulfoxide (DMSO) (EMD Millipore, catalog number: 102952 )
Tryptone (BD, BactoTM, catalog number: 211705 )
Yeast extract (Conda, catalog number: 1702 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: 106404 )
American bacteriological agar (Conda, catalog number: 1802 )
Appropriate, selective antibiotics (Kanamycin and tetracycline) (Sigma-Aldrich, catalog numbers: K1377 , 87128 )
Induction buffer (see Recipes)
LB liquid medium supplemented with appropriate antibiotics (see Recipes)
LB/agar medium supplemented with appropriate antibiotics (see Recipes)
Western blot detection
1.5 ml safe-lock tubes (Eppendorf, catalog number: 0030120086 )
Polyvinyl PVDF membrane (GE Healthcare, catalog number: 10600023 )
Tris-hydroxymethyl-aminomethane (Tris) base (EMD Millipore, catalog number: 108386 )
Hydrochloric acid (HCl) (Hydrochloric acid 37%) (EMD Millipore, catalog number: 100317 )
Ethylenediaminetetraacetic acid (EDTA) (EMD Millipore, catalog number: 324503 )
Lithium chloride (LiCl) (EMD Millipore, catalog number: 105679 )
β-mercaptoethanol solution (EMD Millipore, catalog number: 805740 )
Sodium dodecyl sulfate (SDS) (EMD Millipore, catalog number: 817034 )
Bromophenol Blue (BPB) (Sigma-Aldrich, catalog number: 114391 )
Glycerol (Glycerol 87% solution) (EMD Millipore, catalog number: 104094 )
3-hydroxy-4-(2-sulfo-4-[4-sulfophenylazo] phenylazo)-2,7-naphthalenedisulfonic acid sodium salt (Ponceau S) (Sigma-Aldrich, catalog number: P3504 )
Acetic acid (Acetic acid glacial 100% solution) (EMD Millipore, catalog number: 100063 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: 116224 )
Potassium dihydrogen phosphate (KH2PO4) (Sigma-Aldrich, catalog number: 60230 )
Potassium chloride (KCl) (EMD Millipore, catalog number: 104936 )
Acrylamide (30% Acrylamide/Bis solution, 37.5:1) (Bio-Rad Laboratories, catalog number: 1610158 )
Rabbit anti-PVX CP antibody (LOEWE Biochemica, catalog number: 07037 )
Goat anti-rabbit antibody conjugated with AP (Sigma-Aldrich, catalog number: A3687 )
SigmaFastTM BCI/NBT tablets (Sigma-Aldrich, catalog number: B5655 )
Protein extraction buffer for Western blot (see Recipes)
2x Laemmli solution for western blot (see Recipes)
Ponceau S solution (see Recipes)
Blocking solution (see Recipes)
10x PBS, pH 7.4 (see Recipes)
Equipment
Common equipment
Plant growth chambers (SANYO Electronic) at 24 °C, 2,500 lux of daylight intensity, 16 h/8 h day/night photoperiod
P1000 , P200 and P20 micropipettes (Gilson, Pipetman ClassicTM)
Rubbing
Mortar and pestle (Silico & Chemico Porcelain SE)
Refrigerated table microcentrifuge (Hettich Lab Technology, model: Mikro 200R )
Pacisa Weighing Balances (Precisa Gravimetrics, model: XB620C-G )
Agroinfiltration
28 °C incubator for plate culture (JP Selecta, model: 2001258 )
28 °C refrigerated incubator shaker (Eppendorf, New Brunswick Scientific, model: 4330 )
Refrigerated centrifuge for 13 ml tubes (Hettich Lab Technology, model: Universal 320R )
600 nm wavelength-sensitive spectrophotometer (Eppendorf, model: Bio Photometer 6131 000.012 )
Western blot detection
Blue polypropylene, pellet pestles for 1.5 Eppendorf tubes (Sigma-Aldrich, catalog number: Z359947 )
Thermomixer (Eppendorf, catalog number: 5384000012 )
Cork-borer set (Sigma-Aldrich, catalog number: Z165220 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Aguilar, E., del Toro, F. J., Chung, B., Canto, T. and Tenllado, F. (2016). Infection of Nicotiana benthamiana Plants with Potato Virus X (PVX). Bio-protocol 6(24): e2063. DOI: 10.21769/BioProtoc.2063.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Plant Science > Plant immunity > Host-microbe interactions
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,064 | https://bio-protocol.org/exchange/protocoldetail?id=2064&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression, Purification and Crystallization of Recombinant Arabidopsis Monogalactosyldiacylglycerol Synthase (MGD1)
Joana Rocha
Valerie Chazalet
Christelle Breton
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2064 Views: 7877
Edited by: Arsalan Daudi
Reviewed by: Adam Idoine
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
In plant cells, galactolipids are predominant, representing up to 50% of the lipid content in photosynthetic tissues. Galactolipid synthesis is initiated by MGDG synthases (MGDs), which use UDP-galactose as a donor sugar and diacylglycerol (DAG) as acceptor, to form monogalactosyldiacylglycerol (MGDG). This protocol is used to produce a recombinant form of Arabidopsis thaliana (A. thaliana) monogalactosyldiacylglycerol synthase 1 (MGD1) protein, in Escherichia coli (E. coli), using a two-step chromatographic purification procedure. The protein is easily expressed and purified to milligram quantities, suitable for biochemical and structural studies. The crystallization of MGD1 is also described.
Keywords: Photosynthetic tissues Galactolipids Monogalactosyldiacylglycerol Crystallization MGDG synthase
Background
Previous attempts to express plant MGDs in E. coli showed that approximately 99% of the recombinant protein accumulated in inclusion bodies (Miège et al., 1999). Solubilization of bacterial membranes using detergents, or in vitro inclusion bodies refolding protocols were developed and yielded pure and active fractions, sufficient to monitor the activity of the enzyme, but not to pursue its structural study (Nishiyama et al., 2003; Botté et al., 2005). Using a combination of different biochemical and biophysical techniques, and investigating the effects of various buffers and additives on the biochemical behavior of the enzyme, a simple, efficient and fast protocol was developed for the expression and purification of recombinant MGD1, addressing the problems frequently encountered with the purification of glycosyltransferases, particularly protein aggregation (Rocha et al., 2013). Conditions detailed here allowed the unprecedented production of a pure, soluble and active form of MGD1 and comply with both structural and functional dissections of this enzyme (Rocha et al., 2016). The protocol here described can also serve as a starting strategy to purify similar proteins.
Materials and Reagents
50 ml Corning tubes (Corning, catalog number: 430829 )
1.5 ml Eppendorf tubes (Treff, catalog number: 96.07246.9.01 )
30 ml centrifuge tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3138-0030 )
0.2 µm PES-membrane filters (Dominique Dutscher, catalog number: 051732 )
Vivaspin 20, MWCO 30,000 Da concentrators (Sartorius, catalog number: VS2022 )
HisTrap FF 1 ml column (GE Healthcare, catalog number: 17-5319-01 )
Superdex S200 10/300 GL column (GE Healthcare, catalog number: 17-5175-01 )
24-well VDX plate with sealant (HAMPTON RESEARCH, catalog number: HR3-170 )
22 mm cover slips (HAMPTON RESEARCH, catalog number: HR3-233 )
E. coli BL21(DE3) strain (New England Biolabs, catalog number: C2527I )
Luria Broth (LB) media (Thermo Fisher Scientific, InvitrogenTM, catalog number: 12780-052 )
Kanamycin (Euromedex, catalog number: EU0420 )
Isopropyl-β-D-thiogalactopyranoside (IPTG) (Euromedex, catalog number: EU0008 )
Antifoam 204 (Sigma-Aldrich, catalog number: A6426 )
Benzonase® nuclease (Sigma-Aldrich, catalog number: E1014 )
Imidazole (Sigma-Aldrich, catalog number: 56749 )
Ethanol absolute anhydrous (CARLO ERBA Reagents, catalog number: 308607 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M9272 )
PEG 3350 (Sigma-Aldrich, catalog number: 88276 )
Liquid nitrogen (LN2)
Glycerol (Sigma-Aldrich, catalog number: G7757 )
HEPES (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP310 )
Sodium chloride (NaCl) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10553515 )
Urea (Sigma-Aldrich, catalog number: U1250 )
Dithiothreitol (DTT) (Euromedex, catalog number: EU0006 )
cOmpleteTM protease inhibitor cocktail (Roche Diagnostics, catalog number: 11873580001 )
Bis-tris propane (Sigma-Aldrich, catalog number: B6755 )
Tris(2-carboxyethyl)phosphine (TCEP) (Sigma-Aldrich, catalog number: C4706 )
Tris base (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10376743 )
Sodium dodecyl sulfate (SDS) 10% (Euromedex, catalog number: EU0760 )
Bromophenol blue (EMD Millipore, catalog number: 108122 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Hydrochloric acid 37% (CARLO ERBA Reagents, catalog number: 403871 )
Sodium hydroxide (EMD Millipore, catalog number: 1064621000 )
Lysis buffer (see Recipes)
Washing/binding buffer (see Recipes)
Elution buffer (see Recipes)
Size exclusion buffer (see Recipes)
SDS-PAGE deposition buffer (5x DB) (see Recipes)
20% (v/v) ethanol (see Recipes)
6 N hydrochloric acid solution (for pH adjustment) (see Recipes)
10 M sodium hydroxide solution (for pH adjustment) (see Recipes)
Precipitant solution (or mother liquor) (see Recipes)
Equipment
Culture flasks (IDEA Conception, catalog number: ART0004104 )
Note: These are custom made 3 L culture flasks.
Orbital shakers at 30 °C and 37 °C
Incubator at 20 °C (for crystallization plates)
Sonication bath (room temperature)
Lab balances
Cooled centrifuges
Filtration system or syringes
Cell Disruptor CSL ‘One-shot’ (Constant Systems, Ltd)
ÄKTAFPLC instrument (GE Healthcare, catalog number: 18190026 ) or equivalent
SDS-PAGE equipment
Zetasizer Nano ZSTM for Dynamic Light Scattering Analysis (Malvern Instruments, model: ZEN3600 ) or equivalent
BioPhotometer 6131 (Eppendorf, Germany)
NanoDropTM ND-2000 spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: ND-2000 )
Olympus Zoom Stereo microscope (Olympus, model: SZ1145 TR CTV ) or equivalent
Note: This product has been discontinued.
Olympus Transmitted Light Illumination Base (Olympus, model: SZX-ILLK200 ) or equivalent
Note: This product has been discontinued.
Note: Cryocrystallography material for crystals manipulation in liquid nitrogen (LN2)
Litholoops several sizes (Molecular Dimensions)
CryoCaps (Plain) (Molecular Dimensions, catalog number: MD7-400 )
Magnetic CryoVials (Molecular Dimensions, catalog number: MD7-402 )
EMBL/ESRF Sample changer starter kit (Molecular Dimensions, catalog number: MD7-500 )
Magnetic Cryo Wand (Molecular Dimensions, catalog number: MD7-411 )
LN2 foam dewars (Molecular Dimensions, catalog number: MD7-35 )
Dry shipper (CX100) dewar (Molecular Dimensions, catalog number: MD7-21 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rocha, J., Chazalet, V. and Breton, C. (2016). Expression, Purification and Crystallization of Recombinant Arabidopsis Monogalactosyldiacylglycerol Synthase (MGD1). Bio-protocol 6(24): e2064. DOI: 10.21769/BioProtoc.2064.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,065 | https://bio-protocol.org/exchange/protocoldetail?id=2065&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessment of Wheat Resistance to Fusarium graminearum by Automated Image Analysis of Detached Leaves Assay
Alexandre Perochon
Fiona M. Doohan
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2065 Views: 11303
Edited by: Arsalan Daudi
Reviewed by: Malou FraitureBaohua Li
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Fusarium head blight (FHB) caused by Fusarium pathogens is a globally important cereal disease. To study Fusarium pathogenicity and host disease resistance, robust methods for disease assessment and quantification are needed. Here we describe the procedure of a detached leaves assay emphasizing the image analysis. The protocol provides the different steps of a rapid, automatic and quantitative image analysis to evaluate leaf area infected by Fusarium graminearum.
Keywords: Detached leaf assay Disease assessment Fusarium graminearum Image analysis Fiji Pathogenicity Wheat
Background
Evaluation of wheat FHB resistance at the whole plant level is estimated by visual scoring at flowering stage which is laborious, time consuming and requires space. Therefore in vitro methods that expedites disease assessment for FHB resistance at early plant stage have been developed, such as seed germination assay (Browne, 2009), coleoptiles assay (Shin et al., 2014), detached leaf assay (Browne and Cooke, 2004) and seedling assay (Li et al., 2010). Detached leaves assay is commonly used to assess host responses to Fusarium and was successful in identifying components of FHB resistance (Browne and Cooke, 2004). In such assays pathogen establishment is visually assessed which is time-consuming and limits accurate measurement. The method described recently by Perochon et al. (2015) and detailed here resolved these two limitations by using an automatic method that quantifies leaf area infected by image analysis based on particle size.
Materials and Reagents
Petri dish, triple vent 94 x 15mm (Greiner Bio One, catalog number: 633 185 )
Filter paper (Whatman, catalog number: 1001-090 )
Parafilm (Parafilm, catalog number: PM992 )
Plant container pots, 3 L (National Agrochemical Distributors, catalog number: POTS34 )
John Innes compost No. 2 (Westland Horticulture)
Square Petri dish 100 x 100 x 20 mm (SARSTEDT, catalog number: 82.9923.422 )
Glass Pasteur pipette (VWR, catalog number: 14673-010 )
Fusarium graminearum strain GZ3639 (Proctor et al., 1995)
Plant agar (Duchefa, catalog number: P1001.1000 )
Benzimidazole (Stock solution at 500 mM in ethanol stored in aliquots at -20 °C) (Sigma-Aldrich, catalog number: 194123 )
Ethanol (Sigma-Aldrich, catalog number: E7023 )
Tween-20 (Sigma-Aldrich, catalog number: P2287 )
Equipment
Incubator (20 °C)
Glasshouse (Cambridge HOK production glasshouse) (20-22 °C with a 16 h light/8 h dark photoperiod at 300 μmol m-2 s-1 and 70% relative humidity)
Plant growth room (20 °C with a 16 h light/8 h dark photoperiod at 200 μmol m-2 s-1 and 70% relative humidity)
Digital camera (Nikon, model: COOLPIX P500 with a NIKKOR 36X wide optical ZOOM ED VR, 4.0 - 144 mm, 1:3.4 - 5.7)
Copy stand (RPS Studio RS-CS920 copy stand)
Lights (cold-light fluorescent lighting system)
Software
Fiji (http://fiji.sc/)
Note: Fiji is an open source software using the same functionality as ImageJ with many bundled plugins. For that reason the image analysis presented here could be executed with ImageJ.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Perochon, A. and Doohan, F. M. (2016). Assessment of Wheat Resistance to Fusarium graminearum by Automated Image Analysis of Detached Leaves Assay. Bio-protocol 6(24): e2065. DOI: 10.21769/BioProtoc.2065.
Perochon, A., Jianguang, J., Kahla, A., Arunachalam, C., Scofield, S. R., Bowden, S., Wallington, E. and Doohan, F. M. (2015). TaFROG encodes a Pooideae orphan protein that interacts with SnRK1 and enhances resistance to the mycotoxigenic fungus Fusarium graminearum. Plant Physiol 169(4): 2895-2906.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,066 | https://bio-protocol.org/exchange/protocoldetail?id=2066&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative 3D Time Lapse Imaging of Muscle Progenitors in Skeletal Muscle of Live Mice
Micah T. Webster
Tyler Harvey
Chen-Ming Fan
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2066 Views: 10343
Edited by: Antoine de Morree
Reviewed by: Xiaoyi Zheng
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
For non-optically clear mammalian tissues, it is now possible to use multi-photon microscopy to penetrate deep into the tissue and obtain detailed single cell images in a live animal, i.e., intravital imaging. This technique is in principle applicable to any fluorescently marked cell, and we have employed it to observe stem cells during the regenerative process. Stem cell-mediated skeletal muscle regeneration in the mouse model has been classically studied at specific time points by sacrificing the animal and harvesting the muscle tissue for downstream analyses. A method for direct visualization of muscle stem cells to gain real-time information over a long period in a live mammal has been lacking. Here we describe a step-by-step protocol adapted from Webster et al. (2016) to quantitatively measure the behaviors of fluorescently labeled (GFP, EYFP) muscle stem and progenitor cells during homeostasis as well as following muscle injury.
Keywords: Muscle stem cell Muscle progenitor Muscle regeneration Ghost fiber Live imaging Multi-photon microscopy Second harmonic generation
Background
Long-term in vivo imaging of stem and progenitor cells was first used for hair follicles during continuous physiological regeneration without surgical procedure (Rompolas et al., 2012). By contrast, stem cells for skeletal muscles are largely quiescent and inactive during the normal homeostatic state. An injury to the muscle is necessary to activate muscle stem cells to mount a regenerative process. In vitro live imaging of muscle stem/progenitor cells has been widely used to study them in artificial settings. To understand muscle stem cell behavior during regeneration in their native environment, we developed a method to image them during skeletal muscle regeneration. Our method allows up to 8 h of continuous imaging per session daily following injury. This is the first time that skeletal muscle stem cells have been observed in vivo in an injured/regenerative environment (Webster et al., 2016).
Materials and Reagents
Lab tape (VWR, catalog number: 89097 )
Razor blades for shaving hair (VWR, catalog number: 55411-060 )
Kimwipes (ULINE)
Transfer pipette (Globe Scientific, catalog number: 137038 )
Cyanoacrylate based adhesive that bonds skin to glass (i.e., Loctite glass glue; Amazon.com; Scognamiglio et al., 2016)
Mouse with GFP or YFP expression in Pax7-expressing muscle stem cells (or cell types of interest); GFP and YFP Cre-reporter mice and Pax7-Cre-ERT2 mouse strains are available at Jackson Laboratory (THE JACKSON LABORATORY, catalog numbers: 021847 , 006148, and 012476, respectively)
Isoflurane (Patterson Veterinary Supply, IsoFlo®, catalog number: 07-806-3204 ; To be applied directly into the vapor chamber of equipment list 4; indicated by arrow in Figure 2)
EtOH, 70% (Decon Labs, catalog number: V1401 )
Distilled water (in house)
Equipment
An inverted Leica SP5 (or equivalent) equipped with a Leica 25x/0.95 water objective, a 35 mm culture dish holder attached to the stage, and nondescanned detectors with a dichroic mirror separating the detectable spectrum (430-550 nm) at 495 nm (Figure 1)
Figure 1. Inverted Multi-photon setup. The imaging setup includes an inverted confocal microscope with 25x water objective fitted with a culture dish holder, multi-photon laser and computer.
Chameleon Vision laser (Coherent)
Heating pad with enough area to cover the animal on the microscope stage (Sunbeam 756-500 Heating Pad from Amazon.com)
Animal anesthesia system equipped with induction chamber as well as tubing with nose-cone (VetEquip, catalog number: 901806 ). Please consult with the operation manual prior to use
35 mm fluorodish (World Precision Instruments, catalog number: FD35-100 )
Metal spatula (VWR, catalog number: 82027-530 )
Heat protective glove (VWR)
Bunsen burner (VWR, catalog number: 89038-528 )
Laminar flow fume hood
Fine tip forceps (Dumont #5 forceps) (Fine Science Tools, catalog number: 11252-30 )
Fine scissors for cutting skin (straight, 11.5 cm) (Fine Science Tools, catalog number: 14058-11 )
Spring scissors for cutting fascia (8 mm blades) (Fine Science Tools, catalog number: 15009-08 )
Software
Leica SP5 software
Fiji (Fiji is an updated version of ImageJ, an open source image processing software; Schindelin et al., 2012)
Imaris (Bitplane, version 7.6.4 for Windows X64)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Adult stem cell > Muscle stem cell
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,067 | https://bio-protocol.org/exchange/protocoldetail?id=2067&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Determination of Ascorbate from the Green Alga Chlamydomonas reinhardtii by HPLC
László Kovács
André Vidal-Meireles
Valéria Nagy
Szilvia Z. Tóth
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2067 Views: 7971
Edited by: Maria Sinetova
Reviewed by: Claudia Catalanotti
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
Ascorbate (Asc, also called vitamin C) is of vital importance to the cellular functions of both animals and plants. During evolution, Asc has become one of the most abundant metabolites in seed plants; however, Asc contents in cyanobacteria, green algae and bryophytes are very low. Here we describe a sensitive and reliable HPLC method for the quantitative determination of cellular Asc content in the green alga Chlamydomonas reinhardtii.
Keywords: Ascorbate Cell counter Chlamydomonas reinhardtii HPLC Dehydroascorbate
Background
Previous protocols for the determination of cellular Asc content were developed for higher plants, of which the amounts of cellular Asc are high enough for the analysis. Those protocols are not suitable for green algae, since both the amounts of the plant material and the levels of the cellular Asc are usually limited. Therefore, there was a need to develop a novel method with sensitivity improved to the µM range to measure the cellular Asc in green algae.
Materials and Reagents
15-ml conical centrifuge tubes (Corning, Falcon®)
Polypropylene microcentrifuge tubes of 1.5 ml (Eppendorf)
0.3 ml polypropylene chromatographic vials (Focus Technology, model: VP91 ) with polypropylene cap and PTFE/silicone septa (Focus Technology, model: SC9291 )
4 mm hydrophilic PTFE syringe filter with a 0.22 µm pore size (Nantong Filterbio Membrane, catalog number: FBS4PTFE022L )
47 mm hydrophilic PTFE membrane with a 0.45 µm pore size (Nantong Filterbio Membrane, catalog number: FBM047PTFE045L )
Glass beads 212-300 µm (Sigma-Aldrich, catalog number: G9143-250G )
1 ml disposable polypropylene syringe (B. Braun Medical, catalog number: 9166017V )
Millex-GS 33 mm sterile syringe filter with a 0.22 µm pore size (EMD Millipore, catalog number: SLGS033SS )
Milli-Q water
Liquid nitrogen
Tris-(2-carboxyethyl)-phosphine hydrochloride (TCEP) (Carl Roth, catalog number: HN95.2 )
Potassium dihydrogen phosphate (KH2PO4) (Carl Roth, catalog number: 3904.1 )
Orthophosphoric acid (H3PO4) (Sigma-Aldrich, catalog number: W290017 )
EDTA (Sigma-Aldrich, catalog number: EDS-100G )
Sodium chloride (NaCl) (Duchefa Biochemie, catalog number: S0520.1000 )
Potassium chloride (KCl) (Duchefa Biochemie, catalog number: P0515.1000 )
Di-sodium hydrogen phosphate (Na2HPO4) (Carl Roth, catalog number: P030.2 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2393-100g )
Calcium chloride dihydrate (CaCl2·2H2O) (Duchefa Biochemie, catalog number: C0504.1000 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 258148-2.5L-D )
Sodium L-Asc (Sigma-Aldrich, catalog number: 4034-100G )
Acetonitrile HPLC gradient grade (VWR, HiPerSolv Chromanorm®, catalog number: 83639.320 )
Phosphate-buffered saline (PBS) (see Recipes)
Extraction buffer (see Recipes)
HPLC mobile phase A (see Recipes)
HPLC mobile phase B (see Recipes)
Sodium L-Asc standard solutions (see Recipes)
Equipment
ScepterTM handheld automated cell counter (EMD Millipore, catalog number: PHCC00000 )
ScepterTM Sensors – 40 µm (EMD Millipore, catalog number: PHCC40050 )
Refrigerated table centrifuge and microcentrifuge
HPLC system (Shimadzu Scientific Instruments) equipped with:
LC pump (Shimadzu Scientific Instruments, model: LC-20AD )
Thermostated autosampler (Shimadzu Scientific Instruments, model: SIL-20AC )
Photo Diode Array detector (Shimadzu Scientific Instruments, model: SPD-M30A )
Column oven (Shimadzu Scientific Instruments, model: CTO-20AC )
Synergy hydro 4u Hydro – RP 80 Å 250 x 4.6 mm (Phenomenex, catalog number: 00G-4375-E0 ) directly mounted with a guard column AQ C18 4.0 x 3.0 mm (Phenomenex, catalog number: KJ0-4282 )
Software
LabSolution (Shimadzu Scientific Instruments)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kovács, L., Vidal-Meireles, A., Nagy, V. and Tóth, S. Z. (2016). Quantitative Determination of Ascorbate from the Green Alga Chlamydomonas reinhardtii by HPLC. Bio-protocol 6(24): e2067. DOI: 10.21769/BioProtoc.2067.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Biochemistry > Other compound > Ascorbate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,068 | https://bio-protocol.org/exchange/protocoldetail?id=2068&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Mechanical Tension at cell-cell junctions using two-photon laser ablation
Xuan Liang
Magdalene Michael
Guillermo A. Gomez
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2068 Views: 10029
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
The cortical actomyosin cytoskeleton is found in all non-muscle cells where a key function is to control mechanical force (Salbreux et al., 2012). When coupled to E-cadherin cell-cell adhesion, cortical actomyosin generates junctional tension that influences many aspects of tissue function, organization and morphogenesis (Lecuit and Yap, 2015). Uncovering the molecular mechanisms underlying the generation of junctional tension requires tools for measuring it in live cells with a high spatio-temporal resolution. For this, we have set up a technique of laser ablation, in which we use the high power output of a two-photon laser to physically cut the actin cortex at the sites of cell-cell adhesion labeled with E-cadherin-GFP. Tension, thus is visualized as the outwards recoil of the vertices that define a junction after this was ablated/cut. Analysis of recoil versus time allows extracting parameters related to the amount of contractile force that is applied to the junction before ablation (initial recoil) and the ratio between elasticity of the junction and viscosity of the media (cytoplasm) in which the junctional cortex is immersed. Using this approach we have discovered how Src protein-tyrosine kinase (Gomez et al., 2015); actin-binding proteins such as tropomyosins (Caldwell et al., 2014) and N-WASP (Wu et al., 2014); Myosin II (Priya et al., 2015) and coronin-1B (Michael et al., 2016) contribute to the molecular apparatus responsible for generating tension at the cell-cell junctions. This protocol describes the experimental procedure for setting up laser ablation experiments and how to optimize ablation and acquisition conditions for optimal measurements of junctional tension. It also provides a full description, step by step, of the post-acquisition analysis required to evaluate changes in contractile force as well as cell elasticity and/or cytoplasm viscosity.
Keywords: Laser ablation Tension Cell-cell junction Two-photon Viscoelasticity Epithelial cells
Background
Physical tension on junctions has been revealed by a variety of microscopy methods. These include laser ablation (Ratheesh et al., 2012; Smutny et al., 2015; Michael et al., 2016), optical tweezers (Bambardekar et al., 2015), FRET tension sensors (Grashoff et al., 2010; Borghi et al., 2012; Conway et al., 2013; Leerberg et al., 2014) and immunofluorescence for protein epitopes that are revealed under tension (Yonemura et al., 2010). Among these, laser ablation has become the most popular method, as it is easy to implement and provide a direct measurement of mechanical tension compared with other methods (e.g., FRET or immunofluorescence where the evidence for mechanical tension is more indirect). However, special considerations need to be taken to set up these experiments as well as its analysis, which are important for the correct interpretation of results. This protocol, provides the basic steps needed for the setup and optimization of laser ablation experiments in confluent monolayers of epithelial cells as well as a complete description of the image analysis procedure for measurements of initial recoil after ablation, which is an index of junctional tension.
Materials and Reagents
MCF-7 or Caco-2 cells from ATCC®
Note: This protocol can be easily extended to any other endothelial or epithelial cell line with well defined cell-cell junctions like AML12 cells.
Plasmids (or lentivirus) to express a junctional marker like E-cadherin-GFP.
See Bio-protocol e937 by Priya and Gomez (2013) for lentivirus preparation for expression of mouse E-cadherin-GFP in cells knockdown for endogenous human E-cadherin. In this protocol, we describe the transfection of cells for overexpression of E-cadherin-GFP.
Purified plasmid DNA encoding E-cadherin-GFP (Addgene, catalog number: 67937 ) or any other junctional protein like ZO-1 (Addgene, catalog number: 30313 ), vinculin (Addgene, catalog number: 30312 ), MRLC (Addgene, catalog number: 35680 ), or the actin marker Utrophin (Addgene, catalog number: 26737 )
Lipofectamine 3000 and P3000 reagent (Thermo Fisher Scientific, InvitrogenTM, catalog number: L3000015 )
Dulbecco’s modified Eagle’s medium high glucose with stable L-glutamine (DMEM) (Thermo Fisher Scientific, GibcoTM, catalog number: 11995-073 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 26140079 )
PBS without Ca2+ and Mg2+ (Astral Scientific, catalog number: 09-8912-100 )
Opti-MEM media (Thermo Fisher Scientific, GibcoTM, catalog number: 31985070 )
Hank’s balanced salt solution (HBSS) (Sigma-Aldrich, catalog number: H8264 )
CaCl2
Imaging media (see Recipes)
Equipment
Laser scanning confocal microscope, LSM 510 Meta Zeiss confocal microscope (Zeiss, Jena, Germany) equipped with:
An acoustic optical tunable filter (AOTF) for bleaching of selected areas
A heated chamber (37 °C) for live cell imaging
A tunable two-photon laser (700-1100 nm, > 2,000 mW power, Chameleon Laser, Coherent Inc.)
A 30 mW argon laser (458, 488 and 514 nm laser lines)
A 60x objective, 1.4 NA oil Plan Apochromat (Zeiss) immersion lens
Dichroic and emission filters for the use of the 488 nm laser lines and detection of GFP fluorescence
Glass bottom dishes, No. 1.5 Coverslip (35 mm diameter, MATTEK, catalog number: P35G-1.5-20-C or 29 mm diameter, Shengyou Biotechnology, catalog number: D29-10-1.5-N )
Software
ImageJ software (https://imagej.nih.gov/ij/)
Fiji software (http://imagej.net/Fiji)
MTrackJ pluging (http://www.imagescience.org/meijering/software/mtrackj/manual/)
Microsoft Excel (https://products.office.com/en-au/excel)
GraphPad PRISM software (http://www.graphpad.com/scientific-software/prism/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liang, X., Michael, M. and Gomez, G. A. (2016). Measurement of Mechanical Tension at cell-cell junctions using two-photon laser ablation. Bio-protocol 6(24): e2068. DOI: 10.21769/BioProtoc.2068.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Two-photon microscopy
Cell Biology > Cell structure > Cell adhesion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,069 | https://bio-protocol.org/exchange/protocoldetail?id=2069&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bacterial Growth Inhibition Assay for Xanthomonas oryzae pv. oryzae or Escherichia coli K12 Grown together with Plant Leaf Extracts
ML Marco Loehrer
RD Rhoda Delventhal
DW Denise Weidenbach
US Ulrich Schaffrath
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2069 Views: 8392
Edited by: Marisa Rosa
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
We performed a growth inhibition assay to test antibacterial compounds in leaf extracts from transgenic rice plants. The assay is based on over-night co-incubation of a defined concentration of colony forming units (cfu) of the respective bacteria together with aqueous extracts of ground leaf tissue.
Keywords: Crop plant Rice Pathogen Bacteria Antimicrobial Jacalin Lectin Dirigent
Background
Defense of plants against harmful organisms can be specific against particular pathogen species or groups of pathogens. Aiming at increasing pathogen resistance of crop plants, breeding for resistance against particular diseases can be useful but the ultimate goal is to implement broad-spectrum disease resistance. The rice protein OsJAC1 is a modular protein consisting of a jacalin-related lectin domain predicted to bind to sugar residues and a dirigent domain that might act during coupling of monolignols. This fusion protein is specific to Poaceae and represents a novel type of resistance protein. The protocol described here was used to assess the antimicrobial capabilities of leaf extracts from transgenic rice plants overexpressing the OsJAC1 cDNA (Weidenbach et al., 2016). For this assay, the bacterial lab strain Escherichia coli K12 and the bacterial rice pathogen Xanthomonas oryzae pv. oryzae PXO86, causing bacterial blight, were used.
Materials and Reagents
Test tubes for bacterial liquid cultures
Pipettes and sterile tips
Inoculation loops
Safe lock reaction tubes (1.5 and 2.0 ml) (e.g., Eppendorf tubes)
Sterile toothpicks
0.2 µm syringe filter (Sartorius, catalog number: 16532 )
E. coli K12 (standard lab strain)
Xanthomonas oryzae pv. oryzae PXO86 (received from C.M. Vera Cruz, IRRI, Manila, Philippines)
Rice plants, approx. 2-3 weeks old (see Weidenbach et al., 2016)
Sterilized tap water
Liquid nitrogen
Peptone (Duchefa Biochemie, catalog number: P1328 )
Sodium chloride (NaCl) (Carl Roth, catalog number: 3957 )
Yeast extract (Duchefa Biochemie, catalog number: Y1333 )
Agar-agar (Carl Roth, catalog number: 5210 )
Sucrose (Carl Roth, catalog number: 4621 )
Trisodium phosphate (Na3PO4) (Carl Roth, catalog number: 8613 )
Calcium nitrate [Ca(NO3)2] (Carl Roth, catalog number: P740 )
Ferrous sulphate (FeSO4) (Carl Roth, catalog number: P015 )
HCl (Carl Roth, catalog number: 2607 )
LB-medium (see Recipes)
Modified Wakimoto medium (see Recipes)
Ferrous sulphate (FeSO4) stock solution (see Recipes)
Equipment
Laminar flow hood
28 °C Thermo constant incubator
37 °C Thermo constant incubator
37 °C Thermo shaking incubator
-80 °C low temperature freezer
Spectrophotometer and respective cuvettes
Mortar and pestle (e.g., Carl Roth, catalog numbers: 1568 and 3831 )
Autoclave
Benchtop centrifuge (cooled at 4 °C)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Loehrer, M., Delventhal, R., Weidenbach, D. and Schaffrath, U. (2016). Bacterial Growth Inhibition Assay for Xanthomonas oryzae pv. oryzae or Escherichia coli K12 Grown together with Plant Leaf Extracts. Bio-protocol 6(24): e2069. DOI: 10.21769/BioProtoc.2069.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
207 | https://bio-protocol.org/exchange/protocoldetail?id=207&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Culture Mycoplasma Detection by PCR
HP Huan Pang
Published: Apr 20, 2012
DOI: 10.21769/BioProtoc.207 Views: 19858
Download PDF
Ask a question
Favorite
Cited by
Abstract
DNA was extracted from the supernatant of each sample. After PCR-amplification of mycoplasma DNA, detection was performed by gel electrophresis. The PCR primers were designed to cover the consensus sequences that can detect all types of mycoplasma species.
Materials and Reagents
Ampli Taq Gold (Life Technologies, InvitrogenTM, catalog number: 4338856 )
Sodium acetate
Ethanol
Phenol
MgCl2
PCR buffer
Sodium acetate
dNTPs
Agarose gel
TE-saturated phenol
Ethidium bromide
DDW
Stock solution A (see Recipes)
Master mixture A (see Recipes)
Equipment
1.5 ml Eppendorf tube
Centrifuges
Micropipette
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,070 | https://bio-protocol.org/exchange/protocoldetail?id=2070&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Inoculation of Rice with Different Pathogens: Sheath Blight (Rhizoctonia solani), Damping off Disease (Pythium graminicola) and Barley Powdery Mildew (Blumeria graminis f. sp. hordei)
RD Rhoda Delventhal
ML Marco Loehrer
DW Denise Weidenbach
US Ulrich Schaffrath
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2070 Views: 12794
Edited by: Marisa Rosa
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
To prevent yield losses in plant cultivation due to plant pathogens, it is an important task to find new disease resistance mechanisms. Recently, Weidenbach et al. (2016) reported about the capacity of the rice gene OsJAC1 to enhance resistance in rice and barley against a broad spectrum of different pathogens. Here, we describe the respective protocols used by Weidenbach and colleagues for inoculation of rice with the basidiomycete Rhizoctonia solani, the oomycete Pythium graminicola and the ascomycete Blumeria graminis f. sp. hordei (Bgh).
Keywords: Rice Inoculation protocols Fungal plant pathogens Oomycete Rhizoctonia solani Pythium graminicola Blumeria graminis f. sp. Hordei Nonhost resistance
Background
Following the observation that transcripts of the rice gene OsJAC1 accumulated after pathogen attack or treatment with chemical resistance inducers, transgenic rice plants with constitutive expression or knockout of this gene were investigated in response to inoculation with fungal pathogens. To cover a broad pathogen spectrum, economically important representatives of ascomycete fungi (Magnaporthe oryzae, Blumeria graminis f. sp. hordei), basidiomycete fungi (Rhizoctonia solani) and oomycetes (Pythium graminicola) were chosen. Using protocols for standardized and even inoculation, an enhanced disease resistance phenotype was established for the transgenic plants constitutively expressing OsJAC1 while the respective knockout plants showed enhanced susceptibility (Weidenbach et al., 2016). A detailed bio-protocol for M. oryzae inoculation on rice is already available (Akagi et al., 2015), therefore we focus here on the inoculation protocols for R. solani, P. graminicola and Bgh.
As causal agent of rice sheath blight R. solani is one of the two most important rice diseases (Lee and Rush, 1983). The fungus overwinters as sclerotia or mycelium in the soil and infects rice sheaths by cuticular penetration or through stomata resulting in lesions, necrosis and leaf death (Ou, 1985). Of different methods available for R. solani inoculation, in the present study a time- and space-saving detached leaf assay is described, that was slightly modified from a protocol provided by Monika Höfte (Ghent University, personal communication).
P. graminicola is a causal agent of seedling damping-off and root rot resulting in stunting and yield loss (Hendrix and Campbell, 1973). In this study P. graminicola was inoculated on rice roots growing on agar plates using a protocol adapted from Van Buyten and Höfte (2013).
Fungi of the B. graminis species invade epidermal cells of their host plants with specialized feeding structures called haustoria. All other parts of the fungal mycelium are developed on the leaf surface thereby causing typical powdery mildew disease symptoms. The disease is of permanent importance in cereal agriculture (Dean et al., 2012). Rice plants do not have any powdery mildew pathogens. However, rice can be inoculated with Bgh which allows the investigation of nonhost resistance mechanisms (e.g., Abbruscato et al., 2012; Weidenbach et al., 2016). For an evenly distributed inoculation density, rice leaves have to be fixed and inoculated in a settling tower, as described for barley (Weidenbach et al., 2014).
Materials and Reagents
Square Petri dishes, (120 x 120) x 17 with vents (Greiner Bio One, catalog number: 688102 )
Round Petri dishes, 94 x 16 with vents (Greiner Bio One, catalog number: 633180 )
Filter paper, e.g., Rotilabo-round filters, type 113A, 125 mm (Carl Roth, Germany)
50 ml tubes (Cellstar tubes) (Greiner Bio One, Germany)
Surgical 3M Micropore tape (3M Deutschland, Germany)
Aluminum foil
Cover glass
Removable adhesive labels, e.g., multipurpose labels (Avery Zweckform, Germany)
Rice (Oryza sativa L. japonica), transgenic plants and respective wild type
Note: Cultivar Nipponbare used in this study was kindly provided by the Center de cooperation internationale en recherche agronomique pour le developpement (CIRAD, Montpellier, France).
Barley (Hordeum vulgare) susceptible to Bgh.
Note: Cultivar Ingrid used in this study was kindly provided by Paul Schulze Lefert (Max-Planck Institute for Plant Breeding Research, Cologne, Germany).
Rhizoctonia solani.
Note: The isolate NL84 used in this study was kindly provided by Monica Höfte (Ghent University, Gent, Belgium).
Pythium graminicola.
Note: The isolate 132 used in this study was kindly provided by Monica Höfte (Ghent University, Gent, Belgium).
Blumeria graminis f. sp. hordei.
Note: In this study race K1 (Hinze et al., 1991) was used, which was kindly provided by Paul Schulze-Lefert (Max Planck Institute for Plant Breeding Research, Cologne, Germany).
Potato extract glucose agar (PDA) (Carl Roth, Germany)
Distilled water
Gamborg B5 medium including vitamins (Duchefa Biochemie, catalog number: G0210.0025 )
Agar-Agar, Kobe I (Carl Roth, Germany)
Sodium hypochlorite (or commercially available bleach water, ‘Eau de Javel’)
Equipment
Scissor, scalpel
Plant growth chamber for rice cultivation (settings: 15 h light/9 h dark period, 24 °C, 75-80% humidity)
Plant growth cabinet for constant Bgh propagation on barley (settings:16 h light/8 h dark period, 18 °C, 65% humidity)
Incubator for maintenance of fungal cultures (22 °C, constant darkness)
Horizontal shaker
Thoma cell counting chamber (Marienfeld, Germany)
Light microscope (ca. 150x magnification)
Trays for Bgh inoculation (min. 30 x 15 cm2)
Note: Area should at least correspond to the magnitude of two-week old rice plants.
Spore settling tower (e.g., a plastic tent of ca. 1 m height with an inoculation opening at the top, see example in Figure 3C)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Delventhal, R., Loehrer, M., Weidenbach, D. and Schaffrath, U. (2016). Inoculation of Rice with Different Pathogens: Sheath Blight (Rhizoctonia solani), Damping off Disease (Pythium graminicola) and Barley Powdery Mildew (Blumeria graminis f. sp. hordei). Bio-protocol 6(24): e2070. DOI: 10.21769/BioProtoc.2070.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,071 | https://bio-protocol.org/exchange/protocoldetail?id=2071&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Antibiotic Disc Assay for Synechocystis sp. PCC6803
OC Otilia Cheregi
Christiane Funk
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2071 Views: 10184
Edited by: Maria Sinetova
Reviewed by: Elizabeth LibbyLaura Molina-García
Original Research Article:
The authors used this protocol in Nov 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2015
Abstract
This protocol describes how to investigate the integrity of the outer cell wall in the cyanobacterium Synechocystis sp. PCC6803 using antibiotics. It is adapted to the agar diffusion test (Bauer et al., 1966), in which filter paper discs impregnated with specified concentrations of antibiotics were placed on agar plates inoculated with bacteria. The antibiotics we tested, interfering with the biosynthesis/function of bacterial cell walls, will diffuse into the agar and produce a zone of cyanobacterial growth inhibition around the disc(s). The size of the inhibition zone reflects the sensitivity of the strain to the action of antibiotics, e.g., a mutation in a protein functioning within the cell wall or its construction would render the mutant strain more sensitive to the respective antibiotic. The method has proven to be useful for phenotyping a mutant of Synechocystis sp. PCC6803 lacking all three genes encoding Deg proteases. Deletion of these ATP-independent serine proteases was shown to have impact on the outer cell layers of Synechocystis cells (Cheregi et al., 2015).
Keywords: Cyanobacteria Cell wall Deg proteases Antibiotics
Background
The cyanobacterium Synechocystis sp. PCC6803 (hereafter, Synechocystis 6803) is a model organism for studying the process of photosynthesis. While its genome was sequenced already in 1996, still more than 50% of its genes encode proteins with hypothetical or unknown function. The three genes slr1204 (htrA), sll1679 (hhoA) and sll1427 (hhoB) encode serine proteases of the Deg (degradation of periplasmic proteins) family; despite detailed analyses (see Cheregi et al., 2016 and references therein) their exact subcellular localization and substrates still are enigmatic. Previous proteomic and metabolomic characterizations of single and triple deg deletion mutants performed in our lab have shown altered expression of proteins with functions in or on the outer cell layers of Synechocystis 6803 (Miranda et al., 2013; Tam et al., 2015; Cheregi et al., 2015).
The antibiotics carbenicillin, colistin and polymyxin inhibit or disrupt the bacterial cell wall and therefore can be used to test the integrity of this cellular component in mutants: polymyxin acts on the outermost lipopolysaccharide layer surrounding the cyanobacterial S-layer, carbenicillin interferes with the peptidoglycan layer and colistin acts on the plasma membrane of gram-negative bacteria (Table 1). An agar diffusion test has been developed (Bauer et al., 1966) in which filter paper discs impregnated with specified concentrations of antibiotics are placed on agar plates inoculated with bacteria. The antibiotics will diffuse from the disc into the agar and inhibit cyanobacterial growth around it. The size of this inhibition zone then reflects the sensitivity of the strain to the antibiotic. The antibiotic disc assay method was used to characterize a triple deg protease mutant, and could be used for the characterization of any cyanobacterial mutant. However, the reader should be aware of the limitations of this assay. Despite the Sll1951 protein being the main component of the outermost cell layer of cyanobacteria, called S-layer, the antibiotic disc assay only had limited effect on a sll1951 deletion mutant (Trautner and Vermaas, 2013). Though the S-layer is compromised in the sll1951 deletion mutant, the underlying layers are still intact, preventing Carbenicillin and Polymyxin B, due to their relatively high molecular masses, to penetrate into the cell.
Table 1 describes the molecular weight, the mode of action and the ordering information for the above mentioned antibiotic discs.
Table 1. Antibiotic discs used in this protocol
Materials and Reagents
RemelTM plastic Petri dishes (85 mm diameter) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R80085 )
Sterile polystyrene spreading rods (SARSTEDT, catalog number: 86.1569.005 )
Carbenicillin (CAR100) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: CT0006B )
Colistin (CT10) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: CT0017B )
Polymyxin (PB300) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: CT0044B )
Dispenser for discs (included in the kit of each of the above mentioned test discs)
Cyanobacterial cultures of WT control and mutants to be tested
Boric acid, H3BO3 (Sigma-Aldrich, catalog number: B6768 )
Manganese(II) chloride tetrahydrate, MnCl2·4H2O (Sigma-Aldrich, catalog number: 221279 )
Zinc sulfate heptahydrate, ZnSO4·7H2O (Sigma-Aldrich, catalog number: Z1001 )
Sodium molybdate dehydrate, Na2MoO4·2H2O (Sigma-Aldrich, catalog number: 331058 )
Cupric sulfate pentahydrate, CuSO4·5H2O (Thermo Fisher Scientific, Fischer Scientific, catalog number: C493-500 )
Cobalt(II) nitrate hexahydrate, Co(NO3)2·6H2O (Sigma-Aldrich, catalog number: 239267 )
Sodium nitrate, NaNO3 (Scharlab, catalog number: SO05010500 )
Magnesium sulfate heptahydrate, MgSO4·7H2O (Sigma-Aldrich, catalog number: 63138 )
CaCl2·2H2O (Scharlab, catalog number: CA01981000 )
Citric acid (Sigma-Aldrich, catalog number: 251275 )
Na2-EDTA (Sigma-Aldrich, catalog number: 27285 )
Ferric ammonium citrate (Sigma-Aldrich, catalog number: F5879 )
Sodium carbonate, Na2CO3(Sigma-Aldrich, catalog number: 71345 )
di-potassium hydrogen phosphate, K2HPO4 (EMD Millipore, catalog number: 105104 )
Na-thiosulfate (solid) (Sigma-Aldrich, catalog number: 217263 )
Difco Bacto-agar (BD, catalog number: 214530 )
TES (Sigma-Aldrich, catalog number: T6541 )
100x BG11 without Fe, phosphate, carbonate (see Recipes)
1,000x ferric ammonium citrate (see Recipes)
1,000x Na2CO3 (see Recipes)
1,000x K2HPO4 (see Recipes)
BG11 solid agar plates (see Recipes)
1 M TES/NaOH buffer, pH 8.2 (see Recipes)
Equipment
Cell culture flasks (50-250 ml) with vented caps (TC flask T25) (SARSTEDT, catalog number: 83.3910.002 )
UV/VIS spectrophotometer (GlobalMarket, PG Instruments, model: T90+ ) for measuring the absorption of cell culture (OD730).
MultisizerTM Coulter Counter for counting cells (Beckman Coulter, model: Z Series Coulter Counter )
Laminar hood (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraguardTM Eco Clean Bench )
Shaking incubator (80-120 rotations/min) with light (IVIS ~60-100 µE m-2 s-1) and temperature adjusted to 30 °C (Eppendorf, model: New BrunswickTM Innova® 43 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cheregi, O. and Funk, C. (2016). Antibiotic Disc Assay for Synechocystis sp. PCC6803. Bio-protocol 6(24): e2071. DOI: 10.21769/BioProtoc.2071.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Antibacterial assay
Microbiology > Microbial metabolism > Other compound
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,072 | https://bio-protocol.org/exchange/protocoldetail?id=2072&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of THY1+ Undifferentiated Spermatogonia from Mouse Postnatal Testes Using Magnetic-activated Cell Sorting (MACS)
Hung-Fu Liao
Joyce Kuo
HL Hsien-Hen Lin
Shau-Ping Lin
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2072 Views: 10169
Edited by: Jyotiska Chaudhuri
Reviewed by: Shravani MukherjeeManuel Sarmiento
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
In mammals, homeostasis of many tissues rely on a subpopulation of cells, referred to as stem cells, to sustain an appropriate number of undifferentiated and differentiated cells. Spermatogonial stem cells (SSCs) provide the fundamental cellular source for spermatogenesis and are responsible for the lifelong maintenance of the germline pool in testes throughout the reproductive lifespan of males. To gain insight into germline stem cell biology and develop strategies for infertility treatment, several germ cell isolation methods have been reported in order to acquire good quality and quantity of undifferentiated spermatogonia. Among them, magnetic-activated cell sorting (MACS) is an efficient cell isolation method that requires less time and less initial cell numbers to obtain an enriched cell population using an antigen-antibody reaction. Thymus cell antigen 1 (THY1, CD90.2) is recognized as a surface marker of undifferentiated spermatogonia in mouse neonatal and adult testes. Here, we describe a protocol for the isolation of one-week-old THY1+ cells and four-week-old THY1+ cells from mouse testes. The isolation procedure consists of three steps: testis collection and single cell suspension, cell labeling using a biotin-conjugated anti-THY1 antibody and magnetic cell separation. Note, this isolation protocol should be completed within five hours to maximize the quality and the amount of living cells.
Keywords: Testis THY1+ spermatogonial stem cell Magnetic-activated cell sorting Germ cell
Background
Co-existence of active and quiescent stem cells is observed in several adult tissues. Adequate balance between quiescence, self-renewal and differentiation is necessary to sustain an appropriate number of undifferentiated stem cells and to avoid premature stem cell exhaustion for the homeostasis of many tissues (Tseng et al., 2015; Wabik and Jones, 2015; Xin et al., 2016). Infertility has become an increasing problem for human couples and a significant portion of male-related infertility cases results from impaired undifferentiated spermatogonia (Boivin et al., 2007; Matzuk and Lamb, 2008). For this reason, SSCs in spermatogenesis, which is a well-characterized stem cell-dependent process (Oatley and Brinster, 2008), is a valuable model to study regulation of tissue homeostasis. Numerous studies have developed germ cell isolation methods in order to gain insight into the biological functions and regulatory networks of undifferentiated spermatogonia. However, in vivo undifferentiated spermatogonia are heterogeneous in their expression of markers including GFRA1, ID4, PLZF and THY1, and different experimental protocols have influences on the enrichment of subpopulations in specific cellular states (Buageaw et al., 2005; Chan et al., 2014; Costoya et al., 2004; Gassei and Orwig, 2013; Hermann et al., 2015; Kubota et al., 2003; Liao et al., 2014). For instance, a large proportion of PLZF+ and THY1+ undifferentiated spermatogonia is found in quiescent phase of the cell cycle in vivo, whereas PLZF+ and THY1+ undifferentiated spermatogonia cultured in mediums supplemented with serum and growth factors are inclined to the proliferation phase (Costoya et al., 2004; Kanatsu-Shinohara et al., 2011; Kubota et al., 2004a; Liao et al., 2014; Sada et al., 2009).
Here, we provide a step-by-step procedure for the isolation of relative quiescent THY1+ undifferentiated spermatogonia from pre-pubertal mice through a serum-free protocol using magnetic-activated cell sorting. This protocol also contains several important information, including cell numbers needed at each step for suitable enzymatic procedures for living germ cell isolation. This protocol should be a valuable tool to obtain large amount of high quality live undifferentiated spermatogonia with specific subpopulation enrichment through the use of antibodies against SSC surface antigens.
Materials and Reagents
100 mm Petri dish (Corning, Falcon®, catalog number: 351029 )
Polypropylene tube:
2 ml tube (Corning, Axygen®, catalog number: MCT-200-C )
5 ml tube (Corning, Axygen®, catalog number: MCT-500-C )
Centrifuge tubes:
15 ml tube (Corning, Falcon®, catalog number: 352096 )
50 ml tube (Corning, Falcon®, catalog number: 352070 )
Cell strainer:
5 ml polystyrene tube with cell strainer snap cap (35 µm nylon mesh) (Corning, Falcon®, catalog number: 352235 )
70 µm nylon mesh (Corning, Falcon®, catalog number: 352350 )
Columns for cell separation:
MS columns (Miltenyi Biotec, catalog number: 130-042-201 )
LS columns (Miltenyi Biotec, catalog number: 130-042-401 )
Poly-L-Lysine coated slides (Thermo Fisher Scientific, catalog number: 10143265 )
ARTTM Barrier Hinged Rack pipette tips
P1000 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2079-HR )
P200 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2069-05-HR )
P20 (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 2149-05-HR )
C57BL/6N Mice (BioLASCO, catalog number: C57BL/6N )
Hank’s balanced salt solution (HBSS), calcium, magnesium, no phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 14025092 )
Hank’s balanced salt solution (HBSS), no calcium, no magnesium, no phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 14175095 )
Type IV collagenase (Thermo Fisher Scientific, GibcoTM, catalog number: 17104019 )
DNase I (RNase-free) (New England Biolabs, catalog number: M0303 )
Antibodies:
Biotin rat anti-mouse CD90.2 (Clone 30-H12) (BD, catalog number: 553011 )
Biotin rat IgG2b, κ isotype control (Clone A95-1) (BD, catalog number: 553987 )
Anti-CD90.2Biotin antibody (Lot 5150211128) (Miltenyi Biotec, catalog number: 130-101-908 )
Anti-CD49f antibody (BD, catalog number: 551129 )
Isotype antibody (negative control) (BD, catalog number: 551066 )
Anti-PLZF antibody (Santa Cruz Biotechnology, catalog number: sc-28319 )
Anti-VASA antibody (Abcam, catalog number: ab13840 )
AffiniPure Donkey Anti-Rabbit IgG (H+L) (Alexa Fluor® 488) (Jackson ImmunoResearch, catalog number: 711-545-152 )
AffiniPure Donkey Anti-Mouse IgG (H+L) (Alexa Fluor® 488) (Jackson ImmunoResearch, catalog number: 715-545-151 )
Anti-biotin microbeads (Miltenyi Biotec, catalog number: 130-090-485 )
PFA (Sigma-Aldrich, catalog number: 158127 )
Bovine serum albumin (BSA), IgG-free and protease-free (Jackson ImmunoResearch, catalog number: 001-000-162 )
Normal donkey serum (Abcam, catalog number: ab7475 )
EDTA, 0.5 M, pH 8.0 (Thermo Fisher Scientific, AnbionTM, catalog number: AM9260G )
BSA
Dulbecco’s phosphate-buffered saline (DPBS), no calcium, no magnesium (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 )
Trypsin-EDTA, 0.25%, phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 16000044 )
PE-Cy5-conjugated antibody
Tween-20 (Sigma-Aldrich, catalog number: P9416 )
E-HBSS (see Recipes)
MACS buffer (see Recipes)
Collagenase solution (see Recipes)
Trypsin solution (see Recipes)
F-MACS buffer (see Recipes)
Staining buffer (see Recipes)
FACS buffer (see Recipes)
PBST (see Recipes)
Equipment
Sterilized forceps and scissors
Dissecting microscope (Leica MZ16F Stereomicroscope)
P1000 pipette
Centrifuge
Hemocytometer
Magnetic separator
OctoMACSTM separator for MS columns (Miltenyi Biotec, catalog number: 130-042-109 )
MidiMACSTM separator for LS columns (Miltenyi Biotec, catalog number: 130-042-302 )
Beckman Coulter FC500 cytometer (Beckman Coulter, model: FC500 )
Leica TCS SP5 II confocal microscope (Leica Microsystems, model: Leica TCS SP5 II )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liao, H., Kuo, J., Lin, H. and Lin, S. (2016). Isolation of THY1+ Undifferentiated Spermatogonia from Mouse Postnatal Testes Using Magnetic-activated Cell Sorting (MACS). Bio-protocol 6(24): e2072. DOI: 10.21769/BioProtoc.2072.
Download Citation in RIS Format
Category
Cell Biology > Cell isolation and culture > Cell isolation
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,073 | https://bio-protocol.org/exchange/protocoldetail?id=2073&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Activity-based Pull-down of Proteolytic Standard and Immunoproteasome Subunits
TB Tobias Baumann*
OV Oliver Vosyka*
BF Bogdan I. Florea
HO Hermen S. Overkleeft
SM Silke Meiners
Ilona E. Kammerl
*Contributed equally to this work
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2073 Views: 8593
Edited by: Alka Mehra
Reviewed by: Marielle Cavrois
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Activity-based probes (ABP) are small organic molecules that irreversibly bind to the active center of a specific enzyme family and may be coupled to a fluorophore or an affinity tag (Li et al., 2013). Here, we describe a method to pull-down active catalytic standard and immunoproteasome subunits in cell lysates using the biotinylated, proteasome-specific ABP Biotin-Epoxomicin (Bio-EP). Covalent labeling of the active catalytic subunits with Bio-EP is followed by a pull-down using streptavidin-coated beads. After elution from the beads, enriched subunits may be detected via Western blot, tandem mass spectrometry (Li et al., 2013), or alternative techniques.
Keywords: Activity-based probe Activity-based pull-down Biotin Streptavidin Proteasome Activity Immunoproteasome Macrophage
Background
The proteasome is a barrel-shaped, multicatalytic enzyme complex that is present in the nucleus and cytoplasm of eukaryotic cells. It is essential for protein degradation, including processing of antigenic peptides for MHC I presentation, and regulates many cellular processes (Kammerl and Meiners, 2016). In cells of hematopoietic origin, the standard (constitutive) proteasome is often replaced by the immunoproteasome (Meiners et al., 2014), which differs in the incorporation of the three distinct catalytically active β-subunits (Figure 1).
To study the molecular function of single catalytic subunits and to modulate physiological processes, the development of subunit-specific proteasome inhibitors is indispensable. Large progress has recently been made in this area by de Bruin et al. (2014). Specific immunoproteasome inhibitors have proven as potential drug candidates for the treatment of inflammatory and autoimmune disease. The inhibition of the immunoproteasome subunit β5i may alter cytokine production by activated monocytes and lymphocytes. In a mouse model of rheumatoid arthritis, this reversed signs of the disease (Muchamuel et al., 2009).
The protocol was developed in the context of a study that investigated the effects of selective inhibition of β5i on the polarization of alveolar macrophages (Chen et al., 2016). The activity-based pull-down of catalytic standard and immunoproteasome subunits using the pan-reactive ABP Bio-EP allowed us to confirm the specific inhibition of β5i by the inhibitor ONX-0914, previously developed by ONYX Pharmaceuticals.
The use of ABPs with alternative specificity may allow for activity-based pull-down of other enzyme families in a similar experimental approach.
Figure 1. Structure of the 20S standard and immunoproteasome. The 20S core particle of the proteasome consists of two stacked inner rings containing the β-subunits 1-7 of which β1, β2 and β5 exhibit proteolytic activity. The β-rings are flanked by two α-rings containing the α-subunits 1-7. In the immunoproteasome β1, β2 and β5 are replaced by β1i, β2i and β5i, respectively, which leads to altered proteolytic activity.
Materials and Reagents
15 cm cell culture dishes
Protein LoBind® tubes (1.7 ml tubes; OMNILAB-LABORZENTRUM, catalog number: 5409327 )
50 ml Falcon tube (Corning, Falcon®, catalog number: 352070 )
Pipette tips
Fine Dosage Syringe Omnifix-F (1 ml) (OMNILAB-LABORZENTRUM, catalog number: 5421736 )
15 ml Falcon tube (Corning, Falcon®, catalog number: 352096 )
Immun-Blot® PVDF membrane (Bio-Rad Laboratories, catalog number: 162-0177 )
PD MidiTrap G-25 (store at RT) (GE Healthcare, catalog number: 28-9180-08 )
Filter 0.2 µm (Sartorius, catalog number 16534-K )
Fuji X-ray films RX, 18 x 24 cm (Kisker Biotech, model: RX1824 )
Whatman blotting paper (Laborbedarf Lammel, catalog number: 3030690 )
Murine alveolar macrophage cell line MH-S (ATCC, catalog number: CRL-2019 )
Liquid nitrogen
BCA Protein Assay Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23225 )
Biotin-Epoxomicin (Bio-EP; dissolved in DMSO, stable for at least 12 months at -20 °C; Hermen Overkleeft Lab, synthesis described in Florea et al., 2010)
Dimethyl sulfoxide (DMSO) (Carl Roth, catalog number: A994.2 )
HEPES (Molecular biology grade) (AppliChem, catalog number: A3724,1000 )
Ultrapure water (e.g., MilliQ)
Streptavidin beads (Strep-Tactin® Superflow® 50% suspension; store at 4 °C) (IBA, catalog number: 2-1206-010 )
Methanol (AppliChem, catalog number: A3493.1000 )
Roti®-Block blocking solution (store at RT) (Carl Roth, catalog number: A151.3 )
Anti-β5 antibody (store at -20 °C) (Abcam, catalog number: 90867 )
Anti-β5i antibody (store at -20 °C) (Abcam, catalog number: 3329 )
Anti-Rabbit IgG, HRP-linked antibody (store at -20 °C) (New England Biolabs, catalog number: 7074S )
Amersham ECL prime Western blotting detection reagent (store at 4 °C) (GE Healthcare, catalog number: RPN2232 )
RPMI-1640 cell culture medium (Thermo Fisher Scientific, GibcoTM, catalog number 11875093 )
Fetal bovine serum (FBS) (Biochrom, catalog number S 0615 )
β-mercaptoethanol (Molecular biology grade) (AppliChem, catalog number A1108-100 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number 15140122 )
Tris (buffer grade) (AppliChem, catalog number: A1379,1000 )
Magnesium chloride 6-hydrate (MgCl2.6H2O) (AppliChem, catalog number: A1036,0500 )
Sodium chloride (NaCl) (AppliChem, catalog number: A2942,1000 )
Ethylenediaminetetraacetic acid (EDTA) (AppliChem, catalog number: A2937,1000 )
Sodium azide (NaN3) (AppliChem, catalog number: A1430,0100 )
Dithiothreitol (DTT) (molecular biology grade) (AppliChem, catalog number: A2948,0025 )
Adenosine triphosphate (ATP), disodium salt (10 g) (Roche Diagnostics, catalog number: 10127531001 )
Glycerol (87%) (molecular biology grade) (AppliChem, catalog number: A3739,1000 )
cOmpleteTM protease inhibitor cocktail (Roche Diagnostics, catalog number: 11697498001 )
PhosSTOPTM (phosphatase inhibitor) (Roche Diagnostics, catalog number: 4906845001 )
Sodium dodecyl sulfate (SDS) (pure) (AppliChem, catalog number: A1502,1000 )
Bromophenol blue (AppliChem, catalog number: A2331,0025 )
Hydrochloric acid (fuming) (37%) (Sigma-Aldrich, catalog number: 258148-2.5L )
Rotiphorese® Gel 30 (37.5:1) (Carl Roth, catalog number: 3029.2 )
Ammonium peroxodisulfate (APS) (AppliChem, catalog number: A0834,0250 )
Tetramethylethylenediamine (TEMED) (AppliChem, catalog number: A1148,0100 )
Tween 20 (Moleculare biology grade) (AppliChem, catalog number: A4974,1000 )
Dulbecco’s phosphate-buffered saline (1x DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190-144 )
Complete growth medium for MH-S cells (see Recipes)
TSDG buffer (see Recipes)
500 µM Bio-EP in DMSO (see Recipes)
50 mM HEPES (pH 7.4) (see Recipes)
10% SDS (see Recipes)
6x Laemmli buffer (see Recipes)
4x SDS-PAGE resolving buffer (pH 8.8) (see Recipes)
4x SDS-PAGE stacking buffer (pH 6.8) (see Recipes)
Stacking gel (see Recipes)
Resolving gel (15% acrylamide) (see Recipes)
PBST (0.1% Tween) (see Recipes)
Equipment
Falcon tube centrifuge (Hettich Instruments, model: Rotina 420R )
Table centrifuge (Hettich Instruments, model: MIKRO 200R )
Water bath (LAUDA, model: Aqualine AL12 LCB 0725 )
Thermomixer (Eppendorf, model: Thermomixer comfort )
Forceps
Pipettes
Scissors
Intelli-mixer rotator (ELMI, model: RM 2M )
Western blot chambers (Bio-Rad Laboratories, model: Mini PROTEAN Tetra Cell )
Power supply (PowerPacTM Basic Power supply) (Bio-Rad Laboratories, model: 1645050 )
Western blot developer (Agfa-Gevaert, model: Curix60 )
Fume hood
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Baumann, T., Vosyka, O., Florea, B. I., Overkleeft, H. S., Meiners, S. and Kammerl, I. E. (2016). Activity-based Pull-down of Proteolytic Standard and Immunoproteasome Subunits. Bio-protocol 6(24): e2073. DOI: 10.21769/BioProtoc.2073.
Download Citation in RIS Format
Category
Biochemistry > Protein > Immunodetection
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,074 | https://bio-protocol.org/exchange/protocoldetail?id=2074&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Electro-fusion of Gametes and Subsequent Culture of Zygotes in Rice
ET Erika Toda
YO Yukinosuke Ohnishi
Takashi Okamoto
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2074 Views: 10638
Edited by: Renate Weizbauer
Reviewed by: Yvon JaillaisAlizée Malnoe
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Electro-fusion system with isolated gametes has been utilized to dissect fertilization-induced events in angiosperms, such as egg activation, zygote development and early embryogenesis, since the female gametophytes of plants are deeply embedded within ovaries. In this protocol, procedures for isolation of rice gametes, electro-fusion of gametes, and culture of the produced zygotes are described.
Keywords: Egg cell Embryogenesis Fertilization in vitro fertilization Sperm cell Rice Zygote
Background
Fertilization and subsequent events in angiosperms, such as embryogenesis and endosperm development, occur in the embryo sac deeply embedded in ovular tissue (Nawaschin, 1898; Guignard, 1899; Russell, 1992; Raghavan, 2003). Therefore, isolated gametes have been used for in vitro fertilization (IVF) system to observe and analyze fertilization and postfertilization processes (reviewed in Wang et al., 2006). The IVF system used for angiosperms includes a combination of three basic micro-techniques: (i) the isolation and selection of male and female gametes; (ii) the fusion of pairs of gametes and (iii) single cell culture (Kranz, 1999). Procedures for isolating viable gametes have been established in a wide range of plant species, including monocotyledonous and dicotyledonous plants (reviewed in Kranz, 1999 and in Okamoto, 2011). The isolated gametes can be fused electrically (Kranz et al., 1991; Uchiumi et al., 2006 and 2007) or chemically using calcium (Faure et al., 1994; Kranz and Lörz, 1994; Khalequzzaman and Haq, 2005), polyethyleneglycol (Sun et al., 1995; Tian and Russell, 1997) or bovine serum albumin (Peng et al., 2005), as the gametes are generally protoplasts. Although gametes can be fused using these different procedures, only zygotes produced by electro-fusion are only known to divide and develop into embryo-like structures and plantlets. A complete IVF system was developed by Kranz and Lörz (1993) using maize gametes and electrical fusion, and, to take advantage of the abundant resources stemming from rice research, a rice IVF system was also established by Uchiumi et al. (2007). By the use of these electro-fusion based IVF systems, post-fertilization events, such as karyogamy (Faure et al., 1993; Ohnishi et al., 2014), egg activation and zygotic development (Kranz et al., 1995; Nakajima et al., 2010; Sato et al., 2010), paternal chromatin decondensation in zygote nucleus (Scholten et al., 2002), the microtubular architecture in egg cells and zygotes (Hoshino et al., 2004), fertilization-induced/suppressed gene expression (Okamoto et al., 2005), epigenetic resetting in early embryos (Jahnke and Scholten, 2009), have been successfully observed and investigated. Moreover, polyspermic triploid zygotes were produced by the modification of the rice IVF system and the triploid zygotes were grown into triploid mature plants (Toda et al., 2016). The rice IVF system described here might become an important technique for generating new cultivars with desirable characters as well as for investigating post fertilization events.
Materials and Reagents
Coverslips (24 x 40 mm) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 125485J ) (siliconized at the edges with 5% dichlorodimethylsilane in 1,1,1-trichloroethane, see Note 3)
Glass capillaries made from 50 μl aspirator tubes (Drummond Scientific, catalog number: 2-000-050 ) (Figures 1A and 1B, Video 1; see Note 4)
Manual handling injector (ST Science, type UJB)
Non-treated plastic dishes with diameter of 3.5 cm (Iwaki, catalog number: 1000-035 )
Razor blade
Millicell-CM inserts, diameter 12 mm (EMD Millipore, catalog number: PICM01250 )
Glass needles (2 mm diameter) with fine tips
Rice plants (Oryza sativa L. cv. Nipponbare) (see Note 1)
Feeder cells: rice suspension cell culture (Line Oc, provided by RIKEN Bio-Resource Center, Tsukuba, Japan) (see Note 2)
Mineral oil (Sigma-Aldrich, catalog number: M8410-100ML )
Mannitol (Wako Pure Chemicals Industries, catalog number: 133-00845 )
Absolute ethanol (Wako Pure Chemicals Industries, catalog number: 057-00451 )
370 mosmol/kg H2O (330 mM) mannitol solution (autoclaved)
450 mosmol/kg H2O (385 mM) mannitol solution (autoclaved)
520 mosmol/kg H2O (430 mM) mannitol solution (autoclaved)
CHU (N6) basal salt mixture (Sigma-Aldrich, catalog number: C1416 )
Na2MoO4.2H2O (Wako Pure Chemicals Industries, catalog number: 514-30001 )
CoCl2·6H2O (Wako Pure Chemicals Industries, catalog number: 036-03682 )
CuSO4·5H2O (Wako Pure Chemicals Industries, catalog number: 039-19385 )
Retinol (Sigma-Aldrich, catalog number: R7632 )
Calciferol (Wako Pure Chemicals Industries, catalog number: 039-00291 )
Biotin (Wako Pure Chemicals Industries, catalog number: 023-08711 )
Thiamin·HCl (Nacalai Tesque, catalog number: 36319-82 )
Nicotinic acid (Sigma-Aldrich, catalog number: N4126 )
Pyridoxine·HCl (Wako Pure Chemicals Industries, catalog number: 163-05402 )
Choline chloride (Sigma-Aldrich, catalog number: C7527 )
Ca-pantothenate (Wako Pure Chemicals Industries, catalog number: 031-14161 )
Riboflavin (Wako Pure Chemicals Industries, catalog number: 180-00171 )
2,4-D (Wako Pure Chemicals Industries, catalog number: 040-18532 )
Cobalamine (Sigma-Aldrich, catalog number: V2876 )
p-aminobenzoic acid (Sigma-Aldrich, catalog number: 100536 )
Folic acid (Wako Pure Chemicals Industries, catalog number: 062-01801 )
Ascorbic acid (Wako Pure Chemicals Industries, catalog number: 012-04802 )
Malic acid (Sigma-Aldrich, catalog number: M1000 )
Citric acid (Sigma-Aldrich, catalog number: 251275 )
Fumaric acid (Wako Pure Chemicals Industries, catalog number: 069-00652 )
Na-pyruvate (Tokyo Chemical Industry, catalog number: P0582 )
Glutamine (Wako Pure Chemicals Industries, catalog number: 078-00525 )
Casein hydrolysate (BD, catalog number: 22 3050 )
Myo-inositol (Wako Pure Chemicals Industries, catalog number: 094-00281 )
Glucose (Wako Pure Chemicals Industries, catalog number: 049-31165 )
MS salt (Wako Pure Chemicals Industries, catalog number: 392-00591 )
MS vitamin (Sigma-Aldrich, catalog number: M7150 )
Sucrose (Wako Pure Chemicals Industries, catalog number: 196-00015 )
Sorbitol (Wako Pure Chemicals Industries, catalog number: 198-03755 )
1-naphthaleneacetic acid (Nacalai Tesque, catalog number: 23628-32 )
Kinetin (Sigma-Aldrich, catalog number: K3378 )
Gelrite (Wako Pure Chemicals Industries, catalog number: 075-05655 )
Dichlorodimethylsilane (Tokyo Chemical Industry, catalog number: D0358 )
1,1,1-trichloroethane (Tokyo Chemical Industry, catalog number: T0380 )
Zygote culture medium (see Recipes)
Regeneration media (see Recipes)
Rooting media (see Recipes)
Equipment
Stereo microscope (OLYMPUS, model: SZ61 )
Inverted microscope (OLYMPUS, model: IX-71 or IX-73 )
Forceps
Electrofusion apparatus (Nepa Gene, model: ECFG21 )
Manipulator (NARISHIGE, model: M-152 ) with a double pipette holder (NARISHIGE, model: HD-21 )
Electrodes (Nepa Gene, model: CUY5100Ti100 ) fixed to the pipette holder
Sliding stage for the insertion of a coverslip and a plastic dish
Environmental chambers
Charge-coupled device camera (Pixcera, model: Penguin 600CL )
Software
InStudio software (Pixcera)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Toda, E., Ohnishi, Y. and Okamoto, T. (2016). Electro-fusion of Gametes and Subsequent Culture of Zygotes in Rice. Bio-protocol 6(24): e2074. DOI: 10.21769/BioProtoc.2074.
Toda, E., Ohnishi, Y. and Okamoto, T. (2016). Development of polyspermic rice zygotes. Plant Physiol 171(1): 206-214.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > General
Cell Biology > Cell engineering > Cell fusion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,075 | https://bio-protocol.org/exchange/protocoldetail?id=2075&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Single-step Marker Switching in Schizosaccharomyces pombe Using a Lithium Acetate Transformation Protocol
SB Simon David Brown
Alexander Lorenz
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2075 Views: 8467
Edited by: Yanjie Li
Reviewed by: Belen Sanz
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
The ability to utilize different selectable markers for tagging or mutating multiple genes in Schizosaccharomyces pombe is hampered by the historical use of only two selectable markers, ura4+ and kanMX6; the latter conferring resistance to the antibiotic G418 (geneticin). More markers have been described recently, but introducing these into yeast cells often requires strain construction from scratch. To overcome this problem we and other groups have created transformation cassettes with flanking homologies to ura4+ and kanMX6 which enable an efficient and time-saving way to exchange markers in existing mutated or tagged fission yeast strains.
Here, we present a protocol for single-step marker switching by lithium acetate transformation in fission yeast, Schizosaccharomyces pombe. In the following we describe how to swap the ura4+ marker to a kanMX6, natMX4, or hphMX4 marker, which provide resistance against the antibiotics G418, nourseothricin (clonNAT) or hygromycin B, respectively. We also detail how to exchange any of the MX markers for nutritional markers, such as arg3+, his3+, leu1+ and ura4+.
Keywords: Schizosaccharomyces pombe Selectable marker Marker switch Li-Acetate transformation Gene tagging Gene deletion Genetic manipulation
Background
This single-step marker swap protocol for Schizosaccharomyces pombe allows for any tagged or mutated gene marked with an MX-type antibiotic marker to be swapped for a nutritional marker (cassettes containing the arg3+, his3+, leu1+, and ura4+ have been constructed) and to exchange genetic ura4+-markers for any MX-type antibiotic resistance marker (kanMX, natMX, and hphMX constructs have been tested for this study) (Lorenz et al., 2015a). Previously, this kind of approach was only feasible for MX-type antibiotic resistance markers (Sato et al., 2005; Hentges et al., 2005). Exchanging antibiotic resistance markers for each other already represented a basic set of useful genetic tools, the ura4+-to-MX as well as the arg3MX4, his3MX4, leu1MX4, and ura4MX4 marker swap cassettes expand this genetic toolbox for tagging and mutating genes in fission yeast (Lorenz et al., 2015a). The lithium acetate transformation protocol itself was described previously (Keeney and Boeke, 1994) and recently suggested modifications (http://listserver.ebi.ac.uk/pipermail/pombelist/2014/004012.html) were incorporated to provide a highly efficient procedure. Streamlining Schizosaccharomyces pombe strain construction in this way is time-saving and, therefore, will prove useful for fission yeast researchers.
Materials and Reagents
Conical tubes:
15 ml (Greiner Bio One, catalog number: 188261 )
50 ml (Greiner Bio One, catalog number: 227261 )
1.5 ml centrifuge tubes (Greiner Bio One, catalog number: 616201 )
0.2 ml flat-cap PCR tubes (Corning, Axygen®, catalog number: PCR-02-C )
Petri dishes (Greiner Bio One, catalog number: 633185 )
BD Plastipak 10 ml syringes (BD, catalog number: 302188 )
Millex-GP 33 mm diameter sterile syringe filter units (Polyethersulfone [PES] membrane, pore size: 0.22 µm) (EMD Millipore, catalog number: SLGPO33RS )
Appropriate Schizosaccharomyces pombe strains: for a marker swap the strain must already carry a mutant or tagged gene marked with either an ura4+ or MX-type marker, such as kanMX, natMX, or hphMX (Bähler et al., 1998; Goldstein and McCusker, 1999). When introducing arg3MX4, his3MX4, leu1MX4, or ura4MX4 into a strain, this strain needs to be mutated for the respective gene at its original locus, e.g., arg3-D4 (Waddell and Jenkins, 1995), his3-D1 (Burke and Gould, 1994), leu1-32 (Keeney and Boeke, 1994), or ura4-D18 (Grimm et al., 1988).
Plasmids: pALo120 (FYP2884), pALo121 (FYP2885), pALo122 (FYP2886), pFA6a-arg3MX4 (FYP2890), pFA6a-his3MX4 (FYP2891), pFA6a-leu1MX4 (FYP2892), and pFA6a-ura4MX4 (FYP2893) (Lorenz, 2015a and 2015b); plasmid can be obtained from the National BioResource Project (NRBP) of MEXT, Japan (please refer to FYP numbers when ordering).
Sonicated salmon sperm DNA (Sigma-Aldrich, catalog number: 31149 )
Agarose, molecular grade (Bioline, catalog number: BIO-41026 )
Q5 high fidelity DNA polymerase (New England Biolabs, catalog number: M0491 )
5x Q5 reaction buffer (accessory part of Q5 high fidelity polymerase) (New England Biolabs, catalog number: M0491 )
10 mM dNTPs (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0191 )
10 µM oligonucleotides (to be used as primers in PCR reactions) (Sigma-Aldrich, USA)
MilliQ H2O drawn from a MilliQ Advantage A10 system (EMD Millipore, catalog number: Z00Q0V0WW )
CutSmart buffer (accessory part of restriction enzymes, can also be ordered separately under New England Biolabs, catalog number: B2704 )
Restriction enzymes:
XbaI restriction enzyme (New England Biolabs, catalog number: R0145 )
BamHI-HF restriction enzyme (New England Biolabs, catalog number: R3136 )
EcoRI-HF restriction enzyme (New England Biolabs, catalog number: R3101 )
PvuII-HF restriction enzyme (New England Biolabs, catalog number: R3151 )
SacI-HF restriction enzyme (New England Biolabs, catalog number: R3156 )
Di-methyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Ethylenediaminetetraacetic acid (EDTA) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10526383 )
Sodium hydroxide (NaOH) pellets (anhydrous) (Sigma-Aldrich, catalog number: S8045 )
Tris(hydroxymethyl)aminomethane (VWR, catalog number: 103156X )
Glacial (100%) acetic acid (VWR, catalog number: 20104.334 )
Yeast extract, microgranulated (ForMediumTM, catalog number: YEM02 )
Glucose anhydrous (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10373242 )
Adenine (Sigma-Aldrich, catalog number: A5665 )
Uracil (ForMediumTM, catalog number: DOCO212 )
Leucine (ForMediumTM, catalog number: DOCO156 )
Lysine (Sigma-Aldrich, catalog number: L8662 )
Histidine (Sigma-Aldrich, catalog number: H5659 )
Arginine (Sigma-Aldrich, catalog number: A6969 )
Agar granulated (ForMediumTM, catalog number: AGR10 )
G418 disulfate (ForMediumTM, product number: G4181 )
Nourseothricin-dihydrogen sulfate (clonNAT) (Werner BioAgents, catalog number: clonNAT)
Hygromycin B (ForMediumTM, catalog number: HYG1000 )
Yeast nitrogen base without amino acids and without ammonium sulfate (ForMediumTM, catalog number: CYN0502 )
L-glutamic acid monosodium salt hydrate (sodium glutamate) (Sigma-Aldrich, catalog number: G5889 )
5 N hydrochloric acid (HCl) (VWR, catalog number: 30018.320 )
Lithium acetate (Sigma-Aldrich, catalog number: L4158 )
Polyethylene glycol (PEG) MW 3,350 (Sigma-Aldrich, catalog number: P4338 )
DNA molecular weight marker, HyperLadderTM 1 kb (Bioline, catalog number: BIO-33025 )
0.5 M EDTA (pH 8.0) (see Recipes)
50x TAE gel electrophoresis buffer (see Recipes)
YES (Yeast extract supplemented) broth (see Recipes)
YES plates (see Recipes)
Concentration of antibiotics in YES media (see Recipes)
YNG (Yeast nitrogen base glutamate) plates (see Recipes)
1 M Tris/HCl (pH 7.5) (see Recipes)
1 M LiAc (pH 7.5) (see Recipes)
10x TE (pH 7.5) (see Recipes)
LiAc/TE (see Recipes)
40% PEG (see Recipes)
Equipment
Erlenmeyer glass flasks for culturing yeast (DURAN Group, catalog number: 2177144 )
Infors HT multitron standard shaking incubator (Infors, model: Multitron Standard )
Static incubator (Gallenkamp forced air incubator) (Weiss Technik UK)
Water baths (Grant Instruments, catalog number: JBN5 )
Eppendorf microcentrifuge (Eppendorf, model: 5424R )
MJ Research PTC-100 programmable thermal cycler
Nucleic acid gel electrophoresis system consisting of a gel electrophoresis chamber with a 7 x 10 cm tray (Bio-Rad Laboratories, model: Mini-Sub® Cell GT ) and a power supply (Bio-Rad Laboratories, model: PowerPacTM Basic Power Supply )
NanoDrop 2000c UV/Vis-spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: ND-2000C )
Sigma 4-16K centrifuge (Sigma Laborzentrifugen, model: Sigma 4-16K )
Haemocytometer, type Neubauer improved (Marienfeld-Superior, catalog number: 0630010 )
Leica DM500 microscope (Leica Microsystems, model: Leica DM500 )
Classic Media 12 L autoclave (Prestige Medical, model: 210048 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Brown, S. D. and Lorenz, A. (2016). Single-step Marker Switching in Schizosaccharomyces pombe Using a Lithium Acetate Transformation Protocol. Bio-protocol 6(24): e2075. DOI: 10.21769/BioProtoc.2075.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Gene mapping and cloning
Microbiology > Microbial genetics > Transformation
Molecular Biology > DNA > DNA recombination
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,076 | https://bio-protocol.org/exchange/protocoldetail?id=2076&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Assays for the Detection of Calreticulin Exposure, ATP and HMGB1 Release upon Cell Death
Yuting Ma
HY Heng Yang
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2076 Views: 18297
Edited by: Lee-Hwa Tai
Reviewed by: Justine MarsolierMichael Enos
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
Accumulating evidence is revealing the essential role of immune system in cancer treatment. Certain chemotherapeutic drugs can potently induce the release of ‘cell death associated molecular patterns’ (CDAMPs), which accompanies cancer cell demise. CDAMPs can engage corresponding receptors on immune cells and stimulate immune responses to achieve long-term tumor control (Ma et al., 2013; Ma et al., 2014; Yang et al., 2015). Among reported CDAMPs, calreticulin (CALR), ATP and HMGB1 are well known for their immune-stimulatory effect. Here we describe the assays that we applied to measure cell death and these CDAMPs. Briefly, cell death can be analyzed by co-staining of 4’,6-diamidino-2-phenylindole (DAPI) with 3,3’-Dihexyloxacarbocyanine Iodide [DiOC6(3)] or Annexin V. CALR exposure on the cell membrane can be detected by flow cytometry. ATP and HMGB1 release can be quantified by luminescence assay and ELISA assay respectively.
Keywords: Cell death DiOC6(3) Annexin V Calreticulin HMGB1 ATP Luciferase
Background
Lactate dehydrogenase assay and trypan blue staining are traditional methods to examine cell death. We describe here two feasible and economic solutions to detect apoptotic and necrotic cell death by flow cytometry (FCM). DAPI labels cells with disrupted integrity (necrosis), while Annexin V binds to phosphatidylserine (which is externalized upon apoptosis). DiOC6(3) uptake indicates mitochondrial transmembrane potential (MTP) and the collapse of MTP reveals apoptosis. DAPI doesn’t require compensation with phycoerythrin (PE, which is conjugated with Annexin V protein) or DiOC6(3), and therefore show advantage over propidium iodide (PI) in these assays.
CALR is an endoplasmic reticulum protein, and activation of caspase cascades triggers CALR translocation to cytoplasmic membrane. CALR exposure can be detected by immunofluorescent staining with corresponding antibodies, followed by FCM- or microscopy-based detection. Extracellular ATP can be measured by enzymatic activity of Luciferase, while HMGB1 concentration can be detected by sensitive ELISA kits.
Materials and Reagents
24 well plates
2 ml Eppendorf tubes
MCA205 fibrosarcoma cells (H2b) were induced by 3-methylcholanthrene in C57BL/6 mice (Shu et al., 1985). The assays described here are applicable for other cell lines
DMEM high glucose (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 , or GE Healthcare, HyCloneTM , catalog number: SH30022 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 16000044 )
100 mM sodium pyruvate solution (Thermo Fisher Scientific, GibcoTM, catalog number: 11360070 )
HEPES, 1 M buffer solution (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
Penicillin and streptomycin
Mitoxantrone (Sigma-Aldrich, catalog number: M6545 )
Trypsin (0.25%) (Thermo Fisher Scientific, GibcoTM, catalog number: 15050065 )
1x PBS, pH 7.4 (Thermo Fisher Scientific, GibcoTM, catalog number: 10010031 )
DiOC6(3) (3,3’-dihexyloxacarbocyanine Iodide) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D273 )
DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D1306 )
CALR antibody (Ab): rabbit monoclonal Ab, clone number: EPR3924 (Abgent, catalog number: AJ1124a ; or Abcam, catalog number: ab92516 ); or rabbit polyclonal Ab (Abcam, catalog number: ab2907 )
Alexa488 conjugated goat anti-rabbit IgG (H+L) secondary antibody (Thermo Fisher Scientific, Invitrogen, catalog number: A-11008 )
ATP Bioluminescent Assay Kit (Sigma-Aldrich, catalog number: FL-AA ) or ENLITEN® ATP Assay System (Promega, catalog number: FF2000 )
Annexin V Apoptosis Detection Kit (BD, catalog number: 559763 )
HMGB1 ELISA Kit (Tecan Trading, catalog number: ST51011 )
1x Annexin V binding buffer (see Recipes)
ATP assay mix (see Recipes)
rLuciferase/Luciferin buffer(see Recipes)
Equipment
Centrifuge
Water-Jacketed CO2 incubator (Thermo Fisher Scientific, Thermo ScientificTM, model: HERAcell® 150i )
Multi-channel pipette
SpectraMax L microplate reader (Molecular Device, model: SpectraMax L )
SpectraMax i3 multi-mode detection platform (Molecular Device, model: SpectraMax i3 )
AttuneTM NxT flow cytometer (Thermo Fisher Scientific, model: AttuneTM NxT Flow Cytometer )
Note: Alternatively, VICTORTM X multilabel reader (PerkinElmer) and MACSQuant® Analyzer 10 (Miltenyi Biotec) are also suitable.
Software
Excel (Microsoft Office)
GraphPad Prism (San Diego, CA, USA)
FlowJo software (Treestar Inc., Ashland, OR, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ma, Y. and Yang, H. (2016). In vitro Assays for the Detection of Calreticulin Exposure, ATP and HMGB1 Release upon Cell Death. Bio-protocol 6(24): e2076. DOI: 10.21769/BioProtoc.2076.
Download Citation in RIS Format
Category
Cancer Biology > Cell death > Immunological assays
Biochemistry > Other compound > Nucleoside triphosphate
Cell Biology > Cell viability > Cell death
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,077 | https://bio-protocol.org/exchange/protocoldetail?id=2077&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for Increasing Carotenoid Levels in the Roots of Citrus Plants
MM Matías Manzi
MP Marta Pitarch-Bielsa
VA Vicent Arbona
AG Aurelio Gómez-Cadenas
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2077 Views: 7655
Edited by: Scott A M McAdam
Reviewed by: Laia Armengot
Original Research Article:
The authors used this protocol in Nov 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2016
Abstract
Carotenoids in plants play several key functions such as acting as light-harvesters, antioxidants (Lado et al., 2016) or being precursors of strigolactones, abscisic acid, volatiles and other signaling compounds (Arbona et al., 2013). Although those functions are well-known in light-exposed tissues, information in belowground organs is limited because of reduced abundance of these pigments. In order to better understand the role of carotenoids in roots, we developed a methodology to increase the abundance of these pigments in underground tissues. We took advantage of the fact that citrus roots exposed to light develop pigmentation in order to increase the carotenoid content. Therefore, here we describe a simple method to increase carotenoids in citrus roots.
Keywords: Abscisic acid Phytohormones Growth chamber in vitro culture Root detachment Seed germination
Background
Carotenoid abundance in roots is quite limited and, therefore, understanding the role of these compounds becomes difficult. Exposure of roots to light is a simple, fast and useful tool to increase carotenoid levels in these tissues, especially when compared to other genomic approaches such as overexpressing some key genes of the carotenoid biosynthetic pathway (Cao et al., 2015).
Materials and Reagents
Pirex® culture tubes 25 x 150 mm
Disposable syringes (25 ml)
1.5 ml Eppendorf tubes
Citrus seeds (e.g., from a commercial rootstock)
Murashige and Skoog (MS) medium (4,302.09 mg L−1) (Duchefa Biochemie, catalog number: M0221 )
Sucrose (30 g L−1) (any supplier)
Sterile MiliQ-water
Agar (European Bacteriological Agar) (Conda, Pronadisa, catalog number: 1800 )
Tween® 20 (0.1% v/v) (Sigma-Aldrich, catalog number: P2287 )
Myo-inositol (100 mg L−1) (Duchefa Biochemie, catalog number: I0609 )
Pyridoxine-HCl (1.0 mg L−1) (Duchefa Biochemie, catalog number: P0612 )
Thiamine-HCl (0.2 mg L−1) (Duchefa Biochemie, catalog number: T0614 )
Nicotinic acid (0.5 mg L−1) (PANREAC QUÍMICA, catalog number: A0963 )
Glycine (0.2 mg L−1) (PANREAC QUÍMICA, catalog number: 141340 )
Mix A (see Recipes)
Sodium hypochlorite solution (50.0%, v/v) (see Recipes)
NaOH (0.1 N) (any supplier) (see Recipes)
Equipment
Pirex® media solution bottles
Autoclave (Raypa, model: Steam Sterilizer AES-75 )
Laminar flow hood (Bioquell, ASTEC MICROFLOW, model: Microflow Laminar Flow Workstation M50546 )
Hooked tweezers
Growth chamber (Snijders Scientific, model: Economic Lux Climate Chamber )
Long-handled scissors with curved tip
pH meter (HACH LANGE SPAIN, model: pH meter Basic 20 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Manzi, M., Pitarch-Bielsa, M., Arbona, V. and Gómez-Cadenas, A. (2016). Protocol for Increasing Carotenoid Levels in the Roots of Citrus Plants. Bio-protocol 6(24): e2077. DOI: 10.21769/BioProtoc.2077.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Biochemistry > Other compound > Carotenoid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,078 | https://bio-protocol.org/exchange/protocoldetail?id=2078&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Plant Tissue Trypan Blue Staining During Phytopathogen Infection
NF Nuria Fernández-Bautista
JD José Alfonso Domínguez-Núñez
MM M. Mar Castellano Moreno
Marta Berrocal-Lobo
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2078 Views: 31904
Edited by: Arsalan Daudi
Reviewed by: Rupesh PaudyalRenate Weizbauer
Original Research Article:
The authors used this protocol in Jan 2002
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2002
Abstract
In this protocol plant tissue is stained with trypan blue dye allowing the researcher to visualize cell death. Specifically this method avoids the use of the carcinogen compound chloral hydrate, making this classical method of staining safer and faster than ever. The protocol is applied specifically to detect cell death on Arabidopsis leaves during the course of infection with necrotrophic fungus Botrytis cinerea.
Keywords: Trypan Blue staining Plant cell death Botrytis cinerea Arabidopsis thaliana Chloral hydrate
Background
One of the most common methods to detect dead plant tissue is trypan blue staining (Keogh et al., 1980). This diazo dye is also used in histology and medicine to measure tissue viability through allowing the visualization of cell death1 (Keogh et al., 1980; Cooksey, 2014). Most microscopic procedures involving trypan blue staining require a long subsequent clearing step using chloral hydrate (CHL), a small organic compound currently used such as a carcinogen, an anesthetic and an analgesic in laboratory animals (Keogh et al., 1980; Lu and Greco, 2006; Salmon et al., 1995). CHL is not approved by the FDA in the USA or the EMA in the European Union for any medical indication (http://www.accessdata.fda.gov/). Only 250 mg or 50 mg of choral hydrate are sufficient to produce adult or pediatric sedation respectively, and its toxicity has also been measured in neonatals (http://www.drugs.com, Salazar et al., 2009). The LD50 (median lethal dose) for an adult is estimated to be a 4-h exposure to 0,440 mg/L vapour concentration, which is also the duration currently recommended for de-staining of plant leaves at a concentration of 250 g/100 ml. Long-term use of chloral hydrate also results in a rapid development of tolerance to its effects and possible addiction, as well as adverse effects including rashes, gastric discomfort and severe kidney, heart, and liver failure (Gelder et al., 2005).
Through avoiding the use of CHL, this protocol allows researchers to stain for plant cell death with trypan blue more rapidly and safely, substantially reducing the risk to researchers. Here we demonstrate the utility of this method by monitoring the course of infection of Col-0 leaves with Botrytis cinerea (B.c), the second phytopathogen fungus on scientific/economic importance with a broad host range, and a high capacity to produce hydrogen peroxide in plants (Rolke et al., 2004; Dean et al., 2012; Lehmann et al., 2015). This protocol has been also applied successfully to other Arabidopsis accessions.
1Note: Trypan blue is a synthetic compound derived from toluidine, invented by Paul Ehrlich, winner of the Nobel prize in Physiology and Medicine, 1904 (http://www.pei.de/).
Materials and Reagents
Conical tubes (50 ml) (Corning, Falcon®, catalog number: 352070 )
Parafilm M laboratory film (Hach, catalog number: 251764 )
Plastic Petri dishes with a transparent lid (JET BIOFIL cell and tissue culture plates 6 well)
Tips
Miracloth (EMD Millipore, catalog number: 475855 )
Labeling tape (Shamrock, catalog number: ST-12-20 )
Paper towels
Arabidopsis accessions: Columbia (Col-0)
Ethanol > 99.8% (Sigma-Aldrich, catalog number: 02860 )
Note: This product has been discontinued.
Lactic acid 85% (w:w) (Sigma-Aldrich, catalog number: L1250 , DL-Lactic acid 11.3 M)
Phenol (TE buffer equilibrated, pH 7.5-8.0) (Roti®-Phenol, Carl Roth, catalog number: 0038.1 )
Glycerol ≥ 99% (Sigma-Aldrich, catalog number: G7757 )
Sterile distilled water (EMD Millipore, milli-q a10 water purification system)
Trypan blue (Sigma-Aldrich, catalog number: T6146 )
Potato dextrose agar (PDA) (BD, DifcoTM, catalog number: 213400 )
Potato dextrose broth (PDB) (BD, DifcoTM, catalog number: 254920 )
Sodium hypochlorite solution (Sigma-Aldrich, catalog number: 239305 )
Sodium dodecyl sulfate (SDS) 98% (Sigma-Aldrich, catalog number: 862010 )
Note: This product has been discontinued.
Tween 20 detergent (Sigma-Aldrich, catalog number: P1379 )
Trypan blue staining solution (see Recipes)
Potato dextrose agar (PDA) (see Recipes)
Bortytis cinerea (B.c) inoculum (see Recipe)
Potato dextrose broth (PDB) (see Recipes)
Seed sterilization solution (see Recipes)
Equipment
Micro scissors NOYE (Auxilab, catalog number: 62101111 )
Dissecting forceps, Toothless 125 mm (Auxilab, catalog number: 61302012 )
Growth chamber (Vötsch Industrietechnik, model: HERAEUS VB1514 )
Biological safety cabinet (Germfree, model: BBF-2SSCH )
Micropipets P1000, P200 and P20 from Rainin Instruments
Weight analysis 440 (KERN & SOHN)
Stereomicroscope (Leica Microsystems, model: MZ9 ) coupled to CCD camera (Leica Microsystems, model: DC 280 )
Conductimeter (HACHLANGE SPAIN, CRISON, model: BASIC30 )
Autoclave (JP SELECTA, model: MED 20 , catalog number: 4001757)
Software
ImageJ software (Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, http://imagej.nih.gov/ij/, 1997-2016)
Statgraphics Centurion XVI.II software (StatPoint Technologies, Inc. www.statgraphics.com)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fernández-Bautista, N., Domínguez-Núñez, J. A., Moreno, M. M. C. and Berrocal-Lobo, M. (2016). Plant Tissue Trypan Blue Staining During Phytopathogen Infection. Bio-protocol 6(24): e2078. DOI: 10.21769/BioProtoc.2078.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Plant Science > Plant immunity > Host-microbe interactions
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,079 | https://bio-protocol.org/exchange/protocoldetail?id=2079&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Gene Expression Analysis of Sorted Cells by RNA-seq in Drosophila Intestine
JC Jun Chen
JL Jia Li
HH Huaiwei Huang
RX Rongwen Xi
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2079 Views: 14842
Edited by: Jihyun Kim
Reviewed by: Leonardo G. GuilgurModesto Redrejo-Rodriguez
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
RNA sequencing (RNA-seq) has become a popular method for profiling gene expression. Among many applications, one common purpose is to identify differentially expressed genes and pathways in different biological or pathological conditions. This protocol provides detailed procedure for RNA-seq analysis of ~250,000 sorted Drosophila intestinal cells (Chen et al., 2016), in which RNA amplification is not required.
Keywords: RNA-seq FACS Drosophila intestine Progenitor cells Transcriptome analysis
Background
Transcriptome analysis by RNA-seq has become a popular method for the identification of differentially expressed genes and pathways under different biological or pathological conditions. For samples that yield low mRNA levels, RNA or cDNA amplification was commonly performed before deep-sequencing (Dutta et al., 2015). However, this procedure could potentially omit important candidates that are expressed in low abundance. Here we provide a detailed procedure for RNA-seq analysis of sorted Drosophila gut cells in which RNA amplification is not required.
Materials and Reagents
Isolation of intestinal progenitor cells by FACS
Microcentrifuge tube (Corning, Axygen®, catalog number: MCT-150-C )
40 μm filters
70 μm filters (Corning, Falcon®, catalog number: 352350 )
The fly strains carrying Esg-GFP fluorescent marker
Elastase (Sigma-Aldrich, catalog number: E0258 )
RNAiso Plus (Takara Bio, catalog number: 9108/9109 )
NaCl
KCI
Na2HPO4
KH2PO4
Diethyl pyrocarbonate (DEPC) (Sigma-Aldrich, catalog number: D5758 )
1x DEPC-PBS (see Recipe)
Elastase solution (see Recipe)
RNA isolation
Directzol RNA MiniPrep Kit (ZYMO RESEARCH, catalog number: R2050 )
95-100% ethanol
Library construction
Agilent RNA 6000 Pico Kit (Agilent Technologies, catalog number: 5067-1513 )
Dynabeads® mRNA DIRECTTM Purification Kit (Thermo Fisher Scientific, AmbionTM, catalog number: 61011 )
Hexadeoxyribonucleotide mixture, pd(N)6 (Takara Bio, catalog number: 3801 )
dNTP mixture (Takara Bio, catalog number: 4019 )
DTT (provided by SuperScript® II reverse transcriptase)
Recombinant RNasin® ribonuclease inhibitor (Promega, catalog number: N2511 )
SuperScript® II reverse transcriptase (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18064014 )
Second-strand buffer (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10812014 )
DNA polymerase I (Takara Bio, catalog number: 2130A )
RNase H (New England Biolabs, catalog number: M0297S )
Agencourt AMPure XP Kit (5 ml) (Beckman Coulter, catalog number: A63880 )
NEBNext® DNA library prep master mix set for Illumina® (New England Biolabs, catalog number: E6040L )
NEBNext® multiplex oligos for Illumina® (New England Biolabs, catalog number: E7335S / E7500S )
Agilent High Sensitivity DNA Kit (Agilent Technologies, catalog number: 5067-4626 )
Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: Q32851 )
Illumina Library Quantification Kit (Kapa Biosystems, catalog number: KK4824 )
Equipment
Isolation of intestinal progenitor cells by FACS
Dissecting microscope with zoom and dual goosenecks to supply oblique illumination; CO2 equipped fly sorting station (Leica, model: MZ16 ; custom fabrication)
Forceps, Dumont #5 (Fine Science Tools, catalog number: 11252-30 )
Dissecting dish (Thermo Fisher Scientific, Fisher Scientific, catalog number: 21-379 )
FACS Aria II sorter (BD)
RNA isolation
Vortex
Library construction
DynaMagTM-2 magnet (Thermo Fisher Scientific, catalog number: 12321D )
Agencourt AMPure XP 5 ml Kit (Beckman Coulter, catalog number: A63880 )
PCR thermal cycler
Qubit® 3.0 Fluorometer (Thermo Fisher Scientific, InvitrogenTM, model: Qubit® 3.0 Fluorometer)
Agilent 2100 Bioanalyzer (Agilent Technologies, model: 2100 Bioanalyzer)
Applied BiosystemsTM 7500 Fast & 7500 real-time PCR system (Thermo Fisher Scientific, model: 7500 Fast & 7500 real-time PCR system)
Hiseq-2500 sequencing system (Illumina, model: Hiseq-2500)
Software
Mapping and analysis of Illumina reads for transcriptome
Bowtie (http://bowtie-bio.sourceforge.net/index.shtml, Langmead et al., 2009)
TopHat (http://ccb.jhu.edu/software/tophat/index.shtml, Trapnell et al., 2009)
Cufflinks (http://cole-trapnell-lab.github.io/cufflinks/, Roberts et al., 2011)
CASAVA (http://support.illumina.com.cn/sequencing/sequencing_software/casava.html, Illumina)
Procedure
Figure 1. Protocol overview. Under RNase-free environment, the midguts with foregut and hindgut portion removed (left panel) are digested with Elastase for 1 h. The dissociated tissues are centrifuged, resuspended in DEPC-PBS, filtered, and then sorted through FACS. About 250,000 sorted cells are collected to harvest total RNA, which is then used for library construction and sequencing with Illumina Hiseq-2500 system. The upper right panel shows a confocal image of midgut epithelium with Esg-GFP expression. The bottom right panel highlights the Esg-GFP+ cell population measured by FACS.
Isolation of intestinal progenitor cells by FACS (Figure 1)
The fly strains carrying Esg-GFP fluorescent markers are used to sort intestinal progenitor cell population (including intestinal stem cells and enteroblasts), midguts from w1118 strain are used to set fluorescence gate. To achieve 250K Esg-GFP+ cells, a minimum of 1,000 midguts is required.
Note: It is important to be consistent with age, gender and culture conditions among different biological samples. Here we take expression analysis of Sox21a mutant flies for example. Sox21a mutants carrying Esg-GFP markers served as the mutant sample, with Esg-GFP wild-type flies as WT Ctrl. Based on the observation that overproliferation phenotype is displayed after 10 days in 90% sox21a mutant intestines, we analyzed flies at 10 days old for both the mutants and WT control. For both groups, we chose female flies and cultured them with identical food (standard fly food plus yeast paste).
The following steps are performed under RNase-free conditions. Forceps and the dissecting pads are pre-washed with DEPC-PBS solution. The prepared females are ice-anesthetized for dissection. Intestines are dissected and the foregut and hindgut parts are removed by forceps (Figure 2). The midguts are then immediately put in DEPC-PBS (see Recipes) solution on ice.
Figure 2. The midgut dissection procedure. A. Use forceps to gently hold a fly and tear the abdomen at the boundary of thorax/abdomen, pull the abdomen away from the anterior part without touching the gut. B and C. Before the gut is fully stretched, cut the gut at the boundaries between foregut and hindgut. Remove the appendix if Malpighian tubule (Mt) or ovarium is attached to the midgut.
Incubate 100-200 guts with 1 mg/ml Elastase (see Recipes) in about 1 ml DEPC-PBS per microcentrifuge tube for 1 h at 25 °C until the midguts are largely dissociated. Softly mix the sample every 15 min by pipetting and inverting several times.
Dissociated samples are pelleted at 400 x g for 20 min, and resuspended in a microcentrifuge tube with 0.5 ml DEPC-PBS. The suspension was filtered with 40 or 70-μm filters (Corning), by touching pipette tips on the top of the filter so that the cells can go through filters. Wash the tubes and the filters with 0.5 ml DEPC-PBS, and also collect the filtered suspension in the filtered cells. The filtered cells are then sorted using a FACS Aria II sorter (BD Biosciences) and collected in 0.5 ml DEPC-PBS.
Note: 40-μm filters are recommended for pure isolation of small diploid cells, such as intestinal progenitor cells or enteroendocrine cells. It’s recommended to double check the sorted cells based on cell morphology and expression of the fluorescent marker.
The sorted cells are pelleted at 400 x g for 20 min and preserved in 0.2-0.8 ml RNAiso Plus (Takara Bio) reagents, which can be stored at -80 °C within 6 months until RNA isolation. For each of the biological replicates, at least 200,000 sorted cells are collected to harvest total RNA. For each genotype group, at least 3 biological replicates are prepared.
RNA isolation
Add equal volume of > 95% ethanol directly to the homogenate cell sample. Mix thoroughly by vortexing.
Follow the Directzol RNA MiniPrep Kit to harvest total RNA of each sample. DNase I treatment is unnecessary, as polyA RNAs will be selectively purified during cDNA library construction. The RNA sample eluted in DNase/RNase-free water should be used immediately for sequencing library construction or stored at -80 °C for up to 3 months.
Library construction
Qualify total RNA on Agilent 2100 Bioanalyzer using Agilent RNA 6000 Pico Kit. Purify polyA RNA from 50 ng total RNA using Oligo-dT Dynabeads according to manufacturer’s protocol (Dynabeads® mRNA DIRECTTM Purification Kit) and elute the polyA RNA in 12 μl RNase free water.
RNA fragmentation
PolyA RNA 12 μl
5x first strand buffer 6 μl
Incubate at 95 °C 5 min and chill on ice
Reverse transcription
Add 1.5 μl Hexadeoxyribonucleotide mixture (50 ng/μl) to each sample, incubate at 65 °C for 5 mins and chill on ice.
Prepare the following RT mix on ice (1x):
dNTP mixture (10 mM) 1.5 μl
DTT (0.1 M) 3 μl
Ribonuclease inhibitor (40 U/μl) 1 μl
SuperScript II Reverse Transcriptase (200 U/μl) 1 μl
Nuclease-free water 4 μl
Add 10.5 µl of the RT mix to each sample, mix and spin. Transfer to thermocycler:
25 °C 10 min
42 °C 50 min
70 °C 15 min
4 °C hold
Synthesis second strand of cDNA
First strand cDNA 30 μl
dNTP mixture (10 mM) 2 μl
Second strand buffer (5x) 10 μl
RNase H (5 U/μl) 1 μl
DNA polymerase I (5 U/μl) 3 μl
Nuclease-free water 4 μl
16 °C 2.5 h
4 °C hold
Purify cDNA using 1.8x AMPure XP beads, and elute in Nuclease-free water.
Construct cDNA library using NEBNex® DNA library prep master mix set and NEBNext® multiplex oligos.
Qualify library on Agilent 2100 Bioanalyzer using Agilent High Sensitivity DNA Kit. Quantify library using Qubit® dsDNA HS Assay Kit and Illumina Library Quantification Kit according to manufacturer’s protocol. Run library on the Illumina Hiseq-2500 sequencing system.
Data analysis
Mapping and analysis of Illumina reads for transcriptome
Illumina Casava1.8 software used for basecalling.
Drosophila melanogaster genome sequences and bowtie index can be downloaded from Tophat website (Figure 3).
Figure 3. Screenshots of the Tophat webpage
Single-end reads are mapped to the Drosophila melanogaster genome (Release 5) using TopHat (v2.0.10). For our analysis, we allow up to 2 mismatches and aligned with command ‘tophat --bowtie1 –N 2 --no-coverage-search –G genes.gtf genome sample.fastq’, where genes.gtf is the structure of genes and sample.fastq is the raw sequencing reads of a sample.
Cuffquant is used for quantifying gene and transcript expression levels for a sample BAM file with command ‘cuffquant -o outputdir genes.gtf -p 15 sample_aligned/accepted_hits.bam’. This step generates .cxb files which contain gene and transcript expression levels.
We use cuffnorm for computing normalized expression values (FPKM) of genes of all samples. csDendro and MDSplot are used for provide insight into the relationships between replicates and different conditions. This step makes sure the replicates samples are consistent and can be used for subsequent analysis (Figure 4).
Differentially expressed genes are identified by cuffdiff and significant differentially expression genes were filtered with P value ≤ 0.05, and fold change ≥ 2.
Figure 4. csDendro (left) and MDSplot (right) are used to evaluate the relationships among experimental and control groups. Here the example shows 3 replicates of sox21a mutant samples (Sox21a-1, -2, -3) and 4 replicates of WT control samples (WT-1, -2, -3, -4).
Recipes
1x DEPC-PBS
1x PBS solution (pH 7.2-7.4) contains 137 mM NaCl, 2.7 mM KCI, 4.3 mM Na2HPO4 and 1.4 mM KH2PO4
0.1% final solution of diethyl pyrocarbonate (DEPC) is added to 1x PBS
Mix well by shaking and leave overnight in a fume hood at room temperature
The solution can be stored at room temperature up to a year in RNase-free conditions
Elastase solution
Dissolve elastase in 1x DEPC-PBS buffer at a final concentration of 1 mg/ml
Acknowledgments
Sorting of intestinal progenitor cells was performed according to the method described previously (Dutta et al., 2015) with some modifications. This work was supported by National Basic Science 973 grant (2014CB850002) from the Chinese Ministry of Science and Technology.
References
Chen, J., Xu, N., Huang, H., Cai, T. and Xi, R. (2016). A feedback amplification loop between stem cells and their progeny promotes tissue regeneration and tumorigenesis. Elife 5. pii: e14330
Dutta, D., Buchon, N., Xiang, J. and Edgar, B. A. (2015). Regional cell specific RNA expression profiling of FACS isolated Drosophila intestinal cell populations. Curr Protoc Stem Cell Biol 34: 2F 2 1-14.
Langmead, B., Trapnell, C., Pop, M. and Salzberg, S. L. (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10(3): R25.
Trapnell, C., Pachter, L. and Salzberg, S. L. (2009). TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25(9): 1105-1111.
Roberts, A., Trapnell, C., Donaghey, J., Rinn, J. L. and Pachter, L. (2011). Improving RNA-Seq expression estimates by correcting for fragment bias. Genome Biol 12(3): R22.
Copyright: Chen et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Chen, J., Li, J., Huang, H. and Xi, R. (2016). Gene Expression Analysis of Sorted Cells by RNA-seq in Drosophila Intestine. Bio-protocol 6(24): e2079. DOI: 10.21769/BioProtoc.2079.
Chen, J., Xu, N., Huang, H., Cai, T. and Xi, R. (2016). A feedback amplification loop between stem cells and their progeny promotes tissue regeneration and tumorigenesis. Elife 5. pii: e14330
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Intestinal stem cell
Cell Biology > Cell isolation and culture > Cell isolation
Molecular Biology > RNA > RNA sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
208 | https://bio-protocol.org/exchange/protocoldetail?id=208&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Antibody Affinity Purification
HP Huan Pang
Published: May 5, 2012
DOI: 10.21769/BioProtoc.208 Views: 14322
Download PDF
Ask a question
Favorite
Cited by
Abstract
Antibody purification is performed to concentrate and enrich antigen-specific antibodies and lower the background signal during detection by removing any non-specific proteins. Affinity purification makes use of specific binding interactions between molecules, and is very simple and efficient.
Materials and Reagents
PBS
NaCl
KCl
Na2HPO4
KH2PO4
Glycine
HCl
Tris-HCl
BSA
Azide
Affinity resin
Sepharose
10x PBS (see Recipes)
1x PBS + 1 M NaCl (see Recipes)
0.1 M glycine-HCl (pH 2.8) (see Recipes)
1 M Tris- HCl (pH 8.5) (see Recipes)
Equipment
Centrifuges
Affinity resin
Spectrometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,080 | https://bio-protocol.org/exchange/protocoldetail?id=2080&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Highly Accurate Real-time Measurement of Rapid Hydrogen-peroxide Dynamics in Fungi
MM Michael Mentges
Jörg Bormann
Published: Vol 6, Iss 24, Dec 20, 2016
DOI: 10.21769/BioProtoc.2080 Views: 9266
Edited by: Valentine V Trotter
Reviewed by: Emilia Krypotou Sadri Znaidi
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
Reactive oxygen species (ROS) are unavoidable by-products of aerobic metabolism. Despite beneficial aspects as a signaling molecule, ROS are principally recognized as harmful agents that act on nucleic acids, proteins and lipids. Reactive oxygen species, and, in particular, hydrogen peroxide (H2O2), are deployed as defense molecules across kingdoms, e.g., by plants in order to defeat invading pathogens like fungi. Necrotrophic plant pathogenic fungi themselves secrete H2O2 to induce host cell death and facilitate infection. Hydrogen peroxide is, to a certain extent, freely diffusible through membranes. To be able to monitor intracellular hydrogen peroxide dynamics in fungi, we recently established the versatile HyPer-imaging technique in the filamentous plant pathogen Fusarium graminearum (Mentges and Bormann, 2015). HyPer consists of a circularly permuted yellow fluorescent protein (cpYFP) inserted into the regulatory domain (RD) of the prokaryotic H2O2-sensing protein, OxyR. The OxyR domain renders the sensor highly specific for H2O2. Oxidation of HyPer increases fluorescence of cpYFP excited at 488 nm and decreases fluorescence excited at 405 nm, thereby facilitating ratiometric readouts (Belousov et al., 2006). HyPer turned out to be pH-sensitive. A single amino acid mutation in the H2O2-sensing domain of HyPer renders the sensor insensitive to H2O2. This reporter is called SypHer and serves as a control for pH changes.
By using the HyPer-imaging technique, we could demonstrate that: i) HyPer imaging enables the specific and accurate detection of rapid changes in the intracellular H2O2 balance, ii) F. graminearum reacts on external stimuli with the transient production of H2O2, and iii) faces increased H2O2 level during initial infection of wheat.
The aim of this protocol is to guide the user through the basic setup of an in vitro HyPer imaging experiment in basically any fungus. It will provide the specific parameter for the fluorescence imaging as well as the construction of customized flow chambers for in vitro applications.
Keywords: Hydrogen peroxide Fusarium graminearum Ratiometric Reactive oxygen species Mycelia Hyphae Filamentous fungi
Background
HyPer is a genetically encoded, highly specific H2O2 sensor protein enabling the real-time detection of fluctuations in the intracellular H2O2-level, e.g., in response to external stimuli. Genetically encoded sensors are advantageous over classical staining methods like 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA), 3,3’-Diaminobenzidine (DAB), or boronate-based H2O2 probes since they lack the major disadvantages of the latter ones as for example technically sophisticated application, requirement for chemical fixation of cells, insufficient uptake, inadequate intracellular distribution of stains, and occasionally irreversibility (reviewed in Guo et al., 2014). A genetically encoded sensor widely used for in-vivo detection of redox states in a cell is the redox-sensitive GFP (roGFP) system. The roGFP system is, however, not specific to a certain subtype of oxidative agent, i.e., H2O2, but (indirectly) monitors the redox status of a cell.
Materials and Reagents
Microplates, 96 well, black, F-bottom (Greiner Bio One, catalog number: 655076 )
Cover slips (24 x 40 mm) (Carl Roth, catalog number: 1870.2 )
Standard microscope slides (Carl Roth, catalog number: 0656.1 )
10 ml disposable syringes (Carl Roth, catalog number: 0058.1 )
0.35 x 25 mm endo needle for root canal rinsing (Vedefar, Dilbeek, catalog number: 99010 )
92 mm Petri dish (SARSTEDT, catalog number: 82.1473 )
Whatman paper (Sigma-Aldrich, catalog number: WHA10347511 ) (Optional)
Plastic disposal bags (Carl Roth, catalog number: E706.1 )
Double-sided adhesive frame (Gene Frame) (Thermo Fisher Scientific, Thermo Fisher ScientificTM, catalog number AB0576 )
Pipette tips (1,000 µl, 200 µl, 10 µl)
PCR tubes
Conidia of F. graminearum (i.e., of F. graminearum expressing HyPer-2 or SypHer; preferably fresh, not frozen)
pC1-HyPer-2 (Addgene, catalog number: 42211 )
pC1-HyPer-C199S (SypHer) (Addgene, catalog number: 42213 )
PCR primer for HyPer and SypHer amplification: forward primer 5’-ATG GAG ATG GCA AGC CCA GCA GGG CGA GAC GAT GT-3’; reverse primer 5’-GCT TTT AAA CCG CCT GTT-3’
Immersion oil, Immersol W 2010 (Pulch + Lorenz, catalog number: 444969-0000-000 )
Hydrogen peroxide 30% (Carl Roth, catalog number: 9681.4 )
1,4-dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 000000010197777001 )
Calcium nitrate tetrahydrate, Ca(NO3)2·4H2O (Carl Roth, catalog number: X886.1 )
Potassium dihydrogen phosphate, KH2PO4 (Carl Roth, catalog number: P018.1 )
Magnesium sulfate heptahydrate, MgSO4·7H2O (Sigma-Aldrich, catalog number: 230391-500G )
Sodium chloride, NaCl (Carl Roth, catalog number: 9265.1 )
Boric acid, H3BO3 (Carl Roth, catalog number: 6943.1 )
Copper(II) sulfate pentahydrate, CuSO4·5H2O (Sigma-Aldrich, catalog number: 209198-250G )
Potassium iodide, KI (Carl Roth, catalog number: 6750.1 )
Manganese(II) sulphate monohydrate, MnSO4·H2O (Carl Roth, catalog number: 7347.2 )
Ammonium molybdate tetrahydrate, (NH4)6Mo7O24·4H2O (Sigma-Aldrich, catalog number: 09880-100G )
Zinc sulphate heptahydrate, ZnSO4·7H2O (Carl Roth, catalog number: 7316.1 )
Iron(III) chloride hexahydrate, FeCl3·6H2O (Carl Roth, catalog number: 7119.1 )
Chloroform
Sucrose (Carl Roth, catalog number: 9097.2 )
Granulated agar (BD, catalog number: 214530 )
Solution A (see Recipes)
Solution B (see Recipes)
Suspension D (see Recipes)
Minimal medium (see Recipes)
Equipment
Microplate multimode reader (e.g., Berthold Technologies Multimode Microplate Reader Mithras² LB 943, BERTHOLD TECHNOLOGIES, model: Mithras2 LB 943 ), equipped with fluorescence excitation filters (380 x 10 nm and 485 x 14 nm, e.g., BERTHOLD TECHNOLOGIES, catalog numbers: 40087-01 and 40271-01 ), fluorescence emission filter (520 x 10 nm, e.g., BERTHOLD TECHNOLOGIES, catalog number: 38836-01 ), and injectors (e.g., BERTHOLD TECHNOLOGIES, model: 54116 )
Neubauer counting chamber improved (Carl Roth, catalog number: T729.1 )
Confocal laser scanning microscope (e.g., LSM 780 mounted on a Carl Zeiss Axio Imager.Z2 microscope with motorized stage)
40x objective (e.g., Carl Zeiss C-apochromat Carl Zeiss 40x/1.20 W Korr M27)
Incubator at 28 °C (Thermo Fisher Scientific, model: Heraeus B20/UB20 )
Solid-state laser 405 nm, 50 mW
Argon ion laser 458, 488 and 514 nm, 30 mW
Multi-channel pipette (Eppendorf, catalog number: 3122000035 )
Pipettors: 10-100 µl (Eppendorf, catalog number: 4920000059 ), 100-1,000 µl (Eppendorf, catalog number: 4920000083 )
300 mm Heidelberger extension (Dezember, Fresenius Kabi Deutschland, catalog number: 2873112 )
Software
Plate reader software (e.g., Berthold MikroWin Lite software [Berthold Technologies])
Spreadsheet software program (e.g., Excel [Microsoft])
ImageJ (Version 1.46r, http://imagej.net/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2016 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mentges, M. and Bormann, J. (2016). Highly Accurate Real-time Measurement of Rapid Hydrogen-peroxide Dynamics in Fungi. Bio-protocol 6(24): e2080. DOI: 10.21769/BioProtoc.2080.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Microbiology > Microbial physiology > Stress response
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,081 | https://bio-protocol.org/exchange/protocoldetail?id=2081&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Procaspase-8 and -10 Processing upon Apoptosis Induction
Sabine Pietkiewicz
CW Clara Wolfe
Jörn H. Buchbinder
IL Inna N. Lavrik
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2081 Views: 9293
Reviewed by: Emilie Besnard
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Apoptosis or programmed cell death is important for multicellular organisms to keep cell homeostasis and for the clearance of mutated or infected cells. Apoptosis can be induced by intrinsic or extrinsic stimuli. The first event in extrinsic apoptosis is the formation of the Death-Inducing Signalling Complex (DISC), where the initiator caspases-8 and -10 are fully activated by several proteolytic cleavage steps and induce the caspase cascade leading to apoptotic cell death. Analysing the processing of procaspases-8 and -10 by Western blot is a commonly used method to study the induction of apoptosis by death receptor stimulation. To analyse procaspase-8 and -10 cleavage, cells are stimulated with a death ligand for different time intervals, lysed and subjected to Western blot analysis using anti-caspase-8 and anti-caspase-10 antibodies. This allows monitoring the caspase cleavage products and thereby induction of apoptosis.
Keywords: Caspase-8 Cleavage Proteolysis Western blot Apoptosis Cell death
Background
Caspases are proteases that are produced as inactive zymogens and are activated by proteolytic cleavage (Degterev et al., 2003). The activation of the caspase cascade is the most important event during apoptotic cell death, which induces the typical biochemical and morphological changes of the apoptotic cell. In contrast to inactive executioner procaspases, the initiator procaspases 8/9/10 have restricted proteolytic activity and become fully activated in high molecular weight complexes (Lavrik et al., 2005). Procaspase-9 is activated at the platform termed apoptosome during intrinsic apoptosis, while stimulation of the death receptors TNF-R1 (Tumor Necrosis Factor Receptor 1), CD95/Fas (Cluster of Differentiation 95), TRAIL-R1 (Tumor Necrosis Factor Related Apoptosis Inducing Ligand Receptor 1), TRAIL-R2 (Tumor Necrosis Factor Related Apoptosis Inducing Ligand Receptor 2) leads to the recruitment of procaspases-8 and -10 with adapter proteins to form the Death-Inducing Signalling Complex (DISC) during extrinsic apoptosis (Schleich et al., 2012). Here, caspases-8 and -10 enter close proximity and perform several intra- and inter-molecular cleavages. This processing results in the release of a small and a large subunit from the prodomain. These form the active heterotetramers p182p102 and p172p122 that triggers the caspase cascade leading to the demolition of the cell (see Figures 1A and 1B).
To verify apoptosis induction, it is important to show the activation of caspases. Checking the activation of the initiator procaspases 8 and 10, accompanied by their cleavage, gives main evidence for the induction of the extrinsic apoptosis via death receptors. The kinetics of procaspases-8 and -10 processing can be analysed by monitoring its cleavage steps by Western blot (see Figure 1C) and give information about the induction of apoptotic cell death after death receptor stimulation (Schleich et al., 2016). Depending on the part of the caspase that is recognized by the antibody, the intermediate products of the caspase containing this particular part can be analysed by western blot. Healthy, unstimulated cells only contain the unprocessed procaspases-8 and -10 (p55/53 and p59/55, respectively), but after stimulation the amount of procaspase decreases and the intermediate cleavage products (caspase-8 p43/41 or caspase-10 p47/43) and active subunits (caspase-8 p18) are enriched and can be detected by Western blot (Figure 1C). By performing time-dependent analysis, it is possible to follow the course of caspase cleavage including the enrichment of the cleaved forms (Schleich et al., 2016). This also allows to compare the time-dependent cleavage of caspases between several conditions.
To ensure getting the complete information on procaspase-8/-10 processing we have developed the protocol presented below. In contrast to a number of other protocols for Western blot analysis of procaspase-8/-10 processing, here we do not follow only a part of the Western blot of a specific molecular weight, e.g., by cutting the membrane, or use antibodies specific only to the active forms of the caspases. In this way, we can follow simultaneously several cleavage products of procaspases-8 and -10: proform, intermediate and final cleavage products. Only this way of measuring procaspase-8/-10 processing allows to escape from misjudgement on the efficiency of procaspase cleavage, e.g., in some studies only the proform of procaspases is followed and in case of a low stimulation strength and a weak caspase processing, the small differences in the decrease of the proform are not detected and might be misleading. Furthermore, another very important feature of our protocol is performing the measurement over different time intervals, which is also often neglected, and thus, the results might be misleading due to missing the key time points of processing, for example the appearance of active caspases, that are degraded fast. To the later point, there is a cell type and stimulation strength specificity with respect to the timing of procaspase-8/-10 processing and the corresponding time intervals have to be carefully selected in each particular case.
Figure 1. Kinetics of procaspase-8 and procaspase-10 processing. A. Scheme of caspase-8 processing. The cleavage at D216, D374 and D384 results in the release of the active subunits (p18 and p10). The point marks the region of the caspase that is recognized by the antibody (epitope). B. Scheme of caspase-10 processing. The cleavage at D219, D372 results in the release of the active subunits (p23/p17 and p12). The point marks the region of the caspase that is recognized by the antibody (epitope). C. Western blot: Hela-CD95 cells (Neumann et al., 2010) were stimulated with 250 ng/ml CD95L for the indicated periods of time. Samples were lysed, subjected to SDS-PAGE and analysed by Western blot for caspase-8 and caspase-10. Western blot for actin was used as loading control.
Materials and Reagents
6-well plates (with a surface suitable for your cells, e.g., SARSTEDT, catalog number: 83.3920 )
Microcentrifuge tubes (e.g., VWR, catalog number: 89202.684 )
Cuvettes (e.g., SARSTEDT, model: 67.742 )
Blotting membrane and Whatman paper (e.g., Trans-Blot Turbo Transfer Pack Mini incl. 0.2 µm nitrocellulose and transfer buffer, Bio-Rad Laboratories, catalog number: 170-4158 )
Human cells expressing caspase-8 and caspase-10, here: HeLa cells stably overexpressing CD95 (Neumann et al., 2010; DKMZ, catalog number: ACC 57 )
Suitable medium for your cells (e.g., DMEM/Ham’s F12 including 10% fetal bovine serum and 1% penicillin/streptomycin)
CD95L has been prepared as described in Fricker et al., 2010
Bovine serum albumin (BSA) standard 2 mg/ml (Bio-Rad Laboratories, catalog number: 5000260 )
SDS-poly acrylamide gel (e.g., Mini-PROTEAN TGX stain-free precast gels, 12%, Bio-Rad Laboratories, catalog number: 456-8046 )
Protein assay dye reagent concentrate (Bio-Rad Laboratories, catalog number: 500-0006 )
Protein standard (e.g., Precision plus Protein All Blue standards, Bio-Rad Laboratories, catalog number: 1610373 )
Anti-caspase-8 antibody, clone C15 (final concentration 0.5-2 µg/ml, a kind gift of P. Krammer, DKFZ Heidelberg)
Anti-caspase-10 antibody, clone 4C1 (dilution 1:1,000, final concentration 1 µg/ml, MEDICAL & BIOLOGICAL LABORATORIES, catalog number: MBL-M059-3 )
Anti-actin antibody (dilution: 1:4,000, final concentration 0.125-0.2 µg/ml, Sigma-Aldrich, catalog number: A2103 )
HRP-coupled isotype specific secondary antibodies (e.g., Santa Cruz Biotechnology, catalog numbers: sc-2060 , sc-2004 , sc-2062 )
HRP-Substrate for Enhanced Luminescence, (e.g., Luminata Forte Western HRP Substrate, EMD Millipore, catalog number: WBLUF0500 )
10x PBS (Biochrom, catalog number: L1835 )
cOmpleteTM protease inhibitor cocktail (PIC) (Roche Diagnostics, catalog number: 11 836 145 001 )
Tris (AppliChem, catalog number: A2264 )
Natrium chloride (NaCl) (Carl Roth, catalog number: P029.3 )
EDTA (Carl Roth, catalog number: CN06.2 )
Glycerol (Carl Roth, catalog number: 3783.1 )
Triton (Carl Roth, catalog number: 3051.4 )
Tween-20 (AppliChem, catalog number: A1389 )
Milk powder (Carl Roth, catalog number: T145.5 )
Sodium azide (Carl Roth, catalog number: K305.1 )
β-mercaptoethanol (Carl Roth, catalog number: 4227.2 ).
10 x Tris/Glycine/SDS (Bio-Rad Laboratories, catalog number: 161-0723 )
4x Laemmli sample buffer (Bio-Rad Laboratories, catalog number: 161-0747 )
1x PBS (see Recipes)
Protease inhibitor cocktail (PIC, see Recipes)
Lysis buffer (see Recipes)
1 x Tris/Glycine/SDS (see Recipes)
PBS-T (see Recipes)
Blocking buffer (see Recipes)
Primary antibody dilution (see Recipes)
4x Laemmli sample buffer (reducing, see Recipes)
Equipment
CO2-incubator (e.g., Thermo Fisher Scientific, Thermo ScientificTM, model: BBD 6220 )
Cell scraper (e.g., Orange Scientific, catalog number: 4460600N )
Centrifuge (Eppendorf, model: 5418R )
Photometer (Bio-Rad Laboratories, model: SmartSpec Plus Spectrophotometer )
Electrophoresis chamber and power supply (Bio-Rad Laboratories, model: Mini-PROTEAN Tetra cell and PowerPac HC )
Transfer system (Bio-Rad Laboratories, model: Trans-Blot Turbo Transfer System )
Imager (Bio-Rad Laboratories, model: ChemiDoc XRS+ Imaging System )
Software
Image Lab (Bio-Rad Laboratories)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Pietkiewicz, S., Wolfe, C., Buchbinder, J. H. and Lavrik, I. N. (2017). Measuring Procaspase-8 and -10 Processing upon Apoptosis Induction. Bio-protocol 7(1): e2081. DOI: 10.21769/BioProtoc.2081.
Download Citation in RIS Format
Category
Cancer Biology > Cell death > Cell biology assays
Immunology > Immune cell function > Cytotoxicity
Molecular Biology > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,082 | https://bio-protocol.org/exchange/protocoldetail?id=2082&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Ubiquitin Dimer Formation Assay
SW Sheng Wang
LC Ling Cao
HW Hong Wang
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2082 Views: 7752
Edited by: Yanjie Li
Reviewed by: Qiangjun Zhou
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
The process of protein ubiquitination typically consists of three sequential steps to add an ubiquitin (Ub) or Ub chain to a substrate protein, requiring three different enzymes, ubiquitin activating enzyme (E1), ubiquitin conjugating enzyme (E2), and ubiquitin protein ligase (E3). Most E2s possess the classical E2 activity in forming E2-Ub complex through a thioester linkage, in presence of an E1 and Ub. Additionally, some E2s have the ability of catalyzing the formation of free Ub dimer. Such activity indicates an important role of these E2s in ubiquitination pathway. Thus, we developed an in vitro Ub dimer formation assay to determine the activity of certain E2s. Moreover, by using Ub mutants, in which different lysine residues are mutated, the specific linkage of dimer can also be determined.
Keywords: Ubiquitination Ubiquitin dimer formation E2 Arabidopsis UBC22 K11 linkage
Background
The existing protocols for E2 conjugation initiation assay (without adding E3 and substrate) aim to detect the thioester linkage (E2-S-Ub). Our method focuses on the E2 activity of catalyzing free Ub dimer formation (Ub-Ub). It provides a convenient way to detect an important biochemical feature of E2 in different species. Further, the specific linkage of dimer can be determined by using different Ub mutants.
Materials and Reagents
1.5 ml polypropylene tubes
Polyvinylidene difluoride (PVDF) membrane (Bio-Rad Laboratories, catalog number: 162-0177 )
AmershamHyperfilmTM ECL (GE Healthcare, catalog number: 28906836 )
Purified human recombinant E1 (BOSTONBIOCHEM, catalog number: K-995 )
Qiagen Ni-NTA Spin Kit (QIAGEN, catalog number: 31314 )
Purified human recombinant Ub (BOSTONBIOCHEM, catalog number: K-995 )
Purified human recombinant Ub with the lysine 11 (K11) residue mutated (Ub-K11R) (BOSTONBIOCHEM, catalog number: UM-K11R )
Purified human recombinant Ub with the lysine 48 (K48) residue mutated (Ub-K48R) (BOSTONBIOCHEM, catalog number: UM-K48R )
Purified human recombinant Ub with the lysine 63 (K63) residue mutated (Ub-K63R) (BOSTONBIOCHEM, catalog number: UM-K63R )
10x reaction buffer (BOSTONBIOCHEM, catalog number: K-995 )
Mg-ATP solution (BOSTONBIOCHEM, catalog number: K-995 )
4x non-reducing loading buffer (BOSTONBIOCHEM, catalog number: K-995 )
SDS-PAGE gel
Skimmed milk powder
Anti-ubiquitin antibody (Cell Signaling Technology, catalog number: 3936 )
Goat anti-mouse antibody conjugated to horseradish peroxidase (HRP) (Bio-Rad Laboratories, catalog number: 170-6516 )
Amersham ECL prime Western blotting detection reagent (GE Healthcare, catalog number: RPN2232 )
NaCl
KCl
Na2HPO4
KH2PO4
Tween-20 (Sigma-Aldrich, catalog number: P1379 )
Tris base
Glycine
Methanol
Dialysis buffer (see Recipes)
1x PBS (see Recipes)
1x PBST (see Recipes)
Transfer buffer (see Recipes)
Equipment
Incubator (VWR, model number: 1545 ) or water bath
Protein electrophoresis apparatus (Bio-Rad Laboratories, model: Mini PROTEAN® 3 Cell )
Western blotting apparatus (Bio-Rad Laboratories, model: Mini Trans-Blot® Cell )
X-Ray film processor (PROTEC, model: OPTIMAX )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, S., Cao, L. and Wang, H. (2017). In vitro Ubiquitin Dimer Formation Assay. Bio-protocol 7(1): e2082. DOI: 10.21769/BioProtoc.2082.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,083 | https://bio-protocol.org/exchange/protocoldetail?id=2083&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pilot-scale Columns Equipped with Aqueous and Solid-phase Sampling Ports Enable Geochemical and Molecular Microbial Investigations of Anoxic Biological Processes
DD Dina M. Drennan
RA Robert Almstrand
IL Ilsu Lee
LL Lee Landkamer
LF Linda Figueroa
Jonathan O. Sharp
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2083 Views: 6767
Reviewed by: Disha SrivastavaAlexander Martin Ruecker
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
Column studies can be employed to query systems that mimic environmentally relevant flow-through processes in natural and built environments. Sampling these systems spatially throughout operation, while maintaining the integrity of aqueous and solid-phase samples for geochemical and microbial analyses, can be challenging particularly when redox conditions within the column differ from ambient conditions. Here we present a pilot-scale column design and sampling protocol that is optimized for long-term spatial and temporal sampling. We utilized this experimental set-up over approximately 2 years to study a biologically active system designed to precipitate zinc-sulfides during sulfate reducing conditions; however, it can be adapted for the study of many flow-through systems where geochemical and/or molecular microbial analyses are desired. Importantly, these columns utilize retrievable solid-phase bags in conjunction with anoxic microbial techniques to harvest substrate samples while minimally disrupting column operation.
Keywords: Environmental engineering Geochemistry Microbiology Pilot-scale Anaerobic respiration Redox Bioremediation Bioreactor
Background
The following describes an experimental design and sampling protocol that circumvents the obstacle of vertical coring for temporal and spatial resolution of column systems. The system has the further advantage of minimal disruption to physical, chemical and biological processes. The pilot-scale design incorporates vertically spaced sampling ports for collection of liquid and solid-phase substrate at discrete time points (Figure 1). Spatial sampling of solid-phase substrates that reside within these columns enables researchers to observe biologically relevant processes such as discrete zones of metal immobilization and shifts in microbial biofilm communities. The evolution of these vertical biogeochemical profiles can be tracked and related to performance over time. While optimized for anoxic systems as described below, this experimental design, which surmounts obstacles of more conventional flow-through column systems, could be applied for spatial inquiry into other systems that rely on aqueous and solid-phase interactions.
Of particular interest to our research, Sulfate Reducing Bioreactors (SRBRs) have been employed to mitigate the release of Mining Influenced Water (MIW) for approximately two decades (Wildeman et al., 1994). Due to the anoxic nature of these systems and their spatial heterogeneity, sampling SRBRs without operational disruption presents many challenges. Previously these systems were sampled with limited spatial resolution potentially excluding seminal processes occurring in regions within (Neculita et al., 2008). While sacrificial sampling can surmount this obstacle, it does so at the expense of temporal resolution. Furthermore, spatial inquiry into pilot-scale and larger SRBRs is challenging due to difficulty associated with coring saturated, heterogeneous organic materials (woodchips, sawdust, hay) and disruptions that can result from this form of sample collection. Our design and sampling procedure enabled us to examine the performance of sulfate reducing bioreactors that treat mining influenced water as a function of organic substrate, microbial community structure, water quality, and metal-sulfide precipitation yielding novel insights into the operation of these systems (Drennan et al., 2016).
Figure 1. Schematic of vertical down flow biochemical reactor columns. The three ports, indicated by circles on the column, were designed for solid substrate retrieval in conjunction with flow along the z-axis of the columns. The five liquid ports are depicted in blue along the side of the column. For discrete retrieval of solid substrates, columns were temporarily tilted to a horizontal plane using a custom built rack to mitigate water pressure complications and resultant loss (Figures 5 and 6). As labelled, ‘MIW Inf.’ indicates where the mining influenced water is introduced. The effluent from these columns was collected at the bottom liquid port as visualized in Figure 4A.
Materials and Reagents
Custom column design and construction (materials needed per column)
Natural organic substrates mixed as described in (Drennan et al., 2016)
Alfalfa hay (Figure 2A)
Wood chips (High Desert Investment Company, Phoenix, AZ) (Figure 2B)
Sawdust (High Desert Investment Company, Phoenix, AZ) (Figure 2C)
Limestone (Imery’s 3.35-4.95 mm) (Figure 2D)
Figure 2. Examples of solid-phase matrix components deployed within columns. A. Alfalfa hay; B. Woodchips; C. Sawdust; and D. Limestone. Alternative substrates such as sand or other organic solid-phase materials could have relevance to alternative applications such as studying subsurface flow or aquifer recharge.
A gas collection system linked to the column headspace was constructed using 10% NaOH solution to trap and scrub released sulfide thereby limiting accumulation of this toxin (Figure 3).
Figure 3. Removal of biogenic sulfide. Produced gases traveled from the column headspace to a connected plastic bag. Sulfide was removed by reacting with a 10% NaOH solution.
Anoxic columns sampling of aqueous and solid-phase samples
10 ml syringes; Luer-Lok® syringes (BD, catalog number: 309604 )
15 ml tubes; Falcon® centrifuge tubes (Corning, Falcon®, catalog number: 352196 )
0.45 µm filters (EMD Millipore, catalog number: SLHV033RB )
Plastic funnel (VWR, catalog number: 300009-435 )
Parafilm (Bemis, catalog number: PM992 )
Aluminum foil (VWR, catalog number: 89107-724 )
20% carbon dioxide balance nitrogen certified standard mixture, size 300 cylinder, CGA-580 (Airgas, catalog number: X02NI80C3003240 )
Nitric acid; 69.0-70.0% (Avantor Performance Materials, J.T. Baker, catalog number: 9598-00 )
Ethanol (VWR, catalog number: 200057-586 )
De-ionized water (DI)
Ice and coolers (for shipping)
Separation of solid-phase substrate for geochemical and microbial analysis
50 ml tubes; Falcon® centrifuge tubes (Corning, Falcon®, catalog number: 352098 )
20% carbon dioxide balance nitrogen certified standard mixture, size 300 cylinder, CGA-580 (Airgas, catalog number: X02NI80C3003240 )
Ethanol (VWR, catalog number: 200057-586)
Equipment
Custom column design and construction (materials needed per column)
Clear PVC pipe with a height of 52’’ (1.32 m) inner diameter (ID) 6” (0.15 m) (Figure 1)
Nylon mesh bags (Phifer 48 in x 25 ft. BetterVue Screen) (Home Depot Product Authority, catalog number: 3027671 ) (Figure 4E)
Impulse heat sealer (Packco, Midwest Pacific, model: MP-12 )
Tygon tubing for influent and effluent; ¼” ID and 3/8”OD (VWR, catalog number: 89403-862 )
Pump tubing for peristaltic pump (4T [size], Blue and White Industry)
Glass marbles (~16 mm diameter) filled the bottom 10 cm as an inert porous bed support. Alternatively large glass beads would also suffice
Fittings (one entry for each type used):
Column bottom fittings
3-way valve for effluent sample (Figure 4A)
Valve for liquid sampling from side port (Figure 4B) (5 per column)
Solid sample port (Figures 4C and 4D) (3 per column)
Figure 4. Sample ports for liquid and solid substrate retrieval. A. 3-way valve to sample effluent; B. Intermediate liquid sampling port; C. Position of intermediate solid-phase sampling port in conjunction with liquid sampling ports; D. Side profile of a solid-phase port before substrate was added to columns, bags were lined up in the port adjacent to each other; E. Sacrificial sample bag containing solid-phase substrate utilized in experiments.
PVC sample ports allowing for flow through and sample retrieval (Figure 4D) which can then be packed with sacrificial bags containing solid-phase substrate (Figure 4E)
Pump (Flex Flow, max feed 2.3 GFD, Blue and White Industry) (one per column)
Feed tank (250 gal HDPE drum) one tank for all columns.
Effluent collection tanks (30 gal HDPE drum)
Custom welded frame (52” height) to hold columns and enable pivoting for sampling (Figures 5A and 4B).
Figure 5. Pilot scale deployment of apparatus detailing. A. Column frame before columns; B. Column frame after columns and plumbing were established.
Column head space gas collection system (to scrub released sulfide to prevent unsafe amounts of sulfide accumulating)
250 ml filter flask stopper No. 6 (Kimax Chase Life Science and Research Products, catalog number: 27060 )
FEP gas bag 6 x 6 on/off (Labpure) (Saint-GoBain, catalog number: D1075002-10 )
Anoxic columns sampling of aqueous and solid-phase samples
Heavy-Duty Single-Stage Gas Regulator (VWR, catalog number: 55850-277 )
PVC hose ¾ in ID (VWR, catalog number: 89068-590 )
Write-On bags (Nasco, Whirl-Pak®, catalog number: B01196WA )
Vacuum sealer (Manufacturer Rival, model: FSFGSL0150-015 )
Vacuum bags (Seal-A-Meal [11-Inch by 9-Foot Rolls, 2pk])
Dissecting forceps; VWR® dissecting forceps, fine tip, curved (VWR, catalog number: 82027-406 )
Needle nose multi-tool; Multi-Plier® 600 Needlenose Pliers, Gerber® (Gerber Gear, catalog number: 47550N )
Bic Classic lighters
Sharpie® permanent ink pen (VWR, catalog number: 500020-888 )
Spray bottle to sterilize instruments with 70% ethanol (VWR, catalog number: 23609-182 )
Separation of solid-phase substrate for geochemical and microbial analysis
Anaerobic chamber (Sheldon Manufacturing, model: Bactron Anaerobic/Environmental chamber )
Scale (OHAUS, model: ES 100 L )
Large weigh boats (VWR, catalog number: 10803-168 )
Scissors; VWR® dissecting scissors, sharp tip, 4½" (VWR, catalog number: 82027-578 )
Needle nose multi-tool; Multi-Plier® 600 Needlenose Pliers, Gerber® (Gerber Gear, catalog number: 47550N )
Dissecting forceps; VWR® dissecting forceps, fine tip, curved (VWR, catalog number: 82027-406)
Spray bottle (VWR, catalog number: 23609-182)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Drennan, D. M., Almstrand, R., Lee, I., Landkamer, L., Figueroa, L. and Sharp, J. O. (2017). Pilot-scale Columns Equipped with Aqueous and Solid-phase Sampling Ports Enable Geochemical and Molecular Microbial Investigations of Anoxic Biological Processes. Bio-protocol 7(1): e2083. DOI: 10.21769/BioProtoc.2083.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,084 | https://bio-protocol.org/exchange/protocoldetail?id=2084&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescence in situ Localization of Gene Expression Using a lacZ Reporter in the Heterocyst-forming Cyanobacterium Anabaena variabilis
BP Brenda S. Pratte
TT Teresa Thiel
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2084 Views: 7502
Edited by: Maria Sinetova
Reviewed by: Manuela RoggianiYoko Eguchi
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
One of the most successful fluorescent proteins, used as a reporter of gene expression in many bacterial, plant and animals, is green fluorescent protein and its modified forms, which also function well in cyanobacteria. However, these fluorescent proteins do not allow rapid and economical quantitation of the reporter gene product, as does the popular reporter gene lacZ, encoding the enzyme β-galactosidase. We provide here a protocol for the in situ localization of β-galactosidase activity in cyanobacterial cells. This allows the same strain to be used for both a simple, quantitative, colorimetric assay with the substrate ortho-nitrophenyl-β-galactoside (ONPG) and for sensitive, fluorescence-based, cell-type localization of gene expression using 5-dodecanolyaminofluorescein di-β-D-galactopyranoside (C12-FDG).
Keywords: β-galactosidase in situ localization Heterocysts Cyanobacteria lacZ reporter
Background
Anabaena variabilis is a filamentous cyanobacterium that differentiates specialized cells called heterocysts that function specifically for nitrogen fixation (Kumar et al., 2010; Maldener and Muro-Pastor, 2010). We use the lacZ gene of Escherichia coli as a transcriptional reporter of cyanobacterial gene expression because of the ease of a quantitative, enzymatic, colorimetric, β-galactosidase assay in 96-well plates (Griffith and Wolf, 2002) and the ability to use the same strain for in situ localization of gene expression using the fluorescent substrate 5-dodecanolyaminofluorescein di-β-D-galactopyranoside (C12-FDG) (Thiel et al., 1995; Ma et al., 2016). One of the earliest reports of lacZ as a reporter was the fusion of malF, encoding the maltose transporter, to lacZ, which resulted in localization of β-galactosidase activity to the cytoplasmic membrane in E. coli (Silhavy et al., 1976). Since then lacZ has been used as a reporter in bacterial, plant and animal systems; e.g., the stable transfection of mouse tumor cells with lacZ allowed single cell histochemical staining using the chromogenic substrate 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) (Arlt et al., 2012). In fact, most cellular localization of expression of lacZ has used X-gal, which is relatively inexpensive, easy to use and provides an easy visual screen. Our initial attempts to use X-gal and other chromogenic substrates in Anabaena were unsuccessful because the colored products were toxic to cyanobacteria and often resulted in cell lysis. In addition, the cyanobacterial pigments, including chlorophyll, phycocyanin, and carotenoids, made color detection difficult. We also attempted to use the fluorescent substrate, 4-methylumbelliferone β-D-galactopyranoside, whose product, 4-methylumbelliferone, emits in the blue range; however, we were not able to detect fluorescence over the background fluorescence of the cells. Finally we tried fluorescein β-D-galactopyranoside (FDG), a very sensitive fluorogenic substrate for β-galactosidase. FDG, which is not fluorescent, is hydrolyzed in two steps by β-galactosidase, first to fluorescein monogalactoside and then to fluorescein. We modified the method developed to visualize lacZ expression during sporulation in Bacillus subtilis (Bylund et al., 1994; Chung et al., 1995). That protocol specified 5-octanolyaminofluorescein di-β-D-galactopyranoside (C8-FDG); however we had poor results with C8-FDG, so we tried the more lipophilic 5-dodecanolyaminofluorescein di-β-D-galactopyranoside (C12-FDG) (Miao et al., 1993; Plovins et al., 1994; Zhang et al., 1991), which has 12 carbons added to the fluorescein in FDG. C12-FDG proved to function well in cyanobacteria. Using C12-FDG we have been able to easily visualize heterocyst-specific expression of genes, such as cnfR1, the activator of the nitrogenase genes in heterocysts (Pratte and Thiel, 2016), fused to lacZ (Figure 1).
Materials and Reagents
1.7 ml Avant microtubes (MIDSCI, catalog number: AVSS1700 )
Aluminum foil
0.22 µm filter (Thermo Fisher Scientific, Fisher Scientific, catalog number: 09-720-004 )
Microscope cover glass (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-545A )
Microscope slides (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-550-A3 )
BP830, an A. variabilis ATCC 29413 derivative, containing a pcnfR1:lacZ fusion (Pratte and Thiel, 2016)
Ammonium chloride (NH4Cl) (Thermo Fisher Scientific, Fisher Scientific, catalog number: A661-500 )
TES buffer (AG Scientific, catalog number: T-1050 )
DMSO (Dimethyl sulfoxide) (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP231-1 )
Millipore water
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: M63-500 )
Calcium chloride dihydrate (CaCl2·2H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP510-500 )
Sodium chloride (NaCl) (Thermo Fisher Scientific, Fisher Scientific, catalog number: S271-1 )
Potassium phosphate dibasic anhydrous (K2HPO4) (Thermo Fisher Scientific, Fisher Scientific, catalog number: P288-500 )
Manganese chloride tetrahydrate (MnCl2·4H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: M87-100 )
Sodium molybdate dihydrate (Na2MoO4·2H2O) (Sigma-Aldrich, catalog number: M1003 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: Z76-500 )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP346-500 )
Boric acid (H3BO3) (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP168-500 )
Cobaltous chloride hexahydrate (CoCl2·6H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: C371-100 )
Potassium hydroxide (KOH) (Thermo Fisher Scientific, Fisher Scientific, catalog number: P250-500 )
Ethylenediaminetetraacetic acid (Na2EDTA·2H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP120-1 )
Ferrous sulfate heptahydrate (FeSO4·7H2O) (Thermo Fisher Scientific, Fisher Scientific, catalog number: I146-500 )
25% glutaraldehyde solution (Sigma-Aldrich, catalog number: G5882 )
ImaGene GreenTM C12FDG lacZ Gene Expression Kit (Thermo Fisher Scientific, catalog number: I2904 )
p-Phenylenediamine (Sigma-Aldrich, catalog number: P-6001 )
Glycerol (Thermo Fisher Scientific, catalog number: G33-1 )
Sodium bicarbonate (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP328-500 )
Allen and Arnon (AA) medium (Allen and Arnon, 1955): (AA/8 = 8-fold dilution of AA) (see Recipes)
AA/8 media
AA Phosphate stock solution
K2HPO4 stock solution
Microelements stock solution
AA FeEDTA solution
0.04% glutaraldehyde solution (see Recipes)
100 µM 5-dodecanoylaminefluorescein di-β-d galactopyranoside (C12-FDG) in 25% DMSO (see Recipes)
0.5 M carbonate buffer (see Recipes)
Antifade solution (see Recipes)
Equipment
125-ml glass flasks (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10-040D )
Plugs for 125-ml flasks (Thermo Fisher Scientific, Fisher Scientific, catalog number: 1412740C )
Shaker (set at 170 rpm) (Eppendorf, New BrunswickTM, model: Innova® 2100 )
Centrifuge (Eppendorf, model: 5415D )*
Incubator (waterbath) (set at 37 °C) (Polyscience, model: 2LS-M )*
Environmental chamber set at 30 °C with 70% humidity and light
Spectrophotometer (Bibby Scientific, JENWAY, model: 7300 )
Zeiss Confocal LSM700 using a Plan-Apochromat 63x/1.4 Oil DIC M27 objective (Carl Zeiss, model: LSM700)
*Note: These products have been discontinued.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Pratte, B. S. and Thiel, T. (2017). Fluorescence in situ Localization of Gene Expression Using a lacZ Reporter in the Heterocyst-forming Cyanobacterium Anabaena variabilis. Bio-protocol 7(1): e2084. DOI: 10.21769/BioProtoc.2084.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Gene expression
Microbiology > Microbial cell biology > Cell staining
Molecular Biology > DNA > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,085 | https://bio-protocol.org/exchange/protocoldetail?id=2085&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Histone H3 Cleavage Assay for Yeast and Chicken Liver H3 Protease
SC Sakshi Chauhan
GA Gajendra Kumar Azad
RT Raghuvir Singh Tomar
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2085 Views: 8691
Edited by: Yanjie Li
Reviewed by: Damián Lobato-Márquez
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Histone proteins are subjected to a wide array of reversible and irreversible post-translational modifications (PTMs) (Bannister and Kouzarides, 2011; Azad and Tomar, 2014). The PTMs on histones are known to regulate chromatin structure and function. Histones are irreversibly modified by proteolytic clipping of their tail domains. The proteolytic clipping of histone tails is continuously attracting interest of researchers in the field of chromatin biology. We can recapitulate H3-clipping by performing in vitro H3 cleavage assay. Here, we are presenting the detailed protocol to perform in vitro H3 cleavage assay.
Keywords: Histone H3 Chicken liver H3 protease Yeast H3 protease Histone clipping Chromatin
Background
Histone H3 clipping is the least understood mechanism of chromatin modification and regulation. It is expected that H3 clipping will permanently erase PTMs from the nucleosomes that might affect chromatin related events. Moreover, the fate of cleaved histones is still under investigation and it has been suggested that the cleaved histones might be recycled at specific regions of chromatin or they are targeted for degradation. There are various reports that describe in vivo clipping of histone H3 in different organisms, while in vitro assays for histone H3-specific clipping are limited. We need an efficient and robust in vitro assay for characterizing histone specific proteases. To this end, we present a protocol that can be used to examine the in vitro histone H3 clipping activity of yeast and chicken liver histone H3 proteases. We have optimized temperature and pH conditions for the assay. Under our optimized conditions, proteases were found to specifically cleave histone H3 out of all core histones. We have extensively used this protocol in our recent publications (Chauhan et al., 2016; Chauhan and Tomar, 2016; Azad and Tomar, 2016; Mandal et al., 2014; Mandal et al., 2013; Mandal et al., 2012). This protocol can be used to identify and characterize histone H3 specific proteases from different organisms ranging from yeast to mammals.
Materials and Reagents
1.5 ml centrifuge tubes (Tarsons)
Dialysis tubing cellulose membrane (Sigma-Aldrich, catalog number: D9277 )
Amicon ultra centrifugal filters (EMD Millipore, catalog number: UFC900396 )
Cheese cloth
Freshly extracted or frozen chicken brain tissue
Saccharomyces cerevisiae yeast cells (BY4743 strain)
Freshly extracted liver tissue from chicken
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Sucrose (Sigma-Aldrich, catalog number: S7903 )
Sodium chloride (NaCl) (EMD Millipore, catalog number: 567440 )
Acetone (HiMedia Laboratories, catalog number: AS024 )
Lyticase (Sigma-Aldrich, catalog number: L4025 )
Protein A sepharose bead (GE Healthcare, catalog number: 17-0963-03 )
Ammonium persulfate (Sigma-Aldrich, catalog number: A3678 )
Ammonium sulfate [(NH4)2SO4] (Sigma-Aldrich, catalog number: A2939 )
Coomassie Brilliant Blue R (Sigma-Aldrich, catalog number: B0149 )
Potassium chloride (KCl) (EMD Millipore, catalog number: 104936 )
Spermidine (Sigma-Aldrich, catalog number: S2626 )
Spermine (Sigma-Aldrich, catalog number: 85590 )
EDTA (Sigma-Aldrich, catalog number: EDS )
EGTA (Sigma-Aldrich, catalog number: E3889 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: 7626 )
Disodium hydrogen phosphate (EMD Millipore, catalog number: 106586 )
Sodium dihydrogen phosphate (EMD Millipore, catalog number: 106370 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Glycerol (EMD Millipore, catalog number: 104093 )
Protease inhibitor cocktail (PIC) (Sigma-Aldrich, catalog number: P2714 )
Potassium acetate (Sigma-Aldrich, catalog number: P1190 )
DTT (Sigma-Aldrich, catalog number: D9779 )
Sorbitol (Sigma-Aldrich, catalog number: S6021 )
Magnesium chloride hexahydrate (MgCl2) (Sigma-Aldrich, catalog number: 63064 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Trizma base (Sigma-Aldrich, catalog number: T6066 )
Hydroxyapatite resin (Sigma-Aldrich, catalog number: 289396 )
Sulfuric acid (H2SO4) (EMD Millipore, catalog number: 112080 )
Acrylamide (Sigma-Aldrich, catalog number: A8887 )
GLUD1 antibody (Sigma-Aldrich, catalog number: SAB2100932-50UG )
Note: This Product has been discontinued.
Solution 1 (see Recipes)
Hypotonic solution (see Recipes)
Sodium phosphate buffer (1 M), pH 6.8 (see Recipes)
HB buffer (see Recipes)
HAP buffer (see Recipes)
Potassium acetate solution (see Recipes)
Prespheroplasting buffer (see Recipes)
Spheroplasting buffer (see Recipes)
Wash buffer (see Recipes)
Lysis buffer (see Recipes)
Protein A sepharose beads (50% slurry) (see Recipes)
Yeast-protease resuspension buffer (see Recipes)
Protease dialysis buffer (see Recipes)
Reaction buffer
Yeast protease reaction buffer (see Recipes)
Chicken liver protease reaction buffer (see Recipes)
10% Triton X-100 solution (see Recipes)
6x SDS-PAGE loading dye (see Recipes)
10x SDS-PAGE running buffer (see Recipes)
Equipment
Homogenizer (Pro Scientific, model: Bio-Gen PRO200 homogenizer )
Potter-Elvehjem PTFE pestle and glass tube (Sigma-Aldrich, catalog number: P7734 )
Centrifuge (Beckman Coulter, models: Avanti® J-E centrifuge-floor , Microfuge® 22R centrifuge )
Sonicator (Boston Industries, model: Branson Digital Sonifier 250 & 102C Converter Ultrasonic Dismembrator )
Note: This product has been sold out.
Ultracentrifuge (Beckman Coulter, model: OptimaTM L-100K ultracentrifuge )
Bio-Rad electrophoresis power supply (Bio-Rad Laboratories, model: PowerPacTM Basic Power Supply )
Bio-Rad SDS-PAGE running apparatus (Bio-Rad Laboratories, model: Mini-PROTEAN tetra cell )
Shaker (Eppendorf, model: New BrunswickTM Innova® 44 )
Rotamer (Tarsons, catalog number: 3090 )
Heating block, Thermocell Cooling and heating Block (Bio-Equip, model: HB-202 )
FPLC cold cabinet (UniEquip, model: Unichromat 1500 )
SuperoseTM 6, 10/300 GL chromatography column (GE Healthcare, catalog number: 17-5172-01 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chauhan, S., Azad, G. K. and Tomar, R. S. (2017). In vitro Histone H3 Cleavage Assay for Yeast and Chicken Liver H3 Protease. Bio-protocol 7(1): e2085. DOI: 10.21769/BioProtoc.2085.
Download Citation in RIS Format
Category
Cancer Biology > Cancer biochemistry > Protein
Biochemistry > Protein > Activity
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,086 | https://bio-protocol.org/exchange/protocoldetail?id=2086&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays
MS Megan M. Senchuk
D Dylan J. Dues
JR Jeremy M. Van Raamsdonk
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2086 Views: 13441
Edited by: Jyotiska Chaudhuri
Reviewed by: Michael Enos
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
Oxidative stress has been proposed to be one of the main causes of aging and has been implicated in the pathogenesis of many diseases. Sensitivity to oxidative stress can be measured by quantifying survival following exposure to a reactive oxygen species (ROS)-generating compound such as paraquat or juglone. Sensitivity to oxidative stress is a balance between basal levels of ROS, the ability to detoxify ROS, and the ability to repair ROS-mediated damage.
Keywords: Oxidative stress C. elegans Paraquat Juglone Stress resistance Reactive oxygen species
Background
A number of approaches have been used to test sensitivity to oxidative stress in Caenorhabditis elegans including exposure to paraquat, juglone, t-BOOH, arsenite, H2O2, or hyperbaric oxygen(Keith et al., 2014). All of these assays serve to increase the levels of ROS in the worm to a point where survival is decreased. The assays differ in the primary type of ROS that the worm is exposed to (e.g., superoxide, hydrogen peroxide), the rate of exposure (acute versus chronic) and the subcellular compartment believed to be most affected (e.g., paraquat increases superoxide levels primarily in the mitochondria (Castello et al., 2007). Based on these differences, it is possible that a particular strain of worm exhibits increased sensitivity or increased resistance to oxidative stress in one assay, but does not show a difference in another assay. It is also possible that a strain of worms is sensitive to oxidative stress at one age, but resistant to that same form of oxidative stress at a different age. Thus, to obtain a full understanding of sensitivity to oxidative stress in a particular strain it is necessary to use multiple assays at different time points.
Materials and Reagents
Petri dishes 60 x 15 mm 500/cs (Thermo Fisher Scientific, Fisher Scientific, catalog number: FB0875713A )
Petri dishes 35 x 10 mm 500/cs (Thermo Fisher Scientific, Fisher Scientific, catalog number: FB0875711YZ )
Autoclave tape
Aluminum foil
99.95% Platinum, 0.05% Iridium Wire (3 ft/pk) (Tritech Research, catalog number: PT-9901 )
OP50 E. Coli bacteria (University of Minnesota, C. elegans Genetics Center, N/A)
Experimental and control C. elegans strains (University of Minnesota, C. elegans Genetics Center, N/A)
Eggs from experimental and control C. elegans strains
Methyl viologen dichloride hydrate (paraquat) (Sigma-Aldrich, catalog number: 856177 )
FUdR (5-fluoro-2’-deoxyuridine) (Sigma-Aldrich, catalog number: F0503 )
5-hydroxy-1,4-naphthoquinone (juglone) (Sigma-Aldrich, catalog number: H47003 )
100% ethanol
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Bacto peptone (BD, catalog number: 211677 )
Agar (Sigma-Aldrich, catalog number: A1296 )
Cholesterol (Sigma-Aldrich, catalog number: C8667 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: M1880 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C3881 )
Potassium phosphate dibasic (K2HPO4) (Sigma-Aldrich, catalog number: P2222 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Tryptone (Sigma-Aldrich, catalog number: T7293 )
Yeast extract (Sigma-Aldrich, catalog number: 70161 )
0.5% cholesterol (see Recipes)
1 M MgSO4 (see Recipes)
1 M CaCl2 (see Recipes)
KPI (see Recipes)
Nematode growth medium (NGM) (see Recipes)
1 M paraquat (see Recipes)
3.33 M paraquat (see Recipes)
0.1 M FUdR stock solution (see Recipes)
Juglone stock solution (12 mM) (see Recipes)
2 YT medium (see Recipes)
Equipment
Erlenmeyer flask (Thermo Fisher Scientific, Fisher Scientific, catalog number: FB5006000 )
M50 stereomicroscope (Leica, model: 10450154 )
Pipetor (Gilson, catalog number: F167300 )
Autoclave (Tuttnauer, model: 6690 )
Stirring hotplate (Corning, catalog number: 6795-620 )
Centrifuge (Eppendorf, model: 5430 )
Refrigerated incubator (Thermo Fisher Scientific, Thermo scientificTM, model: 51028064 ; 37-20)
Bunsen burner (Humbolt, catalog number: H5870 )
Software
GraphPad Prism software (we use Version 5.01)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Senchuk, M. M., Dues, D. J. and Van Raamsdonk, J. M. (2017). Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol 7(1): e2086. DOI: 10.21769/BioProtoc.2086.
Download Citation in RIS Format
Category
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,087 | https://bio-protocol.org/exchange/protocoldetail?id=2087&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Examination of the Interaction between a Membrane Active Peptide and Artificial Bilayers by Dual Polarisation Interferometry
Jennifer A.E. Payne
Tzong-Hsien Lee
Marilyn A. Anderson
Marie-Isabel Aguilar
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2087 Views: 7096
Edited by: Marc-Antoine Sani
Reviewed by: Filipa Vaz
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Examining the interaction of peptides with lipid bilayers to determine binding kinetics is often performed using surface plasmon resonance (SPR). Here we describe the technique of dual polarisation interferometry (DPI) that provides not only information on the kinetics of the peptide binding to the bilayer, but also how the peptide affects the lipid order of the bilayer.
Keywords: Membrane interaction Bilayer Peptide Kinetics Lipid order Protein-lipid interaction
Background
The search for and development of new drugs to effectively treat resistant infections is a serious challenge. One group of molecules, the antimicrobial peptides, shows promise as effective new therapeutics due to their range of activity against bacterial, fungal and cancer cells (Mader and Hoskin, 2006; van der Weerden et al., 2013). The cell killing ability of antimicrobial peptides often involves interaction with the membrane (Brogden, 2005; Zasloff, 2002). To develop these peptides as effective therapeutics we need to understand the nature of the interaction of the peptide with the cell membrane and why this interaction results in cell death. That is, we need to know the full sequence of events that occurs between the peptide and the membrane in real time; from the initial electrostatic interaction of the peptide with the bilayer, to phospholipid selectivity, to final disruption of the membrane including changes in lipid order.
Most techniques that examine peptide-lipid interactions have a limited capacity to provide information on the entire process. For example, surface plasmon resonance (SPR) provides binding data in real time but does not reveal how peptide binding affects membrane structure (Green et al., 2000; Mozsolits and Aguilar, 2002). Other techniques such as quartz crystal microbalance (QCM) and atomic force microscopy (AFM) provide very little time resolved data as they provide information on the overall state of the system. In contrast, dual polarisation interferometry (DPI) provides real-time changes and enables quantification of the thickness, mass/density and birefringence of the membrane during peptide binding. Birefringence quantifies the degree of alignment and uniaxial packing of the lipid molecules. The changes in birefringence that occur relative to the amount of peptide bound provide information on the rate that membrane order changes, which is not available with other techniques. DPI provides unique insights into the mechanism of peptide binding, including how the peptide destabilizes the membrane, by following the dynamic changes that occur in real time as peptide binding disrupts the packing of the lipids.
This method describes DPI measurements used to examine the interaction between peptides and lipid bilayers using the Analight BIO200 (Farfield Group Ltd, Manchester, UK). The interaction between the bilayer and the interacting peptide occurs on a dual slab waveguide sensor chip that is illuminated with two alternating polarized laser beams (He-Ne, wavelength 632.8 nm). The sensor chip has four layers of silicon oxynitride deposited on a silicon wafer surface with an upper sensing waveguide that supports the lipid bilayer, and a lower optical reference waveguide. Two orthogonal polarizations are passed through the sensor chip creating two different waveguide modes; the transverse electric (TE) and transverse magnetic (TM). Both of these modes generate a field spanning from the top sensing waveguide surface to the materials coming into contact with the sensor surface. The molecules that make contact with the surface change the refractive index. When this occurs, the phase difference between the sensing waveguide and the buried reference waveguide is altered and the position of the interference fringes changes. This interference fringe pattern for both the TE and TM illuminates a 1,024 x 1,024 element-imaging device and the data from this is transferred to the digital signaling processing unit. Data is collected every 2 milliseconds using a spatial Fourier transform method and is transferred to the computer for real time data display and further analysis of the data to reveal thickness, RI and birefringence values.
Materials and Reagents
Note: All solutions must be degassed prior to running on the DPI machine.
Liposome preparation
Round-bottom glass vials such as Kimble culture tubes 20 mm diameter, 125 mm length with screw caps (Kimble, catalog number: 73770-20125 )
Parafilm
Polycarbonate membrane; 19 mm diameter, 100 nm pore diameter (Sigma-Aldrich, catalog number: Z377419 )
Syringes (50 ml for running buffer, 3 ml for sample loading)
Wide gauge needle
Lipids
L-α-phosphatidylinositol (PI, bovine liver) (Avanti Polar Lipids, catalog number: 840042P )
L-α-phosphatidylinositol-4,5-bisphosphate (PI[4,5]P2, porcine brain) (Avanti Polar Lipids, catalog number: 840046X )
1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) (Avanti Polar Lipids, catalog number: 850757P )
1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) (Avanti Polar Lipids, catalog number: 850457P )
1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoserine (POPS) (Avanti Polar Lipids, catalog number: 840034P )
Chloroform (VWR, catalog number: 22707.320 )
Methanol (Sigma-Aldrich, catalog number: 494291 )
MilliQ water
N2 gas
MOPS (3-morpholinopropane-1-sulfonic acid) buffer (Sigma-Aldrich, catalog number: M1254 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: 793566 )
Dual polarization interferometry
10% Hellamanex II (Hellma, Müllhein, Germany)
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: 74255 )
100% ethanol
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: 746495 ) (see Recipes)
Membrane interacting protein (for example NaD1)
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: EDS ) (see Recipes)
Bovine serum albumin (BSA), fraction V, fatty acid free (Sigma-Aldrich, catalog number: 10775835001 )
MilliQ water
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S5881 )
Bulk buffer (see Recipes)
2% SDS (see Recipes)
80% ethanol (see Recipes)
Equipment
Liposome production
Water bath
Fume hood
Vacuum pump and chamber
Sonicator bath
Shaking incubator
Avestin lipofast extruder (Sigma-Aldrich, catalog number: catalog number: Z373400 )
Dual polarization interferometery
Silicone oxynitride AnaChip unmodified (Farfield Group Ltd)
Gasket two-channel (Farfield Group Ltd)
Analight® Bio200 DPI instrument (Farfield Group Ltd, UK)
Harvard Apparatus PHD2000 programmable syringe pumps
Software
Analight Explorer software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Lipid > Lipid-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,088 | https://bio-protocol.org/exchange/protocoldetail?id=2088&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ex vivo Culture of Adult Mouse Antral Glands
Valeria Fernandez Vallone
Morgane Leprovots
Gilbert Vassart
Marie-Isabelle Garcia
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2088 Views: 8097
Reviewed by: Rakesh BamHui Zhu
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
The tri-dimensional culture, initially described by Sato et al. (2009) in order to isolate and characterize epithelial stem cells of the adult small intestine, has been subsequently adapted to many different organs. One of the first examples was the isolation and culture of antral stem cells by Barker et al. (2010), who efficiently generated organoids that recapitulate the mature pyloric epithelium in vitro. This ex vivo approach is suitable and promising to study gastric function in homeostasis as well as in disease. We have adapted Barker’s protocol to compare homeostatic and regenerating tissues and here, we meticulously describe, step by step, the isolation and culture of antral glands as well as the isolation of single cells from antral glands that might be useful for culture after cell sorting as an example (Fernandez Vallone et al., 2016).
Keywords: ex vivo Murine gastric epithelium Antral glands Gastric organoids 3D Single cell
Background
Mouse adult stem cells from the glandular stomach can be grown ex vivo in a 3D matrigel as ‘mini-glands’ for indefinite periods of time (Barker et al., 2010). As compared to stem cells from the mouse adult small intestine growing in presence of EGF, Noggin and R-spondin 1, gastric stem cells need to be further supplemented with Fgf10, Gastrin, Wnt3a and a higher concentration of R-spondin 1 (referred to as ENRFGW) to get productive cultures. Till recently, whether, and if so how, adult regenerating antral glands grow in the ex vivo culture system following stem cell ablation, remained unknown. Using the present protocol, it was demonstrated that homeostatic and regenerating antral glands do not grow similarly upon seeding and exhibit different growth culture requirements.
Materials and Reagents
Disposable scalpels (Swan Morton, catalog number: 0510 )
Petri dishes 92 x 16 mm with cams (SARSTEDT, catalog number: 82.1473 )
Tubes 50 ml, 30 x 115 mm, PP (Corning, Falcon®, catalog number: 352070 )
20 ml eccentric tip syringe (BD, catalog number: 300613 )
Needle 21 G x 1 ½ (BD, catalog number: 305167 )
Tips refill (VWR, catalog numbers: 89079-464 ; 89079-470 ; 89079-478 )
70 µm nylon filters (Corning, Falcon®, catalog number: 352350 )
40 µm nylon filters (Corning, Falcon®, catalog number: 352340 )
P6 well plate (VWR, catalog number: 734-2323 )
P12 well plate (VWR, catalog number: 734-2324 )
Microcentrifuge tubes, 1.5 ml (VWR, catalog number: 212-0198 )
Tubes 10 ml, 100 x 16 mm, PP (SARSTEDT, catalog number: 62.9924.284 )
Cryotubes 1 ml (Greiner Bio One, catalog number: 123263 )
Syringe filter 0.2 µm (VWR, catalog number: 28145-477 )
Serological pipets 5 ml, 10 ml and 25 ml (Corning, Falcon®, catalog numbers: 357543 ; 357551 ; 357535 )
Mice (RjOrl:SWISS and C57BL/6JRj backgrounds-6 to 8 weeks old-males and females)
Dulbecco’s phosphate-buffered saline (DPBS), CaCl2 free, MgCl2 free (Thermo Fisher Scientific, GibcoTM, catalog number: 14190-094 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270 )
Stem Pro Accutase cell dissociation reagent (Thermo Fisher Scientific, GibcoTM, catalog number: A1110501 )
Matrigel® basement membrane matrix (Corning, catalog number: 354234 )
Liquid nitrogen (supplied from Air liquide)
500 mM EDTA (pH 8.0) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575-038 )
Albumin from bovine serum (BSA) (Sigma-Aldrich, catalog number: A3294 )
Advanced DMEM/F12 (Thermo Fisher Scientific, GibcoTM, catalog number: 12634-010 )
Gentamycin 50 mg/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15750-037 )
Penicillin-streptomycin cocktail 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
Amphotericin B 250 µg/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15290-026 )
L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030-081 )
N-2 supplement 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 17502-048 )
B-27 w/o vit. A 50x (Thermo Fisher Scientific, GibcoTM, catalog number: 12587-010 )
1 M HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630-056 )
N-acetyl cysteine (Sigma-Aldrich, catalog number: A7250 )
Growth factors:
Recombinant murine EGF (Peprotech, catalog number: 315-09 )
Recombinant murine Noggin (Peprotech, catalog number: 250-38 )
Recombinant murine CHO-derived R-spondin 1 (R&D Systems, catalog number: 7150-RS/CF )
Recombinant murine Fgf10 (R&D Systems, catalog number: 6224-FG )
Recombinant murine Wnt3a (R&D Systems, catalog number: 1324-WN/CF )
Gastrin I (Sigma-Aldrich, catalog number: SCP0152 )
Rho kinase inhibitor Y27632 (Sigma-Aldrich, catalog number: Y0503 )
DMSO (Sigma-Aldrich, catalog number: D8418 )
Propanol-2 (VWR, catalog number: 1.09634.9900 )
Ethanol 95-97% (VWR, TechniSolv®, catalog number: 84857.360 )
70% ethanol (see Recipes)
DPBS-EDTA (10 mM) (see Recipes)
DPBS-BSA 2%-EDTA (2 mM) (see Recipes)
Basal crypt medium (BCM) (see Recipes)
ENRGWF medium for initial seeding (see Recipes)
ENRGWF medium for maintenance (see Recipes)
Freezing medium (see Recipes)
De-freezing medium (see Recipes)
Equipment
Binocular (Motic, model: SMZ-168 )
Cold light source (SCHOTT, model: KL1500 LCD )
Scissors: straight sharp tip (Fine Science Tool, catalog numbers: 14090-09 and 14084-08 )
Angled serrated tip forceps (Fine Science Tool, catalog number: 11080-02 )
Standard (fine) tip forceps (Fine Science Tool, catalog number: 11251-20 )
Micro-dissecting scissors (Fine Science Tool, catalog number: 15018-10 )
Refrigerated centrifuge (Beckman Coulter, model: Allegra X-15R )
MaxQTM 4000 shaker with adaptable temperature (Thermo Fisher Scientific, Thermo ScientificTM, model: MaxQTM 4000)
Biological safety cabinet (Esco Micro Pte, model: Class II Type A2 )
Pipettors with Tip Ejector 20-200 µl and 100-1,000 µl (VWR, catalog numbers: 89079-970 and 89079-974 )
Cell culture incubator (37 °C, 5% CO2) (BINDER, model: C150 )
Inverted bright field microscope (Motic, model: AE31 )
Nalgene Cryo ‘Mr Frosty’ freezing container (Thermo Fisher Scientific, Thermo ScientificTM, model: 5100-0050 )
Ultra-low temperature upright freezer (Thermo Fisher Scientific, model: Thermo scientific Queue Basic)
Cryostorage system K Series (Taylor-Wharton, model: 24K )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Vallone, V. F., Leprovots, M., Vassart, G. and Garcia, M. (2017). Ex vivo Culture of Adult Mouse Antral Glands. Bio-protocol 7(1): e2088. DOI: 10.21769/BioProtoc.2088.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Maintenance and differentiation
Cell Biology > Cell isolation and culture > 3D cell culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,089 | https://bio-protocol.org/exchange/protocoldetail?id=2089&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ex vivo Culture of Fetal Mouse Gastric Epithelial Progenitors
Valeria Fernandez Vallone
Morgane Leprovots
Gilbert Vassart
Marie-Isabelle Garcia
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2089 Views: 8519
Reviewed by: Rakesh BamHui Zhu
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Isolation and tridimensional culture of murine fetal progenitors from the digestive tract represents a new approach to study the nature and the biological characteristics of these epithelial cells that are present before the onset of the cytodifferentiation process during development. In 2013, Mustata et al. described the isolation of intestinal fetal progenitors growing as spheroids in the ex vivo culture system initially implemented by Sato et al. (2009) to grow adult intestinal stem cells. Noteworthy, fetal-derived spheroids have high self-renewal capacity making easy their indefinite maintenance in culture. Here, we report an adapted protocol for isolation and ex vivo culture and maintenance of fetal epithelial progenitors from distal pre-glandular stomach growing as gastric spheroids (Fernandez Vallone et al., 2016).
Keywords: ex vivo Spheroids Mouse fetal epithelium Progenitors 3D Single cells
Background
Mouse adult stem cells from the glandular stomach can be grown ex vivo in a 3D matrigel as ‘mini-glands’ for indefinite periods of time (Barker et al., 2010). As compared to stem cells from the small intestine growing in presence of EGF, Noggin and R-spondin 1, adult gastric stem cells need to be further supplemented with Fgf10, Gastrin, Wnt3a and a higher concentration of R-spondin 1 to get productive long-term cultures. In contrast, little was known till recently about the fetal cells that line the pre-glandular epithelium during development. So far, their nature as well as their potential growth properties ex vivo were uncharacterized. Based on the previous study identifying the cells present in the fetal small intestine (Mustata et al., 2013), we report on the culture of mouse fetal gastric progenitors as spheroids (Fernandez Vallone et al., 2016). Gastric progenitors can be replated in the culture medium previously reported by Sato et al., 2009 to grow small intestinal adult stem cells and, contrary to adult-type gastric stem cells, they do not need extra growth factors supplementation (Fgf10, Wnt3a or Gastrin).
Materials and Reagents
Disposable scalpels (Swan Morton, catalog number: 0510 )
Petri dishes 92 x 16 mm with cams (SARSTEDT, catalog number: 82.1473 )
Microcentrifuge tubes, 1.5 ml (VWR, catalog number: 212-0198 )
Tubes 10 ml, 100 x 16 mm, PP (SARSTEDT, catalog number: 62.9924.284 )
Tubes 50 ml, 30 x 115 mm, PP (Corning, Falcon®, catalog number: 352070 )
70 µm nylon filters (Corning, Falcon®, catalog number: 352350 )
P6 well plate (VWR, catalog number: 734-2323 )
40 µm nylon filters (Corning, Falcon®, catalog number: 352340 )
P12 well plate (VWR, catalog number: 734-2324 )
Tips refill (VWR, catalog numbers: 89079-464 ; 89079-470 ; 89079-478 )
Cryotubes 1 ml (Greiner Bio One, catalog number: 123263 )
Syringe filter 0.2 µm (VWR, catalog number: 28145-477 )
Serological pipets 5 ml, 10 ml and 25 ml (Corning, Falcon®, catalog numbers: 357543 ; 357551 ; 357535 )
Mice (tested on RjOrl:SWISS and C57BL/6JRj backgrounds)
Dulbecco’s phosphate-buffered saline (DPBS), CaCl2 free, MgCl2 free (Thermo Fisher Scientific, GibcoTM, catalog number: 14190-094 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270 )
Stem Pro Accutase cell dissociation reagent (Thermo Fisher Scientific, GibcoTM, catalog number: A1110501 )
Matrigel® basement membrane matrix (Corning, catalog number: 354234 )
Liquid nitrogen (supplied from Air liquide)
Ethanol 95-97% (VWR, TechniSolv®, catalog number: 84857.360 )
Glucose (Merck Millipore, catalog number: 1083371000 )
Leibovitz’s L-15 medium (Thermo Fisher Scientific, catalog number: 11415-049 )
500 mM EDTA (pH 8.0) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 15575-038 )
Albumin from bovine serum (BSA) (Sigma-Aldrich, catalog number: A3294 )
Advanced DMEM/F12 (Thermo Fisher Scientific, GibcoTM, catalog number: 12634-010 )
Gentamycin 50 mg/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15750-037 )
Penicillin-streptomycin cocktail 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
Amphotericin B 250 µg/ml (Thermo Fisher Scientific, GibcoTM, catalog number: 15290-026 )
L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 25030-081 )
N-2 supplement 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 17502-048 )
B-27 w/o vit. A 50x (Thermo Fisher Scientific, GibcoTM, catalog number: 12587-010 )
1 M HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630-056 )
N-acetyl cysteine (Sigma-Aldrich, catalog number: A7250 )
Growth factors
Recombinant murine EGF (Peprotech, catalog number: 315-09 )
Recombinant murine Noggin (Peprotech, catalog number: 250-38 )
Recombinant murine CHO-derived R-spondin1 (R&D Systems, catalog number: 7150-RS/CF )
Rho kinase inhibitor Y27632 (Sigma-Aldrich, catalog number: Y0503 )
DMSO (Sigma-Aldrich, catalog number: D8418 )
Propanol-2 (VWR, catalog number: 1.09634.9900 )
70% ethanol (see Recipes)
1 M glucose (see Recipes)
Embryo’s medium (see Recipes)
DPBS-EDTA 5 mM (see Recipes)
DPBS-BSA 2%-EDTA 2 mM (see Recipes)
Basal crypt medium (BCM) (see Recipes)
ENR medium for initial seeding (see Recipes)
ENR medium for maintenance (see Recipes)
Freezing medium (see Recipes)
De-freezing medium (see Recipes)
Equipment
Binocular (Motic, model: SMZ-168 )
Cold light source (SCHOTT, model: KL1500 LCD )
Scissors: straight sharp tip (Fine Science Tool, catalog numbers: 14090-09 and 14084-08 )
Angled serrated tip forceps (Fine Science Tool, catalog number: 11080-02 )
Standard (fine) tip forceps (Fine Science Tool, catalog number: 11251-20 )
Micro-dissecting scissors (Fine Science Tool, catalog number: 15018-10 )
Pipettors with Tip Ejector 20-200 µl and 100-1,000 µl (VWR, catalog numbers: 89079-970 and 89079-974 )
Refrigerated centrifuge Refrigerated centrifuge (Beckman Coulter, model: Allegra X-15R )
MaxQTM 4000 shaker with adaptable temperature (Thermo Fisher Scientific, Thermo ScientificTM, model: MaxQ TM 4000 )
Biological safety cabinet (Esco Micro Pte, model: Class II Type A2 )
Cell culture incubator (37 °C, 5% CO2) (BINDER, model: C150 )
Inverted bright field microscope (Motic, model: AE31 )
Nalgene Cryo ‘Mr Frosty’ freezing container (Thermo Fisher Scientific, Thermo ScientificTM, model: 5100-0050 )
Ultra-low temperature upright freezer (Thermo Fisher Scientific, model: Thermo scientific Queue Basic )
Cryostorage system K Series (Taylor-Wharton, model: 24K )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Vallone, V. F., Leprovots, M., Vassart, G. and Garcia, M. (2017). Ex vivo Culture of Fetal Mouse Gastric Epithelial Progenitors. Bio-protocol 7(1): e2089. DOI: 10.21769/BioProtoc.2089.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Maintenance and differentiation
Cell Biology > Cell isolation and culture > 3D cell culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
209 | https://bio-protocol.org/exchange/protocoldetail?id=209&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Simple RNA Preparation Procedure from Yeast for Northern Blot Using Hot Phenol
Yuehua Wei
Published: Vol 2, Iss 12, Jun 20, 2012
DOI: 10.21769/BioProtoc.209 Views: 13921
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Compared to several expensive RNA extraction kits, the following protocol provides an economic and simple method for researchers to extract yeast RNA. This method can achieve RNA quality that is sufficient for most northern blot studies in yeast.
Materials and Reagents
W303a cell line
Sodium acetate trihydrate (CH3CO2Na·3H2O) (Sigma-Aldrich, catalog number: 236500 )
Phenol (C6H5OH) (Sigma-Aldrich, catalog number: P1037 )
EDTA (Na2EDTA·2H2O) (Sigma-Aldrich, catalog number: ED2SS )
Acetic acid (CH3COOH) (Sigma-Aldrich, catalog number: 320099 )
Chloroform (CHCl3) (Sigma-Aldrich, catalog number: 472476 )
8-hydroxyquinoline (C9H7NO) (Sigma-Aldrich, catalog number: 252565 )
NaCl (Thermo Fisher Scientific, catalog number: S641-500 )
Synthetic complete (SC) medium
SDS (Sigma-Aldrich, catalog number: L3771 )
Isoamyl alcohol (Sigma-Aldrich, catalog number: W205710 )
Ethanol (Thermo Fisher Scientific, catalog number: 64-17-5 )
DEPC water
Phenol-AE buffer (see Recipes)
Phenol: CHCl3/AE-Na (see Recipes)
CHCl3: Isoamyl alcohol (24:1) (see Recipes)
Equipment
Standard bench-top centrifuge
Microfuge
Shaker
1.5 eppendorf tube
Liquid nitrogen
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wei, Y. (2012). A Simple RNA Preparation Procedure from Yeast for Northern Blot Using Hot Phenol. Bio-protocol 2(12): e209. DOI: 10.21769/BioProtoc.209.
Download Citation in RIS Format
Category
Molecular Biology > RNA > RNA extraction
Microbiology > Microbial genetics > RNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,090 | https://bio-protocol.org/exchange/protocoldetail?id=2090&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Optogenetic Mapping of Synaptic Connections in Mouse Brain Slices to Define the Functional Connectome of Identified Neuronal Populations
SM Susana Mingote
NC Nao Chuhma
SR Stephen Rayport
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2090 Views: 10026
Edited by: Geoff Lau
Reviewed by: Pascal Fossat Ehsan Kheradpezhouh
Original Research Article:
The authors used this protocol in Dec 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2015
Abstract
Functional connectivity in a neural circuit is determined by the strength, incidence, and neurotransmitter nature of its connections (Chuhma, 2015). Using optogenetics the functional synaptic connections between an identified population of neurons and defined postsynaptic target neurons may be measured systematically in order to determine the functional connectome of that identified population. Here we describe the experimental protocol used to investigate the excitatory functional connectome of ventral midbrain dopamine neurons, mediated by glutamate cotransmission (Mingote et al., 2015). Dopamine neurons are made light sensitive by injecting an adeno-associated virus (AAV) encoding channelrhodopsin (ChR2) into the ventral midbrain of DATIREScre mice. The efficacy and specificity of ChR2 expression in dopamine neurons is verified by immunofluorescence for the dopamine-synthetic enzyme tyrosine hydroxylase. Then, slice patch-clamp recordings are made from neurons in regions recipient to dopamine neuron projections and the incidence and strength of excitatory connections determined. The summary of the incidence and strength of connections in all regions recipient to dopamine neuron projections constitute the functional connectome.
Keywords: Channelrhodopsin Dopamine Cotransmission Patch-clamp Immunofluorescence Adeno associated virus
Background
To establish the function of specific neural circuits it is necessary to determine the anatomical connectome, the mapping of anatomical connections, and its functional connectome, the mapping of the strength, incidence and neurotransmitter nature of connections. The use of viral transsynaptic tracing techniques that are monosynaptically restricted, allows for the description of complex anatomical connections of neural circuits, including the dopamine system (Callaway and Luo, 2015; Faget et al., 2016). The functional connectivity of these circuits has been harder to determine due to the intermingling of axons that make selective electrical stimulation impossible. With the advent of optogenetics it became possible to stimulate genetically defined populations of cells selectively. This allowed for the identification of new connections made by striatal medium spiny neurons (Chuhma et al., 2011), ventral midbrain glutamate neurons (Hnasko et al., 2012; Root et al., 2014) and dopamine/glutamate neurons (Mingote et al., 2015). Moreover, optogenetics used in a systematic and comprehensive manner to map the incidence and strength of connections of specific neuronal populations to defined postsynaptic target regions, determines the functional connectome of defined neuronal populations (Chuhma et al., 2011; Mingote et al., 2015). In this protocol, we describe how to determine the functional connectome of any genetically defined neuronal population. As an example, we focus on the excitatory functional connectome of dopamine neurons, mediated by glutamate cotransmission (Mingote et al., 2015).
Part I: Inducing channelrhodopsin expression in dopamine neurons by viral transfection
Materials and Reagents
Glass PCR micropipettes with 1 μl marks (Drummond Scientific, catalog number: 5-000-1001-X10 )
Kimwipe
Syringe
Q-tip
Surgical blades No.11 (Thomas Scientific, catalog number: 3883B59 )
Needle
Mice (THE JACKSON LABORATORY, Strain 006660: DATIREScre )
Note: This knock-in mouse expresses cre recombinase under the transcriptional control of the endogenous dopamine transporter (DAT) promoter. To minimize the interference with the DAT promoter function, cre recombinase expression is driven from the 3’ untranslated region via an internal ribosomal entry sequence (IRES).
AAV5-EF1α-DIO-hChR2(H134R)-EYFP (titer: 8x10e-12 virions/ml) (Addgene, catalog number: 20298 ) is used to drive cre-dependent expression of ChR2-EYFP. The adeno-associated virus (AAV) can be obtained under a MTA from Dr. Karl Deisseroth from the vector core at the University of North Carolina; this AAV is serotype 5 and replication-incompetent.
Paraffin
10% bleach solution
Carprofen (Rimadyl, Zoetis)
Ketamine HCl (KetaVed, Vedco)
Xylazine (Akorn, AnaSed®)
Puralube VET ointment, sterile ocular lubricant (Dechra)
Lidocaine HCl (40 mg/ml) for local anesthesia (Boehringer Ingelheim)
Vetbond, n-butyl cyanoacrylate adhesive (3M)
70% ethanol solution
Betadine
Neosporin
Saline
Equipment
Pipette puller (Sutter Instruments, model: P97 )
NalgeneTM 280 polyurethane tubing (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 8030-0060 )
NalgeneTM 180 clear plastic PVC tubing (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 8000-0004 )
Custom valve controller that delivers momentary pulses of 24 V with 5 watts power (modified pulse controller obtained from General Valve Corporation, model: 9-82-902 )
Note: This product has been discontinued. As an alternative, use UltraMicroPumP III (World Precision Instruments, model: UMP3 ) with a TAXIC900 stereotaxic frame, which allows for a precise control of the rate of delivery of the virus.
Air pressure regulator with gauge (General Cryogenics & Specialty Gas Co.)
Hair clipper (e.g., Wahl Clipper, model: 09916-4301 )
Heating pad, water-circulating
Mouse stereotaxic apparatus (Stoeling, catalog number: 51730D )
Solenoid valve (e.g., Parker Hannifin, part number: 001-0028-900 )
Scalpel handle (Thomas Scientific, catalog number: 3883H10 )
Camera (e.g., Microscope, model: 5MP , catalog number: AM7115MZT)
Video monitor (e.g., Acer)
Drill (Black & Decker, model: RTX )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Mingote, S., Chuhma, N. and Rayport, S. (2017). Optogenetic Mapping of Synaptic Connections in Mouse Brain Slices to Define the Functional Connectome of Identified Neuronal Populations. Bio-protocol 7(1): e2090. DOI: 10.21769/BioProtoc.2090.
Mingote, S., Chuhma, N., Kusnoor, S. V., Field, B., Deutch, A. Y. and Rayport, S. (2015). Functional connectome analysis of dopamine neuron glutamatergic connections in forebrain regions. J Neurosci 35(49): 16259-16271.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Synaptic physiology
Neuroscience > Neuroanatomy and circuitry > Immunofluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,091 | https://bio-protocol.org/exchange/protocoldetail?id=2091&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Tumour-stroma Minispheroids for Drug Efficacy Testing
M Mark Watters
Eva Szegezdi
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2091 Views: 8564
Edited by: HongLok Lung
Reviewed by: Kevin Patrick O’RourkeVikash Verma
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
The three-dimensional organisation of cells in a tissue and their interaction with adjacent cells and extracellular matrix is a key determinant of cellular responses, including how tumour cells respond to stress conditions or therapeutic drugs (Elliott and Yuan, 2011). In vivo, tumour cells are embedded in a stroma formed primarily by fibroblasts that produce an extracellular matrix and enwoven with blood vessels. The 3D mixed cell type spheroid model described here incorporates these key features of the tissue microenvironment that in vivo tumours exist in; namely the three-dimensional organisation, the most abundant stromal cell types (fibroblasts and endothelial cells), and extracellular matrix. This method combined with confocal microscopy can be a powerful tool to carry out drug sensitivity, angiogenesis and cell migration/invasion assays of different tumour types.
Keywords: Mixed cell type 3-dimensional (3D) culture Tumour sphere Breast cancer TRAIL Drug resistance
Background
The traditional monolayer cell culture (2-dimensional) enforces an artificial environment, which is vastly different from the tissues cells exists in vivo. One of the most critical differences is that in monolayer cultures the cells are polarised, i.e., the surface of the cells facing the culture-plastic and the upper cell surface exposed to the culture medium receive completely different, often opposing signals (Fitzgerald et al., 2015). To address the problem of cell polarization, tumour spheroid cultures are increasingly used in cancer research. Tumour spheroids can replicate the 3-dimensional cell-cell interactions present in a tissue and to some extent paracrine signaling via cytokines and chemokines by reducing their diffusion and dilution by the growth medium that typically occurs in monolayer cultures (Lawlor et al., 2002; Barrera-Rodríguez and Fuentes, 2015). The current tumour-stroma minispheroid protocol is one such method. Compared to the other tumour-spheroid protocols, this method also incorporates additional, key features of the tissue environment, namely stromal cells and extracellular matrix in the spheroid and thus provides a model that replicates the in vivo tumour microenvironment more faithfully.
Materials and Reagents
96 U-shaped well plate for suspension cells (Greiner Bio One, catalog number: 650161 )
FiltopurTM syringe filters (SARSTEDT, catalog number: 83.1826.001 )
50 ml syringes (TERUMO, catalog number: SS+50ES )
12 well dishes with 10 mm diameter glass bottom (MATTEK, catalog number: P12G-0-10-F )
1.5 ml sterile Eppendorf tubes (SARSTEDT, catalog number: 72.690.001 )
50 ml sterile centrifuge tubes (Corning, catalog number: 430829 )
35 mm glass bottom dish, 14 mm diameter (MATTEK, catalog number: P35G-0.170-14-C )
T75 flasks for adherent cells (SARSTEDT, catalog number: 83.3911 )
Serological pipettes (5 ml, 10 ml) (CORNING, catalog numbers: 4051 and 4101 , respectively)
Pipette Tips (10 μl, 200 μl, 1,000 μl) (SARSTEDT, catalog numbers: 70.1130.100 , 70.760.002 and 70.762.100 , respectively)
Cell lines: MDA-MB-231 breast cancer epithelial cells (ATCC, HTB-26TM, catalog number: MDA-MB-231); human umbilical vein endothelial cells (HUVEC) (ATCC, CRL-1730TM, catalog number: HUV-EC-C ); normal human dermal fibroblasts (NHDF) (Lonza, catalog number: CC-2509 )
Recombinant human tumour necrosis factor-related apoptosis-inducing ligand (rhTRAIL) (purified in-house), receptor-selective TRAIL mutant, TRAIL-45 (O’Leary et al., 2016; van der Sloot et al., 2006)
Dulbecco’s modified Eagle medium (DMEM)-low glucose concentration (Sigma-Aldrich, catalog number: D6046 )
Fetal bovine serum (Sigma-Aldrich, catalog number: F7524 )
L-glutamine solution, 200 Mm stock (Sigma-Aldrich, catalog number: G7513 )
1x trypsin-EDTA buffer in HBSS
CellTrackerTM CM-Dil Dye (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C7001 ) or CMTPX red cell tracker dye (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C34552 )
Rat tail collagen type I (Corning, catalog number: 354236 )
Hoechst33342 – 10 mg/ml solution in water (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: H3570 )
SYTOX Green nucleic acid dye (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: S7020 )
Endothelial cell growth medium-2 (EGM-2) prepared by adding EGMTM-2 SingleQuotsTM Kit (Lonza, catalog number: CC-4176 ) to EBM-2 basal Medium (Lonza, catalog number: CC-3156 )
Hanks’ balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM catalog number: 24020117 )
1 N NaOH solution
Methylcellulose solution (see Recipes)
Equipment
HeraeusTM MegafugeTM centrifuge (15 ml, 50 ml tube) (Thermo Fisher Scientific, Thermo ScientificTM, model: 16 Centrifuge Series )
Mammalian cell culture incubator (37 °C, 5% CO2) (Thermo Fisher Scientific, Thermo ScientificTM, model: FormaTM Steri-CycleTM )
Hemocytometer
Pipettes (10 μl, 200 μl, 1,000 μl)
Pipette aid
Confocal microscopy system (AndorTM, Revolution Spinning Disk Confocal systemTM)
High-resolution EMCCD camera (Andor iXon EM+)
Olympus IX81 motorised inverted microscope, fitted with a variable temperature/CO2 humidified incubation chamber for live cell experiments
Yokagawa CSU22 spinning disk confocal unit
Magnetic stirrer
Orbital shaker
Software
VolocityTM software (PerkinElmer)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Watters, M. and Szegezdi, E. (2017). Generation of Tumour-stroma Minispheroids for Drug Efficacy Testing. Bio-protocol 7(1): e2091. DOI: 10.21769/BioProtoc.2091.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Tumor microenvironment
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,092 | https://bio-protocol.org/exchange/protocoldetail?id=2092&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bacterial Intracellular Sodium Ion Measurement using CoroNa Green
YM Yusuke V. Morimoto
KN Keiichi Namba
TM Tohru Minamino
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2092 Views: 9379
Edited by: Arsalan Daudi
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
The bacterial flagellar type III export apparatus consists of a cytoplasmic ATPase complex and a transmembrane export gate complex, which are powered by ATP and proton motive force (PMF) across the cytoplasmic membrane, respectively, and transports flagellar component proteins from the cytoplasm to the distal end of the growing flagellar structure where their assembly occurs (Minamino, 2014). The export gate complex can utilize sodium motive force in addition to PMF when the cytoplasmic ATPase complex does not work properly. A transmembrane export gate protein FlhA acts as a dual ion channel to conduct both H+ and Na+ (Minamino et al., 2016). Here, we describe how to measure the intracellular Na+ concentrations in living Escherichia coli cells using a sodium-sensitive fluorescent dye, CoroNa Green (Minamino et al., 2016). Fluorescence intensity measurements of CoroNa Green by epi-fluorescence microscopy allows us to measure the intracellular Na+ concentration quantitatively.
Keywords: Bacteria Bacterial Flagellum FlhA Fluorescence microscopy Proton motive force Sodium ion channel PomAB complex Type III protein export
Background
Measurements of intracellular Na+ concentrations by fluorescence imaging techniques are able to be more accurately and quantitatively performed at single cell levels, because background noise of each cell can be removed by image analysis procedures. Lo et al. have established a protocol for measurement of the cytoplasmic Na+ concentrations in living E. coli cells using a sodium-sensitive fluorescent dye, Sodium Green and have shown that the cytoplasmic Na+ concentration maintains around 10 mM in E. coli over a wide range of 0 to 100 mM of the external Na+ concentrations (Lo et al., 2006). Because CoroNa Green, which is a sodium-sensitive fluorescent dye too, shows much higher cell permeability than Sodium Green, we have developed a CoroNa Green-based protocol to measure the intracellular Na+ concentrations in E. coli. (Minamino et al., 2016). This protocol allows us to quite easily and reproducibly measure the intracellular Na+ concentration of E. coli cells overexpressing FlhA or PomAB complex, both of which have the Na+ channel activity.
Materials and Reagents
1.5 ml Eppendorf tubes
Aluminum foil
Slide
24 x 32 mm coverslip (thickness: 0.12-0.17 mm) (Matsunami Glass, catalog number: C024321 )
18 x 18 mm coverslip (thickness: 0.12-0.17 mm) (Matsunami Glass, catalog number: C018181 )
Double-sided tape (NICHIBAN, catalog number: NW-5 )
Pipette tips
Filter paper
E. coli BL21(DE3) cell (Novagen)
pBAD24 expression vector (Guzman et al., 1995)
pNH319 (pBAD24/ N-His-FLAG-FlhA) (Minamino et al., 2016)
pBAD-PomΔplug (pBAD24/ PomA + PomB[∆41-120]) (Minamino et al., 2016)
Ampicillin sodium (Wako Pure Chemical Industries, catalog number: 014-23302 )
L-arabinose (Wako Pure Chemical Industries, catalog number: 010-04582 )
CoroNa Green-AM (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: C36676 )
Ethylenediamine-N, N, N', N'-tetraacetic acid, dipotassium salt, dihydrate (EDTA·2K) (Dojindo, catalog number: 340-01511 )
Sodium chloride (Wako Pure Chemical Industries, catalog number: 192-13925 )
Gramicidin (Thermo Fisher Scientific, catalog number: G6888 )
Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) (Sigma-Aldrich, catalog number: C2759 )
Bacto tryptone (BD, catalog number: 211705 )
Potassium dihydrogenphosphate (Wako Pure Chemical Industries, catalog number: 164-22635 )
Dipotassium hydrogenphosphate (Wako Pure Chemical Industries, catalog number: 164-04295 )
T-broth (see Recipes)
Equipment
haking incubator (30 °C, at 200 rpm) (TAITEC, model: BR-40LF )
Centrifuge (able to hold 1.5 ml tube, spin at 6,000 x g) (TOMY SEIKO, model: MX-305 )
Tube rotator (able to hold 1.5 ml tubes, rotate at 5 rpm) (WAKENBTECH, model: WKN-2210 )
Single channel pipettes (1,000 µl, 100 µl) (Gilson, model: P-1000 , P-100 )
Spectrophotometer (able to measure OD600) (Shimadzu, model: UV-1800 )
Inverted fluorescence microscope (Olympus, model: IX-73 )
100x oil immersion objective lens (Olympus, model: UPLSAPO100XO , NA 1.4)
sCMOS camera (Andor Technology, model: Zyla4.2 )
Mercury light source system (Olympus, model: U-HGLGPS )
Fluorescence mirror unit (Olympus, model: U-FGFP [Excitation BP 460-480; Emission BP 495-540])
Software
Image J (National Institutes of Health, https://imagej.nih.gov/ij/)
KaleidaGraph (Synergy Software)
Microsoft Excel (Microsoft)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Morimoto, Y. V., Namba, K. and Minamino, T. (2017). Bacterial Intracellular Sodium Ion Measurement using CoroNa Green. Bio-protocol 7(1): e2092. DOI: 10.21769/BioProtoc.2092.
Minamino, T., Morimoto, Y. V., Hara, N., Aldridge, P. D. and Namba, K. (2016). The bacterial flagellar type III export gate complex is a dual fuel engine that can use both H+ and Na+ for flagellar protein export. PLoS Pathog 12(3): e1005495
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell viability
Microbiology > Microbial cell biology > Cell-based analysis
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,093 | https://bio-protocol.org/exchange/protocoldetail?id=2093&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurements of Free-swimming Speed of Motile Salmonella Cells in Liquid Media
YM Yusuke V. Morimoto
KN Keiichi Namba
TM Tohru Minamino
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2093 Views: 8432
Edited by: Arsalan Daudi
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Bacteria such as Escherichia coli and Salmonella enterica swim in liquid media using the bacterial flagella. The flagellum consists of the basal body (rotary motor), the hook (universal joint) and the filament (helical screw). Since mutants with a defect in flagellar assembly and function cannot swim smoothly, motility assay is an easy way to characterize flagellar mutants. Here, we describe how to measure free-swimming speeds of Salmonella motile cells in liquid media. Free-swimming behavior under a microscope shows a significant variation among bacterial cells.
Keywords: Bacterial flagella Motility Motor Optical microscopy Proton motive force Salmonella
Background
The flagellar motor of E. coli and Salmonella is powered by downhill proton translocation along proton motive force (PMF) across the cytoplasmic membrane (Morimoto and Minamino, 2014; Minamino and Imada, 2015). The rotational speed of the proton-driven flagellar motor is proportional to total PMF (Gabel and Berg, 2003). Therefore, measurements of free-swimming speeds of motile cells allow us not only to analyze motor performance of various mutants but also to examine whether there is a significant difference in total PMF under experimental conditions (Minamino et al., 2016).
Materials and Reagents
1.5 ml Eppendorf tubes
Double-sided tape (NICHIBAN, catalog number: NW-5 )
Glass slide (Matsunami Glass, catalog number: S1126 )
18 x 18 mm coverslip (thickness: 0.12-0.17 mm) (Matsunami Glass, catalog number: C018181 )
Pipette tips
Filter paper
Salmonella SJW1103 strain (wild type for motility and chemotaxis) (Yamaguchi et al., 1984)
Salmonella MMHI0117 strain [∆fliH-fliI flhB(P28T)] (Minamino and Namba, 2008)
Bacto tryptone (BD, catalog number: 211705 )
Potassium dihydrogenphosphate (Wako Pure Chemical Industries, catalog number: 164-22635 )
Dipotassium hydrogenphosphate (Wako Pure Chemical Industries, catalog number: 164-04295 )
Bacto yeast extract (BD, catalog number: 212750 )
Bacto agar (BD, catalog number: 214010 )
Sodium chloride (Wako Pure Chemical Industries, catalog number: 192-13925 )
T-broth (TB) (see Recipes)
L-broth agar plate (see Recipes)
Equipment
Selection of single channel pipettes (1,000 µl, 100 µl) (Gilson, model: P-1000 , P-100 )
Shaking incubator (30 °C, at 200 rpm) (TAITEC, model: BR-40LF )
Centrifuge (able to hold 1.5 ml tube, spin at 6,000 x g) (TOMY SEIKO, model: MX-305 )
Spectrophotometer (able to measure OD600) (GE Healthcare, model: GeneQuant 1300 )
Note: This product has been discontinued by the manufacturer.
Phase contrast microscope (Olympus, model: CH40 )
40x objective lens
CCD camera (Hamamatsu Photonics, model: C5405 )
Objective micrometer (10 µm/pitch)
Hard-disk video recorder (Panasonic, model: DMR-XP25V )
Software
Move-tr/2D (Library Co., Tokyo)
Microsoft Excel (Microsoft)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Morimoto, Y. V., Namba, K. and Minamino, T. (2017). Measurements of Free-swimming Speed of Motile Salmonella Cells in Liquid Media. Bio-protocol 7(1): e2093. DOI: 10.21769/BioProtoc.2093.
Minamino, T., Morimoto, Y. V., Hara, N., Aldridge, P.D. and Namba, K. (2016). The bacterial flagellar type III export gate complex is a dual fuel engine that can use both H+ and Na+ for flagellar protein export. PLoS Pathog 12(3): e1005495.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell-based analysis
Cell Biology > Cell movement > Cell motility
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,094 | https://bio-protocol.org/exchange/protocoldetail?id=2094&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cation (Ca2+ and Mn2+) Partitioning Assays with Intact Arabidopsis Chloroplasts
AH Anna Harms
IS Iris Steinberger
Anja Schneider
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2094 Views: 8007
Edited by: Dennis Nürnberg
Reviewed by: Rumen IvanovYuko Kurita
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Determination of the relative distribution of Ca2+ and Mn2+ is an important tool for analyzing mutants showing altered levels of calcium and/or manganese transporters in the chloroplast envelope or thylakoid membrane. The method described in this protocol allows quantitative analyses of the relative distribution of calcium and manganese ions between chloroplast stroma and thylakoids using the isotopes [45Ca] and [54Mn] as radioactive tracers. To avoid contaminations with non chloroplastidic membrane systems, the method is designed for isolating pure and intact chloroplasts of Arabidopsis thaliana. Intact chloroplasts are isolated via Percoll gradient centrifugation. Chloroplasts are then allowed to take up [45Ca] or [54Mn] during a light incubation step. After incubation, chloroplasts are either kept intact or osmotically/mechanically treated to release thylakoids. The amount of incorporated [45Ca] or [54Mn] can be determined by liquid scintillation counting and the relative distribution calculated.
Keywords: Arabidopsis Chloroplast Ion transport Thylakoid membrane Envelope membrane Photosynthesis
Background
Calcium and manganese are structural components of photosystem II and form the inorganic Mn4CaO5 cluster, where water oxidation takes place with the outcome of electrons, protons and molecular oxygen. Ca2+ and Mn2+ fluxes across the chloroplast envelope membrane and the thylakoid membrane are fundamental processes enabling the plant cell to meet the high demand of PSII for these cations. In a previous study, a Ca2+/H+ antiport activity was analyzed using isolated thylakoid membranes from pea plants (Ettinger et al., 1999). In the model plant Arabidopsis thaliana hardly any Ca2+/H+ antiport activity is detectable in isolated thylakoid membranes (Schneider et al., 2016), thus a protocol which allows the thylakoid membrane system to reside in its naturally physiological environment, namely the chloroplast is presented. Furthermore, this protocol permits the relative distribution of Ca2+ and Mn2+ in chloroplasts to be determined. The protocol given here has been tested with Arabidopsis as well as with pea plants.
Materials and Reagents
Corex® centrifuge tubes (30 ml) (Corning, USA)
Note: This product has been discontinued. Replaceable item: 30 ml glass tubes from Krackeler Scientific, catalog number: 6-45500-30 .
Miracloth (pore size: 22-25 µm) (EMD Millipore, catalog number: 475855 )
Pipette tips (10 µl, 200 µl, 1 ml) and ‘cut-off’ pipette tips (1 ml) with the top (~2 mm) cut with a scissors
Falcon tubes (50 ml) (Greiner Bio One, catalog number: 227261 )
2 ml tubes
Aluminum foil
Scintillation vials (SARSTEDT, catalog number: 58.536 ) and push caps (SARSTEDT, catalog number: 65.816 )
Arabidopsis plants, approximately 4 weeks old (see Notes)
Percoll (GE Healthcare, catalog number: 17-0891-01 )
H2Obidest
80% (v/v) acetone (Carl Roth, catalog number: 9372.2 )
45Ca stock solution (1 mCi [37 MBq], CaCl2 > 10 Ci/g) (PerkinElmer, catalog number NEZ013001MC )
54Mn stock solution (200 µCi [7.4 MBq], MnCl2 in 0.5 N HCl > 20 Ci/g) (PerkinElmer, catalog number: NEZ040200UC )
Calciumchlorid (CaCl2) (Carl Roth, catalog number: A119.1 )
Mangan(II)-sulfat monohydrate (MnSO4·H2O) (Carl Roth, catalog number: 4487.1 )
0.1% (w/v) SDS (Carl Roth, catalog number: CN30.4 )
Rotiszint® Eco Plus scintillation cocktail (Carl Roth, catalog number: 0016.3 )
Sorbitol (Carl Roth, catalog number: 6213.2 )
Tricine (Carl Roth, catalog number: 6977.5 )
Natriumhydroxid (NaOH) (Carl Roth, catalog number: P031.2 )
EDTA (Carl Roth, catalog number: 8040.2 )
Magnesiumchlorid (MgCl2) (Carl Roth, catalog number: KK36.1 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S5761 )
BSA (Carl Roth, catalog number: 8076.3 )
Manganese(II) chloride dehydrate (MnCl2) (EMD Millipore, catalog number: 105934 )
EGTA (Carl Roth, catalog number: 3054.2 )
HEPES
45Ca working solution (see Recipes)
54Mn working solution (see Recipes)
5x resuspension buffer, pH 8.4 (see Recipes)
Homogenization buffer, pH 8.4 (see Recipes)
Import buffer, pH 8.0 (see Recipes)
Washing buffer, pH 8.0 (see Recipes)
Lysis buffer, pH 7.6 (see Recipes)
Equipment
Cold room equipped with green light (500-530 nm)
Automatic pipette controller (BrandTech Scientific, model: Accu-Jet® Pro ) and a 10 ml glass pipette
Waring blender (Waring Laboratory Science, model: 7011S) with a steel container and four razor blades
Beckman-AvantiTM J-25 centrifuge with rotors JA-14 and JS-13.1 (Beckman Coulter, model: AvantiTM J-25 )
Note: This product has been discontinued. Replaceable item: Beckman Avanti J-E series centrifuge (Beckman Coulter, model: Avanti J-E).
Centrifuge Type 4K15C for Falcon tubes (Sigma Laborzentrifugen, model: 4K15C) or any other centrifuge, which is adequate for Falcon tubes
UV/Vis spectrophotometer (Biochrom, model: UltrospecTM 2100 ) with quartz cuvettes
Light source Faser-Illuminator (Heinz Walz, model: FL-460 ) set at 90 µmol photons m-2 sec-1
Vortex shaker (Scientific Industries, model: Genie2 )
Centrifuge 5418 R with rotor FA 45-18-11 for 2 ml tubes (Eppendorf, model: 5418 R)
Liquid scintillation counter (PerkinElmer, model: Tri-Carb® 2910TR )
Isotope lab with permission for 54Mn handling, lead coat and lead shields (approximately 5 cm)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Harms, A., Steinberger, I. and Schneider, A. (2017). Cation (Ca2+ and Mn2+) Partitioning Assays with Intact Arabidopsis Chloroplasts. Bio-protocol 7(1): e2094. DOI: 10.21769/BioProtoc.2094.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Organelle isolation
Plant Science > Plant biochemistry > Other compound
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,095 | https://bio-protocol.org/exchange/protocoldetail?id=2095&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dot Blot Analysis of N6-methyladenosine RNA Modification Levels
LS Lisha Shen
Z Zhe Liang
HY Hao Yu
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2095 Views: 27621
Edited by: Antoine de Morree
Reviewed by: Xiaoyi ZhengVaibhav B Shah
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic messenger RNA (mRNA). The total amount of m6A can be detected by several methods, such as dot blot analysis using specific m6A antibodies and quantitative liquid chromatography-tandem mass spectrometry (LC-MS/MS) (Fu et al., 2014; Shen et al., 2016). Here we describe the method for fast detection of total m6A levels in mRNA by dot blot analysis using a specific m6A antibody.
Keywords: Dot blot RNA modification m6A
Background
Dot blot analysis for detecting total m6A levels in mRNA is relatively easy, fast, and cost-effective as compared to other methods, such as two-dimensional thin layer chromatography and LC-MS/MS. This approach can be used, in a qualitative manner, to evaluate temporal and spatial changes in m6A levels in various plant tissues or plants at different developmental stages. This is particularly useful for initial examination of changes in m6A levels in relevant mutants prior to detailed investigations by other complex and quantitative approaches.
Materials and Reagents
Amersham Hybond-N+ membrane (GE Healthcare, catalog number: RPN203B )
Plastic wrap
Amersham Hyperfilm ECL (GE Healthcare, catalog number: 28906835 )
Total RNA
Dynabeads® mRNA Purification Kit (Thermo Fisher Scientific, AmbionTM, catalog number: 61006 )
RNase-free water
Anti-m6A antibody (Synaptic Systems, catalog number: 202 003 )
Goat anti-rabbit IgG-HRP (Santa Cruz Biotechnology, catalog number: sc-2004 )
ECL Western Blotting Substrate (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 32106 )
1x phosphate buffered saline (1x PBS), pH 7.4
Tween 20 (Sigma-Aldrich, catalog number: P9416 )
Non-fat milk (Bio-Rad Laboratories, catalog number: 1706404 )
Wash buffer (see Recipes)
Blocking buffer (see Recipes)
Antibody dilution buffer (see Recipes)
Equipment
NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, model: NanoDropTM 2000 Spectrophotometer )
Heat block
Stratalinker 2400 UV Crosslinker (Stratalinker)
Shaker
Software
ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Shen, L., Liang, Z. and Yu, H. (2017). Dot Blot Analysis of N6-methyladenosine RNA Modification Levels. Bio-protocol 7(1): e2095. DOI: 10.21769/BioProtoc.2095.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > RNA
Molecular Biology > RNA > RNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,096 | https://bio-protocol.org/exchange/protocoldetail?id=2096&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
FICZ Exposure and Viral Infection in Mice
Taisho Yamada
Akinori Takaoka
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2096 Views: 8045
Edited by: Ivan Zanoni
Reviewed by: Meenal SinhaBenoit Chassaing
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
The aryl hydrocarbon receptor (AHR) is known as a sensor for dioxins that mediates their toxicity, and also has important biophysiological roles such as circadian rhythms, cell differentiation and immune responses. 6-formylindolo(3,2-b)carbazole (FICZ), which is derived through the metabolism of L-tryptophan by ultraviolet B irradiation, is one of putative physiological ligands for AHR (Smirnova et al., 2016). It has recently been shown that endogenously-activated AHR signaling modulates innate immune response during viral infection (Yamada et al., 2016). This section describes how to treat mice with FICZ and to infect them with virus.
Keywords: Aryl hydrocarbon receptor 6-formylindolo(3,2-b)carbazole Viral infection Innate immunity Interferon response
Background
The role of AHR had so far been investigated mainly on the basis of experiments with dioxin treatment. On the other hand, it has been shown that AHR-mediated signaling is activated by endogenous tryptophan metabolites (FICZ, Kynurenine, etc.), heme metabolites (bilirubin etc.), and eicosanoids (Lipoxin A etc.). In particular, it was demonstrated that FICZ is a physiological high affinity ligand for AHR, and many accumulating reports have shown that FICZ is involved in various basic biological processes including adaptive responses to ultraviolet light, immune responses, genomic instability, and homeostasis of stem cells. Recently, Yamada et al. (2016) demonstrated its role in innate immune response: FICZ treatment in vivo suppresses type I interferon (IFN) production in response to viral infection and promotes levels of viral titer in sera of mice.
Materials and Reagents
0.1-10 μl pipet tips (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: QSP#TF104 )
1-200 μl pipet tips (Corning, catalog number: 4845 )
100-1,000 μl pipet tips (Corning, catalog number: 4846 )
1.5 ml microcentrifuge tubes (Corning, Axygen®, catalog number: MCT-150-A )
1 ml syringe (NIPRO, catalog number: 4987458080104 )
27 G hypodermic needle (TERUMO, catalog number: NN-2719S )
Feather disposable scalpel (Sigma-Aldrich, catalog number: Z692395 )
Falcon 6-well tissue culture plate (Corning, Falcon®, catalog number: 353046 )
C57BL/6NJcl mice (male, 6 weeks of age, purchasable from CLEA Japan, model: C57BL/6NJcl mice )
Vero cells (purchasable from ATCC, catalog number: CCL-81 )
6-formylindolo(3,2-b)carbazole (FICZ) (Enzo Life Sciences, catalog number: BML-GR206-0100 )
Corn oil (stored at room temperature) (Sigma-Aldrich, catalog number: C8267 )
Vesicular stomatitis virus (VSV) (Indiana strain: Kuroda et al., 2016)
Phosphate-buffered saline (PBS) (pH 7.4) (NISSUI PHARMACEUTICAL, catalog number: 05913 )
VeriKine-HSTM mouse IFN beta serum ELISA kit (Pestka Biomedical Laboratories, catalog number: 42410 )
Dulbecco’s modified Eagle’s medium (DMEM) (‘Nissui’ ②) (NISSUI PHARMACEUTICAL, catalog number: 05919 )
Methyl cellulose, 4,000 cps (Sigma-Aldrich, catalog number: 19-2930 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437-028 )
Acetic acids (KANTO CHEMICAL, catalog number: 01021-70 )
Methanol (NACALAI TESQUE, catalog number: 21915-93 )
Crystal violet (Sigma-Aldrich, catalog number: C6158 )
Formaldehyde (Wako Pure Chemical Industries, catalog number: 063-04815 )
FICZ solution (see Recipes)
VSV stock solution (see Recipes)
Fixation solution (see Recipes)
Crystal violet staining solution (see Recipes)
Equipment
Pipettes (PIPETMAN P2) (Gilson, catalog number: F144801 )
Pipettes (PIPETMAN P20) (Gilson, catalog number: F123600 )
Pipettes (PIPETMAN P1000) (Gilson, catalog number: F123602 )
Centrifuge
Deep freezer
Biosafety hood in a biosafety level 3 (BSL3) facility (HITACHI, model: SCV-1303 ECII-AG )
Labnet VX100 vortex (Labnet International, catalog number: 13111-LV2 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yamada, T. and Takaoka, A. (2017). FICZ Exposure and Viral Infection in Mice. Bio-protocol 7(1): e2096. DOI: 10.21769/BioProtoc.2096.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Cell Biology > Cell signaling > Stress response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,097 | https://bio-protocol.org/exchange/protocoldetail?id=2097&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Treatment of Mouse and Human Cells with Endogenous Ligands for Activation of the Aryl Hydrocarbon Receptor
Taisho Yamada
Akinori Takaoka
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2097 Views: 7723
Edited by: Ivan Zanoni
Reviewed by: Meenal SinhaBenoit Chassaing
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
Activation of the aryl hydrocarbon receptor (AHR) by endogenous ligands has been implicated in a variety of physiological processes such as cell cycle regulation, cell differentiation and immune responses. It is reported that tryptophan metabolites, such as kynurenine (Kyn) and 6-formylindolo(3,2-b)carbazole (FICZ), are endogenous ligands for AHR (Stockinger et al., 2014). This protocol is designed for treatment with Kyn or FICZ in mouse embryonic fibroblasts (MEFs) or primary peripheral monocytes.
Keywords: Aryl hydrocarbon receptor Kynurenine 6-formylindolo(3,2-b)carbazole Tryptophan TCDD-inducible poly(ADP-ribose)polymerase
Background
Tryptophan metabolites such as Kyn and FICZ are endogenous ligands for AHR under physiological conditions. Kyn is generated by tryptophan-2,3-dioxygenase (TDO) and/or indoleamine-2,3-dioxygenases 1 and 2 (IDO1/2) and contributes to the suppression of antitumor response and malignant progression (Stockinger et al., 2014). FICZ is produced by exposure of L-tryptophan to ultraviolet B irradiation and is involved in many biological processes (Smirnova et al., 2016). In the adaptive immune system, FICZ is shown to promote Th17 cell response (Stockinger et al., 2014). It has also been shown that innate interferon response during viral infection is suppressed by treatment with these endogenous AHR ligands (Yamada et al., 2016). In order to evaluate the effect of AHR activation by treatment with these ligands, tryptophan-free culture medium and dialyzed FBS are used to cultivate cells under tryptophan-free conditions (Opitz et al., 2011). The detection of TCDD-inducible poly(ADP-ribose)polymerase (TIPARP) (Ma, 2002), one of the AHR-inducible genes, is analyzed to verify ligand-induced AHR activation.
Materials and Reagents
0.1-10 μl pipet tips (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: QSP#TF104 )
1-200 μl pipet tips (Corning, catalog number: 4845 )
100-1,000 μl pipet tips (Corning, catalog number: 4846 )
15 ml centrifuge tubes (Corning, Falcon®, catalog number: 352096 )
50 ml centrifuge tubes (Corning, Falcon®, catalog number: 352070 )
50 ml syringe (NIPRO, catalog number: 4987458089534 )
0.20 μm sterilizing filter (Advantec MFS, catalog number: 25CS020AS )
Falcon 12-well tissue culture plate (Corning, Falcon®, catalog number: 353043 )
Seamless cellulose tubing (EIDIA, catalog number: 410490033 )
96-well fast plate (NIPPON Genetics, catalog number: 38801 )
qPCR adhesive seal (NIPPON Genetics, catalog number: 4Ti-0560 )
Mouse embryonic fibroblasts (MEFs) of C57/B6 origin (E13.5) (Bryja et al., 2006)
CD14 microbeads, human (Miltenyi Biotec, catalog number: 130-050-201 )
Primary human peripheral monocytes, which are Isolated from peripheral blood of healthy volunteers by magnetic-activated cell sorting with CD14 microbeads according to the manufacturer’s instructions
ISOGEN (Nippon Gene, catalog number: 311-02501 )
Nuclease free-H2O (as an accessory reagent of ReverTra Ace qRT-PCR Kit) (TOYOBO, catalog number: FSQ-101 )
DNase I (Thermo Fisher Scientific, InvitrogenTM, catalog number: 18068015 )
EDTA
ReverTra Ace qRT-PCR Kit (TOYOBO, catalog number: FSQ-101)
SYBR Premix Ex Taq (2x) (Tli RNase H Plus) (Takara Bio, catalog number: RR420 )
ROX reference dye (50x) (Thermo Fisher Scientific, InvitrogenTM, catalog number: 12223-012 )
Primers for amplification of mouse TIPARP cDNA by quantitative PCR (Sigma-Aldrich):
Forward: 5’-GCCAGACTGTGTAGTACAGCC-3’
Reverse: 5’-GGGTTCCAGTTCCCAATCTTTT-3’
Primers for amplification of mouse ACTB cDNA by quantitative PCR (Sigma-Aldrich):
Forward: 5’-AGTGTGACGTTGACATCCGTA-3’
Reverse: 5’-GCCAGAGCAGTAATCTCCTTCT-3’
Primers for amplification of human TIPARP cDNA by quantitative PCR (Sigma-Aldrich):
Forward: 5’-GTTGGGGACCAGATACCGGA-3’
Reverse: 5’-CTGGGTGCAAAAGATCAGTCT-3’
Primers for amplification of human GAPDH cDNA by quantitative PCR (Sigma-Aldrich):
Forward: 5’-CATGAGAAGTATGACAACAGCCT-3’
Reverse: 5’-AGTCCTTCCACGATACCAAAGT-3’
NaCl
NaH2PO4·H2O
KCl
CaCl2
MgSO4·7H2O
Fe(NO3)3·9H2O
L-arginine·HCl
L-histidine·HCl·H2O
L-isoleucine
L-leucine
L-lysine·HCl
L-methionine
L-phenylalanine
L-threonine
Glycine
L-valine
L-cysteine·HCl·H2O
L-serine
L-tyrosine
Choline bitartrate
Folic acid
D-Ca pantothenate
Myo-Inositol
Niacinamide (Nicotinamide)
Pyridoxal·HCl
Thiamine·HCl
Riboflavin
D-glucose
Sodium pyruvate
Phenol Red Na
Succinic acid
Disodium succinate
Dulbecco’s modified Eagle’s medium (DMEM) (NISSUI PHARMACEUTICAL, catalog number: 05919 )
L-glutamine (Thermo Fisher Scientific, GibcoTM, catalog number: 21051-024 )
NaHCO3 (KANTO KAGAKU, catalog number: 37116-00 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10437-028 )
Stock solutions of L-kynurenine (Kyn) (Sigma-Aldrich, catalog number: K8625 ) and 6-formylindolo(3,2-b)carbazole (FICZ) (Enzo Life Sciences, catalog number: BML-GR206-0100 )
Phosphate-buffered saline (PBS) (pH 7.4) (NISSUI PHARMACEUTICAL, catalog number: 05913 )
Dimethylsulfoxide (DMSO) (Dojindo Molecular Technologies, catalog number: SP10 )
Isopropanol (NACALAI TESQUE, catalog number: 29113-53 )
Ethanol (99.5%) (NACALAI TESQUE, catalog number: 14713-95 )
Chloroform (KANTO CHEMICAL, catalog number: 07278-00 )
Tryptophan-free (Trp-free) DMEM (Cell Science & Technology Institute, special order) (see Recipes)
DMEM (FBS+) (see Recipes)
Trp-free DMEM (FBS+) (see Recipes)
Kyn stock solution
FICZ stock solution
Equipment
Pipettes (PIPETMAN P2) (Gilson, catalog number: F144801 )
Pipettes (PIPETMAN P20) (Gilson, catalog number: F123600 )
Pipettes (PIPETMAN P1000) (Gilson, catalog number: F123602 )
Bio clean bench (Hitachi, model: 1305BNG3-AG )
Labnet VX100 vortex (Labnet International, catalog number: 13111-LV2 )
37 °C and 5% CO2 cell culture incubator (WAKENBTECH, catalog number: 9000EX )
ABI StepOnePlusTM Real-Time PCR systems (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4379216 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yamada, T. and Takaoka, A. (2017). In vitro Treatment of Mouse and Human Cells with Endogenous Ligands for Activation of the Aryl Hydrocarbon Receptor. Bio-protocol 7(1): e2097. DOI: 10.21769/BioProtoc.2097.
Download Citation in RIS Format
Category
Immunology > Immune cell function > General
Cell Biology > Cell signaling > Stress response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,098 | https://bio-protocol.org/exchange/protocoldetail?id=2098&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Primary Culture of Mouse Neurons from the Spinal Cord Dorsal Horn
DC De-Li Cao
PJ Peng-Bo Jing
BJ Bao-Chun Jiang
YG Yong-Jing Gao
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2098 Views: 15933
Edited by: Jia Li
Reviewed by: Geoff LauFabiana Scornik
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Primary afferents of sensory neurons mainly terminate in the spinal cord dorsal horn, which has an important role in the integration and modulation of sensory-related signals. Primary culture of mouse spinal dorsal horn neuron (SDHN) is useful for studying signal transmission from peripheral nervous system to the brain, as well as for developing cellular disease models, such as pain and itch. Because of the specific features of SDHN, it is necessary to establish a reliable culture method that is suitable for testing neural response to various external stimuli in vitro.
Keywords: Neuron Culture Spinal cord Dorsal horn Pain Itch Mouse
Background
Unlike existing protocols for culturing isolated mice primary neurons from hippocampus or cerebral cortex, few methods of culturing SDHN in vitro have been reported. This protocol was mainly based on previously described methods (Hu et al., 2003; Hugel and Schlichter, 2000). Here we made a few modifications including reagents, recipes, dissection and described step-by-step procedures of the dissection and culture of primary SDHN from newborn mice. In this protocol, neurons were gained using the enzymatic (papain) digestion method from fresh spinal dorsal horn tissues directly. The culture of SDHN in vitro can be used for further experiments, such as electrophysiological recordings, immunocytochemistry, and Ca2+ imaging, which better support cell behaviors in the spinal cord.
Materials and Reagents
Coverslips (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 174950 )
24-well cell culture plate (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 142475 )
Cell culture dishes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 153066 )
Sterile centrifuge tubes (5 ml and 50 ml)
Cotton ball
Pipette tip
Cell strainer (40 μm) (Corning, Falcon®, catalog number: 352340 )
Ice
3 days-old mice
Diethyl ether (Sigma-Aldrich, catalog number: 346136 )
75% ethanol
Cytosine arabinoside (Sigma-Aldrich, catalog number: C6645 )
4% formaldehyde
5% goat serum
MAP2 antibody (Sigma-Aldrich, catalog number: M1406 )
Anti-mouse FITC-conjugated secondary antibody
DAPI (Sigma-Aldrich, catalog number: M9542 )
Note: This product has been discontinued.
Collagen (Sigma-Aldrich, catalog number: C7661 )
Poly-D-lysine (Sigma-Aldrich, catalog number: P7405 )
HEPES (1 M) (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
HBSS (Thermo Fisher Scientific, GibcoTM, catalog number: 14025092 )
Papain (Worthington Biochemical, catalog number: LS003119 )
Neuro basal (Thermo Fisher Scientific, GibcoTM, catalog number: 10888022 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 1099141 )
Heat-inactivated horse serum (Thermo Fisher Scientific, GibcoTM, catalog number: 26050070 )
B27 (50x) (Thermo Fisher Scientific, GibcoTM, catalog number: 17504044 )
Glutamax (Thermo Fisher Scientific, GibcoTM, catalog number: 35050061 )
Penicillin/Streptomycin (100x) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Collagen stock solution (see Recipes)
Poly-D-lysine (PDL) stock solution (see Recipes)
Coating solution (see Recipes)
HBSS + HEPES solution (see Recipes)
Papain solution (see Recipes)
Culture media (see Recipes)
Equipment
Surgical scissors (decapitation/dissecting spinal column from body) (RWD Life Science, catalog number: S14014-14 )
Blunt-tipped forceps (dissecting/holding spinal column) (RWD Life Science, catalog number: F13017-12 )
Long and narrow-tipped spring scissors (dissecting spinal cord/cutting nerve roots) (66 Vision, catalog number: 54053B )
Small-tipped spring scissors (cutting dura) (Fine Science Tools, catalog number: 15000-02 )
Microforceps (holding spinal cord/trimming off dura) (World Precision Instruments, catalog number: 14098 )
Scalpel #15 sterilized surgical blade (cutting spinal cord to isolate dorsal horn) (Shanghai Jinhuan Medical, catalog number: YY0174-2005 )
Tissue culture hood (Suzhou Antai Airtech, model: SW-CJ-1F(D) )
Stereomicroscope (OLYMPUS, model: SZ61 )
Benchtop centrifuge (4 °C, 50 ml tube) (Eppendorf, model: 5430R )
Pipette (Eppendorf, model: ES-1000 )
Haemocytometer (Shanghai anxin optical instrument manufacture, model: XB-K-25 )
Stackable CO2 incubator (Eppendorf, model: Galaxy®170R )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cao, D., Jing, P., Jiang, B. and Gao, Y. (2017). Primary Culture of Mouse Neurons from the Spinal Cord Dorsal Horn. Bio-protocol 7(1): e2098. DOI: 10.21769/BioProtoc.2098.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,099 | https://bio-protocol.org/exchange/protocoldetail?id=2099&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Simultaneous Intranasal/Intravascular Antibody Labeling of CD4+ T Cells in Mouse Lungs
YW Yanqun Wang*
JS Jing Sun*
RC Rudragouda Channappanavar
JZ Jingxian Zhao
SP Stanley Perlman
JZ Jincun Zhao
*Contributed equally to this work
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2099 Views: 9950
Edited by: Ivan Zanoni
Reviewed by: Shanie Saghafian-Hedengren
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
CD4+ T cell responses have been shown to be protective in many respiratory virus infections. In the respiratory tract, CD4+ T cells include cells in the airway and parenchyma and cells adhering to the pulmonary vasculature. Here we discuss in detail the methods that are useful for characterizing CD4+ T cells in different anatomic locations in mouse lungs.
Keywords: Memory CD4+ T cell Lung Bronchoalveolar lavage fluid Intranasal/intravascular antibody labeling Flow cytometry
Background
To distinguish memory T cells in the circulation and tissues, a method for intravascular staining of T cells has been developed (Anderson et al., 2012). This method has been widely used to define memory T cells in many organs and tissues, including lungs, spleens and intestines. However, memory T cells in the respiratory tract are located in three unique anatomic locations, i.e., airway, parenchyma and pulmonary vasculature. Intravascular staining cannot distinguish cells in the airway and parenchyma, since they are both isolated from the circulation and intravascularly-administered antibodies will not stain these two populations. We designed a simultaneous intranasal/intravascular antibody labeling assay that can label and distinguish cells in all three locations using minimal amount of antibodies.
Materials and Reagents
1.5 ml microtubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 69715 )
1 ml insulin syringe fitted with 28 G x ½ needle (BD, catalog number: 329420 )
Precision glide needles (20 G x 1) (BD, catalog number: 305175 )
5 ml polystyrene round bottom tubes (Corning, Falcon®, catalog number: 352054 )
Precision glide needles (25 G x 5/8) (BD, catalog number: 305122 )
200 μl tips (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM12655 )
15 ml screw cap conical tubes (SARSTEDT, catalog number: 62.554.002 )
10 ml syringes (BD, catalog number: 309604 )
12 well cell culture plates (Corning, Costar®, catalog number: 3513 )
3 ml syringes (BD, catalog number: 309657 )
50 ml screw cap conical tubes (SARSTEDT, catalog number: 62.547.004 )
Cell strainers (70 µm nylon) (Corning, Falcon®, catalog number: 352350 )
60 x 15 mm tissue culture dish (Corning, Costar®, catalog number: 353802 )
10 ml stripettes (Corning, Costar®, catalog number: 3548 )
Gauze sponges (4 x 4 inch) (Pro Advantage by NDC, catalog number: P157118 )
0.2 μm filter (EMD Millipore, catalog numbers: SCGPU11RE and SLGP033RS )
2.5 ml graduate transfer pipettes (RPI, catalog number: 147501-1S )
Absorbent pads (COVIDIEN, catalog number: 949 )
Mouse
CD45-brilliant violet 510 (BV510) (Clone: 30-F11) (BioLegend, catalog number: 103138 )
1x Dulbecco’s phosphate buffered saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14190-144 )
CD90.2-APC-eFluor 780 (Clone: 53-2.1) (Affymetrix, eBioscience, catalog number: 47-0902 )
Isoflurane (USP inhalation vapour, liquid) (Drugs, catalog number: 57319-559-06 )
Ethanol (Sigma-Aldrich, catalog number: 459836 )
Trypan blue solution (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
CD16/32-PerCP/Cy5.5 (Clone: 93) (BioLegend, catalog number: 101324 )
CD4-FITC (Clone: RM4-5) (BioLegend, catalog number: 100510 )
2,2,2-tribromoethanol (Sigma-Aldrich, catalog number: T48402 )
2-methyl-2-butanol (Sigma-Aldrich, catalog number: 152463 )
Nano-pure water (Thermo Fisher Scientific, InvitrogenTM, catalog number: 10977015 )
RPMI medium 1640 (Thermo Fisher Scientific, GibcoTM, catalog number: 11875093 )
HEPES (1 M) (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
L-glutamine (200 mM) 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 25030081 )
Fetal bovine serum (FBS) (Atlanta Biologicals, catalog number: S11150 )
MEM non-essential amino acids solution 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 11140050 )
Sodium pyruvate 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 11360070 )
Penicillin/streptomycin 100x (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Collagenase D (Roche Diagnostics, catalog number: 11088882001 )
DNase I (Roche Diagnostics, catalog number: 10104159001 )
Hank’s balanced salt solution (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14025 )
Sodium azide, NaN3 (AMRESCO, catalog number: 0639 )
Potassium bicarbonate, KHCO3 (Sigma-Aldrich, catalog number: 237205 )
Ammonium chloride, NH4Cl (Sigma-Aldrich, catalog number: A9434 )
EDTA-Na2 (Sigma-Aldrich, catalog number: E9884 )
BD Cytofix fixation solution (BD, catalog number: 554655 )
Avertin (see Recipes)
Complete RPMI 1640 medium (see Recipes)
Digestion buffer (see Recipes)
FACS buffer (see Recipes)
ACK lysis buffer (see Recipes)
Equipment
Desiccator (SP Scienceware - Bel-Art Products - H-B Instrument, model: Space Saver Vacuum Desiccators )
Fume hood (LABSCAPE)
Pipetman P10 (Eppendorf, model: Research plus )
Pipetman P200 (Eppendorf, model: Research plus )
Pipetman P1000 (Eppendorf, model: Research plus )
Pipet aid (Eppendorf, model: Eppendorf Easypet 3 )
Heat lamp (Whitehead Industrial, catalog number: 30715 )
Mouse restrainer (Braintree Scientific, catalog number: TV-150 STD )
Spray bottle with 70% ethanol (SKS Science Products, catalog number: 0185-11 )
Surgical scissors (Sklar Surgical Instrument, catalog number: 47-1246 )
Tweezers (Sklar Surgical Instrument, catalog number: 66-7644 )
Polystyrene foam (Regular polystyrene box top)
Rocker (Labnet, catalog number: S0500 )
Refrigerated tabletop centrifuge (Beckman Coulter, model: Allegra 6R )
Hemocytometer (Thermo Fisher Scientific, catalog number: 99503 )
Flow cytometer (BD, model: FACSVerse)
Software
Flowjo software (Version 10.0.7)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, Y., Sun, J., Channappanavar, R., Zhao, J., Perlman, S. and Zhao, J. (2017). Simultaneous Intranasal/Intravascular Antibody Labeling of CD4+ T Cells in Mouse Lungs. Bio-protocol 7(1): e2099. DOI: 10.21769/BioProtoc.2099.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Cell Biology > Cell staining > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
21 | https://bio-protocol.org/exchange/protocoldetail?id=21&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chromatin Immunoprecipitation (ChIP) Protocol from Tissue
NA Nabila Aboulaich
Published: Jan 20, 2011
DOI: 10.21769/BioProtoc.21 Views: 18852
Download PDF
Ask a question
How to cite
Favorite
Cited by
Materials and Reagents
Frozen tissue
Protease inhibitors complete mini pill (F. Hoffmann-La Roche)
1 kb DNA ladder (Life Technologies, Invitrogen™)
Protein A- or protein G- agarose (Santa Cruz Biotechnology)
Phenol-chloroform-isoamylalchohol (Life Technologies, Invitrogen™)
Pellet paint (Novagen)
General chemicals (Sigma-Aldrich)
PBS
Hepes
Tris-HCl (pH 8.0)
EDTA
SDS
EGTA
NaCl
Triton X-100
Sodium deoxycholate
Agarose gel
HEPES-NaOH buffer (see Recipes)
ChIP lysis buffer (see Recipes)
RIPA buffer (see Recipes)
Digesting buffer (see Recipes)
Equipment
Centrifuges
Sonicator
Razor blade
Shaker
PCR machine
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Aboulaich, N. (2011). Chromatin Immunoprecipitation (ChIP) Protocol from Tissue. Bio-101: e21. DOI: 10.21769/BioProtoc.21.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA-protein interaction
Biochemistry > Protein > Immunodetection > ChIP
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
210 | https://bio-protocol.org/exchange/protocoldetail?id=210&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Improved Method for PAGE-based Detection of Phosphorylated Protein in Yeast
Yuehua Wei
Published: Vol 2, Iss 12, Jun 20, 2012
DOI: 10.21769/BioProtoc.210 Views: 12996
Download PDF
Ask a question
Favorite
Cited by
Abstract
One dimensional polyacrylamide gel electrophoresis has been successfully used to detect protein phosphorylation. This method is very simple and highly reproducible. Hyperhosphorylated proteins usually migrate slowlier than dephosphorylated proteins. However, not all phosphorylated proteins can be readily detected, due to sub-optimal sample preparation and electrophoresis conditions. Here, an improved method is described that can detect phosphorylation of yeast proteins ranging from 15 kD to 200 kD. The improvement in gel electrophoresis should also be applicable to mammalian culture cells.
Keywords: Phosphorylation Yeast Mobility shift Acrylamide gel Western blot
Materials and Reagents
Tris base (C4H11NO3) (Thermo Fisher Scientific, catalog number: 77-86-1 )
NaCl (Thermo Fisher Scientific, catalog number: 7647-14-5 )
EDTA (Na2EDTA•2H2O) (Sigma-Aldrich, catalog number: ED2SS )
Triton X-100 (Thermo Fisher Scientific, catalog number: 9002-93-1 )
Phenylmethanesulfonyl fluoride (PMSF) (C7H7FO2S) (Sigma-Aldrich, catalog number: P7626 )
Complete protease inhibitor cocktail (F. Hoffmann-La Roche, catalog number: 04693159001 )
PhosSTOP tablet (F. Hoffmann-La Roche, catalog number: 04906837001 )
SDS [CH3 (CH2)11OSO3Na] (Sigma-Aldrich, catalog number: L3771 )
Glycerol (Thermo Fisher Scientific, catalog number: 56-81-5 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M7154 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126 )
Synthetic complete (SC) medium
Rapamycin
Methanol
5x SDS loading buffer (see Recipes)
Yeast cell lysis buffer (see Recipes)
Equipment
Standard bench-top centrifuge
Sterilized toothpick
Incubator
Shaker
1.5 ml eppendorf tubes
25G needle
Western blot equipment
Refrigerator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Modification
Microbiology > Microbial biochemistry > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,100 | https://bio-protocol.org/exchange/protocoldetail?id=2100&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo Efficacy Studies in Cell Line and Patient-derived Xenograft Mouse Models
ET Elizabeth A. Tovar
CE Curt J. Essenburg
CG Carrie Graveel
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2100 Views: 14030
Edited by: Lee-Hwa Tai
Reviewed by: Ruth A. Franklin
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
In vivo xenograft models derived from human cancer cells have been a gold standard for evaluating the genetic drivers of cancer and are valuable preclinical models for evaluating the efficacy of cancer therapeutics. Recently, patient-derived tumorgrafts from multiple tumor types have been developed and shown to more accurately recapitulate the molecular and histological heterogeneity of cancer. Here we detail the procedures for developing patient-derived xenograft models from breast cancer tissue, cell-based xenograft models, serial tumor transplantation, tumor measurement, and drug treatment.
Keywords: Patient-derived xenograft Tumor transplantation Mammary fat pad Tumor measurement Dosing
Background
Xenograft models have served as a robust method for investigating the genetic drivers of cancer and determining the potential efficacy of cancer therapeutics. The ability to propagate human cancer cells and tissues in mice was drastically advanced with the discovery of T-cell deficient athymic nude (nu/nu) mice and T- and B-cell deficient severe combined immunodeficient (scid/scid) mice (Flanagan, 1966; Bosma and Carroll, 1991). Since these discoveries additional immunocompromised mouse models have become available including, recombination-activating gene 2 (Rag2)-knockout mice, non-obese (NOD)-scid mice, and NOD-scid IL2Rgamma(null) mice (also known as NSG mice) (Shinkai et al., 1992; Prochazka et al., 1992; Shultz et al., 2005). These immunocompromised mouse models have enabled the development of numerous and diverse in vivo models of human cancer.
There are several options that should be considered when developing a xenograft model including the site of injection or implantation. Subcutaneous xenografts are often used in in vivo studies due to tumor accessibility for growth measurement and imaging; however a significant limitation of this model is the lack of a normal stromal microenvironment for most cancer cells. Orthotopic xenografts offer a complementary stromal microenvironment; however there are also disadvantages to this route depending on the orthotopic site, including more complex surgical procedures, difficulty of measuring tumor growth or response, and the limitations of rodent stroma (Talmadge et al., 2007). The use of orthotopic xenografts has been used extensively in many cancer studies, especially breast cancer research. Injecting into the mammary fat pad is a relatively simple procedure that allows for the visible and measurable growth of breast cancer cells. Even though the mammary fat pad offers a complementary tissue site for breast cancer cells, it is important to note there are distinct differences between the human and rodent mammary stroma and hormonal environment.
Xenograft models have been used extensively as predictive models of cancer therapeutic efficacy. For preclinical studies, it is essential to evaluate drug efficacy and potential toxicities in vivo. Even though in vivo preclinical studies are valuable, the results have not consistently translated to the clinic and the significance of these studies are debated (Talmadge et al., 2007; Sausville and Burger, 2006). There are several variables that need to be considered when designing drug studies such as the appropriate cell lines (or PDX models), dosage and dosing schedules, and statistical analysis. Each of these factors should be carefully considered in order to most closely mimic human cancer progression and treatment response.
Recently there have been significant advances in the development of patient-derived tumor xenografts (PDX). PDX models have the advantage of maintaining the molecular and histological heterogeneity of the original tumor (DeRose et al., 2011). Moreover, they have been shown to be superior at predicting drug response compared to standard cell culture xenograft models (Hait, 2010; Fruchter et al., 1990; Voskoglou-Nomikos et al., 2003; Gao et al., 2015). Recent studies have advanced the success of establishing breast cancer PDX models that recapitulate the molecular, stromal, and phenotypic heterogeneity that exists in breast cancer (DeRose et al., 2013). Overall, cell line-based and patient-derived xenografts are essential models for investigating cancer initiation, progression, and treatment response. Here, we describe the protocols for developing cell-based xenograft models, patient-derived xenograft models from breast cancer tissue, serial tumor transplantation, tumor measurement, and drug treatment.
Materials and Reagents
25 gauge needle (for inoculations) (BD, catalog number: 305127 )
Tissue culture-treated culture dish (Corning, catalog number: 430293 )
Eppendorf tubes (1.5 ml) (Eppendorf, catalog number: 022363204 )
Falcon 15 ml conical centrifuge tubes (Corning, catalog number: 352196 )
Cryogenic vial
Trocar syringe, 10 gauge (Innovative Research of America, catalog number: MP-182 )
1 cc U-100 insulin syringe, 28 gauge x ½” needle (for Ketoprofen injections) (BD, catalog number: 329410 )
Oral gavage tips, 22 gauge x 1” with 1 ¼ mm ball (Cadence, catalog number: 7901 )
Tuberculin syringe, 1 ml (for inoculations) (BD, catalog number: 309659 )
Betadine solution swab sticks (Thermo Fisher Scientific, Fisher Scientific, catalog number: 19-061617 )
Sterile alcohol prep pads, 70% isopropyl alcohol (Thermo Fisher Scientific, Fisher Scientific, catalog number: 22-363-750 )
Sterile cell preparations or patient-derived tumor tissue
4-7 week old Athymic Nude mice [Crl:NU(NCr)-Foxn1nu] (Charles River Laboratories International, catalog number: 490 )
4-7 week old NSG mice (NOD scid gamma, NOD-scid IL2Rgnull, NOD-scid IL2Rgammanull) (THE JACKSON LABORATORY, catalog number: 005557 )
Trypsin or appropriate enzymes
Hanks’ balanced salt solution modified (HBSS) (Thermo Fisher Scientific, GibcoTM, catalog number: 14170112 )
Research Animal Diagnostic Laboratory (RADIL) infectious microbe PCR amplification test (IMPACT) (IDEXX BioResearch)
Phosphate buffered saline (PBS) pH 7.4 (Thermo Fisher Scientific, GibcoTM, catalog number: 10010049 )
Penicillin-streptomycin (5,000 U/ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15070063 )
70% ethanol
Surgical cleaner
Isoflurane liquid inhalant OD 99.9% (Henry Schein Medical, catalog number: 1182097 )
Ketofen® (Ketoprofen) (Patterson Veterinary Supply, catalog number: 10004029 )
Absorbent underpads (Thermo Fisher Scientific, Fisher Scientific, catalog number: S67011 )
10% neutral formalin (Sigma-Aldrich, catalog number: HT501128-4L )
FBS
DMSO
Optional Materials and Reagents
17β-Estradiol, 60-day release pellets (Innovative Research of America, catalog number: SE-121 )
Veterinary grade surgical glue (Patterson Veterinary Supply, catalog number: 07-805-5031 )
Cryogenic media (see formulation below)
Cell freezing container (Corning, catalog number: 432010 )
Internal thread cryogenic vials, 2.0 ml (Corning, catalog number: 430488 )
Liquid nitrogen
Equipment
Digital calipers (Thermo Fisher Scientific, Fisher Scientific, catalog number: 06-664-16 or Mitutoyo America, catalog number: 500-163-30 )
Safety scalpel (Merit Medical Systems, catalog number: SMS210 )
Wound clip applier 9 mm (Roboz Surgical Instrument, catalog number: RS-9260 )
9 mm wound clips (Roboz Surgical Instrument, catalog number: RS-9262 )
Wound clip remover 4’’ (Roboz Surgical Instrument, catalog number: RS-9263 )
Ear punch; 2 mm; 2’’ length (Roboz Surgical Instrument, catalog number: 65-9900 )
Micro dissecting scissors 4’’ straight sharp/sharp (Roboz Surgical Instrument, catalog number: RS-5912 )
Moloney forceps; serrated; slight curve; 4.5’’ length (Roboz Surgical Instrument, catalog number: RS-8254 )
Micro dissecting forceps; serrated, full curve, 4’’ length (Roboz Surgical Instrument, catalog number: RS-5137 )
Isoflurane chamber and nose cone
Fisher scientific slide warmer model 77 (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-594 )
Oster Cord/Cordless trimmer (Patterson Veterinary Supply, catalog number: 07-880-1877 )
Culture hood
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Tovar, E. A., Essenburg, C. J. and Graveel, C. (2017). In vivo Efficacy Studies in Cell Line and Patient-derived Xenograft Mouse Models. Bio-protocol 7(1): e2100. DOI: 10.21769/BioProtoc.2100.
Download Citation in RIS Format
Category
Cancer Biology > Tumor immunology > Tumor formation
Cancer Biology > Invasion & metastasis > Cancer therapy
Cell Biology > Cell isolation and culture > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,101 | https://bio-protocol.org/exchange/protocoldetail?id=2101&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Relative Stiffness Measurements of Cell-embedded Hydrogels by Shear Rheology in vitro
TC Thomas R. Cox
CM Chris D. Madsen
Published: Vol 7, Iss 1, Jan 5, 2017
DOI: 10.21769/BioProtoc.2101 Views: 11393
Edited by: Ralph Bottcher
Reviewed by: Vikash VermaSaskia F. Erttmann
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
Hydrogel systems composed of purified extracellular matrix (ECM) components (such as collagen, fibrin, Matrigel, and methylcellulose) are a mainstay of cell and molecular biology research. They are used extensively in many applications including tissue regeneration platforms, studying organ development, and pathological disease models such as cancer. Both the biochemical and biomechanical properties influence cellular and tissue compatibility, and these properties are altered in pathological disease progression (Cox and Erler, 2011; Bonnans et al., 2014). The use of cell-embedded hydrogels in disease models such as cancer, allow the interrogation of cell-induced changes in the biomechanics of the microenvironment (Madsen et al., 2015). Here we report a simple method to measure these cell-induced changes in vitro using a controlled strain rotational rheometer.
Keywords: Shear rheology Matrix stiffness Cancer-associated fibroblasts Hydrogels
Background
Fibrosis and solid tumours are both accompanied by pathological remodelling of their native tissue (Cox and Erler, 2011; Bonnans et al., 2014). In both pathological conditions, the local tissue environment experiences physico-chemical as well as biological changes, resulting in increased tissue stiffness (elastic modulus) (Humphrey et al., 2014). The strengthened tissue/matrix regulates mechano-signaling that leads to altered cell behaviour, cell morphology, differentiation state, proliferation, migration and stemness. In preclinical animal models of cancer, these changes can drive malignant progression and metastatic spread (Bonnans et al., 2014). Not surprisingly, targeting matrix stiffening has received substantial attention in recent years, and several clinical trials have been initiated (Kai et al., 2016).
The elasticity and mechanical properties of a matrix component can readily be examined using atomic force microscopy (AFM), which is a technique that provides nanometre resolution and concurrent measurement of the applied force with picoNewton resolution (Kasas and Dietler, 2008). However, AFM is not applicable to understand the elastic properties of larger 3D matrices. The mechanical properties of bulk 3D matrices can more accurately be examined using shear rheology (Picout and Ross-Murphy, 2003). Rheology is the study of how materials deform when forces are applied to them. Thus applying shear stress to a 3D matrix can determine the elastic modulus (stiffness) of a bulk 3D matrix. In this protocol we describe a method to measure cell-induced changes on matrix stiffness of hydrogels embedded with cancer-associated fibroblasts by shear rheology.
Materials and Reagents
NuncTM cell-culture treated multidishes, 24-well (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 142475 )
100 μl sterile pipet tip
1,000 μl sterile pipet tip
1.5 ml sterile microcentrifuge tubes
8 mm disposable biopsy punch (KAI, catalog number: BP-80F )
Syringe filter, minisart, 0.20 µm (VWR, catalog number: 514-7011 )
Cells: immortalized human cancer-associated fibroblasts (CAFs) (Gaggioli et al., 2007)
Collagen type I, high concentration, rat tail (Corning, catalog number: 354249 )
Matrigel® basement membrane matrix, *LDEV-Free (Corning, catalog number: 354234 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 10270106 )
Sterile PBS, pH 7.2 (Thermo Fisher Scientific, catalog number: 20012068 )
Trypsin-EDTA (0.25%), phenol red (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
DMEM (Thermo Fisher Scientific, catalog number: 41966-052 )
Insulin-transferrin-selenium (Thermo Fisher Scientific, GibcoTM, catalog number: 41400045 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140-122 )
Y-27632 (Sigma-Aldrich, catalog number: Y0503 )
MEM α, nucleosides (Thermo Fisher Scientific, GibcoTM, catalog number: 11900-073 )
Sodium bicarbonate, NaHCO3 (Sigma-Aldrich, catalog number: S5761 )
1 M HEPES buffer (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
5x collagen buffer (see Recipes)
Growth medium (see Recipes)
1 ml collagen type I/Matrigel hydrogel (+/- cancer-associated fibroblasts) (see Recipes)
Equipment
Timer
Centrifuge
Pipette
Cell incubator at 37 °C, 5% CO2
Discovery Series Hybrid rheometer (TA Instruments, model: DHR-2 )
8 mm geometry, Figure 1a (TA Instruments)
8 stepped mm Peltier plate, Figure 1a (TA Instruments)
Stainless Steel Spatula, One End Flat, One End Bent, 6 in. in length (UNITED SCIENTIFIC SUPPLIES, model: SSFB06 )
Hemocytometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cox, T. R. and Madsen, C. D. (2017). Relative Stiffness Measurements of Cell-embedded Hydrogels by Shear Rheology in vitro. Bio-protocol 7(1): e2101. DOI: 10.21769/BioProtoc.2101.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biomechanical assays
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,102 | https://bio-protocol.org/exchange/protocoldetail?id=2102&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Acute Mouse Spinal Cord Slice Preparation for Studying Glial Activation ex vivo
Juan Mauricio Garré
Guang Yang
Feliksas F. Bukauskas
MB Michael V. L. Bennett
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2102 Views: 10518
Edited by: Oneil G. Bhalala
Reviewed by: Jingli CaoKae-Jiun Chang
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
Pathological conditions such as amyotrophic lateral sclerosis, spinal cord injury and chronic pain are characterized by activation of astrocytes and microglia in spinal cord and have been modeled in rodents. In vivo imaging at cellular level in these animal models is limited due to the spinal cord’s highly myelinated funiculi. The preparation of acute slices may offer an alternative and valuable strategy to collect structural and functional information in vitro from dorsal, lateral and ventral regions of spinal cord. Here, we describe a procedure for preparing acute slices from mouse spinal cord (Garré et al., 2016). This preparation should allow further understanding of how glial cells in spinal cord respond acutely to various inflammatory challenges.
Keywords: Microglia Astrocyte Spinal cord Neuroinflammation Spina cord slices
Background
Mouse transgenic technology has been used to model different human pathologies affecting the spinal cord, many of which are characterized by local glial activation, one hallmark of neuroinflammation. A major breakthrough that has enormously increased the understanding of glial biology in health and disease is the utilization of laser scanning microscopy based techniques, such as confocal microscopy (White et al., 1987) and two-photon microscopy (Denk et al., 1990) to visualize cell structures and subcellular domains in living animals in a noninvasive fashion; for example, mice expressing genetically encoded reporters or calcium sensors have been used to image glial structures (somata and processes) and to study calcium dynamics and signaling, respectively (Davalos et al., 2005; Gee et al., 2014). In spinal cord, myelin is highly compact in the white matter of the dorsal, lateral, and ventral funiculi. In vivo structural imaging of glial cells and infiltrating immune cells has been successfully performed in the past using surgical procedures (laminectomy) that allow optical access to the dorsal spinal cord (Kim et al., 2010). However, since myelin greatly increases light scattering, imaging is limited to the superficial layers of the dorsal funiculus, masking valuable information from deeper regions such as ventral horn. We think that acute slices prepared from wild type and transgenic mice can be used in combination with high-resolution imaging techniques to offer an alternative strategy to collect structural and functional information, in vitro, from dorsal, and also lateral and ventral regions. Coronal sections interrupt ascending and descending axons and many motor axons as well. Nevertheless, the information obtained is likely to be useful in analyzing how glial cells respond acutely to inflammatory challenges in spinal cord.
Materials and Reagents
Double edge razor blades (Everychina, Baili, catalog number: BP005 )
Sterile 21 gauge needles (BD, catalog number: 305165 )
Syringes (½ ml, 3 ml, and 20 ml)
½ ml (COVIDIEN, catalog number: 8881600004 )
3 ml (BD, catalog number: 309657 )
20 ml (BD, catalog number: 302830 )
Adhesive tape
Peel-a-way embedding molds (Sigma-Aldrich, catalog number: E6032 )
Disposable transfer pipettes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 336 )
Six-well multidish (Thermo Fisher Scientific, catalog number: 130184 )
Parafilm
Coverslip (Thermo Fisher Scientific, Fisher Scientific, catalog number: 12-545-88 )
70 μm cell strainer (Corning, Falcon®, catalog number: 352350 )
15 ml and 50 ml polypropylene conical tubes (Corning, Falcon®, catalog numbers: 352095 and 352098 , respectively)
Pipette tips (10 μl, 200 μl, 1,000 μl) (USA Scientific)
One- to two-month-old CX3CR1EGFP/+ transgenic mice (THE JACKSON LABORATORY, catalog number: 005582 )
Ketamine and xylazine (provided by NYU School of Medicine, DLAR)
Isoflurane (provided by NYU School of Medicine, DLAR)
70% ethanol
Low melting point agarose (Sigma-Aldrich, catalog number: A9414 )
Cyanoacrylate (Instant Krazy glue)
Ethidium bromide (MW: 394.3) (MP Biomedicals, catalog number: 802511 )
Propidium iodide (MW: 668.4) (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: P3566 )
Phosphate buffered saline (Thermo Fisher Scientific, GibcoTM, catalog number: 14190-144 )
Triton X-100, 100 ml solution (Sigma-Aldrich, catalog number: X100 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A3294 )
Normal goat serum (Vector Laboratories, catalog number: S1000 )
Optional: chicken anti-GFAP (EMD Millipore, catalog number: AB5541 )
Mowiol® 4-88 (aqueous mounting medium) (Sigma-Aldrich, catalog number: 81381 )
Tween 20
Optional: alexa fluor 647-conjugate goat anti-chicken IgY - H&L (Thermo Fisher Scientific, Invitrogen, catalog number: A21449 ) secondary antibody
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S7653 )
Sodium bicarbonate (NaHCO3) (Sigma-Aldrich, catalog number: S5761 )
Glucose (Sigma-Aldrich, catalog number: G7528 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S8282 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C1016 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
HCl
NaOH
EDTA
Paraformaldehyde (PFA, 32% solution) (Electron Microscopy Sciences, catalog number: 15714 )
Artificial cerebrospinal fluid (ACSF) (see Recipes)
Ca2+ and Mg2+ free-ACSF (see Recipes)
3-4% PFA, pH = 7.4 (see Recipes)
Equipment
Compressed gas tank 5% CO2, 95% O2
Leica vibratome and blade holder (Leica, model: VT1000 S )
Standard 1000 orbital shaker (TROEMNER, catalog number: 980173 )
Digital pH meter (Mettler Toledo)
Hemostat clamps (World Precision Instruments, catalog number: 503736 )
Forceps 12 cm long (World Precision Instruments, catalog number: 14226 )
Fine dissection forceps number 5 (Roboz Surgical Instrument, catalog number: RS-4955 )
SuperCut scissors (World Precision Instruments, catalog number: 14218 )
Spine bone scissors (Dumont, catalog number: 15a )
Digital water bath (Thermo Fisher Scientific, Fisher ScientificTM, model: Isotemp 205 )
Tubing
Digital scale (Mettler Toledo, model: MS104S )
Micropipettes (Gilson, 0.5-2 µl, 1-10 µl , 10-200 µl , 1,000 µl )
Stereo microscope with LED lights (Olympus, model: SZX10 )
Zeiss-700 confocal microscope equipped with 20x objective and appropriate filters
Thermistor thermometer (SP Scienceware - Bel-Art Products - H-B Instrument, catalog number: 605010100 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Garré, J. M., Yang, G., Bukauskas, F. F. and Bennett, M. V. L. (2017). An Acute Mouse Spinal Cord Slice Preparation for Studying Glial Activation ex vivo. Bio-protocol 7(2): e2102. DOI: 10.21769/BioProtoc.2102.
Garré, J. M., Yang, G., Bukauskas, F. F. and Bennett, M. V. (2016). FGF-1 triggers Pannexin-1 hemichannel opening in spinal astrocytes of rodents and promotes inflammatory responses in acute spinal cord slices. J Neurosci 36(17): 4785-4801.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,103 | https://bio-protocol.org/exchange/protocoldetail?id=2103&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of PBMCs Using Vacutainer® Cellular Preparation Tubes (CPTTM)
AP Alaina Puleo
CC Chantia Carroll
Holden Maecker
RG Rohit Gupta
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2103 Views: 36619
Reviewed by: Emmanuel ZavalzaMartin V Kolev
Original Research Article:
The authors used this protocol in 0 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
0 2014
Abstract
Peripheral blood mononuclear cell (PBMC) isolation is commonly done via density gradient centrifugation over Ficoll-Hypaque, a labor-intensive procedure that requires skilled technicians and can contribute to sample variability. Cellular Preparation Tubes (CPTs) are Vacutainer blood draw tubes that contain Ficoll-Hypaque and a gel plug that separates the Ficoll solution from the blood to be drawn. Once blood is drawn into CPTs, they can be centrifuged to separate the PBMC, then shipped (if desired) to a processing lab. The processing lab removes the PBMC from the upper compartment of the tube (above the gel plug), washes the PBMC, and can cryopreserve them using DMSO-containing media, as detailed in this protocol.
Keywords: PBMC Cell preparation CPT Ficoll Blood Stabilization
Background
Isolation and cryopreservation of peripheral blood mononuclear cells (PBMC) is common practice in clinical studies that employ cellular immune assays. Cryopreservation allows for batching of samples, which is convenient and improves the comparability of data. Cryopreservation also allows cells to be stored for unknown future purposes. Because erythrocytes and granulocytes are much more fragile to freezing and thawing, PBMC isolation is a common prerequisite to cryopreservation of blood cells; and the most common method for PBMC isolation is density gradient centrifugation using Ficoll-Hypaque, a high molecular weight carbohydrate solution.
Cellular Preparation Tubes (CPTs), which contain Ficoll-Hypaque, simplify the standard procedure for density gradient centrifugation in two ways: (1) blood is collected into the same tube that is then used to isolate the PBMC; and (2) the tube is pre-loaded with Ficoll-Hypaque, which is separated by a gel plug so that it is not disturbed by the entry of blood into the tube. After blood draw, the tubes are centrifuged, and the PBMCs and plasma become separated from the erythrocytes and granulocytes by the gel plug (see Figure 1). This allows the spun tubes to be shipped, maintaining the PBMC in an isolated environment from the erythrocytes and granulocytes, which may improve their viability and function.
CPTs are ideal for use in studies which collect whole blood across multiple sites and ship to a central processing laboratory (Ruitenberg et al., 2006); this reduces variability in PBMC isolation between technicians. Studies have found no significant difference in PBMCs isolated using the CPT system or by traditional layover methods via density gradient separation (Corkum et al., 2015; Ruitenberg et al., 2006). While material cost can be high, CPTs reduce the length of processing time in addition to decreasing inconsistency between operators; both of these are key to reducing cost and increasing sample quality and consistency. Furthermore, when used with studies or sites which ship blood samples overnight, PBMCs from CPTs have a higher purity and less infiltrate from other (contaminating) cell types, such as red blood cells, in contrast to samples shipped in standard blood collection tubes over a 24-48 h period (Schlenke et al., 1998).
Figure 1. Empty CPT (left), after blood draw (middle), and after centrifugation (right). Location of gel plug and sample layers after centrifugation are shown.
Materials and Reagents
1.8 ml Nunc (or similar) cryovials
BD Vactuainer® Mononuclear Cell Preparation Tubes (CPTTM), 8 ml, with sodium heparin (BD, catalog number: 362753 )
P10 and P200 pipette tips (any vendor)
P10 and P200 mechanical pipettors (any vendor)
50 ml Falcon (or similar) conical polypropylene tubes
Serological pipettes (assorted volumes)
BioCision CoolCell® (BioCision, catalog number: BCS172 ) – alcohol free controlled-rate freezing container
Foam packing material and shipping containers
Phosphate buffer saline (PBS),Ca2+ and Mg2+ free (e.g., Thermo Fisher Scientific, GibcoTM, catalog number: 10010-023 )
Trypan blue (e.g., GE Healthcare, HycloneTM, catalog number: SV30084.01 or Sigma-Aldrich, catalog number: 93595 )
Human AB Serum (e.g., Valley Biomedical, catalog number: HP1022 )
Dimethyl sulfoxide (e.g., Sigma-Aldrich, catalog number: D8418 )
Equipment
A centrifuge capable of reaching speeds of 1,800 x g (e.g., Beckman Coulter, model: Allegra X-14 Series )
50 ml conical adapters and buckets for centrifuge
Pipette gun (any vendor)
Automated cell counter or microscope and hemacytometer (any vendor)
Note: Cell counting methods vary in their throughput, cost, and flexibility for different cell types. For consistency, the same counting method should be used throughout a study.
Biosafety cabinet level A2 (BSC) (any vendor)
-80 °C freezer (for initial cryopreservation) (any vendor)
Liquid nitrogen (LN2) freezer (for long-term cryopreservation) (any vendor)
Note: LN2 systems range from small and simple to large and highly automated. Auto-filling and self-monitoring systems are recommended, especially for larger studies.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Puleo, A., Carroll, C., Maecker, H. T. and Gupta, R. (2017). Isolation of PBMCs Using Vacutainer® Cellular Preparation Tubes (CPTTM). Bio-protocol 7(2): e2103. DOI: 10.21769/BioProtoc.2103.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Leukocyte
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,104 | https://bio-protocol.org/exchange/protocoldetail?id=2104&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Floral Induction of Cuscuta reflexa
Priyanka Das
SS Santilata Sahoo
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2104 Views: 7253
Edited by: Rainer Melzer
Reviewed by: Antoine DanonKenichi Shibuya
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Floral initiation and development in the angiosperms is the essential step on which the yield of the plant depends. Sometimes external climate or any abiotic stress hinders the floral initiation and ultimately affect the plant yield. Hence, in vitro floral induction and development can help to overcome the external climatic factor. Furthermore, the protocol for in vitro floral induction in the parasitic angiosperm like Cuscuta reflexa has not been reported yet. We have standardized the protocol for floral induction in the parasitic plant Cuscuta reflexa. In this study it is established that MMS (modified Murashige Skoog) media supplemented with 2 mg L-1 NAA (naphthalene acetic acid, plant growth regulator) and 2 mg L-1 2,4-D (2,4-dichlorophenoxy acetic acid, plant growth regulator) supported floral induction after shooting in vitro. Furthermore, we found that MMS media supplemented with 2 mg L-1 2,4-D rapidly induced floral buds directly from the nodal explants without any shoot elongation. This protocol will help the researcher to induce flower in vitro in the other angiosperm plants along with Cuscuta reflexa.
Keywords: Cuscuta reflexa in vitro Floral induction NAA 2,4-D
Background
Cuscuta reflexa is a parasitic angiosperm parasitizing on a huge number of angiosperms (Kuijt, 1969). The ability to cause severe damage and loss of yield in the host plant has made this species important for scientific study (Nun and Mayer, 1999). Most of the Cuscuta species are non chloroplastic except few which have functional chloroplasts (Hibberd et al., 1998). Development of seedlings from larger embryos of C. reflexa in white’s medium has been reported (Maheshweri and Baldev, 1961). Floral induction of C. reflexa in short day period as well as dark conditions has been seen in vitro (Baldev, 1962). In vitro floral induction of Cuscuta japonica in short day conditions has also been established by Furuhashi et al. (1991).
Specifically, floral induction and effect of growth regulators on floral induction of C. reflexa has not yet been studied. A complete tissue culture system for Cuscuta trifolli in liquid MS culture has been reported so far (Bakos et al., 1995). The floral induction in C. reflexa on modified white’s medium, subjecting the plant to different light and dark conditions, has been studied years back (Baldev, 1962). Here we have shown a complete in vitro culture system for floral induction in C. reflexa. Concentration of 2,4-D played a significant role in floral induction. Supplementation of NAA along with 2,4-D induces shoot followed by flower, but supplementation of only 2,4-D induces flower directly from nodal explants without showing any stem elongation. This result is very attractive and is showing the importance of 2,4-D in floral induction of this plant.
Materials and Reagents
Pipette tips (Tarsons)
5 ml syringe (Himedia)
0.45 micron filter (Himedia)
Stem explants of Cuscuta reflexa
Murashige & Skoog (MS) basal medium (Murashige and Skoog, 1962) (Sigma-Aldrich, catalog number: M5519 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
Gamborg’s vitamin solution (Sigma-Aldrich, catalog number: G1019 )
Agar (HiMedia Laboratories, catalog number: PCT0901 )
2,4-dichlorophenoxyacetic acid (2,4-D) (Sigma-Aldrich, catalog number: D7299 )
Naphthalene acetic acid (NAA) (Sigma-Aldrich, catalog number: N0640 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 221465 )
Mercury(II) chloride (HgCl2) (0.01%) (EMD Millipore, catalog number: 104419 )
Bavistin (1% solution, Swat agro chemicals)
Ethanol (EMD Millipore, catalog number: 100983 )
MMS (modified Murashige Skoog) media (see Recipes)
2,4-D stock solution (see Recipes)
NAA stock solution (see Recipes)
Floral induction media-1 (see Recipes)
Floral induction media-2 (see Recipes)
HgCl2 (0.1%) (see Recipes)
Bavistin solution (1%) (see Recipes)
Equipment
0.5-10 μl pipette (Transferpette®) (BRAND, catalog number: 704770 )
20-200 μl pipette (Transferpette®) (BRAND, catalog number: 704778 )
100-1,000 μl pipette (Transferpette®) (BRAND, catalog number: 704780 )
Beaker (200 ml, Borosil)
Laminar hood (Thermo Fisher Scientific)
Conical flask (150 ml, Borosil)
Culture room (Daihan LabTech India, model: LGC-S201 )
Autoclave
Forceps (ACE Surgical Supply Company, catalog number: 20-000-48 )
Oven (Hicon India)
Water distillation unit (Mars Scientific Instruments, catalog number: BASIC/pH4 & XL )
pH meter (CD Hightech, model: APX 175 E )
Weighing machine (Sartorius, model: BSA224S-CW )
Scissor (general cutting scissor)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Das, P. and Sahoo, S. (2017). In vitro Floral Induction of Cuscuta reflexa. Bio-protocol 7(2): e2104. DOI: 10.21769/BioProtoc.2104.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > Morphogenesis
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,105 | https://bio-protocol.org/exchange/protocoldetail?id=2105&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessment of Cellular Redox State Using NAD(P)H Fluorescence Intensity and Lifetime
Thomas S. Blacker
TB Tunde Berecz
Michael R. Duchen
Gyorgy Szabadkai
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2105 Views: 13062
Edited by: Nicoletta Cordani
Reviewed by: Rakesh Bam
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
NADH and NADPH are redox cofactors, primarily involved in catabolic and anabolic metabolic processes respectively. In addition, NADPH plays an important role in cellular antioxidant defence. In live cells and tissues, the intensity of their spectrally-identical autofluorescence, termed NAD(P)H, can be used to probe the mitochondrial redox state, while their distinct enzyme-binding characteristics can be used to separate their relative contributions to the total NAD(P)H intensity using fluorescence lifetime imaging microscopy (FLIM). These protocols allow differences in metabolism to be detected between cell types and altered physiological and pathological states.
Keywords: NADH NADPH NAD(P)H Autofluorescence Microscopy Fluorescence lifetime FLIM Redox state
Background
The reduced form of the redox cofactor nicotinamide adenine dinucleotide (NADH) and its phosphorylated counterpart NADPH are intrinsically fluorescent, both absorbing light at wavelengths of 340 (± 30) nm and emitting at 460 (± 50) nm (Patterson et al., 2000). These spectral characteristics are lost upon oxidation to NAD+ or NADP+ (De Ruyck et al., 2007). The redox balances of the separate NAD and NADP pools dictate contrasting metabolic processes (Ying, 2008), as shown in Figure 1. NAD acts as an electron acceptor for the oxidation of sugar, lipid and amino acid substrates in the mitochondria by the tricarboxylic acid (TCA) cycle and as an electron donor to the electron transport chain (ETC) on the inner mitochondrial membrane (IMM), fuelling the pumping of protons into the intermembrane space to act as a power source for the synthesis of adenosine triphosphate (ATP) by the F1FO ATP synthase (Osellame et al., 2012). The balance of NADH to NAD+ in the mitochondria therefore reflects the balance of TCA cycle to ETC activity. ETC dysfunction causes increases in the NADH/NAD+ ratio and the production of potentially damaging reactive oxygen species (ROS) (Murphy, 2009). The cell’s antioxidant defences require the NADP pool to provide reducing equivalents for their maintenance, so the NADPH/NADP+ ratio must be maintained high (> 3) (Pollak et al., 2007). The redox state of the mitochondrial NAD pool and the relative abundance of NADPH are therefore key factors in the level of oxidative stress in a cell type.
Figure 1. Schematic outline of mitochondrial NAD(P)H metabolism. Substrate oxidation in the TCA cycle passes electrons to NAD+, forming NADH. A. Under resting conditions, electrons carried by NADH are passed along the ETC, powering the pumping of protons from the mitochondrial matrix across the inner mitochondrial membrane (IMM) into the intermembrane space. The resulting proton gradient powers the production of ATP at complex V of the ETC (F1FO ATP synthase). B. Addition of an uncoupler such as carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) allows protons to leak back across the IMM, causing the rate of oxidation of NADH at the ETC to increase to restore the membrane gradient. C. Inhibition of the ETC by rotenone halts NADH oxidation and causes an increase in the production of superoxide (O2-), the proximal source of mitochondrial ROS. This is neutralised upon its conversion into water by the superoxide dismutase (SOD2) and glutathione (GSH/GSSG) antioxidant defence systems, maintained by NADPH.
Here, we describe protocols for the assessment of the mitochondrial NADH/NAD+ ratio and the NADPH/NADH balance that rely on the fluorescence of these cofactors when reduced. Their identical absorption and emission spectra leads the combined signal to be termed NAD(P)H (Blacker and Duchen, 2016). Measuring the change in NAD(P)H fluorescence using a confocal microscope following the application of an ETC uncoupler and inhibitor allows the mitochondrial NADH/NAD+ balance to be estimated (Duchen et al., 2003). To discriminate between the relative contributions of NADH and NADPH to the total signal, fluorescence lifetime imaging microscopy (FLIM) must be introduced (Blacker et al., 2014). These protocols describe, in further detail, methods used in Tosatto et al. (2016) to investigate the role of the selective channel responsible for mitochondrial calcium uptake, the mitochondrial calcium uniporter (MCU), in the progression of breast cancer. Basic understanding of confocal microscopy is assumed. For background, readers are directed to Pawley et al. (2012).
Materials and Reagents
NuncTM cell culture treated EasYFlasksTM (75 cm2, filter closure) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 156499 )
Falcon tubes (15 ml) (VWR, catalog number: 734-0451 )
Tips
Falcon tubes (50 ml) (VWR, catalog number: 734-0448 )
Eppendorf tubes (1.5 ml) (VWR, catalog number: 211-2520 )
NuncTM cell-culture treated multidishes (6 wells) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 140675 )
Coverslips (22 mm, thickness No.1) (VWR, catalog number: 631-0158 )
Syringe (20 ml, VWR, catalog number: 613-3921 )
Filter steriliser (0.2 μm, VWR, catalog number: 514-0064 )
MDA-MB-231 cells (ATCC, catalog number: HTB-26 )
Advanced Dulbecco’s modified Eagle’s medium (DMEM) (500 ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 12491023 )
Fetal bovine serum (FBS, heat inactivated, 50 ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 10500064 )
GlutaMAXTM (5 ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 35050061 )
Penicillin-streptomycin (10,000 U ml-1, 5 ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Trypsin-EDTA (0.25%, with phenol red, 100 ml) (Thermo Fisher Scientific, GibcoTM, catalog number: 25200056 )
FCCP (10 mg) (Sigma-Aldrich, catalog number: C2920 )
Rotenone (5 g) (Sigma-Aldrich, catalog number: R8875 )
Ethanol (1 L) (Sigma-Aldrich, catalog number: 02860 )
Dulbecco’s modified Eagle’s medium powder (without glucose, L-glutamine, phenol red, sodium pyruvate and sodium bicarbonate) (Sigma-Aldrich, catalog number: D5030 )
D-(+) glucose (100 g) (Sigma-Aldrich, catalog number: G8270 )
Sodium pyruvate (25 g) (Sigma-Aldrich, catalog number: P2256 )
HEPES (100 g) (Sigma-Aldrich, catalog number: H3375 )
Sodium hydroxide solution (1 N, 1 L) (Sigma-Aldrich, catalog number: 71463 )
Hydrochloric acid solution (1 N, 1 L) (Sigma-Aldrich, catalog number: 71763 )
Routine cell culture medium (500 ml) (see Recipes)
Live-cell imaging medium (50 ml) (see Recipes)
ETC perturbations (see Recipes)
Equipment
Incubator (37 °C, 5% CO2) (Thermo Fisher Scientific, Thermo ScientificTM, model: HERAcellTM 150i )
Centrifuge with 15 ml Falcon tube capacity (Mega Star 1.6) (VWR, catalog number: 521-1749 )
Haemocytometer (Neubauer) (VWR, catalog number: 630-1509 )
Laser-scanning microscope (Zeiss, model: LSM510 )
40x magnification objective
Blackout curtains, for room and covering FLIM microscope (see Figure 2)
Figure 2. Equipment for high signal to noise FLIM. A. Zeiss LSM510 with Coherent Chameleon for two-photon excitation and Becker & Hickl HPM-100-40 detector and SPC830 counting electronics. B. Blackout curtains surrounding both the microscope room and the microscope itself act to ensure that background noise in the FLIM images is kept to a minimum.
Emission filters for NAD(P)H fluorescence (435-485 nm)
For single-photon excitation:
351 nm laser source (Enterprise UV, Coherent)
Long-pass dichroic (375 nm cutoff)
Quartz microscope optics
For two-photon excitation:
Ti:sapphire laser modelocked at 720 nm (Chameleon Ultra, Coherent)
Short pass dichroic (650 nm cutoff)
Non-descanned detection
For FLIM:
Detector with single photon sensitivity (Becker & Hickl, model: HPM-100-40)
Time-correlated single photon counting (TCSPC) electronics (Becker & Hickl, model: SPC-830)
Pulsed excitation source (two-photon excitation by Ti:sapphire laser at 720 nm; Chameleon Ultra, Coherent)
Heated microscope stage (custom built to hold imaging rings, see Figure 3)
Figure 3. Apparatus for mounting coverslips on the microscope. A. Custom built rings and mounting block for securing 22 mm circular coverslips. B. Coverslips are placed directly onto the base of a metal ring. C. A concentric ring with a rubber seal is placed on top of the coverslip. D. A third ring is screwed onto the first two in order to form a watertight seal over the coverslip, allowing (E) the imaging buffer to be pipetted onto the cells. F. The imaging ring and cells then fit into a heated microscope stage.
Straight-tip forceps (VWR, catalog number: 232-0094 )
Imaging rings (custom built, see Figure 3)
Inverted, phase-contrast, bench top microscope (VWR, catalog number: 630-2145 ; ZEISS, model: Primovert )
Laboratory balance (0.1 mg resolution) (Mettler-Toledo, catalog number: 30029067 )
pH meter (Mettler-Toledo International, catalog number: 30266626 )
Tally counter (VWR, catalog number: 720-1984 )
Software
Microscope control software (Zeiss ZEN)
FLIM acquisition software (Becker & Hickl SPCM)
FLIM fitting software (Becker & Hickl SPCImage)
Image analysis software (NIH ImageJ)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Blacker, T. S., Berecz, T., Duchen, M. R. and Szabadkai, G. (2017). Assessment of Cellular Redox State Using NAD(P)H Fluorescence Intensity and Lifetime. Bio-protocol 7(2): e2105. DOI: 10.21769/BioProtoc.2105.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Cancer therapy
Cancer Biology > Cellular energetics > Cell biology assays
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,106 | https://bio-protocol.org/exchange/protocoldetail?id=2106&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pseudomonas syringae Flood-inoculation Method in Arabidopsis
Yasuhiro Ishiga
Takako Ishiga
Yuki Ichinose
KM Kirankumar S. Mysore
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2106 Views: 12161
Edited by: Zhaohui Liu
Reviewed by: Bin Tian
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Pseudomonas syringae pv. tomato strain DC3000 (Pto DC3000), which causes bacterial speck disease of tomato, has been used as a model pathogen because of its pathogenicity on Arabidopsis thaliana. Here, we demonstrate a rapid and reliable flood-inoculation method based on young Arabidopsis seedlings grown on one-half strength MS medium. We also describe a method to evaluate the bacterial growth in Arabidopsis.
Keywords: Pseudomonas syringae Arabidopsis thaliana Plant innate immunity Pathogenicity
Background
The A. thaliana-Pto DC3000 model pathosystem is widely used to investigate the molecular mechanisms of microbial pathogenesis and plant innate immunity (Ishiga et al., 2012 and 2016; Ishiga and Ichinose, 2016). Although several inoculation methods have been developed to study the interactions in this model system, none of the methods reported to date are similar to those occurring in nature.
Materials and Reagents
1.5 ml microcentrifuge tubes (Ina-optika, catalog number: LT-0150 )
1 ml pipette tips (Mettler-Toledo, catalog number: 768/8 RT-1000 )
Inoculating loops (VWR, catalog number: 12000-812 )
3M Micropore 2.5 cm surgical tape (3M, catalog number: 1530-1 )
Plastic Petri plates (100 x 20 mm) (TrueLine, catalog number: TR4002 )
Plastic Petri plates (100 x 15 mm) (VWR, catalog number: 10053-704 )
Conical tubes (50 ml) (LabPlanet, catalog number: 3181-345-008 )
Plant material: Arabidopsis thaliana ecotype Columbia (Col-0) was used as a wild-type plant
Bacterial strains: P. syringae pv. tomato DC3000 (Pto DC3000) was used as pathogenic strain on A. thaliana-Pto DC3000 was kindly provided by Dr. Fumiaki Katagiri at University of Minnesota
Ethanol (70%) (Wako Pure Chemical Industries, catalog number: 059-07895 )
Sodium hypochlorite (Wako Pure Chemical Industries, catalog number: 197-02206 )
Tween 20 (Wako Pure Chemical Industries, catalog number: 327-32475 )
Sterile distilled water
Rifampicin (50 mg/ml) (Wako Pure Chemical Industries, catalog number: 185-01003 )
Silwet L-77 (BMS, catalog number: BMS-SL7755 )
5% H2O2 (Wako Pure Chemical Industries, catalog number: 081-04215 )
Mannitol (Wako Pure Chemical Industries, catalog number: 133-00845 )
L-glutamic acid (Wako Pure Chemical Industries, catalog number: 074-00505 )
KH2PO4 (Wako Pure Chemical Industries, catalog number: 169-04245 )
NaCl (Wako Pure Chemical Industries, catalog number: 191-01665 )
MgSO4·7H2O (Wako Pure Chemical Industries, catalog number: 131-00405 )
Agar (Wako Pure Chemical Industries, catalog number: 010-15815 )
NaOH (Wako Pure Chemical Industries, catalog number: 192-15985 )
Murashige and Skoog basal medium (Sigma-Aldrich, catalog number: M0404 )
Sucrose (Wako Pure Chemical Industries, catalog number: 196-00015 )
PhytagelTM (Sigma-Aldrich, catalog number: P8169 )
KOH (Wako Pure Chemical Industries, catalog number: 165-21825 )
Media
Mannitol-glutamate (MG) medium (see Recipes)
One-half strength Murashige and Skoog (MS) medium (see Recipes)
Equipment
High-speed centrifuge (TOMY, model: MX305 )
Pipette (Mettler-Toledo, model: Pipet-Lite XLS+ )
Labo shaker (TAITEC, model: NR-2 )
Labo incubator (AS ONE, model: ICV-300P )
Clean work station (Hitachi Industrial Equipment Systems, model: CCV-1306E )
Spectrophotometer (JASCO, model: V-630 )
Plant growth chamber (NKsystem, model: LPH-411SP )
Digital scale (AS ONE, model: IB-300 )
Mortars and pestles (AS ONE, catalog number: 6-549-02 , φ90 mm)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ishiga, Y., Ishiga, T., Ichinose, Y. and Mysore, K. S. (2017). Pseudomonas syringae Flood-inoculation Method in Arabidopsis. Bio-protocol 7(2): e2106. DOI: 10.21769/BioProtoc.2106.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > Bacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,107 | https://bio-protocol.org/exchange/protocoldetail?id=2107&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Aggregation Prevention Assay for Chaperone Activity of Proteins Using Spectroflurometry
MB Manish Bhuwan*
Nasreen Z. Ehtesham
Seyed E. Hasnain
*Contributed equally to this work
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2107 Views: 11462
Edited by: Valentine V Trotter
Reviewed by: Soazig Le Guyon
Original Research Article:
The authors used this protocol in Mar/Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar/Apr 2016
Abstract
The ability to stabilize other proteins against thermal aggregation is one of the major characteristics of chaperone proteins. Molecular chaperones bind to nonnative conformations of proteins. Folding of the substrate is triggered by a dynamic association and dissociation cycles which keep the substrate protein on track of the folding pathway (Figure 1). Usually molecular chaperones exhibit differential affinities with different conformations of the substrate. With the exception of the sHsp family of molecular chaperones, the shift from a high-affinity binding state to the low-affinity release state is triggered by ATP binding and hydrolysis (Haselback and Buchner, 2015). Aggregation prevention assay is a simple, yet definitive assay to determine the chaperone activity of heat labile proteins such as Maltodextrin glucosidase (MalZ), Citrate Synthase (CS) and NdeI. This is based on the premise that proteins with chaperone like activity should prevent protein substrates (MalZ, CS and NdeI) from thermal aggregation. Here, we describe a detailed protocol for aggregation prevention assay using two different chaperone proteins, resistin and MoxR1, identified from our lab. Resistin, a human protein (hRes) and MoxR1 a Mycobacterium tuberculosis protein were analysed for their effect on prevention of MalZ/Citrate Synthase (CS)/NdeI aggregation.
Figure 1. Mechanism of action of molecular chaperones. Citrate synthase folds via increasingly structured intermediates (I1, I2) from the unfolded state (U) to the folded state (N). Under heat shock conditions, this process is reversed.
Keywords: Molecular chaperone Thermal aggregation prevention ATPase activity assay GroEL MoxR1 Resistin proteins Refolding of Enzymes & Proteins
Background
To elucidate the chaperone activity of a protein in vitro, several methods have been developed. Primarily these methods are based on examining the enzyme function and the ability of the chaperone to refold and protect enzyme activity under heat or other stress conditions. Other method to identify and study chaperones includes in silico analysis, or co-purification with other proteins. The limitations with such methods are less reproducibility or inherent high chances of false positive results. In the current method the use of light scattering to detect prevention of protein aggregation relies on thermal stabilization of protein only from denatured state, and in the presence of a chaperone. In contrast, if aggregate is formed from native or intermediate state of the protein the amount of aggregation might increase thereby decreasing the chance of false positive. Furthermore, this method uses the purified recombinant protein for the assay and therefore, can also be used to study other chaperone proteins from other bacterial sources.
Materials and Reagents
Pipette tips
Microcentrifuge tube
Parafilm
E. coli BL21 (DE3) cells
Citrate synthase ammonium sulfate suspension from porcine heart (Sigma-Aldrich, catalog number: C3260 )
Ammonium sulphate
Tris (pH 8.0) (AMRESCO, catalog number: 0497 )
Luria Bertani agar plates
Ampicillin (Sigma- Aldrich, catalog number: A9518 )
Isopropyl β-D-1-thiogalactopyranoside, IPTG (Sigma-Aldrich, catalog number: I6758 )
DNAse I (Sigma-Aldrich, catalog number: AMPD1 )
Magnesium chloride hexahydrate (MgCl2·6H2O) (Sigma-Aldrich, catalog number: M2670 )
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: 7626 )
Bradford reagent (Bio-Rad Laboratories, catalog number: 5000006 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
Recombinant protein MoxR1 and hRes (1 mg/ml) (Purified in the laboratory)
Purified recombinant protein GroEL (0.5 mg/ml) (Purified in the laboratory)
Lysozyme (1 mg/ml) (Sigma-Aldrich, catalog number: 4919 )
Milli-Q water
NdeI (20,000 U/ml) (New England BioLab, catalog number: R0111 )
Maltodextrin glucosidase protein (1 mg/ml) (Purified in the laboratory)
EDTA (Sigma-Aldrich, catalog number: E9884 )
Sodium phosphate (dibasic) heptahydrate (Na2HPO4·7H2O) (AMRESCO, catalog number: 0348 )
Sodium phosphate (monobasic) anhydrous (NaH2PO4) (AMRESCO, catalog number: 0571 )
Sodium chloride (NaCl) (AMRESCO, catalog number: 0241 )
Imidazole (AMRESCO, catalog number: 0527 )
Glycerol (AMRESCO, catalog number: 0854 )
TE buffer (see Recipes)
20 mM sodium phosphate buffer pH 7.4 (see Recipes)
Binding buffer (see Recipes)
Washing buffer (see Recipes)
Elution buffer (see Recipes)
Dialysis buffer (see Recipes)
Equipment
Pipette (Gilson, model: Pipetman Neo®)
Centrifuge (Hermle Labor Technik, model: Z 326 K )
PerkinElmer spectrofluorometer (PerkinElmer, model: LS55 ) with controlled temperature peltier block
Incubator (Eppendorf, BrunswickTM, model: 44/44R )
Quartz cuvette (PerkinElmer, Suprasil®, catalog number: B0631071 )
pH meter (Thermo Fisher Scientific, Thermo Scientific, model: CyberScan Ph 510 )
Fluorescence spectrophotometer (Agilent Technologies, model: Cary Eclipse )
Software
Microsoft Excel
Graphpad Prism 5
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bhuwan, M., Suragani, M., Ehtesham, N. Z. and Hasnain, S. E. (2017). Aggregation Prevention Assay for Chaperone Activity of Proteins Using Spectroflurometry. Bio-protocol 7(2): e2107. DOI: 10.21769/BioProtoc.2107.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,108 | https://bio-protocol.org/exchange/protocoldetail?id=2108&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
P-body and Stress Granule Quantification in Caenorhabditis elegans
Matthias Rieckher
Nektarios Tavernarakis
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2108 Views: 12853
Edited by: Jyotiska Chaudhuri
Reviewed by: Leonardo G. GuilgurPia Giovannelli
Original Research Article:
The authors used this protocol in May 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2015
Abstract
Eukaryotic cells contain various types of cytoplasmic, non-membrane bound ribonucleoprotein (RNP) granules that consist of non-translating mRNAs and a versatile set of associated proteins. One prominent type of RNP granules is Processing bodies (P bodies), which majorly harbors translationally inactive mRNAs and an array of proteins mediating mRNA degradation, translational repression and cellular mRNA transport (Sheth and Parker, 2003). Another type of RNP granules, the stress granules (SGs), majorly contain mRNAs associated with translation initiation factors and are formed upon stress-induced translational stalling (Kedersha et al., 2000 and 1999). Multiple evidence obtained from studies in unicellular organisms supports a model in which P bodies and SGs physically interact during cellular stress to direct mRNAs for transport, decay, temporal storage or reentry into translation (Anderson and Kedersha, 2008; Decker and Parker, 2012). The quantification, distribution and colocalization of P bodies and/or SGs are essential tools to study the composition of RNP granules and their contribution to fundamental cellular processes, such as stress response and translational regulation. In this protocol we describe a method to quantify P bodies and SGs in somatic tissues of the nematode Caenorhabditis elegans.
Keywords: Caenorhabditis elegans mRNP granules Processing bodies Stress granules Transgenesis
Background
Thus far, most protocols to study P bodies and SGs were developed for yeast or human cell lines (Buchan et al., 2010). Little is known about the function of somatic RNP granules in multicellular organisms. The simple model organism C. elegans has been extensively used to study germline-specific P granules, which are distinct from P bodies and SGs, and important structures for germline development and function (Updike and Strome, 2010). Although the principles of the presented procedure can be applied to count germline-specific P granules, the protocol focusses on the quantification of somatic RNP granules. Several studies have identified a conserved function of somatic P bodies in the translational deregulation via miRNA pathways in C. elegans (Ding et al., 2005; Zhang et al., 2007). More recently, various tools were created to study the involvement of cytoplasmic RNP granules in cellular and organismal stress response, development and ageing in the nematode (Cornes et al., 2015; Huelgas-Morales et al., 2016; Rieckher et al., 2015; Rousakis et al., 2014; Sun et al., 2011; Table 1).
Such studies take advantage of the comparatively easy implementation of transgenesis methods in C. elegans that allow to constitutively express fluorescent fusion proteins (e.g., green fluorescent protein [GFP]), endogenously or in specific tissues (Rieckher et al., 2009). A collection of fosmids carrying gfp-tagged P body- and SG-specific genes can be obtained at the ‘C. elegans TransGeneome’ project, a genome-scale transgenic project for fluorescent- and affinity-tagged proteins for expression in the nematode (Sarov et al., 2012; Table 1). C. elegans is transparent, which allows for efficient application of fluorescence microscopy methods that are easily combined with differential interference contrast (DIC) microscopy to reveal fluorescent protein expression in an anatomical context. Mounting transgenic animals for P body and SG imaging is based on a previously described method using nanoparticles for immobilization (Kim et al., 2013), since commonly applied anesthetics in C. elegans can induce stress, resulting in increased RNP granule formation. Fluorescence-tagged P body or SG-intensity can be imaged by epifluorescence light microscopy (see Procedure C), while fluorescence intensity, a detailed count and size measurements of P bodies and SGs can be obtained via confocal laser scanning microscopy (see Procedure D).
Table 1. Tools available for transgenic expression of P body/SG-factors in C. elegans
*available at CGC
+germline-specific promoter fusion
$C. elegans TransGeneome project (Sarov et al., 2012)
&can be found in both types of RNP granules
Materials and Reagents
Sterile pipette tips
Surgical disposable scalpel (Braun Medical, catalog number: 5518075 )
Worm Pick with platinum wire (Genesee Scientific, catalog numbers: 59-30P6 )
Pre-flattened tip (Genesee Scientific, catalog numbers: 59-AWP )
Microscope slides (76 x 26 mm) (Carl Roth, catalog number: 0656.1 )
Cover slips (24 x 24 mm) (Carl Roth, catalog number: H875.2 )
Tape (~1 mm thickness)
Greiner Petri dishes (60 x 15 mm) (Greiner Bio One, catalog number: 628161 )
C. elegans strains (see Table 1 for available transgenes)
Escherichia coli OP50 strain (obtained from the Caenorhabditis Genetics Center)
Nail polish
Polystyrene beads (Polybead, 2.5% by volume, 0.1 µm diameter)
Potassium dihydrogen phosphate (KH2PO4) (Carl Roth, catalog number: P018.1 )
Di-potassium hydrogen phosphate (K2HPO4) (Carl Roth, catalog number: 5066.1 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Di-sodium hydrogen phosphate (Na2HPO4) (Carl Roth, catalog number: T876.1 )
Bacto peptone (BD, catalog number: 211677 )
Streptomycin sulfate salt (Sigma-Aldrich, catalog number: S6501 )
Agar (Sigma-Aldrich, catalog number: 05040 )
Cholesterol stock solution (SERVA Electrophoresis, catalog number: 17101.01 )
Calcium chloride dihydrate (CaCl2·2H2O) (Sigma-Aldrich, catalog number: C5080 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Nystatin stock solution (Sigma-Aldrich, catalog number: N3503 )
Agarose (Biozym, catalog number: 840004 )
Phosphate buffer (1 M; sterile) (see Recipes)
Nematode growth medium (NGM) agar plates (see Recipes)
M9 buffer (see Recipes)
5% agarose pads (see Recipes)
Equipment
Dissecting stereomicroscope (Olympus, model: SMZ645 )
Epifluorescence microscope (ZEISS, model: Axio Imager Z2 , objective EC Plan-Neofluar 10x/0.3)
Confocal microscope (we use the Zeiss LSM710 confocal microscope with an Argon multiline laser source 25 mW and a tunable laser with the wavelength range 488-640 nm) (ZEISS, model: LSM710)
Microwave
Incubators for stable temperature (AQUA®LYTIC incubator 20 °C)
Scale
Cylindrical glass beaker (25 ml) (VWR, catalog number: 213-1120 )
Autoclave
Software
ZEN 2009 software (or later), Carl Zeiss AG, Jena, Germany (or any other software controlling a fluorescence microscope or confocal microscope)
Microsoft Office 2011 Excel (Microsoft Corporation, Redmond, USA)
Fiji or ImageJ (https://fiji.sc/ or https://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Rieckher, M. and Tavernarakis, N. (2017). P-body and Stress Granule Quantification in Caenorhabditis elegans. Bio-protocol 7(2): e2108. DOI: 10.21769/BioProtoc.2108.
Rousakis, A., Vlanti, A., Borbolis, F., Roumelioti, F., Kapetanou, M. and Syntichaki, P. (2014). Diverse functions of mRNA metabolism factors in stress defense and aging of Caenorhabditis elegans. PLoS One 9(7): e103365.
Download Citation in RIS Format
Category
Developmental Biology > Cell signaling > Stress response
Cell Biology > Cell signaling > Stress response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,109 | https://bio-protocol.org/exchange/protocoldetail?id=2109&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transplantation of Mesenchymal Cells Including the Blastema in Regenerating Zebrafish Fin
ES Eri Shibata
KA Kazunori Ando
AK Atsushi Kawakami
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2109 Views: 8830
Reviewed by: Michelle Goody
Original Research Article:
The authors used this protocol in Aug 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2016
Abstract
Regeneration of fish fins and urodele limbs occurs via formation of the blastema, which is a mass of mesenchymal cells formed at the amputated site and is essential for regeneration. The blastema transplantation, a novel technique developed in our previous studies (Shibata et al., 2016; Yoshinari et al., 2012) is a useful approach for tracking and manipulating the blastema cells during fish fin regeneration.
Keywords: Zebrafish Fin regeneration Blastema Transplantation Cell lineage
Background
Cell transplantation studies are routinely performed during the early embryonic stage in animal models such as fish, amphibians and mammals, but targeting the transplanted cells to specific tissues has been difficult. Blastema transplantation developed in our studies is an efficient method for introducing mesenchymal donor cells into host fin ray. It enables us to track cell fate and/or manipulate cell signaling such as fibroblast growth factor (Fgf) during fish fin regeneration. Actually, in our recently published work, we transplanted blastema cells, which carried the hsp70l:dominant-negative fgf receptor and the β-actin:dsRed2 transgenes, into a wild-type blastema region and mosaically inhibited Fgf signaling in a subset of fin ray mesenchymal cells (Shibata et al., 2016). This method is applicable for analyzing other cell signals and for tracking cell fate by live cell imaging.
Materials and Reagents
50 ml disposable syringe (Terumo, catalog number: SS-50ESZ )
Stainless steel surgical blade, No.10 (FEATHER Safety Razor, catalog number: No. 10 )
Plastic dish (9 cm diameter) (As One, catalog number: GD90-15 )
Glass capillary (1 x 90 mm, without filament) (Narishige, catalog number: G-1 )
Dissection needle: This is made by attaching 30 G needle (BD, catalog number: 305106 ) to a P1000 pipette chip (BM Equipment, catalog number: BIO1000RF ) whose tip is truncated (Figure 1)
Note: A handmade tool for removing the wound epidermis from the regenerate and for dissecting the blastema. This needle is different from that for transplantation (see Procedure B).
Figure 1. Dissection needle
Syringe filter unit (0.22 µm) (EMD Millipore, catalog number: SLGV033RB )
Zebrafish transplantation donor strain: Tg(Olactb:loxP-dsred2-loxP-egfp), which constitutively expresses the DsRed2 ubiquitously (Yoshinari et al., 2012). For simplicity, we refer the line as Tg(β-actin:dsred2) in this manuscript
Zebrafish transplantation host: a wild-type strain, which has been maintained in our facility by inbred breeding
Agarose (Nacalai Tesque, catalog number: 01028-85 )
Tricaine (3-aminobenzoic acid ethyl ester) (Sigma-Aldrich, catalog number: A5040 )
Fetal bovine serum (FBS) (any brand can be used)
Leibowitz’s L-15 medium (powder) (Thermo Fisher Scientific, GibcoTM, catalog number: 41300070 )
1 M Tris-HCl (pH 9)
L-15 medium (see Recipes)
20x tricaine stock solution (see Recipes)
Equipment
Microwave oven
Micropipette puller (Sutter Instrument, model: P-97 )
Forceps
Glass dish (5 cm diameter)
Surgical blade handle (FEATHER Safety Razor, catalog number: No. 3 )
Microforge (Narishige, model: MF-900 )
Three-dimensional coarse manual manipulator (Narishhige, model: M-152 ) installed on a magnet stand
P20 micropipette
Fluorescence stereomicroscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Shibata, E., Ando, K. and Kawakami, A. (2017). Transplantation of Mesenchymal Cells Including the Blastema in Regenerating Zebrafish Fin. Bio-protocol 7(2): e2109. DOI: 10.21769/BioProtoc.2109.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Regeneration
Stem Cell > Pluripotent stem cell > Blastema cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
211 | https://bio-protocol.org/exchange/protocoldetail?id=211&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunofluorescence Analysis of Yeast Protein
Yuehua Wei
Published: Vol 2, Iss 13, Jul 5, 2012
DOI: 10.21769/BioProtoc.211 Views: 16671
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Many important regulatory proteins such as transcription factors are regulated through subcellular localization. Protein localization can be examined by fusing a GFP tag. However, GFP is relatively big in size, and potentially may affect correct protein localization. Several small tags have been developed, such as myc, HA or Flag. By using immunostain and fluorescence microscopy as described in this protocol, one can easily probe the regulation of a selected yeast protein with the application of the aforementioned small tags.
Keywords: Yeast Immunofluorescence Microscope Spheroplast Antibody
Materials and Reagents
Yeast cells
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P8416 )
Potassium phosphate dibasic (K2HPO4·3H2O) (Sigma-Aldrich, catalog number: P9666 )
Sorbitol (C6H14O6) (Sigma-Aldrich, catalog number: S1876 )
BSA (Albumin from bovine serum) (Sigma-Aldrich, catalog number: A4503 )
Potassium chloride (KCl) (Thermo Fisher Scientific, catalog number: BP366-1 )
37% formaldehyde solution (Thermo Fisher Scientific, catalog number: F75P1GAL )
Zymolyase (USB, catalog number: Z1001 )
Vectorshield
Poly-L-lysine
DAPI
Cytoseal 60
Phosphate buffer (see Recipes)
Sorbitol buffer (see Recipes)
Blocking buffer (see Recipes)
Equipment
Centrifuges
Shaker
Conical tube
Fluorescence microscope
15 ml conical tube
Light microscope
Heat blot
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wei, Y. (2012). Immunofluorescence Analysis of Yeast Protein. Bio-protocol 2(13): e211. DOI: 10.21769/BioProtoc.211.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Fluorescence
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,110 | https://bio-protocol.org/exchange/protocoldetail?id=2110&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Virus Binding and Internalization Assay for Adeno-associated Virus
GB Garrett E. Berry
Longping V. Tse
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2110 Views: 11823
Edited by: Yanjie Li
Reviewed by: Angela CoronaKristin Shingler
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
The binding and internalization of adeno-associated virus (AAV) is an important determinant of viral infectivity and tropism. The ability to dissect these two tightly connected cellular processes would allow better understanding and provide insight on virus entry and trafficking. In the following protocol, we describe a quantitative PCR (qPCR) based method to determine the amount of vector bound to the cell surface and the amount of subsequent virus internalization based on viral genome quantification. This protocol is optimized for studying AAV. Nevertheless, it can serve as a backbone for studying other viruses with careful modification.
Keywords: Adeno-associated virus Binding Internalization Virus entry Virus Cell surface
Background
Studies that assess AAV biology generally use transgene expression as the experimental endpoint. However, there are a number of critical steps AAV must successfully navigate before it reaches the nucleus and transduces the cell. Therefore, there are multiple distinct steps in the AAV infectious pathway that could be disrupted individually or collectively, leading to altered transduction. Assessment of AAV binding and internalization are important first steps in determining the cause of transduction differences observed upon cellular modification by small molecules, CRISPR-based gene knockout, siRNA-based gene knockdown, or other experimental procedures.
Materials and Reagents
12-well tissue culture (TC) treated plates (Corning, catalog number: 3513 )
GeneMate 1.7 ml microcentrifuge tubes (BioExpress, catalog number: C-3262-1 )
Tips
Lightcycler 96-well qPCR plates (Roche Molecular Systems, catalog number: 04729692001 )
Cell lifter (Corning, catalog number: 3008 )
HeLa cells (ATCC, catalog number: CCL-2 )
Purified single-stranded AAV (any serotype) (Grieger et al., 2012)
1x PBS (Thermo Fisher Scientific, GibcoTM, catalog number: 14190144 )
DNeasy Blood and Tissue Kit (QIAGEN, catalog number: 69504 )
Molecular grade water (Mediatech, catalog number: 46-000-C )
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 11995065 )
Trypsin-EDTA (Thermo Fisher Scientific, GibcoTM, catalog number: 25300054 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F2442 )
100x penicillin/streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
FastStart Essential DNA Green Master Mix (Roche Molecular Systems, catalog number: 06402712001 )
Virus-specific qPCR primers (at a working concentration of 20 µM each)
fLuc-F – AAAAGCACTCTGATTGACAAATAC
fLuc-R – CCTTCGCTTCAAAAAATGGAAC
Human genomic qPCR primers (at a working concentration of 20 µM each)
hLB2C1-F – GTTAACAGTCAGGCGCATGGGCC
hLB2C1-R – CCATCAGGGTCACCTCTGGTTCC
10 ng/μl CBA-fLuc plasmid stock solution (see Recipes)
100 ng/μl HeLa genomic DNA stock solution (see Recipes)
Equipment
Pipette
Biosafety cabinet
CO2 tissue culture incubator (NuAire, model number: NU-5500 )
Tabletop centrifuge (Eppendorf, catalog number: 022620401 )
Lightcycler 96 qPCR instrument (Roche Molecular Systems, catalog number: 05815916001 )
PCR plate microcentrifuge (VWR, catalog number: 89184-608 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Berry, G. E. and Tse, L. V. (2017). Virus Binding and Internalization Assay for Adeno-associated Virus. Bio-protocol 7(2): e2110. DOI: 10.21769/BioProtoc.2110.
Berry, G. E. and Asokan, A. (2016). Chemical modulation of endocytic sorting augments adeno-associated viral transduction. J Biol Chem 291(2): 939-947.
Download Citation in RIS Format
Category
Immunology > Complement analysis > Virus
Molecular Biology > DNA > DNA quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,111 | https://bio-protocol.org/exchange/protocoldetail?id=2111&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bioassay of Xanthomonas albilineans Attachment on Sugarcane Leaves
Imène Mensi
Jean-Heinrich Daugrois
Philippe Rott
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2111 Views: 8939
Edited by: Zhaohui Liu
Reviewed by: Shahin S. Ali
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Sugarcane (interspecific hybrids of Saccharum species) is an economically important crop that provides 70% of raw table sugar production worldwide and contributes, in some countries, to bioethanol and electricity production. Leaf scald, caused by the bacterial plant pathogen Xanthomonas albilineans, is one of the major diseases of sugarcane. Dissemination of X. albilineans is mainly ensured by contaminated harvesting tools and infected stalk cuttings. However, some strains of this pathogen are transmitted by aerial means and are able to survive as epiphytes on the sugarcane phyllosphere before entering the leaves and causing disease. Here we present a protocol to estimate the capacity of attachment of X. albilineans to sugarcane leaves. Tissue-cultured sugarcane plantlets were immersed in a bacterial suspension of X. albilineans and leaf attachment of X. albilineans was determined by two methods: leaf imprinting (semi-quantitative method) and leaf washing/homogenization (quantitative method). These methods are important tools for evaluating pathogenicity of strains/mutants of the sugarcane leaf scald pathogen.
Keywords: Attachment Leaf imprinting Leaf scald Pathogenicity Phyllosphere Sugarcane Tissue culture Xanthomonas albilineans
Background
The mechanisms that govern the interactions between X. albilineans and its host plant (the sugarcane) are not well known. Albicidin, a phytotoxin produced by albilineans, is the only molecular factor which has been demonstrated to play a role in pathogenicity of this pathogen (Birch, 2001). However, pathogenicity of X. albilineans doesn’t completely depend on albicidin. Albicidin-deficient mutants are still able to colonize efficiently the sugarcane stalk and to produce disease symptoms (Birch, 2001; Rott et al., 2011). Studies using full grown sugarcane are space and time consuming. Bioassays using miniaturized plants (tissue-cultured plants) or detached leaf bioassays can be very useful because they are less space consuming and they allow the study of plant-pathogen interactions in controlled environments. In vitro propagation of plants is widely used to rapidly propagate disease-free planting material under controlled conditions (Kumar and Reddy, 2011). Additionally, leaf imprinting has been widely used to study the ecology of bacteria associated with the phyllosphere (Hirano and Upper, 2000; Yadav et al., 2010). However, to our knowledge, these techniques have never been associated to decipher pathogenicity of bacterial plant pathogens. To identify additional pathogenicity factors of X. albilineans, especially factors involved in the early phases of infection (epiphytic phase), we developed a new miniaturized bioassay using tissue cultured sugarcane plantlets. Attachment of X. albilineans to sugarcane leaves under axenic condition was reproduced (Fleites et al., 2013; Mensi et al., 2016). This bioassay will permit the rapid testing of leaf attachment capacity of wild type and mutant strains of the pathogen causing leaf scald disease, but also of other bacteria colonizing the sugarcane leaf canopy.
Materials and Reagents
Sterile scalpels blades (Swan Morton, catalog numbers: n° 11 and n° 24 )
Sterilized pipette tips
200 µl (Thermo Fischer Scientific, Fischer Scientific, catalog number: 02-681-2 )
1,000 µl (Thermo Fischer Scientific, Fischer Scientific, catalog number: 02-681-4 )
Sterile plastic loops (Greiner Bio One, catalog number: 731171 )
Falcon 15 ml conical centrifuge tubes (SARSTEDT, catalog number: 62.554.502 )
Soft tissue (Orapi Hygiène, catalog number: 186 )
Disposable, sterile splinter removers/tweezers – 11.1 cm. (4 ¼ in.) (TSIC Solution, catalog number: UTIL-1037 )
90 x 15 mm Petri dishes (Corning, GosselinTM, catalog number: BP93B-15 )
1.5 ml microcentrifuge tube (SARSTEDT, catalog number: 72.690.001 )
Disposable pellet pestle for 1.5 ml centrifuge tube (Kimble Chase Life Science and Research Products, catalog number: 749521-1500 )
Sugarcane plantlets (cultivar CP68-1026 susceptible to leaf scald disease of sugarcane)
Xanthomonas albilineans wild type strains and mutants affected in pathogenicity (grown for 4 to 5 days on Wilbrink medium + appropriate antibiotics); for characteristics of mutants, see Fleites et al. (2013) and Mensi et al. (2016)
Sterile distilled water
Tween 20 (Sigma-Aldrich, catalog number: P2287 )
Sucrose (Merck Millipore, catalog number: 107687 )
Peptone (BD, BactoTM, catalog number: 211677 )
Potassium phosphate, dibasic, trihydrate (K2HPO4·3H2O) (EMD Millipore, Calbiochem®, catalog number: 529567 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (EMD Millipore, catalog number: 105886 )
Sodium sulfite (Na2SO3) (EMD Millipore, catalog number: 106657 )
Agar (BD, BactoTM, catalog number: 214010 )
Potassium bromide, KBr (Sigma-Aldrich, catalog number: P0838 )
Benomyl (Sigma-Aldrich, catalog number: 381586 )
Cycloheximide (Sigma-Aldrich, catalog number: C1988 )
Ethanol (Sigma-Aldrich, catalog number: 32294 )
Note: This product has been discontinued.
Cephalexin (Sigma-Aldrich, catalog number: C0675000 )
Novobiocin (Sigma-Aldrich, catalog number: 1475008 )
Kasugamycin (Sigma-Aldrich, catalog number: 19408-46-9 )
Ammonium nitrate (NH4NO3) (Sigma-Aldrich, catalog number: A3795 )
Potassium nitrate (KNO3) (Sigma-Aldrich, catalog number: P8291 )
Calcium nitrate tetrahydrate (Ca(NO3)2·4H2O) (Sigma-Aldrich, catalog number: C2786 )
Magnesium sulfate heptahydrate (MgSO4·7H2O) (Sigma-Aldrich, catalog number: 63138 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P5405 )
Boric acid (H3BO3) (Sigma-Aldrich, catalog number: B6768 )
Manganese(II) sulfate monohydrate (MnSO4·H2O) (Sigma-Aldrich, catalog number: M7899 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: Z1001 )
Potassium iodide (KI) (Sigma-Aldrich, catalog number: P8166 )
Ammonium molybdate tetrahyddrate ((NH4)6Mo7O24·4H2O) (Sigma-Aldrich, catalog number: M1019 )
Copper(II) nitrate trihydrate (Cu(NO3)2·3H2O) (Sigma-Aldrich, catalog number: 61194 )
Iron(II) sulfate heptahydrate (FeSO4·7H2O) (EMD Millipore, catalog number: 103965 )
Na2EDTA·2H2O (Sigma-Aldrich, catalog number: E5134 )
Nicotinic acid (Sigma-Aldrich, catalog number: N4126 )
Pyridoxol hydrochloride (Sigma-Aldrich, catalog number: P6280 )
Myo-inositol (Sigma-Aldrich, catalog number: I7508 )
Thiamine dichloride (Sigma-Aldrich, catalog number: T1270 )
Phytagel (Sigma-Aldrich, catalog number: P8169 )
Wilbrink medium (WM) (see Recipes)
Wilbrink Selective Davis (WSD) medium (see Recipes)
Macronutrients (see Recipes)
Micronutrients (see Recipes)
Ferric EDTA (see Recipes)
Fuji vitamins (see Recipes)
Nutritive medium for growth of sugarcane plantlets (see Recipes)
Equipment
Growth chamber
200 x 20 mm Pyrex test tubes with cap (Legallais, catalog number: 761224 )
200 mm long tweezers with blunt tips (VWR, catalog number: 82027-436 )
Micropipettes
20-200 µl (Eppendorf, catalog number: 3120000054 )
100-1,000 µl (Eppendorf, catalog number: 3120000062 )
Scalpels (Swan Morton, catalog numbers: N° 3G S/S and N° 4G S/S )
Incubator for microbiology (Memmert, model: B40 )
Note: This product has been discontinued.
Benchtop vortex (Scientific Industries, model: Vortex Genie 2 )
Spectrophotometer (Eppendorf Biophotometer)
250 or 500 ml wide neck Erlenmeyer flasks (Borosilicate glass) (Duran, catalog number: 21 226 36 or 21 226 44 )
Laminar flow cabinet or sterile hood
Autoclave
Software
Package R, version 2.14.1 (R Development Core Team)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mensi, I., Daugrois, J. and Rott, P. (2017). Bioassay of Xanthomonas albilineans Attachment on Sugarcane Leaves. Bio-protocol 7(2): e2111. DOI: 10.21769/BioProtoc.2111.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,112 | https://bio-protocol.org/exchange/protocoldetail?id=2112&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Expression Protocol for an Adenylate Cyclase Anchored by a Vibrio Quorum Sensing Receptor
SB Stephanie Beltz
JS Joachim E. Schultz
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2112 Views: 8498
Edited by: Arsalan Daudi
Reviewed by: Agnès GroisillierTimo Lehti
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
The direct regulation of a mycobacterial adenylate cyclase (Rv1625c) via exchange of its membrane anchor by the quorum sensing receptor CqsS (Vibrio harveyi) has recently been reported (Beltz et al., 2016). This protocol describes the expression and membrane preparation for these chimeric proteins.
Keywords: Adenylate cyclase (AC) Quorum sensing (QS) CqsS Membrane protein Protein expression French press
Background
Membrane-delimited mammalian adenylate cyclases (ACs) are class IIIa ACs. Regulation is indirectly via stimulatory (or inhibitory) Gα-proteins which are released intracellularly upon extracellular stimulation of G-protein-coupled-receptors (GPCR) by first messengers. ACs generate the universal second messenger cAMP using ATP as a substrate. The size of the two hexahelical membrane domains in vertebrate ACs by far exceeds the requirements for a simple membrane anchorage. Yet, regulatory features of this intrinsic membrane anchor/receptor domain are unknown. To investigate a potential function the canonical class IIIa AC Rv1625c from Mycobacteria was chosen which can be easily expressed in bacteria (Guo et al., 2001 and 2005) in contrast to mammalian AC isoforms. We replaced the hexahelical membrane anchor of the Rv1625c AC by the receptor domain of the hexahelical quorum sensing (QS) receptor from V. harveyi, CqsS, to examine whether we can confer a direct regulation of the AC by the QS-ligand ‘cholera autoinducer-1’, CAI-1. The design of the QS-receptor and the class IIIa membrane anchors are highly similar, i.e., minimal transmembrane α-helices and exceptionally short connecting loops.
We have demonstrated a direct regulation of a class IIIa AC by an extracellular signal. This considerably supports the hypothesis of a receptor function for the membrane anchor. Indeed, it raises the possibility that in addition to the well-established indirect GPCR-Gα-protein regulation of mammalian ACs a second, rather different set of signals directly impinge on this most important enzyme.
Materials and Reagents
Expression
FisherbrandTM syringe filter, 25 mm, 0.22 µm (Thermo Fisher Scientific, Fisher Scientific, catalog number: 09719A )
Note: This product has been discontinued.
Glycerol stock of Escherichia coli BL21 (DE3) (F-ompT hsdSB [rB-mB-] gal dcm [DE3]) transformed with plasmid pQE80L or pETDuet-3:
pQE80L [QIAGEN, ΔXhoI, ΔNcoI]
Encodes a lacIq repression module; N-terminal RGS- His6-tag
pETDuet-3 (Figure 1)
MCS1 of pETDuet-1 [Novagen] is converted to MCS of pQE30 [QIAGEN]
MCS1: N-terminal RGS-His6-tag, MCS2: C-terminal S-tag
Note: Expression of both plasmids is controlled by an IPTG-inducible T5 (pQE80L) or T7 (pETDuet-3) promoter. pQE80L has only one MCS. If you want to co-express a second protein from the same plasmid, pETDuet expression vectors are suitable.
Ampicillin sodium salt (Carl Roth, catalog number: K029 )
IPTG (isopropyl β-D-thiogalactopyranoside) (AppliChem, catalog number: A1008 )
LB broth (Lennox) (Carl Roth, catalog number: X964 )
Ampicillin solution (see Recipes)
IPTG solution (see Recipes)
LB-medium (see Recipes)
Figure 1. Comparison of the two MCS of pETDuet-1 (A) and pETDuet-3 (B)
Note: This sequence map is generated using the program DNA5 (https://pga.mgh.harvard.edu/web_apps/web_map/start).
Cell harvesting
Culture from expression
Tris (AppliChem, catalog number: A1086 )
HCl (37%)
EDTA (Sigma-Aldrich, catalog number: E5134 )
Wash-buffer (see Recipes)
Membrane preparation
1.5 ml Eppendorf tube
Frozen cell pellet from expression
Thioglycerol (Sigma-Aldrich, catalog number: M1753 )
Sodium chloride, NaCl (EMD Millipore, catalog number: 106404 )
cOmpleteTM EDTA-free protease inhibitor (Roche Diagnostics, catalog number: 05056489001 )
Glycerol (EMD Millipore, catalog number: 104094 )
Liquid N2
Lysis-buffer (see Recipes)
Membrane-buffer (see Recipes)
Data analysis
Tris (AppliChem, catalog number: A1086)
HCl (37%)
Sodium dodecyl sulfate, SDS (Sigma-Aldrich, catalog number: 71729 )
β-mercaptoethanol (EMD Millipore, catalog number: 805740 )
Glycerol (EMD Millipore, catalog number: 104094)
Bromophenol blue (Sigma-Aldrich, catalog number: B8026 )
RGSHis-antibody (QIAGEN, catalog number: 34650 )
S-tag-antibody (EMD Millipore, catalog number: 71549 )
Protein marker IV prestained (VWR, catalog number: 27-2110 )
Protein marker I unstained (VWR, catalog number: PEQL27-1010 )
ECL Plex goat-anti-mouse IgG-Cy3-antibody (GE Healthcare, catalog number: PA43010 )
4x SDS-loading dye (see Recipes)
Equipment
Expression
1 L Erlenmeyer flask
Eppendorf Biophotometer
Cuvettes
Shaker incubator (37 °C and 22 °C)
Cell harvesting
Centrifuges (supplier: Thermo Fisher Scientific)
Sorvall RC5B Plus
Rotor: Kontron-Hermle A6.14 (Sorvall, catalog number: 202200 )
Heraeus Megafuge 1.0R
Rotor: Heraeus Sepatech BS4402/A (Heraeus, catalog number: 3360 )
250 ml Sorvall metal rotor tubes (Sorvall, catalog number: 522 )
50 ml centrifuge tube (Greiner Bio One, catalog number: 227261 )
Vortex Genie-2 (VWR, catalog number: 4445900 )
Box with water-ice-mix
Freezer (-80 °C)
Membrane preparation
Vortex Genie-2 (Scientific Industries, model: Vortex-Genie 2 )
French® Pressure Cell Press (SLM Instruments, SLM Aminco®, model: FA-078-E1 )
Alternative supplier: Glen Mills Inc. (USA) or G.Heinemann Ultraschall- und Labortechnik (Germany)
Aminco® French Pressure Cell (SLM Instruments, SLM Aminco®, catalog number: FA-073 , serial number: 9110668)
Alternative supplier: Glen Mills Inc. (USA) or G.Heinemann Ultraschall- und Labortechnik (Germany)
Centrifuges
Heraeus Megafuge 1.0R
Rotor: Heraeus Sepatech BS4402/A (Heraeus, catalog number: 3360 )
Beckmann L-60
Rotor: Beckman Coulter, model: Type 50.2 Ti
Box with water-ice-mix
Polycarbonate ultracentrifuge-tubes
7 ml Dounce Tissue Grinder (WHEATON, catalog number: 357542 )
Freezer (-80 °C)
Data analysis
Ettan DIGE Imager (GE Healthcare, catalog number: 63005642 or 29-0834-61 )
Software
Program DNA5 (https://pga.mgh.harvard.edu/web_apps/web_map/start)
Procedure
Expression
Inoculate a flask containing 200 ml LB-medium and 200 µl ampicillin (final concentration: 100 µg/ml) with approximately 5 ml overnight culture with the desired construct (see Materials and Reagents A1. point) to an OD600 of 0.1.
Incubate the culture under shaking (200 rpm) at 37 °C up to an OD600 of 0.2-0.3 (approx. 45-90 min).
Lower temperature to 22 °C (shaker incubator).
At an OD600 of 0.4-0.6 induce expression by 500 µM IPTG (100 µl 1 M IPTG/200 ml culture).
Cell harvesting
Harvest the cells at an OD600 of 2.0-2.8 (120-150 min after induction).
Collect cells at 3,200 x g for 10 min at 4 °C (Sorvall centrifuge).
Add 25 ml of wash-buffer (4 °C) to the pellet, suspend by vortexing and pellet at 4,300 x g for 30 min at 4 °C (Heraeus centrifuge).
Discard supernatant and store cells at -80 °C or continue with the membrane preparation.
Membrane preparation
Thaw frozen cells on ice and suspend in 25 ml of lysis-buffer (4 °C) by vortexing.
Notes:
The cell pellet should be completely dissolved to avoid clogging the outlet of the Aminco® French Pressure Cell.
Add always the cOmpleteTM EDTA-free protease inhibitor tablet just before using the lysis-buffer.
Lyse cells mechanically by French press (1,100 psi) twice (Figure 2).
Notes:
Aminco® French Pressure Cell should be kept pre-cooled at 4 °C.
Open outlet of the Aminco® French Pressure Cell such that a flow drop by drop is visible.
Make sure that samples are continuously cooled in ice-water.
Centrifuge homogenate for 30 min, 4 °C, 4,300 x g (Heraeus centrifuge) and discard pellet (cell debris).
Transfer supernatant to an ultracentrifuge-tube and pellet membranes at 100,000 x g, 4 °C for 60 min (Beckman L-60 centrifuge).
Decant supernatant, take up membranes (pellet) in 1-2 ml membrane-buffer and gently suspend in a homogenizer (Dounce Tissue Grinder). Transfer the membrane preparation into a 1.5 ml Eppendorf tube.
Note: The amount of membrane-buffer to be used depends on the size of the pellet. Suspend a pellet of approximately 1 cm in diameter at the bottom of the centrifuge tube in 2 ml membrane-buffer.
Freeze membrane preparation in liquid N2 and store at -80 °C.
Figure 2. Short French press protocol. A. Equipment of the French Pressure Cell; B. Aminco French Pressure Cell (taken out of the fridge 4 °C); C. Attention! Before use: Grease the O-rings and back-up rings of the stamp with glycerol! Insert the stamp into the cell body so that the inner cell body surface is covered with glycerol as well! D. Place the cell body with the stamp upside down into the stand with the opening facing upwards. E. Place the flow valve into the hole. F. Fill in the cell solution (looks milky). G. Put the lid on top. H. Close the flow valve. I. Place the French Pressure Cell into the gadget and… (J) close the bracket. K. Start the French press by turning the hand gear on ‘high’ and (L) switch on the pump. M. When the French press set up 1,100 psi… (N) open carefully the flow valve such that… (O) a flow drop by drop is visible. P. Attention! Stop in time so you can easily open the bracket and the stamp does not hit the ground! Q. When you are done, flip the switch to ‘down’ and turn on the pump again. The hydraulic lift moves down and you can take out the French Pressure Cell. R. Your cells are lysed properly when you can see the scale through the tube. S. Put your sample back on ice for the next step.
Data analysis
The expression of the proteins is verified by SDS-PAGE (Laemmli, 1970) and Western blot. The isolated membranes are incubated in 4x SDS-loading dye at room temperature for at least 30 min prior to application to SDS-PAGE (do not boil sample). Dilute the sample (membrane preparation) in MilliQ H2O to get 2.5-5 µg of protein in a final volume of 15 µl. Add 5 µl 4x SDS-loading dye. Load 20 µl of the mixture into one slot of the SDS-PAGE. The membranes are incubated for 1 h with each antibody (first antibody at 4 °C, second antibody at room temperature). The first antibody is either the RGSHis- (Figures 3A and 3C) or the S-tag-antibody (Figure 3B). In both cases, the ECL Plex goat-anti-mouse IgG-Cy3-antibody is used as a secondary antibody (dilution 1:2,500). Western blot evaluation is carried out using an Ettan DIGE Imager.
Note: In contrast to soluble proteins, membrane proteins are NOT boiled (95 °C, 5-10 min).
Figure 3. Western blots (A-C) and SDS-PAGE (D)
Recipes
Ampicillin solution (100 mg/ml)
Dissolve 100 mg ampicillin in 1 ml MilliQ H2O (filter to sterilize)
1 M IPTG solution
Dissolve 238.3 mg IPTG in 1 ml MilliQ H2O (filter to sterilize)
LB-medium
Dissolve 20 g LB in 1 L demineralized H2O (autoclave 20 min at 121 °C)
Wash-buffer
50 mM Tris/HCl (pH 8.0 at room temperature)
1 mM EDTA
Lysis-buffer
50 mM Tris/HCl (pH 8.0 at room temperature)
2 mM thioglycerol
50 mM NaCl
1 tablet cOmpleteTM EDTA-free protease inhibitor/50 ml lysis-buffer
Membrane-buffer
40 mM Tris/HCl (pH 8.0 at room temperature)
1.6 mM thioglycerol
20% glycerol (85%)
4x SDS-loading dye
130 mM Tris/HCl (pH 6.8)
10% SDS
10% β-mercaptoethanol
20% glycerol (85%)
0.06% bromophenol blue
Acknowledgments
This work was supported by the Deutsche Forschungsgemeinschaft (SFB 766; TP B08).
References
Beltz, S., Bassler, J. and Schultz, J. E. (2016). Regulation by the quorum sensor from Vibrio indicates a receptor function for the membrane anchors of adenylate cyclases. Elife 5: e13098.
Guo, Y. L., Kurz, U., Schultz, A., Linder, J. U., Dittrich, D., Keller, C., Ehlers, S., Sander, P. and Schultz, J. E. (2005). Interaction of Rv1625c, a mycobacterial class IIIa adenylyl cyclase, with a mammalian congener. Mol Microbiol 57(3): 667-677.
Guo, Y. L., Seebacher, T., Kurz, U., Linder, J. U. and Schultz, J. E. (2001). Adenylyl cyclase Rv1625c of Mycobacterium tuberculosis: a progenitor of mammalian adenylyl cyclases. EMBO J 20(14): 3667-3675.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227(5259): 680-685.
Copyright: Beltz and Schultz. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Beltz, S. and Schultz, J. E. (2017). Protein Expression Protocol for an Adenylate Cyclase Anchored by a Vibrio Quorum Sensing Receptor. Bio-protocol 7(2): e2112. DOI: 10.21769/BioProtoc.2112.
Beltz, S., Bassler, J. and Schultz, J. E. (2016). Regulation by the quorum sensor from Vibrio indicates a receptor function for the membrane anchors of adenylate cyclases. Elife 5: e13098.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial signaling > Quorum sensing
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,113 | https://bio-protocol.org/exchange/protocoldetail?id=2113&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assay to Access Anthelmintic Activity of Small Molecule Drugs Using Caenohabidtis elegans as a Model
Viviane Sant’Anna
Wanderley de Souza
Rossiane C. Vommaro
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2113 Views: 11011
Edited by: Neelanjan Bose
Original Research Article:
The authors used this protocol in Apr 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2016
Abstract
This protocol proposes to use the nematode Caenorhabditis elegans as a model to screen and study the anthelmintic activity of natural and synthetic compounds and to observe their effects on the morphology and the ultrastructure of the helminths. Furthermore, C. elegans can be used to investigate the anthelmintic activity in embryonated eggs, larval stages and in the adults’ survival. As most current anthelmintics are not effective against all nematode life stages, this protocol can contribute to the identification of new alternatives to helminthic infections (Sant’Anna et al., 2016).
Keywords: C. elegans Nematodes Anthelmintic drugs Chemotherapy
Background
Caenorhabditis elegans is a model organism for parasite nematode research and an excellent system for the screening of compounds with potential anthelmintic activity, because it is inexpensive, readily available, and easy to work with. In addition, the use of C. elegans in assays to investigate nematode behavior, locomotion, reproduction and death is uncomplicated and reliable (Simpkin and Coles, 1981). The protocols for screening new compounds on C. elegans were first carried out in axenic liquid medium in deep well microscope slides (Tomlinson et al., 1985) or using the drugs added to melted modified NGM agar (Driscoll et al., 1989). These methods are not effective in drug screening as axenic cultures, containing low food supply, trigger the intra-uterine birth causing maternal death (endotokia matricida) (Lenaerts et al., 2008) and drugs added to melted agar can modify drug stability due to the high temperatures. In this protocol, we used 96-well plates with liquid medium supplied with Escherichia coli to evaluate each stage (eggs, L1-L2 larvae, L3-L4 larvae and adults) independently.
Materials and Reagents
Transfer pipette
15 ml Falcon tubes (Corning, Falcon®, catalog number: 352095 )
96-well plate, flat bottom, polystyrene, 0.32 cm2, sterile. TPP tissue culture plates (Sigma-Aldrich, catalog number: Z707910 )
Tissue culture dishes of polystyrene TPP- diam. 60 x 15 mm, surface area size 22.1 cm2 with NGM (Sigma-Aldrich, catalog number: Z707678 )
C. elegans N2 strain
Escherichia coli OP50 strain
Drugs to screen
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 795429 )
Hypochlorite (NaClO) (Sigma-Aldrich, catalog number: 13440 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5655 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S5136 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S9888 )
Magnesium sulfate heptahydrate (MgSO4·7H2O), BioUltra ≥ 99.5% (KT) (Sigma-Aldrich, catalog number: 63138 )
Potassium phosphate dibasic (K2HPO4), ACS reagent, ≥ 98% (Sigma-Aldrich, catalog number: P3786 )
Cholesterol (Sigma-Aldrich, catalog number: C3045 )
Ethanol (p.a., without additive, ≥ 99.8%) (Sigma-Aldrich, catalog number: 24102 )
Note: This product has been discontinued.
Citric acid monohydrate (ACS reagent, ≥ 99.0%) (Sigma-Aldrich, catalog number: C1909 )
Tri-potassium citrate monohydrate (Sigma-Aldrich, catalog number: 6100-05-6 )
Disodium EDTA (98.5-101.5%, BioUltra) (Sigma-Aldrich, catalog number: E1644 )
Iron (II) sulfate heptahydrate (FeSO4·7H2O) (Sigma-Aldrich, catalog number: 215422 )
Manganese(II) chloride tetrahydrate (MnCl2·4H2O) (Sigma-Aldrich, catalog number: 203734 )
Zinc sulfate heptahydrate (ZnSO4·7H2O) (BioReagent, suitable for cell culture) (Sigma-Aldrich, catalog number: 7446-20-0 )
Copper(II) sulfate pentahydrate (CuSO4·5H2O) (BioReagent, suitable for cell culture, ≥ 98%) (Sigma-Aldrich, catalog number: C8027 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C1016 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Lysing solution (see Recipes)
M9 buffer (1 L) (see Recipes)
S medium (1 L) (see Recipes)
Equipment
Clinical centrifuge (Thermo Fisher Scientific, catalog number: 22-029-416 )
Inverted microscope (ZEISS, model: Axio Vert.A1 )
Biochemical oxygen demand (BOD) incubator (Thermo Fisher Scientific, Fisher ScientificTM, catalog number: 37-20 )
Micropipet, 100-1,000 μl volume (Nichipet Eco pipette, catalog number: Z710199 )
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sant’Anna, V., de Souza, W. and Vommaro, R. C. (2017). Assay to Access Anthelmintic Activity of Small Molecule Drugs Using Caenohabidtis elegans as a Model. Bio-protocol 7(2): e2113. DOI: 10.21769/BioProtoc.2113.
Download Citation in RIS Format
Category
Biochemistry > Other compound > Small molecule drugs
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,114 | https://bio-protocol.org/exchange/protocoldetail?id=2114&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Two-electrode Voltage-clamp Recordings in Xenopus laevis Oocytes：Reconstitution of Abscisic Acid Activation of SLAC1 Anion Channel via PYL9 ABA Receptor
Cun Wang
Jingbo Zhang
Julian I. Schroeder
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2114 Views: 11263
Edited by: Marisa Rosa
Reviewed by: Kathrin Sutter
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
Two-Electrode Voltage-Clamp (TEVC) recording in Xenopus laevis oocytes provides a powerful method to investigate the functions and regulation of ion channel proteins. This approach provides a well-known tool to characterize ion channels or transporters expressed in Xenopus laevis oocytes. The plasma membrane of the oocyte is impaled by two microelectrodes, one for voltage sensing and the other one for current injection. Here we list a protocol that allows robust reconstitution of multi-component signaling pathways. This protocol has been used to study plant ion channels, including the SLAC1 channel (SLOW ANION CHANNEL-ASSOCIATED 1), in particular SLAC1 activation by either the protein kinase OST1 (OPEN STOMATA 1), Ca2+-dependent protein kinases (CPKs) or the GHR1 (GUARD CELL HYDROGEN PEROXIDE-RESISTANT 1) transmembrane receptor-like protein. Data are presented showing reconstitution of abscisic acid activation of the SLAC1 anion channel by the ‘monomeric’ ABA (abscisic acid) receptor RCAR1/PYL9 (PYRABACT INRESISTANCE1 [PYR1]/PYR1-LIKE [PYL]/REGULATORYCOMPONENTS OF ABA RECEPTORS [RCAR]) by co-expressing four components of the abscisic acid signaling core. This protocol is also suitable for studying other ion channel functions and regulation mechanisms, as well as transporter proteins.
Keywords: Ion channel Voltage-clamp Oocytes SLAC1 ABA receptor Slow-type Anion Channel
Background
Ion channels expressed in Xenopus laevis oocytes can be studied using two-electrode voltage-clamping. This protocol provides a method to measure ion channel or transporter currents expressed in oocytes, including plant ion channels. In this protocol, we not only summarize how to prepare cRNA, isolate oocytes, inject cRNA and record currents, but also provide information on how to succeed in completing experiments upon co-expressing a signal transduction cascade from receptor to ion channel.
Materials and Reagents
Borosilicate glass capillaries (World Precision Instruments, catalog number: 1B100F-4 )
Parafilm (Sigma-Aldrich, catalog number: P7793-1EA )
Xenopus laevis oocytes (Ecocyte Bioscience, catalog number: 0-100-2 )
Vector: pNB1 oocyte expression vector harboring the cDNA of interest using the USER method (Nour-Eldin et al., 2006), or other oocytes expression vector like
mMESSAGE mMACHINE® T7 Kit (Thermo Fisher Scientific, AmbionTM, catalog number: AM1344 )
Collagenase D (Roche Diagnostics, catalog number: 11088882001 )
Mineral oil (Sigma-Aldrich, catalog number: M5904 )
MES hydrate (Sigma-Aldrich, catalog number: M2933 )
Tris-base (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP152-5 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C5670 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Sodium chloride (NaCl) (Thermo Fisher Scientific, Fisher Scientific, catalog number: S271-10 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9333 )
Na-gluconate (Sigma-Aldrich, catalog number: S2054 )
D-sorbitol (Sigma-Aldrich, catalog number: S1876 )
Gentamicin solution (Sigma-Aldrich, catalog number: G1272 )
ND96 buffer (see Recipes)
Recording buffer (see Recipes)
Equipment
Two-electrode voltage clamp amplifier (e.g., Warner Instrument, model: Oocyte Clamp OC-725C )
Digidata 1440A low-noise data acquisition system (Molecular Devices, model: Digidata 1440A)
P-87 flaming/brown microelectrode micropipette puller (Sutter Instrument, model: P-87)
Osmometer (e.g., Wescor, model: Vapor Pressure Osmometer 5500 )
Microdispenser (Drummond Scientific, catalog number: 3-000-510 )
Custom glass tubing (Drummond Scientific, catalog number: 3-000-210-G8 )
Software
pCLAMP 10 Electrophysiology Data Acquisition and Analysis Software (Molecular Devices).
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, C., Zhang, J. and Schroeder, J. I. (2017). Two-electrode Voltage-clamp Recordings in Xenopus laevis Oocytes：Reconstitution of Abscisic Acid Activation of SLAC1 Anion Channel via PYL9 ABA Receptor. Bio-protocol 7(2): e2114. DOI: 10.21769/BioProtoc.2114.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Cell Biology > Cell-based analysis > Ion analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,115 | https://bio-protocol.org/exchange/protocoldetail?id=2115&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Triphenyl-2H-tetrazoliumchloride Reduction Activity in Bacterial Cells
RD Roberto Defez
AA Anna Andreozzi
CB Carmen Bianco
Published: Vol 7, Iss 2, Jan 20, 2017
DOI: 10.21769/BioProtoc.2115 Views: 9542
Edited by: Zhaohui Liu
Reviewed by: Chijioke Joshua
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
This protocol describes the use of the 2,3,5-triphenyl-2H-tetrazolium chloride (TTC) salt to evaluate the cell redox potential of rhizobia cells. The production of brightly colored and insoluble 1,3,5-Triphenyltetrazolium formazan arising from TTC reduction is irreversible and can be easily quantified using a spectrophotometer. This protocol allows the production of reproducible results in a relatively short time for Sinorhizobium meliloti 1021 cells grown both in exponential and stationary phases. The results here presented show that the S. meliloti cells deriving from exponential-phase cultures had increased cell redox potential as compared to the ones deriving from stationary-phase cultures. This means that under exponential growth conditions the S. meliloti cells generate higher amount of reducing equivalents needed for TTC reduction.
Keywords: Sinorhizobium meliloti 1021 Cell redox potential 2,3,5-triphenyl-2H-tetrazolium chloride (TTC) 1,3,5-Triphenyltetrazolium formazan Bacterial cells
Background
The TTC salt is a water-soluble and colorless compound that can be reduced to formazan, a highly colored compound. The irreversible formation of formazan can be quantified using a spectrophotometer. Owing to its property and its low reduction potential, this tetrazolium salt is widely used in both eukaryotes and prokaryotes as an indicator of cell redox activity, viability, drug susceptibility and substrate utilization assays (Byth et al., 2001; Hayashi et al., 2003; Raut et al., 2008; Lin et al., 2008). The net positive charge on tetrazolium salts facilitates cellular uptake due to the membrane potential, allowing their intracellular reduction (Berridge et al., 2005). In prokaryotes, the main studies of TTC reduction have concerned the Gram-negative respiring bacterium Escherichia coli, while only a few studies have been reported for members of the Rhizobiacea family. In this protocol, one of the best genetically characterized members of this family, the S. meliloti 1021 rhizobium strain, was used. The respiratory activity, expression of cytochrome terminal oxidases, of this strain was analysed using TTC as an indicator of cell redox potential.
To enable the development of a measurable color intensity and, at the same time, to avoid any possible inhibition of bacterial growth, the bacteria were incubated in the presence of TTC for an appropriate period of time compared to those described by other authors (Tengerdy et al., 1967; Byth et al., 2001; Tachon et al., 2009).
Materials and Reagents
Sterile inoculation loop with incorporated needle (NUOVA APTACA, catalog number: 6001/SG/CS )
14-ml polypropylene round-bottom tubes (Corning, Falcon®, catalog number: 352059 )
50-ml conical centrifuge tubes (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 339652 )
Safe-lock 2-ml tubes (Eppendorf, catalog number: 0030120094 )
Sinorhizobium meliloti 1021
2,3,5-triphenyl-2H-tetrazolium chloride (TTC) (Sigma-Aldrich, catalog number: T8877 )
1,3,5-Triphenyltetrazolium formazan (Sigma-Aldrich, catalog number: 93145 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D5879 )
Tryptone (Sigma-Aldrich, catalog number: T9410 )
Yeast extract (Sigma-Aldrich, catalog number: Y0375 )
Calcium chloride (CaCl2) (Sigma-Aldrich, catalog number: C3306 )
Na2HPO4 (Acantor® Performance Materials, J.T. Baker, catalog number: 4062-01 )
NaH2PO4 (Acantor® Performance Materials, J.T. Baker, catalog number: 3818-05 )
TYR broth medium (5 g/L tryptone, 3 g/L yeast extract, 6 mM CaCl2) (see Recipes)
Sodium phosphate buffer (pH 7.5) (see Recipes)
Equipment
Incubator room (at 30 °C)
Rotary shaker
Spectrophotometer (Beckman Coulter, catalog number: DU800 )
Cuvettes for spectrophotometry application in the visible spectrum (Kartell, catalog number: 1938 )
Micro-centrifuge (SCILOGEX D3024 High Speed Micro-Centrifuge) (Scilogex, catalog number: 912015139999 )
Centrifuge (Thermo Fisher Scientific, Thermo ScientificTM, model: HeraeusTM MegafugeTM 16R )
Oven (at 65 °C)
Balance (Mettler Toledo, catalog number: B204-S )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Defez, R., Andreozzi, A. and Bianco, C. (2017). Quantification of Triphenyl-2H-tetrazoliumchloride Reduction Activity in Bacterial Cells. Bio-protocol 7(2): e2115. DOI: 10.21769/BioProtoc.2115.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbe-host interactions > Bacterium
Biochemistry > Protein > Quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,116 | https://bio-protocol.org/exchange/protocoldetail?id=2116&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Production, Purification and Crystallization of a Prokaryotic SLC26 Homolog for Structural Studies
Yung-Ning Chang
Farooque R. Shaik
Yvonne Neldner
Eric R. Geertsma
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2116 Views: 9076
Edited by: Arsalan Daudi
Reviewed by: Ching Yao Yang
Original Research Article:
The authors used this protocol in Oct 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2015
Abstract
The SLC26 or SulP proteins constitute a large family of anion transporters that are ubiquitously expressed in pro- and eukaryotes. In human, SLC26 proteins perform important roles in ion homeostasis and malfunctioning of selected members is associated with diseases. This protocol details the production and crystallization of a prokaryotic SLC26 homolog, termed SLC26Dg, from Deinococcus geothermalis. Following these instructions we obtained well-folded and homogenous material of the membrane protein SLC26Dg and the nanobody Nb5776 that enabled us to crystallize the complex and determine its structure (Geertsma et al., 2015). The procedure may be adapted to purify and crystallize other membrane protein complexes.
Keywords: Membrane transport protein Nanobody Crystallization chaperone Solute carrier SLC26
Background
With few exceptions, structural characterization of membrane proteins involves challenges at the level of protein production, stabilization in the detergent-solubilized state, and crystallization. The strategy we have followed to overcome these hurdles relied on the efficient selection of SLC26 homologs with superior biochemical properties and the use of antibodies as crystallization chaperones (Geertsma et al., 2015). The procedures described here do not greatly deviate from those of colleagues, but on a few points we do follow alternative approaches. For example, for protein production we make use of the araBAD promoter (Guzman et al., 1995) and not the popular T7 promoter (Studier et al., 1990). In contrast to the T7 promoter, the PBAD promoter allows direct tuning of the protein production levels and its adjustment to the capacity of the downstream folding machinery, thereby reducing the formation of inclusion bodies (Geertsma et al., 2008). Furthermore, we prefer nanobodies, the variable domain of camelid heavy chain only antibodies (Pardon et al., 2014), as crystallization chaperones over the more commonly used Fabs. In our hands, the generation, selection, and production of nanobodies is far more robust and straightforward. Though we are aware that alternative protein production strategies (Henderson et al., 2000; Kunji et al., 2003; Miroux and Walker, 1996; Studier, 2005; Wagner et al., 2008) and crystallization chaperones (Koide, 2009; Seeger et al., 2013) exist, we did not explore these as the presented procedures proved very robust and successful.
Materials and Reagents
Dialysis tube
MWCO 8 kDa (Carl Roth, catalog number: 1924.1 )
MWCO 3.5 kDa (Carl Roth, catalog number: E860.1 )
Concentrators
MWCO 50 kDa (EMD Millipore, catalog number: UFC905024 )
MWCO 3 kDa (EMD Millipore, catalog number: UFC800324 )
Crystallization plates (HAMPTON RESEARCH, catalog number: HR3-158 )
Potter tube and piston (VWR, catalog numbers: 432-0205 and 432-0211 )
50 ml tube
E. coli MC1061 (Coli Genetic Stock Center, catalog number: 6649 )
Plasmid pBXNPHM3-Nb5776 (Figure 1A)
Note: This plasmid holds the gene coding for the nanobody under control of the araBAD promoter and results in the production of the nanobody fused to an N-terminal pelB leader sequence followed by decaHis-tag, MBP, and a HRV 3C protease site. It contains a beta-lactam antibiotic marker. Plasmid available for non-commercial use upon request.
Plasmid pBXC3GH-SLC26Dg (Figure 1B)
Note: This plasmid holds the gene coding for SLC26Dg under control of the araBAD promoter and results in the production of SLC26Dg fused to a C-terminal HRV 3C protease site, GFP, and a decaHis-tag. It contains a beta-lactam antibiotic marker. Plasmid available for non-commercial use upon request.
Figure 1. Plasmid maps. A. Plasmid map of pBXNPHM3-Nb5776; B. Plasmid map of pBXC3GH-SLC26Dg. Unique restriction sites and important features in the plasmids are indicated.
Ampicillin sodium salt (Carl Roth, catalog number: K029.2 )
L-arabinose (20% w/v in ddH2O) (Carl Roth, catalog number: 5118.2 )
1 M KPi, pH 7.5 (see Recipes)
K2HPO4(AppliChem, catalog number: 121512 )
KH2PO4(AppliChem, catalog number: 131509 )
Sodium chloride (NaCl, 2.5 M, ddH2O) (Carl Roth, catalog number: 3957.1 )
Lysozyme (100 mg/ml in ddH2O) (AppliChem, catalog number: A3711 )
DNAse I (2 mg/ml in ddH2O) (AppliChem, catalog number: A3778 )
Magnesium sulphate heptahydrate (MgSO4, 1 M, ddH2O) (Carl Roth, catalog number: P027.2 )
Phenylmethyl sulphonyl fluoride (PMSF, 200 mM in ethanol) (Carl Roth, catalog number: 6367.1 )
NiNTA (50% w/v slurry in 20% EtOH) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 88223 )
ddH2O
Imidazole (2 M, pH 7.5, HCl, ddH2O) (Carl Roth, catalog number: X998.4 )
HEPES (1 M, pH 7.5, NaOH, ddH2O) (Carl Roth, catalog number: HN78.2 )
HRV 3C protease (homemade)
Polypropylene glycol 2000 (10% v/v in ddH2O) (Sigma-Aldrich, catalog number: 81380-1L )
EDTA, disodium salt dihydrate (Carl Roth, catalog number: X986.1 )
Glycerol, 86% (w/v) (Carl Roth, catalog number: 4043.3 )
Liquid nitrogen
Decylmaltoside (10% w/v in ddH2O) (Anatrace, catalog numbers: D322S and D322LA )
Ammonium formate (Carl Roth, catalog number: 5093.1 )
Sodium acetate (Na-acetate) (Carl Roth, catalog number: 6773.2 )
PEG400 (Sigma-Aldrich, catalog number: 91893 )
Tryptone (AppliChem, catalog number: A1553 )
Yeast extract (AppliChem, catalog number: A1552 )
Agar (Applichem, catalog number: A0917 )
LB agar (see Recipes)
TB medium (see Recipes)
Reservoir solution (see Recipes)
Equipment
5 L baffled flask
Incubator at 37 °C
Shaker with adjustable temperature (Infors, model: HT Multitron )
Centrifuge for pelleting cultures (Thermo Fisher Scientific, Thermo Scientific, model: Thermo Sorvall Evolution RC )
Homogenizer (IKA, model: ULTRA-TURRAX® T25 )
High pressure cell disrupter (Avestin, model: Emulsiflex C3 )
Nanodrop (Thermo Fisher Scientific, NanodropTM, model: 1000 , discontinued)
Magnet stirrer (Heidolph Instruments, model: Hei-Mix S )
SEC column Superdex 75 10/300 GL (GE Healthcare, catalog number: 17-5174-01 )
SEC column Superdex 200 10/300 GL (GE Healthcare, catalog number: 28-9909-44 )
Table-centrifuge (VWR, model: Micro Star 17 )
HPLC (GE Healthcare, model: ÄKTAprime plus )
Fermenter (BIOENGiNEERiNG, model: NLF 22, 30 L)
Spectrophotometer (Amersham Biosciences, model: Ultrospec 10 )
Note: This product has been discontinued.
Ultracentrifuge (Beckman Coulter, model: Optima XPN-100K Ultracentrifuge )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chang, Y., Shaik, F. R., Neldner, Y. and Geertsma, E. R. (2017). Production, Purification and Crystallization of a Prokaryotic SLC26 Homolog for Structural Studies. Bio-protocol 7(3): e2116. DOI: 10.21769/BioProtoc.2116.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Expression
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,117 | https://bio-protocol.org/exchange/protocoldetail?id=2117&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Heterochronic Pellet Assay to Test Cell-cell Communication in the Mouse Retina
NT Nobuhiko Tachibana
DZ Dawn Zinyk
RR Randy Ringuette
VW Valerie Wallace
CS Carol Schuurmans
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2117 Views: 9891
Edited by: Oneil G. Bhalala
Original Research Article:
The authors used this protocol in Sep 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2016
Abstract
All seven retinal cell types that make up the mature retina are generated from a common, multipotent pool of retinal progenitor cells (RPCs) (Wallace, 2011). One way that RPCs know when sufficient numbers of particular cell-types have been generated is through negative feedback signals, which are emitted by differentiated cells and must reach threshold levels to block additional differentiation of that cell type. A key assay to assess whether negative feedback signals are emitted by differentiated cells is a heterochronic pellet assay in which early stage RPCs are dissociated and labeled with BrdU, then mixed with a 20-fold excess of dissociated differentiated cells. The combined cells are then re-aggregated and cultured as a pellet on a membrane for 7-10 days in vitro. During this time frame, RPCs will differentiate, and the fate of the BrdU+ RPCs can be assessed using cell type-specific markers. Investigators who developed this pellet assay initially demonstrated that neonatal RPCs give rise to rods on an accelerated schedule compared to embryonic RPCs when the two cell types are mixed together (Watanabe and Raff, 1990; Watanabe et al., 1997). We have used this assay to demonstrate that sonic hedgehog (Shh), which we found acts as a negative regulator of retinal ganglion cell (RGC) differentiation, promotes RPC proliferation (Jensen and Wallace, 1997; Ringuette et al., 2014). More recently we modified the heterochronic pellet assay to assess the role of feedback signals for retinal amacrine cells, identifying transforming growth factor β2 (Tgfβ2) as a negative feedback signal, and Pten as a modulator of the Tgfβ2 response (Ma et al., 2007; Tachibana et al., 2016). This assay can be adapted to other lineages and tissues to assess cell-cell interactions between two different cell-types (heterotypic) in either an isochronic or heterochronic manner.
Keywords: Heterochronic pellet assay Retinal differentiation Retinal progenitor cells Re-aggregation Amacrine cell Negative feedback signaling Heterotypic cell interactions
Background
Several mechanisms are employed to ensure that the correct numbers of differentiated cells are generated during organ and tissue development. For example, progenitor cells may respond to the levels of hormones or growth factors secreted by differentiated cells, progenitors may count the number of divisions they undergo, or there may be a mechanism to count the final number of differentiated cells (Lui and Baron, 2011). In the retina, negative feedback signals that are secreted by differentiated cells are sensed by progenitor cells, which stop producing that differentiated cell type when the signals reach threshold levels (Belliveau and Cepko, 1999; Reh and Tully, 1986; Waid and McLoon, 1998). We and other have demonstrated that Shh is an essential negative regulator of a RGC fate (Wang et al., 2005; Zhang and Yang, 2001). We also dissected the feedback process for retinal amacrine cells, showing that the transcription factor Zac1 acts in amacrine cells to initiate transforming growth factor b2 (Tgfb2) expression, which negatively regulates RPC proliferation and amacrine cell differentiation (Ma et al., 2007). Notably, other TGFβ family members have similar feedback functions in the olfactory epithelium (Wu et al., 2003), pancreas (Harmon et al., 2004), and skeletal muscle (Tobin and Celeste, 2005). We also used the heterochronic pellet assay to examine how amacrine cell feedback signals are themselves regulated. We found that Pten is an essential positive regulator of amacrine cell differentiation, and using the pellet assay, we demonstrated that Pten acts in RPCs to control responsiveness to Tgfβ2 signaling (Tachibana et al., 2016). Understanding how amacrine cells and RPCs interact provides important new insights into how cell number is controlled in the retina. Notably, similar interactions between Pten and Tgfβ signaling may underlie cell number control in other vertebrate organs where Tgfβ signaling is an important determinant of organ size.
Materials and Reagents
Fisherbrand sterile 100 x 15 mm polystyrene Petri dish (Thermo Fisher Scientific, Fisher Scientific, catalog number: FB0875713 )
15 ml conical tubes (SARSTEDT, catalog number: 62.554.502 )
Sterile individually packaged 5 ml pipettes (SARSTEDT, catalog number: 86.1253.001 )
Tissue culture 24-well plates (SARSTEDT, catalog number: 83.3922.300 )
SamcoTM extra long transfer pipet (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 262 )
13 mm, 0.8 μm Nuclepore Track-Etch membrane (GE Healthcare, catalog number: 110409 )
Kimwipes (Kimberly-Clark Worldwide, catalog number: 34120 ) (not autoclaved, but kept clean)
Superfrost Plus Micro slides (VWR, catalog number: 48311-703 )
Standard microscope slide box (Heathrow Scientific, catalog number: HEA15991A )
Micro cover glass (VWR, catalog number: 48404-454 )
4 in x 250 ft Parafilm roll (Bemis, catalog number: PM999 or VWR, catalog number: 52858-032 )
50 ml corning tube (SARSTEDT, catalog number: 62.547.254 )
0.22 μm sterilize filter filtropur (SARSTEDT, catalog number: 83.1826.001 )
60 ml syringe (Medtronic, catalog number: 8881560125 )
Rapid-FlowTM sterile disposable bottle top filters (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 291-4520 )
E15.5 CD1 mouse (Charles River Laboratories International, catalog number: 022 ) (see Note 1)
P2 Ptenfl/fl; Pax6-Cre+ or Pten+/+ mouse (see Note 2)
1x Ca2+/Mg2+-free DPBS (Thermo Fisher Scientific, GibcoTM, catalog number: 14190250 )
Trypan blue (Thermo Fisher Scientific, GibcoTM, catalog number: 15250061 )
Aqua-Poly/Mount (Polysciences, catalog number: 18606 )
Trypsin (Sigma-Aldrich, catalog number: T1005 )
Heat inactivated FBS (fetal bovine serum) (Thermo Fisher Scientific, GibcoTM, catalog number: 12484028 )
DMEM (Thermo Fisher Scientific, GibcoTM, catalog number: 11965092 )
1x HBSS (Thermo Fisher Scientific, GibcoTM, catalog number: 24020117 )
Heat inactivated horse serum (Thermo Fisher Scientific, GibcoTM, catalog number: 26050088 )
200 mM L-glutamine (Sigma-Aldrich, catalog number: G7513 )
HEPES (Thermo Fisher Scientific, GibcoTM, catalog number: 15630080 )
Penicillin-streptomycin (Thermo Fisher Scientific, GibcoTM, catalog number: 15140122 )
Amphotericin B (Thermo Fisher Scientific, GibcoTM, catalog number: 15290026 )
5-Bromouridine (BrdU) (Sigma-Aldrich, catalog number: 850187 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Potassium chloride (KCl) (EMD Millipore, catalog number: PX1405 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P5379 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S7907 )
Crystalline PFA (Sigma-Aldrich, catalog number: P6148 )
Sucrose (Sigma-Aldrich, catalog number: S9378 )
11.8 M hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 258148 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI) as pre-prepared working solution that is used as described by the manufacturer (Thermo Fisher Scientific, Molecular ProbesTM, catalog number: D1306 )
Antibodies against Pax6 and BrdU (see Recipes, Table 1)
Pax6 (BioLegend, catalog number: 901301 )
BrdU (Bio-Rad Laboratories, catalog number: OBT0030 )
Donkey Anti-rabbit Alexa-Fluor 488 (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-21206 )
Goat Anti-rat Alexa Fluor 568 (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11077 )
Optimal cutting temperature compound (VWR, catalog number: 95057-838 )
2.5% trypsin (see Recipes)
0.125% trypsin (see Recipes)
Retinal explant media (REM) (see Recipes)
1 mg/ml BrdU (see Recipes)
10x phosphate-buffered saline (PBS) (see Recipes)
1x phosphate-buffered saline (PBS) (See Recipes)
20% paraformaldehyde (PFA) (see Recipes)
4% paraformaldehyde (PFA) (See Recipes)
20% sucrose (see Recipes)
2 N hydrochloric acid (see Recipes)
1x phosphate-buffered saline/0.1% Triton X-100 (PBT) (see Recipes)
Blocking solution (see Recipes)
Equipment
Dumont forceps #5 (Fine Science Tools, catalog number: 11252-20 )
Dumont forceps #55 (Fine Science Tools, catalog number: 11255-20 )
Dumont forceps AA (Fine Science Tools, catalog number: 11210-20 )
Shallow form shaking water bath (Precision Scientific, catalog number: 66799 )
Pipette pump (SP Scienceware - Bell-Art Products - H-B Instrument, catalog number: F37898-0000 )
37 °C, 5% CO2 water jacketed incubator (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 3110 )
Refrigerated tabletop centrifuge for 15 ml conical tubes (Eppendorf, model: 5810 R )
Hemacytometer chamber (Hausser Scientific, catalog number: 3100 )
P20 pipetmen (Gilson, catalog number: F123600 )
P200 pipetmen (Gilson, catalog number: F123601 )
P1000 pipetmen (Gilson, catalog number: F123602 )
Cryostat (Leica Biosystems, model: CM3050 S )
-20 °C freezer
Upright fluorescence microscope (Leica Microsystems, model: DM RXA2 )
Autoclave
1 L beaker (Corning, Pyrex®, catalog number: 1395-1L )
500 ml beaker (Corning, Pyrex®, catalog number: 1395-500 )
250 ml Erlenmeyer flask (Corning, Pyrex®, catalog number: 4450-250 )
Fume hood
Stereomicroscope for dissection (Leica Microsystems, model: MZ6 )
Inverted light microscope (Leica Microsystems, model: DMIL LED )
Software
GraphPad Prism (GraphPad Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Tachibana, N., Zinyk, D., Ringuette, R., Wallace, V. and Schuurmans, C. (2017). Heterochronic Pellet Assay to Test Cell-cell Communication in the Mouse Retina. Bio-protocol 7(3): e2117. DOI: 10.21769/BioProtoc.2117.
Tachibana, N., Cantrup, R., Dixit, R., Touahri, Y., Kaushik, G., Zinyk, D., Daftarian, N., Biernaskie, J., McFarlane, S. and Schuurmans, C. (2016). Pten regulates retinal amacrine cell number by modulating Akt, Tgfbeta, and Erk signaling. J Neurosci 36(36): 9454-9471.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Intracellular signalling
Neuroscience > Sensory and motor systems > Retina
Cell Biology > Cell signaling > Intracellular Signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,118 | https://bio-protocol.org/exchange/protocoldetail?id=2118&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cued Rat Gambling Task
Michael M. Barrus
Catharine A. Winstanley
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2118 Views: 12465
Edited by: Soyun Kim
Reviewed by: Adler R. Dillman
Original Research Article:
The authors used this protocol in Jan 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2016
Abstract
The ability of salient cues to serve as powerful motivators has long been recognized in models of drug addiction, but little has been done to investigate their effects on complex decision making. The Cued rat Gambling Task (CrGT) is an operant behavioural task which pairs salient, audiovisual cues with the delivery of sucrose pellet rewards on complex schedules of reinforcement that involve both sugar pellet ‘wins’ and timeout penalty ‘losses’. The task was designed with the intention of providing insight into the influence of such cues on decision making in a manner that models human gambling.
Keywords: Decision making Gambling Animal models Addiction Impulsivity Cues
Background
Although numerous rodent behavioural paradigms that capture different facets of gambling-like behaviour have recently been developed, the motivational power of cues in biasing individuals towards risky choice has so far received little attention despite the central role played by drug-paired cues in successful laboratory models of chemical dependency. Here, we describe the cued rat Gambling Task (CrGT) - a cued version of the rGT analogue of the Iowa Gambling Task (Zeeb et al., 2009). In these tasks, animals chose between four options associated with different magnitudes and frequencies of reward and punishing time-out periods. As in the Iowa Gambling Task, favoring options associated with smaller per-trial rewards but smaller losses, and avoiding the tempting ‘high-risk, high-reward’ options, maximized gains on the task. Crucially, in the CrGT, salient, audiovisual cues were paired with the delivery of sucrose pellet rewards. These cues increase in complexity with the size of the ‘win’, similar to human gambling scenarios. Recent data indicate that the addition of these reward-concurrent cues drastically increases choice of the maladaptive, risky options, thereby biasing choice against the animals’ best interests.
Materials and Reagents
Male Long-Evans rats (Charles Rivers Laboratories) weighing 250-275 g upon arrival at the animal facility
Notes:
Initially animals should be gradually food restricted to 85% of free-feeding weight (fed ~14 g of standard rat chow per day).
Water is available ad libitum in home cages.
Animals are housed in pairs/trios and maintained in a climate-controlled colony room on a 12 h reverse light cycle (lights off at 8:00 AM). Temperature is kept between 19-23 °C and humidity ranges from 40%-70%.
Bio-Serv Dustless Precision Pellets, 45 mg, sucrose (Bio-Serv, catalog number: F06233 )
Equipment
Chambers (Med Associates) (Depicted in Figure 1)
Extra tall modular test chamber (Med Associates, catalog number: ENV-007-VP )
Extra tall MDF sound attenuating cubicle (Med Associates, catalog number: ENV-018MD )
5 unit curved nose poke wall (Med Associates, catalog number: ENV-115A )
Stainless steel grid floor (Med Associates, catalog number: ENV-005 )
Hooded house light (Med Associates, catalog number: ENV-215M )
Pedestal mount pellet dispenser for rat (Med Associates, catalog number: ENV-203-45 )
Pellet receptacle (Med Associates, catalog number: ENV-200R2M-6.0 )
Receptacle light (Med Associates, catalog number: ENV-200RL )
Head entry detector for rat (Med Associates, catalog number: ENV-254-CB )
Multiple tone generator (Med Associates, catalog number: ENV-223 )
Cage speaker (Med Associates, catalog number: ENV-224AM )
Large tabletop cabinet and power supply (Med Associates, catalog number: SG-6510D )
Figure 1. Testing chamber. ‘A’ right side of chamber, ‘B’ left side.
IBM-compatible computer running Med PC software
CrGT code and training programs (5CSRT and CrGT forced choice) (freely available from Dr. Catharine Winstanley upon request)
Personal protective equipment (PPE): May include (but is not limited to) scrubs, a laboratory coat, gloves, bouffant cap, ventilation mask, and shoe covers, depending on the requirements of the unit in which the work is taking place
Software
Med PC software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Barrus, M. M. and Winstanley, C. A. (2017). Cued Rat Gambling Task. Bio-protocol 7(3): e2118. DOI: 10.21769/BioProtoc.2118.
Barrus, M. M. and Winstanley, C. A. (2016). Dopamine D3 receptors modulate the ability of win-paired cues to increase risky choice in a rat gambling task. J Neurosci 36(3): 785-794.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,119 | https://bio-protocol.org/exchange/protocoldetail?id=2119&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Synthetic Lethality Screens Using RNAi in Combination with CRISPR-based Knockout in Drosophila Cells
BH Benjamin E. Housden*
HN Hilary E. Nicholson*
Norbert Perrimon
*Contributed equally to this work
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2119 Views: 10654
Edited by: Jihyun Kim
Reviewed by: Steve JeanChunjing Qu
Original Research Article:
The authors used this protocol in Sep 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2015
Abstract
A synthetic lethal interaction is a type of genetic interaction where the disruption of either of two genes individually has little effect but their combined disruption is lethal. Knowledge of synthetic lethal interactions can allow for elucidation of network structure and identification of candidate drug targets for human diseases such as cancer. In Drosophila, combinatorial gene disruption has been achieved previously by combining multiple RNAi reagents. Here we describe a protocol for high-throughput combinatorial gene disruption by combining CRISPR and RNAi. This approach previously resulted in the identification of highly reproducible and conserved synthetic lethal interactions (Housden et al., 2015).
Keywords: Synthetic lethality Screening RNAi Drosophila S2R+ cells Cell culture CRISPR
Background
Knowledge of genetic interactions such as synthetic lethality can be invaluable for determining the functional relationships between genes. For example, large scale genetic interaction screens in yeast were recently used to assemble a global ‘wiring diagram of cellular function’ (Costanzo et al., 2016). Alternatively, specific types of genetic interaction such as synthetic lethal interactions can be used to identify drug targets for diseases including cancer (Kaelin, 2005).
Identification of synthetic interactions requires combinatorial disruption of two genes. A previous method to achieve this in Drosophila cell culture was to deliver multiple dsRNA reagents simultaneously (e.g., Fisher et al., 2015). However, RNAi reagents have limitations including off-target effects and incomplete target knockdown, which are compounded when multiple reagents are delivered together. By combining CRISPR mutagenesis with single dsRNA treatments, these issues are avoided, leading to simpler interpretation of screen results and robust identification of ‘hits’.
Materials and Reagents
10 cm dish (e.g., Corning, catalog number: 430167 )
T75 flasks (Corning, catalog number: 430641U )
0.2 μm filter (Thermo Fisher Scientific, catalog number: 156-4020 )
6-well tissue culture plates (Corning, catalog number: 3516 )
96-well clear bottom tissue culture plates (Corning, catalog number: 3610 )
40 μm cell strainer (Corning, Falcon®, catalog number: 352340 )
Parafilm (Parafilm, catalog number: PM-999 )
24-well plate
15 ml conical tube
Tips
S2R+ cells (Drosophila Genomics Resource Center, catalog number: 150 )
sgRNA expression plasmid (pl18 - available from author on request)
act-GFP plasmid (available from author on request)
Chemically competent E. coli cells (e.g., Thermo Fisher Scientific, InvitrogenTM, catalog number: C404003 )
Effectene Transfection Reagent Kit (QIAGEN, catalog number: 301427 )
PBS (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 ) with 1% FBS (GE Healthcare, HyCloneTM, catalog number: SH30541.03 )
HRMA reagents (Housden and Perrimon, 2016)
Zero-Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific, InvitrogenTM, catalog number: 450245 )
M13F and M13R primers
dsRNA library in 384-well opaque, white tissue culture plates with 5 μl dsRNA at 50 ng/μl per well (see the Drosophila RNAi Screening Center [http://fgr.hms.harvard.edu/fly-cell-rnai-libraries] for available libraries). Note that this protocol focuses on dsRNA libraries available from the DRSC but additional libraries are also available from other sources.
CellTiter-Glo reagent (Promega, catalog number: G7570 )
Schneider’s Drosophila media (Thermo Fisher Scientific, GibcoTM, catalog number: 21720 )
Penicillin/streptomycin (Thermo Fisher Scientific, Invitrogen, catalog number: 15070063 )
Complete media (10% FBS) (see Recipes)
High-serum media (20% FBS) (see Recipes)
Serum-free Schneider’s media (see Recipes)
Equipment
10 ml pipette
Humidity chamber (a tupperware box lined with damp paper towels is fine)
25 °C cell culture incubator (any brand – CO2 regulation is not necessary)
Microscope (e.g., Leica Microsystems, model: DMIL , with 10x objective and any brand of camera)
12-channel 100 μl pipette (e.g., Thermo Labsystems)
12-channel 10-50 μl pipette (e.g., Thermo Labsystems)
Centrifuge with plate-compatible rotor (any brand)
Pasteur pipette
Haemocytometer (any brand)
Multichannel reservoir
Timer
Rotator
Plate reader with luminescence reading capability (e.g., Molecular Devices, model: SpectraMax Paradigm )
Fluorescence-activated cell sorter (e.g., BD FACSAria)
Thermal cycler (any brand)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Housden, B. E., Nicholson, H. E. and Perrimon, N. (2017). Synthetic Lethality Screens Using RNAi in Combination with CRISPR-based Knockout in Drosophila Cells. Bio-protocol 7(3): e2119. DOI: 10.21769/BioProtoc.2119.
Download Citation in RIS Format
Category
Molecular Biology > RNA > Transfection
Cell Biology > Cell-based analysis > Gene expression
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
212 | https://bio-protocol.org/exchange/protocoldetail?id=212&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Protein Kinase Assay Using Yeast Sch9
Yuehua Wei
Published: Vol 2, Iss 11, Jun 5, 2012
DOI: 10.21769/BioProtoc.212 Views: 35451
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol will describe experimental procedures for an in vitro kinase assay of the yeast protein kinase Sch9. This protocol can be tailored to detect kinase activity of other yeast protein kinase.
Materials and Reagents
W303a wild type yeast cells
Tris base (C4H11NO3) (Thermo Fisher Scientific, catalog number: 77-86-1 )
NaCl (Thermo Fisher Scientific, catalog number: 7647-14-5 )
Na2EDTA•2H2O (EDTA) (Sigma-Aldrich, catalog number: ED2SS )
Triton X-100 (Thermo Fisher Scientific, catalog number: 9002-93-1 )
Phenylmethanesulfonyl fluoride (PMSF) (C7H7FO2S) (Sigma-Aldrich, catalog number: P7626 )
Complete protease inhibitor cocktail (F. Hoffmann-La Roche, catalog number: 04693159001 )
PhosSTOP tablet (F. Hoffmann-La Roche, catalog number: 04906837001 )
Glycerol (Thermo Fisher Scientific, catalog number: 56-81-5 )
MgCl2 (USB, catalog number: 18641 500 GM )
Dithiothreitol (DTT) (Thermo Fisher Scientific, Pierce Antibodies, catalog number: 20290 )
Rapamycin (Santa Cruz Biotechnology, catalog number: sc-3504 )
Glass beads (Sigma-Aldrich, catalog number: G-8772 )
HA antibody (12CA5) (Abcam, catalog number: ab16918
ATP (Sigma-Aldrich, catalog number: A2383-1G )
[γ-32P]-ATP (PerkinElmer, catalog number: BLU002250UC )
Coomassie Blue R250 (National Diagnostics, catalog number: HS-605 )
HCl
2.5x SDS loading dye
IP buffer (see Recipes)
Kinase buffer (see Recipes)
PBS buffer (see Recipes)
Equipment
Standard bench-top centrifuge
Shaker
1.5 ml Eppendorf tubes
Authoradiograph
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Molecular Biology > Protein > Expression
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,120 | https://bio-protocol.org/exchange/protocoldetail?id=2120&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Assessment of RNA Polymerase I Activity
Marzia Govoni
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2120 Views: 8016
Edited by: HongLok Lung
Reviewed by: Gaston A. Pizzio
Original Research Article:
The authors used this protocol in Feb 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2016
Abstract
In eukaryotic cells transcriptional processes are carried out by three different RNA polymerases: RNA polymerase I which specifically transcribes ribosomal RNA (rRNA), RNA polymerase II which transcribes protein-coding genes to yield messenger RNAs (mRNAs) and small RNAs, while RNA polymerase III transcribes the genes for transfer RNAs and for the smallest species of ribosomal RNA (5S rRNA). This protocol describes an in vitro assay to evaluate the rRNA transcriptional activity of RNA polymerase I. The method measures the quantity of radiolabelled uridine 5’ triphosphate incorporated in ex novo synthesized rRNA molecules by RNA polymerase I, in optimal conditions for the enzyme activity and in the presence of a toxin, α-amanitin, which inhibits RNA polymerase II and III without affecting RNA polymerase I (Novello and Stirpe, 1970).
Keywords: RNA polymerase I Ribosomal RNA transcription Nuclei isolation Radiolabelled uridine incorporation α-amanitin
Background
In eukaryotic cells the RNA polymerase I transcribes ribosomal genes, which are located in the nucleolus, producing 45S rRNA precursor molecules. These are processed to form the mature 18S, 5.8S and 28S rRNA. They are essential for the assembly of the 60S and the 40S subunits of mature ribosomes. Recent evidence indicates that the ribosome biogenesis rate is related to cell cycle length (Derenzini et al., 2005) and may play a role in tumorigenesis by controlling the expression of the tumour suppressor protein p53. Cells with an up-regulated ribosome biogenesis are rapidly proliferating and are characterized by a down-regulated p53 expression (Donati et al., 2011). Moreover, the ribosome biogenesis rate influences the sensitivity of cancer cells to chemotherapeutic agents which hinder rRNA transcription: higher the rate of ribosome biogenesis, higher the cytotoxic effect induced by the drug (Scala et al., 2016). Therefore, the evaluation of the ribosome biogenesis rate will become a more and more utilized procedure both in tumour pathology and in clinical oncology (Montanaro et al., 2013). Since the rate of ribosome production is tightly conditioned by the rate of 45S precursor molecules transcription, all the methods used for the evaluation of ribosome biogenesis rate measure the synthesized 45S rRNA. The used methods are: quantitative evaluation of 45S rRNA transcripts by real time PCR analysis; quantitative analysis of 45S rRNA, separated by gel electrophoresis of total RNA extracted from cells labelled with 32P-orthophosphate, and visualized by autoradiography; and quantitative evaluation of radiolabelled uridine 5’ triphosphate incorporated in ex novo synthesized rRNA molecules by RNA polymerase I. The first two methods measure the quantity of 45S rRNA present in the cells, that may be influenced by changes of rRNA processing mechanism, whereas the method described here quantifies the transcriptional activity of the RNA polymerase I and it is indicative of the rRNA transcription rate. This method is very complex and time-consuming and requires special accuracy, but it is still the only one method to selectively measure the rRNA transcription rate.
Materials and Reagents
Cell scraper, 40 cm handle, 16 mm blade (Sigma-Aldrich, catalog number: C6106 )
Plastic tubes 50 ml conical base (114 x 28 mm) (SARSTEDT, catalog number: 62.547.254 )
Plastic tubes 15 ml conical base (120 x 17 mm) (SARSTEDT, catalog number: 62.554.002 )
Plastic tubes 1.5 ml safe lock (Eppendorf, catalog number: 022363204 )
Glass microfiber filters, diameter 25 mm, Whatman grade GF/C (GE Healthcare, catalog number: 1822-025 )
Scintillation plastic vials (Sigma-Aldrich, catalog number: V6755 )
Microscope slides (26 x 76 mm) (Sigma-Aldrich, catalog number: Z692247 )
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S3264 )
Potassium phosphate monobasic (KH2PO4) (Sigma-Aldrich, catalog number: P9791 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: H1758 )
Tris base (Sigma-Aldrich, catalog number: T1503 )
Ammonium sulfate [(NH4)2SO4] (Sigma-Aldrich, catalog number: A4418 )
Sucrose (Merck Millipore, catalog number: 107687 )
1 M magnesium chloride (MgCl2) solution (Sigma-Aldrich, catalog number: M1028 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
1 M manganese(II) chloride (MnCl2) solution (Sigma-Aldrich, catalog number: M1787 )
Guanosine 5’-triphosphate sodium salt (GTP) (Sigma-Aldrich, catalog number: 10106399001 )
Adenosine 5’-triphosphate disodium salt hydrate (ATP) (Sigma-Aldrich, catalog number: A7699 )
Cytidine 5’-triphosphate disodium salt (CTP) (Sigma-Aldrich, catalog number: C1506 )
Uridine 5’-triphosphate tri salt (UTP) (Sigma-Aldrich, catalog number: U6875 )
Uridine 5’ triphosphate [5,6-3H] tetrasodium salt (3H-UTP) (PerkinElmer, catalog number: NET380250UC )
α-amanitin (Sigma-Aldrich, catalog number: A2263 )
Liquid scintillation cocktail Hionic Fluor (PerkinElmer, catalog number: 6013319 )
Trichloroacetic acid (TCA) (Sigma-Aldrich, catalog number: T4885 )
Perchloric acid (PCA) 65% w/w (10.35 N) (CARLO ERBA Reagents, catalog number: 306091 )
Potassium hydroxide (KOH) (EMD Millipore, catalog number: 105033 )
2-mercaptoethanol (EMD Millipore, catalog number: 805740 )
Sodium fluoride (NaF) (Sigma-Aldrich, catalog number: S7920 )
PBS (pH 7.3) (see Recipe 1)
1 M Tris-HCl solution (pH 7.4 or pH 8.0) (see Recipe 2)
3 M ammonium sulfate (see Recipe 3)
Homogenization-solution (see Recipe 4)
Washing solution (see Recipe 5)
Suspension solution (see Recipe 6)
High ionic strength 5x reaction mixture (see Recipe 7)
Nucleoside triphosphate mixture (see Recipe 8)
Non-radioactive solution
Radioactive solution
α-amanitin reconstitution (see Recipe 9)
10% (w/w) TCA (see Recipe 10)
0.6 N PCA (see Recipe 11)
0.3 N KOH (see Recipe 12)
6 N PCA (see Recipe 13)
7% (w/w) PCA (see Recipe 14)
0.5 M NaF (see Recipe 15)
Low ionic strength 5x reaction mixture (see Recipe 16)
Equipment
Protective gloves/protective clothing/eye protection/face protection
Centrifuge (Beckman Coulter, model: TJ-25 )
Note: This product has been discontinued.
Teflon® pestle PYREX® Potter-Elvehjem tissue grinder (Thomas Scientific, catalog number: 1234F )
Forceps
High speed tissue grinder (homogenizer) (IKA, model: Eurostar )
Inverted microscope (Zeiss, model: Primovert, catalog number: 491206-0001-000 )
10 ml glass tubes
Shaking water bath (JULABO, model: SW22 )
2,000 ml filter flask
Spectrophotometer UV-VIS (CHROMSERVIS, model: Nanogenius )
Liquid scintillation counter (Guardian, Wallac, PerkinElmer)
Vacuum glass filter holder for 25 mm disc filters elements: glass funnel, clamp, base for 25 mm glass/filter holder and a perforated stopper (available from many companies, for example: Sigma-Aldrich, catalog number: Z290467 ; EMD Millipore, catalog number: XX1002500 )
Vacuum pump
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Govoni, M. (2017). In vitro Assessment of RNA Polymerase I Activity. Bio-protocol 7(3): e2120. DOI: 10.21769/BioProtoc.2120.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,121 | https://bio-protocol.org/exchange/protocoldetail?id=2121&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Miniature External Sapflow Gauges and the Heat Ratio Method for Quantifying Plant Water Loss
Robert Paul Skelton
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2121 Views: 8643
Edited by: Scott A M McAdam
Reviewed by: Eunsook ParkYuko Kurita
Original Research Article:
The authors used this protocol in Oct 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2013
Abstract
External sapflow sensors are a useful tool in plant ecology and physiology for monitoring water movement within small stems or other small plant organs. These gauges make use of heat as a tracer of water movement through the stem and can be applied in both a laboratory and a field setting to generate data of relatively high temporal resolution. Typical outputs of these data include monitoring plant water use on a diurnal time scale or over a season (e.g., in response to increasing water deficit during drought) to gain insight into plant physiological strategies. This protocol describes how to construct the gauges, how best to install them and some expected data outputs.
Keywords: Sapflow Heat ratio method Plant water use Transpiration External miniature sapflow gauges Plant physiology
Background
Sapflow technology is a tool in plant ecology that uses heat as a proxy of water flow within stems or other plant organs. Although a variety of sapflow methods have been developed (see review by McElrone and Bleby, 2011), external miniature sapflow gauges make use of the heat ratio method (HRM) (Burgess et al., 2001) for estimating plant sap velocity.
The HRM relies upon two thermocouples evenly spaced either side of a heating element along the same axis as the flow of sap (Burgess et al., 2001). (Note: Generally, water moves up through a plant from the roots towards the leaves, where it is lost through stomatal pores during evapotranspiration [E].) Marshall (1958) showed that for low rates of flow the ratio of the downstream temperature differential, T1, to the upstream temperature differential, T2, provides an accurate estimation of the heat pulse velocity, vh:
vh = α/x ln (δ T1/δ T2), in cm s-1 (Eq. 1)
Where,
α is the thermal diffusivity (cm2 s-1),
x is the distance above or below the heating element (cm).
When there is no sapflow the ratio of δ T1 to δ T2 is equal to one and thus the logarithm of the ratio of the two temperature differentials is zero. When sapflow occurs, the ratio of δ T1 to δ T2 is less than or greater than 1, with values above 1 measuring flow towards the leaves and values below 1 indicating reverse flow towards the roots.
The thermal diffusivity, α, can be estimated by recording the temperature profile of one of the thermocouples following a heat pulse under conditions of zero flow (Clearwater et al., 2009). It is proportional to the amount of time it takes for the thermocouple to reach a maximum temperature, tm, after a heat pulse:
α = x2/4 tm, in cm2 s-1(Eq. 2)
For miniature external gauges, α is a property of the gauge material and the properties of the stem with which it is in contact. A significant proportion of heat is propagated through the gauge block and α varies little between individuals of a species (Clearwater et al., 2009). α can be estimated from Eq. 2 by installing gauges on excised stems of study species and recording heat pulses with no imposed xylem flow. Thereafter α can be assumed to be constant for a species and applied in Eq. 1 for other individuals of the same species. Vandegehuchte and Steppe (2012) showed recently that thermal diffusivity, α, of woody stems may vary throughout a growing season, which affects calculations of vh. An improved estimate of α and how it varies throughout a growing season is desirable and may improve the fit between vh and transpiration (E).
Figure 1. Miniature external sapflow gauge with 10 m lead cable connected to a small branch of a potted Umbellularia californica plant and a Campbell Scientific CR10X data logger
Materials and Reagents
Note: Most of these materials can be obtained by ordering online from omega.com or by visiting local electrical supply stores.
2 x 4 cm of 0.15 mm (35 AWG) copper and teflon or plastic coated constantan wire
47 ohm pad resistor
Fast-setting silicone
15 m of 4-core 0.51 mm (24 AWG) cable
15 m of 0.8 mm (20 AWG) constantan wire
10 cm of 2 mm heat shrink wire wrap tubing
15 cm of 1.2 cm heat shrink wire wrap tubing
62 Ohm resistor
Circuit board builder
Pluggable terminal blocks (compatible with circuit board)
Parafilm (Bemis Company, Inc., Neenah, WI, USA)
Polystyrene block approximately 3 x 15 x 9 cm (but could be modified depending on the size of the branch)
Durable and reflective foil (e.g., roof insulation foil)
Equipment
Soldering iron
Solder
Single edged razor blade
Multimeter
Data logger (e.g., CR1000 or CR10X Campbell loggers, Campbell Scientific, model: CR1000 or CR10X)
Software
ImageJ (ImageJ 1.47v, National Institutes of Health, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant physiology > Transpiration
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,122 | https://bio-protocol.org/exchange/protocoldetail?id=2122&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Purification of the GRAS Domain of Os-SCL7 from Rice for Structural Studies
Shengping Li
Yanhe Zhao
YW Yunkun Wu
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2122 Views: 7539
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in May 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2016
Abstract
GRAS proteins, named after the first three members GAI, RGA and SRC, has been found in 294 embryophyta species and is represented by 1,035 sequences. They belong to a plant-specific protein family and play essential roles in plant growth and development. Proteins in this family are defined as minimally containing a conserved GRAS domain, which is about 350-450 resides and can be subdivided into five distinct motifs with their name derived from the most prominent amino acids: LRI (leucine-rich region I), VHIID, LRII (leucine-rich region II), PFYRE and SAW and mainly function in the interaction between GRAS proteins and their partners (Sun et al., 2012).By phylogenetic analysis, the GRAS family can be divided into more than ten subfamilies, of which SCL4/7 is one important subgroup and functions in response to environmental stresses. Here we describe a detailed protocol for the expression and purification of the GRAS domain of Os-SCL7, a SCL4/7 member in rice, which enables us to crystallize it and determine its structure.
Keywords: Expression Purification GRAS Os-SCL7 Rice Structural studies
Background
The GRAS proteins are a large family that plays vital roles in plant development and signaling transduction. Findings indicate that some family members such as DELLAs function as a repressor of GA responsive plant growth and are key regulatory targets in the GA signaling pathway (Murase et al., 2008), NSP1 and NSP2 play important roles in regulating nodulation development and signaling (Kaló et al., 2005), the proteins SCR and SHR together play an important role in the control of radial patterning for both the root and shoot (Helariutta et al., 2000), AtLAS is a key regulator in the developmental processes of the axillary meristem (Greb et al., 2003), HAM functions in shoot meristem maintenance (Stuurman et al., 2002).
Based on sequence analyses, GRAS proteins include a variable N-terminal domain and a widely and highly conserved C-terminal domain known as the GRAS domain. The N-terminal domains constitute a plant-specific unfoldome and may act as molecular bait by initiating the key molecular recognition events (Uversky et al., 2010). And the C-terminal GRAS domain is highly conserved in the whole GRAS family, suggesting that these proteins share a similar function and/or a common mode-of-action (Sun et al., 2012).
Though many members of GRAS proteins have been studied, the functional mechanism of GRAS proteins is still unclear. Structural descriptions of GRAS proteins may deeply clarify the functional mechanism of this family. However as yet little structural analyses have been reported, mainly due to the difficulties in obtaining sufficient quality and quantity of GRAS proteins. Soto et al. (2014) reported the expression and purification of the GRAS domain of rice SLR1. They constructed a GST-SLR1 fusion protein and expressed it in E. coli. But the expression levels were low (0.5 mg [TB medium] or 0.2 mg [M9 medium] of purified protein from 1 L flask culture). With some modifications, they obtained 1-3 mg of stable isotope labeled purified protein at 87% purity from 1 L of fermenter culture. However, the expression levels and purity of SLR1 are both not enough for crystallization. Moreover, reducing the protein synthesis rate by low culture temperature and speed, co-expressing with chaperonins, expressing as a fusion protein with soluble tags such as glutathione S-transferase, thioredoxin and maltose-binding protein or mutating some hydrophobic or disulfide forming amino acids are usually used to improve the expression and solubility of target proteins. While using more purification methods and steps will help to improve the purity of target proteins. In order to get a high purity and quantity of GRAS protein, we established a protocol for easy expression and purification of the GRAS domain of Os-SCL7 from rice.
Materials and Reagents
Amicon Ultra centrifugal filters, 30 K (Merck Millipore, catalog number: UFC903096 )
Amicon Ultra centrifugal filters 30,000 MWCO (EMD Millipore, catalog number: UFC803024 )
Economical biotech dialysis membrane, 14 KD (Sangon Biotech, catalog number: TX0111 )
Escherichia coli (E. coli) (BL21) (Thermo Fisher Scientific, InvitrogenTM, catalog number: C6000-03 )
pET32aM (Novagen, modified from pET32a by inserting a TEV protease cut site inside the NcoI cleavage site) (Figure 1)
Rice (NM_001057650, residues 201-578)
Ampicillin (Sangon Biotech, catalog number: A100741 )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sangon Biotech, catalog number: A100487 )
Chelating Sepharose Fast FLow (GE Healthcare, catalog number: 17057502 )
Nickel(II) sulfate hexahydrate (NiSO4·6H2O) (Sangon Biotech, catalog number: A600658 )
Imidazole (Sangon Biotech, catalog number: A500529 )
TEV (tobacco etch virus) protease (produced in-house) (Fang et al., 2007)
Tryptone (Oxoid, catalog number: LP0042 )
Yeast extract (Oxoid, catalog number: LP0021 )
Sodium chloride (NaCl) (Sangon Biotech, catalog number: A501218 )
Agar (Oxoid, catalog number: LP0011 )
Tris-base (Sangon Biotech, catalog number: A100826 )
Hydrochloric acid (HCl) (Sinopharm Chemical Reagent, catalog number: 7647-01-0 )
Glycerol (Sangon Biotech, catalog number: A100854 )
Ethylenediaminetetraacetic acid disodium salt (EDTA) (Sangon Biotech, catalog number: A100105 )
β-mercaptoethanol (AMRESCO, catalog number: 60-24-2 )
Tween-20 (Sangon Biotech, catalog number: A100777 )
Ethanol anhydrous (Sangon Biotech, catalog number: A500737 )
Phosphoric acid ortho (85%) (Sangon Biotech, catalog number: A502803 )
Acetic acid (Sangon Biotech, catalog number: A501931 )
Coomassie Brilliant Blue G-250 (Sangon Biotech, catalog number: A100615 )
Coomassie Brilliant Blue R-250 (Sangon Biotech, catalog number: A100472 )
SDS (Sangon Biotech, catalog number: A100227 )
Isopropanol (Sangon Biotech, catalog number: A507048 )
LB medium (see Recipes)
LB-agar plates (see Recipes)
Lysis buffer (see Recipes)
Chromatography buffer (see Recipes)
Coomassie Brilliant Blue G-250 buffer (see Recipes)
SDS-PAGE staining solution (see Recipes)
SDS-PAGE destaining solution (see Recipes)
Figure 1. The map of pET32aM plasmid
Equipment
2 L flask
Spectrophotometer device (Kebo instrument, model: UV-1100 )
Sonicator (Scientz, model: IID )
Refrigerated centrifuge (Eppendorf, model: 5810 R )
Chromatography system (GE Healthcare, model: INV-907 )
Note: This product has been discontinued.
HiLoad 16/600 Superdex 200(GE Healthcare, catalog number: 28-9893-35 )
Electrophoresis system (Liuyi, model: DYY-6D )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Li, S., Zhao, Y. and Wu, Y. (2017). Expression and Purification of the GRAS Domain of Os-SCL7 from Rice for Structural Studies. Bio-protocol 7(3): e2122. DOI: 10.21769/BioProtoc.2122.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Expression
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,123 | https://bio-protocol.org/exchange/protocoldetail?id=2123&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bioinformatic Analysis for Profiling Drug-induced Chromatin Modification Landscapes in Mouse Brain Using ChlP-seq Data
YL Yong-Hwee Eddie Loh
JF Jian Feng
E Eric Nestler
LS Li Shen
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2123 Views: 10790
Edited by: Oneil G. Bhalala
Reviewed by: Salma HasanSabine Le Saux
Original Research Article:
The authors used this protocol in Dec 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2012
Abstract
Chromatin immunoprecipitation followed by massively parallel sequencing (ChIP-seq) is a powerful technology to profile genome-wide chromatin modification patterns and is increasingly being used to study the molecular mechanisms of brain diseases such as drug addiction. This protocol discusses the typical procedures involved in ChIP-seq data generation, bioinformatic analysis, and interpretation of results, using a chronic cocaine treatment study as a template. We describe an experimental design that induces significant chromatin modifications in mouse brain, and the use of ChIP-seq to derive novel information about the chromatin regulatory mechanisms involved. We describe the bioinformatic methods used to preprocess the sequencing data, generate global enrichment profiles for specific histone modifications, identify enriched genomic loci, find differential modification sites, and perform functional analyses. These ChIP-seq analyses provide many details into the chromatin changes that are induced in brain by chronic exposure to cocaine, and generates an invaluable source of information to understand the molecular mechanisms underlying drug addiction. Our protocol provides a standardized procedure for data analysis and can serve as a starting point for any other ChIP-seq projects.
Keywords: Chromatin immunoprecipitation (ChIP) Next generation sequencing (NGS) ChIP-seq Cocaine Bioinformatics Epigenetics Histone modifications
Background
Chromatin modification has been implicated in the molecular mechanisms of drug addiction and may hold the key to understanding multiple aspects of addictive behaviors (Robison and Nestler, 2011). Chromatin Immuno-Precipitation (ChIP) followed by massively parallel sequencing (ChIP-seq) is the current state of the art technology to profile the chromatin landscape. The typical procedure of ChIP-seq involves: 1) using the antibody against a protein of interest to pull down the binding DNA, which has been fixed to the protein and broken into smaller fragments, 2) the immunoprecipitated DNA is then purified and constructed into a library for high throughput sequencing of short reads (usually 50-100 bp) from the ends of insert DNA fragments, 3) the short reads are aligned to the genome and put through data analysis. Compared with its predecessor – ChIP-chip, ChIP-seq has unparalleled advantages such as unbiased coverage of the entire genome, single base resolution, and significantly improved signal-to-noise ratio (Park, 2009). It has proven to be an invaluable tool to understand numerous types of chromatin modifications.
Brief overview of ChIP-seq experiment: Please see original research articles for greater experimental details (Renthal et al., 2009; Lee et al., 2006). Briefly, adult mice received a standard regimen of repeated cocaine (7 daily IP injections of cocaine [20 mg/kg] or saline) and were used 24 h after the last injection (Robison and Nestler, 2011). The nucleus accumbens, a major brain reward region, was obtained by punch dissection and used for ChIP-seq. Chromatin IP was performed as described previously (Renthal et al., 2009; Lee et al. 2006; http://jura.wi.mit.edu/young_public/hES_PRC/ChIP.html) with minor modifications, using two antibodies, anti-H3K4me3 (tri-methylation of Lys4 in histone H4) (Abcam #ab8580) and anti-H3K9me3 (Abcam #ab8898). Sequencing libraries for each experimental condition were generated in triplicate, and were then sequenced on an Illumina sequencer.
Bioinformatic analysis: The sequencing data generated from libraries under treatment and corresponding control conditions will be used to identify the specific genomic regions that have undergone chromatin changes. We can then associate these regions with biological functions and select the regions of interest for further study. The basic procedure for this kind of bioinformatic analysis can be laid out as a pipeline of eight steps (Figure 1):
1. Perform quality control analyses on the sequencing data files;
2. Align the sequences to the genome;
3. Remove PCR duplicates;
4. Perform cross-correlation quality analysis;
5. Generate coverage files to be loaded into a genome browser;
6. Generate global coverage plots;
7. Perform peak detection and annotation;
8. Perform differential analysis and functional association.
This protocol shall explain each of these steps in more detail, including some of the principles and rationale underlying the bioinformatics analyses, and provide the necessary commands for execution in a Unix-like command-line environment.
Figure 1. Flowchart of the ChIP-seq analysis pipeline
Equipment
Personal computer or high performance computing cluster. All software mentioned here can be run under a Unix-like workstation, such as Linux and Mac. For Windows users, a terminal emulator, such as Cygwin (http://cygwin.com/), can be used.
Software
FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/)
Bowtie2 (Langmead and Salzberg, 2012; http://bowtie-bio.sourceforge.net/bowtie2/index.shtml)
Samtools (Li et al., 2009; http://samtools.sourceforge.net/)
phantompeakqualtools (http://code.google.com/archive/p/phantompeakqualtools/)
IGV and IGVtools (Robinson et al., 2011; http://software.broadinstitute.org/software/igv/)
ngs.plot (Shen et al., 2014; http://github.com/shenlab-sinai/ngsplot)
MACS (Zhang et al., 2008; http://github.com/taoliu/MACS)
diffReps (Shen et al., 2013; http://github.com/shenlab-sinai/diffreps)
bedtools (Quinlan and Hall, 2010; http://bedtools.readthedocs.io/en/latest/)
region-analysis (Shao et al., 2016; http://github.com/shenlab-sinai/region_analysis)
ChIPseqRUs (Loh et al., 2016; https://github.com/shenlab-sinai/chip-seq_preprocess)
David (Dennis et al., 2003; http://david.ncifcrf.gov/)
IPA (http://www.ingenuity.com/)
GREAT (McLean et al., 2010; http://bejerano.stanford.edu/great/public/html/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Loh, Y. E., Feng, J., Nestler, E. and Shen, L. (2017). Bioinformatic Analysis for Profiling Drug-induced Chromatin Modification Landscapes in Mouse Brain Using ChlP-seq Data. Bio-protocol 7(3): e2123. DOI: 10.21769/BioProtoc.2123.
Download Citation in RIS Format
Category
Systems Biology > Epigenomics > Sequencing
Systems Biology > Epigenomics > Histone modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,124 | https://bio-protocol.org/exchange/protocoldetail?id=2124&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
PRODIGY: A Contact-based Predictor of Binding Affinity in Protein-protein Complexes
AV Anna Vangone
AB Alexandre M. J. J. Bonvin
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2124 Views: 12123
Edited by: Arsalan Daudi
Reviewed by: Prashanth SuravajhalaNoelia Foresi
Original Research Article:
The authors used this protocol in Aug 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2015
Abstract
Biomolecular interactions between proteins regulate and control almost every biological process in the cell. Understanding these interactions is therefore a crucial step in the investigation of biological systems and in drug design. Many efforts have been devoted to unravel principles of protein-protein interactions. Recently, we introduced a simple but robust descriptor of binding affinity based only on structural properties of a protein-protein complex. In Vangone and Bonvin (2015), we demonstrated that the number of interfacial contacts at the interface of a protein-protein complex correlates with the experimental binding affinity. Our findings have led one of the best performing predictor so far reported (Pearson’s Correlation r = 0.73; RMSE = 1.89 kcal mol-1). Despite the importance of the topic, there is surprisingly only a limited number of online tools for fast and easy prediction of binding affinity. For this reason, we implemented our predictor into the user-friendly PRODIGY web-server. In this protocol, we explain the use of the PRODIGY web-server to predict the affinity of a protein-protein complex from its three-dimensional structure. The PRODIGY server is freely available at: http://milou.science.uu.nl/services/PRODIGY.
Keywords: Protein contacts Buried surface area Web-server Prediction Protein interface Kd Protein-protein interactions PPIs
Background
Interaction between biomolecules regulate and control almost every biological process in the cell. Studying and understanding these interactions is therefore a crucial step in the investigation of biological systems and in drug design. Many efforts have been devoted to unravel principles of protein-protein interactions. For this purpose, we introduced a simple but robust descriptor of binding affinity based only on structural properties, mainly intermolecular contacts, of a protein-protein complex (Vangone and Bonvin, 2015). This approach led to the best predictor so far reported. Recently, we implemented our method in the PRODIGY web-server (Xue et al., 2016) (http://milou.science.uu.nl/services/PRODIGY), an online tool to predict the binding affinity of a protein-protein complex given its three-dimensional structure. PRODIGY reports the binding affinity either as Gibbs free energy (ΔG, kcal mol-1) or dissociation constant (Kd, M). PRODIGY predicts the binding affinity using the formula reported in Vangone and Bonvin (2015): It counts the number of Interatomic Contacts (ICs) made at the interface of a protein-protein complex within a 5.5 Å distance threshold, and classifies them according to the polar/apolar/charged character of the interacting amino acids. This information is then combined with properties on the Non-Interacting Surface (NIS), which we have previously shown to influence the binding affinity (Kastritis et al., 2011). For training and testing, we used the binding affinity benchmark of protein-protein complexes published in Kastritis and Bonvin (2010). A recent updated version of this benchmark can be found at: http://bmm.crick.ac.uk/~bmmadmin/Affinity (Vreven et al., 2015).
Further information about the benchmark, the prediction model and its accuracy can be found online on the ‘Dataset’ and ‘Method’ pages of the PRODIGY web-server, respectively.
Equipment
A computer with internet access
Software
A web browser (the PRODIGY server has been tested successfully on Chrome, Firefox and Safari)
PRODIGY web server address: http://milou.science.uu.nl/services/PRODIGY
Software repositories for running a local version (not described in this protocol) under a Linux or MacOSX operating system:
PRODIGY repository (https://github.com/haddocking/binding_affinity)
freeSASA (http://freesasa.github.io)
Procedure
The software
Technical description
PRODIGY is made freely available to the scientific community either as standalone software (https://github.com/haddocking/binding_affinity), which can be used locally on a desktop computer, or more conveniently as an online web-server, for which the usage is explained in this protocol. The PRODIGY software consists of a collection of Python scripts, a few Perl scripts to handle the online submission and the open-source tool freeSASA (Mitternacht, 2016) used to calculate the solvent accessible surface area, using default NACCESS (Hubbard and Thornton, 1993) parameters for atomic radii (http://freesasa.github.io).
Data requirement
Input file – mandatory
The main input required to perform binding affinity prediction is a text file containing the atomic coordinates describing the 3D structure of the protein-protein complex (or ensemble of complexes). They can either be experimental structures solved e.g., by X-ray crystallography or NMR spectroscopy, which can be obtained from the worldwide Protein Data Bank (wwPDB) (http://www.wwpdb.org) (Berman et al., 2003), or structures modeled through computational approaches, e.g., by homology modelling or docking approaches. The 3D coordinates should be provided to the server in PDB or mmCIF format.
The input structure/structures can be provided in different ways:
By uploading a PDB or mmCIF file.
By providing a PDB code for automatic retrieval from the wwPDB (http://www.wwpdb.org).
By uploading an archive file (.tar, .tgz, .zip, .bz2 or .tar.gz) containing multiple PDB/mmCIF files. This option allows the submission of a unique file when many structures have to be analyzed (e.g., models derived from docking simulations).
Chains – mandatory
It is necessary to specify chains identifiers for the molecules involved in the interaction. If one (or both) interacting molecule is made of multiple chains at the interface, they all have to be provided separated by comma.
Temperature – optional
The user can specify at which temperature to perform the calculation of the dissociation constant (Kd). If nothing is specified, PRODIGY will use 25 °C by default.
Job name – optional
If provided, the job name will be used to identify your run. Otherwise a random label will be assigned.
Email – optional
If an email is provided, a link to the results will be sent when the job has completed.
How to use PRODIGY web-server
Submitting a prediction
Here we describe the process of submitting a prediction run to the PRODIGY web-server (http://milou.science.uu.nl/services/PRODIGY). As example, we will use the protein-protein complex between an antibody (FAB) and HIV-1 capsid protein p24, that is present in the Protein Data Bank (PDB) with the access code ‘1E6J’.
Open an internet browser and go to http://milou.science.uu.nl/services/PRODIGY.
Fill in the PRODIGY input page (Figure 1):
Insert the PDB code ‘1E6J’ into the ‘Structure’ box for automatic retrieval from the wwPDB.
The complex 1E6J is made of 3 chains: P (corresponding to HIV-1 capsid protein p24) and L and H (corresponding to the FAB). Considering that in this protocol we want to investigate the binding affinity at the interface between the antibody (chains L + H) and the antigen (chain P), you will need to insert:
Interactor 1 ID_chain(s): P
Interactor 2 IC_chain(s): L, H
Figure 1. Example view of an input page of the PRODIGY web-server. (http://milou.science.uu.nl/services/PRODIGY)
Personalize your job by defining some (optional) parameters if needed:
In the box related to the temperature, change the 25 °C default if needed (note that this only affects the calculation of the dissociation constant and not the binding affinity ΔG).
Give a name to your prediction run. No spaces or special characters other then ‘-‘ or ‘_’ are allowed. For this example we will name our run ‘1E6J_prediction’.
Add your email address to be notified when your job is done and receive the link to the results page.
We are now ready to send the prediction to PRODIGY: Click on the Submit button at the bottom of the page.
A prediction usually does not take more than a few minutes. After this time, you will be redirected to the result page. If an email has been provided (see the above step B1c.iii), you will be notified when the prediction is complete and receive a link to the results page. Please note that the results are only stored for 2 weeks.
The result page
The result page is organized in three sections, reporting different information:
Binding affinity and Kd prediction
The name identifiers of your complex, which contains the PDB code of the retrieved file (or the name of the input you upload) is reported, together with the predicted ΔG (in kcal mol-1) and Kd (in M) values at the given temperature. In this example, -9.1 kcal mol-1 has been predicted for ΔG, corresponding to a Kd of 2.1e-07 M at 25 °C.
Prediction details
Number of ICs calculated within a threshold of 5.5 Å and % NIS classified according to the charged/polar/apolar character of the amino acids are reported. In this case, for example, there are 7 ICs between charged and polar residues and the % NIS charged atoms is 20.48.
Further, the full table (format .txt) of ICs is provided and can be viewed by clicking on the link reported under ‘Table of the ICs at the interface’. The format of the table is the following:
#chain1 #aa1 #res_num1 #chain2 #aa2 #res_num2
H → THR →33PTHR210
In which chain ID, residue type and residue number are reported for both residues interacting in Protein 1 and Protein 2.
Download outputs
In this foldable menu, it is possible to download a ready-to-run Pymol script (.pml) (http://www.pymol.org) that will highlight the interaction interface by displaying and coloring the interacting residues, see Figure 2. Further, it is possible to download a compressed file (.tgz) with all the result files.
Figure 2. A three-dimensional representation of the complex 1E6J with the color-coding of the PRODIGY script (.pml). This script can be downloaded from the PRODIGY output page. Interactor 1 is shown in light pink (chains L and H in this example) and Interactor 2 in light blue (chain P), respectively. The interacting residues are represented in sticks in blue and dark pink for Interactor 1 and Interactor 2, respectively.
Useful information
Make sure to check and input the correct chain_IDs for the PDB file that you are uploading/retrieving: chain_IDs have to be present in the file, and correspond to the chains that are interacting. In this example, the FAB has two chains labeled as L and H, and both of them are interacting with the HIV1 capsid protein, which is labeled as chain P.
PRODIGY can deal with files consisting of an ensemble of structures (e.g., as is typical for NMR structures). In the current implementation, only the first model will be considered for prediction. If you wish to analyze every model present in such an ensemble you should split the PDB file into single-model PDB files and submit them all as an archive file. A collection of useful Python scripts for the manipulation of PDB files, such as splitting of ensemble file, residue renumbering, changing chain ID and so on, can be found in our freely available pdb-tools GitHub repository available online at https://github.com/haddocking/pdb-tools.
The PRODIGY web-server currently only supports the 20 canonical amino acids.
Information about the web-server input/output, the prediction method and its performance, and the dataset used for training/testing the method can be found online under the Manual/Method/Dataset PROGIDY pages respectively. These are reachable through the corresponding tabs located at the beginning of each page.
Distribution/Software download
The PRODIGY web-server is made freely available to the scientific community at: http://milou.science.uu.nl/services/PRODIGY. The prediction scripts are also available from our GitHub repository for local setup and usage at: https://github.com/haddocking/binding_affinity.
The collection of software developed by the HADDOCK group can be found at: http://www.bonvinlab.org/software.
The freeSASA software (Mitternacht, 2016) used to calculate the solvent accessible surface area can be downloaded from http://freesasa.github.io.
Notes
To run the ready-to-run Pymol script (.pml) provided by PRODIGY (see step B2c), open a Pymol session with the PDB code that you submitted to PRODIGY and follow one of the possible options:
From the bar menu of Pymol, choose File Run and navigate in the directory where the PRODIGY Pymol script has been saved. Then select the .pml file clicking on ‘Open’.
In the Pymol terminal bar, type @ followed by the .pml file. Please note, if the Pymol session is not open in that folder, the user will need to type the full path. For example: @home/my_path/prodigy_pymol_script.pml
Acknowledgments
This protocol has been adapted from: Vangone and Bonvin (2015) and Xue et al. (2016). Anna Vangone was supported by H2020 Marie-Skłodowska-Curie Individual Fellowship MCSA-IF-2015 [BAP-659025].
References
Berman, H., Henrick, K. and Nakamura, H. (2003). Announcing the worldwide Protein Data Bank. Nat Struct Biol 10(12): 980.
Hubbard, S. J. and Thornton, J. M. (1993). Naccess. Computer Program.
Kastritis, P. L. and Bonvin, A. M. (2010). Are scoring functions in protein-protein docking ready to predict interactomes? Clues from a novel binding affinity benchmark. J Proteome Res 9(5): 2216-2225.
Kastritis, P. L., Moal, I. H., Hwang, H., Weng, Z., Bates, P. A., Bonvin, A. M. and Janin, J. (2011). A structure-based benchmark for protein-protein binding affinity. Protein Sci 20(3): 482-491.
Mitternacht, S. (2016). FreeSASA: An open source C library for solvent accessible surface area calculations. F1000Res 5: 189.
Vangone, A., and Bonvin, A. M. J. J. (2015). Contacts-based prediction of binding affinity in protein-protein complexes. eLife 4: 291.
Vreven, T., Moal, I. H., Vangone, A., Pierce, B. G., Kastritis, P. L., Torchala, M., Chaleil, R., Jimenez-Garcia, B., Bates, P. A., Fernandez-Recio, J., Bonvin, A. M. and Weng, Z. (2015). Updates to the integrated protein-protein interaction benchmarks: Docking benchmark version 5 and affinity benchmark version 2. J Mol Biol 427(19): 3031-3041.
Xue, L. C., Rodrigues, J. P., Kastritis, P. L., Bonvin, A. M. and Vangone, A. (2016). PRODIGY: a web server for predicting the binding affinity of protein-protein complexes. Bioinformatics.
Copyright: Vangone and Bonvin. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Vangone, A. and Bonvin, A. M. J. J. (2017). PRODIGY: A Contact-based Predictor of Binding Affinity in Protein-protein Complexes. Bio-protocol 7(3): e2124. DOI: 10.21769/BioProtoc.2124.
Vangone, A., and Bonvin, A. M. J. J. (2015). Contacts-based prediction of binding affinity in protein-protein complexes. eLife 4: 291.
Download Citation in RIS Format
Category
Biochemistry > Protein > Interaction
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,125 | https://bio-protocol.org/exchange/protocoldetail?id=2125&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of the in vitro Sporulation Frequency of Clostridium difficile
AE Adrianne N. Edwards
SM Shonna M. McBride
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2125 Views: 7944
Edited by: Valentine V Trotter
Reviewed by: Joana Antunes
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
The anaerobic, gastrointestinal pathogen, Clostridium difficile, persists within the environment and spreads from host-to-host via its infectious form, the spore. To effectively study spore formation, the physical differentiation of vegetative cells from spores is required to determine the proportion of spores within a population of C. difficile. This protocol describes a method to accurately enumerate both viable vegetative cells and spores separately and subsequently calculate a sporulation frequency of a mixed C. difficile population from various in vitro growth conditions (Edwards et al., 2016b).
Keywords: Clostridium difficile Clostridium difficile infection (CDI) Anaerobe Spores Sporulation Ethanol resistance
Background
Sporulation is a complex developmental process that results in the formation of a metabolically dormant spore. The physical properties of the C. difficile spore form provide intrinsic resistance to many environmental stresses and disinfectants, permitting its long-term survival outside of the host (reviewed in: Paredes-Sabja et al., 2014). To differentiate between the vegetative cells and spores of C. difficile, various techniques that take advantage of the physical and resistant properties of spores have been developed, including a short exposure to wet-heat or ethanol (Burns et al., 2010; Lawley et al., 2010; Edwards et al., 2014). However, these techniques may inadvertently cause long-term damage to the spores, depending on the strain of C. difficile tested, resulting in inaccurate recovery rates. Here, we describe an optimized method using a lower concentration of ethanol than previously described (40% less ethanol) to eliminate all vegetative cells within a heterogeneous C. difficile population without reducing the viability of spores. This technique provides highly reproducible and less variable results for quantifying C. difficile spore formation.
Materials and Reagents
Sterile inoculating loops (Grenier Bio One, catalog number: 731170 )
GeneMate 1.7 ml microcentrifuge tubes (BioExpress, catalog number: C-3260-1 )
Petri dishes (94 x 16 mm) (Grenier Bio One, catalog number: 633161 )
Glass test tubes with caps (18 x 150 mm) (Thermo Fisher Scientific, Fisher Scientific, catalog number: 14-961-32 )
0.22 µm filter and syringe (for sterilization of taurocholate solutions) (CELLTREAT Scientific Products, catalog number: 229747 )
0.45 µm filter and syringe (for sterilization of D-fructose and L-cysteine solutions) (CELLTREAT Scientific Products, catalog number: 229749 )
Clostridium difficile strains of interest, including the isogenic parent strain (e.g., 630Δerm or R20291) as a reference strain or positive control, test strains, and a negative control strain that is unable to sporulate, preferably in the same isogenic background as the parent (e.g., a spo0A null mutant [Heap et al., 2007; Dawson et al., 2012; Deakin et al., 2012; Fimlaid et al., 2013; Mackin et al., 2013; Edwards et al., 2014; Edwards et al., 2016a])
95% ethanol (190 proof) (Decon Labs, catalog number: 2805SG )
Sterile water
Taurocholate (Sigma-Aldrich, catalog number: T4009 )
Brain heart infusion (BHI) (BD, catalog number: 237300 )
Yeast extract (BD, catalog number: 212730 )
Agar for solid medium (BD, catalog number: 214010 )
Bacto peptone (BD, catalog number: 211677 )
Proteose peptone (BD, catalog number: 211684 )
Tris base (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP152 )
Ammonium sulfate [(NH4)SO4] (Sigma-Aldrich, catalog number: A5132 )
L-cysteine (Sigma-Aldrich, catalog number: C7352 )
Sodium chloride (NaCl) (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP358 )
Potassium chloride (KCl) (Thermo Fisher Scientific, Fisher Scientific, catalog number: P217 )
Sodium phosphate dibasic heptahydrate (Na2HPO4) (Thermo Fisher Scientific, Fisher Scientific, catalog number: S373 )
Potassium phosphate monobasic (KH2PO4) (Thermo Fisher Scientific, Fisher Scientific, catalog number: BP362 )
D-fructose (Thermo Fisher Scientific, Fisher Scientific, catalog number: L96 )
10% (w/v) sodium taurocholate (see Recipes)
Pre-reduced BHIS agar (brain heart infusion supplemented with yeast extract; see Recipes)
Note: All media needs to be reduced before use. This is achieved by bringing plates or liquid medium into the anaerobic chamber at least 2 h for plates or overnight for liquid medium before use (for additional details, see Edwards et al., 2013).
Pre-reduced BHIS agar supplemented with 0.1% taurocholate
BHIS liquid medium (see Recipes)
70:30 sporulation agar (one plate per strain; see Recipes)
1x PBS (see Recipes)
20% D-fructose (see Recipes)
10% L-cysteine (see Recipes)
Equipment
Anaerobic chamber (Coy Type A or Type C Chamber)
Note: All steps are performed within the anaerobic chamber unless otherwise noted. Details on C. difficile cultivation as well as use and maintenance of an anaerobic chamber are described in (Edwards et al., 2013).
Spectrophotometer (Biochrom, model: CO8000 )
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Edwards, A. N. and McBride, S. M. (2017). Determination of the in vitro Sporulation Frequency of Clostridium difficile. Bio-protocol 7(3): e2125. DOI: 10.21769/BioProtoc.2125.
Download Citation in RIS Format
Category
Microbiology > Microbial physiology > Sporulation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,126 | https://bio-protocol.org/exchange/protocoldetail?id=2126&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
This protocol has been corrected. See the correction notice.
Peer-reviewed
Polysome Fractionation to Analyze mRNA Distribution Profiles
Amaresh C. Panda
J Jennifer L. Martindale
MG Myriam Gorospe
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2126 Views: 29351
Edited by: Antoine de Morree
Original Research Article:
The authors used this protocol in Mar 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2016
Abstract
Eukaryotic cells adapt to changes in external or internal signals by precisely modulating the expression of specific gene products. The expression of protein-coding genes is controlled at the transcriptional and post-transcriptional levels. Among the latter steps, the regulation of translation is particularly important in cellular processes that require rapid changes in protein expression patterns. The translational efficiency of mRNAs is altered by RNA-binding proteins (RBPs) and noncoding (nc)RNAs such as microRNAs (Panda et al., 2014a and 2014b; Abdelmohsen et al., 2014). The impact of factors that regulate selective mRNA translation is a critical question in RNA biology. Polyribosome (polysome) fractionation analysis is a powerful method to assess the association of ribosomes with a given mRNA. It provides valuable information about the translational status of that mRNA, depending on the number of ribosomes with which they are associated, and identifies mRNAs that are not translated (Panda et al., 2016). mRNAs associated with many ribosomes form large polysomes that are predicted to be actively translated, while mRNAs associated with few or no ribosomes are expected to be translated poorly if at all. In sum, polysome fractionation analysis allows the direct determination of translation efficiencies at the level of the whole transcriptome as well as individual mRNAs.
Keywords: mRNA translation Protein synthesis Ribosome Polysomes Sucrose gradient Fractionation RT-qPCR
Background
Gene expression is regulated at many steps, including gene transcription, pre-mRNA splicing, and mRNA export to the cytoplasm, turnover and translation. Given the robust impact of post-transcriptional gene regulatory mechanisms on overall protein expression patterns in the cell, there is great interest in elucidating the processes that control these events. In particular, the steady-state mRNA levels of one-half of the transcriptome show poor correlation with the level of proteins translated from these mRNAs, indicating that protein levels in the cell are potently regulated at the level of mRNA translation and/or protein stability (Schwanhausser et al., 2011). A number of assays can be used to study how translation is regulated in response to different conditions – both at the transcriptome level and at the level of single mRNAs. Traditionally, Western blot analysis, puromycin labeling, and 35S-methionine/cysteine labeling assays have been used to measure the efficiency mRNA translation.
The method discussed here focuses on analyzing the sizes of polysomes that form on a given mRNA. The premise of this analysis is that mRNAs found in larger polysomes are expected to be translated robustly, while mRNAs present in smaller polysomes or devoid of ribosome components are expected to be translated poorly or remain untranslated. This protocol allows the capture of actively translating mRNAs by ‘freezing’ translating ribosomes and thus permitting the measurement of the relative size of polysomes forming on given mRNAs. This method has been successfully used in dozens of studies to analyze how RBPs and microRNAs affect the translation of target mRNAs and can be used to explore the role of polysome-associated proteins and noncoding RNAs on global translation and the translation of specific mRNAs.
Materials and Reagents
Tube, thin-wall, polypropylene, 13.2-ml (Beckman Coulter, catalog number: 331372 )
9” Pasteur pipet (Kimble Chase Life Science and Research Products, catalog number: 883350-0009 )
15 ml tube
Posi-Click 1.7-ml microcentrifuge tube (Denville Scientific, catalog number: C2171 )
ThermoGridTM rigid strip 0.2-ml PCR tubes [(Denville Scientific, catalog number: C18064 (1000859) ]
MicroAmp® optical 384-well reaction plate (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4309849 )
MicroAmp® optical adhesive film (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4311971 )
Piercing needle
100-mm dish
Bromophenol blue (BPB) (Sigma-Aldrich, catalog number: B0126 )
Cycloheximide (CHX) (Sigma-Aldrich, catalog number: C7698 )
Dimethyl sulfoxide (DMSO)
Dulbecco’s phosphate-buffered saline (DPBS) (Thermo Fisher Scientific, GibcoTM, catalog number: 20012027 )
RiboLock RNase inhibitor (40 U/µl) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EO0381 )
TRIzol® reagent (Thermo Fisher Scientific, AmbionTM, catalog number: 15596018 )
Chloroform
Isopropanol
GlycoBlueTM coprecipitant (15 mg/ml) (Thermo Fisher Scientific, InvitrogenTM, catalog number: AM9515 )
Ethanol (Sigma-Aldrich, catalog number: E7023 )
Nuclease-free water (Thermo Fisher Scientific, AmbionTM, catalog number: AM9930 )
Random primers (150 ng/µl) (Sigma-Aldrich, catalog number: 11034731001 )
dNTP mix (10 mM each) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: R0193 )
Maxima reverse transcriptase (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: EP0741 )
KAPA SYBR® FAST ABI prism 2x qPCR master mix (Kapa Biosystems, catalog number: KK4605 ), or SYBR Green from other vendors
EDTA
Sucrose (Sigma-Aldrich, catalog number: S1888 )
NaCl
Tris-HCl
MgCl2
KCl
Nonidet P-40
DTT
5x RT buffer (250 mM Tris-HCl [pH 8.3 at 25 °C], 375 mM KCl, 15 mM MgCl2, 50 mM DTT, provided with Maxima Reverse Transcriptase)
cOmplete EDTA-free protease inhibitor cocktail (Sigma-Aldrich, catalog number: 11873580001 )
2.2 M sucrose (MW 342.3) (see Recipes)
10x salts solution (see Recipes)
Chase solution (60% sucrose) (see Recipes)
Cycloheximide (CHX) (1,000x) (see Recipes)
25x protease inhibitors (see Recipes)
Polysome extraction buffer (PEB) (see Recipes)
Equipment
SW 41 Ti rotor package (Beckman Coulter, catalog number: 331336 )
Manual pipettor (SP Scienceware - Bel-Art Products - H-B Instruments, catalog number: F37911-1010 )
Cell scraper
Vortexer
Refrigerated centrifuge (Eppendorf, model: 5430 R )
NanoDrop spectrophotometer (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: ND-ONE-W )
OptimaTM XE 90K - preparative ultracentrifuge (Beckman Coulter, catalog number: A94471 )
Spectrophotometer
PCR strip tube rotor, mini centrifuge C1201 [Denville Scientific, catalog number: C1201-S (1000806) ]
Veriti® 96-Well thermal cycler (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: 4375786 )
Eppendorf ThermoMixer® F1.5 (Eppendorf, catalog number: 5384000012 )
MPS 1000 mini plate spinner (Next Day Science, catalog number: C1000 )
Density gradient fractionation system (Brandel, catalog number: BR-188 )
QuantStudio 5 Real-Time PCR System, 384-well (Thermo Fisher Scientific, Applied BiosystemsTM, catalog number: A28140 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Panda, A. C., Martindale, J. L. and Gorospe, M. (2017). Polysome Fractionation to Analyze mRNA Distribution Profiles. Bio-protocol 7(3): e2126. DOI: 10.21769/BioProtoc.2126.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Molecular Biology > RNA > RNA-protein interaction
Cell Biology > Organelle isolation > Polyribosome
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,127 | https://bio-protocol.org/exchange/protocoldetail?id=2127&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Force Measurement on Mycoplasma mobile Gliding Using Optical Tweezers
MM Masaki Mizutani
Makoto Miyata
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2127 Views: 7475
Reviewed by: Sofiane El-Kirat-Chatel
Original Research Article:
The authors used this protocol in May/Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May/Jun 2016
Abstract
Dozens of Mycoplasma species, belonging to class Mollicutes form a protrusion at a pole as an organelle. They bind to solid surfaces through the organelle and glide in the direction by a unique mechanism including repeated cycles of bind, pull, and release with sialylated oligosaccharides on host animal cells. The mechanical characters are critical information to understand this unique mechanism involved in their infectious process. In this protocol, we describe a method to measure the force generated by Mycoplasma mobile, the fastest gliding species in Mycoplasma. This protocol should be useful for the studies of many kinds of gliding microorganisms.
Keywords: Mycoplasma Optical tweezers Force Avidin-biotin Bead
Background
Surface motility systems are spread over many bacterial species and they are not well elucidated compared to bacterial flagella and eukaryotic motor proteins (Jarrell and McBride, 2008), although potentially they can give us critical information to understand the survival strategy of bacteria. To elucidate a motility mechanism, we need information about the structure of machinery, the flow of energy, and the mechanical characters including speed and force. Optical tweezers are a special method used for micromanipulations or force measurements in the piconewton range under microscopy, by which an object with a diffractive index different from the medium is trapped at the center of focused laser beam (Ashkin et al., 1986). This method has greatly contributed to clarifying the features of motility systems including myosin, dynein, and kinesin, and now an established method in the field of biophysics. Here, we provide a protocol on how to measure force generated by surface moving microorganisms, based on our studies (Miyata et al., 2002; Tanaka et al., 2016) for gliding mechanism of M. mobile the fastest gliding species in class Mollicutes. This is the first protocol for force measurement made using optical tweezers in bio-protocol.
Materials and Reagents
18 x 18 mm Square microscope cover slip (Matsunami Glass, catalog number: C218181 )
22 x 40 mm Square microscope cover slip (Matsunami Glass, catalog number: C022401 )
Double-sided tape (NICHIBAN, NICETACKTM, catalog number: NW-5 )
Mending tape (3M, Scotch®, catalog number: 810-3-15 )
Filter paper ϕ70 (ADVANTEC, catalog number: 00021070 )
1.5 ml microtube
M. mobile 163K strain (ATCC, catalog number: 43663 )
Polystyrene beads 1.0 µm in diameter (Polybead® Carboxylate Microspheres 1.00 µm) (Polysciences, catalog number: 08226-15 )
PolyLink Protein Coupling Kit for COOH Microspheres (Polysciences, catalog number: 24350-1 )
PolyLink coupling buffer
PolyLink EDAC
Avidin from egg white (Sigma-Aldrich, catalog number: A9275 )
PBS with 20 mM glucose (PBS/G)
PBS with 40 mM glucose
Sulfo-NHS-LC-LC-biotin (Ez-LinkTM Sulfo-NHS-LC-LC-biotin) (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 21338 )
Glucose
Nail polish
Heart infusion broth (BD, catalog number: 238400 )
Yeast extract (BD, catalog number: 212750 )
10 N NaOH
Horse serum (Thermo Fisher Scientific, GibcoTM, catalog number: 16050122 )
Amphotericin B (Sigma-Aldrich, catalog number: A2942 )
Ampicillin Na (Nacalai Tesque, catalog number: 02739-32 )
Sodium phosphate (pH 7.3)
NaCl
Aluotto medium (see Recipes)
Phosphate-buffered saline (PBS) (see Recipes)
Equipment
Centrifuge (Sigma Laborzentrifugen, model: Sigma 1-14 )
25 cm2 tissue culture flask (AS ONE, catalog number: 2-8589-01 )
25 °C incubator (Tokyo Rikakikai, model: LTI-400E )
Sonicator (Emerson Industrial Automation, BRANSON, model: 2510J-MT )
Optical microscope (Olympus, model: IX71 )
Optical tweezers system (Note 1)
High speed charge-coupled device (DigiMo, model: LRH2500XE-1 )
Power meter (Laser Power/Energy Meter) (Coherent, model: FieldMaxII-TOP, catalog number: 1098580 )
Autoclave
Software
ImageJ (http://rsbweb.nih.gov/ij/index.html)
IGOR Pro 6.33J (WaveMetrics, Portland, OR)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mizutani, M. and Miyata, M. (2017). Force Measurement on Mycoplasma mobile Gliding Using Optical Tweezers. Bio-protocol 7(3): e2127. DOI: 10.21769/BioProtoc.2127.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell-based analysis
Microbiology > Microbial physiology > Membrane property
Cell Biology > Cell movement > Cell motility
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,128 | https://bio-protocol.org/exchange/protocoldetail?id=2128&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Streamlined Method for the Preparation of Growth Factor-enriched Thermosensitive Hydrogels from Soft Tissue
CP Christopher J. Poon
ST Shaun S. Tan
SB Sholeh W. Boodhun
Keren M. Abberton
WM Wayne A. Morrison
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2128 Views: 7658
Edited by: Antoine de Morree
Reviewed by: Federica Pisano
Original Research Article:
The authors used this protocol in Mar 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2013
Abstract
Hydrogels are an ideal medium for the expansion of cells in three dimensions. The ability to induce cell expansion and differentiation in a controlled manner is a key goal in tissue engineering. Here we describe a detailed method for producing hydrogels from soft tissues with an emphasis on adipose tissue. In this method, soluble, extractable proteins are recovered from the tissue and stored while the remaining insoluble tissue is processed and solubilised. Once the tissue has been sufficiently solubilised, the extracted proteins are added. The resulting product is a thermosensitive hydrogel with proteins representative of the native tissue. This method addresses common issues encountered when working with some biomaterials, such as high lipid content, DNA contamination, and finding an appropriate sterilisation method. Although the focus of this article is on adipose tissue, using this method we have produced hydrogels from other soft tissues including muscle, liver, and cardiac tissue.
Keywords: Hydrogel Adipose Soft tissue Extracellular matrix Tissue engineering Biomaterial Method Protocol
Background
The main goal of tissue engineering is to generate new tissue by providing the body with a scaffold possessing similar properties to those of the target site. This allows for optimal remodeling and enables formation of de novo endogenous tissue. In the field of adipose tissue engineering, biomaterials derived from adipose tissue are of particular interest because adipose tissue is widely available and in theory provides the best possible environment for induction of adipogenesis (Flynn et al., 2007; Flynn, 2010; Uriel et al., 2008; Choi et al., 2009; Young et al., 2011). It has been established that adipocytes secrete adipogenic factors (Li et al., 1998; Shillabeer et al., 1989; Shillabeer et al., 1990) and that conditioned medium produced from either adipocytes or excised adipose tissue is able to induce adipogenesis in vitro (Sarkanen et al., 2012).
The development of an injectable hydrogel with properties closely matching those of healthy adipose tissue would potentially be of great use in regenerative medicine. The ideal hydrogel would be acellular, contain proteins that are representative of those found in natural adipose tissue, be structurally capable of maintaining a space after implantation, and be capable of inducing adipose tissue growth (Cheung et al., 2014; Drury and Mooney, 2003). We have previously reported on the production of a thermoresponsive hydrogel from excised adipose tissue which was shown to be adipogenic both in vitro and in vivo (Poon et al., 2013). The gel induced adipogenic differentiation of adipose-derived stem cells in vitro and was capable of producing adipose tissue from 8 weeks post-implantation in the subcutaneous layer of the rat back (Debels et al., 2015).
As originally reported, our adipose-derived hydrogel used dispase to decellularise the tissue prior to extraction. Although dispase is capable of efficiently decellularising tissue (Uriel et al., 2008; Prasertsung et al., 2008), we have since observed the degree of digestion varies greatly from batch to batch due to differences in tissue surface area. Additionally, the slight differences in decellularisation led to variations in lipid content between batches which altered protein extraction efficiency and clarity of the final product. The washing and delipidation steps were also of concern as they increased variation of the gel’s final physical properties. Since our original publication, we have developed a practical and efficient method to replace these early processes.
Here we provide a detailed protocol for producing a soft tissue-derived hydrogel which addresses many of these concerns and reduces batch-to-batch variability. In our new method, proteins are extracted from the tissue first in order to retain as much soluble protein as possible for subsequent re-addition. Decellularisation by dispase digestion has been replaced with cold homogenisation and nuclease treatment. Dispase is capable of efficiently decellularising tissue; it works by cleaving fibronectin and collagen IV, but there is a problem, these proteins may provide important functional groups which would otherwise be lost after dispase digestion (Gregoire et al., 1998; Khoshnoodi et al., 2008). Delipidation is no longer performed over the course of multiple salt washes and centrifugation steps, now it is done as part of the homogenisation and solubilisation steps. This method has been used to successfully produce thermoresponsive hydrogels from multiple tissues including skeletal muscle and organs such as the liver and heart. These hydrogels containing a collection of soluble proteins present in the native tissues may provide others in the field the basis for further developments in biomaterials research.
Materials and Reagents
Whatman glass fibre filter paper (Sigma-Aldrich, catalog number: WHA1820021 )
Spectrum Laboratories 12-14 kDa dialysis membrane (Pacific Laboratory Products, catalog number: 132706 )
Freshly harvested subcutaneous porcine adipose tissue, liver, skin, cardiac tissue, and visceral fat (Donated by Diamond Valley Pork [Laverton North, VIC, Australia])
Note: All tissue not used immediately was stored at -20 °C.
Human tissues (Collected from fully consented patients with ethics approval from the St Vincent’s Hospital Melbourne Human Research Ethics Committee [Protocol 52/03])
Note: All tissue not used immediately was stored at -20 °C.
Protease inhibitors (Sigma-Aldrich)
Ammonium sulphate (Sigma-Aldrich, catalog number: 31119 )
70% ethanol (Sigma-Aldrich)
Spectrum Laboratories Spectra/Gel Absorbent (Pacific Laboratory Products, catalog number: 292600 )
PBS (Thermo Fisher Scientific, GibcoTM, catalog number: 10010023 )
DNeasy Blood & Tissue Kit (QIAGEN, catalog number: 69504 )
PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: 23225 )
Dulbecco’s modified Eagle medium (Sigma-Aldrich, catalog number: D5796 )
Fetal calf serum (CSL, Australia)
Antibiotics
Oil Red O (Sigma-Aldrich, catalog number: O0625 )
Haematoxylin
Collagenase I
4% paraformaldehyde or 10% neutral-buffered formalin
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: 798681 )
N-ethylmaleimide (NEM) (Sigma-Aldrich, catalog number: E3876 )
Benzamidine hydrochloride hydrate (Sigma-Aldrich, catalog number: B6506 )
Urea (Sigma-Aldrich, catalog number: U1250 )
Guanidine hydrochloride (GuHCl) (Sigma-Aldrich, catalog number: 50950 )
Glacial acetic acid (Sigma-Aldrich)
Tris base (Sigma-Aldrich, catalog number: RDD008 )
NaCl
DNase I (Roche Diagnostics, catalog number: 11284932001 )
RNase A (Roche Diagnostics, RNASEA-RO )
MgCl2
Zinc sulfate heptahydrate (ZnSO4·7H2O) (Sigma-Aldrich, catalog number: Z0251 )
Chloroform (Sigma-Aldrich)
Methanol (Sigma-Aldrich)
Pepsin (Worthington Biochemical, catalog number: LS003317 )
Solutions (Prepared according to the directions outlined in Recipes)
0.5 M ethylenediaminetetraacetic acid (EDTA)
50 mg/ml N-ethylmaleimide (NEM)
50 mg/ml benzamidine hydrochloride hydrate
8 M urea
8 M guanidine hydrochloride (GuHCl)
0.5 N acetic acid
4 M GuHCl extraction buffer
10x Tris-buffered saline (TBS)
Nuclease solution
1,000x haemoglobin precipitation solution
Chloroform-methanol lipid extraction solution
10x protease inhibitors
0.75% pepsin
Equipment
Knife or scalpel
Balance
4 L beaker
Rotary mixer
Shaking incubator
Centrifuge (capable of speeds of 15,000 x g)
Food processor, immersion blender, or high capacity tissue homogeniser
Cheesecloth or fine mesh gauze
Humidified 37 °C incubator with 5% CO2 (for in vitro testing)
Fume hood
Software
ImageJ (https://imagej.nih.gov/ij/)
GraphPad Prism 6 (GraphPad Software, Inc.)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Poon, C. J., Tan, S. S., Boodhun, S. W., Abberton, K. M. and Morrison, W. A. (2017). A Streamlined Method for the Preparation of Growth Factor-enriched Thermosensitive Hydrogels from Soft Tissue. Bio-protocol 7(3): e2128. DOI: 10.21769/BioProtoc.2128.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Maintenance and differentiation
Cell Biology > Cell isolation and culture > 3D cell culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,129 | https://bio-protocol.org/exchange/protocoldetail?id=2129&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of the Virulence of Uropathogenic Escherichia coli Strain CFT073 in the Murine Urinary Tract
AW Anna Waldhuber
MP Manoj Puthia
AW Andreas Wieser
CS Catharina Svanborg
Thomas Miethke
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2129 Views: 10426
Edited by: Andrea Puhar
Reviewed by: Migla Miskinyte
Original Research Article:
The authors used this protocol in Jul 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2016
Abstract
This urinary tract infection model was used to monitor the efficacy of a new virulence factor of the uropathogenic Escherichia coli strain CFT073 in vivo. The new virulence factor which we designated TIR-containing protein C (TcpC) blocks Toll-like receptor signaling and the NLRP3 inflammasome signaling cascade by interacting with key components of both pattern recognition receptor systems (Cirl et al., 2008; Waldhuber et al., 2016). We infected wild type and knock-out mice with wildtype CFT073 and a mutant CFT073 strain lacking tcpC. This protocol describes how the mice were infected, how CFT073 was prepared and how the infection was monitored. The protocol was derived from our previously published work and allowed us to demonstrate that TcpC is a powerful virulence factor by increasing the bacterial burden of CFT073 in the urine and kidneys. Moreover, TcpC was responsible for the development of kidney abscesses since infection of mice with wildtype but not tcpC-deficient CFT073 mutants caused this complication.
Keywords: Uropathogenic Escherichia coli Toll-like receptor Inflammasome TIR-containing protein C Urinary tract infection
Background
Urinary tract infections (UTIs) are some of the most common bacterial infections worldwide (Dielubanza and Schaeffer, 2011) and are predominantly caused by uropathogenic Escherichia coli (UPEC) (Zhang and Foxman, 2003). There is a high rate of recurrent infections (Dielubanza and Schaeffer, 2011) and also an increase in the emergence of antibiotic resistant E. coli strains (Eurosurveillance editorial, 2015). Therefore the understanding of host and bacterial factors in the pathophysiology of urinary tract infections is of high relevance in order to develop new therapeutic agents.
The murine UTI model system is the primarily used animal model system to study the pathogenicity of UPEC isolates and bacterium-host interactions and to identify underlying molecular mechanism. Besides the murine UTI model system, other animal model systems like porcine, avian, zebra fish and nematodes exist, which have been demonstrated to be useful for investigating UTIs. However, these models are associated with one or several limitations and disadvantages such as no possibility for genetic modification, the lack of a vertebrate-like immune system and/or urinary tract system or high costs. In addition to animal model systems cell culture based systems with primary immune cells or immortalized urinary tract tissue-derived cells are available. In vitro culture methods can be used to analyze UPEC interactions with host cells but they, of course, cannot reflect the complexity of the host environment involving a number of different cell types, tissue architecture and host defense mechanisms. Mice have much in common with humans including conserved immunological factors and a similar urinary tract system. Further, the availability of a variety of genetically distinct mouse strains to assess the impact of the genetic background makes the murine mouse model very accessible to study host-pathogen interactions in order to develop therapeutic agents.
Materials and Reagents
Microcentrifuge tubes (1.5 ml for urine collection and 2.0 ml for tissue homogenization)
1 ml syringes (BD, catalog number: 309628 )
27 G needles (BD, catalog number: 305136 )
ELISA plates (Nunc MaxiSorp® flat-bottom 96 well plate) (Sigma-Aldrich, catalog number: M9410 )
Unfrosted or frosted glass slides (Thermo Fisher Scientific, Fisher Scientific, catalog number: 10149870 )
poly-L-lysine-coated glass slides (Thermo Fisher Scientific, Thermo ScientificTM, catalog number: P4981 )
Coverslips 60 x 24 mm
Mice
Only female mice were used for the UTI infection model because the urethra in male mice is extremely difficult to catheterize due to its anatomy. The following strain of mice at an age of 8 to 16 weeks was used:
C57BL/6
The following knock-out mice were successfully used in the model to study the relevance of a number of host-defense genes but these mice are optional and not required to generate the model:
Tlr4−/−
Myd88−/−
Trif−/−
TrifLps2/Lps2
Il-1β−/−
Irf3−/−
Note: All knock-out mice were at least 8x backcrossed to C57BL/6 mice. All mice were bred and housed in specific pathogen free conditions. Mice were only used upon permission of the local animal experimental ethics committee.
Bacteria
UPEC strain CFT073, provided by ATCC (ATCC, catalog number: 700928 )
tcpC-deficient CFT073 tcpC::kan, generated in the lab using the method described by Datsenko/Wanner (Datsenko and Wanner, 2000).
Complemented mutant strain CFT073 tcpC::kan+pTcpC, the plasmid was generated as described (Cirl et al., 2008).
Note: Bacterial strains used to inoculate the animals were maintained on LB agar plates containing appropriate antibiotics. The strains were grown overnight on tryptic soy agar. Bacteria were harvested in phosphate-buffered saline and bacterial cell density (OD597 = 1 corresponded to 1 x 109 bacteria/ml) was subsequently adjusted on the basis of a standard curve of absorbance at 597 nm to a concentration of 1010 bacteria per ml by dilution in phosphate-buffered saline.
Ice
Dry ice
Ethanol (70%)
Isoflurane (Abbott Laboratories, Forene®, catalog number: 506949 )
Ketamine (Ketaminol®, catalog number: 511519 )
Xylazine (Rompun®, catalog number: 0 22545 )
0.9% NaCl
Phosphate-buffered saline (PBS) (Sigma-Aldrich, catalog number: D8662 )
Gentamicin
Tissue-Tek® O.C.T. compound (SAKURA FINETEK, catalog number: 4583 )
Tissue-Tek® Cryomold (SAKURA FINETEK, catalog number: 4565 )
Isopentane (Sigma-Aldrich, catalog number: PHR1661 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Normal goat serum (Agilent Technologies, catalog number: X0907 )
Rat monoclonal antibody NIMP-R14 (1: 200) (Abcam, catalog number: ab2557 )
Antiserum to a synthetic peptide within the PapG adhesin (1:200), produced in the laboratory
Goat anti-rat immunoglobulins (1:200), conjugated with Alexa 488 dye (A488; 495ext/519em nm) (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11006 )
Goat anti-rabbit immunoglobulins (1:200), conjugated with Alexa 568 dye (A568; 578ext/603em nm) (Thermo Fisher Scientific, InvitrogenTM, catalog number: A-11011 )
Anti-NLRP3 antibody (Santa Cruz Biotechnology, catalog number: sc-66846 )
Anti-IL-1β antibody (Abcam, catalog number: ab9722 )
Anti-ASC antibody (Abcam, catalog number: ab155970 )
DAPI (Sigma-Aldrich, catalog number: D9542 )
VECTASHIELD mounting medium (Vector Laboratories, catalog number: H-1000 )
MIP-2 quantification kit (R&D Systems, catalog number: MM200 )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: P6148 )
Tryptic soy agar (TSA) (BD, DifcoTM, catalog number: 236950 )
LB agar (BD, catalog number: 244520 )
Columbia 5% blood agar (BD, catalog number: 221263 )
Sucrose (Sigma-Aldrich, catalog number: 84100 )
Ketamine/Xylazine solution (see Recipes)
Media for cultivation of bacteria (see Recipes)
Tryptic soy agar plates, LB, Columbia 5% blood agar
Sucrose solution (see Recipes)
4% paraformaldehyde (see Recipes)
Equipment
Burker chamber
ELISA washer
Drop glass jar for gas anesthesia
Biosafety hood in biosafety level 2 facility
Curved forceps, scissors
Soft polyethylene catheter (0.61 mm outer diameter; Clay Adams) (BD, catalog number: 427401 )
Stomacher 80 homogenizer (Seward medical, catalog number: 0080/000/EU )
Cryostat sections were made with a Microtome blade C-35 (FEATHER Safety Razor, model: C-35)
Fluorescence microscopy (Olympus, model: AX60 , equipped with filter sets [excitation/emission] 495ext/519em nm and 578ext/603em nm)
AxioCam ERc 5s camera (Zeiss, model: AxioCam ERc 5s)
Labsystems Multiskan PLUS reader (Analytical Instruments, Golden Valley, USA)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Waldhuber, A., Puthia, M., Wieser, A., Svanborg, C. and Miethke, T. (2017). Analysis of the Virulence of Uropathogenic Escherichia coli Strain CFT073 in the Murine Urinary Tract. Bio-protocol 7(3): e2129. DOI: 10.21769/BioProtoc.2129.
Download Citation in RIS Format
Category
Microbiology > in vivo model > Bacterium
Immunology > Host defense > Murine
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
213 | https://bio-protocol.org/exchange/protocoldetail?id=213&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Yeast DNA Replication 2D Gel Protocol
YZ Yanfei Zou
Published: Vol 2, Iss 13, Jul 5, 2012
DOI: 10.21769/BioProtoc.213 Views: 14604
Original Research Article:
The authors used this protocol in Sep 2008
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2008
Abstract
Two-dimensional agarose gel electrophoresis (2D gel) analysis is used extensively as a method to detect origins of replication. Here, I present a simplified method for the isolation of yeast genomic DNA for 2D gel analysis from a small number of yeast cells. This DNA isolation method is simpler and less time consuming than the traditional method that involves CsCl density gradient centrifugation. This method could be modified for 2D gel analysis in other organisms as well.
Materials and Reagents
Qiagen genomic-tip 20/G ( QIAGEN, catalog number: 10223 , if more DNA needed, 100/G could be used to isolate DNA)
Qiagen Buffer G2 ( QIAGEN, catalog number: 1014636 )
Qiagen buffer QBT (QIAGEN, catalog number: 19054 )
Qiagen buffer QC (QIAGEN, catalog number: 19055 )
Qiagen buffer QF ( QIAGEN, catalog number: 19056 )
Tips: Buffer QBT, QC and QF could be made by yourself.
RNase A (10 mg/ml) ( QIAGEN, catalog number: 19103 )
Proteinase K (20 mg/ml) (QIAGEN, catalog number: 19131 )
Tips: RNase A and Proteinase K could be ordered from any other company, they work fine too.
Sodium azide
Isopropanol
Tris-HCl
EDTA
Agarose
KoAc
Ethidium bromide
Glycerol
MgCl2
Spermine
Spermidine
KOH
GuHCl
MOPS free acid
Tween-20
Triton X-100
NaCl
KB ladder
70% ethanol
TE (see Recipes)
Nuclear isolation buffer (NIB buffer) (see Recipes)
Sodium azide solution (see Recipes)
Qiagen Buffer QBT (see Recipes)
Qiagen Buffer QC (see Recipes)
Qiagen Buffer QF (see Recipes)
Equipment
Acid-washed glass beads (425-600 μm diameter) (Sigma-Aldrich, catalog number: G8772-500G )
BioRad sub-cell GT gel box or other Maxi horizontal electrophoresis units (big agarose gels are needed for both dimentions)
4 °C cold room
Micro centrifuges
Vortex mixer (VORTEX-GENIE)
Microwave oven
Hand-held UV lamp
UV light box
2D gel apparatus tray (4 samples per apparatus -- Fischer self-circulating gel box)
50 ml polypropylene centrifuge tubes
2-ml polypropylene tube
Pasteur pipette
12 x 75 mm polypropylene culture tube
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zou, Y. (2012). Yeast DNA Replication 2D Gel Protocol. Bio-protocol 2(13): e213. DOI: 10.21769/BioProtoc.213.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > DNA extraction
Molecular Biology > DNA > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
2,130 | https://bio-protocol.org/exchange/protocoldetail?id=2130&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Enriching Acidophilic Fe(II)-oxidizing Bacteria in No-flow, Fed-batch Systems
Yizhi Sheng
BK Bradley Kaley
WB William D. Burgos
Published: Vol 7, Iss 3, Feb 5, 2017
DOI: 10.21769/BioProtoc.2130 Views: 8501
Reviewed by: Darrell Cockburn
Original Research Article:
The authors used this protocol in Jun 2016
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2016
Abstract
Low-pH microbial Fe(II) oxidation occurs naturally in some Fe(II)-rich acid mine drainage (AMD) ecosystems across so-called terraced iron formations. Indigenous acidophilic Fe(II)-oxidizing bacterial communities can be incorporated into both passive and active treatments to remove Fe from the AMD solution. Here, we present a protocol of enriching acidophilic Fe(II)-oxidizing bacteria in no-flow, fed-batch systems. Mixed cultures of naturally occurring microbes are enriched from the fresh surface sediments at AMD sites using a chemo-static bioreactor (Eppendorf BioFlo®/Celligen® 115 Fermentor) with respect to constant stirring speed, temperature, pH and unlimited dissolved oxygen. Ferrous sulfate is discontinuously added to the reactor as the primary substrate to enrich for acidophilic Fe(II)-oxidizing bacteria. Successfully and efficiently enriching acidophilic Fe(II)-oxidizing bacteria helps to exploit this biogeochemical process into AMD treatment systems.
Keywords: Acid mine drainage Enrichment Bioreactor Fe(II)-oxidizing bacteria Bioremediation
Background
Low-pH microbial Fe(II) oxidation can be incorporated into AMD passive treatment systems by enhancing the development of terraced iron formations (DeSa et al., 2010; Brown et al., 2011; Larson et al., 2014a and 2014b). For extremely difficult-to-treat AMD (very low pH, very high concentrations of Fe(II) and associated metals), an active treatment bioreactor is required by enriching acidophilic Fe(II)-oxidizing bacterial communities. This process can effectively change a high acidity, high metals discharge into a moderate acidity (still low pH), low metals discharge (Sheng et al., 2016).
Acidophilic aerobic Fe(II) oxidizers Acidithiobacillus spp., Leptospirillum spp., and Ferrovum myxofaciens have all been enriched in both suspended growth and fixed-film laboratory-scale bioreactors for AMD treatment (Hedrich and Johnson, 2012; Heinzel et al., 2009a and 2009b; Janneck et al., 2010; Tischler et al., 2013). For instance, Hedrich and Johnson (2012) designed an AMD remediation system that integrated low-pH Fe(II) oxidation and Fe removal in a multi-reactor system. A pure culture of the Fe(II)-oxidizer Ferrovum myxofaciens was enriched in first suspended-growth reactor. Heinzel et al. (2009a and 2009b), Janneck et al. (2010) and Tischler et al. (2013) all developed a natural mixed community of Fe(II)-oxidizers with porous fixed-film media in a pilot-scale reactor. A protocol of enriching mixed culture acidophilic Fe(II)-oxidizing bacteria in no-flow, fed-batch systems without fixed-film media is suggested here in a chemostatic bioreactor with controlled hydrogeochemical conditions (Sheng et al., 2016).
Materials and Reagents
Sterile plastic containers
0.45 μm sterile bottle-top filters (Corning, catalog number: 430514 )
Al foil
50 ml sterile centrifuge tubes (VWR, catalog number: 89039-656 )
15 ml sterile centrifuge tubes (VWR, catalog number: 89039-664 )
100% N2
0.1% (m/v) sodium pyrophosphate (EMD Millipore, catalog number: SX0741 )
0.1 M sulfuric acid (H2SO4)
0.2 N sodium hydroxide (NaOH)
FeSO4·7H2O (VWR, catalog number: 97061-538 )
1 g/L ferrozine (Thermo Fisher Scientific, Fisher Scientific, catalog number: AC410570050 )
50 mM HEPES (pH = 7.0) (Sigma-Aldrich, catalog number: H3375 )
Hydroxylamine-HCl (VWR, BDH®, catalog number: BDH9236-500G )
Bio-Rad Protein Assay Kit II (Bio-Rad Laboratories, catalog number: 5000002 )
10% (w/v) oxalic acid (VWR, BDH®, catalog number: BDH7336-1 )
Equipment
Heavy-duty round carboy (VWR, catalog number: 10755-104 )
Standard magnetic stirrer
Fermentor (Eppendorf, BrunswickTM, model: BioFlo®/Celligen® 115 )
pH meter
Plate centrifuge
Autoclave
Freezer
Spectrophotometer
Software
Eppendorf BioFlo®/Celligen® 115 fermentor automatic control software
Adobe® Photoshop® software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2017 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sheng, Y., Kaley, B. and Burgos, W. D. (2017). Enriching Acidophilic Fe(II)-oxidizing Bacteria in No-flow, Fed-batch Systems. Bio-protocol 7(3): e2130. DOI: 10.21769/BioProtoc.2130.
Download Citation in RIS Format
Category
Microbiology > Microbial physiology > Adaptation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.